Expression constructs and methods of genetically engineering methylotrophic yeast

Abstract

To provide methods and materials for genetically engineering methylotrophic yeast.SOLUTION: The present invention provides a methylotrophic yeast cell comprising a recombinant nucleic acid molecule, wherein the recombinant nucleic acid molecule comprises an exogenous nucleic acid encoding a transcriptional activator operably linked to at least one methanol-inducible promoter element.SELECTED DRAWING: None

Description

[Technical field]

[0001] Technical Field The present disclosure provides a method for genetically engineering methylotrophic yeast, D The present invention relates generally to NA constructs and methods of using such DNA constructs. [Background technology]

[0002] background Methylotrophic yeasts such as Pichia pastoris are capable of expressing recombinant proteins. It is commonly used to express one or more polypeptides in methylotrophic yeast. Constructs that can be used to efficiently express polypeptides are provided herein. can be. Summary of the Invention

[0003] Abstract The present disclosure provides an AOX1 promoter that significantly improves recombinant production of one or more proteins. To increase the expression of a transgene that is also expressed from the AOX1 promoter, Using a P. pastoris strain overexpressing the transcriptional activator Mxr1 In addition, expression of Mxr1 from the AOX1 promoter was suppressed by the repressing carbon source. When exhausted, AOX was produced in the absence of methanol, which is normally a bona fide inducer. A positive feedback loop that allows expression of one transgene from another promoter Expression of Mxr1 resulted in a significant increase in the amount of protein produced. Glass.

[0004] In one embodiment, a methylotrophic yeast cell is provided that comprises the recombinant nucleic acid molecule. The nucleic acid molecule typically contains at least one methanol-inducible promoter element. Representative embodiments include exogenous nucleic acid encoding a transcription activator operably linked to a transcription factor ( The thyrotrophic yeasts are classified into the genera Candida, Hansenula, and Pichia. Representative methylotrophic yeasts may be of the genus Pichia or Toruplosis. The strain is Pichia pastoris.

[0005] In some embodiments, the recombinant nucleic acid molecule is located in the genome of the methylotrophic yeast cell. In some embodiments, the recombinant nucleic acid molecule is replication competent. Extrachromosomally expressed from a replication-competent plasmid slightly expressed).

[0006] In some embodiments, the exogenous nucleic acid encoding a transcriptional activator is Pichia passivata. Mxr1 sequence from Pichia pastoris, Hansenula polymorpha Adr1 sequence from Candida polymorpha, and Adr2 sequence from Candida boidinii The Trm1 sequence and the Trm2 sequence from Candida boidinii were An exemplary nucleic acid encoding a transcription activator is shown in DQ395124. The transcription activator has the amino acid sequence shown in ABD57365.

[0007] In some embodiments, the at least one methanol-inducible promoter element is Alcohol oxidase 1 (AOX1) from Pichia pastoris Promoter element, AOD1 promoter from Candida boidinii ter element, the MOX promoter from Hansenula polymorpha -element, the MOD1 promoter element from Pichia methanolica, DHAS promoter element from Pichia pastoris, Pichia pastoris The FLD1 promoter element from Pichia pastoris, or Pichia pastoris The PEX8 promoter element from Pichia pastoris.

[0008] In some embodiments, the methylotrophic yeast cell is At least one gene encoding a polypeptide operably linked to an inducible promoter element. In some embodiments, the nucleic acid molecule further comprises at least one heterologous nucleic acid. The seed nucleic acid may be a nucleic acid that binds to an iron-cofactor such as heme (e.g., ALA synthase, AL A dehydratase, porphobilinogen deaminase, UPGI II synthase, UPGIII decarboxylase, CPG oxidase, PPG oxidase One or more polypeptides involved in the biosynthesis of ribosomal enzymes (ribosomal enzymes, ribosomal enzymes, and / or ferrochelatase) In some embodiments, the nucleic acid sequence encodes one or more peptides involved in the biosynthesis of an iron cofactor. The polypeptide or polypeptides are linked to at least one methanol-inducible promoter element. is doing.

[0009] In another aspect, a method for expressing a heterologous polypeptide in a cell is provided. The method typically includes providing a methylotrophic yeast cell as described herein; At least one Pichia pastoris alcohol oxidase 1 (A At least one molecule encoding a polypeptide operably linked to the OX1 promoter element introducing a recombinant nucleic acid molecule containing a heterologous nucleic acid into a methylotrophic yeast cell; and The cells are cultured under conditions suitable for expression of the recombinant nucleic acid molecule, thereby producing the heterologous polypeptide. This includes expressing a tide.

[0010] In some embodiments, the conditions under which the cells are cultured include iron or pharmacological or metabolic In some embodiments, the introducing step comprises adding a salt thereof that is acceptable for: Transduction, electroporation, biolistic particle delivery, or chemical In some embodiments, the culturing step includes culturing in the presence of methanol. The method includes culturing the cells in the presence of

[0011] In another embodiment, a transcriptional activator operably linked to the promoter it activates. Recombinant organisms are provided that contain the factors. In some embodiments, the factors are promoters and operably linked. In yet another aspect, a recombinant organism is provided that expresses a polypeptide that is operably linked to the recombinant polypeptide. The method for expressing a polypeptide from an inducible promoter without adding an inducer comprises: Provided as described herein.

[0012] Unless otherwise specified, all technical and scientific terms used herein refer to methods and and composition have the same meaning as commonly understood by one of ordinary skill in the art to which the term pertains. Methods and materials similar or equivalent to those described herein are provided herein. Suitable methods and materials that may be used in practicing or testing the compositions are described below. In addition, the materials, methods, and examples are illustrative only and are intended to be limiting. All publications, patent applications, patents, and other references mentioned herein are hereby expressly incorporated by reference in their entirety. are incorporated herein by reference in their entireties. [Brief description of the drawings]

[0013] [Figure 1] FIG. 1 is a schematic depicting the steps involved in the heme biosynthetic pathway. [Diagram 2] FIG. 2 is a schematic diagram of the plasmids used in the construction of production strain MXY0183. [Diagram 3] FIG. 3 is a schematic showing the generation of production strains, MXY0183 and MXY0207, from the parent strain Bg11. [Figure 4] FIG. 4 is a schematic diagram showing plasmids pGAB and pMx354. [Diagram 5] FIG. 5 is a schematic showing the generation of antibiotic selection-free producer strains, MXY0291 and MXY0338, from the parent strain Bg11. [Figure 6] FIG. 6 is a schematic diagram of the linear piece of DNA containing Mxr1 and LegH var3 that was introduced by cotransformation to generate production strain MXY0291. [Figure 7] FIG. 7 is a schematic diagram showing a linear construct expressing LegH under the control of the native Pichia non-pAOX1 constitutive promoter. [Figure 8] Figure 8 is a photograph showing the phenotypic changes associated with strain MXY0183. Shake flasks at the start of induction (0 hours) and 72 hours post-induction are shown. 1, MXY0051; 2, MXY0118; 3, MXY0183. [Figure 9]9 shows the production of LegH from engineered P. pastoris strains. Panel A is an SDS gel showing lysates from P. pastoris strains grown in shake flasks: 51, MXY0051; 118, MXY0118; 183, MXY0183. Panel B is a table comparing LegH production from strains MXY0118, MXY0183, and MXY0207. [Figure 10] 10 shows data from an experiment with strain MXY0206. Panel A is a photograph of shake flask cultures of strains MXY0183 (left) and MXY0206 (right) after 48 hours of growth on a repressing carbon source. Panel B is a photograph of cell pellets from shake flask cultures of strains MXY0183 (left) and MXY0206 (right) after 48 hours of growth in BMY medium. Panel C is a graph showing the relative yield of heme-loaded LegH (in the absence of any inducer). [Figure 11] FIG. 11 is a summary table showing the relative yields of strains described herein when grown in the presence of methanol and glycerol, or methanol and glucose, in 2 L fermentors. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0014] Detailed Description Allows cells to be genetically engineered to increase recombinant expression of polypeptides Nucleic acid constructs are provided herein. In some embodiments, the absence of an inducing molecule To increase recombinant expression of a polypeptide from an inducible promoter under Nucleic acid constructs that allow for the manipulation of genes are provided herein. Without being bound by any mechanism, the methods described herein include methods for detecting low levels of naturally occurring transcriptional activators. Expression is a positive feedback loop that induces a promoter that is operably linked to a transcription activator. This creates a loop that works with transcription activators and the same inducible promoter. This results in increased expression of one or more dynamically linked target polypeptides.

[0015] Nucleic acid constructs that allow for the genetic engineering of methylotrophic yeast cells are provided herein. The method is provided herein for the preparation of a Pichia species (i.e., P. pastoris). astoris, but other species of the Pichia genus may also be used. Candida, Hansenula, Pichia and Torulopsis Seeds from any of the species of Torulopsis may also be used.

[0016] Genetic engineering of methylotrophic yeast cells typically involves the introduction of recombinant nucleic acid molecules into the cells. As described herein, a recombinant nucleic acid molecule typically comprises at least and a transcription activator that is operably linked to another inducible promoter element. The nucleic acid includes a causative agent.

[0017] The recombinant nucleic acid molecules used in the methods described herein are typically DNA, but Alternatively, RNA molecules may be used under appropriate circumstances. "Inducible" refers to any nucleic acid sequence that is introduced into the genome of a cell from an external source, wherein The external source can be nucleic acid from the same or a different organism or produced synthetically. For example, the exogenous nucleic acid may be from one microorganism (e.g., one genus or species of methylotrophic yeast). These nucleic acids may be nucleic acids introduced into different genus or species of methylotrophic yeast, However, the exogenous nucleic acid is a nucleic acid from a methylotrophic yeast that does not have a corresponding naturally occurring nucleic acid sequence. was introduced into methylotrophic yeast as an additional copy despite the presence of It can also be a nucleic acid. For example, P. pastoris expresses the Mxr1 transcription activator Contains endogenous nucleic acid encoding the gene. Additional Mx of P. pastoris r1 nucleic acid (e.g., recombinantly introduced into P. pastoris) or Modifications of an endogenous P. pastoris Mxr1 nucleic acid are considered exogenous.

[0018] Transcriptional activators and nucleic acids encoding transcriptional activators (e.g., Exogenous nucleic acids encoding Pichia pastoris are known in the art. The transcriptional activator from Pichia pastoris is the Mxr1 sequence, but proper transcription The activator was derived from Hansenula polymorpha (Adr1 sequence; e.g. For example, the nucleic acid sequence is GenBank accession number AEOI02000005, base 85 8873 to 862352, and for amino acid sequences, GenBank accession nos. ESX01253) and Candida boidinii ( Trm1 sequence; see, for example, GenBank accession number AB365355 for nucleic acid sequence; and for amino acid sequence see GenBank accession number BAF99700 ;Trm2 sequence; see, e.g., GenBank accession number AB548760 for nucleic acid sequence and for amino acid sequence, see GenBank accession number BAJ07608 A representative P. pastoris Mxr1 nucleic acid sequence is , which can be found, for example, in GenBank accession number DQ395124, but a representative P. pass The P. pastoris Mxr1 polypeptide sequence is available, for example, under GenBank Accession No. ABD57365.

[0019] Transcriptional activators such as Mxr1 may be normally expressed at low levels. It is desirable to place the nucleic acid (ie, the transcriptional activator) under the control of an inducible promoter. As used herein, "operably linked" means linked to a promoter or other expression vector. The element is positioned relative to the nucleic acid encoding sequence such that it directs or regulates expression of the nucleic acid. For example, in-frame.

