Cells and method of cell culture

Abstract

To provide improved cell culture systems for optimum production of proteins.SOLUTION: Provided is a method of cell culture, comprising providing cells in a cell culture medium to start a cell culture process, the cells being modified to reduce the level of synthesis of growth and / or productivity inhibitors by the cell. Also provided is a method of producing cells with improved cell growth and / or productivity in cell culture, comprising the steps of: (i) identifying one or more cell metabolites which are cell growth and / or productivity inhibitors, (ii) identifying one or more cell metabolic pathways resulting in the synthesis of the cell growth and / or productivity inhibitors, and (iii) identifying genes in the cell metabolic pathways encoding an enzyme which catalyzes the synthesis of the cell growth and / or productivity inhibitors or metabolic intermediates thereof.SELECTED DRAWING: Figure 1

Description

[Technical field]

[0001] The present invention relates to methods of cell culture, in which the cells are modified to reduce the levels of synthesis of proliferation and / or productivity inhibitors by the cells. The present invention also relates to methods of cell culture, in particular for improving cell proliferation and productivity in fed-batch cultures of mammalian cells at high cell densities. The present invention further relates to a method for producing cells with improved cell proliferation and / or productivity in cell culture, as well as cells obtained or obtainable by such a method. [Background technology]

[0002] Proteins are becoming increasingly important as diagnostic and therapeutic agents. In most cases, proteins for commercial use are produced in cell culture from cells that have been engineered and / or selected to produce significantly higher levels of the particular protein of interest. Optimization of cell culture conditions is critical to the success of commercial production of proteins. Mammalian cell metabolism is inefficient, which causes the cells to consume large amounts of nutrients and convert a significant amount of the nutrients into by-products. The by-products are released into the culture medium and accumulate over the course of the culture. Lactate and ammonia, known to be traditional inhibitors of cells in culture, are two major by-products of cell metabolism that accumulate to high levels in the culture medium and above certain concentrations, which begin to inhibit the growth and productivity of cells in the culture medium. Cell culture methods aimed at reducing the amount of lactate and ammonia in the cell culture medium have been developed, which can increase the growth and productivity of mammalian cells. However, cell growth still slows down even when the concentrations of lactate and ammonia are kept low, thereby limiting the maximum cell density and productivity of the cells. Summary of the Invention [Problem to be solved by the invention]

[0003] Thus, there is a need for the development of improved cell culture systems for optimal production of proteins, in particular for cell culture methods for cells that have been modified to increase viable cell density and / or titer, in particular to reduce levels of proliferation and / or synthesis of productive inhibitors. [Means for solving the problem]

[0004] The present invention relates to a method of cell culture comprising the step of (i) initiating a cell culture process by providing cells in a cell culture medium, wherein the cells have been modified to reduce the level of proliferation and / or synthesis of a productive inhibitor by the cells.

[0005] The present invention also provides a method for producing cells with improved cell growth and / or productivity in cell culture, comprising the steps of: (i) identifying one or more cellular metabolic products that are cellular proliferation and / or productivity inhibitors; (ii) identifying one or more cellular metabolic pathways that lead to the synthesis of a cell proliferation and / or productive inhibitor; (iii) identifying one or more genes in one or more cellular metabolic pathways that encode enzymes that catalyze the synthesis of a cellular proliferation and / or productivity inhibitor, or a metabolic intermediate thereof, and / or one or more genes that encode enzymes in metabolic pathways that branch off or directly branch off therefrom; (iv) modifying the expression of one or more genes to reduce the level of cell proliferation and / or synthesis of a productive inhibitor; The present invention relates to a method comprising the steps of:

[0006] The present invention further relates to cells comprising one or more modified genes that reduce the level of proliferation and / or synthesis of a productive inhibitor by the cell, in particular the one or more modified genes are selected from Bcat1, Bcat2, Auh, Mccc1, Mccc2, Ivd, PCBD1, QDPR, Hpd, Hgd, and Pah, where the modification increases or decreases gene expression, as well as to the use of said cells for the expression of recombinant proteins or polypeptides. [Brief description of the drawings]

[0007] [Figure 1A] FIG. 1 shows the growth characteristics and metabolic profile of CHO cells in a conventional fed-batch process. Data reported include viable cell density (solid squares), culture lactate levels (solid triangles), and ammonia levels (solid diamonds). Harvest titers (protein concentration at day 12) are also reported. [Figure 1B] FIG. 1 shows the growth characteristics and metabolic profile of CHO cells in the HiPDOG process. Data reported include viable cell density (closed squares), culture lactate levels (closed triangles), and ammonia levels (closed diamonds). Harvest titers (protein concentration at day 12) are also reported. [Diagram 2] Graphs showing viable cell density of GS-CHO cells (hereafter GS-CHO, cell line A) on days 0, 3, and 6 exposed to increasing concentrations of 2-hydroxybutyrate (FIG. 2A), homocysteine ​​(FIG. 2B), or indole carboxylic acid (FIG. 2C). GS-CHO cells were seeded in medium A at low viable cell density and individually treated with inhibitors at the reported concentrations. The effect of inhibitors on cell proliferation was monitored for 6 days. [Diagram 3] Figure 3 shows the effect of increasing concentrations of two metabolites, 4-hydroxyphenylpyruvate (Figure 3A) and phenyllactate (Figure 3B), on the viable cell density of GS-CHO cells. GS-CHO cells were seeded in medium A at low viable cell density and treated individually with inhibitors at the reported concentrations. [Figure 4]Figure 4A shows the effect of increasing concentrations of four metabolites, indole lactate (Figure 4A), 3-(4-hydroxyphenyl) lactate (Figure 4B), sodium formate (Figure 5A), and isovalerate (Figure 5B), on the viable cell density of GS-CHO cells. GS-CHO cells were seeded in medium A at low viable cell density and treated individually with inhibitors at the reported concentrations. [Diagram 5] Figure 4A shows the effect of increasing concentrations of four metabolites, indole lactate (Figure 4A), 3-(4-hydroxyphenyl) lactate (Figure 4B), sodium formate (Figure 5A), and isovalerate (Figure 5B), on the viable cell density of GS-CHO cells. GS-CHO cells were seeded in medium A at low viable cell density and treated individually with inhibitors at the reported concentrations. [Figure 6] Figure 1 shows the effect of four metabolites (4-hydroxyphenylpyruvate, indole lactate, phenyl lactate, and 3-(4-hydroxyphenyl) lactate) on the viable cell density of GS-CHO cells compared to the control where cells were cultured in the absence of metabolites. GS-CHO cells were seeded in medium A at low viable cell density and treated with fresh medium alone or fresh medium containing the four metabolites mentioned above in combination at concentrations detected at day 7 of HiPDOG culture (see Table 4). The effect of inhibitors on cell proliferation was monitored for 6 days. [Figure 7A] FIG. 1 shows the viable cell density of GS-CHO cells during the "HiPDOG" (black squares) and "low AA+HiPDOG" (black diamonds) processes. [Figure 7B] FIG. 1 shows culture titers (IgG) on different days in the "HiPDOG" (closed squares) and "Low AA+HiPDOG" (closed diamonds) processes. [Figure 8]Figure 7 shows the amino acid concentrations of four amino acids in the "Amino Acid Limited HiPDOG Process "Low AA+HiPDOG" (black squares) and the "HiPDOG" process (black diamonds). The four amino acids include tyrosine (Figure 7A), tryptophan (Figure 8B), phenylalanine (Figure 9A), and methionine (Figure 9B). [Figure 9] Figure 7 shows the amino acid concentrations of four amino acids in the "Amino Acid Limited HiPDOG Process "Low AA+HiPDOG" (black squares) and the "HiPDOG" process (black diamonds). The four amino acids include tyrosine (Figure 7A), tryptophan (Figure 8B), phenylalanine (Figure 9A), and methionine (Figure 9B). [Figure 10A] FIG. 1 shows the viable cell density of GS-CHO cells during the cell culture process using different conditions disclosed in Example 5 (HiPDOG1 (filled squares), HiPDOG2 (filled circles), Low 4AA+HiPDOG (filled diamonds), Low 8AA+HiPDOG (filled triangles)). [Figure 10B] FIG. 1 shows culture titers (IgG) on different days in a cell culture process using GS-CHO cells and different cell culture conditions disclosed in Example 5 (HiPDOG1 (filled squares), HiPDOG2 (filled circles), Low 4AA+HipDOG (filled diamonds), Low 8AA+HipDOG (filled triangles)). [Figure 11] FIG. 11A shows the concentrations of tyrosine (FIG. 11A), methionine (FIG. 11B), phenylalanine (FIG. 12A), tryptophan (FIG. 12B), leucine (FIG. 13A), threonine (FIG. 13B), glycine (FIG. 14A), and serine (FIG. 14B) in cell cultures of GS-CHO cells using conditions disclosed in Example 5 (HiPDOG1 (filled squares), HiPDOG2 (filled circles), Low 4AA+HipDOG (filled diamonds), Low 8AA+HipDOG (filled triangles)). [Figure 12]FIG. 11A shows the concentrations of tyrosine (FIG. 11A), methionine (FIG. 11B), phenylalanine (FIG. 12A), tryptophan (FIG. 12B), leucine (FIG. 13A), threonine (FIG. 13B), glycine (FIG. 14A), and serine (FIG. 14B) in cell cultures of GS-CHO cells using conditions disclosed in Example 5 (HiPDOG1 (filled squares), HiPDOG2 (filled circles), Low 4AA+HipDOG (filled diamonds), Low 8AA+HipDOG (filled triangles)). [Figure 13] FIG. 11A shows the concentrations of tyrosine (FIG. 11A), methionine (FIG. 11B), phenylalanine (FIG. 12A), tryptophan (FIG. 12B), leucine (FIG. 13A), threonine (FIG. 13B), glycine (FIG. 14A), and serine (FIG. 14B) in cell cultures of GS-CHO cells using conditions disclosed in Example 5 (HiPDOG1 (filled squares), HiPDOG2 (filled circles), Low 4AA+HipDOG (filled diamonds), Low 8AA+HipDOG (filled triangles)). [Figure 14] FIG. 11A shows the concentrations of tyrosine (FIG. 11A), methionine (FIG. 11B), phenylalanine (FIG. 12A), tryptophan (FIG. 12B), leucine (FIG. 13A), threonine (FIG. 13B), glycine (FIG. 14A), and serine (FIG. 14B) in cell cultures of GS-CHO cells using conditions disclosed in Example 5 (HiPDOG1 (filled squares), HiPDOG2 (filled circles), Low 4AA+HipDOG (filled diamonds), Low 8AA+HipDOG (filled triangles)). [Figure 15] 15A-15B show concentrations of 3-(4-hydroxyphenyl)lactate (FIG. 15A), isovalerate (FIG. 15B), and indole-3-lactate (FIG. 16) on days 5, 7, and 9 of cell culture of GS-CHO cells using conditions disclosed in Example 5 (HiPDOG1 (filled squares), HiPDOG2 (filled circles), Low 4AA+HipDOG (filled diamonds), Low 8AA+HipDOG (filled triangles)). [Figure 16]15A-15B show concentrations of 3-(4-hydroxyphenyl)lactate (FIG. 15A), isovalerate (FIG. 15B), and indole-3-lactate (FIG. 16) on days 5, 7, and 9 of cell culture of GS-CHO cells using conditions disclosed in Example 5 (HiPDOG1 (filled squares), HiPDOG2 (filled circles), Low 4AA+HipDOG (filled diamonds), Low 8AA+HipDOG (filled triangles)). [Figure 17] FIG. 1 shows the viable cell density and culture titer (IgG) of GS-CHO cells during the cell culture process using the conditions disclosed in Example 5 (low 4AA+HiPDOG (black diamonds), low 8AA+HipDOG (black triangles)). [Figure 18] FIG. 1 shows the viable cell density and culture titer (IgG) of GS-CHO cells during the cell culture process using the conditions disclosed in Example 6 (HiPDOG (closed squares), low 8AA+HipDOG (closed triangles)). [Figure 19] 19A-B show concentrations of 3-(4-hydroxyphenyl)lactate (FIG. 19A), isovalerate (FIG. 19B), and indole-3-lactate (FIG. 20) on days 5, 7, and 10 of cell culture of GS-CHO cells using conditions disclosed in Example 6 (HiPDOG (filled squares), low 8AA+HipDOG (filled triangles)). [Figure 20] 19A-B show concentrations of 3-(4-hydroxyphenyl)lactate (FIG. 19A), isovalerate (FIG. 19B), and indole-3-lactate (FIG. 20) on days 5, 7, and 10 of cell culture of GS-CHO cells using conditions disclosed in Example 6 (HiPDOG (filled squares), low 8AA+HipDOG (filled triangles)). [Figure 21] FIG. 1 shows the viable cell density and culture titer (IgG) of GS-CHO cells during the cell culture process using different conditions as disclosed in Example 6 (HiPDOG (black squares), low 4AA+HipDOG (black diamonds)). [Figure 22]22A-22B show concentrations of 3-(4-hydroxyphenyl)lactate (FIG. 22A), isovalerate (FIG. 22B), and indole-3-lactate (FIG. 23) on days 5 and 7 of cell culture of GS-CHO cells using conditions disclosed in Example 6 (HipDOG (black squares), low 4AA+HipDOG (black diamonds)). [Diagram 23] 22A-22B show concentrations of 3-(4-hydroxyphenyl)lactate (FIG. 22A), isovalerate (FIG. 22B), and indole-3-lactate (FIG. 23) on days 5 and 7 of cell culture of GS-CHO cells using conditions disclosed in Example 6 (HipDOG (black squares), low 4AA+HipDOG (black diamonds)). [Figure 24] Diagram showing the phenylalanine / tyrosine and leucine pathways with metabolic enzymes involved in the pathways and their branches, respectively. RT qPCR measures of transcript abundance shown for genes of the pathway as cycle number or CT (threshold cycle) are also tabulated. CT values ​​of metabolism-related genes are tabulated and compared to the CT value of a well-characterized housekeeping gene, beta-actin. The difference between the CT of the target gene and the CT of beta-actin is tabulated as ΔCT. High ΔCT values ​​indicate low gene expression levels. [Diagram 25] Diagram showing the phenylalanine / tyrosine and leucine pathways with metabolic enzymes involved in the pathways and their branches, respectively. RT qPCR measures of transcript abundance shown for genes of the pathway as cycle number or CT (threshold cycle) are also tabulated. CT values ​​of metabolism-related genes are tabulated and compared to the CT value of a well-characterized housekeeping gene, beta-actin. The difference between the CT of the target gene and the CT of beta-actin is tabulated as ΔCT. High ΔCT values ​​indicate low gene expression levels. [Figure 26]Gene expression analysis of phenylalanine / tyrosine pathway genes using RT-qPCR assay. (A) Expression levels of phenylalanine / tyrosine pathway genes in CHO cell line A and CHO parental cell line. Data are plotted as the logarithm of the ratio of gene of interest transcript amount to B-actin transcript amount. Higher values ​​indicate higher expression of the gene. (B) Schematic of the phenylalanine / tyrosine catabolic pathway. Phenylpyruvate, phenyllactate, 4-hydroxyphenylpyruvate, and 3-(4-hydroxyphenyl)lactate of the pathway are inhibitory intermediates and by-products of the pathway. Enzymes in light grey shades are those expressed at very low levels. [Figure 27] Gene expression analysis of tetrahydrobiopterin (BH4) biosynthesis and regeneration pathway genes using RT-qPCR assay. (A) Schematic of the tetrahydrobiopterin (BH4) biosynthesis and regeneration pathway. GTP is the carbon source for the biosynthesis of BH4, which is catalyzed by three enzymes, GCH1, PTS, and SPR. The BH4 regeneration pathway consists of two enzymes, PCBD1 and QDPR, which regenerate BH4 from BH4-4a-carbinolamine, which is the product of the reaction catalyzed by PAH. (B) Expression levels of tetrahydrobiopterin (BH4) biosynthesis and regeneration pathway genes in cell pools of CHO cell line A, CHO cell line B, or CHO parental cell line overexpressing mouse PAH. Data are plotted as the logarithm of the ratio of the gene of interest transcript amount to B-actin transcript amount. Higher values ​​indicate higher expression of the gene. [Figure 28] FIG. 1 shows plasmids used to generate transgenic CHO cell lines expressing mouse PAH, HPD, HGD, and PCBD1. (A) Plasmid map of the expression vector for mouse PAH. (B) Plasmid map of the expression vector for mouse HPD. (C) Plasmid map of the expression vector for mouse HGD. (D) Plasmid map of the expression vector for mouse PCBD1. [Figure 29]Figure 2 shows the growth kinetics of 4x transfected (4x-tfxn) or negative 4x transfected control (4x-control-tfxn) cell pools in two subsequent tyrosine-free cell culture passages. The length of the first passage was 3 days, the length of the second passage was 5 days. (A) Cell pool derived from CHO cell line B. (B) Cell pool derived from CHO parental cell line. Closed triangles: 4x-tfxn, closed squares: 4x-control-tfxn. [Diagram 30] Figure 1 shows a comparison of the performance of a 4x-transfected (4x-tfxn) cell pool from cell line B in a HiPDOG fed-batch process compared to a negative 4x-transfected control (4x-control-tfxn) cell pool in the original HiPDOG fed-batch process (supplemented with tyrosine). (A) Viable cell density, (B) viability, (C) titer, (D) levels of 3-(4-hydroxyphenyl)lactate. Closed triangles: 4x-tfxn, closed squares: 4x-control-tfxn. [Diagram 31] FIG. 1 shows the effect of different concentrations of 2-methylbutyrate (A) or isobutyrate (B) on the growth of CHO cell line A. [Diagram 32] Figure 1 shows the suppression of 2-methylbutyrate (B) and isobutyrate (D) accumulation by controlling the concentrations of isoleucine (A) and valine (C) at low levels in fed-batch cultures of CHO cell line C. Black triangles: low AA, black diamonds: low AA, black squares: control [Diagram 33]Gene expression analysis of leucine pathway genes using RT-qPCR assay. (A) Expression levels of leucine pathway genes in CHO cell line A and CHO parent cell line. Data are plotted as the ratio of the transcript amount of the gene of interest to the transcript amount of B-actin. Higher values ​​indicate higher expression of the gene. (B) Schematic of leucine, isoleucine, and valine catabolic pathways. Isovalerate, 2-methylbutyrate, and isobutyrate are growth inhibitory by-products of the leucine, isoleucine, and valine catabolic pathways, respectively. BCAT1 (BCAT2) and BCKHDA / BCKHDB are shared by all three catabolic pathways. Knocking down or knocking out or inhibiting the enzymatic activity of BCAT1 (and / or BCAT2) or BCKDHA / BCKDHB, for example, with a small molecule inhibitor molecule, will simultaneously reduce the biosynthesis of the three inhibitory metabolites (isovalerate, 2-methylbutyrate, and isobutyrate). [Diagram 34]Western blot to probe the levels of BCAT1 and B-actin in CHO cells independently transiently transfected with 5 miRNAs against BCAT1. (A) B-actin protein levels in non-transfected or transfected CHO parental cell line, (B) BCAT1 protein levels in non-transfected or transfected CHO parental cell line, (C) B-actin protein levels in non-transfected or transfected CHO cell line B, (D) BCAT1 protein levels in non-transfected or transfected CHO cell B. Gel loading details for all gels are as follows: Lane 1: protein ladder, lane 2: non-transfected cells, lane 3: cells transfected with BCAT1 miRNA seq1.1a, lane 4: cells transfected with BCAT1 miRNA seq2.1a, lane 5: cells transfected with BCAT1 miRNA seq3.1a, lane 6: cells transfected with miRNA BCAT1 seq4.1a, lane 7: cells transfected with BCAT1 miRNA seq5.1a, lane 8: cells transfected with negative control miRNA. Protein sizes: 42 kD for B-actin and 43 kD for BCAT1. [Diagram 35]Western blots to probe BCAT1 and B-actin in stable CHO cell pools generated from independent transfections with 5 miRNAs against BCAT1. (A) B-actin protein levels in stable pools generated from transfection into CHO parental cell line, (B) BCAT1 protein levels in stable pools generated from transfection into CHO parental cell line. Gel loading details for all gels are as follows: Lane 1: protein ladder, Lane 2: cells transfected with BCAT1 miRNA seq1.1a, Lane 3: cells transfected with BCAT1 miRNA seq2.1a, Lane 4: cells transfected with BCAT1 miRNA seq3.1a, Lane 5: cells transfected with miRNA BCAT1 seq4.1a, Lane 6: cells transfected with BCAT1 miRNA seq5.1a, Lane 7: cells transfected with negative control miRNA. Protein sizes: 42 kD for B-actin and 43 kD for BCAT1. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0008] The present invention provides a method and a medium for cell culture.The present invention provides a cell culture method in which the concentration of at least one metabolite selected from 3-(4-hydroxyphenyl)lactate, 4-hydroxyphenylpyruvate, phenyllactate, phenylpyruvate, indole lactate (indole-3-lactate), indole carboxylic acid (indole-3-carboxylate), homocysteine, 2-hydroxybutyric acid, isovalerate, 2-methylbutyrate, isobutyrate, and formate, and / or at least one amino acid selected from phenylalanine, tyrosine, tryptophan, methionine, leucine, serine, threonine, and glycine is maintained at a low level in the cell culture medium.

