Recombinant adeno-associated virus genomes and monopolar rAAV vectors packaged therefrom

Abstract

The present specification relates to a recombinant adeno-associated virus (rAAV) genome and a monopolar rAAV (spAAV) vector packaged therefrom. Specifically, the present invention provides a pre-packaged spAAV genome, both ends of which are linear and open-ended, except that one end does not have an inverted terminal repeat (ITR) or a part thereof, and the other end has an ITR cleavage portion (ITRt), and the ITRt does not form a T-shaped hairpin palindrome structure. The spAAV genome is a monopolar single-stranded DNA. In addition, the present invention provides a spAAV vector, a method for using the vector to deliver foreign nucleic acid to cells, and the use of the vector in preparing products for gene expression, gene therapy, gene editing, or gene regulation.

Description

Detailed Description of the Invention

[0001] Technical Field The present invention relates generally to the fields of gene vectors and gene therapy, and more specifically to recombinant adeno-associated virus (rAAV) genomes and single polarity AAV (spAAV) vectors packaged therefrom.

[0002] Background technology Gene therapy is targeted to patients with genetic mutations caused by gene mutations or abnormal gene expression. It involves the treatment or prevention of genetic diseases caused by gene deficiency, dysregulation or abnormal expression (e.g., diseases caused by under- or overexpression of genes, malignant tumors, etc.), which can be treated, prevented or mitigated by providing the patient with corrective genetic material. Currently, gene delivery vectors mainly include viral gene vectors and non-viral gene vectors. Among the many virus-derived gene vectors available, such as recombinant retroviruses, recombinant lentiviruses and recombinant adenoviruses, recombinant adeno-associated virus (rAAV) gene vectors are gaining in popularity.

[0003] Adeno-associated virus (AAV) belongs to the Parvoviridae family. It has the advantages of non-pathogenicity, low immunogenicity, and broad infectivity, making it the most promising gene vector for gene therapy. AAV is a non-enveloped single-stranded DNA virus with a linear single-stranded DNA genome of about 4.7 kb. Both ends of the AAV DNA genome contain inverted terminal repeats (ITRs) of 145 bp, except for the 125 bases near the ends, which are longer palindromic structures that fold back by complementary base pairing, making the ITRs appear as T-shaped hairpin structures. Both positive-strand and negative-strand DNA genomes with wild-type inverted terminal repeats are packaged into AAV viral capsids with equal probability, thereby producing equal amounts of positive-strand or negative-strand DNA AAV viral particles. AAV virus particles infect cells, enter the nucleus of the cells, and release the AAV genome into the nucleus by peeling off the capsid. The ITRs at both ends of the AAV genome can fold back to form a T-shaped hairpin structure, and the 3' end of the ITR can act as a primer for DNA synthesis to synthesize a second strand and form a double-stranded DNA molecule, which initiates the expression of the gene contained in the AAV genome. The plus-strand and minus-strand DNA molecules of the AAV genome can also form a double-stranded DNA molecule in a complementary manner to express genes.

[0004] Currently, it is generally believed in the art that the ITRs at both ends of the AAV DNA genome contain basic information for AAV DNA replication, packaging, integration, and rescue. All rAAV packaging systems used in the art use AAV ITRs as basic packaging elements, which are placed at both ends of the foreign gene DNA to be packaged in rAAV capsid, and the foreign gene DNA is packaged into the rAAV vector. Such rAAV vectors have defects in the application of gene delivery, gene manipulation, and gene editing, for example, it is impossible to deliver single-stranded DNA of a single polarity for single-stranded DNA gene editing; it is difficult to design an rAAV vector that generates short-term gene expression for short-term gene expression, for example, when delivering a nuclease gene for gene editing, long-term gene expression may cause off-target risks and cytotoxicity; it is difficult to achieve pairing of single-stranded genes to express large genes; long oligodeoxynucleotides cannot be delivered for small molecule nucleic acid gene therapy, gene control, etc.

[0005] Contents of the invention The technical solution provided herein provides an rAAV vector capable of packaging a single-stranded DNA genome of a single polarity, also referred to as a single-polarity rAAV or spAAV. Through long-term research, the inventors have developed a pre-packaged spAAV genome, which has a linear open end, contains only a portion of the AAV ITR structural sequence elements at its 5' end, and does not contain the AAV ITR structural sequence at its 3' end. The spAAV vector packaged and formed according to the present specification contains only DNA molecules of a single polarity, i.e., either spAAV vectors of positive-stranded DNA molecules or spAAV vectors of negative-stranded DNA molecules, but does not contain a mixture of the two. The spAAV vector can advantageously deliver single-stranded DNA of the same polarity (i.e., single polarity) with a linear open end. That is, the spAAV vector packaged and formed according to the present specification delivers either positive-stranded DNA or negative-stranded DNA, but not both at the same time. spAAV vectors packaged and formed according to the present specification can provide viral particle titers and cell transfection performance comparable to conventional rAAV.

[0006] The spAAV vector packaged with the pre-packaged spAAV genome described herein greatly expands the application scope of AAV vectors in terms of gene site-specific integration, large-scale gene expression, highly efficient gene expression, short-term gene expression, nuclease-free gene editing, long oligodeoxynucleotide delivery, etc., effectively promoting the development and application of AAV gene therapy.

[0007] On the other hand, the present specification provides an spAAV genome before packaging, and both ends of the spAAV genome before packaging are linear open-ended, with the exception that one end does not have an ITR or a part thereof, and the other end has an ITRt, which does not form a T-shaped hairpin palindrome structure.

[0008] Alternatively, the present specification provides an spAAV vector, which comprises a capsid protein and a spAAV genome packaged by the capsid protein, wherein the spAAV genome packaged by the capsid protein is derived from a pre-packaged spAAV genome described herein.

[0009] Alternatively, the present specification provides spAAV recombinant plasmids that can be used to produce the prepackaged spAAV genomes described herein.

[0010] On the other hand, the present specification provides a method for packaging an spAAV vector, which includes: transforming the spAAV gene recombinant plasmid and Cap and Rep expression plasmids described herein into E. coli competent cells, respectively; selecting and amplifying white colonies by at least one blue-white spot screening, and extracting recombinant bacmids; using the recombinant bacmids to transfect insect cells to generate recombinant baculoviruses; and extracting the recombinant baculoviruses and infecting insect cells with the recombinant baculoviruses to obtain spAAV vectors.

[0011] Alternatively, the present specification provides a method for delivering exogenous nucleic acid to a cell, comprising contacting the cell with one or more spAAV vectors described herein.

[0012] However, the genome of one or more of the spAAV vectors includes the gene expression box and / or any other DNA sequence of the foreign nucleic acid.

[0013] Alternatively, the present specification provides an isolated host cell, which contains a spAAV vector described herein.

[0014] In another aspect, the present specification provides the use of the spAAV vectors described herein in the preparation of products for gene expression.

[0015] In another aspect, the present specification provides the use of the spAAV vectors described herein in the preparation of gene therapy products.

[0016] On the other hand, the present specification provides the use of the spAAV vectors described herein in the preparation of gene editing products.

[0017] In another aspect, the present specification provides the use of the spAAV vectors described herein in the preparation of gene regulatory products.

[0018] BRIEF DESCRIPTION OF THE DRAWINGS The present invention is further described below with reference to the accompanying drawings, the representations of which are only intended to illustrate embodiments of the present invention and are not intended to limit the scope of the present invention. [Brief description of the drawings]