[0020] There are many inducible promoters that can be used when genetically engineering methylotrophic yeast. For example, methanol-inducible promoters, or promoter elements therefrom, can be used. Methanol inducible promoters can be used. Methanol inducible promoters are known in the art. For example, For example, the commonly used methanol-inducible protease from P. pastoris The motor encodes alcohol oxidase 1 (AOX1), which is strongly transcribed in response to methanol. ) genes, or parts thereof. However, other Candida inducible promoters or promoter elements therefrom include, but are not limited to, Candida Promolyzed alcohol oxidase (AOD1) from Candida boidinii (see, e.g., GenBank accession number YSAAOD1A), Hansen et al. Alcohol oxidase (MOX) protein from Hansenula polymorpha promoter (see, e.g., GenBank Accession No. X02425), Pichia The MOD1 or MOD2 promoter from Pichia methanolica (e.g. , Raymond et al., 1998, Yeast, 14:11-23; and Nakagawa et al., 1999, Yeast, 15: 1223-30), the DHAS promoter from P. pastoris (see, e.g., GenBank Accession No. FJ752551) or from promoter element from Pichia pastoris Dehydrogenase (FLD1) promoter (e.g., GenBank accession number AF06 6054), or the PEX8 promoter from P. pastoris motors (see, e.g., Kranthi et al., 2010, Yeast, 27: 705-11). In some embodiments, the transcriptional activator can be used in the transcription of Pichia passivata. The Mit1 sequence from Pichia pastoris (e.g., GenBank accession no. (See No. CAY70887.) All these promoters are It is known that it is induced by

[0021] Those skilled in the art will appreciate that the recombinant nucleic acid molecules described herein can be integrated into the genome of a methylotrophic yeast cell. Can be stably integrated or expressed extrachromosomally from a replication-competent plasmid It will be appreciated that methods to accomplish both are well known and routine in the art. It is used in.

[0022] As shown herein, a methanol-regulated transcriptional activator in Pichia The gene binds to the AOX1 promoter and cooperates with Mxr1 to translocate the AOX1 promoter. In some embodiments, two methanol-regulated genes can be expressed by Transcriptional activators of the genus Mxr1 and Mit1 (e.g., Mxr1 and Mit1) regulate the methanol-induced promoter. The actuator may be operatively connected to the actuator element.

[0023] The strains containing the recombinant nucleic acid molecules described herein can be used to express a second The recombinant nucleic acid molecule can be used to regulate (e.g., overexpress) the recombinant nucleic acid molecule. A recombinant nucleic acid molecule can be, for example, a nucleic acid sequence encoding one or more polypeptides of interest. or a plurality of heterologous nucleic acids. Similarly, heterologous nucleic acid is any nucleic acid that is not native to or in the genome of an organism. A heterologous nucleic acid refers to a sequence (e.g., a heterologous nucleic acid is a nucleic acid sequence that is expressed in a single microorganism (e.g., a single genus of methylotrophic yeast). or species) that has been introduced into a different genus or species of methylotrophic yeast. could be).

[0024] By way of example only, a heterologous nucleic acid encoding one or more polypeptides of interest can be The nucleic acid may be involved in the biosynthesis of a cofactor. Involved in heme biosynthesis as determined and annotated from the Pichia pastoris genome sequence These nucleic acids code for eight different enzymes that act on the mitochondrial endothelial cell wall. For example, ALA synthase, ALA dehydrogenase, and ALA acetylcholinesterase are Dolatase, porphobilinogen deaminase, UPGIII synthase, UPGII I decarboxylase, CPG oxidase, PPG oxidase, and ferrochelate The heterologous nucleic acid encoding the enzyme is expressed in the methylotrophic yeast strains described herein. The methylated vector can be modified to contain two or more heterologous nucleic acids (e.g., transgenes). Methanol-inducible and constitutive promoters for genetic engineering of loaf yeast or combinations thereof to further enhance expression of such nucleic acids. Can be combined.

[0025] Previous studies in Saccharomyces cerevisiae ALA dehydratase and porphobilinogen deaminase are regulated in heme biosynthesis It has been identified as a fast enzyme (e.g., Hoffman et al., 2003, Biochem. Biophys. Res. Com mun., 310 (4): 1247-53). However, glyceraldehyde-3-hydroxybutyric acid Expression of P. pastoris from the phosphate dehydrogenase (GAP) promoter Heterologous expression of individual heme enzymes in Escherichia coli (R. ris) has led to the synthesis of recombinant proteins containing heme cofactors. However, they have not been successful in overcoming the limitations associated with expression of (See Cell Fact., 13; 14: 4). As described herein, P. pastoris Highly efficient expression of recombinant heme-containing proteins in P. pastoris demonstrates the ability to efficiently express heme-containing proteins without the use of methanol. This was achieved by co-expressing the entire heme biosynthetic pathway from a heme-inducible promoter, One or more genes involved in the glycine biosynthetic pathway are expressed under one or more constitutive promoters. It will be appreciated that the polypeptide may be expressed from any suitable nucleic acid.

[0026] In addition to the enzymes involved in iron cofactor biosynthesis, the globulins of proteins including plant hemoglobins It encodes a member of the bin family (PF00042 in the Pfam database). It will be understood that there may be a nucleic acid that is There is a nucleic acid encoding hemoglobin (LegH). LegH binds to the iron cofactor heme. It is a protein that binds to 415 nm and produces a characteristic absorbance at 415 nm and a distinct red color. The LegH protein (also known as LGB2) is naturally found in soybean root nodules ( See, e.g., UniprotKB Accession No. P02236), The nucleic acid sequence is codon optimized for expression in P. pastoris. For example, see International Publication No. WO 2014 / 110539 and International Publication No. Please refer to brochure No. 2014 / 110532.

[0027] Alternatively, the heterologous nucleic acid encoding the polypeptide of interest can be, for example, a dehydrin, a fluorescein, or a phospholipid. Deoxyrithase, protease, catalase, lipase, peroxidase, amylase, tetrahydrofuran Insglutaminase, oxidoreductase, transferase, hydrolase, reductase or an antibody against any such polypeptide. In other embodiments, the heterologous nucleic acid may be, but is not limited to, ethanol, lactic acid, One or more involved in the production pathways of small molecules such as butanol, adipic acid, or succinic acid It is possible to code for multiple enzymes.

[0028] The exogenous nucleic acid encoding the transcriptional activator as well as the nucleic acid encoding the polypeptide of interest are The heterologous nucleic acid may contain an inducible promoter element (e.g., a methanol-inducible promoter element). A heterologous nucleic acid encoding a polypeptide of interest can be operably linked to , can be operably linked to a constitutive promoter or a constitutive promoter element. Inducible promoters and elements therefrom are discussed above. Constitutive promoter elements are known in the art. A commonly used constitutive promoter from P. pastoris is strongly constitutively expressed. A promoter from the transcription elongation factor EF-1α gene (TEF1) that is transcribed, or However, other constitutive promoters or promoters derived from them may also be involved. The glycerol alkaloids from P. pastoris can also be used. Anhydride-3-phosphate dehydrogenase (GAPDH) promoter (e.g., GenB ank accession number U62648.1), P. pastoris These potential glycosylphosphatidylinositol (GPI)-anchored proteins Promoter GCW14p (PAS_chr1~4_0586) from the chromosome (e.g., (see GenBank accession number XM_002490678), or P. pastoris From the 3-phosphoglycerate kinase gene (PGK1) from the squirrel (P. pastoris) promoter (see, e.g., GenBank Accession No. AY288296). These include, but are not limited to:

[0029] Similar to the recombinant nucleic acid molecules described herein, the second recombinant nucleic acid molecule is - Can be stably integrated into the genome of yeast cells or can be delivered as a replication-competent plasmid. It can be expressed extrachromosomally.

[0030] Inducible promoters (e.g., methanol-inducible) and constitutive promoters (or Any combination of promoter elements from the above is operably linked to any of them. It will be appreciated by those skilled in the art that the expression of a nucleic acid that is There will be.

[0031] A heterologous nucleic acid encoding a polypeptide of interest operably linked to a promoter element. The acid may be isolated from the recombinant nucleic acid molecules described herein or may be isolated from the recombinant nucleic acid molecules described herein. A transcriptional activator operably linked to a promoter element contained within the recombinant nucleic acid molecule. It will be appreciated by those skilled in the art that the exogenous nucleic acid encoding the activating factor may be adjacent to the If the second nucleic acid molecule is adjacent to a recombinant nucleic acid molecule described herein, A single promoter, or promoter elements from both or all of the genes The exogenous nucleic acid encoding the transcription activator as well as the polypeptide of interest may be can be used to drive transcription of one or more heterologous nucleic acids encoding It will also be recognized by those skilled in the art.

[0032] Methods for introducing nucleic acids into methylotrophic yeast cells are known in the art, including These include, but are not limited to, transduction, electroporation, biolistic delivery, and chemical transformation. do not have.

[0033] In addition, methods for culturing methylotrophic yeast cells are known in the art. For example, see Pichia Protocols, Methods In Molecular Biology, 389, Cregg, Ed., 2007, 2nd Ed., Humana Press, Inc. In some circumstances, methanol It may be desirable to introduce or add to the culture medium, as demonstrated herein. Methanol promotes efficient expression of high levels of one or more polypeptides of interest. In some circumstances (e.g., involved in the biosynthesis of the iron cofactor), it is not required for In one embodiment, the nucleic acid or nucleic acids encoding the enzymes that regulate the expression of the enzymes are expressed in the culture medium, and the culture medium is added with iron or a drug. It is advisable to supplement these compounds with their salts that are physiologically or metabolically acceptable (GRAS). Sometimes that happens.

[0034] Pichia strains can grow on methanol as the sole carbon source. The utilization of alcohol is via the conversion of methanol to formaldehyde by the action of alcohol oxidase. The transformation of the methylotrophic yeast Pichia pastoris ) contains two genes for alcohol oxidase, AOX1 and AOX2. Strains with reduced alcohol oxidase activity ("slow methanol utilization," or Mu tS strains) often express recombinant proteins from the AOX1 promoter in the The columbine oxidase activity is higher in the strain with both AOX genes than in the strain without the reduced columbine oxidase activity. The mutated strains and those completely lacking alcohol oxidase activity metabolize methanol. However, the expression from the AOX1 promoter was not observed in the presence of methanol. These strains retain the ability to use other carbon sources for growth, but However, the addition of methanol still did not induce heterologous protein expression from the AOX1 promoter. These strains do not metabolize methanol (the "methanol-deprived" or Mut strains). ), so much less methanol is required to induce protein expression, Strains carrying these mutations avoid problems with methanol supply in large-scale fermentations. See, e.g., Chiruvolu et al., 1997, Enzyme Microb. Technol., 21: 277-83. Expression of LegH from the AOX1 promoter in Mut strains increased LegH yield. It has been determined herein that AOX1 and AOX2 genes have been improved. Methylotrophic yeast carrying mutations in both the parent and host can be used in the methods described herein. This can be done.