[0009] The present inventors have unexpectedly discovered that in cell cultures, particularly high density cell cultures, such as fed-batch cell cultures for the purpose of producing high amounts of recombinant proteins, cell growth is inhibited by the accumulation of metabolic products, such as 3-(4-hydroxyphenyl)lactate, 4-hydroxyphenylpyruvate, phenyllactate, phenylpyruvate, indole lactate, indole carboxylic acid, homocysteine, 2-hydroxybutyric acid, isovalerate, 2-methylbutyrate, isobutyrate, and formate, in the cell culture medium. The inhibitory effect of these metabolic products can be limited by maintaining their concentrations in the cell culture medium below levels at which they inhibit cell growth. The inhibitory effects of these metabolites can also be limited by modifying one or more genes in the cell such that the levels of proliferation and / or synthesis of productive inhibitors by the cell are reduced, particularly when the one or more modified genes are selected from Bcat1, Bcat2, Auh, Mccc1, Mccc2, Ivd, Hpd, Hgd, Pah, PCBD1, and QDPR.

[0010] Methods comprising the step of controlling metabolite concentrations in cell culture media at low levels In a first aspect, the present invention provides a method of cell culture comprising the steps of (i) initiating a cell culture process by providing cells in a cell culture medium, wherein the cells are modified to reduce levels of proliferation and / or synthesis of a productive inhibitor by the cells.

[0011] In some embodiments, the cells are modified to alter expression of one or more genes, and in one embodiment, the genes are in one or more cellular metabolic pathways that synthesize a growth inhibitor or a metabolic intermediate thereof, or a metabolite of the growth inhibitor or a metabolic intermediate thereof, or a metabolite of the metabolic intermediate.

[0012] A "metabolic intermediate" is understood to be a precursor or metabolic product required for the synthesis of a cell proliferation and / or productive inhibitor, including reactants, products, and cofactor molecules of enzymes of one or more cellular metabolic pathways. Relevant cofactors include, for example, BH4 (tetrahydrobiopterin), or BH4-4a (carbinolamine), or q-BH2. A metabolic intermediate can be synthesized in the same pathway as one or more cellular metabolic pathways that code for an enzyme that catalyzes the synthesis of a cell proliferation and / or productive inhibitor, or can be synthesized in a branched pathway. A "metabolite" is understood to include the product of a metabolic reaction catalyzed by an enzyme of one or more cellular metabolic pathways, including reactants, products, and cofactor molecules of said enzymes, including, for example, BH4 (tetrahydrobiopterin), or BH4-4a (carbinolamine), or q-BH2. The metabolites may occur within the same pathway as one or more cellular metabolic pathways that encode enzymes that catalyze the synthesis of the cell proliferation and / or productivity inhibitors, or intermediates thereof, or may be synthesized within a branched pathway, which may occur at a node located above or below one or more genes within one or more cellular metabolic pathways that encode enzymes that catalyze the synthesis of the cell proliferation and / or productivity inhibitors, or intermediates thereof.

[0013] In some embodiments, the modified gene or genes encode an enzyme that catalyzes the synthesis of 3-(4-hydroxyphenyl)lactate (HPLA), 4-hydroxyphenylpyruvate, phenyllactate (PLA), phenylpyruvate, indole-3-carboxylate (indole carboxylic acid), indole-3-lactate (indole lactate), 2-hydroxybutyrate, homocysteine, isovalerate, 2-methylbutyrate, isobutyrate, butyrate, formate, or a metabolic intermediate thereof, or a metabolite of said molecule or a metabolic intermediate thereof, or a metabolite of a metabolic intermediate.

[0014] In some embodiments, the modified gene or genes encode an enzyme that catalyzes the synthesis of 4-hydroxyphenylpyruvate or phenyllactate (PLA), a metabolite thereof, or a metabolic intermediate thereof, or a metabolite of the metabolic intermediate.

[0015] In some embodiments, the modified gene or genes encode an enzyme that catalyzes the synthesis of isovalerate, 2-methylbutyrate, isobutyrate, or butyrate, a metabolite thereof, or a metabolic intermediate thereof, or a metabolite of a metabolic intermediate.

[0016] In some embodiments, the modified gene or genes are selected from PCBD1, QDPR, Pah, Mif, Got1, Got2, Nup62-il4i1, Hpd, Hgd, Gstz1, Fah.

[0017] In some embodiments, the modified gene or genes are selected from PCBD1, QDPR, Hpd, Hgd, and Pah; in one embodiment, the modified gene or genes are selected from (i) PCBD1, (ii) Pah, (iii) QDPR, (iv) PCBD1 and QDPR, (v) PCBD1 and Pah, (vi) Pah and QDPR, (vii) PCBD1 and Pah, and QDPR, (viii) any of (i)-(vii) and Hpd and / or Hgd.

[0018] In some embodiments, the modified gene or genes are selected from Bcat1, Bcat2, Bckdha / b, Dbt / Dld, Ivd, Acadm, Mccc1, Mccc2, Auh, Hmgcl, Fasn.

[0019] In some embodiments, the modified gene or genes are selected from Bcat1, Bcat2, Auh, Mccc1, Mccc2, Ivd.

[0020] In some embodiments, the modified gene or genes include: (i) Auh, (ii) Bcat1, (iii) Bcat2 (iv) one or more of Mccc1, Mccc2, and Ivd; (v) Bcat1 and / or Bcat2 and / or Auh, and one or more of Mccc1, Mccc2, and Ivd; (vi) Pah, (vii) PCBD1, (viii) PCBD1 and / or QDPR (ix) one or more of Hpd and Hgd; (x) Pah and / or PCBD1, and one or more of Hpd and Hgd (xi) Pah and PCBD1, and optionally QDPR (xii) Pah, PCBD1, Hpd, and Hgd, and optionally QDPR (xiii) Bcat1 and / or Bcat2, Auh, Mccc1, Mccc2, and Ivd, or (ix) Bcat1 and / or Bcat2, Auh, Mccc1, Mccc2, Ivd, Pah, PCBD1, Hpd, Hgd, and optionally QDPR.

[0021] In some embodiments, one or more genes are modified to increase or decrease gene expression.

[0022] In some embodiments, one or more genes are modified to increase gene expression, and in one embodiment, the one or more genes are Pah and / or PCBD1 and / or QDPR and / or Hpd and / or Hgd.

[0023] In some embodiments, the one or more genes are modified to reduce gene expression, and in one embodiment, the one or more genes are Bcat1 and / or Bcat2.

[0024] In some embodiments, the modified gene or genes are selected from: (i) PCBD1, (ii) Pah, (iii) QDPR, (iv) PCBD1 and QDPR, (v) PCBD1 and Pah, (vi) Pah and QDPR, (vii) PCBD1 and Pah, and QDPR, (viii) any of (i)-(vii), and Hpd and / or Hgd.

[0025] In some embodiments, the cells include (i) an expressible nucleic acid or vector construct comprising the PCBD1 gene; (ii) an expressible nucleic acid or vector construct comprising a Pah gene; (iii) an expressible nucleic acid or vector construct comprising the Pah gene and the PCBD1 gene; (iv) an expressible nucleic acid or vector construct comprising the PCBD1 gene or the Pah gene or the Pah gene and the PCBD1 gene, and further comprising a QDPR gene; (v) An expressible nucleic acid or vector construct of (i) to (iv) further comprising an Hpd gene and / or an Hgd gene. Includes.

[0026] In some embodiments, the method further comprises: (ii) maintaining in the cell culture medium at least one metabolite selected from 3-(4-hydroxyphenyl)lactate, 4-hydroxyphenylpyruvate, phenyllactate, indole lactate (indole-3-lactate), indole carboxylic acid (indole-3-carboxylate), homocysteine, 2-hydroxybutyrate, isovalerate, 2-methylbutyrate, isobutyrate, and formate at a concentration C1 less than 3 mM, wherein C1 is 3 mM. Further includes:

[0027] In some embodiments, C1 is 2.5 mM, 2 mM, 1.5 mM, 1 mM, 0.9 mM, 0.8 mM, 0.7 mM, 0.6 mM, 0.5 mM, 0.4 mM, 0.3 mM, 0.2 mM, or 0.1 mM. In some embodiments, C1 is 1 mM. In some embodiments, C1 is 0.5 mM.

[0028] In some embodiments, step (ii) comprises measuring the concentration of said at least one metabolite.

[0029] In some embodiments, when the measured concentration is above a preset value, the concentration of the precursor of the at least one metabolite in the cell culture medium is decreased by reducing the amount of precursor provided to the cell. The preset value is selected to prevent the concentration of the precursor from increasing above C1 due to the decrease in the concentration of the metabolite. The preset value can be equal to C1 or can be a percentage of C1. In some embodiments, the percentage is 50, 55, 60, 65, 70, 75, 80, 85, 90, or 95% of C1. In some embodiments, the percentage is 80% of C1.

[0030] In some embodiments, when the measured concentrations of 3-(4-hydroxyphenyl)lactate, 4-hydroxyphenylpyruvate, and / or phenyllactate are above the predetermined value, the concentration of phenylalanine is decreased in the cell culture medium.

[0031] In some embodiments, when the measured concentration of 3-(4-hydroxyphenyl)lactate and / or 4-hydroxyphenylpyruvate is above the predetermined value, the concentration of tyrosine is decreased in the cell culture medium.

[0032] In some embodiments, when the measured concentrations of 3-(4-hydroxyphenyl)lactate, 4-hydroxyphenylpyruvate, and / or phenyllactate are above the predetermined value, the concentrations of tyrosine and phenylalanine are decreased in the cell culture medium.

[0033] In some embodiments, when the measured concentration of indole lactate and / or indole carboxylic acid is above the predetermined value, the concentration of tryptophan is decreased in the cell culture medium.

[0034] In some embodiments, when the measured concentrations of homocysteine ​​and / or 2-hydroxybutyrate are above the predetermined values, the concentration of methionine is decreased in the cell culture medium.

[0035] In some embodiments, when the measured concentration of isovalerate is above said predetermined value, the concentration of leucine is decreased in the cell culture medium.

[0036] In some embodiments, when the measured concentration of 2-methylbutyrate is above said predetermined value, the concentration of isoleucine is decreased in the cell culture medium.

[0037] In some embodiments, when the measured concentration of isobutyrate is above said predetermined value, the concentration of valine is decreased in the cell culture medium.

[0038] In some embodiments, when the measured concentration of formate is above said predetermined value, the concentration of serine, threonine, and / or glycine is decreased in the cell culture medium.

[0039] In some embodiments, when the measured concentration of formate is above said predetermined value, the concentration of serine is decreased in the cell culture medium.

[0040] In some embodiments, when the measured concentration of formate is above said predetermined value, the concentration of threonine is decreased in the cell culture medium.

[0041] In some embodiments, when the measured concentration of formate is above said predetermined value, the concentration of glycine is decreased in the cell culture medium.

[0042] The concentration of a precursor in a cell culture medium can be reduced by reducing the amount of precursor provided to the cells, for example by reducing the concentration of said precursor in the feed medium, reducing the supply rate of the feed, or reducing the number or volume of the feeds. For example, the feed medium can be replaced with a feed medium containing a lower concentration of the precursor.

[0043] In some embodiments of the above-described method, step (ii) comprises maintaining one, two, three, four, five, six, seven, eight, nine, ten, or eleven of 3-(4-hydroxyphenyl)lactate, 4-hydroxyphenylpyruvate, phenyllactate, indole lactate (indole-3-lactate), indole carboxylic acid (indole-3-carboxylate), homocysteine, 2-hydroxybutyrate, isovalerate, 2-methylbutyrate, isobutyrate, and formate at less than C1 in the cell culture medium.

[0044] In some embodiments of the above-described methods, step (ii) comprises maintaining one, two, three, four, five, six, or seven of 3-(4-hydroxyphenyl)lactate, 4-hydroxyphenylpyruvate, phenyllactate, indole lactate, indole carboxylic acid, homocysteine, and 2-hydroxybutyrate below C1 in the cell culture medium.

[0045] In some embodiments of the above-described methods, step (ii) comprises maintaining 3-(4-hydroxyphenyl)lactate, 4-hydroxyphenylpyruvate, and phenyllactate below C1 in the cell culture medium.

[0046] In some embodiments of the above-described method, step (ii) comprises maintaining indole lactate (indole-3-lactate) and indole carboxylic acid (indole-3-carboxylate) below C1 in the cell culture medium.

[0047] In some embodiments of the above-described methods, step (ii) comprises maintaining homocysteine ​​and 2-hydroxybutyrate below C1 in the cell culture medium.

[0048] In some embodiments of the above-described method, step (ii) comprises maintaining isovalerate, 2-methylbutyrate, and isobutyrate below C1 in the cell culture medium.

[0049] In some embodiments of the above-described methods, step (ii) comprises maintaining isobutyrate below C1 in the cell culture medium.

[0050] In some embodiments of the above-described methods, step (ii) comprises maintaining 2-methylbutyrate below C1 in the cell culture medium.

[0051] In some embodiments of the above-described methods, step (ii) comprises maintaining isovalerate below C1 in the cell culture medium.

[0052] In some embodiments of the above-described methods, step (ii) comprises maintaining formate below C1 in the cell culture medium.

[0053] In some embodiments of the above-described methods, step (ii) comprises maintaining isovalerate and 4-hydroxyphenylpyruvate below C1 in the cell culture medium.

[0054] In some embodiments of the above-described method, step (ii) comprises maintaining 3-(4-hydroxyphenyl)lactate, 4-hydroxyphenylpyruvate, phenyllactate, indole lactate (indole-3-lactate), indole carboxylic acid (indole-3-carboxylate), homocysteine, 2-hydroxybutyrate, isovalerate, 2-methylbutyrate, isobutyrate, and formate at less than C1 in the cell culture medium.

[0055] In some embodiments of the above-described method, in step (ii), the concentration of 3-(4-hydroxyphenyl)lactate is maintained at less than 0.5 mM, 0.4 mM, 0.3 mM, 0.2 mM, or 0.1 mM.

[0056] In some embodiments of the above-described method, in step (ii), the concentration of 3-(4-hydroxyphenyl)lactate is maintained below 0.3 mM.

[0057] In some embodiments of the above-described method, in step (ii), the concentration of 3-(4-hydroxyphenyl)lactate is maintained at less than 0.1 mM.

[0058] In some embodiments of the above-described method, in step (ii), the concentration of 4-hydroxyphenylpyruvate is maintained at less than 0.1 mM, 0.08 mM, 0.06 mM, 0.05 mM, 0.04 mM, 0.03 mM, or 0.02 mM.

[0059] In some embodiments of the above-described methods, in step (ii), the concentration of 4-hydroxyphenylpyruvate is maintained below 0.05 mM.

[0060] In some embodiments of the above-described methods, in step (ii), the concentration of 4-hydroxyphenylpyruvate is maintained below 0.02 mM.