[0019] [Figure 1] FIG. 1 shows an exemplary schematic diagram of the DNA sequence structure of the AAV2 Flip ITR (including RBE, trs). [Diagram 2] FIG. 2 shows a schematic diagram of spAAV vector construction packaging according to an exemplary embodiment of the present specification. [Diagram 3] FIG. 3 shows a schematic diagram of co-transfection of cells with positive-strand and negative-strand DNA spAAV vectors, pairing of the positive-strand and negative-strand DNA of spAAV vectors, and gene expression according to an exemplary embodiment of the present specification. [Figure 4] FIG. 4 shows a schematic diagram of gene expression of spAAV vector single-stranded DNA integrated into a cell genome, according to an exemplary embodiment of the present specification. [Diagram 5] Figure 5 shows the SDS-PAGE electrophoresis patterns of spAAV vector capsid proteins. Lane MW: protein molecular weight standard; lane 1: rAAV-EGFP vector; lane 2: spAAV-EGFP(+) vector; lane 3: spAAV-EGFP(-) vector. [Figure 6]Figure 6 shows the neutral agarose gel electrophoresis patterns of the plus and minus strands of spAAV vector DNA. Lane MW: DNA molecular weight standard; lane 1: rAAV-EGFP vector DNA; lane 2: spAAV-EGFP(+) vector DNA; lane 3: spAAV- EGFP(-) vector DNA; lane 4: 2.4 kb DNA PCR fragment. [Figure 7] Figure 7 shows the alkaline denaturing agarose gel electrophoresis patterns of the plus and minus strands of spAAV vector DNA. Lane MW: DNA molecular weight standard; lane 1: rAAV-EGFP vector DNA; lane 2: spAAV-EGFP(+) vector DNA; lane 3: spAAV-EGFP(-) vector DNA; lane 4: 2.4 kb DNA PCR fragment. [Figure 8] Figure 8 shows the neutral agarose gel electrophoresis patterns of the plus and minus strands of spAAV vector DNA and after pairing. Lane MW: DNA molecular weight standard; lane 1: rAAV-EGFP vector DNA; lane 2: spAAV-EGFP(+) vector DNA; lane 3: spAAV-EGFP vector DNA(-); lane 4: spAAV-EGFP(+) vector DNA + spAAV-EGFP(-) vector DNA annealed pairing complementation product; lane 5: 2.4 kb DNA PCR fragment. [Figure 9] 9 shows the neutral agarose gel electrophoresis patterns of the plus and minus strands of spAAV vector DNA and after digestion with S1 nuclease after pairing. Lane MW: DNA molecular weight standard; Lane 1: rAAV-Gli1 vector DNA; Lane 2: spAAV-EGFP(+) vector DNA; Lane 3: spAAV-EGFP(-) vector DNA; Lane 4: spAAV-EGFP(+) vector DNA + spAAV-EGFP(-) vector DNA; Lane 5: 2.4 kb DNA PCR fragment; Lane 6: denatured rAAV-Gli1 vector DNA; Lane 7: denatured spAAV-EGFP(+) vector DNA + spAAV-EGFP(-) vector DNA; Lane 8: denatured 2.4 kb DNA PCR fragment. [Figure 10] Figure 10 shows fluorescence images of gene expression in HEK293 cells infected with spAAV vector DNA plus-strand and minus-strand vectors, respectively and mixed together. A. HEK293 was infected with vector virus for 24 hours and EGFP was expressed; B. HEK293 was infected with vector virus for 3 days and EGFP was expressed; C. HEK293 was infected with vector virus for 7 days and EGFP was expressed; D. HEK293 was infected with vector virus for 14 days and EGFP was expressed. 1. rAAV-EGFP; 2. spAAV-EGFP(+); 3. spAAV-EGFP(-); 4. spAAV-EGFP(+) and spAAV-EGFP(-) co-infection.

[0020] Specific embodiments The meanings of scientific and technical terms used in this application are consistent with the common understanding of those skilled in the art, unless otherwise specified. In this application, unless otherwise specified, "a" or its combination with various quantifiers includes both singular and plural meanings. In this application, when multiple values, numerical ranges, or combinations thereof are described in the description of the same parameter or variable, it is equivalent to specifically clarifying the numerical ranges formed by those values, the end values ​​of the ranges, and any combinations thereof. In this application, numerical values, regardless of the presence or absence of a modifier such as "about", include an approximate range that can be understood by a person skilled in the art, for example, plus or minus 10%, 5%, etc. In this specification, each "embodiment" refers to and covers each method and system embodiment of this application in the same way. In this application, one or more technical features in any embodiment can be freely combined with one or more technical features in one or more other embodiments, and the resulting embodiments also belong to the disclosure of this application.

[0021] Adeno-associated viruses are members of the Parvoviridae family. They are non-enveloped and have an icosahedral symmetric structure. Currently, more than 10 serotypes of AAV and hundreds of variants have been discovered, among which AAV2 is currently the most thoroughly studied and widely used serotype.

[0022] The AAV genome contains a linear single-stranded DNA of about 4.7 kb in length, with an ITR of about 145 bases at both ends. Approximately 125 bases near the ends of the ITR contain a palindromic sequence that folds back on itself by complementary base pairing to form a T-shaped hairpin structure. The ITR contains a Rep protein binding element (RBE) and a terminal resolution site (trs), which can be recognized and bound by the Rep protein to generate a nick in the trs.

[0023] The AAV genome contains two open reading frames (ORFs) between the ITRs at both ends. These two ORFs code for rep and cap, respectively. The rep gene codes for four Rep proteins, Rep78, Rep68, Rep52 and Rep40, which play roles in AAV viral replication, integration, rescue and packaging. The cap gene codes for the AAV viral capsid proteins VP1, VP2 and VP3. However, VP1 is essential for the formation of infectious AAV, and VP3 is the major protein that constitutes the AAV viral particle, with the ratio of VP1, VP2 and VP3 in the AAV viral capsid being approximately 1:1:10.

[0024] Figure 1 shows a schematic diagram of the DNA sequence structure of AAV2 Flip ITR, where the ITR forms a T-shaped palindrome hairpin structure. As shown in Figure 1, the sequence of the first 125 bases of the ITR can be divided into different segments, such as A', C', C, B', B, and A, in order, among which B and B', C and C' form a T-shaped palindrome hairpin structure in reverse complementarity, and A and A' form the handle of the hairpin. The A' segment is followed by the D segment. The positions of the RBE and trs are shown in Figure 1.

[0025] Although the ITR sequences differ among the AAV genomes of various serotypes, all of them form a T-shaped palindromic hairpin structure and have an RBE and trs.

[0026] When AAV is assembled and virus particles are formed, the plus-strand and minus-strand DNA genomes with wild-type ITRs are packaged into the AAV virus capsid with equal probability, thereby generating the same number of plus-strand or minus-strand AAV virus particles. The AAV virus particles infect cells, the cells detach the capsid and release the AAV genome, and the ITRs at both ends of the AAV genome fold back to form a T-shaped palindrome hairpin structure, after which the 3' end serves as a primer to synthesize a second strand and form a double-stranded molecule, thereby initiating the expression of genes contained in the AAV genome. The plus-strand and minus-strand DNA molecules of the AAV genome can also form complementary double-stranded DNA to express genes.

[0027] On the other hand, the present specification provides a pre-packaged spAAV genome, both ends of which are linear open ends, with the exception that one end does not have an ITR or a part thereof, and the other end has an ITRt, which does not form a T-shaped hairpin palindrome structure.

[0028] As used herein, the term "unipolar" or "sp" refers to a single DNA polarity, i.e., the spAAV vectors produced by packaging of the prepackaged spAAV genomes described herein are either spAAV vectors having positive strand DNA or spAAV vectors having negative strand DNA, and not both positive strand DNA and negative strand DNA are produced simultaneously. The spAAV vectors produced by packaging of the prepackaged spAAV genomes described herein are referred to as "unipolar rAAV vectors" or "spAAV vectors."

[0029] As used herein, the term "recombinant adeno-associated viral vector" or "rAAV" refers to a non-wild-type adeno-associated viral particle that serves as a gene delivery vector and contains a recombinant AAV genome packaged within the viral capsid.

[0030] As used herein, the term "pre-packaged spAAV genome" refers to a recombinant AAV genome to be packaged for subsequent packaging into capsid proteins.

[0031] As used herein, the term "open end" or "linear open end" refers to the 3' or 5' end of a nucleotide sequence that has no structure other than linear (eg, a hairpin structure).

[0032] As used herein, the term "ITR or a portion thereof" refers to all or a portion of the DNA segment of an ITR, including "ITR constituent elements." For example, in the case of a Flip ITR (e.g., as shown in FIG. 1), the ITR constituent elements include, but are not limited to, a D segment, a trs site, an RBE site, an A' segment (part), a C' segment, a C segment, a B' segment, a B segment, an A segment, etc.

[0033] It should be understood that the ITR sequences present at the ends of the AAV genome often have the same or different segment orientations, e.g., Flip / Flop, Flop / Flip, Flip / Flip or Flop / Flop. An exemplary structural orientation of a "Flip" ITR is shown in Figure 1. An exemplary structural orientation of a "Flop" ITR is shown in Figure 1, with the difference being that the positions of the B' and C' segments are reversed, and the positions of the B and C segments are reversed.

[0034] As used herein, the term "ITR cleavage portion" or "ITRt" refers to a partial DNA segment of an ITR (e.g., a partial ITR constituent element) that is derived from the ITR but does not form a hairpin palindrome structure, as distinguished from an ITR that can form a T-shaped hairpin palindrome structure, and forms a linear open end, allowing packaging of the rAAV genome.

[0035] As used herein, the term "hairpin structure" refers to a "hairpin" shape formed by folding back a DNA molecule such that some bases in the folded region are adjacent to each other and complementarily pair, for example, a T-shaped hairpin structure as shown in FIG. 1.

[0036] Unlike conventional prepackaged rAAV genomes, the prepackaged spAAV genomes provided herein do not contain ITRs at both ends of the linear single-stranded DNA that can form hairpin structures (such as T-shaped hairpin structures), but have ITRts at the 5' end that form linear open ends but do not form hairpin structures. The inventors have surprisingly found that the spAAV vectors produced by packaging the prepackaged spAAV genomes described herein are either spAAV vectors with positive strand DNA or spAAV vectors with negative strand DNA, and both positive strand DNA and negative strand DNA are not produced simultaneously. It should be noted that the titer and cell transfection performance of the spAAV viral particles produced by packaging are comparable to those of conventional rAAV viral particles. The spAAV viral particles formed according to the packaging described herein can be used to advantageously deliver single-stranded DNA of the same polarity with linear open ends. Because spAAV DNA is a single-stranded DNA of the same polarity and does not have a 3'ITR structure that can be used as a DNA replication primer, inside the cell, spAAV DNA can only exist in the form of single-stranded DNA, and therefore can be used for gene integration, gene editing, promoting efficient DNA pairing to express large genes, and delivering long oligodeoxynucleotides for small nucleic acid gene therapy.

