Methods and products for nucleic acid production and delivery

Abstract

To provide improved methods and compositions for the production and delivery of nucleic acids to cells, tissues, organs, and patients.SOLUTION: The present invention relates in part to nucleic acids, including nucleic acids encoding proteins, therapeutics and cosmetics comprising nucleic acids, methods for delivering nucleic acids to cells, tissues, organs, and patients, methods for inducing cells to express proteins using nucleic acids, methods, kits and devices for transfecting, gene editing, and reprogramming cells, and cells, organisms, therapeutics, and cosmetics produced using these methods, kits, and devices. Methods and products for altering the DNA sequence of a cell are described, as are methods and products for inducing cells to express proteins using synthetic RNA molecules, including cells present in vivo. Therapeutics comprising nucleic acids encoding gene-editing proteins are also described.SELECTED DRAWING: Figure 1

Description

[Technical field]

[0001] Priority This application was filed on January 3, 2014, the entire contents of which are incorporated herein by reference. U.S. Provisional Patent Application No. 61 / 934,397, filed on August 1, 2014 No. 62 / 038,608, filed on October 28, 2014. This application claims priority to U.S. Provisional Patent Application No. 62 / 069,667.

[0002] This application was filed on May 7, 2012, the entire contents of which are incorporated herein by reference. No. 13 / 465,490, filed Dec. 5, 2012; International Patent Application PCT / US2012 / 067966, filed June 28, 2013 No. 13 / 931,251, filed on November 1, 2013. This application is related to international patent application PCT / US2013 / 068118.

[0003] FIELD OF THEINVENTION The present invention relates, in part, to methods for producing and delivering nucleic acids to cells, tissues, organs, and patients. Methods, compositions, and products for expressing proteins in cells, tissues, organs, and patients and cells, therapeutic agents, and methods produced using these methods, compositions, and articles of manufacture. and cosmetics.

[0004] Description of electronically submitted text files The contents of any text files submitted electronically herewith are hereby incorporated by reference in their entirety. A computer readable format copy of the sequence listing (filename: FAB-008PC SequenceListing.txt, Recording date: 2015 / 1 30th, file size: 929KB). [Background technology]

[0005] Synthetic RNA and Nucleic Acid Therapeutics Ribonucleic acid (RNA) is ubiquitous in both prokaryotic and eukaryotic cells, where it is used as a messenger - Genetic information is encoded in the form of RNA, and amino acids are linked together in the form of transfer RNA. They transport and assemble amino acids into proteins in the form of ribosomal RNA and microRNAs. and in the form of long non-coding RNA, which carries out numerous other functions, including regulating gene expression. It can be produced synthetically by methods including direct chemical synthesis and in vitro transcription. , can be administered to patients for therapeutic use. However, the previously described synthetic RNA molecules are unstable in human cells and induce a strong innate immune response. for efficient non-viral delivery of nucleic acids to patients, organs, tissues, and cells in vivo. Methods for this have not been previously described. Existing synthetic RNA technologies and methods for delivery of nucleic acids Many shortcomings of the methods make those techniques and methods less desirable for therapeutic or cosmetic use. It will become something different.

[0006] Cellular reprogramming and cell-based therapies Cells can be transformed by exposing them to specific extracellular cues and / or or reprogramming by ectopic expression of specific proteins, microRNAs, etc. Several reprogramming methods have been previously described, including ectopic expression. Most of the dependencies on genomic DNA require the introduction of foreign DNA, which can pose a risk of mutation. DNA-free reprogramming based on direct delivery of reprogramming proteins However, these methods are too inefficient for commercial use. In addition, RNA-based reprogramming methods have been described (e.g., Angel. MIT Thesis.2008.1-56;Angel et a l.PLoS ONE.2010.5,107, Warren et al.Cell Stem Cell.2010.7,618-630;Angel.MIT Thesi s.2011.1-89, and Lee et al.Cell.2012.151,54 7-558, the entire contents of which are incorporated herein by reference. However, existing RNA-based reprogramming methods, when performed on mature cells, , time-consuming, unreliable and inefficient (incurring significant costs and potential for error). (1) Requires multiple transfections and can only reprogram a limited number of cell types can only reprogram a limited number of cell types, and The use of inhibitors was required, and multiple human fibroblast feeders, including blood-derived HSA, were used. Previously disclosed RNA-based reprogramming requires the use of a marker-derived component. A number of drawbacks of the methods make them undesirable for in vivo use. It has become.

[0007] Gene editing Several naturally occurring proteins are DNA-binding proteins that can recognize specific DNA sequences. Binding domains, such as zinc finger (ZF) and transcription activator-like effector (T ALE) are contained in the DNA binding domain and the cleavage domain of FokI endonuclease. A fusion protein containing one or more of the cleavage domains is then inserted into a desired region of DNA in a cell. can be used to create double stranded breaks (see, e.g., U.S. Patent Application Publication No. US 2005 / 0133663). No. 2012 / 0064620, U.S. Patent Application Publication No. US2011 / 0239315, U.S. No. 8,470,973, U.S. Patent Application Publication No. US2013 / 0217119, U.S. Patent No. 8,420,782, U.S. Patent Application Publication No. US2011 / 0301073 , U.S. Patent Application Publication No. US2011 / 0145940, U.S. Patent No. 8,450,471 No. 8,440,431, U.S. Pat. No. 8,440,432, and U.S. Pat. Publication No. 2013 / 0122581, the entire contents of which are incorporated herein by reference. However, current methods for gene editing of cells are ineffective. These methods are expensive and involve the risk of uncontrolled mutagenesis, making them unsuitable for research and therapeutic use. This makes somatic DNA-free gene editing undesirable for both uses. Methods for simultaneous or sequential gene editing and replication of somatic cells have not been previously explored. Methods for programming have also not been explored. In addition, Methods for direct gene editing of cells (in vivo) have not been previously explored, and The development of such methods has been limited by the limited availability of acceptable nucleotide sequences, due in part to poor binding of the DNA-binding domain. Lack of targeting, inefficient delivery, inefficient gene editing protein / proteins Inefficient gene editing due to expression, expressed gene editing protein / proteins The undirected dimerization of the FokI cleavage domain and the poor specificity of the DNA binding domain to a certain extent, excessive off-target effects; as well as other factors. Finally, the use of gene editing in antibacterial, antiviral, and anticancer therapy has been previously explored. It has not been done.

[0008] Thus, improved methods for producing and delivering nucleic acids to cells, tissues, organs, and patients are provided. There remains a need for methods and compositions. Summary of the Invention

[0009] The invention relates in part to compositions for delivering nucleic acids to cells, tissues, organs, and patients, Methods, articles, and devices for inducing cells to express proteins, and methods, articles, and devices for producing the compositions, methods, articles, and devices of the present invention. The cells, organisms, cosmetics, and therapeutics produced using these compositions, methods, articles, and devices. Unlike previously reported methods, certain of the present invention provide compositions and articles containing therapeutic agents. Certain embodiments include the use of foreign DNA or allogeneic or animal-derived The product produced according to the method of the present invention does not involve exposing cells to a source material. , making them useful for therapeutic and cosmetic applications.

[0010] In some embodiments, a method for the treatment of a patient's cell population, comprising introducing RNA into the cell population. Methods are provided for expressing proteins and RNA that induce significant cellular immune responses. Contains one or more non-standard nucleotides that do not substantially decrease protein expression. In some embodiments, at least 50%, or at least 75% of the non-standard nucleotides , or at least 90% is 5-hydroxycytidine, 5-hydroxymethylcytidine , 5-carboxycytidine, 5-formylcytidine, 5-Hydroxyuridine, 5-Hydroxymethyluridine, 5-Carboxyuridine, and and 5-formyluridine. or, in some embodiments, 5-hydroxymethylcytidine, 5-carboxymethylcytidine, Further embodiments are selected from one or more of: 5-formylcytidine, 5-formylcytidine, and 5-formylcytidine. , optionally including additional elements of RNA, such as one or more Kozak consensus sequences. including a 5′ cap structure, a 3′ poly(A) tail, and a 5′-UTR and / or a 3′-U With respect to the TR, this sequence increases the stability of the RNA in vivo (e.g., α- globin or β-globin 5′-UTR).

[0011] In some embodiments, a nucleic acid delivery patch is provided. In one embodiment, the nucleic acid is delivered using an electric field. Other aspects include methods and compositions for delivering nucleic acids to the skin. Yet another aspect relates to methods and compositions for expressing proteins in skin. Related to the composition.

[0012] In one aspect, the present invention provides a method for the prevention and treatment of rare dermatological diseases, including but not limited to: This includes, but is not limited to, treatments for rare diseases and treatments used in medical dermatology and aesthetic medicine. The present invention provides methods and compositions for treating human diseases and conditions, including, but not limited to, In one embodiment, the present invention provides a cosmetic comprising the nucleic acid. The present invention relates to methods and compositions for modifying pigmentation, for example for treating pigmentation disorders. The method may be used to enhance healing, including, but not limited to, healing in response to wounds or surgery. Other aspects relate to methods and compositions for detecting nucleic acids that contain one or more non-standard nucleotides. In one aspect, the present invention relates to a method for the treatment of osteoarthritis, such as 5-hydroxycytidine, 5-hydroxymethyl Lucitidine, 5-carboxycytidine, 5-formylcytidine, 5-hydroxyuridine , 5-hydroxymethyluridine, 5-carboxyuridine, and 5-formyluridine or in some embodiments, a 5-hydroxytryptamine derivative is provided. Methylcytidine, 5-carboxycytidine, and / or 5-formylcytidine One or more may be selected.

[0013] The compositions of the present invention are intended to be used to treat the integumentary system of a subject, including but not limited to the skin, hair, and nails. Change, modify, and / or alter the appearance of organs of the integral system Such changes, modifications, and / or variations may include, but are not limited to, the following: and / or methods of treatment as described herein, including dermatological and cosmetic treatments. This may be in relation to therapeutic use.

[0014] In some embodiments, synthetic RNA molecules are provided that have low toxicity and high translation efficiency. In one aspect, the present invention provides a method for the highly efficient in vivo transfection, reprogramming, and expression of cells. A cell culture medium for gene editing is provided. Another embodiment is a method for the preparation of a reprogramming protein. Yet another aspect relates to a method for generating synthetic RNA molecules that encode genes. The present invention relates to methods for generating synthetic RNA molecules that encode child editing proteins.

[0015] In one aspect, the present invention provides a highly efficient gene encoding an endonuclease that contains an engineered nuclease cleavage domain. In another aspect, the present invention provides an editing protein comprising an engineered nuclease cleavage domain. In another embodiment, the present invention provides a high-fidelity gene editing protein comprising an engineered DNA. In yet another embodiment, the present invention relates to a highly efficient gene editing protein comprising an A-binding domain. The present invention relates to high-fidelity gene editing proteins that contain engineered DNA-binding domains. Another aspect relates to gene-editing proteins that include engineered repeat sequences. The method involves transfecting cells with or expressing a gene editing protein. The present invention relates to a method for modifying the DNA sequence of a cell by inducing the cell to Another embodiment relates to a method for altering a DNA sequence in a cell present in in vitro culture. Yet another embodiment relates to a method for altering the DNA sequence of a cell present in vivo. do.

[0016] In some embodiments, the invention provides a therapeutically effective amount of a gene editing protein or a gene editing A method for treating cancer comprising administering to a patient a nucleic acid encoding a protein. In one embodiment, the gene editing protein alters the DNA sequence of a cancer-associated gene. In another embodiment, the cancer-associated gene is the BIRC5 gene. The embodiments include, for example, type 1 diabetes, heart disease including ischemic and dilated cardiomyopathy, macular degeneration, Parkinson's disease, cystic fibrosis, sickle cell anemia, thalassemia, Fanconi anemia, severe complex Immunodeficiency, hereditary sensory neuropathy, xeroderma pigmentosum, Huntington's disease, muscular dystrophy, Including amyotrophic lateral sclerosis, Alzheimer's disease, cancer, as well as hepatitis and HIV / AIDS Therapeutic agents comprising nucleic acids and / or cells for treating infectious diseases, and nucleic acids and / or cells The present invention relates to methods of using therapeutic agents that include cells. In some embodiments, the nucleic acid includes synthetic RNA. In other embodiments, the nucleic acid is delivered to the cell using a virus. In another embodiment, the virus is a replication-competent virus. In another embodiment, the virus is a replication-incompetent virus. do.

[0017] Details of the invention are set forth in the accompanying specification below. As set forth herein Although any equivalent methods and materials can be used in the practice or testing of the present invention, illustrative Methods and materials are described herein. Other features, objects, and advantages of the invention are described herein. The present invention will become apparent from the following detailed description and the appended claims. In the scope, the singular includes the plural unless the context clearly indicates otherwise. To the extent possible, all technical and scientific terms used herein are understood to be within the skill of the art to which this invention belongs. "conventional" has the same meaning as commonly understood by those skilled in the art. [Brief description of the drawings]

[0018] [Figure 1] FIG. 1 depicts RNA encoding human elastin protein and containing adenosine, 50% guanosine, 50% 7-deazaguanosine, 60% uridine, 40% 5-methyluridine, and 5-methylcytidine, separated on a formaldehyde denaturing agarose gel. [Diagram 2] FIG. 1 depicts RNA-transfected primary adult human dermal fibroblasts. [Diagram 3] 3 depicts the results of immunocytochemical analysis of the primary adult human dermal fibroblasts of FIG. 2 using an antibody targeted to human elastin protein. [Figure 4]1 depicts primary human dermal fibroblasts transfected with synthetic RNA encoding Oct4 protein containing cytidine, 5-methylcytidine ("5mC"), 5-hydroxymethylcytidine ("5hmC"), 5-carboxycytidine ("5cC"), or 5-formylcytidine ("5fC"). 24 hours after transfection, cells were fixed and stained for Oct4 protein. [Diagram 5] 1 depicts primary human dermal fibroblasts transfected with synthetic RNA containing 5-hydroxymethylcytidine and encoding green fluorescent protein ("GFP"). Cells were imaged 24 hours after transfection. [Figure 6] 1 depicts a region of the ventral forearm of a healthy 33-year-old male subject that was treated with synthetic DNA containing 5-hydroxymethylcytidine ("5hmC") and encoding GFP. Arrows indicate fluorescent cells. [Figure 7] Figure 1 represents an area of ​​the ventral forearm of a healthy 33-year-old male patient that was treated with synthetic DNA containing 5-hydroxymethylcytidine ("5hmC") and encoding GFP. The top panel represents an untreated area on the same forearm, and the bottom panel represents two areas within the treated area. Fluorescent cells (indicated by arrows) are clearly visible in the bottom panel. [Figure 8] Figure 1 shows primary human dermal fibroblasts transfected with synthetic RNA containing 5-methyluridine and 5-hydroxymethylcytidine and encoding the indicated proteins. Forty-eight hours after transfection, cells were fixed and stained with antibodies targeting the indicated proteins. [Figure 9] Figure 1 shows primary human dermal fibroblasts transfected with synthetic RNA containing 5-methyluridine and 5-hydroxymethylcytidine and encoding human tyrosinase. 24 hours after transfection, cells were fixed and stained with an antibody targeting human tyrosinase. [Figure 10] 1 represents primary human epidermal melanocytes. [Figure 11]FIG. 1 depicts primary human dermal fibroblasts transfected with synthetic RNA containing 5-hydroxymethylcytidine and encoding the indicated proteins. [Figure 12] Primary human dermal fibroblasts were transfected daily with synthetic RNA containing 5-hydroxymethylcytidine and encoding human tyrosinase. The number of transfections is indicated above each sample. Cells were imaged 48 hours after the final transfection. [Figure 13] Figure 1 depicts primary human dermal fibroblasts transfected daily with synthetic RNA encoding human tyrosinase, containing the indicated nucleotides. Cells were imaged 48 hours after transfection. [Figure 14] Figure 1 shows IFNB1 expression and pigment production in primary human dermal fibroblasts transfected with synthetic RNA containing the indicated nucleotides and encoding human tyrosinase. Values ​​are normalized to samples transfected with synthetic RNA containing only standard nucleotides ("A, G, U, C"). GAPDH was used as a loading control. Error bars show standard error (n=2). [Figure 15] Expression of the indicated genes measured as in FIG. 14 is presented. [Figure 16] 1 shows an area of ​​the ventral forearm of a healthy 33-year-old male subject treated with synthetic DNA containing 5-methyluridine and 5-hydroxymethylcytidine and encoding human tyrosinase (top panel), as well as an ephedra of the ventral forearm of the same subject (bottom panel). The same magnification was used for both images. [Figure 17] Primary human dermal fibroblasts transfected with synthetic RNA containing 5-hydroxymethylcytidine and encoding collagen I (A1) ("+COL1 RNA"). 24-72 hours after transfection, cells were fixed and stained with an antibody targeting collagen I. Two representative fields for each of transfected and non-transfected cells ("negative control") are shown. Arrows indicate extracellular deposits of collagen I. [Figure 18] Primary human dermal fibroblasts transfected with synthetic RNA containing 5-hydroxymethylcytidine and encoding collagen VII (A1) ("+COL7 RNA"). 24-72 hours after transfection, cells were fixed and stained with an antibody targeting collagen I. Representative ranges for transfected and non-transfected cells ("negative control") are shown. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0019] definition "Molecule" means a molecular entity (molecule, ion, complex, etc.).

[0020] By "RNA molecule" is meant a molecule that contains RNA.

[0021] "Synthetic RNA molecules" are RNA molecules that are generated outside of a cell or that are produced within a cell using biotechnology. RNA molecules that are produced by in vitro transcription reactions, including but not limited to RNA molecules produced by direct transcription reactions, RNA molecules produced chemically or in engineered E. coli cells. This refers to the NA molecule.

[0022] "Transfection" means contacting a molecule with a cell, so that the molecule is absorbed by the cell. It is internalized.

[0023] "At the time of transfection" means during or after transfection. It means after the sion.

[0024] A "transfection agent" is a molecule that binds to and mediates the delivery of the molecule to a cell and / or A substance or mixture of substances, such as, but not limited to, cationic surfactants, that facilitates internalization of the molecule. By this term is meant an ionic lipid, a charged polymer, or a cell-penetrating peptide.

[0025] "Reagent-based transfection" refers to transfection using a transfection reagent. It means sfection.

[0026] "Cell culture medium" refers to any medium used in vitro or in vivo. Media that can be used for cell culture include, but are not limited to, Dulbecco's Modified Eagle Medium. medium (DMEM), or DMEM + 10% fetal bovine serum (FBS).

[0027] The "complex formation medium" is a medium containing a transfection reagent and a compound to be transfected. The molecule to be transfected is added, and the transfection reagent is added. The term "media" refers to a medium that binds to a molecule that is a target of proliferation.

[0028] "Transfection medium" refers to a medium used in vitro or in vivo. Media that can be used for transfection, regardless of whether they are , Dulbecco's modified Eagle's medium (DMEM), DMEM / F12, saline, or water means.

[0029] "Recombinant protein" means a protein or peptide that is not produced in animals or humans. Non-limiting examples include human transferrin produced in bacteria, mouse cell insulin, and the like. Human fibronectin produced in vitro and human serum albumin produced in rice Examples include:

[0030] "Lipid carriers" can increase the solubility of lipids or lipophilic molecules in aqueous solutions. Substances, non-limiting examples of which include human serum albumin and methyl-β-cyclodextrin. Taste.

[0031] "Oct4 protein" refers to the protein encoded by the POU5F1 gene, The natural or engineered variants, family members, orthologs ue), fragments or fusion constructs, including, but not limited to, the human Oct4 protein ( SEQ ID NO: 8), mouse Oct4 protein, Oct1 protein, POU5F1 pseudogene 2, the DNA binding domain of Oct4 protein, or O ct4-GFP fusion protein. In some embodiments, Oct4 protein comprises an amino acid sequence having at least 70% identity to SEQ ID NO: 8, or In embodiments, the amino acid sequence of SEQ ID NO:8 is at least 75%, 80%, 85%, 90%, or 95% In some embodiments, the Oct4 protein comprises an amino acid sequence having an identity of: An amino acid sequence having 1 to 20 amino acid insertions, deletions, or substitutions (in total) relative to SEQ ID NO:8. Alternatively, in another embodiment, the Oct4 protein comprises the amino acid sequence of SEQ ID NO:8. 1-15 or 1-10 amino acid insertions, deletions, or substitutions (total) Contains the amino acid sequence.

[0032] "Sox2 protein" refers to a protein encoded by the SOX2 gene, or Natural or engineered variants, family members, orthologs, fragments or Fusion constructs, including but not limited to human Sox2 protein (SEQ ID NO: 9), mouse Sox2 protein, the DNA-binding domain of the Sox2 protein, or a Sox2-GFP fusion tag. In some embodiments, the Sox2 protein has at least one sequence similar to SEQ ID NO:9. or in another embodiment, comprises an amino acid sequence having at least 70% identity to SEQ ID NO: No. 9. In some embodiments, the Sox2 protein comprises the amino acid sequence of SEQ ID NO:9. It includes amino acid sequences having 1 to 20 amino acid insertions, deletions, or substitutions in total. In another embodiment, the Sox2 protein has 1 to 2 amino acids (in total) identical to SEQ ID NO: 9. These include amino acid sequences having insertions, deletions, or substitutions of 15 or 1 to 10 amino acids.

[0033] "Klf4 protein" refers to a protein encoded by the KLF4 gene, or Natural or engineered variants, family members, orthologs, fragments or Fusion constructs, including but not limited to, human Klf4 protein (SEQ ID NO: 10), mouse Klf 4 protein, the DNA-binding domain of the Klf4 protein, or a Klf4-GFP fusion In some embodiments, the Klf4 protein has the sequence set forth in SEQ ID NO: 10. or, in another embodiment, a sequence having at least 70% identity to the amino acid sequence of Has at least 75%, 80%, 85%, 90%, or 95% identity to sequence number 10 In some embodiments, the Klf4 protein comprises an amino acid sequence set forth in SEQ ID NO: 10. An amino acid sequence having 1 to 20 amino acid insertions, deletions, or substitutions (total) Alternatively, in other embodiments, the Klf4 protein comprises a sequence similar to SEQ ID NO: 10 (complete Amino acid sequences having insertions, deletions, or substitutions of 1 to 15 or 1 to 10 amino acids in the whole Contains columns.

[0034] "c-Myc protein" refers to the protein encoded by the MYC gene, or Natural or engineered variants, family members, orthologs, fragments or Fusion constructs, including but not limited to, human c-Myc protein (SEQ ID NO: 11), mouse c- Myc protein, l-Myc protein, c-Myc(T58A) protein, cM The DNA binding domain of the yc protein or the c-Myc-GFP fusion protein In some embodiments, the c-Myc protein has at least 7 sequences identical to SEQ ID NO:11. 100% identical to SEQ ID NO: 11, or in another embodiment, Amino acid sequences with at least 75%, 80%, 85%, 90%, or 95% identity In some embodiments, the c-Myc protein comprises a sequence similar to SEQ ID NO: 11 (complete or an amino acid sequence having 1 to 20 amino acid insertions, deletions, or substitutions (in whole or in part); In another embodiment, the c-Myc protein is 1 to 1 (total) to SEQ ID NO: 11. This includes amino acid sequences having 5 or 1-10 amino acid insertions, deletions, or substitutions.

[0035] "Reprogramming" refers to causing a change in the phenotype of a cell, including, but not limited to, Differentiation of β cell progenitors into mature β cells, dedifferentiation of fibroblasts into pluripotent stem cells Transdifferentiation of cardiac stem cells and keratinocytes; lengthening telomeres of cells This means growing the axons of the neurons.

[0036] "Reprogramming factors" refer to molecules that are contacted with cells and / or that cause cells to express molecules. When combined with other molecules, either alone or in combination with other molecules, they induce reprogramming. By "cell-selective cleavage" is meant a molecule capable of cleaving a cellular signal, a non-limiting example being the Oct4 protein.

[0037] "Feeders" are cells that are used to condition or otherwise support the culture of other cells. It refers to cells that can be used to support growth.

[0038] "Conditioning" refers to contacting the medium with one or more feeders.

[0039] "Fatty acid" refers to a molecule that contains an aliphatic chain of at least two carbon atoms, such as, but not limited to, linoleic acid. oleic acid, α-linolenic acid, octanoic acid, leukotrienes, prostaglandins, cholesterol role, glucocorticoids, resolvins, protectins, thromboxanes, lipoxins , maresin, sphingolipid, tryptophan, N-acetylglucosamine By "ptophan" is meant a compound, such as a phenylalanine, ...

[0040] "Short chain fatty acid" means a fatty acid containing a fatty chain of from 2 to 30 carbon atoms.

[0041] "Albumin" refers to a highly water-soluble protein, such as, but not limited to, human serum albumin. This means

[0042] "Binding molecule" means a molecule that non-covalently binds to another molecule.

[0043] An "albumin binding molecule component" refers to one or more molecules that bind to an albumin polypeptide. Molecules, including but not limited to, lipids, hormones, cholesterol, rolls, calcium ions, etc.

[0044] "Processed albumin" refers to albumin that has had its binding molecular components reduced, removed, replaced, or otherwise altered. or albumin that has been otherwise treated to inactivate it, including, but not limited to, high temperature Human serum albumin incubated with sodium octanoate, human serum in contact with sodium octanoate It means albumin or human serum albumin in contact with the porous material.

[0045] An "ion exchange resin" is a type of resin that, when in contact with a solution containing ions, converts one or more different ions into A material capable of exchanging one or more of the ions with the ions can be, for example, A substance that can exchange one or more sodium ions for one or more calcium ions. It means.

[0046] "Germ cell" means a sperm cell or an egg cell.

[0047] "Pluripotent stem cells" are cells that can give rise in vivo to all three germ layers (endoderm, mesoderm, and ectoderm). The term "cells" refers to cells that can differentiate into cells of the above type.

[0048] "Somatic cells" refer to cells that are not pluripotent stem cells or germ cells, such as, but not limited to, skin cells. It means.

[0049] When "glucose-responsive insulin-producing cells" are exposed to a certain concentration of glucose, The insulin produced and / or secreted by cells when exposed to different concentrations of glucose is produce and / or secrete amounts of insulin that differ (either less than or greater than) By "cells" is meant cells capable of reprogramming, such as, but not limited to, beta cells.