[0035] A protein of interest or a complex containing one or more proteins of interest ( For example, heme-bound LegH, dehydrins, phytases, proteases, and catalases. , lipase, peroxidase, amylase, transglutaminase, oxidoreductase enzymes, transferases, hydrolases, lyases, isomerases, ligases, Polypeptides (e.g., antibodies) can be purified from yeast cells. Methods for purifying polypeptides are known in the art. As used herein, a "purified" polypeptide is one that is A polypeptide that has been separated or purified from cellular components that naturally accompany it. Typically, The polypeptide is preferably at least 70% (e.g., at least 75%) by dry weight of the , 80%, 85%, 90%, 95%, or 99%) that is naturally associated with A polypeptide is considered to be "purified" when it is free of naturally occurring molecules. Chemically synthesized polypeptides are essentially those that have been separated from the components that naturally accompany them. Thus, the synthetic polypeptide is "purified."

[0036] As used herein, nucleic acid can include DNA and RNA, and may be one or more of the following: Nucleic acids can include those containing multiple nucleotide analogs or backbone modifications. It can be single-stranded or double-stranded, which usually depends on its intended use. Nucleic acids and polypeptides that vary from the given sequences are also provided. A nucleotide sequence is a sequence that has at least 50% sequence identity ( For example, at least 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82% , 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92% , 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity). It is possible.

[0037] In calculating the percent sequence identity, two sequences are aligned and the nucleotide identity between the two sequences is calculated. The number of identical matches is determined. by the length of the aligned nucleotides or amino acid residues (i.e., the number of aligned nucleotides or amino acid residues) multiplied by 100 This results in a percent sequence identity value. The length of the aligned region is calculated by multiplying the length of the shortest sequence by the total length of the shortest sequence. It will be appreciated that the length of the sequence may be a portion of one or both sequences up to the length of the sequence. can align with two or more other sequences and therefore span the entire aligned region. It will also be appreciated that different sequences may have different percent sequence identity values.

[0038] Alignment of two or more sequences to determine percent sequence identity can be performed using computer programs. This can be done using the program ClustalW and default parameters. It is important to note that the alignment of nucleic acid or polypeptide sequences is based on their entire length (global alignment). Chenna et al., 2003, Nucleic Acids Res., 3 1 (13): 3497-500. ClustalW finds optimal matches between a query sequence and one or more target sequences. Align them so that you can calculate good matches and determine identities, similarities, and differences. Gaps of one or more residues are inserted into the query sequence, the subject sequence, or both. To maximize sequence alignment, a method for rapidly aligning nucleic acid sequences using the You can use the default parameters (i.e., word size: 2; window Size: 4; Scoring method: percentage; number of top diagonals onals: 4; and gap penalty: 5); for aligning multiple nucleic acid sequences , the following parameters can be used: Gap opening penalty: 1 0.0; Gap Extension Penalty: 5.0; and Weight Change (weig ht transitions): Yes. For rapid pairwise alignment of polypeptide sequences, The following parameters can be used: word size: 1; window size: 5; Coring method: percentage; number of top diagonals: 5; and gap penalty: 3. For aligning multiple polypeptide sequences, the following patterns are used: You can use the following parameters: weight matrix: blosum; Gap opening penalty: 10.0; Gap extension penalty: 0 .05;Hydrophilic Gap:On;Hydrophilic Residues:Gly, Pro, Ser, Asn, Asp , Gln, Glu, Arg, and Lys; and residue-specific gap penalties: ClustalW is available, for example, on the Baylor College of Medicine Search Launcher website. te or on the World Wide Web at the European Bioinformatics Institute website. This can be done.

[0039] Changes can be introduced into a nucleic acid molecule to thereby alter the amino acid sequence of the encoded polypeptide. For example, changes can be made to the nucleic acid encoding sequence, such as by mutagenesis. (e.g., site-directed mutagenesis, PCR-mediated mutagenesis) or or by chemically synthesizing a nucleic acid molecule having such changes. Such nucleic acid changes may be conservative and / or non-conservative at one or more amino acid residues. A "conservative amino acid substitution" refers to a substitution of one amino acid. In some embodiments, the acid residue is replaced with a different amino acid residue having a similar side chain (e.g., Dayhoff et al. (1978, Atlas of Protein Sequences), which provides frequency tables for amino acid substitutions. nce and Structure, 5 (Suppl. 3): 345-352), and non-conservative substitutions , in which an amino acid residue is replaced with an amino acid residue that does not have a similar side chain. and / or the polypeptide sequence may be modified and augmented as described herein. expression (e.g., transcription and / or translation), tighter regulation, deregulation, catabolite repression Loss of control, altered specificity, secretion, thermal stability, solvent stability, oxidative stability, protease One or more of the following properties may be present: The properties can be improved.

[0040] As used herein, an "isolated" nucleic acid molecule refers to the nucleic acid molecule from which the isolated nucleic acid is derived. The nucleic acid in the genome of the derived organism may be naturally flanked at one or both ends by sequences (e.g. , cDNA or genomic D produced by PCR or restriction endonuclease digestion Such isolated nucleic acid molecules are nucleic acid molecules that are free of the nucleic acid fragments (NA fragments). For convenience of use, or to generate fusion nucleic acid molecules, which are discussed in more detail below, vectors may be used. The gene is generally introduced into a vector (eg, a cloning vector or an expression vector). In addition, an isolated nucleic acid molecule can be an engineered nucleic acid molecule, such as a recombinant or synthetic nucleic acid molecule. It can contain molecules.

[0041] Nucleic acids can be isolated using routine techniques in the art. Acids include, but are not limited to, recombinant nucleic acid techniques and / or polymerase chain reaction (PCR) ) can be used to isolate the nucleic acid. Common PCR techniques include, for example, PCR Primer: A Laboratory Manual, Dieffenbach & Dveksler, Eds., Cold Spring Harbo Recombinant nucleic acid techniques are described in, for example, restriction enzyme digestion. These include synthesis and ligation, which can be used to isolate nucleic acids. Nucleic acids can be synthesized either as a single nucleic acid molecule or as a series of oligonucleotides. It can also be chemically synthesized.

[0042] Polypeptides can be isolated from natural sources (e.g., biological samples) using techniques such as DEAE ion exchange, gel filtration, and the like. The mixture is purified by known methods such as filtration and hydroxyapatite chromatography. The polypeptide can be produced, for example, by expressing a nucleic acid in an expression vector. In addition, purified polypeptides can be obtained by chemical synthesis. The degree of purity of the polypeptide can be determined by any suitable method, for example, column chromatography. It is measured using cytometry, polyacrylamide gel electrophoresis, or HPLC analysis. It is possible.

[0043] Constructs or vectors containing nucleic acids (e.g., nucleic acids encoding polypeptides) are also provided. Constructs or vectors containing expression constructs or vectors are commercially available or or by recombinant DNA techniques routine in the art. A construct or vector containing such a nucleic acid comprises an expression element operably linked to such a nucleic acid. and encoding a selectable marker (e.g., an antibiotic resistance gene). The construct or vector containing the nucleic acid may further comprise a sequence such as A fusion polypeptide (i.e., a polypeptide having a nucleotide sequence at either the N-terminus or C-terminus of the polypeptide) The polypeptide can encode a polypeptide operably linked to a heterologous polypeptide that can be Representative heterologous polypeptides can be used in the purification of the encoded polypeptide. (e.g., 6xHis tag, glutathione S-transferase (GST )).

[0044] Expression elements include nucleic acid sequences that direct and regulate the expression of a nucleic acid coding sequence. An example of an element is a promoter sequence. Expression elements include introns, enhancer sequences, It can also include response elements, or inducible elements that modulate expression of the nucleic acid. The gene may be of bacterial, yeast, insect, mammalian, or viral origin, and the vector may be a heterologous vector. The composition may contain a combination of elements from different sources.

[0045] The vectors described herein can be introduced into a host cell. As used herein, the term "host cell" refers to the particular cell into which nucleic acid is introduced, and includes those cells that harbor vectors. The host cell may be any prokaryotic or eukaryotic cell. For example, nucleic acids can be expressed in bacterial cells, such as E. coli, or in insect cells, yeast or mammalian cells (such as Chinese hamster ovary cells (CHO) or COS cells) ) Other suitable host cells are known to those of skill in the art. Many methods for introducing nucleic acid into a host cell, both in vitro and in vivo, are well known to those of skill in the art, including electroporation, Calcium phosphate precipitation, polyethylene glycol (PEG) transformation, heat shock, lipofection, microinjection, and viral-mediated nucleic acid transfer. Not limited to these.

[0046] The nucleic acid may be amplified using any number of amplification techniques (e.g., PCR Primer: A Laboratory Manual, 1995, Die ffenbach & Dveksler, Eds., Cold Spring Harbor Laboratory Press, Cold Spring Harb or, NY; and U.S. Pat. Nos. 4,683,195 and 4,683,202. See 4,800,159; and 4,965,188. ) with an appropriate pair of oligonucleotides (e.g., primers) to detect Many modifications of the original PCR have been developed and can be used to detect nucleic acids. This can be done.

[0047] Nucleic acids can also be detected using hybridization. The construction is based on Sambrook et al. (1989, Molecular Cloning: A Laboratory Manual, 2nd Ed., C old Spring Harbor Laboratory Press, Cold Spring Harbor, NY; Sections 7.37-7.57, 9.47-9.57, 11.7-11.8, and 11.45-11.57). described a Southern blot assay suitable for oligonucleotide probes less than about 100 nucleotides. Lot conditions are disclosed (Sections 11.45-11.46). The Tm between a sequence and a second sequence can be calculated using the formula provided in Section 11.46. In addition, Sambrook et al. Southern blot conditions for the oligonucleotide probes are also disclosed (Sections 9.47-9. 54). The Tm between a sequence that is more than 100 nucleotides in length and a second sequence can be calculated using the formula provided in Sections 9.50-9.51 of Sambrook et al. can.

[0048] The conditions under which the membrane containing the nucleic acid is prehybridized and hybridized, and the nucleic acid The membrane containing the probe is washed to remove excess and non-specifically bound probe. Conditions can play a significant role in the stringency of hybridization. Such hybridization and washing can be carried out under medium or high stringency conditions. Wash conditions can be adjusted as needed, for example by changing the washing conditions to a lower salt concentration in the wash solution. and / or by increasing the temperature at which the wash is carried out. By way of example only, high stringency conditions are typically This includes washing the membrane in 0.2×SSC for 1 min.

[0049] In addition, the amount of hybridization can be read using, for example, labeled oligonucleotides. Specific activity of the probe on the template nucleic acid to which the probe is hybridized -by the number of binding sites and by the amount of autoradiographic exposure or other detection medium Any number of hybridization and washing conditions can be used to determine the fixation of the probe nucleic acid molecules. can be used to test for hybridization to a fixed target nucleic acid. The probes hybridize to the target nucleic acid under identical hybridization, washing, and exposure conditions. It will be readily appreciated by those skilled in the art that it is more important to examine hybridization. Preferably, the target nucleic acid is on the same membrane.

[0050] A nucleic acid molecule is one in which hybridization to a nucleic acid is inversely proportional to hybridization to another nucleic acid. At least 5-fold (e.g., at least 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 20-fold, 50-fold) 100-fold), it is a hybrid with a certain nucleic acid and not with another. It is believed that the nucleic acid does not form a hybrid. The amount of hybridization is Directly or by using, for example, a PhosphorImager or Densitometer ( (Molecular Dynamics, Sunnyvale, CA) Quantitation can be achieved from the radiograph.