[0037] In some embodiments, the spAAV genome is single-stranded DNA.

[0038] In some embodiments, the 3' end of the spAAV genome before packaging does not have an ITR or a portion thereof. In some embodiments, the 5' end of the spAAV genome before packaging has the ITRt. In some embodiments, the 3' end of the spAAV genome before packaging does not have an ITR or a portion thereof, and the 5' end has the ITRt.

[0039] Because the resulting spAAV vector lacks an ITR palindrome sequence at the 3' end, it cannot form a double-stranded DNA molecule by synthesizing a second strand using the 3' end as a primer after entering a host cell.

[0040] In some embodiments, the ITRt comprises a trs and an RBE. In some embodiments, the ITRt comprises D, A', and C' segments derived from a Flip ITR, e.g., a corresponding structure is shown in Figure 1. In some embodiments, the ITRt comprises D, A', and B' segments derived from a Flop ITR, etc.

[0041] In some exemplary embodiments, the pre-packaged spAAV genome comprises, in 5' to 3' order, an ITRt, a foreign gene expression box, and / or any other foreign DNA sequence, where the ITRt comprises an RBE and trs. In some exemplary embodiments, the pre-packaged spAAV genome comprises, in 5' to 3' order, an ITRt, a foreign gene expression box, and / or any other foreign DNA sequence, where the ITRt comprises a D, A', and C' segment derived from a Flip ITR. In some exemplary embodiments, the pre-packaged spAAV genome comprises, in 5' to 3' order, an ITRt, a foreign gene expression box, and / or any other foreign DNA sequence, where the ITRt comprises a D, A', and B' segment derived from a Flop ITR.

[0042] In some exemplary embodiments, the ITRs described herein have the following nucleotide sequence (Flip ITR): Flip ITR(SEQ ID NO:1): aggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtggccaa

[0043] In some exemplary embodiments, the ITRs described herein have the following nucleotide sequence (Flop ITR): Flop ITR(SEQ ID NO:2): aggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagagagggagtggccaa

[0044] In some exemplary embodiments, the nucleotide sequences of the ITRs described herein have greater than 80%, greater than 85%, greater than 90%, greater than 95%, greater than 98%, greater than 99%, or 100% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2. In some exemplary embodiments, the nucleotide sequences of the ITRs described herein are the nucleotide sequences set forth in SEQ ID NO: 1 or SEQ ID NO: 2.

[0045] In some exemplary embodiments, the nucleotide sequence of the RBE described herein has the nucleotide sequence shown in SEQ ID NO:3: RBE(SEQ ID NO:3): gcgc gctc gctc gctc

[0046] In some exemplary embodiments, the nucleotide sequence of the RBE described herein has greater than 80%, greater than 85%, greater than 90%, greater than 95%, greater than 98%, greater than 99%, or 100% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 3. In some exemplary embodiments, the nucleotide sequence of the RBE described herein is the nucleotide sequence set forth in SEQ ID NO: 3.

[0047] In some exemplary embodiments, the nucleotide sequence of the trs described herein has the nucleotide sequence shown in SEQ ID NO: 4: trs(SEQ ID NO:4): agttgg

[0048] In some exemplary embodiments, the nucleotide sequence of the trs described herein has greater than 80%, greater than 85%, greater than 90%, greater than 95%, greater than 98%, greater than 99%, or 100% sequence identity to the nucleotide sequence shown in SEQ ID NO: 4. In some exemplary embodiments, the nucleotide sequence of the trs described herein is the nucleotide sequence shown in SEQ ID NO: 4.

[0049] In some exemplary embodiments, the ITRt described herein has the nucleotide sequence shown in SEQ ID NO: 5: ITRt(SEQ ID NO:5): aggaaccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaa

[0050] In some exemplary embodiments, the nucleotide sequence of the ITRt described herein has greater than 80%, greater than 85%, greater than 90%, greater than 95%, greater than 98%, greater than 99%, or 100% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 5. In some exemplary embodiments, the nucleotide sequence of the ITRt described herein is the nucleotide sequence set forth in SEQ ID NO: 5.

[0051] Those skilled in the art can understand that the above ITR, RBE, and trs sequences are described based on AAV2 for illustrative purposes only and not for limiting purposes. Those skilled in the art can determine the ITR and RBE, trs sequences of each type of rAAV (e.g., each serotype) and make appropriate adjustments to practice the present invention without departing from the teachings of the present specification.

[0052] In some embodiments, the pre-packaged spAAV genome does not have nucleotide sequences encoding the rep and / or cap genes.

[0053] In some embodiments, the pre-packaged spAAV genome comprises a foreign nucleic acid (e.g., a foreign gene expression box) between one end having an ITRt and the other end. The foreign nucleic acid may comprise a nucleotide sequence encoding a foreign gene. In some embodiments, the pre-packaged spAAV genome comprises an optional DNA sequence between one end having an ITRt and the other end. The optional DNA sequence may be a nucleotide sequence that does not encode a foreign gene (e.g., a stuffer sequence).

[0054] As used herein, the terms "foreign gene," "foreign nucleic acid," or "target gene" refer to genes and DNA that originate from a source other than the organism of interest or study (e.g., an individual organism). The foreign gene, foreign nucleic acid, or target gene may be any foreign gene or foreign DNA that is expected to produce expression or a biological function in a recipient cell to which the spAAV viral particle is delivered.

[0055] In some embodiments, the spAAV genome comprises a positive-sense single-stranded DNA sequence of a foreign nucleic acid (e.g., a foreign gene expression box). In some embodiments, the spAAV genome comprises a negative-sense single-stranded DNA sequence of a foreign nucleic acid (e.g., a foreign gene expression box).

[0056] In some embodiments, the nucleotide sequence encoding the exogenous gene comprises a forward exogenous gene expression box. In some exemplary embodiments, the forward exogenous gene expression box comprises, in a 5'-3' direction, a promoter, an exogenous gene open reading frame, and a polyA sequence. In some exemplary embodiments, the forward exogenous gene expression box may further comprise an enhancer and an intron. In some exemplary embodiments, the enhancer and intron are located between the promoter and the exogenous gene open reading frame. In some exemplary embodiments, the forward exogenous gene expression box may comprise, in a 5'-3' direction, a DNA sequence for gene editing or gene regulation.

[0057] In some embodiments, the nucleotide sequence encoding the exogenous gene comprises a reverse exogenous gene expression box. In some exemplary embodiments, the reverse exogenous gene expression box may comprise, in a 5'-3' direction, a reverse complement of a polyA sequence, a reverse complement of an exogenous gene open reading frame, and a reverse complement of a promoter. In some exemplary embodiments, the reverse exogenous gene expression box may further comprise an enhancer and an intron. In some exemplary embodiments, the enhancer and intron are located between the reverse complement of the promoter and the reverse complement of an exogenous gene open reading frame. In some exemplary embodiments, the reverse exogenous gene expression box may comprise, in a 5'-3' direction, a reverse complement of a DNA sequence for gene editing or gene regulation.

[0058] In some embodiments, the promoter may include, for example, a CMV promoter, a CAG promoter, or a cell-specific promoter, such as a GFAP promoter, a hAAT promoter, and the like.

[0059] In some embodiments, the pre-packaged spAAV genome may be produced by construction of a plasmid (e.g., an spAAV recombinant plasmid). The spAAV recombinant plasmid described herein may be selected from any plasmid suitable for generating the pre-packaged spAAV genome described herein. Suitable spAAV recombinant plasmids can be based on, for example, but are not limited to, pFastBacdual, pFastBac1 plasmids, and the like.

[0060] The pre-packaged spAAV genome can then be packaged into capsid proteins to form an spAAV vector via an spAAV vector packaging system, which in some embodiments can include, for example, an insect cell baculovirus packaging system, a mammalian cell packaging system, and the like.

[0061] On the other hand, the present specification provides an spAAV vector, which comprises: Capsid protein, and spAAV genome packaged by capsid protein Contains; However, the spAAV genome packaged by the capsid proteins is derived from the pre-packaged spAAV genome described herein.

[0062] As used herein, an "spAAV vector" is also referred to as an "spAAV viral particle," which comprises a pre-packaged spAAV genome packaged into AAV capsid proteins, e.g., via an spAAV vector packaging system.

[0063] In some embodiments, exemplary spAAV vector packaging systems may include, for example, insect cell baculovirus packaging systems, mammalian cell packaging systems, and the like.

[0064] In some embodiments, the spAAV genome packaged by the capsid protein is a unipolar, single-stranded DNA.