[0050] "Hematopoietic cells" include, but are not limited to, blood cells or cells capable of differentiating into blood cells. By this we mean hematopoietic stem cells or white blood cells.

[0051] "Cardiac cells" include, but are not limited to, cardiac cells or cells that can differentiate into cardiac cells. By this term is meant cardiac stem cells or cardiac cells.

[0052] "Retinal cells" include, but are not limited to, retinal cells or cells that can differentiate into retinal cells. By this we mean retinal pigment epithelial cells.

[0053] "Skin cells" refer to cells normally found in the skin, including, but not limited to, fibroblasts, keratinocytes, and the like. This means tumour cells, melanocytes, adipocytes, mesenchymal stem cells, adipose stem cells or blood cells. do.

[0054] A "Wnt signaling agonist" refers to an antagonist or antagonists of one or more members of the Wnt family of proteins. Molecules capable of performing one or more of the biological functions of the members of the , Wnt2, Wnt3, Wnt3a, or 2-amino-4-[3,4-(methylenediamine)

[0036] 5-(3-methoxyphenyl)pyrimidine means [6-(3-methoxyphenyl)pyrimidine].

[0055] "IL-6 signaling agonist" refers to a biological function of the IL-6 protein. Molecules capable of one or more of the following, including but not limited to, IL-6 protein or IL-6 Receptor (also known as soluble IL-6 receptor, IL-6R, IL-6Rα, etc.).

[0056] "TGF-β signaling agonists" are members of the TGF-β superfamily of proteins. Molecules capable of performing one or more of the biological functions of one or more of the members of the Examples include TGF-β1, TGF-β3, activin A, BMP-4, or Nodal. means.

[0057] An "immunosuppressant" is an agent capable of suppressing one or more aspects of the immune system and which is capable of inhibiting an immune response normally present in a mammal. By "absent" is meant substances that are not present, such as, but not limited to, B18R or dexamethasone.

[0058] A "single-strand break" is a break in one or more of the covalent bonds that link the nucleotides. refers to a region of single- or double-stranded DNA that is broken in one of the two strands .

[0059] A "double-strand break" is a break in one or more of the covalent bonds that connect the nucleotides of a double strand. Each refers to a region of double-stranded DNA that has been cut.

[0060] "Nucleotide" refers to a nucleotide or a fragment or derivative thereof, including but not limited to By way of example, it refers to nucleic acid bases, nucleosides, nucleotide triphosphates, and the like.

[0061] "Nucleoside" refers to a nucleotide or fragment or derivative thereof, including but not limited to By way of example, it refers to nucleic acid bases, nucleosides, nucleotide triphosphates, and the like.

[0062] "Gene editing" refers to modifying the DNA sequence of a cell, including, but not limited to, This is a protein that induces mutations in cells by transfecting them. Taste.

[0063] A "gene editing protein" refers to a molecule that is capable of modifying a gene, either alone or in combination with one or more other molecules. Proteins that can modify the DNA sequence of a cell, such as, but not limited to, nucleic acids nucleases, transcription activator-like effector nucleases (TALENs), zinc finger nucleases Nucleases, meganucleases, nickases, regularly spaced clusters Clustered regularly interspaced short palindromic repeats Critical hort palindromic repeat (CRISPR) binding proteins, or a naturally occurring or engineered variant, family member, ortholog, or fragment thereof Or it means a fusion structure.

[0064] The "repair template" is within 10 kb of the target site for the gene-editing protein By this is meant a nucleic acid containing a region having at least about 70% homology with a sequence.

[0065] A "repeated sequence" is a repeat sequence that occurs in two or more repeats in a protein within a range of at least about 10% homology. Amino acid sequences present in the copy, including, but not limited to, those of transcription activator-like effectors It stands for monomer repeat.

[0066] A "DNA binding domain" refers to a region of a molecule that is capable of binding to a DNA molecule, including but not limited to, Examples include a protein domain that contains one or more zinc fingers, one or more transcriptional activities, Protein domains containing agonist-like (TAL) effector repeats, or DNA molecules The term "binding pocket" refers to a small molecule binding pocket that can bind to a target protein.

[0067] "Binding sites" include gene editing proteins, DNA binding proteins, and DNA binding domains. or a biologically active fragment or variant thereof. A suitable nucleic acid sequence, or a gene editing protein, a DNA binding protein, a DNA binding domain or a biologically active fragment or variant thereof has a high affinity A sequence, as a non-limiting example, is approximately 20 bases of DNA in exon 1 of the human BIRC5 gene. It means paired sequence.

[0068] "Target" means a nucleic acid containing a binding site.

[0069] Other definitions are found in U.S. patent application Ser. No. 10 / 299,333, the contents of which are incorporated herein by reference in their entirety. 3 / 465,490, U.S. Provisional Patent Application No. 61 / 664,494, U.S. Provisional Patent Application No. 1 / 721,302, International Patent Application No. PCT / US12 / 67966, U.S. Provisional Patent No. Application No. 61 / 785,404, U.S. Provisional Patent Application No. 61 / 842,874, International Patent Application No. No. PCT / US13 / 68118, U.S. Provisional Patent Application No. 61 / 934,397, U.S. Patent No. No. 14 / 296,220, U.S. Provisional Patent Application No. 62 / 038,608, and U.S. Described in Provisional Patent Application No. 62 / 069,667.

[0070] Glycosylation is the process by which one or more sugar molecules are attached to a protein. By altering the number or location of glycosylation sites, protein stability can be improved. It has now been discovered that certain Certain embodiments relate to proteins having one or more glycosylation sites. In one embodiment, the protein is more glycosylated or glycosylated than a naturally occurring variant of the protein. In another embodiment, the protein is engineered to have a silylating site. It is engineered to have fewer glycosylation sites than the naturally occurring variant. In another embodiment, the protein has increased stability. The protein has reduced stability.

[0071] The transfection medium may contain one or more steroids and / or one or more antioxidants. In certain circumstances, in vivo transfection efficiency, in vivo reprogramming, etc. It has further been discovered that the efficiency of in vivo gene editing and the efficiency of in vivo gene editing can be increased. Thus, certain embodiments include hydrocortisone, prednisone, Glucocorticoids such as diazepam, methylprednisolone, dexamethasone, or betamethasone Other embodiments involve contacting a cell or a patient with a steroid. and contacting the cells with one or more nucleic acid molecules. The present invention relates to a method for inducing cells to express a protein of interest by In an embodiment, the nucleic acid molecule comprises synthetic RNA. In yet another embodiment, hydrocortisone is from about 0.1 μM to about The medium is present at a concentration of about 10 μM, or about 1 μM. Other embodiments include a medium containing an antioxidant. and contacting the cells in vivo with one or more nucleic acid molecules. The present invention relates to a method for inducing cells to express a protein of interest by inducing In one embodiment, the antioxidant is ascorbic acid or ascorbic acid-2-phosphate. In another embodiment, the ascorbic acid or ascorbic acid-2-phosphate is about 5 It is present in the medium at a concentration of about 0.5 mg / L to about 500 mg / L, including 0 mg / L. Another embodiment involves contacting the cells with a medium containing a steroid and / or an antioxidant. and by contacting the cells with one or more nucleic acid molecules. The present invention relates to a method for reprogramming and / or gene editing a cell, the method comprising the steps of: The vector encodes one or more reprogramming and / or gene editing proteins. In certain embodiments, the cell is present in a living organism and the steroid and / or antioxidant is / are administered to the living organism. is delivered to the body.

[0072] Addition of transferrin to the complex formation medium may promote proteolysis in certain circumstances. It has been reported that it increases the efficiency of plasmid transfection. Addition of transferrin to the culture medium allowed in vivo transfer of synthetic RNA molecules. It has now been discovered that the efficiency of the reaction can be increased in a similar manner. In certain embodiments, one or more synthetic RNAs are added to a solution containing transferrin. Add molecules and transfection reagents to express the protein of interest In one embodiment, the present invention relates to a method for inducing cells in vivo to The amine is present in the solution at a concentration of from about 1 mg / L to about 100 mg / L, such as about 5 mg / L. In another embodiment, the transferrin is recombinant.

[0073] For example, the stratum corneum, which can function as a barrier against foreign organisms and nucleic acids. Cells, tissues, organs, and living organisms, including but not limited to humans, may inhibit or inhibit delivery of nucleic acids. These features are therefore: Many of these characteristics are due to the flexible membrane and This can be avoided or overcome by using a patch with multiple needles, and Such patches can serve as effective and safe articles for the delivery of nucleic acids. It has now been discovered that certain embodiments relate to nucleic acid delivery patches. In one embodiment, the nucleic acid delivery patch comprises a flexible membrane. In yet another embodiment, the delivery patch comprises a plurality of needles attached to a flexible membrane. In some embodiments, the patch comprises a nucleic acid. In one embodiment, the nucleic acid is In one embodiment, the plurality of needles includes one or more needles having a lumen. In one embodiment, the patch further comprises a second flexible membrane. The soft membrane and the second flexible membrane are arranged to form a cavity. In yet another embodiment, the membrane is capable of allowing the passage of nucleic acid. In yet another embodiment, a single tubular member having one or more holes and a lumen is provided. The needle may include one or more needles having a lumen and extending through at least one of the one or more holes. The needles are arranged to allow the passage of a solution containing nucleic acid through at least one of the needles. In some embodiments, the patch is configured to deliver a solution to the skin. In one embodiment, the solution comprises a nucleic acid. In another embodiment, the solution comprises a vehicle. In yet another embodiment, the vehicle is a lipid or lipidoid. In yet another embodiment, the vehicle is a lipid-based transfection reagent.

[0074] The cell membrane can function as a barrier to foreign nucleic acids. It has now been discovered that the efficiency of nucleic acid delivery can be increased by combining Therefore, certain embodiments have been proposed in which at least two pins are connected to the high voltage circuit. In one embodiment, the high voltage circuit In another embodiment, the high voltage circuit generates a voltage greater than about 20 V. In yet another embodiment, the electric field is generated between two needles. In yet another embodiment, the magnitude of the electric field is at least about 100 V / cm. In embodiments, the magnitude of the electric field is at least about 200 V / cm. In another embodiment, the patch is configured to deliver the nucleic acid to the epidermis. In yet another embodiment, the patch is configured to deliver nucleic acid to the subcutaneous tissue. In yet another embodiment, the patch is configured to deliver nucleic acid to muscle. Certain embodiments are configured to deliver nucleic acid to a patient using a nucleic acid delivery pack that includes multiple electrodes. In one embodiment, the plurality of electrodes is attached to a flexible membrane. The present invention relates to a nucleic acid delivery patch comprising a rigid structure. In one embodiment, the plurality of electrodes comprises a rigid structure. It is attached to the structure.

[0075] Other embodiments include in vivo methods, which involve applying the nucleic acid to tissue containing cells in vivo. In one embodiment, the method further comprises: In another embodiment, the method includes applying a transient electric field near an internalizing nucleic acid. In yet another embodiment, the nucleic acid comprises synthetic RNA. In some embodiments, the method further comprises producing a cell that internalizes a therapeutically or cosmetically effective amount of the nucleic acid. In one embodiment, the cell is a skin cell. In another embodiment, the cell is a muscle cell. In yet another embodiment, the cells are dermal fibroblasts. In one embodiment, the cells are keratinocytes. In yet another embodiment, the cells are myoblasts. In some embodiments, the nucleic acid comprises a protein of interest. In another embodiment, the protein of interest is a fluorescent protein. In yet another embodiment, the protein of interest is elastin, collagen. lysyl oxidase, laminin, fibronectin, vitronectin, elastin Binding protein, growth factor, fibroblast growth factor, transforming growth factor β, Granulocyte colony-stimulating factor, matrix metalloproteinase, actin, fibrillin, Microfibril-associated glycoprotein, lysyl oxidase-like protein, platelet-derived growth factor Factors, lipases, uncoupling proteins, thermogenins, and proteins involved in pigment production In some embodiments, the method further comprises delivering the nucleic acid to the epidermis. In other embodiments, the method further comprises delivering the nucleic acid to the dermis. In an embodiment, the method further comprises delivering the nucleic acid to the dermis. In another embodiment, delivery is by injection using a microneedle array. In yet another embodiment, delivery is by topical administration. In a further embodiment, delivery is by In yet another embodiment, the delivery includes disruption or removal of a portion of the tissue. In some embodiments, the nucleic acid is in solution. In another embodiment, the solution comprises a growth factor. In yet another embodiment, the growth factor is a member of the group of rehoming growth factors. It is a member of the basic fibroblast growth factor and transforming growth factor β family. In the form, the solution comprises cholesterol.

[0076] In another embodiment, the method further comprises contacting the cell with one or more nucleic acid molecules. In yet another embodiment, at least one of the one or more nucleic acid molecules is In a further embodiment, the method comprises causing the cell to express a protein of interest. In yet another embodiment, the method comprises administering a therapeutically or cosmetically effective amount of a target tan. This results in cells expressing the protein.

[0077] In another embodiment, the cell is contacted with a nucleic acid molecule. In a further embodiment, the method results in a cell that internalizes the nucleic acid molecule. In one embodiment, the nucleic acid is a nucleic acid molecule of interest. In one embodiment, the nucleic acid molecule encodes a dsDNA molecule, a ssDNA molecule, dsRNA molecules, ssRNA molecules, plasmids, oligonucleotides, synthetic RNA molecules, Includes members of the classes of miRNA molecules, mRNA molecules and siRNA molecules.

[0078] Synthetic RNA containing only standard nucleotides can bind to pattern recognition receptors , which can recognize pathogen-associated molecular patterns, translation blockade, and the expression of proinflammatory cytokines. Inducing a strong immune response in cells that can lead to secretion and cell death Synthetic RNA containing certain non-standard nucleotides can be detected by the innate immune system. It has now been discovered that the process can be avoided and the product can be translated into protein with high efficiency. At least one of 5-hydroxycytidine, 5-hydroxymethylcytidine , 5-carboxycytidine, 5-formylcytidine, 5-hydroxyuridine, 5-hydrocytidine A member of the group of 5-hydroxymethyluridine, 5-carboxyuridine, and 5-formyluridine Synthetic RNA containing α-aminobutyric acid can evade detection by the innate immune system and is highly effective at targeting proteins. It has further been discovered that the translation can be performed at a rate of 100%. The method involves contacting cells with synthetic RNA to express a protein of interest. Other embodiments relate to methods for inducing cells comprising one or more synthetic RNA molecules. contacting the cells with a solution to transfect the cells with the synthetic RNA. Yet another embodiment relates to a method for treating a patient comprising administering synthetic RNA to the patient. In one embodiment, the synthetic RNA is 5-hydroxycytidine. cytidine, 5-hydroxymethylcytidine, 5-carboxycytidine, 5-formylcytidine, 5-Hydroxyuridine, 5-Hydroxymethyluridine, 5-Carboxyuridine, and and 5-formyluridine. In another embodiment, The synthetic RNA encodes a protein of interest. Representative RNAs include any of the RNAs described herein. As described elsewhere herein, including with respect to expression of any protein of interest. It may contain combinations and levels of standard and non-standard nucleotides. In one embodiment, the method results in expression of a protein of interest. In a further embodiment, the method comprises: This results in expression of the protein of interest in the patient's skin.

[0079] Exposure of cells to steroids suppresses the innate immune response to foreign nucleic acids. It has now been further discovered that it is possible to increase the efficiency of nucleic acid delivery and translation. Accordingly, certain embodiments involve contacting cells with a steroid. In another embodiment, the patient is administered a steroid. In one embodiment, the steroid is hydrocortisone. In another embodiment, the steroid is dexamethasone. Yet another embodiment is a compound selected from the group consisting of antibiotics, antifungals, and RNAse inhibitors. to a patient.

[0080] Other embodiments relate to methods for delivering nucleic acids to cells in vivo. The embodiments relate to methods for inducing cells in vivo to express a protein of interest. Yet another embodiment relates to a method for treating a patient. In one embodiment, the method In another embodiment, the method includes contacting a cell with a nucleic acid. In yet another embodiment, the method results in the cell internalizing the nucleic acid. In further embodiments, the method results in the cell expressing a protein of interest. In another embodiment, the method results in expression of a protein of interest in the patient. In embodiments, the method results in an improvement in one or more of the patient's symptoms. In one embodiment, the patient is in need of the protein of interest. , the target protein is missing.

[0081] Yet another embodiment is a method for treating a patient comprising delivering the composition to the patient. In one embodiment, the composition comprises an albumin treated with an ion exchange resin or activated carbon. In another embodiment, the composition comprises one or more nucleic acid molecules. In one embodiment, at least one of the one or more nucleic acid molecules encodes a protein of interest. In one embodiment, the method results in expression of a protein in the skin of the patient. In one embodiment, the method includes expressing a therapeutically or cosmetically effective amount of a protein of interest in a patient. In yet another embodiment, the method includes administering a steroid. In an embodiment, the steroid is a member of the group: hydrocortisone and dexamethasone.

[0082] Certain embodiments relate to synthetic RNA molecules. In one embodiment, the synthetic RNA molecule is , encoding a protein of interest. Cytidine, 5-hydroxymethylcytidine, 5-carboxycytidine, 5-formylcytidine uridine, 5-hydroxyuridine, 5-hydroxymethyluridine, 5-carboxyuridine Other embodiments relate to cosmetic compositions. In one embodiment, the cosmetic composition comprises albumin. In yet another embodiment, the cosmetic composition is treated with an ion exchange resin or activated carbon. In a further embodiment, the cosmetic composition comprises albumin and a nucleic acid molecule. Yet another embodiment includes an apparatus configured to deliver a composition to a patient. In yet another embodiment, the present invention relates to a cosmetic treatment article comprising a cosmetic composition contained in In one embodiment, the nucleic acid molecule is , elastin, collagen, tyrosinase, melanocortin 1 receptor, and hyaluronic acid It encodes a member of a family of synthetic enzymes.

[0083] Certain proteins have long half-lives, lasting for hours, days, weeks, months, or Can persist in tissues for years, e.g., contain one or more beneficial proteins Certain methods of treating a patient may result in the accumulation of one or more proteins. It has now been discovered that certain embodiments may be capable of detecting one or more tamper The method includes delivering a series of doses of a nucleic acid encoding a protein to a patient. In one embodiment, the nucleic acid comprises synthetic RNA. In yet another embodiment, the first dose is given at a first time point. In a further embodiment, one or more of the following are given in the patient at the second time point: The amount of at least one of the proteins is greater than the amount of said protein at the first time point. In yet another embodiment, the method results in accumulation of said protein in the patient.

[0084] Other embodiments relate to therapeutic compositions comprising nucleic acid molecules encoding one or more proteins. and at least one of the one or more proteins is an extracellular matrix protein. Yet another embodiment is a cosmetic composition comprising a nucleic acid molecule encoding one or more proteins. and wherein at least one of the one or more proteins is an extracellular matrix protein. It is of high quality.

[0085] Pigmentation disorders can cause severe symptoms in patients. and that the disease can be treated by delivering a nucleic acid encoding tyrosinase to a patient. It has now been discovered that certain embodiments of the invention provide a method for treating pigmentation disorders. Other embodiments relate to methods for altering pigmentation in a patient. In one embodiment, the method comprises delivering to the patient a nucleic acid encoding tyrosinase. Other embodiments relate to cosmetic compositions that include a nucleic acid encoding tyrosinase. The embodiments relate to therapeutic compositions comprising a nucleic acid encoding tyrosinase. The embodiments relate to a method for increasing ultraviolet light absorption in the skin of a patient. In another embodiment, the method includes delivering to the patient a nucleic acid encoding tyrosinase. The method results in an increase in ultraviolet light absorption in the patient's skin. The present invention relates to a method for reducing photodamage to human skin upon exposure to ultraviolet radiation. In the present invention, the method results in a reduction in photodamage to human skin upon exposure to ultraviolet light. The embodiments relate to a method for treating xeroderma pigmentosum. In one embodiment, the method comprises administering In yet another embodiment, the method comprises delivering a nucleic acid encoding a rosinase to a patient. In one embodiment, the method comprises administering type VII collagen to a subject. In another embodiment, the method comprises delivering to the patient a nucleic acid encoding a melanocorticoid. In yet another embodiment, the method includes delivering a nucleic acid encoding the IL-1 receptor to a patient. In one embodiment, the method comprises administering to the patient a hyaluronic acid synthase. In another embodiment, the patient is a patient with atopic dermatitis. In yet another embodiment, the patient has been diagnosed with ichthyosis. Certain embodiments relate to methods for treating cosmetic conditions. Other embodiments relate to methods for treating tissue healing. In one embodiment, the method comprises administering to a subject a hyaluronic acid synthase. In another embodiment, the cosmetic condition is wrinkles, In yet another embodiment, the patient is a member of the group consisting of loose skin, thin skin, discoloration, and dry skin. The subject has undergone cataract surgery. In some embodiments, the nucleic acid is synthetic RNA. In embodiments, the method results in amelioration of one or more of the patient's symptoms. by delivering a nucleic acid encoding a protein or peptide to a cell or patient, Still other embodiments relate to methods for treating an indication, including the use of a protein or peptide. The present invention also relates to compositions comprising nucleic acids encoding the Indications and Proteins and Peptides That Can Be Encoded by the Compositions of the Invention are set forth in Table 1 and are provided for illustration and not for limitation. In another embodiment, the disease is selected from Table 1. In yet another embodiment, the indication and / or the protein or peptide is selected from: In a further embodiment, the protein of interest is selected from the same row of Table 1. CP2, and UCP3. Another embodiment expresses multiple proteins of interest. In one embodiment, the protein of interest is At least two members of the group of lipases, UCP1, UCP2, and UCP3 In another embodiment, the protein of interest comprises lipase as well as UCP1, UCP2, and UCP3. In another embodiment, the protein is a gene editing protein. In yet another embodiment, the gene editing protein is at least partially In yet another embodiment, the gene editing protein targets a gene that is responsible for the phenotype of the The protein targets a gene encoding a protein selected from Table 1. In embodiments, the gene editing protein is a gene that modifies a mutation that is at least partially responsible for a disease phenotype. The mutations may be expressed either alone or in combination with one or more other molecules or gene editing proteins. Modify or delete it.

[0086] [Table 1] [Table 2]

[0087] Additional exemplary objects of the present invention include, but are not limited to, the disclosures of which are incorporated herein by reference in their entirety. These include the cosmetic objects described in Table 6 of International Patent Publication No. WO2013 / 151671.

[0088] Additionally, the compositions and methods may, for example, reduce sagging skin and increase skin thickness. Increases skin volume and reduces the number, length and / or depth of wrinkles Increases skin firmness, tone, and / or elasticity, and promotes skin hydration and moisture retention Increases the ability to maintain moisture, water flow, and osmotic balance, and increases skin lipid levels modifying biological and / or physiological processes to enhance the function of the extracellular matrix and and / or increase adhesion and signaling polypeptides, enhancing skin's energy production, utilization, and conservation. Increases the immune system, improves oxygen availability, improves the lifespan of skin cells, and promotes skin cell immune defense and thermal Shock stress response, antioxidant defense capacity to neutralize free radicals, and / or toxic defense Improves control, improves protection and recovery from UV rays, and stimulates skin cell communication and nerves in skin cells improves cell adhesion / aggregation, and promotes calcium and other mineral metabolism It may be used to improve cell turnover and improve circadian rhythm of cells. stomach.

[0089] Furthermore, in some embodiments, the compositions are used to treat a disease, disorder, and / or condition. and / or for treating a disease, disorder, and / or condition. The present invention may alter, modify or change the appearance of members of the integumentary system of a subject, These diseases, disorders and / or conditions include acne vulgaris, summer acne, acne congenital, cosmetic acne ( acne cosmetic, acne fulminans, keloid acne dalis nuchae), mechanical acne, acne medication side effects, miliary acne gangrenosum (acn e miliaris necrotica), gangrenous acne, erythematous acne, actinic keratosis , Acne vulgaris, Summer acne, Acne cluster, Cosmetic acne, Acne fulminans, Keloid acne, Mechanical Acne, side effects of acne medication, acne miliaris necrosis tica), acne gangrenosa, acne erythematous, acute urticaria, allergic contact dermatitis, alopecia areata Acne, angioedema, tinea pedis, atopic dermatitis, autosensitization dermatitis, baby acne cne), balding, blastomycosis, Blackheads, birthmarks and other skin pigmentation problems, pimples, bruises, insect bites and stings, burns, bees Follicular rash, scrub mites, chloracne, cholinergic urticaria or stress urticaria (uricara) , chronic urticaria (urticara), cold type urticaria (cold type urticaria) ia(urticara)), confluent and r eticulated papillomatosis, corns, cysts, pityriasis capitis , herpetic dermatitis, dermatographia, dyshidrotic eczema, diaper rash, dry skin, dyshidrosis, hypohidrosis Hyprohidrotic ectodermal dysplasia lasia and X-linked hypohidrotic ectodermal dysplasia (hyprohidrotic e Ectodermal dysplasia, eczema, verrucous epidermis Epidermaodysplasia, erythema nodosum, exfoliative acne, exercise induced Anaphylaxis, folliculitis, excess sebum hair densi ty), hair growth rate, halogen acne gen acne), alopecia, miliaria, hematoma, herpes simplex infections (e.g. non-genital), Hidradenitis suppurativa, urticarial papules, hyperhidrosis, hyperpigmentation, hypohidrotic ectodermal dysplasia, pigment Hernia, impetigo, ingrown hairs, heat type urticaria urticara), ingrown nails, childhood or neonatal acne, pruritus, irritant contact dermatitis, Jock itch, keloid, keratosis pilaris, lichen planus, lichen sclerosus, miliary wolves disseminated facially Blisters, melasma, lentigines, molluscum contagiosum, nail growth rate, nail Nail health, neurodermatitis, nummular eczema, occupational acne, oily acne , Onychomycosis, Physical urticaria (urticara), Pilonidal cyst, Pityriasis rosea, Tinea versicolor , poison ivy rash, pomade acne, pseudofolliculitis folliculitis barbae) or acne keloids on the back of the neck, psoriasis, psoriatic joints Inflammation, pressure or delayed pressure urticaria ssue urticaria (urticara), stings such as cuts and abrasions, Rare or water type urticaria ria(urticara), rhinoplasty, tinea, rosacea, Rothmund-Thomson syndrome, Sagging skin, scabies, scarring, seborrhea, seborrheic dermatitis, shingles, skin cancer , skin tag, solar type urticari a) (urticara), spider bites, stretch marks, sunburn, tar acne, tropical acne, skin skin thinning, acne scars, tinea versicolor, transient acantholytic dermatosis, acne necrosis (tycoon's c ap) or miliary acne, uneven skin tone, varicose veins , venous eczema, angioedema, vitiligo, warts, Weber's Christian's disease, wrinkles, X-linked hypohidrotic ectodermal dysplasia, dry eczema, yeast infections , as well as general signs of aging.