[0051] The polypeptide can be detected using an antibody. Techniques for detecting the virus include enzyme-linked immunosorbent assay (ELISA), Western blot, These include immunoprecipitation and immunofluorescence. Antibodies can be polyclonal or monoclonal. Antibodies having specific binding affinity for a polypeptide are known in the art. Antibodies can be generated using methods known in the art. The method can be used to attach the ELISA kit to a solid support such as a microtiter plate. In the presence of the polypeptide, an antibody-polypeptide complex is formed.

[0052] Detection (e.g., detection of an amplification product, a hybridization complex, or a polypeptide) can be performed using a method such as the steps of: This is usually achieved using a detectable label. The term "label" includes direct labeling as well as indirect labeling. It is intended to encompass the use of labels. Detectable labels include enzymes, prosthetic groups, fluorescent These include luminescent, bioluminescent, and radioactive materials.

[0053] Used to generate strains that lack sequences for selection (i.e., lack a selectable marker). Methods that can be used are described herein. These methods involve the production of circular plasmids. This includes the use of DNA vectors and linear DNA sequences; circular plasmid DNA vectors , a selection marker and an origin of DNA replication (also known as an autonomously replicating sequence (ARS) The linear DNA sequence is inserted into the genome of Pichia by homologous recombination. In addition, the linear DNA molecule contains one or more Proteins that are involved, such as, but not limited to, heme-bound LegH, dehydrins, Phytase, protease, catalase, lipase, peroxidase, amylase, Transglutaminase, oxidoreductase, transferase, hydrolase, ases, isomerases, ligases, small molecules, e.g., ethanol, lactate, butanol, One or more enzymes involved in the production pathway of dipic acid or succinic acid, or any It may include nucleic acid sequences encoding antibodies against such proteins.

[0054] Pichia cells express the DNA molecule and the selectable marker on the circular plasmid. Transformants selected for the presence of the linear DNA fragment can then be transformed with both. Transformants can be selected, for example, using PCR, to integrate the gene into the genome. Transformants that had correctly integrated the marker-free linear DNA molecule were identified. Thus, cells can be grown in the absence of selection for the circular plasmid. The plasmid is not stably maintained in the absence of selection, so the plasmid is suitable for selection under relaxed conditions. The resulting strains often disappear very quickly after being synthesized. Therefore, this method has a significant effect on recombinant protein yields. Selectable markers (e.g., heterologous selectable markers) that have little or no effect on the host. It can be used to construct Pichia strains lacking

[0055] The present invention relates to a method for the preparation of a method for the preparation of a medicament ... Recombinant DNA techniques may be used. Such techniques are fully explained in the literature. The invention will be further illustrated in the following examples, which are provided to illustrate the principles of the claimed invention. The scope of the methods and compositions is not limited. EXAMPLES

[0056] Part A. Materials and Methods

[0057] Example 1 Polymerase Chain Reaction Genes of interest were isolated from genomic or plasmid DNA templates using Phus ion Hi-fidelity DNA polymerase (New England Bio Briefly, 0.6 μM of forward and and reverse primer in the presence of 1-2 U of Phusion DNA polymerase. Ink with 10–50 ng of template DNA and a mixture of 400 μM nucleotides The reaction conditions were as follows:

[0058] [Table 1]

[0059] Example 2 Plasmid construction by ligation 50-100 ng of restriction enzyme digested plasmid and 3x molar excess of PCR amplified plasmid DNA The amended insert was ligated with T4 DNA ligase (New England BioLabs). Ligation was carried out for more than 2 hours at 16°C. The ligation reaction was transformed into DH10B electrocompetent E. coli cells. .

[0060] Example 3 E. coli ElectroMax DH10B T1 phage resistant Transformation into competent cells Add 1.5-2 μl of the ligation mixture to 20 μl of ElectroMax DH10B T1 Phage resistant competent cells (Invitrogen, Cat# 12033-015 ) and electroporation using a MicroPulser (BioRad) set at 1.7 kV. The hole allows the use of 1 mm gap cuvettes (BioRad, catalog #165-2089). After the pulse, 1 ml of SOC was added to the cells, and the cells were incubated at 37°C for 1 hour. The mixture was incubated for 2 h with shaking at 200 rpm. 10 μl of the recovery mixture was The mixture was plated on LB agar plates containing phosphorus at a concentration of 100 μg / ml. was incubated overnight at 37°C.

[0061] Example 4: Plasmid DNA for transformation into P. pastoris Shape Plasmid DNA was digested with the PmeI restriction endonuclease in 1× CutSmart buffer. (New England BioLabs, catalog #R0560L) for 1–4 h. 37°C or in 1× CutSmart buffer with SfiI restriction endonuclease (Ne (England BioLabs, Cat. #R0123L) for 1-4 hours at 50°C. The linearized plasmid was purified by elution from a 0.8% agarose gel using Zymo clean Gel DNA Recovery Kit (Zymo Research, Catalog #D4002 ) and gel purified. DNA was eluted in 20 μl HO.

[0062] Example 5 Preparation of P. pastoris transformation competent cells Selected strains of P. pastoris were cultured in 25 ml of YPD medium at 4°C for 1 h. The cells were grown to several growth phases (approximately 2OD). The cells were centrifuged at 930×g for 15 min. The cell pellet was then collected in 2 ml of a solution of 80% YPD and 200 mM HEPES ( The cells were resuspended in 75 μl of 1M DTT (pH 6.8). The pellet was mixed at 100 rpm for 25 minutes at 30° C. Suspend the pellet in a volume of 40 ml of ice-cold sterile water. In addition to the lysate, cells were harvested by centrifugation at 1,125 x g for 15 min and placed on ice. The cell pellet was collected by resuspension in 40 ml of ice-cold water, followed by two washing steps. The cell pellet was then resuspended in 20 ml of ice-cold 1 M sorbitol. The final cell pellet was collected by centrifugation as before. The mixture was suspended in sorbitol, aliquoted, and frozen at -80°C.

[0063] Example 6 Transformation into P. pastoris 30–100 ng of linearized plasmid DNA was added to 30 μl of electrocompetent P. pastoris cells were cultured using a 1 mm gap GenePulser A GenePulser (BioRad) was used at 1.15 kV. The cells were transformed using ioRad. 1 ml of YPD / 1M sorbitol was added to the cells. The cells were mixed in a 1:1 ratio. The cells were allowed to recover for 3 hours at 30°C with shaking at 100 rpm. 100 μl of the recovery mixture was plated onto YPD plates containing the appropriate antibiotic to obtain the cells. The remaining cells were plated on YPD plates containing the appropriate antibiotic. The plates were incubated at 30° C. Incubate for 48 hours. The first transformation plate was plated on YPD containing the appropriate antibiotic. The plates were streaked and incubated at 30°C for 48 hours. The colony was patched onto a YPD plate containing antibiotics and the patch was used to identify colony P To perform PCR or genomic DNA preparation to confirm chromosomal integration for further analysis The strain was grown in shake flasks.

[0064] Example 7 Growth of cultures in shake flasks for production of LegH Strains from fresh patches were cultured in growth medium BMGY (BMGA supplemented with 0.75% glycerol). Y) and grown overnight at 30°C with shaking at 200 rpm. The next day, the expression of LegH was To demonstrate this, ON cultures were cultured in BMM supplemented with 0.1 mM ammonium Fe(III) citrate. The cultures were induced with methanol by dilution in Y medium (BMY + 1% methanol). The cells were grown until the OD600 reached 0.5-0.7. Antifoam was added to a final concentration of 0.01%. The cultures were grown for a total of 72 hours; methanol was added to the cultures for 24 hours. Add 1 / 10 of the shake flask volume of 10x BMMY medium (BMY + 10% methanol) to each shake flask. Cells were harvested by centrifugation after 72 hours of induced growth. did.

[0065] Example 8 Shake Flask Media BMY medium was prepared by dissolving 10 g of yeast extract and 20 g of soytone in 790 ml of water. The mixture was sterilized by autoclaving and cooled to room temperature. 00 ml of 1 M potassium phosphate buffer (pH 6.0) and 100 ml of amino acids. No. 10x Yeast Nitrogen Base (13.4 g YNB powder per 100 mL; Sigma-Aldrich ldrich) was sterilized by filtration (0.2 μm pore size PES) and added to the medium. No need to

[0066] [Table 2] The following components were dissolved in water and sterilized by autoclave.

[0067] [Table 3]

[0068] Example 9 Fermentation medium and preparation The ingredients listed below were dissolved and the volume adjusted with water. Ingredients were either FCC food grade or The results were comparable. The medium was autoclaved and steamed in situ. or equivalent means.

[0069] [Table 4] After sterilization, the medium was allowed to cool to room temperature and the following components were added:

[0070] [Table 5] The trace metals PTM1 solution was a powdered mixture from Sunrise Science ( (Cat. No. 4052-AB-1L). Pouch A and Pouch B are 9 Mix in 50 mL of water and add 5 mL of sulfuric acid. Some precipitation is expected upon mixing; The mixture was filter sterilized (0.2 μm pore size PES) and stored at 4° C. in the dark.

[0071] [Table 6] Alternatively, trace metal PTM1 can be made as follows.

[0072] [Table 7] The ingredients are mixed together, filter sterilized, and stored at room temperature. Prepare the glycerol feed mixture by mixing 4000 with 320 mL of water and stirring to dissolve. A mixture of water and Amberferm was added to 850 g of glycerol and heated at 100°C. The feed mixture was sterilized by autoclaving. .

[0073] [Table 8] The methanol supply consisted of 99–100% methanol supplemented with 12 mL / L of PTM1 solution. This was done using a tool.

[0074] Example 10: Protocol for laboratory-scale high oxygen transfer fermentation Seeded shake flask protocol In a sterile biosafety hood, mix low osmolarity medium and BMY in a 9:1 ratio of low osmolarity medium. The medium was mixed in a ratio of 1:1. Glycerol was added to the medium at a concentration of 12.5 g / L. Food grade glycerol / glycerin (50% v / v (63% w / w) glycerol / The solution was sterilized by autoclaving using Sigma 204 (99.7% purity in aqueous solution). or equivalent antifoam agent was added to the medium at a concentration of 0.25 mL / L. Glycerol seeding vials Remove the container, spray the outside with 70% IPA or ethanol, and place in a biosafety hood. The flask was thawed at room temperature for approximately 5 minutes in a refrigerator. The glycerol seeding vial was placed in a baffled shake flask. A 1 mL inoculum vial was used for every 1 L of shake flask medium. The plates were grown at 4°C for 24 hours with shaking (200 RPM with 1" throw). Ratios of actual medium volume:nominal shake flask volume between 1:10 and 1:5 were used. Fill a flask of nominal volume 2.8 L with 250 to 500 mL of medium and routinely It was successfully used. After 24 hours of growth, the OD at 600 nm was measured. If the OD was greater than or equal to 5, the culture was used to inoculate the fermenter. If the OD was less than 15, If so, the culture was grown for an additional 1-2 hours and the OD was determined again. If D was not reached after 15 to 30 hours, the seed flask was unsuccessful. It was considered as an example.