[0061] In some embodiments of the above-described method, in step (ii), the concentration of phenyllactate is maintained at less than 0.5 mM, 0.4 mM, 0.3 mM, 0.2 mM, or 0.1 mM.

[0062] In some embodiments of the above-described method, in step (ii), the concentration of phenyllactate is maintained below 0.2 mM.

[0063] In some embodiments of the above-described methods, in step (ii), the concentration of phenyllactate is maintained below 0.1 mM.

[0064] In some embodiments of the above-described method, in step (ii), the concentration of indole lactate (indole-3-lactate) is maintained at less than 3 mM, 2 mM, 1 mM, 0.5 mM, 0.3 mM, or 0.1 mM.

[0065] In some embodiments of the above-described methods, in step (ii), the concentration of indole lactate is maintained at less than 1 mM.

[0066] In some embodiments of the above-described method, in step (ii), the concentration of indole lactate is maintained below 0.3 mM.

[0067] In some embodiments of the above-described method, in step (ii), the concentration of indole lactate is maintained below 0.1 mM.

[0068] In some embodiments of the above-described method, in step (ii), the concentration of indole carboxylic acid (indole-3-carboxylate) is maintained at less than 1 mM, 0.8 mM, 0.6 mM, 0.4 mM, or 0.2 mM.

[0069] In some embodiments of the above-described methods, in step (ii), the concentration of the indole carboxylic acid is maintained below 0.5 mM.

[0070] In some embodiments of the above-described method, in step (ii), the concentration of the indole carboxylic acid is maintained below 0.2 mM.

[0071] In some embodiments of the above-described methods, in step (ii), the concentration of homocysteine ​​is maintained at less than 0.5 mM, 0.4 mM, 0.3 mM, 0.2 mM, or 0.1 mM.

[0072] In some embodiments of the above-described methods, in step (ii), the concentration of homocysteine ​​is maintained below 0.3 mM.

[0073] In some embodiments of the above-described methods, in step (ii), the concentration of homocysteine ​​is maintained below 0.1 mM.

[0074] In some embodiments of the above-described method, in step (ii), the concentration of 2-hydroxybutyrate is maintained at less than 1 mM, 0.8 mM, 0.6 mM, 0.4 mM, or 0.2 mM.

[0075] In some embodiments of the above-described methods, in step (ii), the concentration of 2-hydroxybutyrate is maintained below 0.5 mM.

[0076] In some embodiments of the above-described method, in step (ii), the concentration of 2-hydroxybutyrate is maintained below 0.2 mM.

[0077] In some embodiments of the above-described method, in step (ii), the concentration of isovalerate and / or 2-methylbutyrate and / or isobutyrate is maintained below 2 mM, 1 mM, 0.8 mM, 0.6 mM, 0.4 mM, or 0.2 mM.

[0078] In some embodiments of the above-described methods, in step (ii), the concentration of isovalerate and / or 2-methylbutyrate and / or isobutyrate is maintained below 1 mM.

[0079] In some embodiments of the above-described method, in step (ii), the concentration of isovalerate, and / or 2-methylbutyrate, and / or isobutyrate is maintained below 0.5 mM.

[0080] In some embodiments of the above-described method, in step (ii), the concentration of formate is maintained at less than 4 mM, 3 mM, 2 mM, 1 mM, 0.5 mM, or 0.2 mM.

[0081] In some embodiments of v, in step (ii), the concentration of formate is maintained below 3 mM.

[0082] In some embodiments of the above-described methods, in step (ii), the concentration of formate is maintained at less than 1 mM.

[0083] A method comprising the step of controlling the amino acid concentration in a cell culture medium at a low level. In some embodiments, the method of cell culture comprises: (iii) maintaining at least one amino acid selected from phenylalanine, tyrosine, tryptophan, methionine, leucine, isoleucine, valine, serine, threonine, and glycine in the cell culture medium at a concentration below C2, where C2 is 2 mM. Further includes:

[0084] In some embodiments, the concentration is maintained between 0.1 mM and C2, 0.2 mM and C2, 0.3 mM and C2, 0.4 mM and C2, or 0.5 mM and C2. In some embodiments, the concentration is maintained between 0.5 mM and C2.

[0085] In some embodiments, C2 is 2 mM, 1.5 mM, 1 mM, 0.9 mM, 0.8 mM, 0.7 mM, 0.6 mM, 0.5 mM, 0.4 mM, 0.3 mM, 0.2 mM, 0.1 mM, 0.05 mM. In some embodiments, C2 is 1 mM.

[0086] Method comprising the step of measuring the concentration of an amino acid in a cell culture medium In some embodiments, step (iii) comprises measuring the concentration of said at least one amino acid. The concentration of an amino acid can be measured by any method known to those of skill in the art, including offline and online measurement methods.

[0087] The concentration of amino acid can be measured once or several times during cell culture.In some embodiments, the concentration of amino acid is measured continuously, intermittently, every 30 minutes, every hour, every 2 hours, twice a day, every day, or every 2 days.In a preferred embodiment, the concentration of amino acid is measured every day.

[0088] The concentration of the amino acid can be measured by any method known to those skilled in the art. Suitable methods for measuring the concentration of the amino acid in an online or offline method include, for example, liquid chromatography, such as HPLC, UPLC, or LCMS, NMR, or GCMS.

[0089] In some embodiments, the concentration of amino acids is measured offline by measuring the concentration of said at least one amino acid in said sample. In some embodiments, the concentration of amino acids is measured as disclosed in Example 4. A suitable method for measuring the concentration of amino acids offline is UPLC.

[0090] In some embodiments, the concentration of amino acid is measured online. In some embodiments, the concentration of amino acid is measured online using Raman spectroscopy. In some embodiments, the concentration of amino acid is measured online using Raman spectroscopy as disclosed in Example 7. In some embodiments, the concentration of amino acid is measured online using HPLC or UPLC technology with an autosampler that draws sample from reactor and transfers it to the device in a programmed manner.

[0091] In some embodiments, when the measured concentration is above a predetermined value, the concentration of the at least one amino acid in the cell culture medium is decreased. The predetermined value can be equal to C2 or can be a percentage of C2. In some embodiments, the percentage is 50, 55, 60, 65, 70, 75, 80, 85, 90, or 95% of C2. In some embodiments, the percentage is 80% of C2.

[0092] The concentration of an amino acid in a cell culture medium can be reduced by reducing the amount of the amino acid provided to the cells, for example by reducing the concentration of said amino acid in the feed medium, reducing the feeding rate of the feed, or reducing the number or volume of the feeds. For example, the feed medium can be replaced by a feed medium containing a lower concentration of the amino acid.

[0093] Concentrations of phenylalanine, tyrosine, tryptophan, methionine, leucine, isoleucine, valine, serine, threonine, and glycine in cell culture media In some embodiments, in step (iii), the concentration of phenylalanine is maintained below 2 mM in the cell culture medium. In a preferred embodiment, the concentration of phenylalanine is maintained between 0.1 and 2 mM in the cell culture medium. In a preferred embodiment, the concentration of phenylalanine is maintained between 0.1 and 1 mM in the cell culture medium. In a preferred embodiment, the concentration of phenylalanine is maintained between 0.2 and 1 mM in the cell culture medium. In a preferred embodiment, the concentration of phenylalanine is maintained between 0.5 and 1 mM in the cell culture medium.

[0094] In some embodiments, in step (iii), the concentration of tyrosine is maintained below 2 mM in the cell culture medium. In preferred embodiments, the concentration of tyrosine is maintained between 0.1 and 2 mM in the cell culture medium. In preferred embodiments, the concentration of tyrosine is maintained between 0.1 and 1 mM in the cell culture medium. In preferred embodiments, the concentration of tyrosine is maintained between 0.2 and 1 mM in the cell culture medium. In preferred embodiments, the concentration of tyrosine is maintained between 0.5 and 1 mM in the cell culture medium.

[0095] In some embodiments, in step (iii), the concentration of tryptophan is maintained below 2 mM in the cell culture medium. In a preferred embodiment, the concentration of tryptophan is maintained between 0.1 and 2 mM in the cell culture medium. In a preferred embodiment, the concentration of tryptophan is maintained between 0.1 and 1 mM in the cell culture medium. In a preferred embodiment, the concentration of tryptophan is maintained between 0.2 and 1 mM in the cell culture medium. In a preferred embodiment, the concentration of tryptophan is maintained between 0.5 and 1 mM in the cell culture medium.

[0096] In some embodiments, in step (iii), the concentration of methionine is maintained below 2 mM in the cell culture medium. In preferred embodiments, the concentration of methionine is maintained between 0.1 and 2 mM in the cell culture medium. In preferred embodiments, the concentration of methionine is maintained between 0.1 and 1 mM in the cell culture medium. In preferred embodiments, the concentration of methionine is maintained between 0.2 and 1 mM in the cell culture medium. In preferred embodiments, the concentration of methionine is maintained between 0.5 and 1 mM in the cell culture medium.

[0097] In some embodiments, in step (iii), the concentration of leucine is maintained below 2 mM in the cell culture medium. In preferred embodiments, the concentration of leucine is maintained between 0.1 and 2 mM in the cell culture medium. In preferred embodiments, the concentration of leucine is maintained between 0.1 and 1 mM in the cell culture medium. In preferred embodiments, the concentration of leucine is maintained between 0.2 and 1 mM in the cell culture medium. In preferred embodiments, the concentration of leucine is maintained between 0.5 and 1 mM in the cell culture medium.

[0098] In some embodiments, in step (iii), the concentration of isoleucine is maintained below 2 mM in the cell culture medium. In a preferred embodiment, the concentration of isoleucine is maintained between 0.1 and 2 mM in the cell culture medium. In a preferred embodiment, the concentration of isoleucine is maintained between 0.1 and 1 mM in the cell culture medium. In a preferred embodiment, the concentration of isoleucine is maintained between 0.2 and 1 mM in the cell culture medium. In a preferred embodiment, the concentration of isoleucine is maintained between 0.5 and 1 mM in the cell culture medium.

[0099] In some embodiments, in step (iii), the concentration of valine is maintained below 2 mM in the cell culture medium. In preferred embodiments, the concentration of valine is maintained between 0.1 and 2 mM in the cell culture medium. In preferred embodiments, the concentration of valine is maintained between 0.1 and 1 mM in the cell culture medium. In preferred embodiments, the concentration of valine is maintained between 0.2 and 1 mM in the cell culture medium. In preferred embodiments, the concentration of valine is maintained between 0.5 and 1 mM in the cell culture medium.

[0100] In some embodiments, in step (iii), the concentration of serine is maintained below 2 mM in the cell culture medium. In preferred embodiments, the concentration of serine is maintained between 0.1 and 2 mM in the cell culture medium. In preferred embodiments, the concentration of serine is maintained between 0.1 and 1 mM in the cell culture medium. In preferred embodiments, the concentration of serine is maintained between 0.2 and 1 mM in the cell culture medium. In preferred embodiments, the concentration of serine is maintained between 0.5 and 1 mM in the cell culture medium.

[0101] In some embodiments, in step (iii), the concentration of threonine is maintained in the cell culture medium at less than 2 mM. In a preferred embodiment, the concentration of threonine is maintained in the cell culture medium at between 0.1 and 2 mM. In a preferred embodiment, the concentration of threonine is maintained in the cell culture medium at between 0.1 and 1 mM. In a preferred embodiment, the concentration of threonine is maintained in the cell culture medium at between 0.2 and 1 mM. In a preferred embodiment, the concentration of threonine is maintained in the cell culture medium at between 0.5 and 1 mM.

[0102] In some embodiments, in step (iii), the concentration of glycine is maintained below 2 mM in the cell culture medium. In preferred embodiments, the concentration of glycine is maintained between 0.1 and 2 mM in the cell culture medium. In preferred embodiments, the concentration of glycine is maintained between 0.1 and 1 mM in the cell culture medium. In preferred embodiments, the concentration of glycine is maintained between 0.2 and 1 mM in the cell culture medium. In preferred embodiments, the concentration of glycine is maintained between 0.5 and 1 mM in the cell culture medium.

[0103] In some embodiments, in step (iii), the concentrations of tyrosine, phenylalanine, and leucine are maintained in the cell culture medium below 2 mM, preferably between 0.1 and 2 mM, between 0.1 and 1 mM, between 0.2 and 1 mM, or between 0.5 and 1 mM.

[0104] In some embodiments, the cell culture medium comprises one, two, three, four, five, six, seven, eight, nine, or ten of glycine, proline, serine, threonine, lysine, arginine, histidine, aspartic acid, glutamic acid, and asparagine at a concentration of greater than 1 mM, 1.5 mM, 2 mM, 3 mM, or 5 mM.

[0105] In some embodiments, the cell culture medium comprises one of glycine, proline, serine, threonine, lysine, arginine, histidine, aspartic acid, glutamic acid, and asparagine at a concentration above 2 mM.

[0106] In some embodiments, the cell culture medium comprises one of glycine, proline, serine, threonine, lysine, arginine, histidine, aspartic acid, glutamic acid, and asparagine at a concentration above 5 mM.

[0107] In some embodiments, the cell culture medium comprises one, two, three, four, five, six, or seven of proline, lysine, arginine, histidine, aspartic acid, glutamic acid, and asparagine at a concentration above 1 mM, 1.5 mM, 2 mM, 3 mM, or 5 mM.

[0108] In some embodiments, the cell culture medium comprises one of proline, lysine, arginine, histidine, aspartic acid, glutamic acid, and asparagine at a concentration above 2 mM.

[0109] In some embodiments, the cell culture medium comprises one of proline, lysine, arginine, histidine, aspartic acid, glutamic acid, and asparagine at a concentration above 5 mM.

[0110] In some embodiments, the cell culture medium does not contain tyrosine. In some embodiments, the cell culture is a HiPDOG culture, the medium does not contain tyrosine. In some embodiments, the cell culture medium is a HiPDOG culture, and is used in the HiPDOG process, but is a medium that does not contain tyrosine. In some embodiments, the cell culture medium does not contain tyrosine, and the HiPDOG culture or process that does not contain tyrosine is used.

[0111] Lactate and ammonia concentrations In some embodiments, other metabolites that inhibit cell growth, such as lactate and ammonia, are also maintained at low levels in the cell culture medium. Methods for maintaining lactate and ammonia at low levels are also known to those of skill in the art.

[0112] For example, lactate can be kept at low levels in cell culture media by using the methods disclosed in WO2004104186, Gagnon et al., Biotechnology and Bioengineering, Vol. 108, No. 6, June 2011 (Gagnon et al.), or WO2004048556.

[0113] A variety of other strategies can be used to limit lactate production and / or induce lactate consumption. These include culturing the cells under a slightly reduced pH (6.7-7.0), culturing the cells at low glucose concentrations by using alternative carbon sources including, but not limited to, fructose (Wlaschin & Hu, 2007) and galactose (Altamirano et al., 2006), using cell lines with reduced protein levels of glycolytic enzymes including, but not limited to, hexose transporters or lactate dehydrogenase (Kim & Lee, 2007a), lactate dehydrogenase and pyruvate dehydrogenase (Kim & Lee, 2007b). These include the use of cell lines in which cellular protein levels of both aldosterone kinase or pyruvate carboxylase enzymes were suppressed (Kim & Lee, 2007b) or with overexpression of inhibitors (small molecule or protein based) of signaling pathways that regulate the activity of energy metabolism pathways (glycolysis, TCA cycle, and redox pathways), such as AKT (Mulukutla et al., 2012), mTOR (Duvel et al., 2010; Lee & Lee, 2012), and HIF1a (Zhou et al., 2011).

[0114] In some embodiments, lactate is maintained at low levels by using high-end pH-controlled delivery of glucose (HiPDOG process / HiPDOG culture) as disclosed in Gagnon et al.

[0115] In some embodiments, lactate is maintained at low levels in the cell culture medium. In some embodiments, the concentration of lactate in the cell culture medium is maintained below 90 mM. In preferred embodiments, the concentration of lactate in the cell culture medium is maintained below 70 mM. In some embodiments, the concentration of lactate in the cell culture medium is maintained below 50 mM. In some embodiments, the concentration of lactate in the cell culture medium is maintained below 40 mM. In some embodiments, lactate is maintained at low levels by controlling the amount of glucose provided to the cell culture medium. In some embodiments, lactate is maintained at low levels by using a HiPDOG process / culture medium. In some embodiments, a pH sensor is used to monitor the pH of the cell culture medium, and glucose is fed to the cell culture medium in response to an increase above a predetermined pH value. In some embodiments, the predetermined pH value is approximately 7.

[0116] Ammonia can be kept at low levels in cell cultures by any method known to those skilled in the art, such as, for example, the methods disclosed in Butler et al., Cytotechnology, 15:87-94, 1994 or Hong et al., Appl Microbiol Biotechnol (2010), 88:869-876. Alternatively, ammonia can be kept at low levels by using a glutamine synthetase (GS) expression system. Such systems are commercially available (Lonza) and can be used to generate recombinant cell lines. Cell lines using the GS expression system demonstrate a gain of function to synthesize glutamine in vivo, thereby completely relieving the cell's dependence on exogenously supplied glutamine. Such a gain of metabolic function reduces the level of ammonia produced in culture, since the major fraction of ammonia produced in culture is derived from the catabolysis of exogenously supplied glutamine.

[0117] In some embodiments, ammonia is maintained at a low level in the cell culture medium. In a preferred embodiment, the concentration of ammonia in the cell culture medium is maintained at less than 20 mM. In a preferred embodiment, the concentration of ammonia in the cell culture medium is maintained at less than 10 mM. In a preferred embodiment, the concentration of ammonia in the cell culture medium is maintained at less than 8 mM.

[0118] Cell culture method The terms "culture" and "cell culture" as used herein refer to a population of cells provided in a medium under conditions suitable for the survival and / or growth of the population of cells. As will be apparent to one of skill in the art, in some embodiments, these terms as used herein refer to a combination comprising a population of cells and a medium in which the population is suspended. In some embodiments, the cells of the cell culture medium comprise mammalian cells.