[0090] In some embodiments, methods of treating dry skin with the compositions are provided. In terms of morphology, profilaggrin (protein converted to filaggrin) is the target protein. quality (e.g., when treating ichthyosis vulgaris).

[0091] In some embodiments, the various types of psoriasis (e.g., plaque psoriasis, guttate psoriasis, pustular psoriasis, Any of the following: psoriasis, inverse psoriasis, and erythrodermic psoriasis In various embodiments, the protein of interest is a psoriasis susceptibility inhibitor. Any product of genes 1 to 9 (PSORSI-PSORS9).

[0092] Various embodiments are directed to treating eczema (e.g., atopic dermatitis, nummular eczema, pityroid eczema, seborrhea, dermatitis, irritant contact dermatitis, allergic contact dermatitis, dyshidrosis, venous eczema, herpes For the treatment of skin rashes, skin rashes, neurodermatitis, autosensitization dermatitis and dry eczema, the following may be used as an option: Three gene variants associated with eczema: filaggrin, OVO-like 1 (OVOL1), and amyloidosis ACTL9, kinesin family member 3, and gene brain-derived neurotransmitter Targeting one or more of the following: trophic factor (BDNF) and tachykinin, precursor 1 (TAC1) It is also possible to use the following.

[0093] Acute urticaria, chronic urticaria (urticara) and angioedema, physical urticaria (urti cara), pressure urticaria or delayed pressure urticaria (urticara), cholinergic urticaria or Stress urticaria (uricara), cold urticaria (urticara), heat urticaria ( urticara), solar urticaria (urticara), rare urticaria or water urticaria (u rticara, vibration angioedema, exercise-induced anaphylaxis urticarial papules or urticaria, including but not limited to dermatographia, For example, treatment with the composition may be by targeting PLCG-2.

[0094] Various embodiments are directed to treating erythematotelangiectatic rosacea. ctatic (erthematotelangiectatic), papulopustular rosacea rhinophytic rosacea, phymatous rosacea, and ocular rosacea, but Optionally, cathelicidin antimicrobial peptides (CAMPs) and and / or kallikrein-related peptidase 5 (also known as corneal tryptic enzyme (SCTE)) , the target protein.

[0095] In some embodiments, methods of treating acne with the compositions are provided. For example, acne can be treated with , acne-like rash, summer acne, confluent acne, cosmetic acne, fulminant acne, keloid acne on the neck, mechanical Acne, side effects of acne medication, acne miliaris necrosis tica), acne gangrenosa, erythematous acne, infantile acne, blackheads, chloracne, exfoliative acne, haematitis Acne genitalis, childhood or neonatal acne, lupus miliaris disseminated facialis, occupational acne, oily acne , pomade acne, tar acne, tropical acne, tycoon's cap acne, or miliary gangrenous acne, pseudofolliculitis or keloid acne nuchalensis, and hidradenitis suppurativa. In these embodiments, the target protein may be, but is not limited to, one The above matrix metalloproteinases (MMPs), e.g., ase-1 (MMP-1 or interstitial collagenase), matrix metalloproteinase- 9 (MMP-9), and matrix metalloproteinase-13 (MMP-13). This is also fine.

[0096] In a further embodiment, vitiligo is caused by, for example, an NLR family, pyrin domain-containing 1 gene. The treatment is with the present composition, which targets the gene (NALP1).

[0097] In some embodiments, the composition comprises a compound that is capable of treating hypohidrosis ectodermal dysplasia. The compounds find use in the treatment of hyperemic and hypertensive disorders (HED).

[0098] In some embodiments, the compositions are used to treat hair loss or thinning (e.g., male pattern baldness or alopecia). androgenetic alopecia (AGA), and optionally, The AR, ectodysplasia A2 receptor (EDA2R), and lysophosphatidylserine receptor (LYS) are involved in The protein of interest may be one or more of the following: progesterone receptor 6 (P2RY5);

[0099] The compositions may further comprise, for example, collagen, ribosomal s6 kinase, secreted ctrected) phosphoprotein 1 (also known as osteopontin), or transforming The present invention finds use in methods for the treatment of scars and stretch marks with tumour growth factor beta 3.

[0100] In addition, epidermodysplasia verruciformis (also known as Lutz-Lewandowski epidermodysplasia) is a rare Oligoautosomal recessive inherited skin disorders, e.g., targeted transmembrane channels The gene encoding the recombinant human endothelial cell line EVER1 or EVER2 is used to express the recombinant human endothelial cell line EVER1. Treatment with a composition may also be used.

[0101] In some embodiments, sagging skin, thinning, or wrinkles can be prevented by, for example, collagen, Elastin, fibroblast growth factor 7, TIMP metallopeptidase inhibitors, matrix Metallopeptidases, superoxide dismutases, and other extracellular matrix proteins Target one or more proteins of interest, such as proteins and proteoglycans The patient may then be treated with the composition.

[0102] Further embodiments include, for example, melanocyte stimulating hormone and / or proopioid hormone. Used in nocortin-mediated skin tanning.

[0103] In some embodiments, the compositions may be used for wound treatment. In some embodiments, the method of treating a wound with the composition may include additional, e.g., debridement, sharp debridement ( surgical removal of dead or infected tissue from a wound) Chemical debridement agents, such as enzymes, to remove dead tissue and provide a moist, warm environment for the wound and wound dressings (e.g., hydrocortisone, hydrochloride, glycerol, terpenes, etc.) for the treatment of inflammatory bowel disorders and for promoting tissue repair and healing. Gel-containing wound dressings (e.g., AQUASORB®, DUODERM®, (trademark)), hydrocolloid-containing wound dressings (e.g., AQUACEL®, CO MFEEL®), foam-containing wound dressings (e.g., LYOFOAM®), (trademark), SPYROSORB®), and wound dressings containing alginates (e.g. , ALGISITE (registered trademark), CURASORB (registered trademark) Cleansing the wound bed to facilitate wound healing and closure, stimulating cell division and proliferation and the administration of growth factors, such as becaplermin, to promote wound healing. (i) a soft tissue wound dressing step; and (ii) a soft tissue wound dressing step. may be required to obtain adequate wound coverage (e.g., autologous skin grafts, cadaveric skin grafts). , bioengineered skin substitutes (e.g., APLIGRAF®, DERMAGRAFT®, Registered trademark))).

[0104] In various embodiments, various cancers (e.g., colorectal cancer, gallbladder cancer, lung cancer, pancreatic cancer, and gastric cancer) are treated with the Cancer) is treated with the composition. In some embodiments, skin cancer is treated with the composition. Examples are basal cell carcinoma (BCC), squamous cell carcinoma (SCC), and melanoma. In one embodiment, the compositions of the present invention are used for peripheral and deep margin assessment (CIR) cumferential peripheral and deep margin assessment), Mohs surgery, radiation (e.g., external beam radiation therapy or brachytherapy), radiation therapy), chemotherapy (e.g. topical chemotherapy with imiquimod or 5-fluorouracil therapy), as well as an adjunct to complete cryotherapy. The composition is further used as an adjuvant by the American Joint Committee on Cancer ( AJCC) TNM system stage (e.g., TX, T0, Tis, T1, T1a, T 1b, T2, T2A, T2B, T3, T3a, T3b, T4, T4a, T4b, NX, N 0, N1, N2, N3, M0, M1a, M1b, M1c) and / or ,Staging systems (e.g., Stage 0, Stage IA, Stage IB, Stage IIA, Stage IIB, Stage IIC, Stage IIIA, Stage IIIB, Stage Skin cancers (e.g., basal cell carcinoma (BCC), squamous cell carcinoma (SCCC), stage IIIC, stage IV) The present invention finds use in the treatment of various stages of cancer, including uterine cancer (SCC) and melanoma. .

[0105] In various embodiments, one or more rare diseases are treated with the compositions, illustrative examples include red blood cells, erythrocyte sedimentation syndrome (ERS), and rheumatoid arthritis. Hemopoietic protoporphyria, Hailey-Hailey disease, epidermolysis bullosa (EB), xerosporum pigmentosum Dermatomyositis, Ehlers-Danlos syndrome, Cutis laxa, Protein C & Protein S deficiency, LePort syndrome, striated palmoplantar keratoderma, lethal acantholytic EB, pseudoxanthoma elasticum (PXE) ), ichthyosis vulgaris, pemphigus vulgaris, and basal cell nevus syndrome.

[0106] In certain circumstances, one may consider that the non-animal-derived and / or recombinant components are not animal-derived. In part because it can be produced with a greater degree of consistency than its constituent parts, Non-animal-derived and / or recombinant components have lower toxicity and / or toxicity than animal-derived components. and non-animal-derived and / or recombinant components due to the risk of contamination with pathogenic substances. In some cases, it may be desirable to replace animal-derived components. The form relates to proteins that are non-animal derived and / or recombinant. Regarding media in which some or all of the components of the media are of non-animal origin and / or recombinant type do.

[0107] Other embodiments relate to methods for transfecting cells in vivo. In embodiments, cells in vivo are transfected with one or more nucleic acids to produce transfectants. Transfection is carried out using a transfection reagent such as a lipid-based transfection reagent. In one embodiment, the one or more nucleic acids comprise at least one RNA molecule. In another embodiment, the cells are transfected with one or more nucleic acids and The above nucleic acids are involved in the expression of p53, TERT, cytokines, secreted proteins, membrane-bound proteins, and enzymes. Enzymes, gene editing proteins, chromatin modifying proteins, DNA binding proteins, transcription factors Histone deacetylases, pathogen-associated molecular patterns, and tumor-associated antigens or Biologically active fragments, analogs, variants, or family members In another embodiment, the cells encode at least one of the following sequences: At least about 2 times in 0 days, or at least about 3 times in about 7 consecutive days, or The cells are transfected at least about four times over a period of about six days.

[0108] Reprogramming can be achieved by the addition of one or more nucleic acids encoding one or more reprogramming factors. This can be achieved by transfecting cells. Examples of the proteins include Oct4 protein, Sox2 protein, Klf4 protein, and c- Myc protein, I-Myc protein, TERT protein, Nanog protein , Lin28 protein, Utf1 protein, Aicda protein, miR200 MicroRNA, miR302 microRNA, miR367 microRNA, miR36 9 MicroRNAs, and Biologically Active Fragments, Analogs, Mutants, and Family members, but are not limited to these. The present invention relates to a method for reprogramming cells in vivo. The in vivo cells are transfected with one or more nucleic acids encoding one or more reprogramming factors. In one embodiment, the cells are reprogrammed by transfection with one or more The above nucleic acid comprises an RNA molecule encoding the Oct4 protein. The nucleic acids further include those encoding the Sox2 protein, the Klf4 protein, and the c-Myc protein. In yet another embodiment, the protein comprises one or more RNA molecules encoding the protein. The nucleic acid further comprises an RNA molecule encoding a Lin28 protein. The cells are human skin cells, and the human skin cells are reprogrammed into pluripotent stem cells. In another embodiment, the cell is a human skin cell, and the human skin cell is a glucose-responsive These cells are then reprogrammed into insulin-producing cells. Examples of cells and other cells that the cells can be reprogrammed include skin cells, Pluripotent stem cells, mesenchymal stem cells, beta cells, retinal pigment epithelial cells, hematopoietic cells, cardiac cells, airway These include epithelial cells, neural stem cells, nerve cells, glial cells, bone cells, blood cells, and dental pulp stem cells. In one embodiment, the cells are selected from the group consisting of, but not limited to, reprogrammed cells. In one embodiment, the medium further comprises a cell-supporting medium. .

[0109] Importantly, this is combined with culturing the cells in a medium that supports cardiomyocyte growth. To transduce skin cells with viruses encoding Oct4, Sox2, Klf4, and c-Myc, Without first reprogramming skin cells into pluripotent stem cells by infection It has been reported that it induces the reprogramming of skin cells into cardiomyocytes ( Efs et al. Nat Cell Biol. (See, e.g., 2011;13:215-22.) In certain circumstances, direct reprogramming may be used. Reprogramming (also known as "transdifferentiation"), a process that involves reprogramming somatic cells into pluripotent stem cells Reprogramming one somatic cell into another without the need for a second somatic cell is one Culturing pluripotent stem cells can be time-consuming and expensive, making it difficult to obtain stable The additional processing involved in establishing and characterizing pluripotent stem cells poses an increased risk of contamination. Additional time in culture associated with generating pluripotent stem cells may be required. It is believed that the gene expression profile of genomic instability and abrupt changes, including point mutations, copy number alterations, and karyotypic abnormalities, may be involved in the pathogenesis of genomic instability and abrupt changes in genomic DNA, including point mutations, copy number alterations, and karyotypic abnormalities. This may be desirable since it may entail an increased risk of acquiring mutations. Certain embodiments relate to methods for reprogramming somatic cells in vivo, The cells are reprogrammed into somatic cells and no characterized pluripotent stem cell lines are produced.

[0110] In certain circumstances, this method allows for less total transfection than according to other methods. What may be required to reprogram cells according to the methods of the invention It has further been discovered that, therefore, certain embodiments involve replicating cells in vivo. The method comprises the steps of: programming approximately 1 to approximately 12 consecutive transfections; Transfections were performed over a 20 day period, or about 4 to about 10 consecutive transfections over a 15 day period. or about 4 to about 8 transfections are performed over about 10 consecutive days. When cells are contacted with a medium containing nucleic acid molecules, the cells may undergo simultaneous or different The nucleic acid sequence of the present invention is a sequence that is generated by a nucleic acid ... It is recognized that the cells may be transformed into nucleic acid-containing medium. Even if only one contact is made, the cell may be contacted with the nucleic acid more than once, e.g., repeatedly. do.

[0111] Of note, nucleic acids may contain one or more non-standard or "modified" residues (e.g., Denine, guanine, thymine, uracil, and cytosine, or their standard nucleosides , a residue other than a nucleotide, a deoxynucleoside or a deoxynucleotide derivative Of particular note, pseudouridine-5'-triphosphate can contain Substitute uridine-5′-triphosphate in in vitro transcription reactions to obtain synthetic RNA At most 100% of the uridine residues in synthetic RNA are pseudouridine. residues may be exchanged for pseudouridine and 5-methylcytidine by in vitro transcription. Residual immunogenicity was observed even when the amino acids were completely replaced by uridine and cytidine, respectively. It is possible to obtain RNA having the formula , Angel.Reprogramming Human Somatic Cells to Pluripotency Using RNA Cambridge, MA:MIT; 2011). When transfecting cells with A, add immunosuppressants to the transfection medium. In certain circumstances, it is common to add immunosuppressants to the transfection medium. Addition of an agent is one of the most commonly used recombinant immunosuppressants for this purpose. The drug B18R may be undesirable because it can be expensive and difficult to manufacture. In vivo cells can be cultured according to the invention without the use of B18R or any other immunosuppressant. Can be transfected and / or reprogrammed according to the method It has now been discovered that in vivo immunosuppressant therapy can be achieved according to the methods of the present invention without the use of immunosuppressants. Reprogramming cells has the potential to be rapid, efficient, and reliable. It has further been discovered that, therefore, certain embodiments include Method for transfecting cells in vivo, in which the culture medium does not contain immunosuppressants Another embodiment relates to a method for transfection of a mammalian cell, the transfection medium being free of immunosuppressants. The present invention relates to methods for reprogramming cells in vivo. In certain circumstances, e.g. If high cell densities are used, immunosuppressants may be added to the transfection medium. Therefore, certain embodiments may be advantageous in that the transfection medium The present invention relates to a method for transfecting cells in vivo, the method comprising administering to the patient an immunosuppressant. Another embodiment is an in vivo cell transfection method in which the transfection medium contains an immunosuppressant. In one embodiment, the immunosuppressant is B18. R or a biologically active fragment, analog, variant, or family member thereof or dexamethasone or a derivative thereof. The application medium does not contain immunosuppressants and the nucleic acid dose was selected to prevent excessive toxicity. In another embodiment, the nucleic acid dose is administered per cm of tissue. 2 Approximately 1 mg per 100 cells, 000, or less than about 10 mg / kg.

[0112] The reprogrammed cells produced according to certain embodiments of the present invention include: Does not contain foreign DNA sequences and may be unclear, toxic and / or pathogenic contaminants The therapeutic and / or Moreover, the high speed, efficiency, and Reliability may reduce the risk of acquisition and accumulation of mutations and other chromosomal abnormalities Thus, certain embodiments of the present invention are used in therapeutic and / or cosmetic applications. The present invention can be used to generate cells with an appropriate safety profile for For example, the RNA and medium of the present invention may be a medium that does not contain animal or human derived components. By reprogramming cells using Thus, certain embodiments may have a desirable safety profile. In one embodiment, the reprogrammed cells In another embodiment, the reprogrammed cells are less than about 5 copy number variations (CNVs) per genome, e.g., less than about 3 per patient genome or no copy number variation relative to the patient genome. In embodiments, the reprogrammed cells have a normal karyotype and conformation to the patient genome. Fewer than about 100 single nucleotide variants within the coding region or the patient genome Fewer than about 50 single nucleotide variants within the region or within the coding region relative to the patient genome has less than about 10 single nucleotide variations.

[0113] Endotoxins and nucleases can be co-purified and / or purified from serum antigens. In particular, many recombinant proteins can bind to other proteins, such as albumin. In the case of There may be high concentrations of endotoxins and nucleases. For example, by acetylation, addition of a stabilizer such as sodium octanoate, followed by heat treatment by adding nuclease inhibitors to the albumin solution and / or medium by crystallization; by contacting with one or more ion exchange resins by contact with activated charcoal, by preparative electrophoresis, or by affinity chromatography. According to many methods of the invention, including by column chromatography, It can be removed, replaced, or otherwise inactivated. and / or nucleases from the medium and / or from one or more components thereof. Partially or completely reduce, remove, replace, or otherwise inactivate This allows the efficiency with which cells can be transfected and reprogrammed. It has now been discovered that the present invention can be used to increase the The transfection medium is free of one or more endotoxins and / or nucleases. Partially or completely reduce, remove, replace, or otherwise inactivate for transfecting cells in vivo with one or more nucleic acids that are treated to Other embodiments relate to media that cause minimal degradation of nucleic acids. In embodiments, the medium has a concentration of less than about 1 EU / mL, or less than about 0.1 EU / mL, or less than about Contains less than 0.01EU / mL.

[0114] In certain circumstances, protein-based lipid carriers such as serum albumin can be used to bind methyl-β-cyano groups. The medium of the present invention may be replaced with a non-protein lipid carrier such as cyclodextrin. In addition, for example, transfection may not require the presence of a lipid carrier. , or is carried out using a method that may not benefit from it, e.g. one or more transfection reagents, polymeric transfection reagents, or Using peptide-based transfection reagents or by electroporation, Many protein-binding molecules, such as metals, can be used to bind to cells in vivo. This toxicity can lead to reduced survival and acquisition of mutations. Therefore, certain embodiments may produce cells that are free of toxic molecules. The additional benefits arise from

[0115] The binding molecule component of the protein is responsible for suspending the protein in solution and for This can be measured by measuring the conductivity. Thus, certain embodiments , wherein about 10% of the protein in water has a conductivity of less than about 500 μmho / cm. In one embodiment, the solution has a conductivity of less than about 50 μmho / cm. In another embodiment, less than about 0.65% of the dry weight of protein, including lipids, and / or about 0.35% of the dry weight of protein is free of fatty acids.

[0116] The amount of nucleic acid delivered to a cell in vivo can be increased to enhance the desired effect of the nucleic acid. However, beyond a certain point, the amount of nucleic acid delivered to a cell in vivo can be This may result in decreased cell viability, due in part to the toxicity of the transfection reagent. The nucleic acid may be transferred to a certain amount of in vivo cells (e.g., tissue When a nucleic acid is delivered to a population of cells (cells in a certain region of a given area), the amount of nucleic acid delivered to each cell is The total amount of nucleic acid delivered to the population and to the confluency of cells may depend on the high cell density. It has now been discovered that using a combination of 100% glycerol and 100% glycerol results in less nucleic acid being delivered to each cell. In certain embodiments, in vivo cells are transfected two or more times with one or more nucleic acids. Under certain conditions, for example, when cells grow, the cell density is increased by one may vary from transfection to transfection. Certain embodiments relate to methods for transfecting cells in vivo with nucleic acids. However, cells are transfected more than once, and the amount of nucleic acid delivered to the cells is determined by the ratio of the two transfections. In one embodiment, the cells are transfected with The amount of nucleic acid delivered to the cells increases with the first of two transfections. More for the second of two transfections than for the first. In one embodiment, the cell is transfected three or more times and the amount of nucleic acid delivered to the cell is The second of three transfections showed a higher β-catenin concentration than the same three transfections. The amount of nucleic acid delivered to the cells was greater for the first of the three transfections than for the second of the three transfections. For the third of the three transfections, In yet another embodiment, the cells are transfected two or more times. The maximum amount of nucleic acid delivered to a cell during each transfection is at least To obtain at least approximately 80% viability for two successive transfections, Low enough.

[0117] The amount of nucleic acid delivered to a population of growing cells in vivo in a series of transfections Modulation of the IL-1 gene can result in increased efficacy of nucleic acids and increased viability of cells. It has now been discovered that in certain circumstances, cells in vivo contacting the one or more nucleic acids encoding one or more reprogramming factors with the If so, the efficiency of reprogramming should be evaluated in at least part of the transfection series. In contrast, the amount of nucleic acid delivered in a later transfection is greater than the amount delivered in the previous transfection. It has further been discovered that the amount of nucleic acid that can be achieved can be increased if more than Thus, certain embodiments include a method for preparing a nucleic acid sequence comprising the steps of: The nucleic acid is delivered to the cell repeatedly in a single transfection, and the amount of nucleic acid delivered to the cell is increased by at least one subsequent transfection. transfection was more effective than at least one previous transfection. The present invention relates to a method for reprogramming cells in vivo, the method comprising: The cells are transfected about 2 to about 10 times, or about 3 to about 8 times, or about 4 to about 6 times. In another embodiment, the one or more nucleic acids comprises at least one RNA molecule, Cells are transfected approximately 2 to approximately 10 times, with each transfection delivering The amount of nucleic acid delivered is the same as the amount of nucleic acid delivered to the cell in the most recent previous transfection. In yet another embodiment, the cells are transfected in the first step. The amount of nucleic acid delivered to the 2 ~about 250ng / cm 2 , or 100n g / cm 2 ~600ng / cm 2 In yet another embodiment, the cells are from about 12 to about The cells were transfected approximately five times at 48-hour intervals, and the amount of nucleic acid delivered to the cells was approximately 100% per transfection. Approximately 25ng / cm for eye transfection 2 , for the second transfection In contrast, approximately 50 ng / cm 2 , and approximately 100 ng / cm for the third transfection. 2 , Approximately 200ng / cm for the fourth transfection 2 5th transfection Approximately 400ng / cm 2 In yet another embodiment, the cells are further Transfected at least once after the first transfection and delivered to cells The amount of nucleic acid to be analyzed is approximately 400 ng / cm 2 It is.

[0118] Certain embodiments relate to methods for transfecting cells in vivo with nucleic acids. In the method of the present invention, the amount of nucleic acid is determined by measuring cell density, and In one embodiment, the cell density is selected based on the amount of nucleic acid to be transfected. In another embodiment, the cells are repeatedly transfected and the amount of the chromatin is measured by optical means. The cell density increased between the two transfections, and The amount of nucleic acid delivered was greater for the second of the two transfections than for the first of the two transfections. More than for the first transfection.

[0119] In certain circumstances, the in vivo transfection efficiency of cells contacted with the medium of the present invention It has now been discovered that the rate and survival of cells can be improved by conditioning the medium. Thus, certain embodiments relate to methods for conditioning a medium. The embodiments relate to conditioned medium. In one embodiment, the feeder is a fibroblast. In another embodiment, the transfection medium is conditioned for about 24 hours. In another embodiment, the method comprises the steps of: The medium is conditioned, for reprogramming and / or gene editing cells in vivo. In one embodiment, the feeder is a medicament such as, for example, mitomycin-C. Mitotic induction by exposure to chemicals or by exposure to gamma radiation In certain embodiments, without being bound by theory to any extent, for example, Although not desirable, to avoid the risk of disease transmission from feeders to cells or patients In some cases, it may be beneficial to use only autologous material. In one embodiment, the transfection medium is conditioned and the feeder is transfected. Method for transfecting cells in vivo derived from the same individual as the cells to be transfected - Patent application Other embodiments relate to the use of conditioned medium and feeders for reprogramming and / or reprogramming and expression of in vivo cells derived from the same individual as the cells to be gene edited and / or methods for gene editing.

[0120] Some molecules can be added to the medium by conditioning. An embodiment relates to a medium supplemented with one or more molecules present in conditioned medium. In this embodiment, the medium contains Wnt1, Wnt2, Wnt3, Wnt3a, or a biological and supplemented with a more active fragment, analog, variant, agonist, or family member. In another embodiment, the medium contains TGF-β or a biologically active fragment thereof. , analogs, variants, agonists, or family members may be added. In vivo, cells are morphologically stable after the medium is not supplemented with TGF-β for about 1 to about 5 days. Reprogramming according to the methods of the present invention is performed by supplementing TGF-β for at least about 2 days after the first initiation of the reprogramming. In yet another embodiment, the medium contains IL-6, IL-6R, or Biologically active fragments, analogs, variants, agonists, or family members In yet another embodiment, the medium is supplemented with sphingolipids or fatty acids. In yet another embodiment, the sphingolipid is lysophosphatidic acid, lysophosphatidic acid, Ngomyelin, sphingosine-1-phosphate, or biologically active analogues thereof , variants, or derivatives.