[0065] In some embodiments, both ends of the spAAV genome packaged by the capsid proteins (also referred to herein as the "packaged spAAV genome") are linear and open-ended, except that at one end, the ITRs or portions thereof are absent, and at the other end, sequences derived from the ITRs are present.

[0066] As used herein, the term "ITRt-derived sequence" refers to a sequence obtained by cleavage at the trs site contained in the ITRt, which forms a linear open end and does not form a hairpin structure.

[0067] In some embodiments, the packaged spAAV genome has a sequence derived from an ITRt at the 5' end. In some embodiments, the packaged spAAV genome has no ITRs or portions thereof at the 3' end. In some embodiments, the packaged spAAV genome has a sequence derived from an ITRt at the 5' end and no ITRs or portions thereof at the 3' end.

[0068] In some embodiments, the ITRt-derived sequence comprises an RBE, In some embodiments, the ITRt-derived sequence comprises an RBE and a portion of the trs sequence (the portion of trs remaining after cleavage into Rep).

[0069] In some embodiments, the packaged spAAV genome does not have nucleotide sequences encoding the rep and / or cap genes.

[0070] In some embodiments, the packaged spAAV genome comprises a foreign nucleic acid (e.g., a foreign gene expression box) between one end having a sequence derived from an ITRt and the other end. The foreign nucleic acid may comprise a nucleotide sequence encoding a foreign gene. In some embodiments, the nucleotide sequence encoding a foreign gene is a monopolar, single-stranded DNA sequence. In some embodiments, the packaged spAAV genome comprises an optional DNA sequence between one end having a sequence derived from an ITRt and the other end. The optional DNA sequence may be a nucleotide sequence that does not encode a foreign gene (e.g., a stuffer sequence).

[0071] In some embodiments, the packaged spAAV genome comprises a positive-sense single-stranded DNA sequence of a foreign nucleic acid (e.g., a foreign gene expression box). In some embodiments, the packaged spAAV genome comprises a negative-sense single-stranded DNA sequence of a foreign nucleic acid (e.g., a foreign gene expression box).

[0072] In some embodiments, the nucleotide sequence encoding the exogenous gene comprises a forward exogenous gene expression box. In some exemplary embodiments, the forward exogenous gene expression box comprises, in a 5'-3' direction, a promoter, an exogenous gene open reading frame, and a polyA sequence. In some exemplary embodiments, the forward exogenous gene expression box may further comprise an enhancer and an intron. In some exemplary embodiments, the enhancer and intron are located between the promoter and the exogenous gene open reading frame. In some exemplary embodiments, the forward exogenous gene expression box may comprise, in a 5'-3' direction, a DNA sequence for gene editing or gene regulation.

[0073] In some embodiments, the nucleotide sequence encoding the exogenous gene comprises a reverse exogenous gene expression box. In some exemplary embodiments, the reverse exogenous gene expression box may comprise, in a 5'-3' direction, a reverse complement of a polyA sequence, a reverse complement of an exogenous gene open reading frame, and a reverse complement of a promoter. In some exemplary embodiments, the reverse exogenous gene expression box may further comprise an enhancer and an intron. In some exemplary embodiments, the enhancer and intron are located between the reverse complement of the promoter and the reverse complement of an exogenous gene open reading frame. In some exemplary embodiments, the reverse exogenous gene expression box may comprise, in a 5'-3' direction, a reverse complement of a DNA sequence for gene editing or gene regulation.

[0074] In some embodiments, the promoter may include, for example, a CMV promoter, a CAG promoter, or a cell-specific promoter, such as a GFAP promoter, a hAAT promoter, and the like.

[0075] In some embodiments, the capsid protein is an AAV capsid protein. In some embodiments, the capsid protein may be a capsid protein of an AAV selected from AAV1-AAV12 (AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12), etc.

[0076] In some embodiments, the capsid protein is an AAV capsid protein variant, such as a single amino acid / multiple amino acid variant of tyrosine, a tyrosine, serine, threonine variant, or a multi-serotype chimera such as AAV-DJ, or a polypeptide embedded variant.

[0077] In some embodiments, the capsid protein can be produced from a plasmid expressing the AAV capsid protein Cap by utilizing the spAAV vector packaging system.

[0078] In some embodiments, the spAAV vector can be produced by packaging an spAAV recombinant plasmid (producing the pre-packaged spAAV genome) and a plasmid expressing the AAV capsid protein Cap and the replication protein Rep (producing the Cap and Rep proteins) using an spAAV vector packaging system. In some embodiments, the AAV Cap-encoding gene and the AAV Rep-encoding gene can be located on the same plasmid or on two different plasmids. In some embodiments, the AAV Cap and / or AAV Rep expression plasmid can include Cap and / or Rep gene expression boxes and required expression elements, intron sequences that enhance expression, etc. The plasmid expressing AAV Cap and / or Rep is not particularly limited, and any AAV Cap and / or Rep expression plasmid can be generally used, see, for example, Urabe M, Ding C, Kotin RM. Insect cells as a factory to produce adeno-associated virus type 2 vectors. Hum Gene Ther. 2002 Nov 1;13(16):1935-43. doi: 10.1089 / 10430340260355347. PMID: 12427305.

[0079] Alternatively, the present specification provides spAAV recombinant plasmids that can be used to produce the prepackaged spAAV genomes described herein.

[0080] The spAAV recombinant plasmid described herein may be any plasmid suitable for generating a pre-packaged spAAV genome as described herein. Suitable spAAV recombinant plasmids can be based on, but are not limited to, pFastBacdual plasmid, pFastBac1 plasmid, etc.

[0081] In some exemplary embodiments, the spAAV recombinant plasmid can be designed to encode a positive-sense single-stranded DNA sequence of a foreign gene, which may include, in 5' to 3' order, an ITRt (including an RBE and trs), a promoter (e.g., CMV), a foreign gene open reading frame, and a polyA. In some exemplary embodiments, the spAAV recombinant plasmid can include a stuffer sequence. In some specific embodiments, the stuffer sequence can be, for example, upstream of the promoter and / or downstream of the polyA.

[0082] In some exemplary embodiments, the spAAV recombinant plasmid can be designed to encode a negative-sense single-stranded DNA sequence of a foreign gene, which may include, in 5' to 3' order, an ITRt (including an RBE and trs), a polyA', a foreign gene open reading frame', and a promoter' (e.g., CMV'). In some exemplary embodiments, the spAAV recombinant plasmid can include a stuffer sequence. In some specific embodiments, the stuffer sequence can be, for example, downstream of the promoter' and / or upstream of the polyA'.

[0083] As used herein, the term "stuffer sequence" refers to the auxiliary DNA that is added to fill the DNA length to reach the packaging length of AAV when the length of the target DNA is less than the packaging length of AAV, which is 4.7 kb. In some embodiments, the stuffer sequence may be of different lengths, as long as the final DNA is, for example, about 4.7 kb long.

[0084] The spAAV gene recombinant plasmid, together with the Rep and Cap gene expression plasmids, is packaged by the spAAV vector packaging system to produce the spAAV vector described herein.

[0085] On the other hand, the present specification provides a method for packaging an spAAV vector, which includes: transforming the spAAV gene recombinant plasmid and Cap and Rep expression plasmids described herein into E. coli competent cells, respectively; selecting and amplifying white colonies by at least one blue-white spot screening, and extracting recombinant bacmids; using the recombinant bacmids to transfect insect cells to generate recombinant baculoviruses; and extracting the recombinant baculoviruses and infecting insect cells with the recombinant baculoviruses to obtain spAAV vectors.

[0086] In some embodiments, the E. coli competent cells are E. coli DH10Bac competent cells. In some embodiments, the spAAV vector packaging system is an insect cell baculovirus packaging system.

[0087] In some embodiments, white colonies are selected and amplified to extract recombinant bacmids by at least one round of blue-white spot screening, in some embodiments, white colonies are selected and amplified to extract recombinant bacmids by two or more rounds of blue-white spot screening.

[0088] In some embodiments, the recombinant bacmid is transfected into insect cells (eg, Sf9 insect cells) to generate a recombinant baculovirus (eg, a P3 generation recombinant baculovirus).

[0089] In some embodiments, the recombinant baculoviruses (e.g., two or three recombinant baculoviruses of the P3 generation) are infected (e.g., co-infected) into insect cells (e.g., Sf9 insect cells) and packaged to produce spAAV vectors.

[0090] 2 provides a schematic diagram of spAAV vector construction packaging according to one exemplary embodiment of the present specification. In this method, when the spAAV vector is packaged, the Rep protein recognizes the Rep binding site (RBE) on the recombinant baculovirus DNA, binds to the site, recognizes the terminal melting site (trs), opens the phosphodiester bond between the bases tt, and covalently binds to the 5' end, introducing DNA, which is packaged into the AAV capsid, and the length of the DNA packaged into the capsid is about 4.7 kb.