[0075] Fermentation Protocol Fermentation medium and feed materials were prepared as described herein. The initial volume was 100 ml at maximum fermentation temperature. It should be about 40% of the fermenter volume, e.g., 4 L if the maximum usable volume of the fermenter is 10 L. This is because the process will approach maximum working volume by the end of the fermentation. The fermentor is inoculated with a shake flask inoculation at a ratio of 10% inoculum to fermentor, e.g., 4 If 1.0 L of initial medium is present in the fermenter, the fermenter is cultured with a shake flask inoculation of approximately 0.4 L. The total volume in the fermenter at this point is called the TO volume, e.g., in this representative In the example, it is 4.4 L. Process controls include the following conditions: temperature at 30°C; 20% saturation setting. Dissolved oxygen control guided by an agitation-aeration cascade to maintain a constant point; and 28% pH control driven by addition of NH4OH, set point will depend on process phase .

[0076] Batch phase (from inoculation to glycerol depletion, indicated by DO spikes): Dissolved acid Depending on the response of the basic PID control, a strong DO spike or A rapid decline or a combination of both may occur as the cells consume all the glycerol present in the medium. The fed batch phase begins when this occurs. The duration of the catch phase is approximately 20 hours, although up to 24 hours may be tolerated. The H set point is 5.0. The wet cell weight at the end of the batch phase is approximately 220 g / L. Wax.

[0077] Fed-batch phase: Glycerol feed is started and diluted 12–100 mL based on the T0 volume. Achieve 4 g / L / hr neat glycerol. Feed rate is approximately 350 g / L wet cell weight, which will take approximately 7-10 hours. The pH set point is 5.0.

[0078] Transition phase: Samples are taken before starting the transition phase. The methanol feed is started and Undiluted based on T0 volume until methanol concentration reaches 1-2 g / L in fermentation broth A methanol concentration of 0.25-1 g / L / hr was achieved in the broth for the remainder of the fermentation. The methanol feed rate was adjusted to maintain a methanol concentration of 1000 / L. The federate rate was 12-14 g / L based on the T0 volume over the course of 2 hours. The feed rate was linearly decreased from 100 g / L / hr to 8-9 g / L / hr of neat glycerol. A stepwise decrease every 20 minutes would also be acceptable. The pH set point was changed to 3.5. This allows the fermentation to adjust naturally (i.e., without the addition of acid) to the new set point. I did.

[0079] Production phase (from the end of glycerol feed reduction to the end of fermentation): pH set point is 3. The methanol concentration in the fermentation broth was maintained at 0.25-1 g / L. The glycerol feed rate was maintained at 8-9 g / L / h neat glycerol based on the T0 volume. Samples were taken approximately every 12 hours. Samples were run at 4000 to 7000 RCF at 4°C. The pellet and supernatant were then decanted. The supernatant was saved in a separate tube. Three samples of 5 mL of supernatant were frozen at -80°C. Maximum aeration and agitation for the vessels were set at -80°C. If 15-20% DO cannot be maintained during production even at this rate, the glycerol feed rate should be increased to T The concentration can be reduced to 5 g / L / hr neat glycerol on a 0.0 volume basis. Fermentation was terminated 60 hours after inoculation. At the 1000 L scale, the harvest process consisted of a feedstock and Stop the heating and aeration, cool the broth to 8°C, and use Sharpless or Diskless. The paste was concentrated using a tack centrifuge. It takes 10 hours and does not result in detectable degradation of the product. For laboratory scale, 3× A 5 mL sample plus an additional 50 mL sample at the end is sufficient. The amount was >450 g / L and was found in the spun pellets from the pre-injection sample which appeared whiter. In contrast, the spun pellet appeared pink. The broth changed from white to a more pronounced pink. The color change began after approximately 6-12 hours of induction.

[0080] Part B. Construction of production strains Producing strain MXY0183 Example 11: Cloning of each enzyme of the heme biosynthetic pathway into pGAN or pGAZ integrative vectors Lawn pGAN (containing the natural selection marker) and pGAZ (containing the Zeocin selection marker) (which is a marker for chromatin synthesis) was purchased from Biogrammatics, Inc. (Carlsbad, CA). Each gene was placed under the control of the AOX1 promoter, and the FDH terminator was inserted into each gene. The genes in the heme biosynthetic pathway were placed immediately after the stop codon of the wild-type P. pastoris ( were amplified by PCR from P. pastoris strains or subcloned from previous constructs. .

[0081] The heme biosynthetic pathway, including the enzymes involved in the biosynthesis of heme, is shown in Figure 1. The intermediates produced are shown in boxes, and the enzyme-catalyzed steps are shown on the right. The rate-limiting enzymatic step exhibited in S. cerevisiae is underlined.

[0082] ALA synthase, ALA dehydratase, UPGIII synthase, UPGIII dehydratase The carboxylase, CPG oxidase and PPG oxidase genes were cloned using restriction endonucleases. Amplification by PCR using primers containing a site for recognition by the nuclease BsaI. Oligonucleotides were synthesized by ElimBiopharm.

[0083] [Table 9]

[0084] Phusion High-Fidelity DNA Polymerase (New Eng Land BioLabs, catalog #M0530L) and the gene from genomic DNA. The PCR products were amplified using DNA Clean & Concent The DNA was purified using a HPLC-5 (catalog #D4004) and aliquoted in 25 μl of H2 The vector DNA, pGAZ and pGAN, and the PCR products were eluted in B with saI (New England BioLabs, catalog #R0535S). Digestion was carried out at 37°C in a reaction volume of 50 μl.

[0085] Linearized vector and digested PCR products were visualized from a 0.8% agarose gel. Zymoclean Gel DNA Recovery Kit (Zymo Resea The DNA was purified using 100% PBS (Rch catalog #D4002). The DNA was eluted in 20 μl of H2O. The ligation reaction was carried out using T4 DNA ligase (New England BioLabs, Catalog # M0202S) overnight at 16° C. in 10 μl.

[0086] The PBD and ferrochelatase genes were subcloned from the previously constructed plasmids. pJAZ_PBD was cloned using the BstBI (Bsp119I) ntific, FD0124) and NotI (ThermoScientific, D0596) in 1× Fast Digest buffer for 5 minutes at 37°C. pJAZ_Ferroch was cloned using the MfeI (MunI, ThermoScientific c, FD0753) and NotI (ThermoScientific, FD0596 ) in 1× Fast Digest buffer for 5 minutes at 37° C.

[0087] The digested products were purified by elution from a 0.8% agarose gel using Zymoclean Gel DN A Recovery Kit (Zymo Research Catalog #D4002) The DNA was eluted in 20 μl of H2O.

[0088] The ligation reaction was carried out overnight at 16°C using T4 DNA ligase (New England BioL abs, catalog #M0202S) was used in a 10 μl reaction.

[0089] 1.5 μl of the ligation mixture was transferred to 20 μl of ElectroMax DH10B T1 phas resistant competent cells (Invitrogen, catalog #12033-015) Electroporation was performed using a MicroPulser (BioRad) set at 1.7 kV. The cells were transformed with 100% ethanol and incubated in 1 ml SOC for 1 h at 37°C with shaking at 200 rpm. 10 μl of the collected mixture was diluted with ampicillin at a concentration of 100 μg / mL. The plates were incubated overnight at 37°C for 1 h. Colonies were screened for the presence of the insert by colony PCR. The sequence was confirmed.

[0090] [Table 10]

[0091] Example 12 Plasmid for integration into the P. pastoris mutS genome Assembly of heme biosynthetic genes in yeast The entire cassette, "promoter gene terminator", was integrated into the Pichia genome. Contain sites for restriction endonucleases to construct plasmids for insertion The DNA was amplified by PCR using primers that

[0092] Paox1_UPS_FDHterm- in pGAN plasmid (pMx327) Assembly of Paox1_UPD_FDHterm-Paox1_CPO_FDHterm pGAN-CPG oxidase (pMx312) was cloned with the UPS and UPD cassettes. The UPGIII synthase cassette was inserted into pM x310 contains NheI and SphI recognition sites for the restriction endonucleases PCR was performed using primers against the AOX1 promoter / FDH1 terminator. R amplified.

[0093] [Table 11]

[0094] The UPGIII decarboxylase cassette was extracted from pMx311 using the restriction endonuclease AOX1 promoter / FD containing SphI and AgeI recognition sites for the enzyme It was PCR amplified using primers against the H1 terminator.

[0095] [Table 12]

[0096] Phusion High-Fidelity DNA Polymerase (New Eng DNA from plasmids using the 3D printer (Land BioLabs, catalog #M0530L) was amplified.

[0097] The resulting PCR products were purified using DNA Clean & Concentrator-5 ( Zymo Research, catalog #D4004) was used to purify the DNA. The mixture was eluted in 1 μl of H2O.

[0098] The vector pGAN-CPG oxidase (pMx312) was incubated at 1× NheI-HF (New England BioLabs, Catalog #R3131S) and AgeI-HF (New England BioLa The digestion was performed overnight at 37°C using 100% ribosomal DNA (Cas9, Cat# R3552S).

[0099] PCR products for the UPGIII synthase cassette are digested in 1x CutSmart buffer. heI-HF (New England BioLabs, Catalog #R3131S) and and SphI-HF (New England BioLabs, catalog #R3182 S) overnight at 37°C.

[0100] UPGIII decarboxylase cassette PCR product in 1x CutSmart buffer Among them, SphI-HF (New England BioLabs, catalog #R3182 S) and AgeI-HF (New England BioLabs, catalog #R3 552S) overnight at 37°C.

[0101] Digested vector and PCR products were purified from 0.8% agarose by Zymoclea n Gel DNA Recovery Kit (Zymo Research, catalogue The DNA was gel purified using 100% ribosomal DNA (#D4002). The DNA was eluted in 20 μl of HO.

[0102] UPGIII synthase cassette, SphI-Age digested with NheI-SphI The UPGIII decarboxylase cassette was digested with I and NheI-AgeI. A three-way ligation between the cloned vectors was performed using T4 DNA ligase (New England 10 μl at 16°C overnight using a 10% CO2 elution buffer (BioLabs, catalog #M0202S). He made him do so.

[0103] 1.5 μl of the ligation mixture was transferred to 20 μl of ElectroMax DH10B T1 phas resistant competent cells (Invitrogen, catalog #12033-015). Electroporation was performed using a MicroPulser (BioRad) set at 1.7 kV. cells were incubated at 37°C in 1 ml SOC for 1 h with shaking at 200 rpm. 10 μl of the recovered mixture was diluted with ampicillin to a concentration of 100 μg / ml. The plates were incubated overnight at 37°C. Colonies were screened for the presence of the insert by colony PCR. The sequence of the junctions between the objects was confirmed.

[0104] Paox1_ALA synthase_FDH1term.-Paox1_PPG oxidase _FDH1term-Paox1_Fc_FDH1term.-Paox1_PBD_F Assembly of DH1term cassette (pMx330) a. PCR amplification of gene cassettes The ALA synthase cassette was cloned from pMx310 with the restriction endonuclease AOX1 promoter / FDH1 terminator containing NheI and XhoI recognition sites The gene was amplified by PCR using primers against the target gene.

[0105] [Table 13]

[0106] The PPG oxidase cassette was cloned from pMx313 using the restriction endonuclease The AOX1 promoter / FDH1 terminus contains XhoI and AflII recognition sites. The gene was PCR amplified using primers against the inator gene.

[0107] [Table 14]

[0108] The ferrochelate cassette was cloned from pMx323 in response to the restriction endonuclease AOX1 promoter / FDH1 terminator containing AflII and AgeI recognition sites The gene was amplified by PCR using primers against the promoter.