[0121] In addition to mitotically inactivating cells, under certain conditions, irradiation can also It can change gene expression and specific to cells that are more sensitive to radiation than cells that are not irradiated. The protein is less abundant, while certain other proteins, such as the Wnt family of proteins, In addition, certain members of the Wnt family of proteins can promote cell growth and transformation. In certain circumstances, reprogramming The efficiency of the irradiated feeders instead of the mitomycin-C treated feeders was By contacting in vivo cells with medium conditioned using a dye, It has now been discovered that it is possible to achieve this. The observed increase in reprogramming efficiency may be due in part to the increased Wnt secreted by the feeder. It has further been discovered that certain In some embodiments, the cells express Wnt1, Wnt2, Wnt3, Wnt3a, or their biosynthetic counterparts. Biologically active fragments, analogs, variants, family members, or agonists ( agonists of downstream targets of Wnt proteins, and / or Agents that mimic one or more of the biological effects of 2-amino-4-[3,4-(methylamino) Contact with [dioxy)benzylamino]-6-(3-methoxyphenyl)pyrimidine , relates to methods for reprogramming cells in vivo.

[0122] Due to the low efficiency of many DNA-based reprogramming methods, these methods are limited in number. This makes it difficult or impossible to use with cells derived from patient specimens that may contain only In contrast, the high efficiency of certain embodiments of the present invention allows for the production of single cells This allows for reliable reprogramming of small numbers of cells, including certain The embodiments relate to methods for reprogramming small numbers of cells. Other embodiments relate to In one embodiment, the cell is In another embodiment, the enzyme is collagenase. In an embodiment, the collagenase is free of animal components. The enzyme is about 0.1 mg / mL to about 10 mg / mL, or about 0.5 mg / mL to about 5 mg In another embodiment, the cells are blood cells. In this embodiment, the cells are contacted with a medium containing one or more proteins derived from the patient's blood. In yet another embodiment, the cells are cultured in DMEM / F12+2 mM L-alanyl-L- Glutamine + 5% to 25% of patient-derived serum or 10% to 20% of patient-derived serum The cells are contacted with serum or a medium containing about 20% patient-derived serum.

[0123] In certain circumstances, the medium of the present invention can be used to inhibit Oct4, Sox2, Klf4, and c -transfecting cells in vivo with a mixture of RNAs encoding Myc It has now been discovered that the proliferation rate of cells can be increased by The amount of RNA delivered was too small to ensure that all of the cells were transfected. If not, only a portion of the cells may exhibit increased proliferation rates. In certain circumstances, such as when creating customized therapeutics, the rate at which cells grow can be increased. For one thing, doing so reduces the time it takes to create a treatment. This is desirable because it can reduce the amount of medication that is administered and, therefore, the cost of the drug. Thus, certain embodiments may include the use of Oct4, Sox2, Klf4, and Transfect cells in vivo with a mixture of RNA encoding c-Myc and c-Myc In one embodiment, the cells exhibit an increased proliferation rate. In this case, the cells are reprogrammed.

[0124] Many diseases are associated with one or more mutations. Mutations can occur alone or in combination with other molecules. contacting the cells with a nucleic acid encoding a protein that alters the mutation in any of the combinations; Such proteins can be modified by modifying them (an example of gene editing). Examples of such nucleases include zinc finger nucleases and TALENs. In certain embodiments, the nucleic acid is a DNA molecule, either alone or in combination with other molecules. Nucleic acids that encode proteins that form single- or double-strand breaks in the in vivo In one embodiment, the method comprises transfecting a protein is a zinc finger nuclease or TALEN. In another embodiment, the nucleic acid In yet another embodiment, the single-stranded or double-stranded break is a CCR5, CXCR4, GAD1, GAD2, CFTR, HBA1, HBA2, HBB, HBD, F ANCA, XPA, XPB, XPC, ERCC2, POLH, HTT, DMD, SOD1 , APOE, PRNP, BRCA1, and BRCA2 or their analogs, variants, or or approximately 5,000 transcription start sites of genes selected from a group of family members. In yet another embodiment, the cell detects a single or double strand break within 10,000 bases of the Causing the insertion of a DNA sequence into a region or a single- or double-strand break in the region act as a repair template by either altering the NA sequence in another way In yet another embodiment, the cell is reprogrammed. In yet another embodiment, the cells are genetically edited. In yet another embodiment, gene editing and The reprogramming is performed within about 7 days of each other. The editing and reprogramming occur simultaneously or on the same day. The cells are skin cells, and the skin cells are genetically edited to inhibit the CCR5 gene. Skin cells can then be reprogrammed into hematopoietic stem cells, providing protection against HIV / AIDS. The therapeutic agent is used to treat patients with HIV / AIDS. In yet another embodiment, the skin cells are from the same patient as the therapeutic agent is being used to treat. Derived from the patient.

[0125] Genes that can be edited according to the methods of the invention to produce therapeutic agents of the invention include Can be edited to restore normal functionality, and can be edited to reduce or eliminate functionality Such genes include those in which mutations cause sickle cell disease (SC D) and β-globin (HBB), which can cause β-thalassemia; Breast cancer 1, early onset (BRCA1) and breast cancer 2, which may increase susceptibility to cancer , early onset (BRCA2); mutations may confer resistance to HIV infection C- C chemokine receptor type 5 (CCR5) and CXC chemokine receptor type 4 (CXCR4 ); Cystic fibrosis transmembrane conductance regulator, whose mutations may cause cystic fibrosis Mutations in the CFTR gene cause Duchenne muscular dystrophy and Becker muscular dystrophy. Dystrophin Dystrophies (DMD) that can cause muscular dystrophies, including dystrophin DMD Mutations may prevent autoimmune destruction of β-cells, glutamic acid decarboxylates glutamic acid decarboxylase 1 and glutamic acid decarboxylase 2 (GAD1, GAD2); Hemoglobin alpha 1, hemoglobin alpha 2, and hemoglobin alpha 3, which can cause thalassemia Globin delta (HBA1, HBA2, and HBD); mutations cause Huntington's disease Huntington (HTT) mutations may cause amyotrophic lateral sclerosis (ALS) Mutations in superoxide dismutase 1 (SOD1) can cause XPA, XPB, XPC, XPD (ERCC6) may cause xeroderma vitae , and polymerase (DNA-dependent), eta (POLH); mutations in Parkinson's disease leucine-rich repeat kinase 2 (LRRK2), which may cause Mutations may cause Fanconi anemia, Fanconi anemia, complementation groups A, B, C, D1, D2, E, F, G, I, J, L, M, N, P(FANCA, FANCB, FA NCC, FANCD1, FANCD2, FANCE, FANCF, FANCG, FANC I, FANCJ, FANCL, FANCM, FANCN, FANCP), and RAD51 Homolog C (S. cerevisiae) (RAD51C) are included, but are not limited to.

[0126] Certain embodiments relate to therapeutic agents comprising nucleic acids. In one embodiment, the nucleic acid comprises one or more In another embodiment, the method of the present invention comprises the steps of: Transfected, reprogrammed, and / or gene-edited in vivo; In one embodiment, the cells are , reprogramming, and / or gene editing, transfection, reprogramming In another embodiment, the engineered and / or gene-edited cells are introduced into the patient. The cells may be transfected, reprogrammed, and / or gene-edited cells. The therapeutic agent of the present invention is administered to a patient having a disease that can be treated with the therapeutic agent of the present invention. Examples of diseases include Alzheimer's disease, spinal cord injury, amyotrophic lateral sclerosis, cystic fibrosis, and ischemia. Heart disease including hemolytic and dilated cardiomyopathy, macular degeneration, Parkinson's disease, Huntington's disease, diabetes Diabetes, sickle cell anemia, thalassemia, Fanconi anemia, xeroderma pigmentosum, muscular dystrophy These include severe combined immunodeficiency, hereditary sensory neuropathy, cancer, and HIV / AIDS. In certain embodiments, the therapeutic agent includes, but is not limited to, a cosmetic. In an embodiment, cells are harvested from a patient and the cells are cultured into a large number of adipocytes to produce the cosmetic product. After reprogramming and expansion, the cosmetic product is introduced into the patient. Cosmetics are used for tissue regeneration.

[0127] Detailed examples of the production of specific cell types and the generation of therapeutic agents that include specific cell types However, methods of the invention include, for example, the preparation of cells according to the methods of the invention. reprogramming cells and providing conditions similar to those present in the microenvironment of developing cells By culturing cells under conditions that mimic one or more aspects of development, and for producing one or more of many other types of cells. It will be appreciated that the compounds may be used to generate therapeutic agents.

[0128] Certain embodiments include a library of cells with different human leukocyte antigen (HLA) types. The HLA matching library is, in part, The present invention provides a method for the rapid production and / or administration of a therapeutic agent without the need to wait for the therapeutic agent to be produced by the patient's cells. It may be beneficial to provide such libraries for distribution. Lee said the company is looking to expand its product lineup to include cosmetics, as well as to provide patients with ready access to treatments or cosmetics. For the treatment of heart disease and diseases of the blood and / or immune system that may benefit from This can be particularly beneficial.

[0129] Certain non-standard nucleotides, when incorporated into synthetic RNA molecules, are exogenous to some degree. Proteins that detect nucleic acids, such as protein kinase R, Rig-1, and oligonucleotides. By disrupting the binding of proteins of the adenylate synthetase family, When incorporated into synthetic RNA, it can reduce the toxicity of the synthetic R A molecule. Non-canonical nucleotides that have been reported to reduce the toxicity of NA molecules include pseudotype 1 and pseudotype 2. Douridine, 5-methyluridine, 2-thiouridine, 5-methylcytidine, N6-methyl However, non-standard nucleotides include adenosine, alpha-adenosine, and certain combinations thereof. This allows for the synthesis of non-standard RNA molecules that can be used to reduce the in vivo toxicity of synthetic RNA molecules. The chemical properties of nucleotides are, to date, still unknown. Most non-standard nucleotides, e.g., 5-methyluridine, 2-thiouridine, 5- By incorporating methylcytidine and N6-methyladenosine, synthetic RNA molecules can be This may reduce the efficiency with which proteins can be translated, making protein expression necessary. This limits the use of synthetic RNA molecules containing these nucleotides in desired applications. In addition, pseudouridine enhances the efficiency with which synthetic RNA molecules can be translated into proteins. It can be fully substituted for uridine in synthetic RNA molecules without a decrease in the rate of In certain circumstances, such as when frequent repeated transfections are performed, A synthetic RNA molecule containing only adenosine, guanosine, cytidine, and pseudouridine. The child may show excessive toxicity.

[0130] In the case of pyrimidines, at positions 2C and / or 4C and / or 5C, or in the case of purines 1, containing one or more substitutions at positions 6C and / or 7N and / or 8C, Synthetic RNA molecules containing one or more non-standard nucleotides are used to detect foreign nucleic acids. The ability to make substitutions at these positions to disrupt recognition of synthetic RNA molecules by proteins is Due to their high affinity for nucleotides, they may be less toxic than synthetic RNA molecules that contain only standard nucleotides. Furthermore, substitutions at these positions may mediate base pairing and base stacking interactions. Due in part to the lack of interference with substitutions at these positions, the synthetic RNA molecules have Currently, it has been shown that this may have minimal impact on the efficiency with which the protein can be translated. It has been discovered.

[0131] JPEG2025003953000004.jpg3062

[0132] In the case of pyrimidines, at positions 2C and / or 4C and / or 5C, or in the case of purines In the case of Examples of quasi-nucleotides are 2-thiouridine, 5-azauridine, and pseudouridine. , 4-thiouridine, 5-methyluridine, 5-aminouridine, 5-hydroxyuridine 5-methyl-5-azauridine, 5-amino-5-azauridine, 5-hydroxy- 5-Azauridine, 5-methylpseudouridine, 5-aminopseudouridine, 5-hidroxy 4-thio-5-azauridine, 4-thiopseudouridine, 4-thio-5-methyluridine, 4-thio-5-aminouridine, 4-thio-5-hydro Xylidine, 4-thio-5-methyl-5-azauridine, 4-thio-5-amino-5- Azauridine, 4-thio-5-hydroxy-5-azauridine, 4-thio-5-methylpropane Pseudouridine, 4-thio-5-aminopseudouridine, 4-thio-5-hydroxypseudouridine Pseudouridine, 2-thiocytidine, 5-azacytidine, pseudoisocytidine, N4- Methylcytidine, N4-aminocytidine, N4-hydroxycytidine, 5-methylcytidine 5-aminocytidine, 5-hydroxycytidine, 5-methyl-5-azacytidine, 5 -Amino-5-azacytidine, 5-hydroxy-5-azacytidine, 5-methylpseudo Isocytidine, 5-aminopseudoisocytidine, 5-hydroxypseudoisocytidine , N4-methyl-5-azacytidine, N4-methylpseudoisocytidine, 2-thio-5 -Azacitidine, 2-thiopseudoisocytidine, 2-thio-N4-methylcytidine, 2 -thio-N4-aminocytidine, 2-thio-N4-hydroxycytidine, 2-thio-5- Methylcytidine, 2-thio-5-aminocytidine, 2-thio-5-hydroxycytidine, 2-thio-5-methyl-5-azacytidine, 2-thio-5-amino-5-azacytidine, 2-Thio-5-hydroxy-5-azacytidine, 2-Thio-5-methylpseudoisocytidine 2-thio-5-aminopseudoisocytidine, 2-thio-5-hydroxypseudoisocytidine Isocytidine, 2-thio-N4-methyl-5-azacytidine, 2-thio-N4-methylprop Pseudoisocytidine, N4-methyl-5-methylcytidine, N4-methyl-5-aminocytidine Cytidine, N4-methyl-5-hydroxycytidine, N4-methyl-5-methyl-5-aza Cytidine, N4-methyl-5-amino-5-azacytidine, N4-methyl-5-hydroxy Cy-5-azacytidine, N4-methyl-5-methylpseudoisocytidine, N4-methyl -5-aminopseudoisocytidine, N4-methyl-5-hydroxypseudoisocytidine N4-amino-5-azacytidine, N4-aminopseudoisocytidine, N4-amino N-5-methylcytidine, N4-amino-5-aminocytidine, N4-amino-5-hydroxycytidine Roxycytidine, N4-amino-5-methyl-5-azacytidine, N4-amino-5-methyl-5-azacytidine N4-amino-5-hydroxy-5-azacytidine, N4-amino-5-hydroxy-5-azacytidine N4-amino-5-methylpseudoisocytidine, N4-amino-5-aminopseudoisocytidine N4-amino-5-hydroxypseudoisocytidine, N4-hydroxy-5-aza Cytidine, N4-hydroxypseudoisocytidine, N4-hydroxy-5-methylcytidine N4-hydroxy-5-aminocytidine, N4-hydroxy-5-hydroxycytidine N4-hydroxy-5-methyl-5-azacytidine, N4-hydroxy-5-amino No-5-azacytidine, N4-hydroxy-5-hydroxy-5-azacytidine, N4- Hydroxy-5-methylpseudoisocytidine, N4-hydroxy-5-aminopseudo Isocytidine, N4-hydroxy-5-hydroxypseudoisocytidine, 2-thio-N 4-Methyl-5-methylcytidine, 2-thio-N4-methyl-5-aminocytidine, 2- Thio-N4-methyl-5-hydroxycytidine, 2-thio-N4-methyl-5-methyl- 5-Azacytidine, 2-thio-N4-methyl-5-amino-5-azacytidine, 2-thio -N4-methyl-5-hydroxy-5-azacytidine, 2-thio-N4-methyl-5-methyl Tyrpseudoisocytidine, 2-thio-N4-methyl-5-aminopseudoisocytidine , 2-thio-N4-methyl-5-hydroxypseudoisocytidine, 2-thio-N4-methyl 5-amino-azacytidine, 2-thio-N4-aminopseudoisocytidine, 2-thio-N 4-amino-5-methylcytidine, 2-thio-N4-amino-5-aminocytidine, 2- Thio-N4-amino-5-hydroxycytidine, 2-thio-N4-amino-5-methyl- 5-Azacytidine, 2-thio-N4-amino-5-amino-5-azacytidine, 2-thio -N4-amino-5-hydroxy-5-azacytidine, 2-thio-N4-amino-5-methyl Thiopseudoisocytidine, 2-thio-N4-amino-5-aminopseudoisocytidine , 2-thio-N4-amino-5-hydroxypseudoisocytidine, 2-thio-N4-hi 2-thio-N4-hydroxypseudoisocytidine, 2- Thio-N4-hydroxy-5-methylcytidine, N4-hydroxy-5-aminocytidine , 2-thio-N4-hydroxy-5-hydroxycytidine, 2-thio-N4-hydroxy -5-Methyl-5-azacytidine, 2-thio-N4-hydroxy-5-amino-5-azacytidine Cytidine, 2-thio-N4-hydroxy-5-hydroxy-5-azacytidine, 2-thio -N4-hydroxy-5-methylpseudoisocytidine, 2-thio-N4-hydroxy- 5-Aminopseudoisocytidine, 2-thio-N4-hydroxy-5-hydroxypseudoisocytidine Doisocytidine, N6-methyladenosine, N6-aminoadenosine, N6-hydroxy Adenosine, 7-deazaadenosine, 8-azaadenosine, N6-methyl-7-deaza Adenosine, N6-methyl-8-azaadenosine, 7-deaza-8-azaadenosine, N6 -Methyl-7-deaza-8-azaadenosine, N6-amino-7-deazaadenosine, N 6-Amino-8-azaadenosine, N6-Amino-7-deaza-8-azaadenosine, N 6-Hydroxyadenosine, N6-hydroxy-7-deazaadenosine, N6-hydroxy 6-Thiaza-8-azaadenosine, N6-hydroxy-7-deaza-8-azaadenosine, Oguanosine, 7-deazaguanosine, 8-azaguanosine, 6-thio-7-deazaguanosine 6-thio-8-azaguanosine, 7-deaza-8-azaguanosine, and 6-thio Certain non- It should be noted that alternative nomenclature systems exist for the standard nucleotides. For example, In certain circumstances, 5-methylpseudouridine may be used as a substitute for 3-methylpseudouridine. or "N3-methylpseudouridine" or "1-methylpseudouridine" or It can be called "N1-methylpseudouridine."

[0133] Nucleotides that contain the prefix "amino" are attached to an atom at a given position in the nucleotide. The term can refer to any nucleotide that contains a nitrogen atom that is connected to a 5-amino acid. Cytidine includes 5-aminocytidine, 5-methylaminocytidine, and 5-nitrocytidine. Similarly, a nucleotide containing the prefix "methyl" can be used to refer to can refer to any nucleotide containing a carbon atom bonded to an atom at a given position, For example, 5-methylcytidine is also known as 5-methylcytidine, 5-ethylcytidine, and 5-hydoxycytidine. A nucleotide that includes the prefix "thio" can refer to a nucleotide that is a nucleotide with a thio group. refers to any nucleotide that contains a sulfur atom bonded to an atom at a given position in the nucleotide and a nucleotide containing the prefix "hydroxy" can be used at a given position of the nucleotide. The term can refer to any nucleotide that contains an oxygen atom bonded to an atom at the 2-position, for example 5-Hydroxyuridine is a 5-hydroxyuridine with an oxygen atom at the 5C position of uridine. can refer to a uridine having a methyl group bonded to an oxygen atom that is bonded to an atom of .

[0134] Thus, in certain embodiments, the synthetic RNA molecule is / or 4C and / or 5C positions, or in the case of puddings, 6C and / or 7C positions Contains one or more nucleotides containing one or more substitutions at positions N and / or 8C Synthetic RNA molecules. Other embodiments relate to therapeutic agents that contain one or more synthetic RNA molecules. In the case of pyrimidine, one or more synthetic RNA molecules may have a 2C and / or 4C and / or or 5C, or in the case of puddings, 6C and / or 7N and / or 8C In one embodiment, the therapeutic agent comprises one or more nucleotides that contain one or more substitutions. In one embodiment, the therapeutic agent comprises a transfection reagent. The ion exchange reagent includes a cationic lipid, a liposome, or a micelle. In one embodiment, the liposome or micelle contains folic acid and the therapeutic composition has anti-cancer activity. In embodiments, the one or more nucleotides are selected from the group consisting of pseudouridine, 2-thiouridine, 4- Thiouridine, 5-azauridine, 5-hydroxyuridine, 5-methyluridine, 5- Aminouridine, 2-thiopseudouridine, 4-thiopseudouridine, 5-hydroxy Cypseudouridine, 5-methylpseudouridine, 5-aminopseudouridine, Idoisocytidine, N4-methylcytidine, 2-thiocytidine, 5-azacytidine, 5- Hydroxycytidine, 5-aminocytidine, 5-methylcytidine, N4-methylpseudocytidine Isocytidine, 2-thiopseudoisocytidine, 5-hydroxypseudoisocytidine, 5-Aminopseudoisocytidine, 5-Methylpseudoisocytidine, 7-Deazaadeno 7-deazaguanosine, 6-thioguanosine, and 6-thio-7-deazaguanosine In another embodiment, the one or more nucleotides include at least one of the following: Idouridine, 2-thiouridine, 4-thiouridine, 5-azauridine, 5-hydroxyuridine Thiouridine, 5-methyluridine, 5-aminouridine, 2-thiopseudouridine, 4 -Thiopseudouridine, 5-hydroxypseudouridine, 5-methylpseudouridine At least one of 5-aminopseudouridine, 5-aminopseudouridine, and pseudoisocyanin. Cytidine, N4-methylcytidine, 2-thiocytidine, 5-azacytidine, 5-hydroxycytidine Cytidine, 5-aminocytidine, 5-methylcytidine, N4-methylpseudoisocytidine 2-thiopseudoisocytidine, 5-hydroxypseudoisocytidine, 5-amino At least one of pseudoisocytidine and 5-methylpseudoisocytidine In yet another embodiment, the one or more nucleotides include pseudouridine, 2-thiol. Auridine, 4-thiouridine, 5-azauridine, 5-hydroxyuridine, 5-methyl Uridine, 5-aminouridine, 2-thiopseudouridine, 4-thiopseudouridine 5-aminopropane, 5-hydroxypseudouridine, and 5-methylpseudouridine At least one of pseudouridine, pseudoisocytidine, N4-methyl Cytidine, 2-thiocytidine, 5-azacytidine, 5-hydroxycytidine, 5-amino Cytidine, 5-methylcytidine, N4-methylpseudoisocytidine, 2-thiopseudoisocytidine Isocytidine, 5-hydroxypseudoisocytidine, 5-aminopseudoisocytidine and 5-methylpseudoisocytidine, and at least one of 7-deazaglycine and 5-methylpseudoisocytidine. At least one of anosine, 6-thioguanosine, and 6-thio-7-deazaguanosine In yet another embodiment, the one or more nucleotides include 5-methylcytidine. and 7-deazaguanosine. In another embodiment, the one or more nucleotides further include , pseudouridine or 4-thiouridine or 5-methyluridine or 5-amino Uridine or 4-thiopseudouridine or 5-methylpseudouridine or 5- In yet another embodiment, the one or more nucleotides further comprise an aminopseudouridine. In another embodiment, the one or more nucleotides include 7-deazaadenosine. pseudoisocytidine, 7-deazaguanosine, and 4-thiouridine. In embodiments, one or more nucleotides are pseudoisocytidine or 7-deazaguarantine. In yet another embodiment, one or more nucleotides include guanine and pseudouridine. includes 5-methyluridine, 5-methylcytidine and 7-deazaguanosine. In certain embodiments, the one or more nucleotides are pseudouridine or 5-methylpseudouridine. In another embodiment, the nucleotides include idouridine, 5-methylcytidine, and 7-deazaguanosine. The one or more nucleotides are pseudoisocytidine and 7-deazaguanosine and In one embodiment, the synthetic RNA molecule is present in vivo.