[0091] For methods of packaging rAAV vectors using an insect cell baculovirus packaging system, see, e.g., Urabe M, Ding C, Kotin RM. Insect cells as a factory to produce adeno-associated virus type 2 vectors. Hum Gene Ther. 2002 Nov 1; 13(16):1935-43. doi: 10.1089 / 10430340260355347. PMID: 1242730.

[0092] Alternatively, the present specification provides a method for delivering an exogenous nucleic acid to a cell, comprising contacting the cell with one or more spAAV vectors described herein, wherein the genome of the one or more spAAV vectors comprises a gene expression box and / or any other DNA sequence of the exogenous nucleic acid.

[0093] In some embodiments, the cell may be a eukaryotic cell. In some embodiments, the cell may be an animal cell. In some embodiments, the cell may be a vertebrate cell. In some embodiments, the cell may be a mammalian cell, such as a human cell.

[0094] In some embodiments, the foreign nucleic acid comprises a nucleic acid sequence of a foreign gene. In some embodiments, the foreign nucleic acid comprises a nucleic acid sequence of a non-foreign gene.

[0095] In some embodiments, the genome of the spAAV vector comprises a positive-stranded or negative-stranded single-stranded DNA sequence of the foreign gene.

[0096] In some embodiments, the one or more spAAV vectors include an spAAV vector that contains only a positive-stranded single-stranded DNA sequence of the foreign nucleic acid and / or an spAAV vector that contains only a negative-stranded single-stranded DNA sequence of the foreign nucleic acid.

[0097] In some embodiments, the one or more spAAV vectors include two or more spAAV vectors, including at least a first spAAV vector having a positive-stranded single-stranded DNA sequence of the foreign gene and a second spAAV vector having a negative-stranded single-stranded DNA sequence of the foreign gene.

[0098] In some embodiments, the cell is contacted with an spAAV vector having a positive single-stranded DNA sequence of the foreign gene. In some embodiments, the cell is contacted with an spAAV vector having a negative single-stranded DNA sequence of the foreign gene. In one preferred embodiment, the cell is contacted with a first spAAV vector having a positive single-stranded DNA sequence of the foreign gene and a second spAAV vector having a negative single-stranded DNA sequence of the foreign gene. In some embodiments, the cell is contacted with the first spAAV vector having a positive single-stranded DNA sequence of the foreign gene and the second spAAV vector having a negative single-stranded DNA sequence of the foreign gene simultaneously. In some embodiments, the cell is contacted sequentially (e.g., within 24 hours) with the first spAAV vector having a positive single-stranded DNA sequence of the foreign gene and the second spAAV vector having a negative single-stranded DNA sequence of the foreign gene, or vice versa. It should be understood that in this specification, the terms "first spAAV vector" and "second spAAV vector" are used only to distinguish the two and do not limit the order of their use.

[0099] When a cell is infected with an spAAV vector having a positive-strand single-stranded DNA sequence of the foreign gene shown, or an spAAV vector having a negative-strand single-stranded DNA sequence of the foreign gene, the foreign gene carried by the vector is integrated into the cell genome with a high probability (e.g., 20%), resulting in long-term stable foreign gene expression.

[0100] The combined use of an spAAV vector carrying a positive-strand single-stranded DNA sequence of a foreign gene and an spAAV vector carrying a negative-strand single-stranded DNA sequence of a foreign gene promotes rapid complementary pairing of the spAAV genome containing the positive and negative strands in the nucleus of the host cell to form a double-stranded molecule, thereby initiating gene expression.

[0101] 3 shows a schematic diagram of the complementary pairing of the positive and negative strands of a positive strand DNA spAAV vector and a negative strand DNA spAAV vector to express genes according to one exemplary embodiment of the present specification. In this case, the spAAV DNA is a single-stranded single-stranded DNA, and after a cell is transfected, the loaded single-stranded DNA is released, which has no ITR structure and no 3' primer available for DNA synthesis, so it cannot synthesize a complementary second DNA strand and cannot express genes. When another complementary single-stranded spAAV virus is co-infected, the two complementary single-stranded DNAs can pair to form double-stranded DNA and express genes.

[0102] 4 shows a schematic diagram of spAAV vector integration into cellular genomic DNA according to one exemplary embodiment of the present specification, in which the spAAV DNA is a single-stranded DNA, and after a cell is transfected, the loaded single-stranded DNA is released, which can undergo homologous or non-homologous recombination with the cellular genomic DNA, thereby integrating into the cellular genome and synthesizing a second complementary DNA strand, enabling gene expression.

[0103] Alternatively, the present specification provides an isolated host cell, which contains a spAAV vector described herein.

[0104] In some embodiments, the host cell may be a eukaryotic cell. In some embodiments, the host cell may be an animal cell. In some embodiments, the host cell may be a vertebrate cell. In some embodiments, the host cell may be a mammalian cell. In some embodiments, the host cell may be a human cell.

[0105] In some embodiments, the host cell is obtained by contacting a eukaryotic cell (e.g., an animal cell, e.g., a mammalian cell, e.g., a human cell) with a spAAV vector described herein.

[0106] On the other hand, the spAAV vector described herein is provided and used for gene expression.The use of the spAAV described herein in preparing products for gene expression is also provided.In some embodiments, the subject of the gene expression is an animal, particularly a vertebrate, more particularly a mammal, more particularly a human.

[0107] On the other hand, the spAAV vector described herein is provided for use in gene therapy.The use of the spAAV described herein in preparing gene therapy products is also provided.In some embodiments, the subject of the gene therapy is an animal, particularly a vertebrate, more particularly a mammal, more particularly a human.

[0108] On the other hand, the spAAV vector described herein is provided, and is used for gene editing.The use of the spAAV described herein in preparing gene editing products is also provided.In some embodiments, the subject of gene editing is an animal, particularly a vertebrate, more particularly a mammal, more particularly a human.

[0109] On the other hand, the spAAV vector described herein is provided and used for gene regulation.The use of the spAAV described herein in preparing gene regulation products is also provided.In some embodiments, the subject of said gene regulation is an animal, particularly a vertebrate, more particularly a mammal, more particularly a human. EXAMPLES

[0110] Working Example Construction of plasmid vectors for spAAV vector packaging Herein, a rAAV recombinant plasmid containing an ITR-related sequence at only one end encoding the expression box of a foreign gene is also referred to as a "unipolar" plasmid. The primary plasmid involved in this invention is the spAAV DNA genome plasmid.

[0111] How to build: 1. spAAV-EGFP(+)DNA genomic plasmid The plasmid DNA contains D sequence and A'B' sequence from 5' to 3' direction, and the DA'B' sequence is: 5'-AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAA-3' (SEQ ID NO: 5). The entirety of the 1.3 kb stuff1 stuffer sequence, the forward EGFP gene expression box (CMV-EGFP-polyA) sequence, the 1.3 kb stuff2 stuffer sequence, and the packaging frame is 5.0 kb. The EGFP gene expression box sequence is, in order, the promoter CMV, enhancer, intron, EGFP open reading frame, and polyA sequence. The construction is carried out using pFastBacdual-ITR-EGFP as a vector.

[0112] The first step was to construct pFastBacdual-DtrsA'B'-CMV-EGFP-polyA-RHstuff; DtrsA'B' was denatured and renatured after ordering primers (Primer 1: 5'-CAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAA-3' (SEQ ID NO: 6); Primer 2: 5'-CGCGTTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGGTAC-3' (SEQ ID NO: 7)) (synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.), and 5 μl each of primer 1 and primer 2 oligonucleotides (concentration: 200 μM), 4 μl of 5× annealing buffer, and DNase- and RNase-free deionized water were added to make the final volume 20 μl. After annealing in a PCR machine at 95°C for 4 minutes, the reaction tube was removed and placed on the laboratory bench and cooled to room temperature for 5 to 10 minutes to form oligo-dsDNA with KpnI / MluI sticky ends, which was then inserted into the KpnI / MluI double enzyme-digested pFastBacdual-ITR-EGFP vector.

[0113] RHstuff was denatured and renatured in the same way after ordering primers (primer 3: 5'-GACCGATAATCTCTAGATTGAGGAACAA-3' (SEQ ID NO: 8); primer 4: 5'-AGCTTTGTTCCTCAATCTAGAGATTATCG-3' (SEQ ID NO: 9)) (synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.) to form oligo-dsDNA with RsrII / HindIII sticky ends, which was then inserted into KpnI / MluI double enzyme digested pFastBacdual-DtrsA'B'-CMV-EGFP-polyA vector.

[0114] The second step is to construct pFastBacdual-DtrsA'B'-1.3kb stuff1-CMV-EGFP-polyA-1.3kb stuff2. The 1.3kb stuff1 was fused with the CMV fragment by PCR, and the 1.3kb stuff1-CMV fragment was cloned and amplified using primer sequences (primer 5: 5'-TCACTGACGCGTCGGAAGGTCGGTATCCACGGA-3' (SEQ ID NO:10); primer 6: 5'-CTTCAACCGGCTGAAGCTGGCTAGTTATTAATAGTAATCA-3' (SEQ ID NO:11); primer 7: 5'-TGATTACTATTAATAACTAGCCAGCTTCAGCCGGTTGAAG-3' (SEQ ID NO:12); primer 8: 5'-CCCGGGGAATTCAATCGATGTTCGAATCCCAAT-3' (SEQ ID NO:13)) (Sangon Bioengineering (Shanghai) Co., Ltd.) was denatured and renatured, and the fragment was inserted into pFastBacdual-DtrsA'B'-CMV-EGFP-polyA-RHstuff vector by MluI / EcoRI double enzyme digestion.