[0119] The present invention can be used with any cell culture method applicable to the desired process (e.g., production of a recombinant protein (e.g., an antibody)). As a non-limiting example, cells can be grown in batch or fed-batch culture, where the culture is terminated after sufficient expression of the recombinant protein (e.g., an antibody), and the expressed protein (e.g., an antibody) is then harvested. Alternatively, as another non-limiting example, cells can be grown in batch refeed, where the culture is not terminated and new nutrients and other components are added to the culture medium periodically or continuously, during which the expressed recombinant protein (e.g., an antibody) is harvested periodically or continuously. Other suitable methods (e.g., spin tube culture) are known in the art and can be used to practice the present invention.

[0120] In some embodiments, the cell culture suitable for the present invention is a fed-batch culture. The term "fed-batch culture" as used herein refers to a method of culturing cells in which additional components are provided to the culture medium at the same time or from time to time after the culture process begins. Components provided in this way typically include nutrients for the cells that are depleted during the culture process. The fed-batch culture is typically stopped at some point and the cells and / or components in the medium are harvested and optionally purified. In some embodiments, the fed-batch culture comprises a basal medium supplemented with a feed medium.

[0121] The cells can be grown in any convenient volume selected by the practitioner. For example, the cells can be grown in small scale reactors ranging in volume from a few milliliters to several liters. Alternatively, the cells can be grown in large scale commercial bioreactors ranging in volume from approximately at least 1 liter to 10, 50, 100, 250, 500, 1000, 2500, 5000, 8000, 10,000, 12,000, 15,000, 20,000, or 25,000 liters or more, or any volume in between.

[0122] The temperature of the cell culture will be selected primarily based on the range of temperatures at which the cell culture remains viable and produces high levels of the desired product (e.g., recombinant protein). In general, most mammalian cells can grow well and produce the desired product (e.g., recombinant protein) within a range of about 25°C to 42°C, but the methods taught by the present disclosure are not limited to these temperatures. Certain mammalian cells can grow well and produce the desired product (e.g., recombinant protein or antibody) within a range of about 35°C to 40°C. In certain embodiments, the cell culture is grown at a temperature of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45°C at one or more times during the cell culture process. A person skilled in the art will be able to select the appropriate temperature or temperatures at which to grow the cells depending on the specific needs of the cells and the specific production requirements of the practitioner. The cells can be grown for any amount of time depending on the needs of the practitioner and the requirements of the cells themselves. In some embodiments, the cells are grown at 37°C. In some embodiments, the cells are grown at 36.5°C.

[0123] In some embodiments, cells can be grown during the first growth phase (or growth phase) for a greater or lesser amount of time depending on the needs of the practitioner and the requirements of the cells themselves. In some embodiments, cells are grown for a sufficient time to achieve a predetermined cell density. In some embodiments, cells are grown for a sufficient time to achieve a cell density that is a given percentage of the maximum cell density that the cells would eventually reach if grown undisturbed. For example, cells can be grown for a sufficient time to achieve a desired viable cell density of 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 99 percent of the maximum cell density. In some embodiments, the cells are grown until the cell density does not increase by more than 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% per day of culture. In some embodiments, the cells are grown until the cell density does not increase by more than 5% per day of culture.

[0124] In some embodiments, the cells are grown for a defined period of time. For example, depending on the starting concentration of the cell culture, the temperature at which the cells are grown, and the intrinsic growth rate of the cells, the cells can be grown for 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more days, preferably 4-10 days. In some cases, the cells can be grown for a month or more. The practitioner of the present invention will choose the duration of the first growth phase depending on the protein production requirements and the needs of the cells themselves.

[0125] The cell culture may be agitated or shaken during the initial cultivation stage to increase oxygenation and distribution of nutrients to the cells. In accordance with the present invention, one skilled in the art will appreciate that it may be beneficial to control or regulate certain internal conditions of the bioreactor during the initial growth phase, including but not limited to pH, temperature, oxygenation, etc.

[0126] At the end of the first growth phase, at least one of the culture conditions may be shifted such that a second set of culture conditions is applied during the culture to effect a metabolic shift. The metabolic shift may be achieved, for example, by changing the temperature, pH, osmolality, or chemical inductant levels of the cell culture medium. In a non-limiting embodiment, the culture conditions are shifted by shifting the temperature of the culture. However, as is known in the art, temperature shifting is not the only mechanism by which a suitable metabolic shift can be achieved. For example, such metabolic shifts may also be achieved by shifting other culture conditions, including, but not limited to, pH, osmolality, and sodium butyrate levels. The timing of the culture shift will be determined by the practitioner of the present invention based on the protein production requirements or the needs of the cells themselves.

[0127] When shifting the temperature of the culture, the temperature shift may be gradual. For example, it may take several hours or days to complete the temperature change. Alternatively, the temperature shift may be sudden. For example, the temperature change may be completed within less than a few hours. Given the appropriate production and control equipment that is standard in commercial large-scale production of polypeptides or proteins, the temperature change may even be completed within less than an hour.

[0128] In some embodiments, once the cell culture conditions have been shifted as discussed above, the cell culture is maintained for a subsequent production phase under second culture conditions that are conducive to the survival and viability of the cell culture and suitable for expression of the desired polypeptide or protein at commercially relevant levels.

[0129] As discussed above, the culture can be shifted by shifting one or more of several culture conditions, including but not limited to temperature, pH, osmolality, and sodium butyrate level. In some embodiments, the temperature of the culture is shifted. According to this embodiment, during the subsequent production phase, the culture is maintained at a temperature or temperature range that is lower than the temperature or temperature range of the initial growth phase. As discussed above, multiple individual temperature shifts can be used to increase cell density or viability, or to increase recombinant protein expression.

[0130] In some embodiments, cells can be maintained in the subsequent production phase until desired cell density or production titer is reached. In another embodiment of the present invention, cells are grown for a defined period during the subsequent production phase. For example, depending on the density of cell culture at the beginning of the subsequent growth phase, the temperature at which the cells are grown, and the intrinsic growth rate of the cells, cells can be grown for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more. In some cases, cells can be grown for a month or more. The expert of the present invention will be able to select the duration of the subsequent production phase depending on the polypeptide or protein production requirements and the needs of the cells themselves.

[0131] The cell culture can be agitated or shaken during the subsequent production phase to increase oxygenation and distribution of nutrients to the cells. In accordance with the present invention, one skilled in the art will appreciate that it may be beneficial to control or regulate certain internal conditions of the bioreactor during the subsequent growth phase, including but not limited to pH, temperature, oxygenation, etc.

[0132] In some embodiments, the cells express a recombinant protein and the cell culture methods of the invention include a growth phase and a production phase.

[0133] In some embodiments of the cell culture method, steps (ii) and / or (iii) are applied during the entire cell culture method. In some embodiments, steps (ii) and / or (iii) are applied during a portion of the cell culture method. In some embodiments, steps (ii) and / or (iii) are applied until a predetermined viable cell density is obtained.

[0134] In some embodiments, the cell culture method of the invention comprises a growth phase and a production phase and steps (ii) and / or (iii) and is applied during the growth phase. In some embodiments, the cell culture method of the invention comprises a growth phase and a production phase and steps (ii) and / or (iii) and is applied during a portion of the growth phase. In some embodiments, the cell culture method of the invention comprises a growth phase and a production phase and steps (ii) and / or (iii) and is applied during the growth phase and the production phase.

[0135] In steps (ii) and / or (iii), the term "maintaining" can refer to maintaining the concentration of an amino acid or metabolic product below C1 or C2 throughout the entire culture process (until harvest), or throughout a portion of the culture process, for example, during the growth phase, during a portion of the growth phase, or until a predetermined cell density is achieved.

[0136] The present invention also provides a method for producing cells with improved cell growth and / or productivity in cell culture, comprising the steps of: (i) identifying one or more cellular metabolic products that are cellular proliferation and / or productivity inhibitors; (ii) identifying one or more cellular metabolic pathways that lead to the synthesis of a cell proliferation and / or productive inhibitor; (iii) identifying one or more genes in one or more cellular metabolic pathways that encode an enzyme that catalyzes the synthesis of a cellular proliferation and / or productivity inhibitor, or a metabolic intermediate thereof, or one or more genes that encode an enzyme in a metabolic pathway that branches off or directly branches off therefrom; and / or (iv) identifying one or more genes in one or more cellular metabolic pathways that encode a cellular proliferation and / or productivity inhibitor, or a metabolic product of a cellular proliferation and / or productivity inhibitor, or a metabolic intermediate of a cellular proliferation and / or productivity inhibitor, or a metabolic product of a metabolic intermediate, or a cofactor in one or more cellular metabolic pathways, or BH4 (tetrahydrobiopterin), or BH4-4a (carbinolamine), or an enzyme that catalyzes the synthesis of q-BH2; (v) modifying the expression of one or more genes to reduce the level of cell proliferation and / or synthesis of a productive inhibitor; The present invention provides a method comprising:

[0137] In some embodiments, the step of identifying cellular metabolic products that are cellular proliferation and / or productivity inhibitors comprises: (i) measuring the concentration / level of a measurable cellular metabolic product produced in a cell culture up to maximum viable cell density; (ii) identifying cellular metabolites that are highly expressed or that accumulate to high levels / concentrations and / or that demonstrate an increased rate of metabolite production or an increased level / concentration of metabolite production in cell culture compared to other metabolites; Includes.

[0138] Identification of cellular metabolites that are highly expressed metabolites or that accumulate to high levels / concentrations can be performed using methods to identify and / or measure metabolite concentrations in cell culture medium or within cells, e.g., cell pellets, using one or more of NMR, LC / MS, and GC / MS techniques, or a combination thereof. For metabolomic analysis, spent medium samples and cell pellet samples can be collected and analyzed from single or duplicate reactor runs performed for each condition employed at time points throughout the culture, e.g., including at maximum and / or maximum viable cell density, e.g., at days selected from 0, 1, 2, 3, 4, 5, 7, 8, 9, 11, and 12. The relative levels (fold changes) of all measurable metabolites are measured and calculated. The relative levels are determined and calculated in both spent medium and / or cell pellet samples based on the fold changes compared to the level of the metabolite initially detected, up to the desired time endpoint, usually maximum viable cell density. A metabolite accumulating at a high level is determined by a fold change cutoff of greater than or equal to any one of 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, or 100 times between the first time point at which the metabolite is measured and the desired time end point, e.g., maximum viable cell density. In some embodiments, it is greater than or equal to 20 times.

[0139] In some embodiments, the increase in the rate of metabolite production or the increase in the level / concentration of metabolite production is greater than or equal to 2, 3, 4, 5, 6, 7, 8, 9, or 10 times. In some embodiments, it is greater than or equal to 15, 20, 25, 30, 35, 40, 45, or 50 times. In some embodiments, it is greater than or equal to 40 times. In some embodiments, it is greater than or equal to 50 times.

[0140] In some embodiments, the identification of cellular metabolites that are cell proliferation (productive) inhibitors includes: (i) Quantifying the production / concentration of highly expressed metabolites at maximum viable cell density; and (ii) culturing the cells with and without the presence of an amount of the metabolite highly expressed in (i); (iii) comparing the maximum viable cell density or productivity and / or maximum viable cell density and / or productivity during cell culture of each cell population in (ii) to determine the effect of the highly expressed metabolites on cultured cell growth and / or productivity; Further includes:

[0141] Quantifying highly expressed metabolite production / concentration at maximum viable cell density can be performed using methods for identifying and / or measuring metabolite concentrations in cell culture medium or in cells. In some embodiments, measuring and / or quantifying metabolites, including highly expressed metabolites, is performed using liquid chromatography with mass spectrometry (LC / MS), gas chromatography with mass spectrometry (GC / MS), or nuclear magnetic resonance (NMR). In some embodiments, cellular metabolites and / or highly expressed metabolites are identified from a sample of culture medium or from cultured cells in cell culture.

[0142] Measurement and / or quantification of metabolite or highly expressed metabolite can be carried out by using the obtained purified compound form of metabolite or highly expressed metabolite.These compounds can be used to prepare a calibration curve for the compound at known concentration, so that the measurement value obtained from the method can be accurately correlated with the concentration of metabolite.In this way, accurate measurement of the concentration of metabolite can be determined at any given time point in cell culture at maximum viable cell density.

[0143] The effect of the quantified concentration of the highly expressed metabolite can be determined on the cell growth and / or productivity of cells in cell culture by introducing a predetermined concentration into the cell culture and comparing the effect on cell growth and / or productivity with an otherwise identical culture lacking the introduced metabolite. For example, cells that may be recombinant protein producing cells can be inoculated into culture medium spiked with different selected concentrations of the highly expressed metabolite, either alone or in combination with other different highly expressed metabolites at selected concentrations, and these concentrations can be, for example, the concentration determined at the maximum viable cell density or a serial dilution thereof. The pH of the culture medium can also be adjusted to 7 before inoculating the cells. By comparison, the presence of a negative effect of the metabolite on cell growth and / or productivity on the same scale and / or the presence of a synergistic effect between the metabolites can be determined, thereby determining such highly expressed metabolites as inhibitors of cell growth and / or productivity.

[0144] In some embodiments of the method for producing cells, one or more cellular metabolic pathways are determined from the highly expressed metabolites that are cellular growth and / or productivity inhibitors or the nutritional sources or components of the culture medium of one or more cellular metabolic products, which are broadly classified into amino acids, vitamins, inorganic salts, trace elements, vitamins, energy sources, lipids, and nucleotides, and further disclosure is provided herein. Those skilled in the art who have knowledge of the identity of the highly expressed metabolites that are inhibitory metabolites and knowledge of the nutritional sources of the metabolites can apply biochemical knowledge of metabolic pathways common to cells to infer the relevant one or more cellular metabolic pathways that contribute to the synthesis of growth and / or productivity inhibitors and may include pathways leading to and branching from metabolic intermediates.

[0145] In some embodiments, the identification of one or more genes in one or more cellular metabolic pathways that encode an enzyme that catalyzes the synthesis of a cellular proliferation and / or productivity inhibitor, or a metabolic intermediate, or one or more genes that encode an enzyme in a metabolic pathway branch therefrom, is determined by: (i) determining the relative gene expression levels in one or more cellular metabolic pathways and identifying genes that are expressed at increased or decreased levels; and / or (ii) identifying genes in one or more cellular metabolic pathways that contain the mutations; Further includes:

[0146] In some embodiments, the identification of one or more genes in one or more cellular metabolic pathways that encode an enzyme that catalyzes the synthesis of a cell proliferation and / or productivity inhibitor or a metabolic intermediate thereof, or one or more genes that encode an enzyme in a metabolic pathway branching therefrom, or the identification of one or more genes in one or more cellular metabolic pathways that encode an enzyme that catalyzes the synthesis of a cell proliferation and / or productivity inhibitor, or a metabolic product of a cell proliferation and / or productivity inhibitor, or a metabolic intermediate of a cell proliferation and / or productivity inhibitor, or a metabolic product of a metabolic intermediate, or a cofactor in one or more cellular metabolic pathways, such as BH4 (tetrahydrobiopterin) or BH4-4a (carbinolamine) or q-BH2, further comprises modifying the one or more genes. In some embodiments, the identification of one or more genes comprises gene expression analysis, which in some embodiments comprises gene expression analysis of one or more genes in the identified one or more pathways, and in some embodiments comprises gene expression analysis of all genes in the identified one or more pathways. In some embodiments, it includes gene expression analysis by measuring the amount of transcription, and in some embodiments, it includes real-time quantitative PCR assay or RT-qPCR assay. RT qPCR can measure the amount of transcription by amplifying a target cDNA sequence using PCR in combination with a detection reagent, such as SYBR Green. Relative gene expression levels can be determined by measuring the number of PCR cycles required for a signal from the detection reagent to exceed background, which can increase logarithmically. This number of cycles is expressed as C T (threshold cycle). Low abundance transcripts, such as beta-actin, have a high C T It has a value and vice versa.

[0147] In some embodiments, the relative gene expression levels are determined by real-time quantitative PCR, RT-qPCR, and in some embodiments, the identification of gene mutations is determined by mRNA sequencing.

[0148] In some embodiments, the identified genes are expressed at increased or decreased levels, higher or lower than the expression level of the control gene, and in some embodiments, the levels are greater than or equal to any one of 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, or 95 percent higher or lower than the expression level of the control gene, for example, as determined by Ct or dCt values. In some embodiments, the identified genes are expressed 10% higher or lower than the expression level of the control gene, in some embodiments, 15% higher or lower, and in some embodiments, 20% higher or lower than the expression level of the control gene. In some embodiments, the control gene has a Ct value equal to 14 and 17, or between 14 and 17, or a Ct value equal to 15 and 16, or between 15 and 16, as measured by RT-qPCR, and in some embodiments, the control gene is beta-actin. In some embodiments, the identified genes have a C greater than or equal to any one of 23, 24, 25, 26, 27, 28, 29, 30, or more than 30. t In some embodiments, the identified genes have a C value of less than or equal to any one of 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or less than 14 as measured by RT-qPCR. t In some embodiments, the identified genes have a dCt value less than or equal to -1, less than or equal to 0, less than or equal to 1, greater than or equal to any one of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11, or greater than or equal to 11, as measured by RT-qPCR.

[0149] In some embodiments, the identification of one or more genes in one or more cellular metabolic pathways that encode enzymes that catalyze the synthesis of a cell proliferation and / or productivity inhibitor or its metabolic intermediate, or one or more genes that encode enzymes in metabolic pathways branching therefrom, additionally or alternatively comprises genetic mutation analysis of one or more genes in the identified pathway(s), which in some embodiments comprises genetic mutation analysis of all genes in the identified pathway(s).

[0150] In some embodiments, expression of one or more genes has / can be altered if one or more genes encoding enzymes in a cellular metabolic pathway or in a metabolic pathway branching off therefrom that encode an enzyme that catalyzes the synthesis of a cellular proliferation and / or productivity inhibitor or its metabolic intermediate, are expressed at increased or decreased levels that are higher or lower than the expression level of a control gene and / or are mutated.