[0135] Certain non-standard nucleotides can be used to mediate both standard base-pairing and base-stacking interactions. The nucleotide sequence involved in the functioning of the nucleotide sequence and the corresponding canonical nucleotides interacting with RNA polymerase These specific non-canonical nucleoside nucleotides interact with RNA polymerase in a manner similar to that of the Due in part to the propensity of the nucleotide sequence to bind to RNA, the RNA polynucleotides commonly used for in vitro transcription are It can be incorporated by ribozyme into synthetic RNA molecules more efficiently than other non-standard nucleotides. As a result, it is possible to identify specific nucleotide mixtures that contain one or more non-standard nucleotides. The mixtures can be synthesized, in part, by in vitro transcription reactions containing these nucleotide mixtures. It may be beneficial to obtain large amounts of synthetic RNA. Particular embodiments are those in which the 2C and / or 4C and / or 5C positions are present in the case of pyrimidines. or in the case of purines, at positions 6C and / or 7N and / or 8C, The present invention relates to a nucleotide mixture containing one or more nucleotides containing a substitution of the following: As for the tide mixture, (the number before each nucleotide is the nonstandard Representative fractions of nucleotide triphosphates are shown, e.g., pseudoisocytidine at 0.2 is , adenosine-5′-triphosphate, guanosine-5′-triphosphate, uridine-5′-triphosphate Contains cytidine-5'-triphosphate, cytidine-5'-triphosphate, and pseudoisocytidine-5'-triphosphate The reaction is referred to as pseudoisocytidine-5′-triphosphate, and the amount is determined by mole or mass. The amount of pseudoisocytidine-5′-triphosphate present in the reaction was measured either Cytidine-5'-triphosphate was present in the reaction in an amount approximately equal to 0.2 times the total amount of nucleotide Two or more numbers before the dot indicate a representative range of fractions) 1.0 for pseudouridine, 0 .1 to 0.8 2-thiouridine, 0.1 to 0.8 5-methyluridine, 0.2 to 1. 0 5-hydroxyuridine, 0.1-1.0 5-aminouridine, 0.1-1.0 4-thiouridine, 0.1-1.0 2-thiopseudouridine, 0.1-1.0 4- Thiopseudouridine, 0.1-1.0 5-hydroxypseudouridine, 0.2-1 of 5-methylpseudouridine, 0.1 to 1.0 of 5-aminopseudouridine, 0.2 ~1.0 2-thiocytidine, 0.1-0.8 pseudoisocytidine, 0.2-1.0 of 5-methylcytidine, 0.2 to 1.0 of 5-hydroxycytidine, 0.1 to 1.0 of 5 -aminocytidine, 0.2 to 1.0 N4-methylcytidine, 0.2 to 1.0 5-methyl Lupseidoisocytidine, 0.2-1.0 5-hydroxypseudoisocytidine, 0. 2 to 1.0 5-aminopseudoisocytidine, 0.2 to 1.0 N4-methylpseudoisocytidine isocytidine, 0.2-1.0 2-thiopseudoisocytidine, 0.2-1.0 7- Deazaguanosine, 0.2-1.0 6-thioguanosine, 0.2-1.0 6-thio- 7-deazaguanosine, 0.2-1.0 8-azaguanosine, 0.2-1.0 7-de Aza-8-azaguanosine, 0.2-1.0 6-thio-8-azaguanosine, 0.1- 0.5 of 7-deazaadenosine and 0.1 to 0.5 of N6-methyladenosine. Examples include, but are not limited to:

[0136] In various embodiments, a synthetic RNA composition or a synthetic polynucleotide composition (e.g., (which may be prepared by in vitro transcription) at the position having adenine or "A" in the genetic code. The term "substantially" in this context means that the nucleic acid sequence contains substantially or completely the standard nucleotide. The term refers to at least 90%. In these embodiments, the synthetic RNA composition or The synthetic polynucleotide composition further comprises a 7-deazaguanidine derivative at the "G" position of the genetic code. and the corresponding standard nucleotide "G", The ratio of standard and non-standard nucleotides at the positions is within the range of 5:1 to 1:5, or in some implementations. In some embodiments, the ratio may be in the range of 2:1 to 1:2. The RNA composition or synthetic polynucleotide composition further comprises a polynucleotide at the "C" position of the genetic code. 5-Hydroxymethylcytidine, 5-Hydroxycytidine, 5-Carboxycytidine, and and one or more (e.g., two, three, or four) of 5-formylcytidine, and may contain (e.g., consist of) the standard nucleotide "C", and standard and non-standard nucleotides at the C position may be The standard nucleotides are in the range of 5:1 to 1:5, or in some embodiments, 2:1 In some embodiments, the non-standard nucleotide at the "C" position may be in the range of 0:1 to 1:2. The concentration of the oxalate is as described in the preceding paragraph. The synthetic RNA composition or synthetic polynucleotide composition further comprises a nucleotide sequence at the position of "U" in the genetic code. 5-Hydroxymethyluridine, 5-Hydroxyuridine, 5-Carboxyuridine, and one or more (e.g., two, three, or four) of 5-formyluridine, and may contain (e.g., consist of) the standard nucleotide "U", and may include (e.g., consist of) the standard nucleotide "U" at the position of "U". and the non-standard nucleotide is in the range of 5:1 to 1:5, or in some embodiments, In some embodiments, the non-standard position of the "U" may be in the range of 2:1 to 1:2. The concentrations of the nucleotides are as described in the previous paragraph.

[0137] The combination of certain non-standard nucleotides is one way of reducing the toxicity of synthetic RNA molecules. It may be beneficial to be able to add non-canonical nucleotides that reduce the contribution of It has now been discovered that certain embodiments, for example, The leutidine mixture contains both pseudoisocytidine and 7-deazaguanosine, and The nucleotide mixture contains both N4-methylcytidine and 7-deazaguanosine. The nucleotide mixture may be a nucleotide mixture containing two or more of the non-standard nucleotides. In one embodiment, the nucleotide mixture comprises said non-standard nucleotides. and each of the non-standard nucleotides is present in the mixture in said fraction. For example, the nucleotide mixture may contain 0.1 to 0.8 pseudoisocytidine and 0. 0.2 to 1.0 7-deazaguanosine, or the nucleotide mixture contains 0.2 to Contains 1.0 N4-methylcytidine and 0.2-1.0 7-deazaguanosine. Such is the case.

[0138] In certain situations, such as maximizing the yield of an in vitro transcription reaction, it is not necessary Alternatively, other nucleotide fractions may be used if this is undesirable. Representative fractions and ranges of fractions are based on nucleotide triplicates of normal purity (>90%). The larger fraction of these and other nucleotides is associated with high Nucleotide synthesis was performed using conventional chemical purification techniques such as high pressure liquid chromatography (HPLC). This can be achieved by purifying the triphosphate solution or by other means. High purity, for example, greater than about 95% purity or greater than about 98% purity or about 99% purity By using a nucleotide triphosphate solution having a purity of greater than about 99.5% In one embodiment, the nucleotide having multiple isomers can be The isomers are then refined to enrich for the desired isomer.

[0139] Other embodiments include pyrimidines at positions 2C and / or 4C and / or 5C. or in the case of purines, at positions 6C and / or 7N and / or 8C, contacting the cell with a synthetic RNA molecule containing one or more non-standard nucleotides, including a substitution of Method for inducing cells in vivo to express a protein of interest by inducing Yet another embodiment relates to a pyrimidine having a C-position and / or a C-position and / or a C-position. or at position 5C, or in the case of purines at positions 6C and / or 7N and / or 8C and a synthetic RNA molecule containing one or more non-standard nucleotides with one or more substitutions at positions Transfecting and reprogramming cells in vivo by contacting the cells In one embodiment, the present invention relates to a method for gene editing, transcription and / or gene editing using a synthetic RNA molecule. In one embodiment, the synthetic RNA molecule is produced by in vitro transcription. In another embodiment, the one or more reprogramming factors are encoded. In another embodiment, the cell further comprises a Sox2 protein. In yet another embodiment, the cell is further contacted with a synthetic RNA molecule encoding a K In yet another embodiment, the cells are contacted with a synthetic RNA molecule that encodes the lf4 protein. The cells are then contacted with a synthetic RNA molecule that encodes the c-Myc protein. In embodiments, the cell is further contacted with a synthetic RNA molecule encoding a Lin28 protein. do.

[0140] Enzymes such as T7 RNA polymerase can synthesize RNA containing both standard and non-standard nucleotides. In in vitro transcription reactions, canonical nucleotides may be preferentially incorporated. In vitro transcription reactions containing a certain fraction of non-standard nucleotides result in the production of non-standard nucleotides. The nucleotides are nonstandard nucleotides in a fraction different, often lower, than those present in the reaction. Thus, in certain embodiments, RNA containing nucleotides may be obtained. Reference to the oxytide incorporation fraction (e.g., "a synthetic RNA molecules" or "0.1 to 0.8 pseudoisocytidines") are involved in such reactions. Thus, the non-standard nucleotides contain a different fraction of nucleotides than was present in the reaction. Even if RNA is obtained, it is possible to obtain RNA fragments that contain a given fraction of nucleotides. and a predetermined fraction of nucleotides (or nucleotide derivatives, e.g., nucleotides The term can refer to both RNA molecules synthesized in reactions containing ribozyme-containing diphosphate (RIP) and ribozyme-containing diphosphate (RIP).

[0141] Different nucleotide sequences can encode the same protein by using alternative codons. Thus, in certain embodiments, the nucleotide incorporation molecule can be Reference to a percentage refers to an RNA molecule that contains a given fraction of nucleotides, and a different RNA molecule. It can refer to both RNA molecules that code for the same protein, and different RNA molecules that code for different proteins. , containing a given fraction of nucleotides.

[0142] Certain embodiments include one or more components required to carry out the invention. In one embodiment, the kit contains one or more synthetic RNA molecules. In one embodiment, the kit comprises one or more reprogramming factors and / or gene editing factors. In another embodiment, the one or more synthetic RNA molecules encoding the protein The synthetic RNA molecule above has pyrimidines at positions 2C and / or 4C and / or 5C. one at position C, or for purines at positions 6C and / or 7N and / or 8C In another embodiment, the kit comprises one or more non-standard nucleotides having the above substitutions. The transfection medium, transfection reagent, complex formation medium, and matrix In one embodiment, the matrix solution contains one or more of the following: fibronectin and / or vitronectin, or recombinant fibronectin and / or In one embodiment, one of the components of the kit comprises a The above are present in multiple aliquots. In one embodiment, the kit comprises a nucleic acid transfer kit. In another embodiment, the kit contains an aliquot of the injection-reagent complex. In some embodiments, the nucleic acid transfer agent may be provided as a frozen or lyophilized pellet. In yet another embodiment, the kit comprises an aliquot of the filtration reagent complex. Each aliquot is stabilized by either chemical treatment or freezing. The transfection reagent-nucleic acid complex is

[0143] Transfection in general, and reprogramming in particular, is repetitive and error prone It may be a difficult and time-consuming technique. The technique is often performed manually due to the lack of automated transfection equipment. Thus, certain embodiments are often automated or semi-automated. In this manner, cells in vivo can be transfected, reprogrammed, and / or genetically modified. This relates to a system capable of gene editing.

[0144] Non-canonical nucleotide members of the 5-methylcytidine demethylation pathway are incorporated into synthetic RNA. When incorporated into a gene, the efficiency with which synthetic RNA can be translated into protein in vivo is increased. It has now been discovered that this can reduce the toxicity of synthetic RNA in vivo. These non-standard nucleotides include, for example, 5-methylcytidine, 5-hydroxytryptamine, 5-hydroxymethylcytidine, 5-formylcytidine, and 5-carboxycytidine (also known as Thus, certain embodiments relate to nucleic acids. In some embodiments, the nucleic acid is present in vivo. In one embodiment, the nucleic acid is synthetic. In another embodiment, the nucleic acid is an RNA molecule. In one embodiment, the nucleic acid is an nucleotide sequence that encodes one or more non-canonical nucleotides in the 5-methylcytidine demethylation pathway. In another embodiment, the nucleic acid comprises a 5-methylcytidine, a 5-hydroxy ... Cytidine, 5-formylcytidine, and 5-carboxycytidine or their derivatives In a further embodiment, the nucleic acid comprises at least one of the following: pseudouridine, 5-Methylpseudouridine, 5-hydroxyuridine, 5-methyluridine, 5-methyl Cytidine, 5-hydroxymethylcytidine, N4-methylcytidine, N4-acetylcytidine 7-deazaguanosine, 7-deazaguanosine, or a derivative thereof. .

[0145] (chemical 2) 5-Methylcytidine demethylation pathway JPEG2025003953000005.jpg3877

[0146] Certain embodiments relate to proteins. Other embodiments relate to vectors that encode proteins. In one embodiment, the protein is a protein of interest. The protein is selected from a reprogramming protein and a gene editing protein. In one embodiment, the nucleic acid is a plasmid. In another embodiment, the nucleic acid is a virus. In a further embodiment, the nucleic acid is present in a virus or a viral vector. The vector is replication-incompetent. In yet another embodiment, the virus or viral vector In one embodiment, the virus or viral vector is an adenovirus. viruses, retroviruses, lentiviruses, herpes viruses, adeno-associated viruses, or natural or engineered variants thereof, and / or engineered viruses. Also includes one.

[0147] Certain combinations of nonstandard nucleotides allow synthetic RNA to be synthesized into proteins in vivo. The aim of this study was to increase the efficiency with which synthetic RNA can be translated into a high-quality RNA and to reduce the toxicity of synthetic RNA in vivo. It has also been discovered that these compounds can be particularly effective in reducing, for example, The combination is 5-methyluridine, 5-methylcytidine, and 5-hydroxyuridine. uridine and 5-methylcytidine, 5-hydroxyuridine and 5-hydroxymethylcytidine , 5-methyluridine and 7-deazaguanosine, 5-methylcytidine and 7-deazaguanosine Anosine, 5-methyluridine, 5-methylcytidine, and 7-deazaguanosine, and 5-methyluridine, 5-hydroxymethylcytidine, and 7-deazaguanosine. Thus, certain embodiments include 5-methyluridine, 5-methylcytidine, 5-hydroxymethylcytidine, 7-deazaguanosine, or one or more of these Other embodiments relate to nucleic acids comprising at least two of the derivatives. cytidine, 5-methylcytidine, 5-hydroxymethylcytidine, and 7-deazaguanosine, or one or more derivatives thereof. The forms are 5-methyluridine, 5-methylcytidine, 5-hydroxymethylcytidine, and and 7-deazaguanosine, or one or more derivatives thereof. In one embodiment, the nucleic acid comprises one or more 5-methyluridine residues, one or more 5-methyluridine residues, A cytidine residue and one or more 7-deazaguanosine residues or one or more 5-methyl cytidine residue, one or more 5-hydroxymethylcytidine residues, and one or more 7- Contains a deazaguanosine residue.

[0148] Synthetic R containing a particular fraction of specific non-standard nucleotides and their combinations The NA molecule may exhibit particularly high translation efficiency and low toxicity in vivo. It has further been discovered that certain embodiments of the invention include one or more uridine residues, Contains at least one of one or more cytidine residues and one or more guanosine residues. In one embodiment, the nucleic acid comprises a uridine residue, About 20% to about 80% of the groups are 5-methyluridine residues. In a further embodiment, about 30% to about 50% of the uridine residues are 5-methyluridine residues. In one embodiment, about 40% of the uridine residues are 5-methyluridine residues. In another embodiment, about 60% to about 80% of the cytidine residues are 5-methylcytidine residues. About 80% to about 100% of the cytidine residues are 5-methylcytidine residues. In another embodiment, about 100% of the cytidine residues are 5-methylcytidine residues. In terms of morphology, about 20% to about 100% of the cytidine residues are 5-hydroxymethylcytidine residues. In one embodiment, about 20% to about 80% of the guanosine residues are 7-deazaguanosine. In another embodiment, about 40% to about 60% of the guanosine residues are 7-deaza In a further embodiment, about 50% of the guanosine residues are 7-deoxyribonucleic acid. In one embodiment, about 20% to about 80% of the cytidine residues are guanosine residues. About 30% to about 60%, or about 40% are N4-methylcytidine and / or N4-acetonitrile. In another embodiment, each cytidine residue is a 5-methylcytidine residue. In a further embodiment, about 100% of the cytidine residues are 5-methylcytidine residues. and / or 5-hydroxymethylcytidine residues and / or N4-methylcytidine residues group and / or N4-acetylcytidine residue and / or one or more derivatives thereof. In yet another embodiment, about 40% of the uridine residues are 5-methyluridine residues. and about 20% to about 100% of the cytidine residues are N4-methylcytidine and / or N4- acetylcytidine residues, and approximately 50% of the guanosine residues are 7-deazaguanosine residues. In one embodiment, about 40% of the uridine residues are 5-methyluridine residues; About 100% of the cytidine residues are 5-methylcytidine residues. Approximately 40% of the amino acid residues are 5-methyluridine residues, and approximately 50% of the guanosine residues are In a further embodiment, about 100% of the cytidine residues are , 5-methylcytidine residues, and approximately 50% of the guanosine residues are 7-deazaguanosine In a further embodiment, about 100% of the uridine residues are 5-hydroxyuridine residues. In one embodiment, about 40% of the uridine residues are 5-methyluridine residues. Approximately 100% of the cytidine residues are 5-methylcytidine residues, and approximately 100% of the guanosine residues are 50% are 7-deazaguanosine residues. In another embodiment, about 40% of the uridine residues are 5-methyluridine residues, and about 20% to about 100% of the cytidine residues are 5-hydroxy Approximately 50% of the guanosine residues are 7-deazaguanosine residues. In some embodiments, less than 100% of the cytidine residues are 5-methylcytidine residues. In another embodiment, less than 100% of the cytidine residues are 5-hydroxymethylcytidine. In one embodiment, each uridine residue in the synthetic RNA molecule is a pseudouridine residue. In another embodiment, the uridine residue is a 5-methylpseudouridine residue. Approximately 100% of the residues are pseudouridine and / or 5-methylpseudouridine residues. In a further embodiment, about 100% of the uridine residues are pseudouridine residues and and / or 5-methylpseudouridine residues, and approximately 100% of the cytidine residues are 5-methyl Approximately 50% of the guanosine residues are 7-deazaguanosine residues. do.

[0149] Other non-steroidal anti-inflammatory drugs that can be used in place of or in combination with 5-methyluridine The standard nucleotides are pseudouridine, 5-hydroxyuridine, and 5-methyluridine. Pseudouridine (also known as 1-methylpseudouridine, also known as N1-methylpseudouridine) 5- lysine), or one or more derivatives thereof. Instead of or in combination with methylcytidine and / or 5-hydroxymethylcytidine Other non-standard nucleotides that can be used in combination are pseudoisocytidine, 5- Methylpseudoisocytidine, 5-hydroxymethylcytidine, 5-formylcytidine, 5-carboxycytidine, N4-methylcytidine, N4-acetylcytidine, or In certain embodiments, the present invention includes, but is not limited to, one or more derivatives of, for example, For example, if only a single transfection, injection, or delivery is performed, or if The cells, tissues, organs, or patients being transfected, injected, or delivered are particularly susceptible to in the absence of transfection-associated toxicity or susceptibility to innate immune signaling The proportion of non-standard nucleotides can be reduced. In part, this reduces the cost of nucleic acids by reducing the fraction of non-standard nucleotides. In certain circumstances, e.g. For example, if minimal immunogenicity of the nucleic acid is desired, the fraction of non-standard nucleotides can be increased. This can be done.

[0150] Enzymes such as T7 RNA polymerase can synthesize RNA containing both standard and non-standard nucleotides. In in vitro transcription reactions, canonical nucleotides may be preferentially incorporated. In vitro transcription reactions containing a certain fraction of non-standard nucleotides result in the production of non-standard nucleotides. The nucleotides are nonstandard nucleotides in a fraction different, often lower, than those present in the reaction. Thus, in certain embodiments, RNA containing nucleotides may be obtained. References to fractional oxydide incorporation (e.g., "50% 5-methyluridine") refer to such The reaction produces a non-standard nucleotide with a different fraction than the fraction present in the reaction. Even if a nucleic acid containing a given fraction of nucleotides is obtained, and a predetermined fraction of a nucleotide (or a nucleotide derivative, e.g., nucleotide In addition, it can refer to both nucleic acids synthesized in reactions containing different Nucleotide sequences that use alternative codons may code for the same protein. Thus, in certain embodiments, the fraction of nucleotide incorporation can be The reference to nucleic acids containing a given fraction of nucleotides and different nucleic acids that produce the same protein The term can refer to both nucleic acids that encode a given fraction of nucleotides, and different nucleic acids can refer to both nucleic acids that encode a given fraction of nucleotides, and Contains.

[0151] The DNA sequence of a cell can be modified by contacting the cell with a gene-editing protein or by This can be altered by inducing the cells to express a specific protein. However, previously disclosed gene editing proteins have low binding efficiency and excessive off-target activity. These have the disadvantage of being unable to inhibit cell proliferation, e.g. in therapeutic and cosmetic applications. This could potentially introduce undesirable mutations into NAs, greatly limiting their use in vivo. In these applications, unwanted mutations are introduced into the patient's cells. The StsI endonuclease cleavage domain (sequence Gene editing proteins containing the nucleotide sequence (number 1) show high levels of on-target activity in vivo. While maintaining substantially lower in vivo activity than previously disclosed gene editing proteins. It has now been discovered that gene editing proteins may exhibit off-target activity. Protein: StsI-HA (SEQ ID NO: 2), StsI-HA2 (SEQ ID NO: 3), StsI-U HA (SEQ ID NO: 4), StsI-UHA2 (SEQ ID NO: 5), StsI-HF (SEQ ID NO: 6 ), and when used as the nuclease domain of StsI-UHF (SEQ ID NO: 7) In addition, it has high in vivo on-target activity, low in vivo off-target activity, and small Other new types of engineered tannins that can exhibit suitable size, solubility, and other desirable properties are also being investigated. Proteins have also been discovered: StsI-HA, StsI-HA2 (high activity), StsI-U HA and StsI-UHA2 (super-high activity) have specific N-terminal regions at positions 34 and 61. It is more potent than both wild-type StsI and wild-type FokI, due in part to amino acid substitutions in It can show good in vivo on-target activity, while StsI-HF (high fidelity ) and StsI-UHF (ultra-high fidelity) are specific for positions 141 and 152 in the C-terminal region. It is lower than both wild-type StsI and wild-type FokI, due in part to amino acid substitutions in These compounds can exhibit significant in vivo off-target activity.

[0152] Thus, certain embodiments relate to proteins. In another embodiment, the protein is a nuclease domain. In one embodiment, the nuclease domain comprises the FokI endonuclease ( SEQ ID NO:53), the cleavage domain of StsI endonuclease (SEQ ID NO:1), StsI -HA (SEQ ID NO: 2), StsI-HA2 (SEQ ID NO: 3), StsI-UHA (SEQ ID NO: 4), StsI-UHA2 (SEQ ID NO: 5), StsI-HF (SEQ ID NO: 6), and Sts I-UHF (SEQ ID NO: 7) cleavage domain, or a biologically active fragment thereof. The present invention includes one or more of the above-mentioned modifications or variants.

[0153] Engineered gene-editing proteins that contain a specific novel repeat-containing DNA-binding domain The quality of the product is consistent with previously disclosed genes while maintaining high levels of on-target activity in vivo. They also found that these proteins may exhibit lower off-target activity in vivo than gene-editing proteins. Some of these engineered gene-editing proteins have been shown to have, for example, increased binding The improved flexibility of the linker region connecting the repeat sequences can result in increased efficiency. These proteins may offer several advantages over previously disclosed gene editing proteins, including: Thus, certain embodiments relate to proteins that contain multiple repeat sequences. In embodiments, at least one of the repeat sequences contains the amino acid sequence: GabG, "a" and "b" each represent any amino acid. In one embodiment, the protein In another embodiment, one or more of the repeat sequences is a gene editing protein. In a further embodiment, "a" and "b" are each independently In yet another embodiment, "a" and "b" are selected from the group H and the group G. are H and G, respectively. In one embodiment, the amino acid sequence is In another embodiment, the amino acid sequence is located at the C-terminus of the repeat sequence. In some embodiments, one or more Gs in the amino acid sequence GabG can be an amino acid other than G, e.g. For example, the repeat sequence is replaced with one or more amino acids, such as A, H, or GG. is about 32 to about 40 amino acids, or about 33 to about 39 amino acids, or about 34 to 38 or about 35 to about 37 amino acids, or about 36 amino acids, or about 32 or more than about 33 amino acids, or more than about 34 amino acids, or or greater than about 35 amino acids in length. Other embodiments include one or more transcriptional activating factors. In one embodiment, the present invention relates to a protein comprising a transcription activator-like effector domain. At least one of the effector domains comprises a repeat sequence. Between at least two of the repeat sequences of the transcription activator-like effector domain, The present invention relates to a protein containing multiple repeat sequences produced by inserting the above amino acids. In one embodiment, the one or more amino acids are located about 1 to 5 from the C-terminus of the at least one repeat sequence. 1 or about 2 or about 3 or about 4 or about 5 amino acids are inserted. In this embodiment, approximately every other repeat sequence has a different length than the repeat sequence immediately before or after it. In one embodiment, every other repeat sequence is In another embodiment, every other repeat sequence is about 36 amino acids long. Yet another embodiment relates to a protein comprising multiple repeat sequences, The string contains at least two repeat sequences, each at least 36 amino acids long, At least two of the repeats that are at least 36 amino acids long are less than 36 amino acids long. Some embodiments include, for example, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:5 9, and SEQ ID NO: 60.

[0154] Other embodiments relate to proteins that include a DNA binding domain. In one embodiment, the DNA binding domain comprises multiple repeat sequences. In one embodiment, the multiple repeat sequences are This allows for highly specific recognition of the binding site of the target DNA molecule. At least two of the rows are at least about 50%, or about 60%, or about 70% different from each other. 0%, or about 80%, or about 90%, or about 95%, or about 98%, or about 9 In a further embodiment, at least one of the repeat sequences has a homology of 9% to the target In yet another embodiment, the target DNA molecule comprises one or more regions capable of binding to a binding site on the target DNA molecule. In one embodiment, the binding site comprises a distinct sequence of about 1 to about 5 bases in length. The NA binding domain comprises a zinc finger. In another embodiment, the DNA binding domain In a further embodiment, the TALE comprises a transcription activator-like effector. The repeat sequence is at least about 50%, or about 60%, or about 70%, or About 80%, or about 90%, or about 95%, or about 98%, or about 99% homology In yet another embodiment, the gene editing protein comprises at least one repeat sequence having the The protein contains clustered regularly interspaced short palindromic repeats (CRISPR)-binding proteins. In one embodiment, the gene editing protein comprises a nuclear localization sequence. In embodiments, the nuclear localization sequence comprises the amino acid sequence PKKKRKV. The gene editing protein comprises a mitochondrial localization sequence. The endonuclearis localization sequence comprises the amino acid sequence LGRVIPRKIASRASLM. In one embodiment, the gene editing protein comprises a linker. In another embodiment, the linker is a nucleic acid In a further embodiment, the linker connects the cleavage domain to the DNA binding domain. In some embodiments, the linker is about 1 to about 10 amino acids in length. , or about 3, or about 4, or about 5, or about 6, or about 7, or about 8, or In one embodiment, the gene editing protein is about 9 or about 10 amino acids in length. It is possible to create a nick or a double-stranded break in the DNA molecule.

[0155] Certain embodiments relate to a method for modifying the genome of a cell in vivo, the method comprising: An artificial nucleic acid sequence comprising one or more repeat units of 36 amino acids in length and an endonuclease domain. Non-naturally occurring fusion proteins containing transcription activator-like (TAL) effector repeat domains The method includes introducing into a cell in vivo a nucleic acid molecule encoding the repeat domain, The fusion protein is engineered for recognition of a given nucleotide sequence. In one embodiment, the cell is a eukaryotic cell. In another embodiment, the cell is an animal cell. In a further embodiment, the cell is a mammalian cell. In one embodiment, the cell is a human cell. In another embodiment, the cell is a plant cell. In some embodiments, the cell is a prokaryotic cell. In some embodiments, the fusion protein is An endonucleolytic cleavage site is introduced into the nucleic acid of the cell to be modified.