[0109] [Table 15]

[0110] The G418 marker was introduced from the pJAG plasmid purchased from Biogrammatics. Then, PCR amplification was performed using the following primers:

[0111] [Table 16]

[0112] Phusion High-Fidelity DNA Polymerase (New England and BioLabs, catalog #M0530L) to amplify DNA from plasmids The PCR products were obtained and DNA Clean & Concentrated Purification was performed using ator-5 (Zymo Research, Cat #D4004). The DNA was eluted in 25 μl of H2O.

[0113] b. Vector Preparation The vector, designated pGAZ-PBD (pMx321), was transformed with 1× CutSmart Bu In ffer, NheI-HF (New England BioLabs, catalog #R 3131S) and XhoI (New England BioLabs, catalog #R 0146S) overnight at 37°C.

[0114] pGAZ-ALAsyn.-PBD(pMx328) contains 1x NEBuffer3.1 Among them, MluI (New England BioLabs, catalog #R0198S) and and BbvCI (New England BioLabs, catalog #R0601S) The digestion was performed overnight at 37°C.

[0115] pGAG-ALAsyn-PBD (pMx332) was diluted with 1x CutSmart Buf In fer, XhoI (New England BioLabs, catalog #R0146 S) and AgeI-HF (New England BioLabs, catalog #R3 552S) overnight at 37°C.

[0116] c. Generation of intermediate constructs and assembly of the final cassette Digested vector and PCR products were purified from 0.8% agarose by Zymoclea n Gel DNA Recovery Kit (Zymo Research, catalogue The DNA was gel purified using 100% ribosomal DNA (#D4002). The DNA was eluted in 20 μl of HO.

[0117] pGAZ-PBD (pMx3 21) The vector was digested with the PCR product of the ALA synthase cassette digested with the same enzymes. T4 DNA ligase (New England Biosciences) was used in a 10 μl reaction overnight at 16°C. oLabs, catalog #M0202S) and ligated into pGAZ-ALAsyn.- The PBD plasmid (pMx328) was obtained.

[0118] pGAG-ALA digested with XhoI and AgeI-HF restriction endonucleases syn-PBD(pMx332), XhoI, AflII and AflII, AgeI -HF restriction endonuclease digested PPG oxidase cassette and ferroxine The corresponding products of the ligase cassette PCR were ligated with T4 DNA ligase (New England). nd BioLabs, catalog #M0202S) in a three-way ligation reaction. , pGAG-ALA synthase_PPG oxidase_Fc_PBD(pMx330) Got it.

[0119] 1.5 μl of the ligation mixture was transferred to 20 μl of ElectroMax DH10B T1 phas resistant competent cells (Invitrogen, catalog #12033-015) Electroporation was performed using a MicroPulser (BioRad) set at 1.7 kV. The cells were transformed with 1 ml of SOC at 37°C for 1 hour with shaking at 200 rpm. 10 μl of the recovered mixture was diluted with ampicillin to a concentration of 100 μg / ml. The plates were incubated overnight at 37°C. Colonies were screened for the presence of the insert by colony PCR. The sequences of the junctions between the inputs were confirmed.

[0120] [Table 17]

[0121] Example 13: Transformation of linearized plasmids carrying gene cassettes into P. pastoris toris) into the Bg11 genome The plasmids used to generate the production strain MXY0183 are shown in Figure 2. The steps taken to make the modifications that led to strain MXY0183 are depicted in FIG.

[0122] The first enzyme to be introduced into the Bg11 genome of P. pastoris was AL The plasmid containing ALAD driven by pAOX1 (pMX229, 2i and 3) were prepared using PmeI restriction enzyme (New England BioLab). The linearized plasmid was linearized using 0.8% agarose as described. The AOX1 gene was purified from the gel and transformed into P. patens using homologous recombination at the native AOX1 locus. The plasmid was transformed into P. pastoris, generating strain MXY099 (Figure 3).

[0123] The soybean LegH gene (P. pastoris) under the control of the pAOX1 promoter pMX28 containing two copies of the sequence optimized for pMcPNA (SEQ ID NO:3) The plasmid designated 2 (Figure 2ii and Figure 3) was linearized using SfiI restriction enzyme. The linearized plasmid was purified from a 0.8% agarose gel as described. Transformation of the ALAD-containing P. pastoris strain into strain MXY011 8 (Figure 3). Using qPCR, strain MXY0118 was found to have Based on the concatamerization of plasmid pMX282 in It was determined to contain several copies of the egH gene.

[0124] Uroporphyrinogen III synthase (UPS) under the control of the AOX1 promoter , uroporphyrinogen III decarboxylase (UPD) and coproporphyrin CPO (catalyzing steps 4, 5, and 6, respectively) Plasmid pMX327, which contains the gene encoding the enzyme (Figure 2iii and Figure 3) was linearized using SfiI restriction endonuclease and introduced into MXY0118 to produce strain MXY0170 was obtained (Figure 3).

[0125] ALA synthase (ALAS) from the P. pastoris genome, proto Porphyrin III oxidase (PPO), ferrochelatase (FC) and porphyrin III oxidase (PPO), Bilinogen deaminase (PBD) (catalyzes steps 1, 7, 8, and 3, respectively) The gene encoding the enzyme that activates the ribozyme was assembled on the plasmid pMX330 (Fig. 2iv and pMX330 was linearized with SfiI restriction endonuclease and transformed into MXY0 170, leading to the generation of strain MXY0183 (Figure 3). Genotypes were confirmed using PCR and qPCR. Producing strain MXY0207

[0126] Example 14 Construction of pGAB expression vector The pGAB expression vector (Figure 4A) was transformed into the pGAZ vector (BioGrammatics The open reading frame of the Zeocin resistance gene in Selection of transformants carrying a plasmid in frame with the antibiotic blasticidin S Aspergillus terreus, which enables By replacing the open reading frame with that from the benzoxazole S deaminase (BSD) gene, It was constructed by:

[0127] The BSD open reading frame was synthesized from a commercially synthesized DNA molecule using oligonucleotides. The nucleotide primers MxO0476 and MxO0477 were used to The DNA was amplified using the highly reliable polymerase chain reaction described in the literature.

[0128] [Table 18] The BSD PCR product was dissolved in 1x TBE buffer (89 mM Tris, 89 mM boric acid, 2 mM The product was purified by gel electrophoresis on a 1% agarose gel in EDTA, pH 8.3. SYBR Safe DNA gel stain (Life Technologies, Carlsbad The desired DNA fragment was visualized using agarose gel (Sbad, CA). The DNA was then extracted using the Zymoclean Gel DNA Recovery Kit. (Zymo Research, Irvine, CA).

[0129] The purified BSD PCR product and the pGAZ vector were digested with 10 units each of MluI and and BbvCI restriction endonuclease (New England BioLabs, Ip 1x NEBuffer3.1 (100 mM Swich, MA) at 37°C for 1 hour. M NaCl, 50 mM Tris-HCl, 10 mM MgCl2, 100 μg / ml BS A, pH 7.9 at 25°C. The digested DNA products were gel electrophoresed as described above. The proteins were recovered by electrophoresis.

[0130] The purified MluI and BbvCI digested BSD product and pGAZ vector The ligase was diluted with 400 units of T4 DNA ligase (New England BioLabs ) and 1x T4 DNA ligase reaction buffer (50 mM Tris-HCl, 10 mM MgCl l2, 1 mM ATP, 10 mM DTT, pH 7.5 at 25°C) in a 20 μl reaction. The 20 μl reaction was incubated at 16° C. for 2 hours. Electrocompetent E. coli ( Transform E. coli DH10B cells with 2 μl of the ligation reaction to confer antibiotic resistance. Transformants were selected on LSB agar plates supplemented with 100 μg / μl ampicillin.

[0131] Example 15 Construction of Mxr1 expression vector The Mxr1 expression vector pMx354 was transformed with the Mxr1 open reading frame pG The Mxr1 open reading frame was constructed by introducing it into the AB vector (FIG. 4B). The frame was designed to express the methanol-induced alcohol from Pichia pastoris. Translation is initiated immediately downstream of the alcohol oxidase 1 (AOX1) promoter and expressed in P. pastoris. A translation termination sequence immediately followed by a transcription terminator sequence from the P. pastoris FDH1 gene The plasmid pGAB was inserted into pGAB.

[0132] The open reading frame encoding the Mxr1 protein was identified in BioGram Pichia pastoris was obtained from Biochemicals, Inc. (Carlsbad, CA). Mxr1 was amplified from genomic DNA isolated from the Bg11MutS strain of Mxr1. The open reading frame was derived from the genomic DNA of P. pastoris. The primers added flank the NotI restriction endonuclease recognition site. -MxO0495(TTTTGCGGCCGCATGAGCAATCTACCCCCAA CTTTTG (SEQ ID NO: 45)) and MxO0496 (AAAAGCGGCCGCC Amplified using TAGACACCACCATCTAGTCGGTT (SEQ ID NO: 46) Amplification was accomplished using the polymerase chain reaction as described herein.

[0133] The amplified Mxr1 PCR product and the pGAB vector were digested with 10 units of NotI restriction enzyme. Endonuclease (New England BioLabs) was used for 1 hour at 37°C. °C, 1x NEBuffer3.1 (100 mM NaCl, 50 mM Tris-HCl, 10 The digestion was performed in 10 mM MgCl2, 100 μg / ml BSA, pH 7.9 at 25°C. Following transfection, the NotI-digested pMx352 vector was transformed with 5 units of Antarctic c phosphatase (New England BioLabs) for 15 min at 37°C. , 1x Antarctic phosphatase buffer (50 mM Bis-Tris-propane-H Cl, 1 mM MgCl2, 0.1 mM ZnCl2, pH 6 at 25°C did.

[0134] The amplified Mxr1 fragment and pMx352 vector were digested with NotI. , 1x TBE buffer (89 mM Tris, 89 mM boric acid, 2 mM EDTA, pH 8.3 ) and electrophoretically separated on a 1% agarose gel in SYBR SAFE DNA Gel Visualized using staining (Life Technologies, Carlsbad, CA) The desired DNA fragment was excised from the agarose gel and the DNA was purified by PCR using the moclean Gel DNA Recovery Kit (Zymo Research h, Irvine, Calif.).

[0135] A NotI-digested fragment containing the Mxr1 open reading frame by ligating the pGAB at the NotI site immediately downstream of the AOX1 promoter. The Mxr1 open reading frame was introduced into the NotI plasmid (137 ng). ng of NotI-digested and phosphatase-treated DNA and 60 ng of NotI-digested and phosphatase-treated p The mixture containing Mx352 was diluted with 400 units of T4 DNA ligase (New England and BioLabs) was used to ligate the DNA using 1× T4 DNA ligase reaction buffer (50 mM Tris. and BioLabs). Lys HCl, 10 mM MgCl2, 1 mM ATP, 10 mM DTT, pH 2.0 at 25 °C 7.5) 20 μl reactions were incubated at 16°C for 2 hours in 20 μl reactions. Transform 2 μl of the ligation reaction into lactocompetent E. coli DH10B cells. The antibiotic-resistant transformants were then plated on LSB agar supplemented with 100 μg / μl ampicillin. The plates were incubated overnight at 37°C. The colonies were selected using the insert. The presence of the compound was examined by PCR using primers MxO0495 and MxO0496. The sequence of the final vector was confirmed by DNA sequencing.