[0115] The 1.3 kb stuff2 fragment was cloned by PCR using primer sequences (primer 9: 5'-TTTGTAGGTAACCTCAAGAAGCACATCCTGAATC-3' (SEQ ID NO: 14); primer 10: 5'-GCACGTGGTTACCTTGCCCAGAATGTCTGTGCTG-3' (SEQ ID NO: 15)) (synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.), which was denatured and renatured, and the fragment was inserted into pFastBacdual-DtrsA'B'-1.3 kb Staff1-CMV-EGF-polyA-RHstuff vector by BstEII single digestion. Thus, the pFastBacdual-DtrsA'B'-1.3kb stuff1-CMV-EGF-polyA-1.3kb stuff2(spAAV-CMV-EGFP(+)) vector was obtained, i.e., the spAAV-CMV-EGFP(+) genome packaging plasmid was obtained. To construct the EGFP expression box, please refer to the following literature: Li Taiming et al., Preparation of AAV-ITR gene expression microvector from insect cells, Chinese Journal of Bioengineering, 2015, 31(8), page 1232, "Construction of pFastBacdual-ITR-EGFP plasmid" in Method 1.2.1.

[0116] 2. spAAV-EGFP(-) DNA genomic plasmid The plasmid DNA contains, from 5' to 3', a D sequence and an A'B' sequence, and the DA'B' sequence is: 5'-AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAA-3' (SEQ ID NO:5). The reverse EGFP gene expression box sequence is a polyA sequence, a reverse complementary sequence of the EGFP open reading frame, an intron, an enhancer, a promoter, and a downstream Rep recognition and cleavage sequence. The reverse EGFP expression box was synthesized by PCR using pFastBacdual-DtrsA'B'-1.3kb stuff1-CMV-EGF-polyA-1.3kb stuff2 as a template and cloning the 1.3kb stuff2'-polyA'-EGFP'-CMV'-1.3kb stuff1' fragment with primer sequences (primer 11: 5'-TCACTGACGCGTCACGTGGTTACCTTGCCCAGA-3' (SEQ ID NO:16); primer 12: 5'-CAAGATCGGTCCGCGGAAGGTCGGTATCCACGGA-3' (SEQ ID NO:17)) (Sangon The AAV-EGFP-polyA-RHstuff vector was synthesized by Bioengineering (Shanghai) Co., Ltd.) and then denatured and renatured, and the fragment was inserted into the pFastBacdual-DtrsA'B'-CMV-EGFP-polyA-RHstuff vector by MluI / RsrII double enzyme digestion, resulting in the pFastBacdual-DtrsA'B'-1.3kb stuff2'-polyA'-EGFP'-CMV'-1.3kb stuff1' (spAAV-EGFP(-)) genome packaging plasmid.

[0117] Preparation of recombinant bacmids The three recombinant plasmids from the previous step were used to prepare recombinant Bacmids, respectively. The specific method is as follows: 1. 100 μl of DH10Bac competent was slowly thawed on ice. 2. 500ng of plasmid DNA was added and mixed gently. 3. Place on ice for 30 minutes, heat shock at 42°C for 90 seconds, and immediately transfer to ice and leave for 2 minutes. 4. 900 μl of LB medium was added and the mixture was shaken at 37°C and 225 rpm for 2 to 3 hours. 5. Drop 40 μl of 2% (20 mg / ml) X-gal and 20 μl of 20% (200 mg / ml) IPTG onto the center of a previously prepared 90 mm agar plate containing 50 μg / ml Kan, 7 μg / ml Gen, and 10 μg / ml Tet. Using a sterile spreader, spread over the entire surface of the culture plate and incubate at room temperature until all the liquid has disappeared.

[0118] 6. Using LB medium, culture the cells on a gradient (10 -1 , 10 -2 ) and 100 μl of each gradient was applied to an LB plate. 7. After leaving it at 37°C for 48 hours, two white colonies were picked, dipped into a new LB agar plate (with the same resistance as above), streaked, and stored at 37°C overnight. 8. Two single bacterial colonies were picked for PCR identification; the bacmid was identified by PCR, and the primers used were target gene F / R and PUC M13 F / R, respectively. 9. The correctly identified bacmid colonies were picked and inoculated into 10ml LB (Kan+, Gen+, Tet+), and the bacteria were shaken for 12 hours; the recombinant bacmid DNA was extracted and isolated using the OMEGA kit, and the bacmid concentration was measured according to the kit instructions, then aliquoted and frozen at -20℃.

[0119] Preparation of baculovirus 1. Preparation of transfection reagent 1 x HBS 200ml preparation Hepes 0.954g NaCl 1.754g Sterile ddH2O 150ml 1M NaOH Adjust pH to 7.4 The solution was adjusted to 200 ml, sterile filtered in a safety cabinet, and stored at 4°C.

[0120] Prepare PEI 20ml PEI 0.043g 1ml absolute ethanol After complete dissolution, the solution was adjusted to 20 ml with 1x HBS, freeze-thawed three times (freezing at -20°C, thawing at room temperature), and then stored at -20°C.

[0121] 2. Cell plating Plating: Prepare a 6-well plate, aspirate and count the suspension cultured cells, and confirm that the plating density is 2*10 6 cells / ml, 2 ml per well, with cell viability greater than 95%.

[0122] 3. Transfection (amount per well) Solution A: PEI: 6 μl of PEI and 94 μl of 1×HBS were added, mixed well, and allowed to stand for 4 minutes. Solution B: Take 3 μg of bacmid (the bacmid was previously inactivated at 65° C. for 30 min) DNA and add to 1×HBS to a final volume of 100 μl and mix gently. 100 μl of solution A was added to solution B, mixed thoroughly, and incubated at room temperature for 30 minutes, then added to wells containing plated cells, and cultured for 96 hours.

[0123] 4. Virus amplification 1) Isolation of P1 After confirming that the cells were in the late stage of infection (96 hours), 2 ml of the virus-containing medium from each well was collected into a sterile 15 ml centrifuge tube and centrifuged at 500 g for 5 minutes to remove cell debris.

[0124] The supernatant was transferred to a sterile EP tube and stored in the dark at 4° C. For long-term storage, the supernatant was divided into small portions and frozen at −80° C.

[0125] 2) Amplify the virus to obtain P2 Take 8 ml of suspension cultured cells with an MOI of 0.1 and a density of 2 × 10 6 The required amount of P1 was calculated to be 1.6 ml, with the cell count being 1.6 cells / ml. After culturing at 27°C for 72 hours, the suspension culture cells were collected into a sterile 15 ml centrifuge tube and centrifuged at 500 g for 5 minutes. The supernatant was dispensed into a sterile EP tube, and the viral supernatant was P2, which was stored in the dark at 4°C; for long-term storage, it was divided into small aliquots and frozen at -80°C.

[0126] 3) Amplify the virus to obtain P3 Following the above method, amplification was performed to obtain P3, with an MOI of 0.1 and a density of 2 x 10 6 10 ml of cells / ml of suspension cultured cells were taken, added to 200 μl of P2 storage solution, and cultured for 72 hours, and P3 was collected.

[0127] The titer of P1 virus obtained routinely is 1 × 10 6 ~1×10 7 and the titer of the P2 virus was 1 × 10 7 ~1×10 8 It is.

[0128] 4) Virus packaging Take 100 ml of suspension cultured cells with an MOI of 1 and a density of 5 × 10 6 cells / ml, 5 ml each of Rep, Cap, and the target gene of the P3 generation were added, cultured for 72 hours, and the cells were harvested.

[0129] Packaging of spAAV vectors The spAAV vector packaging system of the present invention may be an insect cell baculovirus packaging system or a mammalian cell packaging system. The insect cell is an Sf9 cell. First, one or both of the plasmids expressing the AAV replication protein Rep and the AAV capsid protein Cap were recombined into a plasmid (the Rep and Cap genes are in one or two different plasmids), and the other plasmid contained the spAAV DNA genome. E. coli DH10Bac competent cells were transformed respectively, and by two rounds of blue-white spot screening, colonies containing recombinant bacmids were white and colonies without recombinants were blue, and white colonies were selected for amplification, and recombinant bacmids were extracted.

[0130] Next, the above two or three recombinant bacmids were transfected into Sf9 insect cells using an insect cell transfection reagent, and after 4 to 5 days, the cell supernatant was collected to obtain P1 generation insect cell recombinant baculovirus. The P1 generation recombinant baculovirus was amplified by infecting Sf9 insect cells twice to obtain P3 generation recombinant baculovirus. The titer of the P3 generation baculovirus was determined using the plaque method, and the virus titer (pfu / ml) = 1 / dilution factor × number of plaques × 1 / inoculation volume per well.