[0156] In certain embodiments, the nucleic acid is an in vivo nucleic acid encoding a gene editing protein. In another embodiment, the nucleic acid mixture comprises: A first nucleic acid encoding a first gene editing protein and a second gene editing protein Altering the DNA sequence of a cell in vivo containing a nucleic acid mixture that includes a second nucleic acid encoding In one embodiment, the present invention relates to a composition for the purpose of The binding sites for the two gene editing proteins are present on the same target DNA molecule. The binding site of the first gene editing protein and the binding site of the second gene editing protein The positions are less than about 50 bases, or less than about 40 bases, or less than about 30 bases. or less than about 20 bases, or less than about 10 bases, or from about 10 to about 25 In one embodiment, the first gene is separated by about 15 bases. The nuclease domain of the second gene editing protein and the nuclease domain of the second gene editing protein In another embodiment, the dimer is capable of forming a dimer. It is possible to create a nick or a double-stranded break in the DNA molecule.

[0157] Certain embodiments relate to therapeutic compositions. Other embodiments relate to cosmetic compositions. In some embodiments, the composition comprises a repair template. The repair template is a single-stranded or double-stranded DNA molecule.

[0158] Other embodiments include a manufacturing method for synthesizing a protein or a nucleic acid encoding a protein. In one embodiment, the article is a nucleic acid. In another embodiment, the protein is In a further embodiment, the nucleic acid comprises a DNA binding domain. In one embodiment, the protein comprises a nucleotide sequence that encodes a nuclease domain. In another embodiment, the nucleic acid comprises a nucleotide sequence encoding a nuclease domain. In one embodiment, the protein comprises multiple repeat sequences. In another embodiment, The nucleic acid encodes multiple repeat sequences. In a further embodiment, the nuclease domain is , FokI, StsI, StsI-HA, StsI-HA2, StsI-UHA, Sts I-UHA2, StsI-HF, and StsI-UHF, or their natural or engineered forms In one embodiment, the polypeptide is selected from engineered mutants or biologically active fragments. In another embodiment, the nucleic acid comprises an RNA polymerase promoter. The enzyme promoter is a T7 promoter or an SP6 promoter. In one embodiment, the nucleic acid comprises a viral promoter. In another embodiment, the nucleic acid is an in vitro transcription template.

[0159] Certain embodiments include methods for inducing cells to express proteins in vivo. Other embodiments relate to methods of transfecting cells in vivo with gene editing proteins. or by injecting cells with the gene editing protein in vivo. The present invention also relates to a method for modifying the DNA sequence of a cell in vivo, comprising inducing Another embodiment relates to a method for reducing expression of a protein of interest in a cell in vivo. In one embodiment, the cell is adapted to express a gene editing protein that nicks a target DNA molecule. The method is to express a gene editing protein capable of forming a double-stranded break or a double-stranded break in the target gene. In another embodiment, the nick or double-strand break results in gene inactivation. Yet other embodiments include inactive, reduced activity, or dominant in vivo In one embodiment, the protein is a seropositive protein. Yet another embodiment is a method for producing a medicament comprising administering to a subject an in vivo cell a mutated medicament comprising administering to the subject an endothelial ... In one embodiment, the cells are contacted with a repair template. In another embodiment, the repair template is a DNA molecule. The repair template does not contain a binding site for a gene editing protein. In this state, the repair template is coded with a DNA sequence that contains a binding site for the gene-editing protein. It codes for the amino acid sequence to be encoded.

[0160] Other embodiments include a therapeutically or cosmetically effective amount of a protein or a compound encoding a protein. The present invention relates to a method for treating a patient comprising administering to the patient a nucleic acid that In certain embodiments, treatment results in an improvement in one or more of the patient's symptoms. The embodiment includes: a. transfecting cells in vivo with a nucleic acid encoding a protein of interest. Inducing cells to express a protein of interest by inducing or b. a method for treating a patient, comprising reprogramming cells in vivo. In one embodiment, the cells are reprogrammed to a less differentiated state. In another embodiment, the cells encode one or more reprogramming proteins. Reprogramming can be achieved by transfecting cells with one or more synthetic RNA molecules. In a further embodiment, the cells are differentiated. The cells are responsible for the production of skin cells, glucose-responsive insulin-producing cells, hematopoietic cells, cardiac cells, and retinal cells. , kidney cells, nerve cells, interstitial cells, adipocytes, bone cells, muscle cells, oocytes, and sperm cells Another embodiment is a nucleic acid encoding a gene editing protein. Expressing gene-edited proteins by transfecting cells in vivo with and / or b. inducing cells to reprogram in vivo. The present invention relates to a method for treating a patient comprising administering

[0161] Other embodiments relate to a complex formation medium. In one embodiment, the complex formation medium comprises about 7 or greater than about 7.2, or greater than about 7.4, or greater than about 7.6 or greater than about 7.8, or greater than about 8.0, or greater than about 8.2, or Greater than about 8.4, or greater than about 8.6, or greater than about 8.8, or about 9.0 In another embodiment, the complex formation medium comprises transferrin. In a further embodiment, the complex formation medium comprises DMEM. In another embodiment, the complex formation medium comprises DMEM / F12. In one embodiment, the present invention relates to a method for forming a complex of a transfection reagent. The transfer reagent is incubated with the complex formation medium. Incubation occurs prior to the mixing step. In a further embodiment, the incubation step The duration is about 5 seconds to about 5 minutes, or about 10 seconds to about 2 minutes, or about 15 seconds to about 1 minute, or about 3 In one embodiment, the transfection reagent is selected from Table 2. In another embodiment, the transfection reagent is a lipid or lipid-like substance. In a further embodiment, the transfection reagent comprises a cation. In yet another embodiment, the cation is a multivalent cation. The cation reagent is N1-[2-((1S)-1-[(3-aminopropyl)amino]-4- [Di(3-aminopropyl)amino]butylcarboxamido)ethyl]-3,4-di[ oleyloxy]-benzamide (also known as MVL5) or its derivatives.

[0162] Certain embodiments involve contacting a cell with a nucleic acid in vivo to produce a protein. In one embodiment, the cell is a mammalian cell. In another embodiment, the cell is a human cell or a rodent cell. The present invention relates to a cell produced using one or more of the methods of the present invention. In another embodiment, the cells are present in a patient. In another embodiment, the cells are isolated from the patient. The morphology may be determined by screening assays that include cells generated using one or more of the methods of the present invention. In one embodiment, the screening library comprises a cardiotoxicity screening Toxicity screening, including screening for neurotoxicity, and screening for hepatotoxicity , potency screening, high throughput screening, high content screening The method is used for at least one of the following screening:

[0163] Other embodiments relate to kits containing the nucleic acid. In one embodiment, the kit includes a delivery reagent. In another embodiment, the kit contains a reagent (also known as a "transfection reagent"). In a further embodiment, the kit is a gene editing kit. Another embodiment relates to a kit for producing nucleic acids. In one embodiment, the kit comprises , pseudouridine triphosphate, 5-methyluridine triphosphate, 5-methylcytidine triphosphate 5-Hydroxymethylcytidine triphosphate, N4-Methylcytidine triphosphate, N4- Acetylcytidine triphosphate, and 7-deazaguanosine triphosphate, or one or more thereof Other embodiments include a nucleic acid-containing therapeutic agent or derivative thereof. In one embodiment, the therapeutic agent or cosmetic is a pharmaceutical composition. In an embodiment, the pharmaceutical composition is formulated. In a further embodiment, the formulation is in liposomal. Examples of liposome components are listed in Table 2 and are subject to the following restrictions: These are provided by way of example and not by way of limitation. In one embodiment, the liposome comprises one or more polysaccharides. In another embodiment, the PEG comprises a PEG200 chain. In a further embodiment, the liposome is 1,2-distearoyl-sn-glycol. DSPE or its derivatives. In one embodiment, the therapeutic agent comprises one or more ligands. In another embodiment, the therapeutic agent comprises androgen. Gen, CD30 (TNFRSF8), cell-penetrating peptide, CXCR, estrogen, Epidermal growth factor, EGFR, HER2, folic acid, insulin, insulin-like growth factor I, interleukin-1 -Leukin 13, integrin, progesterone, stromal-derived factor 1, thrombin, vitamin and transferrin, or biologically active fragments or variants thereof. Further embodiments include at least one of the variants. The present invention relates to a therapeutic agent or cosmetic comprising cells produced using the above. In one embodiment, The drug is used to treat type 1 diabetes, heart disease including ischemic and dilated cardiomyopathy, macular degeneration, and Parkinson's disease. , cystic fibrosis, sickle cell anemia, thalassemia, Fanconi anemia, severe combined immunodeficiency, Hereditary sensory neuropathy, xeroderma pigmentosum, Huntington's disease, muscular dystrophy, amyotrophic lateral sclerosis of sclerosis, Alzheimer's disease, cancer, and infectious diseases, including hepatitis and HIV / AIDS. is administered to a patient to treat at least one of the following:

[0164] [Table 3]

[0165] In some embodiments, the present invention relates to a method for the treatment of cancer, the entire contents of which are incorporated herein by reference. U.S. Patent Nos. 5,711,964, 5,891,468, 6,316, Nos. 260, 6,413,544, 6,770,291, and 7,390 This relates to one or more of the administration techniques described in US Pat. No. 5,780.

[0166] Certain embodiments include cap 0, cap 1, cap 2, and cap 3, In one embodiment, the nucleic acid comprises a 5' cap structure selected from the following derivatives: In another embodiment, the nucleic acid comprises one or more UTRs. In a further embodiment, one or more UTRs are alpha globin or beta globin. In yet another embodiment, the one or more UTRs comprise alpha globin or alpha globin 5' UTR. In yet another embodiment, the synthetic RNA molecule comprises an alpha globin 3' UTR. globin or β globin 5'UTR, and α globin or β globin 3'UTR. In one embodiment, the 5'UTR comprises a Kozak sequence substantially similar to the Kozak consensus sequence. In another embodiment, the nucleic acid comprises a 3' poly(A) tail. In this case, the 3′ poly(A) tail is about 20 nt to about 250 nt, or about 120 nt to about 1 In a further embodiment, the 3' poly(A) tail is about 20 nt in length. or about 30 nt, or about 40 nt, or about 50 nt, or about 60 nt, or about 70 nt, or about 80 nt, or about 90 nt, or about 100 nt, or about 110 nt, or about 120 nt, or about 130 nt, or about 140 nt, or about 150 nt, or about 160 nt, or about 170 nt, or about 180 nt, or about 190 nt, or about 200 nt, or about 210 nt, or about 220 nt, or about 230 nt, or about 240 nt, or about 250 nt in length.

[0167] Other embodiments relate to methods for reprogramming cells in vivo. In one embodiment, a cell is reprogrammed by contacting the cell with one or more nucleic acids. In one embodiment, the cells express Oct4 protein, Sox2 protein, Klf4 protein, Proteins, c-Myc proteins, Lin28 proteins, or their biological activities and a plurality of nucleic acids encoding at least one of the fragments, variants, or derivatives of the nucleic acid sequence. In another embodiment, the cells are contacted with an acid. Klf4 protein, c-Myc protein, or one or more of them Multiple coding sequences for multiple proteins, including active fragments, variants, or derivatives. In yet another embodiment, the method comprises the steps of: In one embodiment, the cell is genetically modified by contacting the cell with one or more nucleic acids. Child edited.

[0168] When delivered in vivo, the nucleic acid, including the liposome formulation containing the nucleic acid, is delivered to the liver and The nucleic acid encoding the protein may accumulate in the liver and / or spleen. and the ability to regulate protein expression in the The nucleic acids described herein may constitute a powerful therapeutic agent for the treatment of liver and spleen diseases. It has now been discovered that the ribozyme is capable of encoding a protein of interest. Method for treating liver and / or spleen disease by delivering to a patient a nucleic acid that binds to the Another embodiment relates to a method for treating liver and / or spleen disorders, comprising administering to the patient a protein of interest. The present invention relates to a therapeutic composition comprising a nucleic acid encoding the Diseases and conditions include hepatitis, alcohol-induced liver disease, drug-induced liver disease, Epstein-Barr disease, Virus infection, adenovirus infection, cytomegalovirus infection, toxoplasmosis , Rocky Mountain spotted fever, nonalcoholic fatty liver disease, hemochromatosis, Wilson's disease , Gilbert's disease, and cancer of the liver and / or spleen.

[0169] Certain embodiments include albumin treated with ion exchange resin or activated carbon, and contacting an in vivo cell with a solution containing one or more nucleic acid molecules, The present invention relates to a method for inducing cells in vivo to express a gene, comprising administering to said cells one or more nucleic acid molecules At least one of the sequences encodes a protein of interest. In another embodiment, the one or more nucleic acid molecules comprises a synthetic RNA molecule. In one embodiment, the cell is a skin cell. In one embodiment, the cell is a muscle cell. In yet another embodiment, the cell is a skin fibroblast cell. In yet another embodiment, the cell is a myoblast. In another embodiment, the protein of interest is an elastase protein. tin, collagen, laminin, fibronectin, vitronectin, lysyl oxidase , elastin-binding protein, growth factor, fibroblast growth factor, transforming Growth factor β, granulocyte colony-stimulating factor, matrix metalloproteinase, actin, fibronectin Brilin, a microfibril-associated glycoprotein, a lysyl oxidase-like protein, and In one embodiment, the solution is delivered to the dermis. In an embodiment, delivery is by injection. In yet another embodiment, delivery is by microneedling. In one embodiment, the solution further comprises growth factors. In an embodiment, the growth factor is selected from fibroblast growth factor and transforming growth factor beta. In yet another embodiment, the solution further comprises cholesterol.

[0170] Another embodiment involves combining a solution comprising cholesterol and one or more nucleic acid molecules with cells in vivo. Inducing cells in vivo to express a protein of interest, comprising contacting the cells with wherein at least one of the one or more nucleic acid molecules In one embodiment, the method further comprises: Yet another embodiment is a method for treating the ion exchange resin or activated carbon. contacting an in vivo cell with a solution containing albumin and a nucleic acid molecule. The present invention relates to a method for transfecting cells in vivo in a mammalian cell, comprising: The method provides for the cell to be transfected with the nucleic acid molecule. The nucleic acid molecule may be a dsDNA molecule, a ssDNA molecule, a dsRNA molecule, a ssRNA molecule, Plasmids, oligonucleotides, synthetic RNA molecules, miRNA molecules, mRNA molecules, s In yet another embodiment, the nucleic acid molecule is an iRNA molecule. and delivering to the patient a composition comprising the albumin treated with the method of claim 1 and one or more nucleic acid molecules. The present invention relates to a method for treating a patient, comprising administering to a patient a nucleic acid sequence comprising at least one of the one or more nucleic acid molecules. In one embodiment, the method comprises: In another embodiment, the method results in expression of a protein of interest in the dermis of the patient. Brings about expression.

[0171] Certain embodiments include albumin treated with ion exchange resin or activated carbon, and nuclei. In one embodiment, the present invention relates to a cosmetic composition comprising the acid molecule. In another embodiment, the present invention relates to a cosmetic treatment article. In one embodiment, the cosmetic treatment article comprises an implement configured to deliver the composition to a patient. In another embodiment, the nucleic acid molecule encodes an elastin protein or a collagen protein. Yet another embodiment is a combination of cholesterol or a cholesterol analog and 1 The present invention relates to a solution for transfecting cells in vivo, comprising one or more nucleic acid molecules. In one embodiment, cholesterol or a cholesterol analog is attached to one or more nucleic acid molecules. In another embodiment, the cholesterol analog is covalently attached to at least one of the is an oxysterol. In yet another embodiment, the cholesterol analog is Substitution, B-ring substitution, D-ring substitution, side chain substitution, cholestanoic acid id), cholestenoic acid, polyunsaturated moiety, heavy water one or more of a halogenated moiety, a fluorinated moiety, a sulfonated moiety, a phosphorylated moiety, and a fluorescent moiety. In yet another embodiment, the method further comprises administering to the subject a dermal filler, a neurotoxin (illustratively, sodium Umium channel blockers (e.g., tetrodotoxin), potassium channel blockers (e.g., tetraethylammonium), chloride channel inhibitors (e.g., chlorotoxin and chlorine Re), calcium channel blockers (e.g., conotoxins), inhibitors of synaptic vesicle release (e.g., botulinum toxin and tetanus toxin), and inhibitors of the blood-brain barrier (e.g., aluminum The present invention includes treating the patient with one or more of the following:

[0172] For example, botulinum toxin type A has been used to treat essential blepharospasm, strabismus and unilateral eyelid glaucoma in patients over 12 years of age. For the treatment of facial spasms, cervical dystonia, frown lines, (facial) wrinkles, and excessive sweating It has been approved by the U.S. Food and Drug Administration (FDA) for the treatment of botulinum type B infection. The toxin is approved for the treatment of cervical dystonia. The composition may be used to treat these diseases. These toxins may also be combined in therapy.

[0173] Additionally, any one combination of the aforementioned toxins may result in facial wrinkles, hyperactive skin lines, and brow blemishes. Wrinkles between the eyes, crow's feet, nasolabial folds, skin disorders, nasolabial folds, blepharospasm, strabismus, hemifacial spasm The present compositions and methods are also useful for various cosmetic treatments, including, but not limited to, those for treating sweating disorders. Alternatively, the present compositions may be used as a monotherapy to provide these cosmetic treatments. It may also be used in such a case.

[0174] Certain embodiments include one or more of the pharmaceutical or cosmetic compositions of the present invention and Combination therapies including one or more adjunctive or cosmetic treatments. In some embodiments, one or more of the pharmaceutical or cosmetic compositions of the present invention may be used in combination with one or more adjunctive therapeutic agents. The present invention is administered to subjects undergoing treatment with adjunctive therapy or cosmetic treatment. Examples of adjunctive therapy and cosmetic treatment (Example) is U.S. Provisional Patent Application No. 6, the contents of which are incorporated herein by reference. Tables 3 and 5 of 1 / 721,302 are provided by way of example and not by way of limitation. can be done.

[0175] [Table 4] [Table 5]

[0176] The pharmaceutical formulation may further comprise a delivery reagent (also known as a "transfection reagent"), and / or a medicament. The vehicle may include a pharma- ceutically acceptable delivery agent, excipient, and a patient (a.k.a. "subject"). "), methods for their preparation and use, including methods for preparing and administering pharmaceutical formulations, are described in the present application. No. 5,993,333, which is well known in the art and is incorporated herein by reference in its entirety. It has been described in numerous publications, including Publication No. 2008 / 0213377.

[0177] For example, the compositions of the present invention can be in the form of a pharma- ceutically acceptable salt. Such salts are described, for example, in J. Pharma. Sci.66,2-19(1977) and The Handbook of Phar maceutical salts;Properties,Selection,an d Use.PHStahl and CGWermuth(eds.),Ve including those described in Rlag, Zurich (Switzerland) 2002 Non-limiting examples of pharma- ceutically acceptable salts include sulfates, citrates, acetates, and the like. , oxalate, chloride, bromide, iodide, nitrate, bisulfate, phosphate acid phosphate, isonicotinate, Lactate, salicylate, acid citrate, tart Late, oleate, tannate, pantothenate, bittertrate, ascorbate, sucrose succinate, malate, gentisinate, fumarate, gluconate, glucaronate, Saccharate, formate, benzoate, glutamate, methanesulfonate, ethane Sulfonate, benzenesulfonate, p-toluenesulfonate, camphorsulfonate Acetate, pamoate, phenylacetate, trifluoroacetate, acrylate, chloroacetate Nitrobenzoate, dinitrobenzoate, hydroxybenzoate, methoxybenzoate , methyl benzoate, o-acetoxy benzoate, naphthalene-2-benzoate , isobutyrate, phenylbutyrate, α-hydroxybutyrate, butyne-1,4- Dicarboxylate, hexyne-1,4-dicarboxylate, caprate, caprylate , cinnamate, glycolate, heptanoate, hippurate, Malate, hydroxymalate, malonate, mandelate, mesylate, nicotinate , phthalate, teraphthalate, propiolate, propionate, phenylpropionate ester, sebacate, suberate, p-bromobenzenesulfonate, chlorobenzenesulfonate sulfonate, ethyl sulfonate, 2-hydroxyethyl sulfonate, methyl sulfonate Naphthalene-1-sulfonate, Naphthalene-2-sulfonate, Naphthalene-1, 5-sulfonate, xylene sulfonate, tartrate; Nat hydroxides of alkali metals such as sodium, potassium, and lithium; hydroxides of calcium and magnesium hydroxides of alkaline earth metals such as sodium; hydroxides of other metals such as aluminum and zinc ammonia and unsubstituted or hydroxy-substituted mono-, di-, or tri-alkyl Amines and other organic amines;Dicyclohexylamine;Tributylamine;Pyridine;N- Methyl, N-ethylamine; diethylamine; triethylamine; mono-, bis-, or Tris-(2-hydroxyethyl)amine, 2-hydroxy-tert-butylamine or tris-(hydroxymethyl)methylamine; N,N-Dimethyl-N-(2-hydroxyethyl)amine N,N-di-lower alkylamine, such as tri(2-hydroxyethyl)amine or tri(2-hydroxyethyl)amine N-methyl-D-glucamine;Alkyl-N-(hydroxyl-lower alkyl)-amines;N ... These include amino acids such as ginine, lysine, and the like.

[0178] The pharmaceutical composition may contain water and oils such as peanut oil, soybean oil, mineral oil, sesame oil, and the like. Contains excipients that contain liquids such as oils, including those of petroleum, animal, vegetable, or synthetic origin Pharmaceutical excipients include, for example, saline, gum acacia, gelatin, starch, etc. It can be glue, talc, keratin, colloidal silica, urea, and the like. In addition, auxiliary, stabilizing, thickening, lubricating, and coloring agents can be used. In certain embodiments, pharma- ceutically acceptable excipients are sterile when administered to a subject. Excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice , wheat flour, chalk, silica gel, sodium stearate, glycerol monostearate glycerol, propylene, glycol, Water, ethanol, and the like. Any of the agents described herein may further include, if necessary, If desired, the composition can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents.

[0179] In various embodiments, the compositions described herein can be administered in doses ranging from, for example, about 1 mg / kg to about 100 mg / kg, about 2.5 mg / kg to about 50 mg / kg, or about 5 mg / kg to about It can be administered at an effective dose of 25mg / kg. Exactly what is considered an effective dose is unclear. The appropriate decision may be based on factors individual to each patient, including size, age, and type of disease. The amount can be readily ascertained by one of ordinary skill in the art from this disclosure and knowledge in the art. For example, dosages are described in Physici, 2002, 2003, the contents of which are incorporated by reference in their entirety. ans'Desk Reference,66th Edition,PDR Netw Ork;2012 Edition (December 27, 2011) may be decided. stomach.

[0180] The active compositions of the present invention may include typical pharmaceutical formulations. Administration of the agent may be via any common route, so long as the target tissue is available via that route. This may include oral, nasal, or buccal. Alternatively, administration may be intradermal, subcutaneous, By intramuscular, intraperitoneal, or intravenous injection, or by direct injection into cancer tissue The agents disclosed herein may also be administered via a catheter system. Such compositions are generally described as pharma- ceutically acceptable compositions, as described herein. It is administered as follows.

[0181] Upon formulation, solutions will be dispensed in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. Formulations may be administered in the form of injectable solutions, drug-releasing capsules, and the like. For parenteral administration in an aqueous solution, for example, the solution is generally The liquid diluent should be suitably buffered, e.g., with sufficient saline or glucose. Such aqueous solutions are suitable for, e.g., intravenous, intramuscular, subcutaneous, and intraperitoneal administration. Preferably, a sterile aqueous medium is used, as known to those skilled in the art, particularly As used in the context of this disclosure.

[0182] Representative subjects or patients include humans and other primates (e.g., chimpanzees and other apes). and monkey species), livestock (e.g., cattle, sheep, pigs, goats, and horses), domestic milk Animals (e.g., dogs and cats), laboratory animals (e.g., mice, rats, and guinea pigs), rodents, and birds (e.g., chickens, turkeys, and other poultry birds, (including domestic, wild and game birds such as leeches, geese and the like) In some embodiments, the subject is a mammal. In some embodiments, the subject is a human.

[0183] Administration of the compositions described herein can be by, for example, injection, topical administration, ocular administration, and nasal administration. Injections may be by injection, including but not limited to intradermal, subcutaneous, and intramuscular routes. In some embodiments, the injection may include an electrical force (e.g., an electrochemical Electroporation, including instruments that find use in , IGEA Srl, Carpi [MO], Italy). may be a cream, lotion, ointment, gel, spray, solution, and the like. Topical administration may further include, but is not limited to, surfactants, fatty acids, bile acids, chelating agents, etc. Agent, Non-chelating non-surfactant, Polyoxyethylene-9-lauryl ether, Polyoxy Ethylene-20-cetyl ether, fatty acids and / or salts in combination with bile acids and / or salts or salts, lauric acid, capric acid, and sodium salts in combination with UDCA, and Topical administration may further include a penetration enhancer, such as, but not limited to, a fragrance. The composition may include colorants, colorants, sunscreens, antibacterial agents, and / or moisturizers. The composition applied is intended for application to the forehead, scalp, hair follicles, hair, upper eyelids, lower eyelids, eyebrows, eyelashes, infraorbital eyelids, and the like. Rear, periorbital area, temples, nose, bridge of nose, cheeks, tongue, nasolabial folds, lips, periocular area ( periobicular areas), jaw line, ears, neck, chest, forearms, upper arms, hands Palms, hands, fingers, nails, back, abdomen, sides, buttocks, thighs, calves, feet, toes, and the like The administration may be to at least one site, such as, but not limited to, one or more of the following:

[0184] [Table 6] [Table 7] [Table 8] [Table 9] [Table 10]

[0185] The invention is further illustrated by the following non-limiting examples. EXAMPLES

[0186] Example 1 RNA synthesis Green fluorescent protein or human proteins elastin, tyrosinase, melanocortin 1 receptor, hyaluronan synthase 1, hyaluronan synthase 2, hyaluronan synthase 3 , Type III collagen a1, Type VII collagen a1, Interleukin 10, P-selenium Cutin glycoprotein ligand 1, α-(1,3)-fucosyltransferase (fucosyltransferase osyltransferase) Oct4, Sox2, Klf4, c-Myc-2( T58A), and Lin28, or human genes XPA, CCR5, TERT, MYC, and TALENs encoding BIRC5-targeting TALENs with various canonical and non-canonical nucleotides. The RNA containing the combination of (U.S. Patent Application Serial No. 13 / 465,490 (now U.S. Patent No. 8,497,124), International Application No. PCT / US12 / 67966, U.S. Patent Application No. 13 / 931,251; and International Patent Application No. PCT / US13 / 68118, the contents of all of which are incorporated herein by reference in their entirety. (incorporated herein by reference) using a T7 high yield RNA synthesis kit and mRNA synthesis kit. Vaccinia capping system with A-cap 2'-O-methyltransferase DNA was purified using a DNA kit (all manufactured by New England Biolabs, Inc.). The RNA was synthesized from the A template (Table 4). The RNAse inhibitors were diluted to 100 µg / µL with nuclease-free water for certain experiments. Harmful agent (Superase·In, Life Technologies Corpora tion) was added at a concentration of 1 μL per 100 μg of RNA. The RNA solution was stored at 4C. For reprogramming experiments, Oct4, Sox2, Klf4, c-Myc- 2(T58A), and RNA encoding Lin28 at a molar ratio of 3:1:1:1:1. Mixed.