[0151] In some embodiments, expression of one or more genes in one or more cellular metabolic pathways that encode enzymes that catalyze the synthesis of a cellular proliferation and / or productivity inhibitor or its metabolic intermediate is altered.

[0152] In some embodiments, one or more genes encoding enzymes in a metabolic pathway branch from one or more cellular metabolic pathways that includes one or more genes encoding enzymes that catalyze the synthesis of a cell proliferation and / or productivity inhibitor or a metabolic intermediate thereof are modified.

[0153] In some embodiments, the branching occurs in a node located above one or more genes in one or more cellular metabolic pathways that encode catalysts that catalyze the synthesis of a cell proliferation and / or productivity inhibitor or a metabolic intermediate thereof. In some embodiments, the branching occurs in a node located below.

[0154] In some embodiments, the branching occurs in a node located above one or more genes in one or more cellular metabolic pathways that encode enzymes that catalyze the synthesis of a cell proliferation and / or productive inhibitor, and in some embodiments, the branching occurs in a node located below.

[0155] In some embodiments, one or more genes in one or more cellular metabolic pathways that encode an enzyme that catalyzes the synthesis of a cellular proliferation and / or productivity inhibitor, or a metabolic product of a cellular proliferation and / or productivity inhibitor, or a metabolic intermediate of a cellular proliferation and / or productivity inhibitor, or a metabolic product of a metabolic intermediate, or a cofactor in one or more cellular metabolic pathways, such as BH4 (tetrahydrobiopterin), or BH4-4a (carbinolamine), or q-BH2, have been modified.

[0156] As illustrated in the Examples, a method for producing cells with improved cell growth and / or productivity in cell culture involves identifying metabolic inhibitors produced by cells. The method further involves identifying metabolic pathways leading to and / or away from the point of inhibitor synthesis, where the metabolism channels to and / or from the point of inhibitor synthesis (see FIG. 24). Similarly, pathway branches from these metabolic pathways are identified (see FIG. 25). Such branches may occur at nodes in the pathway located above, below, or at the point of inhibitor synthesis, and may similarly function to channel metabolism towards the inhibitor and / or away from the inhibitor synthesis point, or to channel metabolism towards or away from the synthesis point of an intermediate of inhibitor synthesis. Furthermore, the method illustrated in the Examples involves the identification of genes encoding enzymes in these aforementioned pathways, including branches or branched pathways. These genes can encode enzymes that synthesize inhibitors; they can encode enzymes that synthesize intermediates or upstream intermediates for synthesizing inhibitors; they can encode enzymes for which the inhibitor is an intermediate or upstream intermediate in enzymatic action; or they can encode enzymes for which the inhibitor is a direct intermediate or substrate in enzymatic action (e.g., this is exemplified in FIG. 24 by genes Hpd and Hgd), and can encode enzymes that generate cofactors in one or more cellular metabolic pathways, such as BH4 (tetrahydrobiopterin), or BH4-4a (carbinolamine), or q-BH2.

[0157] As illustrated in the examples, the method further involves modifying the expression of one or more of the above-mentioned genes to reduce the level of cell proliferation and / or synthesis of productive inhibitors. This objective can be achieved in several ways, as illustrated in the examples. Genes encoding enzymes that synthesize inhibitors or enzymes that synthesize intermediates in the pathway leading to the inhibitor or pathway branching off from it can be modified to reduce gene expression, thus reducing metabolic channeling towards the production of inhibitors, especially in cases where one or more genes are highly expressed. Genes encoding enzymes for which the inhibitor is a substrate or intermediate or upstream intermediate in the pathway leading to the inhibitor or pathway branching off from it can be modified to increase gene expression, thus increasing metabolic channeling away from the production of inhibitors, especially in cases where one or more genes are underexpressed and / or mutated and / or suffer from loss of function or enzyme activity. Similarly, genes encoding enzymes that are also intermediates or upstream intermediates in inhibitor synthesis, i.e., genes in a pathway branching from a node located at an intermediate synthesis point upstream of the inhibitor synthesis point, can be modified to increase gene expression, thus increasing metabolic channeling away from the pathway leading to the production of the inhibitor, particularly in cases where one or more genes are underexpressed and / or mutated and / or suffer loss of function or enzymatic activity.

[0158] The identified gene or genes code for enzymes that directly synthesize inhibitors or intermediates of inhibitor synthesis or metabolite intermediates, and it may not be desirable to modify such genes if they are involved in other important metabolic processes. This is exemplified in Example 4 (Figure 24) with reference to genes Got1, Got2, Nup62-il4i1, and Mif, which may be expressed at normal or high levels. In this situation, one or more genes in a branched pathway may be modified in a pathway branch, for example, from a node located at the intermediate synthesis point upstream of the inhibitor synthesis point, to increase metabolic channeling away from the pathway leading to the production of the inhibitor. This can be achieved by increasing the expression of genes in the branch, especially in cases where one or more genes in the branch are underexpressed and / or mutated and / or suffer loss of function or enzymatic activity by increasing the expression of genes in the branch. This is exemplified in Example 4 (Figure 24) for gene Pah. Alternative genes encoding enzymes for which the inhibitor is a substrate or upstream intermediate can be modified to increase gene expression, particularly in cases where one or more genes are underexpressed and / or mutated and / or suffer loss of function or enzymatic activity, by increasing the expression of the genes during branching, thus increasing metabolic channeling away from the production of the inhibitor. This is illustrated in Example 4 (Figure 24) for genes Hpd and / or Hgd. Thus, the metabolic targets of the phenylalanine / tyrosine pathway (Figure 24) are one or more of the Pah, Hpd, and / or Hgd genes and / or PCBD1 and / or QDPR (Figures 26 and 27). These are targets for increasing expression that can be achieved by mutating the genes to correct the loss or increase in activity and / or by providing an additional one or more wild-type copies of one or more genes in an expression-capable vector that can be introduced into the cell.

[0159] In the case where the identified gene or genes code for the enzymes that directly synthesize inhibitors, or intermediates in inhibitor synthesis, or metabolic products of inhibitors or intermediates, it may be desirable to modify such genes to prevent metabolic channeling toward inhibitor synthesis production.As illustrated in Example 24, this can be achieved by modifying one or more genes directly upstream from inhibitor production, as shown for genes Bcat1 and / or Bcat2.Such modification can be by gene knockdown or gene knockout.

[0160] In one embodiment, gene knockdown reduces gene expression or activity of the encoded molecule to less than or equal to any of the following: 90, 80, 70, 60, 50, 45, 40, 35, 30, 25, 20, 15, 10, 5, 2.5 percent compared to an unmodified cell.

[0161] In one embodiment, Bcat1 and / or Bcat2 knockdown reduces the level or activity of Bcat1 and / or Bcat2 expression to less than or equal to any of 90, 80, 70, 60, 50, 45, 40, 35, 30, 25, 20, 15, 10, 5, 2.5 percent compared to unmodified cells.

[0162] Knockdown can be achieved by gene deletion, disruption, substitution, point mutation, multiple point mutation, insertion mutation, or frameshift mutation CRISPR / CAS9, or any one or more of CRISPR interference or interfering RNA, interfering mRNA or interfering aptamers applied to the identified gene that is expressed at a reduced level, or by suppression of gene expression by use of siRNA or siRNA interference or zinc finger transcription factors or zinc finger nucleases or transcription activator-like effector nucleases (TALENs), or by the use of inhibitors, such as inhibitor molecules or small molecule inhibitors, e.g., active inhibitors of protein or enzyme activity.

[0163] As also illustrated in the examples, increasing metabolic channeling away from inhibitor synthesis production can be achieved by modifying one or more genes encoding enzymes that share the intermediates of inhibitor production as their own intermediates. As illustrated in Example 5, it can be achieved by modifying one or more genes directly downstream from inhibitor production (Figure 25) or downstream from a node that branches toward inhibitor production to increase expression. This is especially the case when one or more genes are underexpressed or mutated and suffer loss of function or enzyme activity. This is illustrated for genes Ivd, Mccc1, and / or Mccc2, and underexpressed gene Auh, when the enzyme suffers activity modifying mutation. Thus, the metabolic target of the leucine pathway is one or more of Ivd, Mccc1, Mccc2, and Auh genes. These are targets for increasing expression that can be achieved by mutating the genes to correct the loss of activity or the increase in activity, and / or by providing a wild-type copy of one or more genes in an expression-capable vector that can be introduced into the cell.

[0164] According to some embodiments, the modification inhibits, reduces, prevents the biosynthesis of a proliferation and / or productivity inhibitor and / or its intermediates, and in some embodiments, the modification inhibits, reduces, prevents the biosynthesis of a proliferation and / or productivity inhibitor. According to some embodiments, the modification produces cells with improved cell proliferation and / or productivity in cell culture.

[0165] In some embodiments, modifying the expression of one or more genes comprises: (a) any one or more of a gene deletion, disruption, substitution, point mutation, multiple point mutation, insertion mutation, or frameshift mutation applied to an identified gene or an identified gene containing a mutation that is expressed at an increased or decreased level; or (b) introduction of one or more nucleic acids, optionally including a gene, into the cell as an expressible nucleic acid or vector construct; (c) Repression or activation of gene expression by the use of CRISPR / CAS9 or CRISPR interference or interfering RNA, interfering mRNA or interfering aptamers, or siRNA or siRNA interference, or zinc finger transcription factors or zinc finger nucleases or transcription activator-like effector nucleases (TALENs). Includes.

[0166] When modifying the expression of one or more genes includes the use of interfering RNA (RNAi), suitable RNAi includes RNAi that reduces or increases the level of gene product, i.e., targets one or more genes. For example, RNAi can be shRNA or siRNA. "Small interfering" or "short interfering RNA" or siRNA is an RNA duplex of nucleotides that is targeted to a gene of interest or one or more genes. "RNA duplex" refers to a structure formed by complementary pairing between two regions of an RNA molecule. siRNA is "targeted" to a gene in that the nucleotide sequence of the duplex portion of the siRNA is complementary to the nucleotide sequence of the target gene. In some embodiments, the length of the siRNA duplex is less than 30 nucleotides. In some embodiments, the duplex can be 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, or 10 nucleotides long. In some embodiments, the length of the duplex is 19-25 nucleotides long. The RNA duplex portion of the siRNA can be part of a hairpin structure. In addition to the duplex portion, the hairpin structure can contain a loop portion located between the two sequences forming the duplex. The loop can vary in length. In some embodiments, the loop is 5, 6, 7, 8, 9, 10, 11, 12, or 13 nucleotides long. The hairpin structure can also contain a 3' or 5' overhang portion. In some embodiments, the overhang is a 3' or 5' overhang that is 0, 1, 2, 3, 4, or 5 nucleotides long. "Short hairpin RNA" or shRNA is a polynucleotide construct that can be made to express an interfering RNA such as an siRNA.

[0167] In some embodiments, the vector contains one or more of a promoter sequence, a directional cloning site, an epitope tag, a polyadenylation sequence, and an antibiotic resistance gene. In some embodiments, the promoter sequence is human cytomegalovirus immediate early promoter, the directional cloning site is TOPO, the epitope tag is V5 for detection using anti-V5 antibody, the polyadenylation sequence is from herpes simplex virus thymidine kinase, and the antibiotic resistance gene is blasticidin.

[0168] In some embodiments, the cell proliferation and / or productivity inhibitor is selected from the group consisting of 3-(4-hydroxyphenyl)lactate (HPLA), 4-hydroxyphenylpyruvate, phenyllactate (PLA), indolecarboxylate (indole-3-carboxylate), indolelactate (indole-3-lactate), 2-hydroxybutyrate, homocysteine, isovalerate, 2-methylbutyrate, isobutyrate, butyrate, and formate.

[0169] In some embodiments, the one or more cellular metabolic pathways synthesize 3-(4-hydroxyphenyl)lactate (HPLA), 4-hydroxyphenylpyruvate, phenyllactate (PLA), indolecarboxylate (indole-3-carboxylate), indolelactate (indole-3-lactate), 2-hydroxybutyrate, homocysteine, isovalerate, 2-methylbutyrate, isobutyrate, butyrate, formate, or a metabolite thereof, or a metabolic intermediate thereof, or a metabolite of a metabolic intermediate.

[0170] In some embodiments, the cellular metabolic pathway is the leucine pathway and / or the isoleucine pathway and / or the valine pathway, or the phenylalanine / tyrosine pathway, or the acetoacetate / fumarate pathway.In some embodiments, the cellular metabolic pathway is the leucine pathway or the phenylalanine / tyrosine pathway.In some embodiments, the cellular metabolic pathway is the leucine pathway and the isoleucine pathway and the valine pathway and / or the phenylalanine / tyrosine pathway.

[0171] In some embodiments, the modified gene encodes an enzyme that catalyzes the synthesis of 3-(4-hydroxyphenyl)lactate (HPLA), 4-hydroxyphenylpyruvate, phenyllactate (PLA), indolecarboxylate (indole-3-carboxylate), indolelactate (indole-3-lactate), 2-hydroxybutyrate, homocysteine, isovalerate, 2-methylbutyrate, butyrate, butyrate, formate, or a metabolite thereof, or a metabolic intermediate thereof, or a metabolite of a metabolic intermediate.

[0172] In some embodiments, the modified gene encodes an enzyme that catalyzes the synthesis of 4-hydroxyphenylpyruvate or phenyllactate (PLA), or a metabolite thereof, or a metabolic intermediate thereof, or a metabolite of a metabolic intermediate.

[0173] In some embodiments, the modified gene encodes an enzyme that catalyzes the synthesis of isovalerate, 2-methylbutyrate, isobutyrate, or butyrate, or a metabolite thereof, or a metabolic intermediate thereof, or a metabolite of a metabolic intermediate.

[0174] In some embodiments, the one or more genes to be modified are selected from PCBD1, QDPR, Pah, Mif, Got1, Got2, Nup62-il4i1, Hpd, Hgd, Gstz1, Fah.

[0175] In some embodiments, the modified gene or genes are selected from Bcat1, Bcat2, Bckdha / b, Dbt / Dld, Ivd, Acadm, Mccc1, Mccc2, Auh, Hmgcl, Fasn.

[0176] In some embodiments, the modified gene or genes are selected from PCBD1, QDPR, Pah, Mif, Got1, Got2, Nup62-il4i1, Hpd, Hgd, Gstz1, Fah, Bcat1, Bcat2, Bckdha / b, Dbt / Dld, Ivd, Acadm, Mccc1, Mccc2, Auh, Hmgcl, Fasn, Fasn.

[0177] In some embodiments, the modified gene or genes are selected from Hpd, Hgd, and Pah, PCBD1, QDPR.

[0178] In some embodiments, the modified gene or genes are selected from Bcat1, Bcat2, Auh, Mccc1, Mccc2, Ivd.

[0179] In some embodiments, the modified gene or genes are selected from Bcat1, Bcat2, Auh, Mccc1, Mccc2, Ivd, Hpd, Hgd, and Pah, PCBD1, QDPR.

[0180] In some embodiments, the gene is modified to increase or decrease gene expression.

[0181] In some embodiments, the gene is modified to reduce gene expression.

[0182] In some embodiments, the modification (a) increases gene expression; and (b) increases gene expression except when the gene is Bcat1 and / or Bcat2, where the modification decreases gene expression.

[0183] According to some embodiments, cells are provided that contain one or more modified genes that reduce the level of proliferation and / or synthesis of productive inhibitors by the cells. In some embodiments, the cells contain one or more modified genes selected from Bcat1, Bcat2, Auh, Mccc1 / 2, Ivd, Hpd, Hgd, and Pah, PCBD1, QDPR, where the modification increases or decreases gene expression, in some embodiments increases, in some embodiments reduces gene expression of Bcat1 and / or Bcat2, and in some embodiments also reduces the level of proliferation and / or synthesis of productive inhibitors by the cells.

[0184] In some embodiments, the modified gene or genes are Auh, or Bcat1, or Bcat2, or Bcat1 and Bcat2, or one or more of Mccc1, Mccc2, and Ivd, for example Mccc1 or Mccc2 or Ivd, which may be combined with Auh and / or Bcat1 and / or Bcat2, or Auh and one or more of Mccc1, Mccc2, and Ivd, or Auh, Mccc1, Mccc2, and Ivd, which may be combined with Bcat1 and / or Bcat2. In some embodiments of the above embodiment, the gene or genes are modified to increase gene expression by gene mutation, and in some embodiments, by introduction of a copy of a wild-type gene into the cell, optionally as an expressible vector. In some embodiments, Auh gene expression can be increased by introduction of a copy of a wild-type gene, in some embodiments, by mutation, or alternatively by both. In some embodiments, Mccc1, Mccc2, Ivd gene expression can be increased by mutation, in some embodiments, by introduction of a copy of a wild-type gene, or alternatively by both. In some embodiments, Auh gene expression is increased by introduction of a copy of a wild-type gene, and / or Mccc1, Mccc2, and Ivd gene expression is increased by mutation. In some embodiments, Bcat1 and / or Bcat2 gene expression is reduced by gene knockdown or knockout, in some embodiments, Bcat1 and / or Bcat2 knockdown is less than or equal to any of 90, 80, 70, 60, 50, 45, 40, 35, 30, 25, 20, 15, 10, 5, 2.5 percent levels of Bcat1 and / or Bcat2 expression or activity compared to unmodified cells.In some embodiments, the one or more modified genes are (a) Pah, PCBD1, QDPR, Mif, Got1, Got2, Nup62-il4i1, Hpd, Hgd, Gstz1, Fah, Bcat1, Bcat2, Bckdha / b, Dbt / Dld, Ivd, Acadm, Mccc1, Mccc2, Auh, Hmgcl, Fasn, Fasn; (b) Pah, PCBD1, QDPR, Mif, Got1, Got2, The modifications are selected from Nup62-il4i1, Hpd, Hgd, Gstz1, Fah, (c) Bcat1, Bcat2, Bckdha / b, Dbt / Dld, Ivd, Acadm, Mccc1, Mccc2, Auh, Hmgcl, Fasn, Fasn, (d) Bcat1, Bcat2, Auh, Mccc1, Mccc2, Ivd, Hpd, Hgd, and Pah, PCBD1, QDPR, and gene expression is increased or decreased by the modifications.