[0136] During cloning, six additional amino acids were introduced at the N-terminus of Mxr1. The open reading frame is shown in the "Nucleic Acid Sequence" section, and the remaining amino acids from the cloning are shown in the "Nucleic Acid Sequence" section. The amino acids are underlined. It contains the Mxr1 sequence with an additional six amino acids at the N-terminus. Pichia production strain and wild-type Mxr1 (i.e., Mxr1 with an additional six amino acids at the N-terminus) Pichia strains containing α-aminobutyric acid (Ab) and α-aminobutyric acid (Ab) were indistinguishable in the fermenter.

[0137] Example 16 Construction of native Mxr1 expression vector pMX35 containing the Mxr1 transcription factor gene under the control of the pAOX1 promoter The plasmid designated AOX1 was used as a template for PCR amplification. The 3' end of the promoter, the LegH open reading frame, and the AOX1 promoter The promoter was amplified from pMX354 using primers MxO0617 and MxO06 47. The AOX1 terminator, linker and AOX1 promoter were amplified using The 5' end of the pMX382 was cloned using primers MxO0618 and MxO0646. was used for amplification.

[0138] [Table 19]

[0139] Obtain PCR product and use DNA Clean & Concentrator-5 The PCR product was purified using 100% PBS and the DNA was eluted in 12 μl of H2O. PCR amplification using primers MxO0617 and MxO0618 in combination The resulting PCR product was used as a template for the next round. The 3' end of the terminator, followed by the Mxr1 open reading frame, the AOX1 terminator The PC1 gene was composed of a 5′ end of the AOX1 promoter, a short linker sequence, and the 5′ end of the AOX1 promoter. The R product was obtained and purified as described herein. Purified PCR products Zero Blunt® TOPO® PCR Cloning Kit (Invitrogen, Catalog #K2800-20) was used to create pCR™-B The vector was cloned into the lunt II-TOPO® vector to create the pMX402 vector. created the Tar.

[0140] Example 17 P. pastoris strains MXY0206 and MXY0207 construction The pMx354Mxr1 expression vector (Figure 4B) was transformed into MXY018 It was introduced into three strains (Fig. 3).

[0141] The pMx354 vector (1.5 μg) was dissolved in 1× NEBuffer4 (50 mM potassium acetate). 20 mM Tris acetate, 10 mM magnesium acetate, 1 mM DTT, pH 7.0 at 25°C 20 units of PmeI restriction endonuclease (New England The AOX1 promoter was digested with 500 kDa DNA (BioLabs) for 1 hour at 37°C. The sequence was linearized at a unique PmeI site.

[0142] The PmeI-digested pMX354 vector was purified by gel electrophoresis and purified using the above Z The DNA was recovered using the ymoclean Gel DNA Recovery kit. The modified pMX354 vector was transformed into strain MXY0183 to produce a brassica. Selected on cytosine-containing medium. Two independent clones were obtained from the transformation and were The AOX1 promoter was expressed in these strains. The presence of an additional copy of Mxr1 under the control of was confirmed by PCR.

[0143] Producing strain MXY0291 Example 18 Construction of Strains MXY0213 and MXY0260 FIG. 5 shows strain MXY, which contains the seven enzymes of the heme biosynthetic pathway and does not contain an antibiotic marker. The steps taken to construct pAOX13 are shown. Contains the homologous variant Mxr1 (six extra amino acids at the N-terminus) under pAOX1 A linear piece of DNA encoding the ribozyme was introduced using cotransformation (Figures 5 and 6i). The Mxr1 expression cassette was transformed into Pichia (Pichia cerevisiae) using the pIL75 plasmid. ia) were simultaneously introduced into strain MXY213. The pIL75 vector was panA allows the plasmid vector to be maintained without integration into the genome RS autonomously replicating sequence (Liachko & Dunham, 2014, FEMS Yeast Res., 14: 364-7) and It carries the kanMX marker for selection of transformants with the biosynthetic agent G418. The transformed cells were grown in medium supplemented with G418, and the kanM gene in the pIL75 plasmid was expressed. Pichia transformants were selected for the presence of the X marker. Colonies were selected for transformation that had taken up the midi and correctly integrated the Mxr1 expression cassette. Selection was performed by PCR.

[0144] Example 19 Co-transformation of LegH expression cassette into Pichia Different Pichia pastoris clones expressing soybean LegH genes under the control of the pAOX1 promoter Pichia pastoris - including a codon-optimized variant (Phase 3; SEQ ID NO: 5) A plasmid designated pMX399 containing the nucleotide sequence ##STR00011## was used as a template for PCR amplification of the gene. The backbone from the TOPO cloning plasmid pMX401 was used as a source of The insert and vector were amplified using Gibson assembly (NEB Gibson The plasmid pMX422 was generated by assembling the plasmid using the . The plasmid was transformed with P It was used as a template for the next round of CR amplification.

[0145] [Table 20]

[0146] The resulting PCR product, in the 5' to 3' direction, contains the 3' end of the AOX1 promoter, The LegH var3 open reading frame, followed by the AOX1 terminator, The 5′ end of the AOX1 promoter was then inserted into the 5′-terminal of the AOX1 promoter (Figure 6ii). CR products were obtained and purified by agarose gel electrophoresis as described herein. .

[0147] Transformants carrying the LegH expression cassette integrated into the genome were screened by PCR. were selected and characterized for LegH gene copy number using qPCR.

[0148] Example 20 Curing of transformants of plasmid vectors carrying selection markers The soybean LegH expression cassette was correctly identified by colony PCR and highly expressed by qPCR. In clones that showed high copy number integration, the required G418 selection was The pIL75 plasmid was eliminated by relaxing the selection against the antibiotic. Transformants were streaked to single colonies on medium lacking the G418 antibiotic. Since the plasmid is not stably maintained in the absence of selection, pIL75 does not form under these conditions. The resulting Pichia strain, MXY0291, rapidly disappeared from the transformed cells. It contains sequences for expressing LegH in the same copy number as XY0207, but for selection purposes It lacks heterologous sequences.

[0149] Producing strains MXY0330, MXY0333, and MXY0338 Example 21 Construction of strain MXY0306 Genotyping of strain MXY0291 by PCR revealed that the CPG oxidase-encoding sequence It was revealed that a portion of the CPG oxidase was deleted during the construction of this strain. The coding region was restored by replacement of the truncated copy. Then, using the primers MxO0866 and MxO0867 shown below, pAOX 1. A linear DNA fragment containing the promoter and the full-length CPG oxidase coding region The fragment was generated by PCR amplification from the plasmid pMX312.

[0150] [Table 21]

[0151] The linear pAOX1-CPG oxidase DNA fragment was cloned into the pIL75 plasmid. The transformants were introduced into strain MXY0291 by co-transformation of The presence of the full-length CPG oxidase coding region was detected by PCR using a medium that was selected for Isolates containing full-length CPG oxidase were identified and subsequently analyzed as described above. The plasmid vector required for G418-based selection was eliminated. It was named Y0306 (see Figure 5).

[0152] Example 22 Linear constructs for hybrid promoter strains LegH var3 was transformed with the three native Pichia pastoris strains shown here. The linear constructs were expressed under the direction of the constitutive promoter of each of the vectors (Lyssmann et al., 2003). , the 3' half of the promoter, followed by LegH variant 3, followed by the FDH1 transcription factor This was followed immediately by Ashbya gossypii. pTEF promoter from Aspergillus nidulans and Ashbya gossypii pii) followed by an antibiotic resistance cassette containing the TEF terminator from The construct contained the 5' half of the promoter. This linear cassette is listed in the table below. The oligonucleotide primers listed in the table were used to amplify the 5' and 3' ends of the DNA fragment. Contains hundreds of base pairs of homology to each of the promoters in the natural Pichia genome. A construct was generated.

[0153] [Table 22]

[0154] Competent MXY0306 cells were transformed with each of the linear cassettes and the amdS selection vector was inserted. Transformants containing the selection cassette were cultured on ice containing acetamide as the sole nitrogen source. These strains were selected based on their ability to grow on 3D plates. The presence of LegH under the control of a constitutive promoter was verified by PCR (Figure 5). .

[0155] Example 23 Nucleic Acid Sequences Nucleic acid sequence of Mxr1 (underlined nucleotides are N-terminal nucleotides introduced during cloning) (SEQ ID NO:1)

[0156] [ka]

[0157] [ka] Mxr1 protein sequence (the underlined 6 amino acids at the N-terminus are under cloning) (SEQ ID NO:2)

[0158] [ka] Pichia pastoris - Codon-optimized LegH nucleic acid sequence ( SEQ ID NO:3)

[0159] [ka] Pichia pastoris - Codon-optimized LegH amino acid sequence Column (SEQ ID NO:4)

[0160] [ka] Pichia pastoris - Codon-optimized LegH plasmotype 3 Nucleic acid sequence (SEQ ID NO:5)

[0161] [ka] Pichia pastoris - Codon-optimized LegH plasmotype 3 Amino acid sequence (SEQ ID NO:6)

[0162] [ka] Pichia pastoris pAOX1 promoter (SEQ ID NO:7)

[0163] [ka] Pichia pastoris pGAP promoter (SEQ ID NO:8)

[0164] [ka] The pGCW14 promoter of Pichia pastoris (SEQ ID NO:9) )

[0165] [ka] Pichia pastoris pTEF1 promoter (SEQ ID NO:10 )

[0166] [ka] Heme biosynthetic enzyme 1-ALA synthase (SEQ ID NO:11)

[0167] [ka] Heme biosynthetic enzyme 2-ALA dehydratase (SEQ ID NO:12)

[0168] [ka] Heme biosynthetic enzyme 3-porphobilinogen deaminase (SEQ ID NO: 13)

[0169] [ka] Heme biosynthetic enzyme 4-uroporphyrinogen III synthase (SEQ ID NO:14)

[0170] [ka] The heme biosynthetic enzyme 5-uroporphyrinogen III decarboxylase (SEQ ID NO:1) 5)

[0171] [ka] Heme biosynthetic enzyme 6-coproporphyrinogen III oxidase (SEQ ID NO:16)

[0172] [ka] Heme biosynthetic enzyme 7-protoporphyrinogen oxidase (SEQ ID NO: 17)

[0173] [ka] Heme biosynthetic enzyme 8-ferrochelatase (SEQ ID NO: 18)

[0174] [ka]

[0175] Part C. Results and Discussion Example 24 Characterization of strain MXY0183 Optimal growth conditions for strain MXY0183 were a target pH of 3.0 to 6.0 and a pH of 28 to 40. To produce the LegH protein, strain MXY0183 was incubated at 35°C. The medium must be able to grow aerobically for 6 days.

[0176] Expression of the genes associated with strain MXY0183 caused phenotypic changes in the strain. Photographs of shake flasks at the start of induction (0 hours) and 72 hours after induction are shown. The flasks designated #1 and #2 contain the host strain MXY0051. The flasks designated #2 and #3 contain the host strain MXY0051. Intermediate strains (i.e., those with >10 copies of the LegH gene and ALA dehydrogenase from the heme biosynthetic pathway) MXY0118) and production strains (i.e., strains containing >10 copies of the LegH gene MXY0183), which contains eight enzymes from the heme and acetylcholine biosynthetic pathways, The characteristic red color in flask #3 after 72 hours represents heme-bound Leg This indicates the production of H.