[0187] [Table 11] [Table 12]

[0188] "A" stands for adenosine-5'-triphosphate and "G" stands for guanosine-5'-triphosphate "U" stands for uridine-5'-triphosphate and "C" stands for cytidine-5'-triphosphate. "5mC" refers to 5-methylcytidine-5′-triphosphate, and "5hmC" refers to 5 -hydroxymethylcytidine-5′-triphosphate, and "5cC" stands for 5-carboxycytidine "5fC" stands for 5-formylcytidine-5'-triphosphate. "psU" refers to 5-pseudouridine-5′-triphosphate, and "5mU" refers to 5 -methyluridine-5′-triphosphate, and “5hU” refers to "7dG" refers to the 5'-triphosphate of uridine with a methyl group attached to the oxygen atom of the refers to 7-deazaguanosine-5′-triphosphate.

[0189] Example 2 Transfection of cells with synthetic RNA For transfection in a 6-well plate, 2 μg of RNA and 6 μL of transfection medium were used. Transfection reagent (Lipofectamine RNAiMAX, Life Technologies) First, the complex formation medium (Opti chnologies Corporation) was -MEM, Life Technologies Corporation, or DM EM / F12 + 10 μg / mL insulin + 5.5 μg / mL transferrin + 6 Separately dilute with 0.7 ng / mL sodium selenite + 2 μg / mL ethanolamine The diluted RNA and transfection Mix the transfection reagent and the ELISA kit according to the manufacturer's instructions and incubate at room temperature for 1 Incubated for 5 minutes. The complex was then added to the cells in culture. 12 μL to 24 Add 0.0 μL of complex to a well already containing 2 mL of transfection medium. The complexes were added to each well of a 6-well plate. The plate was gently shaken to distribute the complexes to the wells. The cells were incubated with the complexes for 4 hours to overnight, after which the medium was replaced with fresh The transfection medium was replaced with fresh transfection medium (2 mL / well). Reduced for transfection in 6-well plates. Alternatively, 0.5 μg to 5 μg of RNA and 2–3 μL of transfection reagent (Li pofectamine 2000, Life Technologies Corpo ration) was first prepared using complex formation medium (Opti-MEM, Life Technologies, Logies Corporation, or DMEM / F12+10μg / mL insulin + 5.5 μg / mL transferrin + 6.7 ng / mL sodium selenite Dilute separately with 100 μL of ethanolamine (1 μg / mL ethanolamine + 2 μg / mL ethanolamine) and add 5 μL to 100 μL of ethanolamine. The diluted RNA and transfection reagent were then mixed and incubated at room temperature. The mixture was incubated at 4°C for 10 min. The complex was then added to the cells in culture. Add 200 μL of complexes to a well already containing 2 mL of transfection medium. In one particular experiment, DMEM + 10% FBS or DMEM + 50% FBS instead of transfection medium The plate was gently shaken to distribute the complexes throughout the wells. The cells were incubated for 4 h. In certain experiments, the medium was incubated with the complexes for 1 h at 4 °C for 1 h at 4 °C. After 4 or 24 hours of transfection, fresh transfection medium (2 mL / well) was added. ) and exchanged it for

[0190] Example 3 Toxicity of synthetic RNA containing non-standard nucleotides and proteins derived therefrom translation Primary human fibroblasts were cultured with RNA synthesized according to Example 1 and with RNA synthesized according to Example 2. Twenty to 24 hours after transfection, the cells were transfected with The cells were fixed and stained with an antibody against ct4. The relative toxicity of RNA was evaluated by the This was determined by assessing the density.

[0191] Example 4 Transfection Media Formulations The cell culture medium is then mixed with the nucleic acid for efficient transfection of cells with nucleic acid and efficient reprogramming of the cells. ("Transfection medium"): DMEM / F12 + 15mM HEPES + 2mM L-alanyl-L-glutamine + 10 μg / mL insulin + 5.5 μg / mL transferrin + 6.7 ng / mL Sodium Selenite + 2μg / mL Ethanolamine + 50μg / mL L-Aspartate Corbic acid 2-phosphate sesquimagnesium salt hydrate + 4 μg / mL cholesterol + 1 μM hydrocortisone + 25 μg / mL polyoxyethylene sorbitan monophosphate Oleate + 2μg / mL D-α-tocopherol acetate + 20ng / mL bFG F+ 5mg / mL processed human serum albumin.

[0192] A variant of this medium has been demonstrated to support robust long-term culture of a variety of cell types, including pluripotent stem cells. Created to support ("Maintenance Medium"): DMEM / F12 + 2 mM L-alanyl-L-glutamine + 10 μg / mL insulin Phosphorus + 5.5 μg / mL transferrin + 6.7 ng / mL sodium selenite + 2μg / mL ethanolamine + 50μg / mL L-ascorbic acid 2-phosphoric acid sesquimagnesium sulfate hydrate + 20ng / mL bFGF + 2ng / mL TGF -β1.

[0193] Treated human serum albumin was incubated with 32 mM sodium octanoate followed by The mixture was heated at 60°C for 4 hours, followed by ion exchange resin (AG501-X8(D)) at room temperature for 6 hours. (Bio-Rad Laboratories, Inc.), followed by overnight incubation at room temperature. , dextran-coated activated charcoal (C6241, Sigma-Aldrich Co. LLC.), followed by centrifugation, filtration, and dilution with nuclease-free water for 10 min. % solution and then added to the other components of the medium. The transfection medium was used in all examples described herein unless otherwise noted. For reprogramming experiments, cells were transfected with 100% ethanol as described separately. Unless otherwise specified, use DMEM + 10%-20% serum, uncoated plates, or Transfection medium, fibronectin and vitronectin coated The transfection medium was then plated onto either of the plates. The formulation of the transfection medium was adjusted to suit the specific cell type being cultured. It will be appreciated that the process can be tailored to meet the needs of the cell type. Human serum albumin is more compatible with other processed albumins without adversely affecting medium performance. It will be appreciated that the glycerol may be replaced with, for example, treated bovine serum albumin. A glutamine source, such as L-glutamine, may be used instead of L-alanyl-L-glutamine. Other buffer systems, e.g., phosphate, betaine, that carbonates, etc., can be used in place of or in addition to HEPES; Other forms of selenium, such as selenite, may be used in place of or in combination with sodium selenite. In addition to L-ascorbic acid, other antioxidants such as L- Ascorbic acid 2-phosphate sesquimagnesium salt hydrate and / or D-α-tocopherol It can be used in place of or in addition to copherol acetate, Surfactants such as Pluronic F-68 and / or Pluronic F-1 27 may be used in place of or in addition to polyoxyethylene sorbitan monooleate. It is possible to use other basal media such as MEM and DMEM, and DMEM / F1 2 can be used instead of or in addition to it, and the composition of the culture medium The components do not adversely affect the performance of the medium, e.g., TGF-β on days 0-5. After that, use medium containing 2 ng / mL TGF-β from day 5 onwards. It will be appreciated that the amount of the composition may vary over time depending on the amount of other ingredients, e.g. For example, fatty acids, lysophosphatidic acid, lysosphingomyelin, sphingosine-1-phosphate phosphates, other sphingolipids, ROCK inhibitors including Y-27632 and thiazovivin Inhibitors, members of the TGF-β / NODAL family of proteins, IL-6, proteins Members of the Wnt family can be added at appropriate concentrations without adversely affecting the performance of the medium. It has been shown that the agonist can be added to the nucleosomes of cells, and can promote or inhibit the growth of specific cell types. Agonists and / or antagonists of the compounds and / or proteins or other molecules known to promote or inhibit the growth of specific cell types, e.g. When used with phingosine-1-phosphate and pluripotent stem cells, these cell types In this case, it can be added to the medium at an appropriate concentration without adversely affecting the performance of the medium. It is recognized that the present invention also provides for components added as purified compounds, parts of distinct mixtures. Ingredients, complexes or indefinite mixtures added as part of, e.g., animal or vegetable oils and components added by biological processes, e.g. acclimation. The concentrations of the components may be varied as would be apparent to one skilled in the art without adversely affecting the performance of the medium. The ranges may vary from the stated values. The medium was modified with recombinant versions of all protein components and semi-synthetic plant-derived cholesterol ( All non-animal derived versions of Avanti Polar Lipids, Inc. It was produced by using all other components.

[0194] Example 5 Transfection Media Formulations The medium allows efficient transfection, reprogramming, and gene editing of cells. Created to support: DMEM / F12 + 10 μg / mL insulin + 5.5 μg / mL transferrin glycerol + 6.7 ng / mL sodium selenite + 20 ng / mL bFGF + 5 mg / mL L of treated human serum albumin.

[0195] Variants of media can be combined with specific transfection reagents, specific nucleic acids, and specific cell types: DMEM / F12 + 10 μg / mL insulin + 5.5 μg / mL transferrin +6.7ng / mL sodium selenite +4.5μg / mL cholesterol +20 ng / mL bFGF + 5mg / mL treated human serum albumin in DMEM / F12 + 10 μg / mL insulin + 5.5 μg / mL transferrin + 6.7 ng / m L sodium selenite + 1 μM hydrocortisone + 20 ng / mL bFGF + 5 10 mg / mL of treated human serum albumin, and 10 μg / mL of DMEM / F12+ insulin + 5.5 μg / mL transferrin + 6.7 ng / mL sodium selenite + 4.5 μg / mL cholesterol + 1 μM hydrocortisone + 20 ng / mL Improved when used with 10 mg / mL bFGF + 5 mg / mL processed human serum albumin It was created to provide the performance

[0196] In certain experiments, additional components (listed at exemplary concentrations) were added to the cell culture medium. An example of a solution containing 15 mM HEPES, 2 mM L-alanyl-L-glutamine, 2 μg / mL ethanolamine, 10 μg / mL fatty acids, 10 μg / mL cod liver oil fatty acids (methyl ester), 25 μg / mL polyoxyethylene sorbitan monooleate, 2 μg / mL D-α-tocopherol acetate, 1-50 μg / mL L-ascorbyl phosphate 2-phosphate sesquimagnesium salt hydrate, 200ng / mL B18R, and and 0.1% Pluronic F-68.

[0197] For certain experiments in which the media was conditioned, the following variants were used: DMEM / F12 + 15mM HEPES + 2mM L-alanyl-L-glutamine + 10 μg / mL insulin + 5.5 μg / mL transferrin + 6.7 ng / mL Sodium selenite + 2μg / mL ethanolamine + 4.5μg / mL cholesterol Tetraterol + 10 μg / mL cod liver oil fatty acid (methyl ester) + 25 μg / mL polio Dioxyethylene sorbitan monooleate + 2 μg / mL D-α-tocopherol acetate + 1μg / mL L-ascorbic acid 2-phosphate sesquimagnesium salt hydrate + 0.1% Pluronic F-68 + 20ng / mL bFGF + 5mg / mL Processed human serum albumin.

[0198] For certain experiments in which the medium was not conditioned, the following variants were used: DMEM / F12 + 15mM HEPES + 2mM L-alanyl-L-glutamine + 10 μg / mL insulin + 5.5 μg / mL transferrin + 6.7 ng / mL Sodium selenite + 2μg / mL ethanolamine + 4.5μg / mL cholesterol Terol + 1 μM hydrocortisone + 0 to 25 μg / mL polyoxyethylene sorbitol Tanmonooleate + 2μg / mL D-α-tocopherol acetate + 50μg / mL L-ascorbic acid 2-phosphate sesquimagnesium salt hydrate + 20ng / mL of bFGF + 5mg / mL processed human serum albumin.

[0199] To prepare these mutants, treated human serum albumin was diluted with 32 mM octadecyl sulfate. Sodium phosphate was added, followed by heating at 60°C for 4 hours, followed by ion exchange at room temperature for 6 hours. The cells were treated with resin (AG501-X8(D)) and then coated with dextran overnight at room temperature. Treated with activated carbon (C6241, Sigma-Aldrich Co. LLC.) followed by centrifugation, filtration, and adjustment to a 10% solution with nuclease-free water, followed by The medium was treated by adding it to the other components of the medium. To do this, the medium was conditioned on irradiated human neonatal fibroblast feeders for 24 h. Procedure: Unless otherwise noted, cells were grown on fibronectin-coated plates or Plated on fibronectin and vitronectin coated plates Ta.

[0200] Media formulations can be tailored to meet the needs of the particular cell type being cultured. In addition, in certain circumstances, the processed human serum albumin may be more effective than other processed albumins. glutamine, e.g., processed bovine serum albumin, and other glutamine sources, For example, L-glutamine can be used in place of or in addition to L-alanyl-L-glutamine. Other buffer systems, e.g., phosphate, bicarbonate, etc., can be used. Other forms of selenium may be used in place of, or in addition to, EPES, e.g. Selenite may be provided in place of, or in addition to, sodium selenite. Other antioxidants, such as L-ascorbic acid, can be used. Phosphate sesquimagnesium salt hydrate and / or D-α-tocopherol acetate Alternatively or in addition, other surfactants may be used, such as Pluro nic F-127 is a polyoxyethylene sorbitan monooleate and / or Plu Other basal media that can be used in place of or in addition to ronic F-68 For example, MEM, DMEM, etc. can be used instead of or in addition to DMEM / F12. The components of the culture medium can be, for example, TGF-β-free on days 0 to 5. Use medium, then use medium containing 2ng / mL TGF-β from day 5 onwards. In certain circumstances, other ingredients, e.g., fats, may be added to the mixture over time. Fatty acids, lysophosphatidic acid, lysosphingomyelin, sphingosine-1-phosphatase Phages, other sphingolipids, and members of the TGF-β / NODAL family of proteins IL-6, members of the Wnt family of proteins, etc. can be added at appropriate concentrations. and / or proteins known to promote or inhibit the growth of specific cell types. Agonists and / or antagonists of proteins, or those that promote the growth of specific cell types Other molecules known to inhibit or inhibit sphingosine-1-phosphate and and pluripotent stem cells should be added to the medium at the appropriate concentration when used with those cell types. Components can be purified compounds, parts of well-defined mixtures, or parts of complex or indefinite mixtures. It can take the form of oils, e.g., animal or vegetable oils, and can be used in biological processes, e.g. The concentrations of the components are described within the scope of what would be apparent to one skilled in the art. The values ​​can vary from those given.

[0201] Example 6 Transfection of cells with synthetic RNA For transfection in a 6-well plate, 2 μg of RNA and 6 μL of transfection medium were used. Transfection reagent (Lipofectamine™ RNAiMAX, Lif e Technologies Corporation) was first added to the complex formation medium ( Opti-MEM®, Life Technologies Corpora tion) to a total volume of 60 μL each. The diluted RNA was then and transfection reagent according to the manufacturer's instructions. The complexes were then added to the cells in culture. 30 μL to 240 μL of the complex was added to 2 mL of transfection per well. Culture medium was added to each well of a 6-well plate that already contained medium. The plate was then gently The cells were incubated with the complexes for 2 hours to overnight. After incubation, the medium was replaced with fresh transfection medium (2 mL / well). The amount was reduced for transfection in 24-well and 96-well plates. The cells were immunofluorescently stained with an antibody against Oct4 20–24 h after transfection. The cells were fixed and stained for 1 h. Nuclei were stained and counted, and the relative toxicity of RNA was determined.

[0202] Example 7 Nucleic acid transfection and RNA analysis of unprocessed human serum albumin preparations Analysis of the ability to support reprogramming Primary human neonatal fibroblasts were cultured in medium with or without 5 mg / mL HSA. Cohn Fraction V (A6784, Sigma-Aldrich Co. LLC) .) and four different recombinant HSA preparations (Sigma-Aldrich Co. LLC. The following antibodies were screened: A6608, A7736, A9731, and A9986 (manufactured by Eppendorf). The cells were transfected according to Example 2 with RNA synthesized according to Example 1. Non-transfected cells were transfected with Although the cells grew well on media containing any of the HSA preparations in the sample, each of the HSA preparations Dramatically different cell morphology and cell density were obtained, and morphological changes indicative of reprogramming were observed. It was not brought about.

[0203] Example 8. Preparation of Octanoate-Treated Human Serum Albumin A 10% HSA solution was prepared by dissolving 22 mM sodium chloride and 16 mM sodium octanoate in 10 mL of 100 mL of 10% ethanol. The cells were preincubated with 100% ethanol (Sigma-Aldrich Co. LLC) and incubated in complete medium. Incubate at 37C for 3 hours before assembly.

[0204] Example 9. Treatment of human serum albumin using ion exchange chromatography Dissolve 2 g of HSA in 10 ml of nuclease-free water with gentle stirring at room temperature. By using Pichia pastoris (A7736, Sigma-Aldrich Co., A 20% solution of recombinant HSA produced by .LLC. was prepared. Bed deionization resin (AG 501-X8(D), Bio-Rad Laboratories The HSA solution was deionized by adding 100% ethanol (Ess, Inc.) and rocking at room temperature for 1 hour. The HSA solution was then decanted into a tube containing 5 g of fresh resin and incubated at room temperature for 4 hours. Finally, the deionized HSA solution was decanted and diluted with nuclease-free water for 1 The total protein content was adjusted to 0%, and the solution was filtered through a 0.2 μm PES membrane filter. It was filter sterilized and stored at 4C.

[0205] Example 10: Cultured in medium containing octanoate-treated human serum albumin Analysis of transfection efficiency and viability of cultured cells Primary human neonatal fibroblasts were treated according to Example 8 and / or Example 9. Contains recombinant HSA or processed plasma-derived HSA (Bio-Pure HSA, The cells were cultured in a medium containing 100% ethanol (Dietary Biological Industries). Then, the cells were transfected daily with RNA synthesized according to Example 1 and according to Example 2. The images were taken on day 3. Morphological changes resembling mesenchymal to epithelial transition were observed. Several small areas of cells undergoing oxidative stress were observed in wells containing octanoate. The results showed increased transfection efficiency. Numerous large areas of morphological changes were observed in samples containing treated plasma-derived HSA. In both cases, morphological changes were a hallmark of reprogramming.

[0206] Example 11 Human serum albumin-containing medium containing octanoate-treated human serum albumin Reprogramming Human Fibroblasts Primary human neonatal fibroblasts were cultured at a density of 5000 cells / well in fibroblast medium (DM The cells were plated in a 6-well plate containing 10% fetal bovine serum (EM) and 10% fetal bovine serum (FBS). After 6 hours, the cells were was replaced with transfection medium containing octanoate-treated HSA. From day 0, the cells were cultured with RNA synthesized according to Example 1 and RNA synthesized according to Example 2. Transfections were performed daily. By day 5, the wells contained The experiment contained several areas of cells showing the same morphology as the feeder or immune cells. The use of antimicrobial suppressants was not included.

[0207] Example 12: Cultured in a medium containing human serum albumin treated with ion exchange resin Analysis of transfection efficiency and viability of cultured cells Starting from day 0, primary human neonatal fibroblasts were transfected with RNA synthesized according to Example 1. Transfection was performed according to Example 2. Images were taken on day 2. Untreated HS Cells in wells containing A were transferred to wells containing treated plasma-derived HSA or ions. The viability was lower than that of any of the wells containing recombinant HSA treated with exchange resin. showed.

[0208] Example 13 Human fibroblasts using human serum albumin treated with ion exchange resin Reprogramming Primary human neonatal fibroblasts were cultured at a density of 10,000 cells / well in fibroblast medium ( DMEM + 10% fetal bovine serum) on feeders in 6-well plates. From day 0, the cells were cultured with RNA synthesized according to Example 1 and RNA synthesized according to Example 2. Passage with a split ratio of 1:20 was performed on day 4. Images were taken on day 10. The wells contained cells exhibiting morphology consistent with reprogramming. Many large colonies were contained. The colonies were cultured in cell culture medium containing untreated HSA. None were observed in wells exposed to

[0209] Example 14 Reprogramming of human fibroblasts without feeders or immunosuppressants ng Primary human fibroblasts were cultured at a density of 20,000 cells / well in fibroblast medium (DME) After 6 hours, the medium was , transfection medium containing treated HSA, or without immunosuppressants The RNA dose was reduced to 1 μg / well, and the cells were then treated with 100 μl of 10 ... RNA synthesized according to Example 1, except that transfection was performed Transfection was performed daily according to Example 2. Images were taken on the 7th day. Small colonies of cells exhibiting morphology consistent with gramming were visible as early as day 5. On day 7, the medium was changed to DMEM / F12 + 20% Knockout™ Se rum Replacement(Life Technologies Corpor ation) + 1X non-essential amino acids + 2mM L-glutamine, and irradiated for 24 hours. The cells were then conditioned with 20 ng / mL bFGF and 10 μM Y- 27632. Large colonies with reprogrammed morphology were quickly Colonies were visible on day 8. Colonies were picked on day 10 and cultured with basement membrane extract (Cult rex® Human BME Pathclear®, Trevi The cells were plated onto wells coated with GFP (GFP-10001). The established line expressed the pluripotent stem cell markers Oct4 and S Positive staining for SEA4 was observed. The entire protocol was repeated with similar results.

[0210] Example 15 Efficient and rapid derivation and reprogramming of cells from human skin biopsy tissue Full-thickness skin punch biopsies were performed according to an approved protocol in healthy 31-year-old volunteers. Briefly, topical application of 2.5% lidocaine was administered to the skin area of ​​the left upper arm. The area was disinfected with 70% isopropanol and a full thickness skin biopsy was performed. The tissue was then immersed in phosphate-buffered saline (PBS) for 1 h. Then, 250 μL of TrypLE™ Select CTS™ (Life Technologies and placed in a 1.5 mL tube containing 100% glycerol (GlcNAc) from Biotechnology Corporation. The tissue was then incubated for 30 minutes at 37° C. The tissue was then resuspended in 250 μL of DMEM / F12- CTS(trademark)(Life Technologies Corporation)+5 Transfer to a 1.5 mL tube containing 2 mg / mL collagenase and incubate at 37 C for 2 hours. The epidermis was removed using forceps and the tissue was mechanically dissociated. The cells were then cultured in DM Rinse twice with EM / F12-CTS™ and filter the 24-well and 96-well plates. The cells were plated onto wells coated with bronchin. The patient was randomly assigned to receive the blood sample, and venous blood was collected in a Vacutainer® SST™ tube (B Serum was collected at the Eppendorf ambulance (Electon, Dickinson and Company). The isogenic plating medium was prepared using DMEM / F 12-CTS™ + 2 mM L-alanyl-L-glutamine (Sigma-Aldrich) The tissue was prepared by mixing 100% human serum (100% human serum) with 100% human serum. Cells from the sample were cultured in either transfection medium or syngeneic plating medium. After 2 days, the wells were rinsed and the medium was replaced with transfection medium. Numerous cells with fibroblast morphology began to attach and spread by the second day. From the second day onwards, the cells were cultured in a reduced volume to accommodate the smaller wells. , transfection according to Example 2 with RNA synthesized according to Example 1 By day 5, areas of cells with morphology consistent with reprogramming were observed. It was.

[0211] Example 16 Reproduction of human fibroblasts using synthetic RNA containing non-standard nucleotides Programming Primary human fibroblasts were cultured at a density of 20,000 cells / well in transfection medium. The recombinant human fibronectin and recombinant human vitronectin (respectively, DME Dilute in M / F12 to a concentration of 1 μg / mL, 1 mL / well, and incubate for 1 hour at room temperature. The next day, cells were plated on 6-well plates coated with 100 μg / mL of 100% ethanol. The RNA dose was 0.5 μg / well on day 1, 0.5 μg / well on day 2, and 0.5 μg / well on day 3. RNA synthesized according to Example 1, except that on day 1, 2 μg / well Transfection was performed as in Example 2. Images were taken on day 4. Small colonies of cells exhibiting morphology consistent with IgG were visible by day 4.

[0212] Example 17 Reprogramming of human fibroblasts with non-conditioned transfection medium Primary human fibroblasts were cultured at a density of 20,000 cells / well in transfection medium. The recombinant human fibronectin and recombinant human vitronectin (respectively, DME Dilute in M / F12 to a concentration of 1 μg / mL, 1 mL / well, and incubate for 1 hour at room temperature. The next day, cells were plated on 6-well plates coated with 100 μg / mL of 100% ethanol. The RNA dose was 0.5 μg / well on day 1, 0.5 μg / well on day 2, and 0.5 μg / well on day 3. 2 μg / well on day 1, 2 μg / well on day 4, and 4 μg / well on day 5. The RNA synthesized according to Example 1 was transfected as in Example 2, except that Small colonies of cells exhibiting morphology consistent with reprogramming emerged as early as 5 days. On day 7, the medium was changed to DMEM / F12 + 20% Knockout ut(trademark)Serum Replacement(Life Technology s Corporation) + 1X non-essential amino acids + 2mM L-glutamine The cells were then conditioned with irradiated mouse embryonic fibroblasts for 24 hours, and then treated with 20 ng / mL bFGF and The large colonies with reprogrammed morphology were then treated with 10 μM Y-27632. Ronnies were visible as early as day 8. Colonies were picked on day 10 and the basement membrane Extract (Cultrex® Human BME Pathclear® The cells were plated onto wells coated with 100% EDTA (Trevigen Inc.). The cells grew rapidly and were passaged to establish lines.