[0131] Finally, two or three recombinant baculoviruses from the P3 generation were co-infected into Sf9 insect cells and packaged to obtain spAAV vector virus particles. Reference for procedure: Urabe M, Ding C, Kotin RM. Insect cells as a factory to produce adeno-associated virus type 2 vectors. Hum Gene Ther. 2002 Nov 1;13(16):1935-43. doi:10.1089 / 10430340260355347. PMID:12427305.

[0132] A schematic diagram of packaging using the insect cell baculovirus packaging system is shown in FIG.

[0133] Iodixanol density gradient ultracentrifugation purification step 1. Obtaining cell lysates 1) 72 hours after cotransfection, cells were harvested by centrifugation at 1000 g for 5 min; 2) The supernatant was discarded and the cells were resuspended in 10 ml of Lysis Buffer; Lysis Buffer(1L): NaCl 8.766g Tris 6.055g DH2O 950ml The pH was adjusted to 8.5 with 5M Hcl, and the volume was adjusted to 1 L. Sterile filtration was performed in a safety cabinet and stored at 4°C.

[0134] 3) freezing in liquid nitrogen and thawing at 37°C, repeated 3-4 times until transparent; 4) The mixture was centrifuged at 5000 g for 30 minutes at 4°C to recover the supernatant; the precipitate was resuspended in 4-5 ml of PBS and centrifuged again to recover the supernatant; 5) DNase (10 μl / ml) and RNase (1 μl / ml) were added and digested in a 37°C water bath for 1 hour in preparation for purification;

[0135] 2. Virus purification by iodixanol density gradient ultracentrifugation 1), PBS-MK (1x PBS, 1mM MgCl2, 2.5mM KCl) was used, 60% iodixanol was diluted to 15%, 25%, 40%, and 58%, and solid NaCl was added to the 15% phase to a final concentration of 1M; 2) 0.5% phenol red solution was added to the 15% and 25% phases to 1.5 μl / ml, and 0.5% phenol red solution was added to the 58% phase to 0.5 μl / ml; 3) Using a 1.27 x 120 mm flat-ended spinal needle, 8 ml of 15%, 6 ml of 25%, 8 ml of 40%, and 5 ml of 58% iodixanol dilutions were added to the bottom of a 39 ml quick seal tube, taking care to avoid air bubbles;

[0136] 4) Carefully cover the cell lysate on the iodixanol density gradient solution, fill the tube (so that it is flush with the opening line of the tube), add Lysis Buffer to fill the tube if necessary, balance, and centrifuge at 69000 rpm, 18℃ for 1.5 hours (BECKMAN COULTER Centrifuge 70Ti Rotor); 5) The quick seal tube was punctured from the bottom, the first 4 ml (corresponding to the 58% phase) was discarded, and 6 ml of the solution in the tube was recovered; 6) Ultrafiltration was performed using ultrafiltration tubes (Amicon Uitra-4 Centrifugai Filters, Ultracel-100k) and centrifuged at 3000g for 5 minutes; washing was repeated with PBS ((1xPBS, Solarbio Company, 5M NaCl added to a final concentration of 350mM)) until the residual concentration of iodixanol was less than 0.1%, and finally the virus was compressed to approximately 200μl per 100ml packaging volume; 7) Glycerol was added to a final concentration of 5%, sterile filtered, aliquoted, and stored at -80°C;

[0137] Detection of spAAV vector titer by fluorescent quantitative PCR RT-PCR method 1. Plasmid ITR-EGFP was diluted 10-fold, then gradient diluted, and diluted in five gradients to create a standard curve. 2. The virus was diluted 10-fold, then gradient dilutions were performed, with four gradient dilutions 3. Buffer preparation (in the dark): 2xSuperpreMix Plus (SYBR Green) 10μl Upstream primer, 5'-TCCGCGTTACATAACTTACGG-3' (SEQ ID NO: 18; synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.) 0.3 μl Downstream primer, 5'-GGGCGTACTTGGCATATGAT-3' (SEQ ID NO: 19; synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.) 0.3 μl DD H2O 4.4μl

[0138] 4. Load samples: 20 μl system: 5 μl template + 15 μl Buffer, for each gradient, two duplicate wells were made. 5. RT-PCR (Roche LightCycler) program: Stage 1 Pre-denaturation Reps 1 95℃ 600s Stage 2 Cycle reaction Reps 40 95℃ 10s 55℃ 30s 72℃ 30s Stage3 Melting curve Reps 1 95℃ 15s 60℃ 60s 95℃ 15s

[0139] SDS-PAGE electrophoretic analysis of spAAV vector capsid proteins 1. Gel Preparation: 1), Separation gel (10%): The following amount of materials (9.093 ml) were added to a beaker to prepare the separation gel: 3.69 ml of double distilled water, 2.97 ml of 30% acrylamide gel solution (acrylamide: methylene bisacrylamide = 29:1), 2.25 ml of 2M Tris, pH 8.8, 90 μl of 10% ammonium persulfate, 90 μl of 10% SDS, 3 μl of TEMED. After mixing, the separation gel was dropped using a dropper between two glass plates until the liquid level reached 1 cm from the bottom end of the comb. 75% ethanol was slowly added with a dropper, left to stand, and after the separation gel polymerized, the 75% ethanol layer was discarded.

[0140] 2), Stacking gel (5%): The following amount of materials (2.357 ml) were added to a beaker to prepare stacking gel: 1.83 ml of double distilled water, 0.39 ml of 30% acrylamide gel solution (acrylamide: methylene bisacrylamide = 29:1), 0.75 ml of 0.5 M Tris, pH 6.8, 30 μl of 10% ammonium persulfate, 30 μl of 10% SDS, 2 μl of TEMED. Immediately after mixing, stacking gel was added using a dropper to cover the separating gel between the two glass plates until it was full, and a comb was gently inserted. After solidification, a gel plate could be created.

[0141] 2. Sample processing: The virus sample was mixed with 5X loading buffer at a ratio of 2:1, and immersed in a boiling water bath for 10 minutes. After immediate centrifugation, all samples were collected and subjected to electrophoresis.

[0142] 3. Electrophoresis 1) A gel plate consisting of two glass plates was attached vertically onto a power rack in an electrophoresis tank so that the recessed portion of the gel plate was close to the power rack. 2) The gel plate and power rack were secured in the power slot as required, electrophoresis buffer was added, and the comb was gently removed from the gel plate. 3) The treated sample solution was taken and using a microinjector, 15 μl of the sample solution was taken and slowly added to the notch (sample entry point) of the gel plate. 4) In electrophoresis, the voltage was controlled to 90 V for the concentration gel and 120 V for the separation gel. Electrophoresis was stopped when the bromophenol blue color bar in the gel was 1 cm away from the bottom.

[0143] 4. Staining. Gently pry open the two glass plates on the outside of the gel plate with a razor or thin board, and cut off the separating gel along the junction of the separating gel and stacking gel with a razor on the gel. Then, carefully transfer the separating gel to a staining container, add 100 ml of staining solution, cover, and stain for 1 to 3 hours.

[0144] 5. Destaining. Discard the staining solution. Rinse the stained gel with water several times, place it in clear water so that the water is just above the gel, place it in a microwave oven and heat it on high heat for 2 minutes, take it out, shake it slowly, and repeat this operation until the protein bands are clearly visible.

[0145] The results of SDS-PAGE electrophoresis of spAAV vector capsid proteins are shown in Figure 5. There is no difference in the composition of spAAV capsid proteins and normal rAAV capsid proteins, and both are composed of spAAV capsid proteins consisting of three proteins, VP1, Vp2, and Vp3, and the composition of the three proteins is basically 1:1:10.

[0146] Identification of spAAV vector genomes DNA neutral agarose gel electrophoresis analysis 1. In an Erlenmeyer flask or glass bottle, add an accurate amount of agarose powder and a quantitative amount of 1X TAE electrophoresis buffer to prepare an agarose solution. 2. Gently pack Kimwipes paper into the neck of the flask. If using a glass bottle, the stopper must be loosened. Heat the suspension in a boiling water bath or microwave until the agarose dissolves. 3. The clear solution was cooled to 40-50℃, 4S red stain was added, and the gel was rapidly perfused. Once the gel had completely solidified, it was placed in the electrophoresis tank and freshly prepared 1XTAE electrophoresis buffer was added to just cover the gel. 4. Prepare 10μl of virus, add 1.1μl of 10XPCR Buffer, place in a PCR machine and run at 95℃ for 5 minutes, 72℃ for 5 minutes, 55℃ for 5 minutes, 37℃ for 5 minutes, 80℃ for 5 minutes, 72℃ for 5 minutes, 55℃ for 5 minutes, and 37℃ for 15 minutes.