[0185] In some embodiments, the modified gene or genes are Pah and / or PCBD1 and / or QDPR, or one or more of Hpd and Hgd, for example Hpd or Hgd, optionally combined with Pah and / or PCBD1 and / or QDPR, or one or more of Pah and Hpd and Hgd, such as Pah, Hpd, and Hgd. In some embodiments, the modified gene or genes are selected from (i) PCBD1, (ii) Pah, (iii) QDPR, (iv) PCBD1 and QDPR, (v) PCBD1 and Pah, (vi) Pah and QDPR, (vii) PCBD1 and Pah, and QDPR, (viii) any of (i)-(vii), and Hpd and / or Hgd. In some of the above embodiments, the gene or genes are modified to increase gene expression. In some embodiments, any one or more of Pah, PCBD1, QDPR, Hpd, Hgd gene expression can be increased by introducing a copy of a wild-type gene, in some embodiments, by mutation, or alternatively by both. In some embodiments, Pah, PCBD1, QDPR, Hpd, and Hgd gene expression is increased by introducing a copy of a wild-type gene. In some embodiments, Hpd and Hgd gene expression is increased by introducing a copy of a wild-type gene. In some embodiments, Pah, PCBD1, and / or QDPR gene expression is increased by introducing a copy of a wild-type gene.

[0186] In some embodiments, the modified gene or genes are Auh, Mccc1, Mccc2, Ivd, Pah, Hpd, and Hgd. In some embodiments, the modified gene or genes are Auh, Mccc1, Mccc2, Ivd, Pah, PCBD1, Hpd, and Hgd, and optionally QDPR. In some embodiments, the modified gene or genes are Bcat1 and / or Bcat2, Pah, PCBD1, Hpd, and Hgd, and optionally QDPR. In some of the above embodiments, the gene or genes are modified to increase gene expression by the associated method of introducing a copy of a wild-type gene, by mutation, or alternatively by both. In some embodiments, Auh gene expression is increased by introducing a copy of a wild-type gene, and Mccc1, Mccc2, Ivd, Pah, PCBD1, QDPR, Hpd, and Hgd gene expression is increased by mutation.

[0187] The present invention further provides a cell obtained or obtainable by the method of producing a cell. In some embodiments, the cell comprises one or more modified genes that reduce the level of proliferation and / or synthesis of productive inhibitors by the cell. In some embodiments, the cell comprises one or more modified genes selected from Bcat1, Bcat2, Auh, Mccc1, Mccc2, Ivd, Hpd, Hgd, and Pah, PCBD1, QDPR, and the modification increases or decreases gene expression. In some embodiments, gene expression is increased. In some embodiments, the level of proliferation and / or synthesis of productive inhibitors by the cell is also reduced.

[0188] In some embodiments of the cells obtained by the method for producing cells, the modified one or more genes are Auh, or Bcat1, or Bcat2, or Bcat1 and Bcat2, or one or more of Mccc1, Mccc2, and Ivd, for example Mccc1 or Mccc2 or Ivd, which may be combined with Auh and / or Bcat1 and / or Bcat2, or Auh and one or more of Mccc1, Mccc2, and Ivd, or Auh, Mccc1, Mccc2, and Ivd, which may be combined with Bcat1 and / or Bcat2. In some embodiments of the above embodiments, the one or more genes are modified to increase gene expression by gene mutation, and in some embodiments, by introduction of a copy of a wild-type gene into the cell, optionally as an expressible vector. In some embodiments, Auh gene expression can be increased by introduction of a copy of a wild-type gene, in some embodiments, by mutation, or alternatively by both. In some embodiments, Mccc1, Mccc2, Ivd gene expression can be increased by mutation, in some embodiments, by introduction of a copy of a wild-type gene, or alternatively by both. In some embodiments, Auh gene expression is increased by introduction of a copy of a wild-type gene, and / or Mccc1, Mccc2, and Ivd gene expression is increased by mutation. In some embodiments, Bcat1 and / or Bcat2 gene expression is reduced by gene knockdown or knockout, in some embodiments, Bcat1 and / or Bcat2 knockdown is less than or equal to any of 90, 80, 70, 60, 50, 45, 40, 35, 30, 25, 20, 15, 10, 5, 2.5 percent levels of Bcat1 and / or Bcat2 expression or activity compared to unmodified cells.

[0189] In some embodiments, the modified gene or genes are Pah and / or PCDB1 and / or QDPR, or one or more of Hpd and Hgd, for example Hpd or Hgd, optionally combined with Pah and / or PCDB1 and / or QDPR, or one or more of Pah and Hpd and Hgd, such as Pah, Hpd, and Hgd. In some embodiments, the modified gene or genes are selected from (i) PCDB1, (ii) Pah, (iii) QDPR, (iv) PCBD1 and QDPR, (v) PCBD1 and Pah, (vi) Pah and QDPR, (vii) PCDB1 and Pah, and QDPR, (viii) any of (i)-(vii), and Hpd and / or Hgd. In some of the above embodiments, the gene or genes are modified to increase gene expression. In some embodiments, Pah, PCDB1, QDPR, Hpd, Hgd gene expression can be increased by introducing a copy of a wild-type gene, in some embodiments, by mutation, or alternatively by both. In some embodiments, Pah, PCDB1, QDPR, Hpd, and Hgd gene expression is increased by introducing a copy of a wild-type gene. In some embodiments, Hpd and Hgd gene expression is increased by introducing a copy of a wild-type gene. In some embodiments, Pah, PCDB1, QDPR, Hpd, and Hgd gene expression is increased by introducing a copy of a wild-type gene.

[0190] In some embodiments, the modified gene or genes are Auh, Mccc1, Mccc2, Ivd, Pah, Hpd, and Hgd. In some embodiments, the modified gene or genes are Auh, Mccc1, Mccc2, Ivd, Pah, PCDB1, Hpd, and Hgd, and optionally QDPR. In some embodiments, the modified gene or genes are Bcat1 and / or Bcat2, Pah, PCDB1, Hpd, and Hgd, and optionally QDPR. In some embodiments of the above embodiments, the gene or genes are modified to increase gene expression by the associated method of introducing a copy of a wild-type gene, by mutation, or alternatively by both. In some embodiments, Auh gene expression is increased by introducing a copy of a wild-type gene, and Mccc1, Mccc2, Ivd, Pah, PCDB1, QDPR, Hpd, and Hgd gene expression is increased by mutation.

[0191] In some embodiments, the modified gene or genes are selected from Bcat1, Bcat2, Auh, Mccc1, Mccc2, Ivd, Hpd, Hgd, PCBD1, QDPR, and Pah, and the modification increases gene expression of one or more of Auh, Mccc1, Mccc2, Ivd, Hpd, Hgd, PCBD1, QDPR, and Pah, and / or reduces gene expression of Bcat1 or Bcat2, and / or reduces the level of proliferation and / or synthesis of a productive inhibitor by the cell.

[0192] In some embodiments, the modified gene or genes are one or more of: (i) Auh, (ii) Bcat1, (iii) Bcat2, (iv) one or more of Mccc1, Mccc2, and Ivd, (v) Bcat1 and / or Bcat2 and / or Auh, and one or more of Mccc1, Mccc2, and Ivd, (vi) Pah, (vii) PCBD1, (viii) PCBD1 and / or QDPR, (ix) one or more of Hpd and Hgd, (x) Pah and / or PCBD1, and Hp (xi) Pah and PCBD1, and optionally QDPR, (xii) Pah, PCBD1, Hpd, and Hgd, and optionally QDPR, (xiii) Bcat1 and / or Bcat2, Auh, Mccc1, Mccc2, and Ivd, or (xiv) Bcat1 and / or Bcat2, Auh, Mccc1, Mccc2, Ivd, Pah, PCBD1, Hpd, Hgd, and optionally QDPR, (xv) Bcat1 and / or Bcat2. In some embodiments, the modification (a) increases gene expression, and (b) increases gene expression except when the gene is Bcat1 and / or Bcat2, where the modification reduces gene expression, optionally with Bcat1 and / or Bcat2 knockdown to less than or equal to any of 90, 80, 70, 60, 50, 45, 40, 35, 30, 25, 20, 15, 10, 5, 2.5 percent levels of Bcat1 and / or Bcat2 expression or activity compared to unmodified cells. In one embodiment, the cell expresses a recombinant protein or a heterologous recombinant protein.

[0193] cell Any cell amenable to cell culture can be utilized in accordance with the present invention, hi some embodiments, the cell is a mammalian cell. Non-limiting examples of mammalian cells that may be used according to the present invention include BALB / c mouse myeloma line (NSO / 1, ECACC number: 85110503); human retinoblastoma cells (PER.C6, CruCell, Leiden, The Netherlands); monkey kidney CV1 line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic kidney line (293 or 293 cells subcloned to grow in suspension culture, Graham et al., J. Gen Virol., 36:59, 1977); baby hamster kidney cells (BHK, ATCC CCL10); Chinese hamster ovary cells + / - DHFR (CHO, Urlaub and Chasin, Proc. Natl. Acad. Sci. USA, 77:4216, 1980); mouse Sertoli cells (TM4, Mather, Biol. Reprod., 23:243-251, 1980); monkey kidney cells (CV1 ATCC CCL 70); African green monkey kidney cells (Vero-76, ATCC CRL-1 587); human cervical carcinoma cells (HeLa, ATCC CCL 2); canine kidney cells (MDCK, ATCC CCL 34); buffalo rat hepatocytes (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL 75); human hepatocytes (Hep G2, HB 8065); mouse mammary tumor (MMT 060562, ATCC CCL51); avian cells (Mather et al., Annals NYAcad. Sci., 383:44-68, 1982); MRC 5 cells; FS4 cells; and human hepatocellular carcinoma line (Hep G2). In some preferred embodiments, the cells are CHO cells. In some preferred embodiments, the cells are GS cells.

[0194] Additionally, any number of commercially available and non-commercially available hybridoma cell lines can be utilized by the present invention. The term "hybridoma" as used herein refers to the cell or cell progeny resulting from the fusion of an immortalized cell and an antibody-producing cell. Such resulting hybridomas are immortalized cells that produce antibodies. The individual cells used to create hybridomas can be of any mammalian cell origin, including, but not limited to, rat, pig, rabbit, sheep, pig, goat, and human. In some embodiments, hybridomas are trioma cell lines that arise when the progeny of a heterohybrid myeloma fusion, which is the product of the fusion of a human cell with a murine myeloma cell line, is subsequently fused with plasma cells. In some embodiments, hybridomas are any immortalized hybrid cell line that produces antibodies, such as, for example, quadromas (see, for example, Milstein et al., Nature, 537:3053, 1983). One of skill in the art will appreciate that hybridoma cell lines may have different nutritional requirements and / or require different culture conditions for optimal growth, and conditions can be modified as necessary.

[0195] Methods comprising identifying and / or measuring metabolic concentrations in cell culture medium or cells (cell pellet samples) The metabolites can be identified and / or the concentrations of the metabolites can be measured by any method known to those skilled in the art, including offline and online measurement methods, which also constitute metabolomic analysis or measurement, and are applied to cell culture medium or a sample of cells, such as a cell pellet.

[0196] Metabolite identity and / or concentration can be measured one or more times during cell culture. In some embodiments, metabolite concentration is measured continuously, intermittently, every 30 minutes, every hour, every 2 hours, twice a day, every day, or every 2 days. In a preferred embodiment, metabolite identity and / or concentration is measured every day.

[0197] An offline measurement method herein refers to a method in which the measurement of a parameter such as a concentration is not automated and integrated with the cell culture method. For example, a measurement method in which a sample is manually taken from a cell culture medium so that a specific concentration can be measured in said sample is considered an offline measurement method.

[0198] Online measurement methods, as used herein, refer to methods in which the measurement of a parameter, such as concentration, is automated and integrated into the cell culture method.

[0199] For example, the method using Raman spectroscopy disclosed in Example 7 is an on-line measurement method. Alternatively, the use of high performance liquid chromatography (HPLC) or ultra-performance liquid chromatography (UPLC) based techniques with an autosampler that draws samples from the reactor in a programmed manner and transfers them to the instrument is an on-line measurement method.

[0200] The identification and / or concentration of metabolites can be measured by any method known to those skilled in the art.Suitable methods for identifying and / or measuring the concentration of metabolites by online or offline methods include, for example, liquid chromatography, such as high performance liquid chromatography (HPLC), ultra-performance liquid chromatography (UPLC) or liquid chromatography-mass spectrometry (LCMS), nuclear magnetic resonance (NMR), or gas chromatography-mass spectrometry (GCMS).

[0201] In some embodiments, the identity and / or concentration of metabolites is measured offline by taking a sample of cell culture medium and measuring the concentration of said at least one metabolite in said sample. In some embodiments, the identity and / or concentration of metabolites is measured as disclosed in Example 2. A suitable method for measuring the identity and / or concentration of metabolites in an offline method is LCMS.

[0202] In some embodiments, the identification and / or concentration of the metabolites is measured online. In some embodiments, the identification and / or concentration of the metabolites is measured online using Raman spectroscopy. In some embodiments, the identification and / or concentration of the metabolites is measured online using Raman spectroscopy as disclosed in Example 7. In some embodiments, the identification and / or concentration of the metabolites is measured online using HPLC or UPLC-based techniques with an autosampler that pulls samples from the reactor in a programmed manner and transfers them to the device. Identifying the metabolites includes determining the presence and / or identity of the metabolites.

[0203] Improved cell growth and productivity In some embodiments of the above-described methods, cell proliferation and / or productivity is increased compared to a control culture, which is identical except that it does not include steps (ii) and / or (iii) and / or does not include modified cells or cells produced by the method of producing cells, i.e., the cells are unmodified.

[0204] In some embodiments of the methods described above, the methods of the invention are methods for improving cell growth. In some embodiments, the methods of the invention are methods for improving cell growth in high density cell cultures at high cell densities.

[0205] High cell density, as used herein, is defined as 1×10 6 cells / mL, 5×10 6 cells / mL, 1×10 7 cells / mL, 5×10 7 cells / mL, 1×10 8 cells / mL or 5 x 10 8 >1x10 cells / mL, preferably 1x10 7 More than 5 x 10 cells / mL, more preferably 7 Refers to cell density in > cells / mL.

[0206] In some embodiments, the methods described above are performed at a cell density of 1×10 6 cells / mL, 5×106 cells / mL, 1×10 7 cells / mL, 5×10 7 cells / mL, 1×10 8 cells / mL, or 5 x 10 8 In some embodiments, the method is for improving cell growth in cell cultures where the maximum cell density is greater than 1×10 6 cells / mL, 5×10 6 cells / mL, 1×10 7 cells / mL, 5×10 7 cells / mL, 1×10 8 cells / mL, or 5 x 10 8 This is to improve cell growth in cell cultures with > 100 cells / mL.

[0207] In some embodiments, cell proliferation is determined by viable cell density (VCD), maximum viable cell density, or integrated viable cell count (IVCC). In some embodiments, cell proliferation is determined by maximum viable cell density.

[0208] The term "viable cell density" as used herein refers to the number of cells present in a given volume of medium. Viable cell density can be measured by any method known to those skilled in the art. Preferably, viable cell density is measured using an automated cell counter such as Bioprofile Flex®. The term maximum cell density as used herein refers to the maximum cell density achieved during cell culture. The term "cell viability" as used herein refers to the ability of cells in culture to survive under a given set of culture conditions or experimental variations. Those skilled in the art will appreciate that one of many methods for determining cell viability are encompassed in the present invention. For example, a dye (e.g., trypan blue) can be used to determine cell viability, which does not pass through the membrane of live cells, but can pass through the disrupted membrane of dead or dying cells.

[0209] The term "integrated viable cell count (IVCC)" as used herein refers to the area under the viable cell density (VCD) curve. IVCC can be calculated using the following formula: IVCC t+1 =IVCC t +(VCD t +VCD t+1 )*(Δt) / 2 where Δt is the time difference between time t and time t+1, and IVCC t=0 can be assumed to be negligible. t and VCDs t+1 is the viable cell density at time points t and t+1.

[0210] The term "titer" as used herein refers to the total amount of recombinantly expressed protein produced by, for example, a cell culture in a given amount of medium volume. Titer is typically expressed in grams of protein per liter of medium.

[0211] In some embodiments of the above-described methods, cell proliferation is increased by at least 5%, 10%, 15%, 20%, or 25% compared to a control culture. In some embodiments, cell proliferation is increased by at least 10% compared to a control culture. In some embodiments, cell proliferation is increased by at least 20% compared to a control culture.

[0212] In some embodiments of the methods described above, productivity is determined by titer and / or volumetric productivity.

[0213] The term "titer" as used herein refers to the total amount of recombinantly expressed protein produced by, for example, a cell culture in a given amount of medium volume. Titer is typically expressed in grams of protein per liter of medium.

[0214] In some embodiments of the above-mentioned methods, the productivity is determined by titer. In some embodiments, the productivity is increased by at least 5%, 10%, 15%, 20%, or 25% compared to a control culture. In some embodiments, the productivity is increased by at least 10% compared to a control culture. In some embodiments, the productivity is increased by at least 20% compared to a control culture.

[0215] In some embodiments of the above-described methods, the maximum cell density of the cell culture is 1×10 6 cells / mL, 5×10 6 cells / mL, 1×10 7 cells / mL, 5×10 7 cells / mL, 1×10 8 cells / mL, or 5 x 10 8 In some embodiments, the maximum cell density of the cell culture is greater than 5×10 6 In some embodiments, the maximum cell density of the cell culture is greater than 1×10 8 > cells / mL.