[0213] Example 18 Reproduction of human fibroblasts using synthetic RNA containing non-standard nucleotides Programming Primary human neonatal fibroblasts were transfected at a density of 10,000 cells / well. Recombinant human fibronectin and recombinant human vitronectin (respectively Dilute in DMEM / F12 to a concentration of 1 μg / mL, 1 mL / well, and incubate for 1 hour at room temperature. The next day, the cells were plated on 6-well plates coated with 100% ethanol. The cells were incubated with RNA containing A, 0.5 7dG, 0.5 5mU, and 5mC, and 0.5 μg / well on day 1, 0.5 μg / well on day 2, and 2 μg / well on day 3 , 2 μg / well on day 4, and 4 μg / well on day 5. The cells were transfected as described in 2. Small colonies were visible as early as day 5. On day 6, the medium was replaced with maintenance medium. The cells were stained with an antibody against Oct4. Oct4 positive colonies of cells exhibiting the morphology were visible throughout the wells.

[0214] Example 19 Feeder-free passaging of primary adult human fibroblasts with synthetic RNA Reprogramming without immunosuppressants or conditioning The wells of a 6-well plate were incubated with recombinant human fibronectin and recombinant with a mixture of human vitronectin (1 μg / mL in DMEM / F12, 1 mL / well) Primary adult human fibroblasts were plated at a density of 10,000 cells / well. The cells were plated onto the coated wells in transfection medium. 5% CO 2 and 5% O 2 The cells were then maintained at 37° C. from the next day onwards. The cells were transfected daily for 5 days with the RNA synthesized according to Example 2. The total amount of RNA transfected on each of the five days was 0.5 μg, 0 From the fourth transfection, The medium was changed twice a day. The day after the final transfection, the medium was replaced with 10 μM The transfection medium was replaced with one supplemented with Y-27632. The total amount of transfected RNA was 0.25 μg, 0, 0.5 μg, and 0 .5μg, 0.5μg, or 0.25μg, 0, 0.25μg, 0.25μg, 0 In certain experiments, the transfection medium was The medium was replaced only once a day during transfection. Compact colonies bearing .DELTA.- ... I can see it now.

[0215] Example 20: Efficient and rapid induction and reprogramming of cells from adult human skin biopsy tissue ng Full-thickness skin punch biopsies were performed according to an approved protocol in healthy 31-year-old volunteers. Briefly, topical application of 2.5% lidocaine was administered to the skin area of ​​the left upper arm. The area was disinfected with 70% isopropanol and a full thickness skin biopsy was performed. The tissue was then immersed in phosphate-buffered saline (PBS) for 1 h. Then, 250 μL of TrypLE Select CTS (Life Technologies) was added. Place in a 1.5 mL tube containing 100% ethanol (Gies Corporation) and incubate at 37°C for 30 min. The tissue was then incubated in 250 μL of DMEM / F12-CTS (Lif e Technologies Corporation) + 5mg / mL collagenase The epidermis was then transferred to a 1.5 mL tube containing ethanol and incubated for 2 hours at 37°C. The tissue was mechanically dissociated using a tether. The cells were then cultured in DMEM / F12-CTS. In addition, bloodletting was performed on the same volunteers and venous blood was collected using Vacutaine r Collected in SST tubes (Becton, Dickinson and Company). Serum was separated according to the manufacturer's instructions. Isogenic plating media was prepared using MEM / F12-CTS + 2 mM L-alanyl-L-glutamine (Sigma-Ald The skin tissue was prepared by mixing 100% human serum and 20% human serum. Cells from tissue samples were plated in isogenic plating medium on fibronectin-coated 6-well plates. The cells were plated onto cutin-coated wells. The cells began to attach and spread by day 2. The cells were allowed to expand and were then transferred to Synth-a-Fr Freeze in eeze (Life Technologies Corporation). Ta.

[0216] The cells were subcultured in 6-well plates at a density of 5,000 cells / well. Replace with transfection medium and incubate cells with A, 0.5 mM 7dG, 0.4 mM 5mU, and 5mC, and 0.5 μg / well on day 1 and 0.5 μg / well on day 2. g / well on day 1, 2 μg / well on day 2, 2 μg / well on day 4, and 2 μg / well on day 5. The RNA dose of the well was used for transfection as in Example 2. Wells received an additional 2 μg / well transfection on days 6 and 7. In addition, certain wells received 2ng / mL TGF-β1 from day 4 onwards. On day 1, the medium was replaced with maintenance medium. Colonies of cells showing morphology consistent with reprogramming were cultured. Knees became visible on days 5-10. The colonies grew rapidly and many of them were embryonic. The morphology was similar to that of stem cell colonies. and recombinant human vitronectin (1 μg / mL, 1 mL / well, respectively). The plates were coated with 100 μg / mL PBS (diluted in DMEM / F12 at 37 °C and incubated at room temperature for 1 h). Cells grew rapidly and were passaged to establish lines.

[0217] Example 21 Highly efficient gene expression by repeated transfection with RiboSlice Translated Primary human fibroblasts were plated as in Example 19. The following day, the cells were The RNA synthesized according to Example 1 was transfected as in Example 2. Then, the cells in one of the wells were transfected a second time. Two days after transfection, the efficiency of gene editing was evaluated using a mutation-specific nuclease assay. The measurements were performed using

[0218] Example 22: Encoding synthetic RNA containing non-standard nucleotides and repair templates Transfection of cells with DNA For transfection in 6-well plates, 1 μg of human APP gene was 1 μg of RNA encoding a gene-editing protein targeting Chthon 16 was administered to target cells. Single-stranded repair template DNA containing a PstI restriction site that was not present, and 6 μL Transfection reagents (Lipofectamine RNAiMAX, Life Sciences) First, the complex formation medium (O pti-MEM, Life Technologies Corporation) The diluted RNA, repair template, and and transfection reagent according to the manufacturer's instructions. The complexes were added to the cells in culture. Approximately 120 μL of complexes already contained in 2 mL of transfection medium per well The complex was added to each well of a 6-well plate that had been pre-assembled. The plate was gently shaken to disperse the complex. The complexes were then distributed throughout the wells. The cells were incubated with the complexes for 4 hours to overnight, and then cultured. The medium was replaced with fresh transfection medium (2 mL / well). The next day, the medium was replaced with DM The medium was replaced with EM + 10% FBS. Two days after transfection, genomic DNA was isolated. A region within the APP gene was amplified by PCR, and the amplified product was transformed into Pst I and analyzed by gel electrophoresis.

[0219] Example 23 In vivo RiboSlice safety studies Forty female NCr nu / nu mice were cultured in 50% Matrigel (BD Biosciences) ences) in 5 × 10 6 MDA-MB-231 tumor cells were injected subcutaneously. The volume was 0.2 mL / mouse. Mice were 8-12 weeks old at the start of the study. Tumor is 100-150 mm 3 When the animals reached their average size, they were paired and separated. The animals were divided into four groups of 10 each and treatment was initiated. Body weights were recorded every 5 days. The measurements were taken on the 2nd day of the study and then every other week until the end of the study. ine 2000, Life Technologies Corporation) The RiboSlice consisted of BIRC5-1.2. To prepare the dosing solution, add 308 μL of complexation buffer (Opti-MEM, Life Technologies, Technologies Corporation) were used in two sterile RNase-free Pipette 22 μL of RiboSlice into each of the 1.5 mL tubes. BIRC5-1.2 (500 ng / μL) was added to one of the two tubes, and the contents of the tube were The mixture was mixed by pipetting. 22 μL of vehicle was added to the second tube. The contents of the first tube are mixed and then transferred to the first tube and mixed with the contents of the first tube by pipetting. The complex was incubated at room temperature for 10 minutes. The syringe was loaded during injection. Animals were administered 100 µL of the 1st dose in a total volume of 60 µL per animal. A total dose of 1 μg of RNA per mouse was injected intravenously or intratumorally. A total of five treatments were performed. Injections were administered every other day and doses were not adjusted for body weight. The animals were observed for 17 days. No significant decrease in mean body weight was observed, and the RiboSlice gene was The in vivo safety of gene-editing RNA has been demonstrated.

[0220] Example 24 Screening of reagents for delivering nucleic acids to cells Polyethylenimine (PEI), various commercial lipid-based transfection reagents, A tide-based transfection reagent (N-TER, Sigma-Aldrich Co., Ltd.) Delivery agents, including LC., as well as several lipid- and sterol-based delivery agents, have been The delivery reagents were screened for transfection efficiency and toxicity in vitro. The complex was then combined with RiboSlice BIRC5-1.2 and the complex was then delivered to cultured HeLa cells. Toxicity was assessed by analyzing cell density 24 hours after transfection. Transfection efficiency was assessed by analyzing morphological changes. The tested reagents showed a wide range of toxicity and transfection efficiency. Reagents containing more than one ester bond are preferred over reagents containing a lower percentage of ester bonds or It showed less toxicity than reagents that did not contain steric bonds.

[0221] Example 25 High-concentration liposome RiboSlice Add 1 μg of RNA at 500 ng / μL to 3 μL of complex formation medium (Opti-MEM, Li fe Technologies Corporation) was mixed with 1 μg of RNA. 2.5 μL of transfection reagent (Lipofectamine 2000, Life Technologies Corporation) to 2.5 μL of the complex High-concentration liposome RiboSlices were prepared by mixing with the formation medium. Mix the diluted RNA and transfection reagent and incubate for 10 min at room temperature. Alternatively, DOSPA or A transfection reagent containing DOSPER is used.

[0222] Example 26 In vivo RiboSlice efficacy experiments - subcutaneous glioma model 40 female NCr nu / nu mice were given 1 × 10 7 Subcutaneous injection of U-251 tumor cells The amount of cells injected was 0.2 mL per mouse. The mice were 8 weeks old at the start of the study. ~12 weeks. Tumor size is 35-50 mm. 3 When the average size of the The animals were then divided into four groups of 10 each and treatment was initiated. Measurements were taken every day for 5 days after the start of the study, and then every other week until the end of the study. Caliper measurements were taken every other week. The tumor size was calculated. Treatment consisted of vehicle (Lipofectamine 2000, RiboS complexed with riboS (Life Technologies Corporation) To prepare the dosing solution, 294 μL of Complexation buffer (Opti-MEM, Life Technologies Corp oration) into 196 μL of RiboSlice BIRC5-1.2 (500 nM) 2. Pipette into the tube containing 100 µg / µL of 100 µ ... Pipette 245 μL of complexation buffer into the tube containing 245 μL of vehicle. The contents of the second tube were mixed and then transferred to the first tube and the first tube was diluted with water by pipetting. The complex was incubated at room temperature for 10 minutes. During the incubation period, the syringes were loaded. Animals were dosed with 2 μg or at a total dose of 5 μg of RNA, either in a total volume of 20 μL or 50 μL per animal. A total of five treatments were administered intratumorally, with injections given every other day. The dose was not adjusted for body weight. The animals were observed for 25 days.

[0223] Example 27 Liposomal Formulations and Encapsulation of Nucleic Acids Liposomes were prepared in the following formulation: 3.2 mg / mL N-(carbonyl-ethoxypolyethylene Polyethylene glycol 2000)-1,2-distearoyl-sn-glycero-3-phospho Ethanolamine (MPEG2000-DSPE), fully hydrogenated form at 9.6 mg / mL Sphatidylcholine, 3.2mg / mL cholesterol, 2mg / mL ammonium The pH is adjusted using sodium hydroxide, sulfate, and histidine as a buffer. To form liposomes, the tonicity is controlled with sucrose. The lipids were mixed in an organic solvent, dried, and hydrated with stirring to give a mean pore size of 800 nm. The nucleic acid is sized by extrusion through a polycarbonate filter having a Combine 10 μg of liposome formulation per 1 μg of nucleic acid and incubate at room temperature for 5 min. The encapsulation is done by adding

[0224] Example 28 Folate Targeted Liposome Formulations Liposomes were prepared by dissolving in 0.27 mg / mL 1,2-distearoyl-sn-glycero-3- Phosphoethanolamine-N-[folic acid (polyethylene glycol)-5000](F The same procedure as in Example 62 was repeated except that 1,2-dichlorophenyl ether (A-MPEG5000-DSPE) was added to the lipid mixture. Prepare accordingly.

[0225] Example 29 Therapeutics containing RNA encoding liposomal proteins Encapsulating synthetic RNA encoding a therapeutic protein synthesized according to Example 1 Liposomes that are encapsulated are prepared according to Example 27 or Example 28. The drug is administered by intravenous infusion or injection.

[0226] Example 30: Creation of an elastin ivT-RNA template Total RNA was purified using the RNeasy Mini Kit (QIAGEN) according to the manufacturer's instructions. The elastin coding region was extracted from human neonatal skin fibroblasts using the ELISA kit (Germany). The cDNA was then purified using MonsterScript™ reverse transcriptase (Epicentre Biotechnologies) and primer AAAAAAACCGGTTCAT TTTCTCTTCCGGCCAC was used to prepare the in vitro transcription (ivT) template. Rate, primer F: AAAAAAGCTAGCATGGCGGGTCTGACG; and R:AAAAAAACCGGTTCATTTTCTCTTCCGGCCAC , prepared from cDNA by PCR amplification of the elastin coding sequence (CDS). The CR products were analyzed by agarose gel electrophoresis and the QIAquick gel extraction kit (QIAGE Human β-globin (HBB) 5′ and 3′ untranslated DNA was purified by using a 5′-mercaptoethanolase (N GmbH) The vector was cloned into a vector containing the translation region as well as a strong Kozak sequence. Prior to RNA synthesis, the fragment was amplified, purified, and linearized.

[0227] Example 31 Synthesis of elastin RNA RNA encoding human elastin was synthesized using the DNA sequence of Example 30 according to the manufacturer's instructions. A template and T7 high yield RNA synthesis kit (New England Biola The RNA samples were synthesized using agarose gel electrophoresis. The quality of the RNA was assessed by analysis using the method described above (Figure 1). and RNAse inhibitor (Superase·In™, Life Technologies nologies Corporation) at a concentration of 1 μL per 200 μg of RNA. The RNA solution was stored at 4°C.

[0228] Example 32 Preparation of Octanoate-Treated Human Serum Albumin A 10% HSA solution was dissolved in 16 mM sodium octanoate (Sigma-Aldric h Co. LLC) and incubated at 37°C for 3 hours prior to construction of complete medium. Incubated.

[0229] Example 33 Formulations for in vivo delivery of nucleic acids Formulations for in vivo delivery of nucleic acids are prepared by adding a suitable buffer (e.g., DMEM / F12, RNA synthesized according to Example 31 in a confluence medium, such as Opti-MEM and human serum albumin treated according to Examples 8, 9, and / or 32. Prepare by combining:

[0230] Example 34 Syringe administration of RNA encoding treated albumin and elastin Increased elastin production in the skin by subcutaneous injection The formulation of Example 33 was loaded into an insulin syringe with a 28 gauge 0.5 inch needle. The pharmaceutical composition is then delivered through the epidermis into the patient's dermis. Additional doses are administered as needed.

[0231] Example 35 Electric microdissection of RNA encoding treated albumin and elastin Increased elastin production in the skin by percutaneous injection of needle arrays The formulation of Example 33 was applied to a motorized microneedle applicator set to a penetration depth of approximately 0.1 mm. The microneedle array is then inserted through the epidermis into the dermis of the patient. Deliver something.

[0232] Example 36 Transdermal injection of RNA encoding processed albumin and collagen Increased collagen production in the skin The formulation of Example 33 was administered with RNA encoding human collagen types I and / or III. The formulation is delivered as in Examples 34 or 35.

[0233] Example 37 Bone regrowth by intramuscular injection of RNA encoding processed albumin and actin Increased actin production in skeletal muscles The formulation of Example 33 is prepared using RNA encoding skeletal alpha actin. is delivered to the patient via intramuscular injection.

[0234] Example 38 Wound healing treatment The formulation of Example 33 was prepared using RNA encoding basic fibroblast growth factor. The formulation is delivered as in Examples 34 or 35.

[0235] Example 39 Anti-scarring treatment The formulation of Example 33 is prepared using RNA encoding collagenase. , delivered as in Examples 34 or 35.

[0236] Example 40. Generation of tyrosinase ivT-RNA template Total RNA was purified using the RNeasy Mini Kit (QIAGEN) according to the manufacturer's instructions. The human tyrosinase-encoding gene was extracted from human epidermal melanocytes using the ELISA kit (Germany). The cDNA was then purified using MonsterScript™ reverse transcriptase (Epicentre In vitro transcription (ivT) templates were prepared using the Biotechnologies Corporation. The rate was prepared from cDNA by PCR amplification of the tyrosinase coding sequence (CDS). The PCR products were then subjected to agarose gel electrophoresis and extraction with the QIAquick gel extraction kit ( Human β-globin (HBB) 5′ and The vector contained a 3′ untranslated region and a strong Kozak sequence. The vector was amplified, purified and linearized prior to RNA synthesis.

[0237] Example 41 Synthesis of tyrosinase RNA RNA encoding human tyrosinase was synthesized according to the manufacturer's instructions using the method described in Example 40, D. NA template and T7 high-yield RNA synthesis kit (New England Biol The RNA samples were synthesized using ELISA kits (Abs, Inc.) according to Example 1 (Table 4). The quality of the RNA was assessed by agarose gel electrophoresis. The RNA solution was stored at 4° C.

[0238] Example 42 Preparation of Octanoate-Treated Human Serum Albumin A 10% HSA solution was dissolved in 16 mM sodium octanoate (Sigma-Aldric h Co. LLC) and incubated at 37°C for 3 hours prior to construction of complete medium. Incubated.

[0239] Example 43: Tyrosinase-encoding RNA is injected into the skin via a syringe Increased melanin production The RNA of Example 41 was loaded into a syringe and injected into a healthy 33-year-old male for approximately 30 seconds. The patient was delivered into the dermis of the ventral forearm.

[0240] Example 44 Combining delivery and electroporation of RNA encoding tyrosinase Increased melanin production in the skin due to The area of ​​skin treated in Example 43 was then placed into a two-electrode adapter electrically connected to a capacitor. Using a ray, patients were exposed to electric pulses of 10 V to 155 V and for about 10 milliseconds to about 1 second. The subjects reported a percussion pain sensation at all voltages and penetration depths. (See FIG. 16.) The experiment was repeated several times with similar results.

[0241] Example 45 Increase in skin by topical or intradermal application of RNA encoding tyrosinase Increased melanin production The RNA of Example 41 or the liposome of Example 29 was administered with or without disruption of the stratum corneum. Direct application to the skin without exposure to sunlight or at a dose of 1 microgram per square centimeter or less Optionally, an electric field is used to enhance delivery of the RNA, as described in Example 44. or by using a surface contact patch.

[0242] Example 46 Increased elastin in skin by transdermal delivery of elastin-encoding RNA Chin production RNA encoding elastin is prepared according to Example 1. Deliver as in 43, 44, or 45.

[0243] Example 47 Increased collagen in the skin by transdermal delivery of collagen-encoding RNA Gen production Collagen-encoding RNA is prepared according to Example 1. The RNA is Deliver as in 43, 44, or 45.

[0244] Example 48 Involves Delivery of RNA Encoding Erythropoietin or Darbepoietin anemia treatment The RNA encoding darbepoetin alfa was prepared according to Example 1. Delivered as in Examples 43, 44, or 45.

[0245] Example 49 Increased actin in skeletal muscle by intramuscular delivery of actin-encoding RNA Chin production The actin-encoding RNA is prepared according to Example 1. The RNA is then purified according to Example 4. 3, 44, or 45 are delivered to patients via intramuscular injection with or without an electric field. .

[0246] Example 50 Wound healing treatment RNA encoding basic fibroblast growth factor is prepared according to Example 1. The NA is delivered as in Examples 43, 44, or 45.

[0247] Example 51 Anti-scarring treatment The collagenase-encoding RNA is prepared according to Example 1. Deliver as in Examples 43, 44, or 45.

[0248] Example 52 Production of Botulinum Toxin RNA encoding a botulinum toxin is prepared according to Example 1. The RNA is Delivered as in Examples 43, 44, or 45.

[0249] Example 53 By transfection with RNA encoding collagen I Increased collagen production in skin cells RNA containing the coding sequence of the human COL1A1 gene was synthesized according to Example 1. Primary human dermal fibroblasts were plated in 24-well plates and cultured as described in Example 2. 24–72 h after transfection, cells were The cells were fixed and stained with an antibody targeting collagen I. Deposits were visible in the transfected wells (Figure 17).

[0250] Example 54 Transfection with RNA encoding collagen VII Increased collagen production in skin cells RNA containing the coding sequence of the human COL7 gene was synthesized according to Example 1. Human dermal fibroblasts were plated in 24-well plates and incubated according to Example 2. 24-72 hours after transfection, the cells were transfected with The cells were fixed and stained with an antibody targeting collagen VII. Transfected cells expressed higher concentrations of collagen VI compared to non-transfected controls. I was shown (Figure 18).

[0251] Example 55 Syringe delivery of RNA encoding collagen I or collagen VII Increased collagen production in the skin by percutaneous injection RNA containing the coding sequence of the human COL1A1 gene or the human COL7 gene was The RNA was synthesized according to Example 1. The RNA was loaded into a syringe and incubated for approximately 30 seconds or until the Delivered to the patient's dermis as in Examples 43, 44, or 45.

[0252] Example 56 Delivery and electrophoresis of RNA encoding collagen I or collagen VII Increased collagen production in the skin by combining poration techniques The area of ​​skin treated in Example 55 was examined using a multi-electrode array electrically connected to a power source. The subject is then exposed to an electric pulse of 10 V to 155 V and about 50 microseconds to about 1 second.

[0253] Equivalent Those of ordinary skill in the art will be able to, using no more than routine experimentation, identify and / or modify any particular embodiment specifically described herein. It will be possible to recognize or identify numerous equivalents to the embodiments. is intended to be encompassed by the following claims.

[0254] Incorporation by Reference All patents and publications referenced herein are hereby incorporated by reference in their entirety. Be absorbed.

Claims

1. A composition comprising a synthetic RNA comprising a coding sequence, a 5' untranslated region (5'UTR), and a 3' untranslated region (3'UTR), wherein at least 50% of the uridine residues of the synthetic RNA are selected from the group consisting of 5-hydroxyuridine, 5-hydroxymethyluridine, 5-carboxyuridine, and 5-formyluridine.

2. The composition described in claim 1, wherein at least 75% of the uridine residues of the synthetic RNA are selected from the group consisting of 5-hydroxyuridine, 5-hydroxymethyluridine, 5-carboxyuridine, and 5-formyluridine.

3. The composition described in claim 1 or 2, wherein at least 90% of the uridine residues of the synthetic RNA are selected from the group consisting of 5-hydroxyuridine, 5-hydroxymethyluridine, 5-carboxyuridine, and 5-formyluridine.

4. The composition described in any one of claims 1 to 3, wherein 100% of the uridine residues of the synthetic RNA are selected from the group consisting of 5-hydroxyuridine, 5-hydroxymethyluridine, 5-carboxyuridine, and 5-formyluridine.

5. The composition of claim 1, wherein at least 75% of the uridine residues in the synthetic RNA are 5-hydroxyuridine.

6. The composition of claim 1, wherein at least 90% of the uridine residues in the synthetic RNA are 5-hydroxyuridine.

7. A composition described in any one of claims 1 to 6, wherein 100% of the uridine residues in the synthetic RNA are 5-hydroxyuridine.

8. A composition described in any one of claims 1 to 7, wherein the synthetic RNA encodes a reprogramming factor.

9. The composition of any one of claims 1 to 8, wherein the synthetic RNA encodes at least one of p53, TERT, a cytokine, a secreted protein, a membrane-associated protein, an enzyme, a gene editing protein, a chromatin-modifying protein, a DNA-binding protein, a transcription factor, a histone deacetylase, a pathogen-associated molecular pattern, or a tumor-associated antigen.

10. A composition described in any one of claims 1 to 9, wherein the synthetic RNA encodes a gene-editing protein.

11. The composition of claim 10, wherein the gene editing protein is selected from the group consisting of nucleases, transcription activator-like effector nucleases (TALENs), zinc finger nucleases, meganucleases, nickases, and clustered regularly interspaced short palindromic repeats (CRISPR) binding proteins.

12. The composition of any one of claims 1 to 11, wherein the synthetic RNA is transcribed in vitro.

13. The composition of any one of claims 1 to 12, wherein the synthetic RNA further comprises one or more non-standard nucleotides selected from the group consisting of 5-carboxycytidine, 5-formylcytidine, 5-hydroxymethylcytidine, 5-methylcytidine, 5-methylpseudouridine, 5-methyluridine, 7-deazaguanosine, 5-hydroxymethyluridine, 5-carboxyuridine, 5-formyluridine, and pseudouridine.

14. The composition of any one of claims 1 to 13, wherein the synthetic RNA comprises one or more of a 5' cap, a 5' cap structure, and a 3' poly(A) tail.

15. The composition of claim 14, wherein the 5' cap structure is selected from cap 0, cap 1, cap 2, and cap 3, or derivatives thereof.

16. The composition of any one of claims 1 to 15, wherein the 5'UTR is selected from alpha globin 5'UTR and beta globin 5'UTR.

17. The composition of any one of claims 1 to 16, wherein the 5'UTR comprises a Kozak sequence.

18. The composition of any one of claims 1 to 17, wherein the 3'UTR is selected from alpha globin 3'UTR and beta globin 3'UTR.

19. The composition of claim 14, wherein the 3' poly(A) tail is about 20nt, about 30nt, about 40nt, about 50nt, about 60nt, about 70nt, about 80nt, or about 90nt, about 100nt, about 110nt, about 120nt, about 130nt, about 140nt, about 150nt, about 160nt, about 170nt, about 180nt, about 190nt, about 200nt, about 210nt, about 220nt, about 230nt, about 240nt, or about 250nt in length.

20. A pharmaceutical composition comprising the composition according to any one of claims 1 to 19 and a pharma- ceutically acceptable excipient.

Images