[0147] 5. 0.2 volume of 6X gel loading buffer was added to the denatured and renatured sample. 6. All samples dissolved in 6X loading buffer were added to the loading well. Electrophoresis was performed for 50 minutes at a voltage of 100V. 7. Imaging: The gel was placed in a gel imager and photographed and recorded.

[0148] Figure 6 shows the results of neutral agarose gel electrophoresis of the spAAV gene vector. The DNA of spAAV is a single-stranded DNA with a single polarity, and when analyzed by neutral agarose gel electrophoresis, the DNA appears as a DNA band much smaller than its molecular weight and is often diffuse.

[0149] DNA alkaline agarose gel electrophoresis analysis 1. Preparation of alkaline agarose gel: 0.36 g of agarose powder and 27 ml of distilled water were placed in an Erlenmeyer flask or glass bottle to prepare the agarose solution. The neck of the Erlenmeyer flask was gently packed with Kimwipes paper. If a glass bottle is used, the stopper must be loosened. The suspension was heated in a microwave oven until the agarose was dissolved. The clear solution was equilibrated in a 56°C water bath for 5 minutes. 3 ml of 10X alkaline gel electrophoresis buffer was added, mixed well (equilibrated in a 56°C water bath for 2 minutes), and perfused rapidly to produce a gel. Once the gel had completely solidified, it was placed in the electrophoresis tank and freshly prepared 1X electrophoresis buffer (4°C) was added to just cover the gel. 2. Sample preparation: 30 μl of virus sample was taken, 3 μl of proteinase K (20 mg / ml) was added, and digested at 65°C for 15 minutes, then centrifuged at 12000 g for 5 minutes, 30 μl of the supernatant was taken, and 6 μl of 6X alkaline gel loading buffer was added. 3. Electrophoresis: All DNA samples were added to the loading well and electrophoresis was started at a voltage of <3.5V / cm. (Horizontal electrophoresis tank JY-SPAT 27V electrophoresis 3h)

[0150] 4. Dissolution: The gel was placed in 400 ml of water for injection and dissolved on a horizontal shaker at 56 rpm for 1 hour, with water changed every 30 minutes. 5. Staining: The eluted gel was stained with 1XTAE staining solution containing 0.5 μg / ml EB (ethidium bromide). 6. Imaging: The gel was placed in a gel imager and photographed and recorded.

[0151] Figure 7 shows the results of alkaline agarose gel electrophoresis of spAAV vectors. spAAV DNA is a single-stranded DNA, and when analyzed by alkaline agarose gel electrophoresis, it shows one single DNA band, and the molecular weight of the single-stranded DNA is 4.7 kb. Conventional rAAV EGFP packages often have DNA molecules of different molecular weights, and this rAAV EGFP package has two molecular weights of DNA molecules, namely, a single-stranded DNA with a molecular weight of 4.7 kb and a single-stranded DNA with a molecular weight of 2.7 kb.

[0152] Identification of monopolar genomes by spAAV genome annealing containing target gene DNA plus and minus strands 8 μl each of spAAV-EGFP(+)DNA and spAAV-EGFP(-)DNA and 4 μl of 5× annealing buffer were added, and the mixture was kept at 95°C for 15 minutes, then removed, cooled to room temperature on the bench, and placed in a water bath at 37°C for 30 minutes. DNA was subjected to neutral agarose gel electrophoresis and Goldview staining analysis.

[0153] Figure 8 shows the results of neutral agarose gel electrophoresis of the complementary pairing of the plus and minus strands of spAAV DNA. spAAV DNA is a single-stranded DNA with a single polarity, and when analyzed by neutral agarose gel electrophoresis, the DNA appears as a DNA band much smaller than its molecular weight, and is often diffuse. Positive strand DNA spAAV vector and negative strand DNA When the positive strand DNA molecules and negative strand DNA molecules of the spAAV vector are annealed, the positive strand DNA molecules and the negative strand DNA molecules are complementary paired to form a double-stranded DNA, and the molecular weight of the double-stranded DNA is 4.7 kb.

[0154] Identification of single-stranded DNA genome of spAAV vector by S1 enzyme digestion S1 enzyme and buffer (5X Reaction Buffer:S1 Nuclease = 10:1) were mixed, and the extracted spAAV vector DNA genome was added, followed by incubation at 37°C for 30 minutes and detection by DNA neutral agarose gel electrophoresis.

[0155] Figure 9 shows the results of neutral agarose gel electrophoresis of spAAV DNA digested with S1 nuclease. S1 nuclease is a specific single-stranded nucleotide endonuclease that degrades single-stranded DNA. spAAV DNA is a unipolar single-stranded DNA that is degraded by S1 nuclease. However, when spAAV plus-strand and minus-strand DNA molecules were annealed together, the plus-strand and minus-strand DNA molecules complementarily paired together to form a double-stranded DNA that was not degraded by S1 nuclease.

[0156] Gene expression in HEK293 cells infected with spAAV vectors HEK293 cells, 1.5x10 5 The next day, HEK293 cells were transfected with rAAV6-EGFP, spAAV-EGFP(+), and spAAV-EGFP(-), respectively, and the HEK293 cells were transfected with spAAV-EGFP(+) and spAAV-EGFP(-), with an MOI of 1x10. 6 The cells were co-infected with 100 μg of ...

[0157] FIG. 10 shows the results of gene expression assay of HEK293 cells infected with spAAV vector. The DNA of the spAAV genome is single-stranded, has no ITR structure, and has no 3' primer available for DNA synthesis, so it cannot synthesize a complementary second DNA strand, and cannot synthesize a second complementary DNA strand in the cell, and cannot express genes by complementary formation of double-stranded DNA molecules of plus and minus strands like bipolar rAAV vectors, so the expression of fluorescent protein is hardly observed in the first two days after spAAV infection. The expression of fluorescent protein is gradually observed in a few cells three days after infection, and after about one week, more fluorescent protein is expressed, fluorescent cells show adjacent clusters, and the expression of fluorescent protein is stable and not lost by cell division. This is the expression pattern of the monopolar single-stranded DNA released by the spAAV vector after integration into the cell genome by homologous or non-homologous recombination, such that gene expression is stable and sustained for a long period of time.

[0158] When a positive strand DNA spAAV vector and a negative strand DNA spAAV vector are simultaneously infected into HEK293 cells, the positive strand DNA and the negative strand DNA are released, and the two complementary monopolar DNAs can pair to form double-stranded DNA and express genes. The spAAV vector expresses proteins in a complementary pairing manner, which is generally fast and efficient.

[0159] As a result, when two spAAVs described herein, i.e., spAAV-EGFP(+) or spAAV-EGFP(-), each containing a positive or negative strand of a target DNA gene, are infected into cells cultured in vitro (e.g., HEK 293 cells), the genes can be integrated into the cell genome, resulting in long-term stable fluorescent protein expression. When two spAAVs described herein, i.e., spAAV-EGFP(+) and spAAV-EGFP(-), each containing a positive or negative strand of a target DNA gene, are co-infected into cells cultured in vitro (e.g., HEK 293 cells), the two can produce complementary double-stranded DNA molecules and express the target gene at a high rate.

Claims

1. Both ends of the spAAV genome before packaging are linear and open-ended, except that one end does not have an inverted terminal repeat (ITR) or a part thereof, and the other end has an ITR cleavage portion (ITRt), which does not form a T-shaped hairpin palindrome structure; specifically, the spAAV genome is a monopolar recombinant adeno-associated virus (spAAV) genome before packaging, characterized in that the spAAV genome is a monopolar single-stranded DNA.

2. The spAAV genome before packaging as described in claim 1, characterized in that the spAAV genome before packaging does not have an ITR or a portion thereof at the 3' end and has the ITRt at the 5' end.

3. The prepackaged spAAV genome of claim 1, characterized in that the ITRt comprises a Rep protein binding element (RBE) and a terminal melting site (trs).

4. Capsid protein; and spAAV genome packaged by capsid protein An spAAV vector comprising: However, the spAAV genome packaged by said capsid proteins is derived from the pre-packaged spAAV genome described in claim 1.

5. The spAAV vector of claim 4, wherein the spAAV genome packaged by the capsid protein is a monopolar, single-stranded DNA.

6. 2. An spAAV recombinant plasmid for producing the prepackaged spAAV genome of claim 1.

7. 5. A method for delivering an exogenous nucleic acid to a cell, comprising contacting the cell with one or more spAAV vectors of claim 4, wherein the genome of said one or more spAAV vectors comprises a gene expression box and / or any other DNA sequence of said exogenous nucleic acid.

8. The method of claim 7, characterized in that the one or more spAAV vectors include an spAAV vector that contains only a positive-stranded single-stranded DNA sequence of the foreign nucleic acid and / or an spAAV vector that contains only a negative-stranded single-stranded DNA sequence of the foreign nucleic acid.

9. 5. An isolated host cell comprising the spAAV vector of claim 4.

10. 5. Use of the spAAV vector of claim 4 in the preparation of a gene expression, gene therapy, gene editing or gene regulation product.

Images