[0216] Cell culture media The terms "medium", "cell culture medium" and "culture medium" as used herein refer to a solution containing components or nutrients that nourish growing mammalian cells. Typically, the nutrients include essential and non-essential amino acids, vitamins, energy sources, lipids, and trace elements required by cells for minimal growth and / or survival. Such solutions also contain further nutrients or additional components that enhance growth and / or survival beyond the minimal proportions, including, but not limited to, hormones and / or other growth factors, specific ions (such as sodium, chloride, calcium, magnesium, and phosphate), buffers, vitamins, nucleosides or nucleotides, trace elements (inorganic compounds that are usually present at very low final concentrations), inorganic compounds (e.g., iron) that are present at high final concentrations, amino acids, lipids, and / or glucose, or other energy sources. In some embodiments, the medium is advantageously formulated to an optimal pH and salt concentration for cell survival and growth. In some embodiments, the medium is a feed medium that is added after the cell culture has begun.

[0217] A wide variety of mammalian growth media can be used according to the present invention. In some embodiments, cells are grown in one of a variety of chemically defined media, where the components of the media are both known and controlled. In some embodiments, cells can be grown in complex media, where not all components of the media are known and / or controlled.

[0218] Chemically defined growth media for mammalian cell culture have been extensively developed and published over the past several decades. All components of the defined media are well characterized, and the defined media do not contain complex additives, such as serum or hydrolysates. Early media formulations were developed to allow cell growth and viability maintenance with little or no interest in protein production. More recently, media formulations have been developed with the express purpose of supporting highly productive recombinant protein producing cell cultures. Such media are suitable for use in the methods of the present invention. Such media generally contain high amounts of nutrients, especially amino acids, to support cell growth and / or maintenance at high density. If necessary, these media can be modified by the skilled artisan for use in the methods of the present invention. For example, the skilled artisan can reduce the amount of phenylalanine, tyrosine, tryptophan, and / or methionine in these media for use as basal or feed media in the methods disclosed herein.

[0219] Not all components of a complex medium are fully characterized, and therefore a complex medium may contain additives such as simple and / or complex carbon sources, simple and / or complex nitrogen sources, and serum, among others. In some embodiments, a complex medium suitable for the present invention contains additives such as hydrolysates in addition to other components of the defined media described herein.

[0220] In some embodiments, a defined medium typically contains approximately 50 chemical entities or components at known concentrations in water. Most of these also contain one or more well-characterized proteins, such as insulin, IGF-1, transferrin, or BSA, but others do not require a protein component and are therefore referred to as protein-free defined media. Typical chemical components of media fall into five broad categories: amino acids, vitamins, inorganic salts, trace elements, and miscellaneous categories that do not lend themselves to neat classification.

[0221] Cell culture media may be supplemented with additional components. The term "additional components" as used herein refers to additional components that enhance growth and / or survival beyond the minimum ratio, including, but not limited to, hormones and / or other growth factors, specific ions (such as sodium, chloride, calcium, magnesium, and phosphate), buffers, vitamins, nucleosides or nucleotides, trace elements (inorganic compounds that are usually present at very low final concentrations), amino acids, lipids, and / or glucose, or other energy sources. In some embodiments, the additional components may be added to the initial cell culture medium. In some embodiments, the additional components may be added after cell culture has begun.

[0222] Typically, components that are trace elements refer to various inorganic salts that are included at micromolar or lower levels. For example, commonly included trace elements are zinc, selenium, copper, etc. In some embodiments, iron (ferrous or ferric salts) can be included as a trace element in the initial cell culture medium at micromolar concentrations. Manganese can be included as a trace element in the initial cell culture medium at nanomolar to micromolar concentrations, as can divalent cations (MnCl 2 or MnSO 4 ) are frequently included among the trace elements. Many less common trace elements are usually added in nanomolar concentrations.

[0223] In some embodiments, the medium used in the methods of the present invention is adapted to grow cells at high cell densities in cell culture, e.g., 1×10 6 cells / mL, 5×10 6 cells / mL, 1×10 7 cells / mL, 5×10 7 cells / mL, 1×10 8 cells / mL, or 5 x 10 8 It is a medium suitable for supporting cells / mL, etc. In some embodiments, the cell culture is a mammalian cell fed-batch culture, preferably a CHO cell fed-batch culture.

[0224] In some embodiments, the cell culture medium contains phenylalanine at a concentration of less than 2 mM, less than 1 mM, between 0.1 and 2 mM, between 0.1 and 1 mM, between 0.5 and 1.5 mM, or between 0.5-1 mM.

[0225] In some embodiments, the cell culture medium comprises tyrosine at a concentration of less than 2 mM, less than 1 mM, between 0.1 and 2 mM, between 0.1 and 1 mM, between 0.5 and 1.5 mM, or between 0.5 and 1 mM. In some embodiments, the cell culture medium does not comprise tyrosine. In some embodiments, the cell culture medium is HiPDOG medium, a medium used in the HiPDOG process but does not comprise tyrosine. In some embodiments, the cell culture medium is used in the HiPDOG culture or process that does not comprise tyrosine.

[0226] In some embodiments, the cell culture medium contains tryptophan at a concentration of less than 2 mM, less than 1 mM, between 0.1 and 2 mM, between 0.1 and 1 mM, between 0.5 and 1.5 mM, or between 0.5 and 1 mM.

[0227] In some embodiments, the cell culture medium comprises methionine at a concentration of less than 2 mM, less than 1 mM, between 0.1 and 2 mM, between 0.1 and 1 mM, between 0.5 and 1.5 mM, or between 0.5 and 1 mM.

[0228] In some embodiments, the cell culture medium comprises leucine at a concentration of less than 2 mM, less than 1 mM, between 0.1 and 2 mM, between 0.1 and 1 mM, between 0.5 and 1.5 mM, or between 0.5 and 1 mM.

[0229] In some embodiments, the cell culture medium comprises isoleucine at a concentration less than 2 mM, less than 1 mM, between 0.1 and 2 mM, between 0.1 and 1 mM, between 0.5 and 1.5 mM, or between 0.5 and 1 mM.

[0230] In some embodiments, the cell culture medium comprises valine at a concentration less than 2 mM, less than 1 mM, between 0.1 and 2 mM, between 0.1 and 1 mM, between 0.5 and 1.5 mM, or between 0.5 and 1 mM.

[0231] In some embodiments, the cell culture medium comprises serine at a concentration less than 2 mM, less than 1 mM, between 0.1 and 2 mM, between 0.1 and 1 mM, between 0.5 and 1.5 mM, or between 0.5 and 1 mM.

[0232] In some embodiments, the cell culture medium comprises threonine at a concentration of less than 2 mM, less than 1 mM, between 0.1 and 2 mM, between 0.1 and 1 mM, between 0.5 and 1.5 mM, or between 0.5 and 1 mM.

[0233] In some embodiments, the cell culture medium comprises glycine at a concentration of less than 2 mM, less than 1 mM, between 0.1 and 2 mM, between 0.1 and 1 mM, between 0.5 and 1.5 mM, or between 0.5 and 1 mM.

[0234] In some embodiments, the cell culture medium comprises two of phenylalanine, tyrosine, tryptophan, methionine, leucine, isoleucine, valine, serine, threonine, and glycine at a concentration of less than 2 mM, less than 1 mM, between 0.1 and 2 mM, between 0.1 and 1 mM, between 0.5 and 1.5 mM, or between 0.5 and 1 mM.

[0235] In some embodiments, the cell culture medium contains phenylalanine and tyrosine at a concentration of less than 2 mM, less than 1 mM, between 0.1 and 2 mM, between 0.1 and 1 mM, between 0.5 and 1.5 mM, or between 0.5 and 1 mM.

[0236] In some embodiments, the cell culture medium contains phenylalanine and tryptophan at a concentration of less than 2 mM, less than 1 mM, between 0.1 and 2 mM, between 0.1 and 1 mM, between 0.5 and 1.5 mM, or between 0.5 and 1 mM.

[0237] In some embodiments, the cell culture medium contains phenylalanine and methionine at a concentration of less than 2 mM, less than 1 mM, between 0.1 and 2 mM, between 0.1 and 1 mM, between 0.5 and 1.5 mM, or between 0.5 and 1 mM.

[0238] In some embodiments, the cell culture medium contains tyrosine and tryptophan at a concentration of less than 2 mM, less than 1 mM, between 0.1 and 2 mM, between 0.1 and 1 mM, between 0.5 and 1.5 mM, or between 0.5 and 1 mM.

[0239] In some embodiments, the cell culture medium comprises tyrosine and methionine at a concentration of less than 2 mM, less than 1 mM, between 0.1 and 2 mM, between 0.1 and 1 mM, between 0.5 and 1.5 mM, or between 0.5 and 1 mM.

[0240] In some embodiments, the cell culture medium contains tryptophan and methionine at a concentration of less than 2 mM, less than 1 mM, between 0.1 and 2 mM, between 0.1 and 1 mM, between 0.5 and 1.5 mM, or between 0.5 and 1 mM.

[0241] In some embodiments, the cell culture medium includes three of phenylalanine, tyrosine, tryptophan, methionine, leucine, serine, threonine, and glycine at concentrations less than 2 mM, less than 1 mM, between 0.1 and 2 mM, between 0.1 and 1 mM, between 0.5 and 1.5 mM, or between 0.5 and 1 mM.

[0242] In some embodiments, the cell culture medium contains phenylalanine, tyrosine, and tryptophan at a concentration of less than 2 mM, less than 1 mM, between 0.1 and 2 mM, between 0.1 and 1 mM, between 0.5 and 1.5 mM, or between 0.5 and 1 mM.

[0243] In some embodiments, the cell culture medium contains phenylalanine, tyrosine, and methionine at a concentration of less than 2 mM, less than 1 mM, between 0.1 and 2 mM, between 0.1 and 1 mM, between 0.5 and 1.5 mM, or between 0.5 and 1 mM.

[0244] In some embodiments, the cell culture medium contains phenylalanine, tryptophan, and methionine at a concentration of less than 2 mM, less than 1 mM, between 0.1 and 2 mM, between 0.1 and 1 mM, between 0.5 and 1.5 mM, or between 0.5 and 1 mM.

[0245] In some embodiments, the cell culture medium contains tyrosine, tryptophan, and methionine at a concentration of less than 2 mM, less than 1 mM, between 0.1 and 2 mM, between 0.1 and 1 mM, between 0.5 and 1.5 mM, or between 0.5 and 1 mM.

[0246] In some embodiments, the cell culture medium includes four of phenylalanine, tyrosine, tryptophan, methionine, leucine, isoleucine, valine, serine, threonine, and glycine at a concentration of less than 2 mM, less than 1 mM, between 0.1 and 2 mM, between 0.1 and 1 mM, between 0.5 and 1.5 mM, or between 0.5 and 1 mM.

[0247] In some embodiments, the cell culture medium comprises phenylalanine, tyrosine, tryptophan, and methionine at a concentration of less than 2 mM, less than 1 mM, between 0.1 and 2 mM, between 0.1 and 1 mM, between 0.5 and 1.5 mM, or between 0.5 and 1 mM.

[0248] In some embodiments, the cell culture medium includes five of phenylalanine, tyrosine, tryptophan, methionine, leucine, isoleucine, valine, serine, threonine, and glycine at a concentration of less than 2 mM, less than 1 mM, between 0.1 and 2 mM, between 0.1 and 1 mM, between 0.5 and 1.5 mM, or between 0.5 and 1 mM.

[0249] In some embodiments, the cell culture medium includes six of phenylalanine, tyrosine, tryptophan, methionine, leucine, isoleucine, valine, serine, threonine, and glycine at a concentration of less than 2 mM, less than 1 mM, between 0.1 and 2 mM, between 0.1 and 1 mM, between 0.5 and 1.5 mM, or between 0.5 and 1 mM.

[0250] In some embodiments, the cell culture medium includes seven of phenylalanine, tyrosine, tryptophan, methionine, leucine, isoleucine, valine, serine, threonine, and glycine at a concentration of less than 2 mM, less than 1 mM, between 0.1 and 2 mM, between 0.1 and 1 mM, between 0.5 and 1.5 mM, or between 0.5 and 1 mM.

[0251] In some embodiments, the cell culture medium comprises phenylalanine, tyrosine, tryptophan, methionine, leucine, isoleucine, valine, serine, threonine, and glycine at a concentration of less than 2 mM, less than 1 mM, between 0.1 and 2 mM, between 0.1 and 1 mM, between 0.5 and 1.5 mM, or between 0.5 and 1 mM.

[0252] In some embodiments, the cell culture medium further comprises at least one, two, three, four, five, six, seven, eight, or nine of glycine, proline, serine, threonine, lysine, arginine, histidine, aspartic acid, glutamic acid, and asparagine at a concentration of greater than 2 mM, 3 mM, 4 mM, 5 mM, 10 mM, 15 mM, preferably 2 mM.

[0253] In some embodiments, the cell culture medium further comprises at least five of glycine, proline, serine, threonine, lysine, arginine, histidine, aspartic acid, glutamic acid, and asparagine at a concentration of greater than 2 mM, 3 mM, 4 mM, 5 mM, 10 mM, 15 mM, preferably 2 mM.

[0254] In some embodiments, the cell culture medium further comprises glycine, proline, serine, threonine, lysine, arginine, histidine, aspartic acid, glutamic acid, and asparagine at concentrations greater than 2 mM, 3 mM, 4 mM, 5 mM, 10 mM, 15 mM, preferably 2 mM.

[0255] In some embodiments, the cell culture medium further comprises at least one, two, three, four, five, six, or seven of proline, lysine, arginine, histidine, aspartic acid, glutamic acid, and asparagine at a concentration of greater than 2 mM, 3 mM, 4 mM, 5 mM, 10 mM, 15 mM, preferably 2 mM.

[0256] In some embodiments, the cell culture medium further comprises at least five of proline, lysine, arginine, histidine, aspartic acid, glutamic acid, and asparagine at concentrations greater than 2 mM, 3 mM, 4 mM, 5 mM, 10 mM, 15 mM, preferably 2 mM.

[0257] In some embodiments, the cell culture medium further comprises proline, lysine, arginine, histidine, aspartic acid, glutamic acid, and asparagine at concentrations greater than 2 mM, 3 mM, 4 mM, 5 mM, 10 mM, 15 mM, preferably 2 mM.

[0258] In some embodiments, the cell culture medium comprises serine at a concentration greater than 3 mM, 5 mM, 7 mM, 10 mM, 15 mM, or 20 mM, preferably 10 mM.

[0259] In some embodiments, the cell culture medium comprises cysteine ​​at a concentration greater than 3 mM, 5 mM, 7 mM, 10 mM, 15 mM, or 20 mM, preferably 10 mM.

[0260] In some embodiments, the cell culture medium is for use in the methods disclosed herein. In some embodiments, the cell culture medium is used in the methods disclosed herein as a basal medium. In some embodiments, the cell culture medium is used in the methods disclosed herein as a feed medium.

[0261] Protein expression As discussed above, in many cases, cells will be selected or engineered to produce high levels of a desired product (e.g., a recombinant protein or antibody). Often, cells will be manipulated by hand to produce high levels of recombinant protein, for example, by the introduction of a gene encoding the protein of interest and / or the introduction of genetic control elements that regulate expression of that gene (whether endogenous or introduced).

[0262] A particular protein may have a detrimental effect on cell growth, cell viability, or some other property of the cell that ultimately limits the production of the protein of interest in some way. Even within a population of one particular type of cell engineered to express a specific protein, there will be variability within the cell population, resulting in certain individual cells growing better, producing more of the protein of interest, or producing proteins with higher activity levels (e.g., enzyme activity). In certain embodiments of the present invention, cell lines are empirically selected by experts for robust growth under the specific conditions selected for culturing the cells. In some embodiments, individual cells engineered to express a particular protein are selected for large-scale production based on cell growth, final cell density, percent cell viability, titer of expressed protein, or any combination of these, or any other condition that experts deem important.

[0263] Any protein that is expressible in a host cell can be produced according to the present teachings, by the method of the present invention, or by the cell of the present invention. The term "host cell" as used herein refers to a cell that has been manipulated by the present invention to produce a protein of interest as described herein. The protein can be expressed from a gene that is endogenous to the cell, or from a heterologous gene that has been introduced into the cell. The protein can be naturally occurring, or alternatively, can have a sequence that has been engineered or selected by the hand of man.

[0264] Proteins that may desirably be expressed by the present invention will often be selected based on interesting or useful biological or chemical activity. For example, the present invention may be used to express any pharma- ceutically or commercially relevant enzyme, receptor, antibody, hormone, regulator, antigen, binder, etc. In some embodiments, the protein expressed by the cells in culture is selected from an antibody or fragment thereof, a nanobody, a single domain antibody, a glycoprotein, a therapeutic protein, a growth factor, a clotting factor, a cytokine, a fusion protein, a pharmaceutical agent, a vaccine, an enzyme, or a Small Modular ImmunoPharmaceuticals™ (SMIPs). One of skill in the art will understand that any protein may be expressed by the present invention, or will be able to select a particular protein to be produced based on the particular needs of the artisan.

[0265] antibody In view of the large number of antibodies currently in use or under investigation as pharmaceutical or other commercial agents, production of antibodies is of particular interest according to the present invention. Antibodies are proteins that have the ability to specifically bind a particular antigen. Any antibody that can be expressed in a host cell can be produced by the present invention, can be produced by the method of the present invention, or can be produced by the cell of the present invention. In some embodiments, the expressed antibody is a monoclonal antibody.

[0266] In some embodiments, the monoclonal antibody is a chimeric antibody. A chimeric antibody contains amino acid fragments derived from more than one organism. A chimeric antibody molecule may contain antigen-binding domains from antibodies derived from, for example, mice, rats, or other species. Various techniques for producing chimeric antibodies have been described. See, for example, Morrison et al., Proc.Natl.Acad.Sci.USA 81, 6851 (1985); Takeda et al., Nature, 314, 452 (1985); Cabilly et al., U.S. Pat. No. 4,816,567; Boss et al., U.S. Pat. No. 4,816,397; Tanaguchi et al., European Patent Publication EP 171496; European Patent Publication 0173494, British Patent No. GB ​​2177096B.

[0267] In some embodiments, the monoclonal antibodies are human antibodies derived, for example, by the use of ribosome display or phage display libraries (see, e.g., Winter et al., U.S. Pat. No. 6,291,159 and Kawasaki, U.S. Pat. No. 5,658,754), or by the use of xenograft species in which the native antibody genes have been inactivated and functionally replaced with human antibody genes, while leaving other components of the natural immune system intact (see, e.g., Kucherlapati et al., U.S. Pat. No. 6,657,103).