[0177] After growth in shake flasks, the P. pastoris strain MXY shown above MXY0051, MXY0118, and MXY0183 were dissolved and the proteins were loaded onto an SDS gel. The arrow indicates the position of the LegH protein. A comparison of LegH production in XY0118 is shown in Figure 9B, which is comparable to that in strain MXY0183. This shows the effectiveness of heme loading on LegH protein by

[0178] Example 25 Characterization of strain MXY0207 Next, transcriptional activators were synthesized in the presence of genes encoding eight enzymes involved in heme biosynthesis. Experiments were carried out to determine the benefit of overexpressing Mxr1. Strain M, which contains the LegH sequence and genes encoding eight enzymes involved in heme biosynthesis XY0183, and >10 copies of LegH sequence, 8 enzymes involved in heme biosynthesis The sister strains MXY0206 and MXY0210, which contain the gene encoding the Mxr1 transcription activator, and MXY0207 were incubated in the presence of glycerol, a repressing carbon source for these strains. The cells were grown in shake flask culture. A photograph of the shake flask culture after 48 hours is shown in Figure 10A. Shown is a photograph of a pellet from cells grown for 48 h in BMY medium without additional carbon source. These experiments show that the repressing carbon source inhibits the AOX1 promoter in Mxr1 and in When the AOX1 promoter was exhausted in the growth medium of the strain expressing the AOX1 promoter, Significant expression of the underlying transgene (e.g., heme enzyme) occurs in the absence of an inducing carbon source. We show that heme-loaded LegH expression in shake flask cultures grown in the absence of inducer is The relative yields are shown in FIG. 10C. These experiments demonstrated that Mxr1 expression was also regulated by the AOX1 promoter. In a Pichia strain driven by the β-glucosamine derivative, in the absence of methanol induction, Significant production of recombinant heme-loaded proteins by AOX1 promoter-driven transgenes This shows that it is achieved from the child.

[0179] Selected strains were grown in 2 L fermentors to determine the relative yields of LegH and heme-loaded LegH. Compared to strain MXY0183, strain MXY0207 had more It produces LegH and efficiently produces enough heme to load the LegH protein with heme. It was possible to produce it efficiently.

[0180] Example 26 Characterization of strain MXY0291 As described above in Examples 18-20, strain MXY0291 was constructed to obtain the L The strain MXY0291 reproduced the egH production ability but did not contain the antibiotic resistance gene. It contains approximately 16 copies of LegH plasmodial 3, Mxr1, and 7 of the 8 heme biosynthetic enzymes. When grown in a 2 L fermentor, this strain was found to have the same The LegH yield was improved compared to the methanol / glycerol and This was observed in both induction media containing methanol / dextrose (D-glucose) and (Figure 11).

[0181] Example 27 Characterization of hybrid promoter strains An additional copy of soybean leghemoglobin (LegH) is added to the already several copies of LegH. -, all heme biosynthetic enzymes, and the promoter pAOX1 (referred to above as MXY0291 The strain contains the transcription factor Mxr1 under the control of three different constitutive promoters. , pGAP, pGCW14 and pTEF1. When induced by methanol in the presence of D-glucose, the constitutive promoter and Both pAOX1 and pAOX1 drive the expression of LegH, but only the pAOX1 promoter regulates the expression of the heme enzyme This promotes the expression of LegH, which further increases the yield compared to the previous strain, MXY0291. This brings about an improvement (Figure 11).

[0182] Although the methods and compositions have been described herein in connection with a number of different embodiments, various The foregoing description of the embodiments is intended to be illustrative and not limiting of the scope of the methods and compositions. It should be understood that other aspects, advantages, and modifications are set forth in the following claims. It is within range.

[0183] can be used for and in connection with the disclosed methods and compositions. Processes which can be used for the preparation thereof or are products thereof and compositions are disclosed. These and other materials are disclosed herein, It is understood that combinations, subsets, interactions, groups, etc. of the methods and compositions are disclosed. That is, the various individual and collective combinations and uses of each of these compositions and methods are Although specific references to substitutions and permutations may not be expressly disclosed, each is specifically It is contemplated and described herein. For example, certain compositions or certain methods are disclosed. and many compositions or methods are discussed, particularly to the contrary. Unless otherwise indicated, each and every combination and permutation of the compositions and methods is expressly intended. Likewise, any subset or combination of these is specifically contemplated. and are disclosed.

Claims

1. A methylotrophic yeast cell comprising a recombinant nucleic acid molecule, said recombinant nucleic acid molecule comprising at least one A transcriptional activator operably linked to at least one methanol-inducible promoter element. A yeast cell comprising an exogenous nucleic acid encoding the

2. The methylotrophic yeast cell is selected from the group consisting of Candida, Hansenula, A yeast selected from the group consisting of Pichia and Torulopsis. The yeast cell of claim 1 which is a mother yeast cell.

3. 3. The method of claim 1, wherein the methylotrophic yeast cell is a Pichia yeast. Yeast cells.

4. 3. The yeast cell of claim 1 or 2, wherein the cell is a Pichia cell.

5. 5. Any of claims 1 to 4, wherein the cell is a Pichia pastoris cell.

2. A yeast cell according to any one of claims 1 to 11.

6. The recombinant nucleic acid molecule is stably integrated into the genome of the methylotrophic yeast cell. A yeast cell according to any one of claims 1 to 5.

7. the recombinant nucleic acid molecule is expressed extrachromosomally from a replication-competent plasmid; A yeast cell according to any one of claims 1 to 5.

8. The exogenous nucleic acid encoding the transcription activator is s), Mxr1 sequence from Hansenula polymorpha dr1 sequence, Trm1 sequence from Candida boidinii, or 8. The method according to claim 1, further comprising the step of: A yeast cell according to any one of the preceding claims.

9. The exogenous nucleic acid encoding the transcription activator is 9. A yeast cell according to any one of claims 1 to 8, comprising an Mxr1 sequence from

10. The transcription activator comprises a sequence represented by GenBank Accession No. ABD57365. A yeast cell according to any one of claims 1 to 9.

11. The transcription activator is a nucleic acid sequence represented by GenBank Accession No. DQ395124. The yeast cell of claim 10 , wherein the gene is encoded by

12. The at least one methanol-inducible promoter element is selected from the group consisting of Pichia pastoris (Pi Alcohol oxidase 1 (AOX1) promoter element from chia pastoris, Kan AOD1 promoter element from Candida boidinii, Hansenula MOX promoter element from Hansenula polymorpha, Pichia methanoides MOD1 promoter element from Pichia methanolica, Pichia pastoris DHAS promoter element from Pichia pastoris is) and the FLD1 promoter element from Pichia pastoris 12. The method of claim 1, wherein the PEX8 promoter element is selected from the group consisting of 2. A yeast cell according to any one of claims 1 to 11.

13. The at least one methanol-inducible promoter element is selected from the group consisting of Pichia pastoris (Pi Alcohol oxidase 1 (AOX1) promoter elements from chia pastoris A yeast cell according to any one of claims 1 to 11.

14. A polypeptide operably linked to at least one methanol-inducible promoter element. The nucleic acid molecule according to claim 1 further comprises at least one heterologous nucleic acid encoding a tide.

14. A yeast cell according to any one of claims 13 to 13.

15. The heterologous nucleic acid encodes at least one polypeptide involved in the biosynthesis of an iron cofactor. The yeast cell of claim 14.

16. The yeast cell of claim 15 , wherein the iron cofactor is heme.

17. The at least one polypeptide involved in the biosynthesis of heme is ALA synthase, A LA dehydratase, porphobilinogen deaminase, UPGIII synthase, U PGIII decarboxylase, CPG oxidase, PPG oxidase, and phe 17. The yeast cell of claim 16, wherein the enzyme is selected from the group consisting of loxatase.

18. The at least one polypeptide involved in the biosynthesis of heme is ALA synthase, A LA dehydratase, porphobilinogen deaminase, UPGIII synthase, U PGIII decarboxylase, CPG oxidase, PPG oxidase, and phe The method according to claim 16, comprising administering to the patient a therapeutically effective amount of at least one polypeptide selected from the group consisting of: Yeast cells on plate.

19. 19. The yeast cell according to any one of claims 1 to 18, wherein the yeast cell lacks a heterologous sequence for selection. Mother cell.

20. 1. A method for expressing a heterologous polypeptide in a cell, comprising the steps of: Providing a yeast cell according to any of the preceding claims; At least one alcohol oxidase from Pichia pastoris A small molecule encoding a polypeptide operably linked to an AOX1 promoter element. introducing a recombinant nucleic acid molecule containing at least one heterologous nucleic acid into a methylotrophic yeast cell; and Culturing the cells under conditions suitable for expression of the recombinant nucleic acid molecule, thereby Expressing the seed polypeptide A method comprising:

21. The heterologous polypeptide is a member of the globin family PF00042.

21. The method according to claim 20.

22. 21. The method of claim 20, wherein the heterologous polypeptide is a plant hemoglobin.

23. 23. The method of claim 22, wherein the plant hemoglobin is leghemoglobin.

24. The leghemoglobin is selected from the group consisting of SEQ ID NO: 4 and SEQ ID NO:

6. The method of claim 23 having the sequence

25. The introducing step can be selected from transduction, electroporation, biolistic delivery, and chemical transformation.

25. The method of any of claims 20 to 24, comprising a technique selected from the group consisting of:

26. The conditions under which the cells are cultured may be such that the cells are free of iron or a pharma- ceutically or metabolically acceptable 26. The method according to any one of claims 20 to 25, comprising the addition of a salt thereof.

27. 3. The method of claim 2, wherein the culturing step comprises culturing the cells in the presence of methanol.

27. The method of any one of claims 0 to 26.

28. 3. The method of claim 2, wherein the culturing step comprises culturing the cells in the absence of methanol.

27. The method of any one of claims 0 to 26.

29. 21. The method of claim 20, wherein the culturing step comprises culturing the cells in the absence of selection.

28. A method according to any one of claims 27 to 28.

30. A methylotrophic Pichia yeast cell comprising a recombinant nucleic acid molecule, said recombinant The nucleic acid molecule, Nucleic acid encoding the Mxr1 transcriptional activator sequence from P. pastoris ； A nucleic acid encoding a member of the globin family (PF00042); and Nucleic acid encoding at least one polypeptide involved in the biosynthesis of heme A methylotrophic Pichia yeast cell comprising:

31. The nucleic acid encoding the Mxr1 transcription activator sequence is a methanol-inducible promoter. The yeast cell of claim 30 operably linked to the element.

32. 31. The method of claim 30, wherein the member of the globin family is leghemoglobin. Law.

33. The nucleic acid encoding the member of the globin family is A yeast cell according to any one of claims 30 to 32, operably linked to a

34. The nucleic acid encoding the globin family member is operable with a constitutive promoter element.

33. A yeast cell according to any one of claims 30 to 32, which is dynamically linked.

35. The nucleic acid encoding at least one polypeptide involved in heme biosynthesis is 35. The method of claim 30, operably linked to a gene inducible promoter element. A yeast cell as described above.

36. The nucleic acid encoding at least one polypeptide involved in heme biosynthesis is constitutive 35. The yeast of any one of claims 30 to 34, which is operably linked to a promoter element. cell.

37. The methanol-inducible promoter element is an alpha promoter from P. pastoris.

33. The alcohol oxidase I (AOX1) promoter element of claim 30, 31, or 33.

36. A yeast cell according to any one of claims 34 to 35.

38. The constitutive promoter element is a transcription elongation factor (EFA) gene from P. pastoris. EF-1α gene (TEF1) promoter element according to claim 30, 34 or 36. A yeast cell according to any one of the preceding claims.

Images