[0268] In some embodiments, the monoclonal antibody is a humanized antibody. A humanized antibody is a chimeric antibody in which the majority of amino acid residues are derived from human antibodies, thus minimizing any potential immune response when delivered to a human subject. In a humanized antibody, the amino acid residues in the complementarity determining region are at least partially replaced with residues from a non-human species that confer the desired antigen specificity or affinity. Such modified immunoglobulin molecules can be produced by any of several techniques known in the art (e.g., Teng et al., Proc. Natl. Acad. Sci. USA, 80, 7308-7312 (1983); Kozbor et al., Immunology Today, 4, 7279 (1983); Olsson et al., Meth. Enzymol. 92, 3-16 (1982)), and are preferably produced according to the teachings of PCT Publication No. WO92 / 06193 or EP0239400, all of which are incorporated herein by reference). Humanized antibodies can be commercially produced, for example, by Scotgen Limited, 2 Holly Road, Twickenham, Middlesex, Great Britain. For further references, see Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-329 (1988); and Presta, Curr. Op. Struct. Biol., 2:593-596 (1992), all of which are incorporated herein by reference.

[0269] In some embodiments, the monoclonal, chimeric, or humanized antibodies described above may contain amino acid residues that do not naturally occur in any antibody in any species in nature. These foreign residues can be utilized to, for example, confer new or modified specificity, affinity, or effector function to the monoclonal, chimeric, or humanized antibody. In some embodiments, the antibodies described above may be conjugated to drugs of systemic drug therapy, such as toxins, low molecular weight cytotoxic drugs, biological response modifiers, and radionuclides (see, for example, Kunz et al., Calicheamicin derivative-carrier conjugates, US20040082764A1).

[0270] In general, the practitioner of the present invention will select the protein of interest and will know its exact amino acid sequence. Any given protein expressed by the present invention may have its own specific properties, may affect the cell density or viability of cultured cells, may be expressed at a lower level than another protein grown under the same culture conditions, and may have different biological activities depending on the exact culture conditions and steps performed. The practitioner of skill will be able to appropriately modify the steps and compositions used to produce a particular protein according to the teachings of the present invention to optimize cell growth and production and / or activity levels of any given expressed protein.

[0271] Introduction of genes for protein expression into host cells In general, the nucleic acid molecule introduced into the cell that encodes the protein desired to be expressed by the present invention can be introduced and expressed by the method of the present invention or into and by the cell of the present invention.Alternatively, the nucleic acid molecule can encode a gene product that induces the cell to express the desired protein.For example, the genetic material introduced can encode a transcription factor that activates the transcription of an endogenous or heterologous protein.Alternatively or additionally, the nucleic acid molecule introduced can increase the translation or stability of the protein expressed by the cell.

[0272] Suitable methods for introducing sufficient nucleic acid to achieve expression of a protein of interest into mammalian host cells are known in the art. See, for example, Gething et al., Nature, 293:620-625, 1981; Mantei et al., Nature, 281:40-46, 1979; Levinson et al., EP 117,060; and EP 117,058, each of which is incorporated herein by reference. For mammalian cells, common methods for introducing genetic material into mammalian cells include the calcium phosphate precipitation method of Graham and van der Erb (Virology, 52:456-457, 1978) or the lipofectamine™ (Gibco BRL) method of Hawley-Nelson (Focus 15:73, 1993). General aspects of mammalian cell host system transformation are described by Axel in U.S. Patent No. 4,399,216, issued August 16, 1983. For various techniques for introducing genetic material into mammalian cells, see Keown et al., Methods in Enzymology, 1989, Keown et al., Methods in Enzymology, 185:527-537, 1990, and Mansour et al., Nature, 336:348-352, 1988. Additional suitable methods for introducing nucleic acids include, for example, electroporation by BioRad™ utilized with a GenePulser XCell™ electroporator.

[0273] In some embodiments, the nucleic acid introduced is in the form of a naked nucleic acid molecule. For example, the nucleic acid molecule introduced into the cell may consist only of the nucleic acid encoding the protein and the necessary genetic control elements. Alternatively, the nucleic acid encoding the protein (including the necessary regulatory elements) may be contained within a plasmid vector. Non-limiting representative examples of vectors suitable for expressing proteins in mammalian cells include pCDNA1; pCD, see Okayama et al., Mol. Cell Biol. 5:1136-1142, 1985; pMClneo Poly-A, see Thomas et al., Cell, 51:503-512, 1987; baculovirus vectors such as pAC373 or pAC610; CDM8, see Seed, B., Nature, 329:840, 1987; and pMT2PC, see Kaufman et al., EMBO J. 6:187-195, 1987. Each of these is incorporated herein by reference in its entirety. In some embodiments, the nucleic acid molecule that is introduced into the cell is contained in a viral vector.For example, the nucleic acid that codes for a protein can be inserted into the viral genome (or a partial viral genome).The regulatory elements that direct the expression of the protein can be included with the nucleic acid that is inserted into the viral genome (i.e., linked to the gene that is inserted into the viral genome), or can be provided by the viral genome itself.

[0274] Naked DNA can be introduced into cells by forming a precipitate containing DNA and calcium phosphate. Alternatively, naked DNA can be introduced into cells by forming a mixture of DNA and DEAE-dextran and incubating with cells, or by incubating cells and DNA together in a suitable buffer and subjecting the cells to a high-voltage electric pulse (e.g., by electroporation). A further method for introducing naked DNA into cells is by mixing DNA with a liposome suspension containing cationic lipids. The DNA / liposome complex is then incubated with cells. Naked DNA can also be directly injected into cells, for example, by microinjection.

[0275] Alternatively, naked DNA can be introduced into cells by complexing the DNA to a cation, such as polylysine, which is coupled to a ligand for a cell surface receptor (see, e.g., Wu, G. and Wu, CHJ Biol. Chem. 263:14621, 1988; Wilson et al., J. Biol. Chem. 267:963-967, 1992; and U.S. Patent No. 5,166,320, each of which is incorporated herein by reference in its entirety). Binding of the DNA-ligand complex to the receptor promotes uptake of the DNA by receptor-mediated endocytosis.

[0276] The use of viral vectors containing specific nucleic acid sequences, for example cDNA coding proteins, is a common method for introducing nucleic acid sequences into cells. Infecting cells with viral vectors has the advantage that a large proportion of cells receive nucleic acid, which can eliminate the need to select cells that have received nucleic acid. Furthermore, the molecules encoded in viral vectors, for example by the cDNA contained in the viral vector, are generally expressed efficiently in cells that have absorbed viral vector nucleic acid.

[0277] Defective retroviruses have been well characterized for use in gene transfer for gene therapy purposes (for review, see Miller, AD, Blood, 76:271, 1990). Recombinant retroviruses can be constructed that have a nucleic acid encoding a protein of interest inserted into the retroviral genome. Additionally, portions of the retroviral genome can be removed to render the retroviral replication defective. Such replication-defective retroviruses can then be packaged into virions that can be used to infect target cells using helper viruses by standard techniques.

[0278] The genome of adenovirus can be manipulated so that it is inactivated in terms of its ability to encode and express a protein of interest and replicate in the normal lytic viral life cycle.See, for example, Berkner et al., BioTechniques, 6:616, 1988; Rosenfeld et al., Science, 252:431-434, 1991; and Rosenfeld et al., Cell, 68:143-155, 1992. Suitable adenovirus vectors derived from the adenovirus strain Ad type 5 dl324, or other strains of adenovirus (e.g., Ad2, Ad3, Ad7, etc.), are known to those skilled in the art. Recombinant adenoviruses are advantageous in that they do not require dividing cells to be efficient gene delivery vehicles and can be used to infect a wide variety of cell types, including airway epithelia (Rosenfeld et al., 1992, cited above), endothelial cells (Lemarchand et al., Proc. Natl. Acad. Sci. USA, 89:6482-6486, 1992), liver parenchymal cells (Herz and Gerard, Proc. Natl. Acad. Sci. USA, 90:2812-2816, 1993), and muscle cells (Quantin et al., Proc. Natl. Acad. Sci. USA, 89:2581-2584, 1992). Furthermore, the introduced adenoviral DNA (and the foreign DNA contained therein) does not integrate into the genome of the host cell, but remains episomal, thereby avoiding potential problems that may occur as a result of insertional mutagenesis in situations where the introduced DNA becomes integrated into the host genome (e.g., retroviral DNA). Furthermore, the carrying capacity of the adenoviral genome for foreign DNA is large (up to 8 kilobases) relative to other gene delivery vectors (Berkner et al., cited above; Haj-Ahmand and Graham, J. Virol., 57:267, 1986). Most replication-defective adenoviral vectors currently in use have been deleted for all or part of the viral E1 and E3 genes, and retain as much as 80% of the adenoviral genetic material.

[0279] Adeno-associated virus (AAV) is a naturally occurring defective virus that requires another virus, such as adenovirus or herpesvirus, as a helper virus for efficient replication and productive life cycle (for review, see Muzyczka et al., Curr. Topics in Micro. and Immunol., 158:97-129, 1992). It can integrate its DNA into non-dividing cells and is one of the few viruses that exhibits high frequencies of stable integration (see, e.g., Flotte et al., Am. J. Respir. Cell. Mol. Biol., 7:349-356, 1992; Samulski et al., J. Virol. 63:3822-3828, 1989; and McLaughlin et al., J. Virol., 62:1963-1973, 1989). Vectors containing as little as 300 base pairs of AAV can be packaged and can integrate. The space of exogenous DNA is limited to about 4.5 kb. AAV vectors such as those described by Tratschin et al. (Mol. Cell. Biol. 5:3251-3260, 1985) can be used to introduce DNA into cells. Various nucleic acids have been introduced into different cell types using AAV vectors (see, for example, Hermonat et al., Proc. Natl. Acad. Sci. USA, 81:6466-6470, 1984; Tratschin et al., Mol. Cell. Biol. 4:2072-2081, 1985; Wondisford et al., Mol. Endocrinol. 2:32-39, 1988; Tratschin et al., J. Virol. 51:611-619, 1984; and Flotte et al., J. Biol. Chem. 268:3781-3790, 1993).

[0280] When the method used to introduce nucleic acid molecules into a population of cells results in the modification of a large proportion of cells and the efficient expression of protein by the cells, the modified population of cells can be used without further isolation within the population or subcloning of individual cells.That is, there may be sufficient production of protein by the population of cells, so that the population can be used immediately to produce protein and seed cell culture without the need for further cell isolation.As an alternative, it may be desirable to isolate and expand a homogeneous population of cells from a few cells or a single cell that efficiently produces protein.

[0281] An alternative to introducing a nucleic acid molecule into a cell that encodes a protein of interest is that the introduced nucleic acid may encode another polypeptide or protein that induces or increases the level of expression of a protein endogenously produced by the cell. For example, a cell may be able to express a particular protein and fail to express it without additional treatment of the cell. Similarly, a cell may express an insufficient amount of a protein for a desired purpose. Thus, an agent that stimulates the expression of a protein of interest can be used to induce or increase the expression of that protein by the cell. For example, the introduced nucleic acid molecule may encode a transcription factor that activates or upregulates the transcription of the protein of interest. The expression of such a transcription factor in turn leads to the expression or more robust expression of the protein of interest.

[0282] In certain embodiments, the nucleic acid directing the expression of the protein is stably introduced into the host cell. In certain embodiments, the nucleic acid directing the expression of the protein is transiently introduced into the host cell. Those skilled in the art will be able to choose whether to stably or transiently introduce the nucleic acid into the cell based on experimental needs.

[0283] The gene encoding the protein of interest may be linked to one or more regulatory gene control elements.In certain embodiments, the gene control element directs the constitutive expression of the protein.In certain embodiments, the gene control element can be used that causes the gene encoding the protein of interest to be inducible.The use of an inducible gene control element (e.g., an inducible promoter) allows the modulation of the production of the protein in the cell. Non-limiting examples of inducible gene control elements potentially useful for use in eukaryotic cells include hormone regulatory elements (see, e.g., Mader, S. and White, JH, Proc. Natl. Acad. Sci. USA, 90:5603-5607, 1993), synthetic ligand regulatory elements (see, e.g., Spencer, DM et al., Science 262:1019-1024, 1993), and ionizing radiation regulatory elements (see, e.g., Manome, Y. et al., Biochemistry 32:10607-10613, 1993; Datta, R. et al., Proc. Natl. Acad. Sci. USA 89:10149-10153, 1992). Additional cell-specific or other regulatory systems known in the art may be used in accordance with the present invention.

[0284] Those skilled in the art can select and appropriately modify the method for introducing genes into cells that express a protein of interest according to the teachings of the present invention.

[0285] Isolation of expressed protein In general, it will typically be desirable to isolate and / or purify the proteins expressed by the present invention. In certain embodiments, the expressed proteins are secreted into the culture medium, so that cells and other solids can be removed, for example, by centrifugation or filtration as a first step in the purification process.

[0286] Alternatively, expressed protein can be bound to the surface of host cell.For example, medium can be removed, and host cell expressing protein is dissolved as the first step in purification method.Lysis of mammalian host cell can be achieved by any number of means well known to those skilled in the art, including physical disruption by glass beads and exposure to high pH conditions.

[0287] The expressed protein can be isolated and purified by standard methods including, but not limited to, chromatography (e.g., ion exchange, affinity, size exclusion, and hydroxyapatite chromatography), gel filtration, centrifugation, or differential solubility, ethanol precipitation, and / or by any other available technique for purifying proteins (see, e.g., Scopes, Protein Purification Principles and Practice, 2nd ed., Springer-Verlag, New York, 1987; Higgins, SJ and Hames, BD (eds.), Protein Expression: A Practical Approach, Oxford Univ Press, 1999; and Deutscher, MP, Simon, MI, Abelson, JN (eds.), Guide to Protein Purification: Methods in Enzymology (Methods in Enzymology Series, Vol. 182), Academic Press, 1997, each of which is incorporated herein by reference). For immunoaffinity chromatography, in particular, a protein can be isolated by binding it to an affinity-column containing an antibody raised against the protein and attached to a solid support. Alternatively, affinity tags, such as influenza coat sequence, poly-histidine, or glutathione-S-transferase, can be attached to the protein by standard recombinant techniques to allow easy purification by passing over an appropriate affinity column. Protease inhibitors, such as phenylmethylsulfonyl fluoride (PMSF), leupeptin, pepstatin, or aprotinin, may be added at any and all stages to reduce or eliminate protein degradation during the purification method. Protease inhibitors are particularly advantageous, especially when the expressed protein must be dissolved in order to be isolated and purified.

[0288] One of skill in the art will appreciate that the exact purification technique will vary depending on the characteristics of the protein being purified, the characteristics of the cells in which the protein is expressed, and / or the composition of the medium in which the cells are grown.

[0289] Pharmaceutical preparations In certain preferred embodiments of the invention, the polypeptide or protein produced will have pharmacological activity and will be useful in the preparation of pharmaceuticals. The inventive compositions described above can be administered to a subject or initially formulated for delivery by any available route, including but not limited to parenteral (e.g., intravenous), intradermal, subcutaneous, oral, nasal, bronchial, ocular, transdermal (topical), transmucosal, rectal, and vaginal routes. Pharmaceutical compositions of the invention typically include purified polypeptides or proteins expressed from mammalian cell lines, delivery agents (i.e., cationic polymers, peptide molecular transporters, surfactants, etc., as described above), in combination with a pharmaceutically acceptable carrier. As used herein, the phrase "pharmaceutically acceptable carrier" includes solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, etc., compatible with pharmaceutical administration. Additional active compounds may also be incorporated into the composition.

[0290] A pharmaceutical composition is formulated to suit its intended route of administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous applications may contain the following components: a sterile diluent, such as water for injection, saline, fixed oils, polyethylene glycol, glycerin, propylene glycol, or other synthetic solvents; antibacterial agents, such as benzyl alcohol or methylparaben; antioxidants, such as ascorbic acid or sodium bisulfite; chelating agents, such as ethylenediaminetetraacetic acid; buffers, such as acetate, citric acid, or phosphate, and agents for adjusting tonicity, such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. Parenteral preparations can be sealed in glass or plastic ampoules, disposable syringes, or multiple dose vials.

[0291] Pharmaceutical compositions suitable for injectable use typically include sterile aqueous solutions (if water soluble) or dispersions and sterile powders for extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, NJ), or phosphate buffered saline (PBS). In all cases, the composition should be sterile and fluid to the extent that easy syringability exists. Suitable pharmaceutical preparations must be stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms such as bacteria and fungi. In general, relevant carriers can be solvents or dispersion media containing, for example, water, ethanol, polyols (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by maintaining the required particle size in the case of dispersions, and by the use of surfactants. Prevention of microbial action can be achieved by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, etc. In many cases, it will be preferable to include isotonic agents in the composition, such as sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride. Prolonged absorption of injectable compositions can be achieved by including in the composition an agent that delays absorption, such as aluminum monostearate and gelatin.

[0292] Sterile injectable solution can be prepared by incorporating purified polypeptide or protein in the required amount in suitable solvent with one or combination of the above-listed components, and then sterilizing by filtration if necessary.Generally, dispersion is prepared by incorporating purified polypeptide or protein expressed from mammalian cell line into a sterile vehicle that contains basic dispersion medium and other components required from the above-listed ones.In the case of sterile powder for preparing sterile injectable solution, the preferred method of preparation is vacuum drying and freeze-drying, which produces powder of active ingredient + any additional desired components from these solutions that have been previously sterilized and filtered.

[0293] Oral compositions generally contain an inert diluent or edible carrier. For the purpose of oral therapeutic administration, purified polypeptide or protein can be incorporated with excipients and used in the form of tablets, troches, or capsules, for example, gelatin capsules. Oral compositions can also be prepared using fluid carriers for use as mouthwash. Pharmaceutically compatible binding agents and / or adjuvant materials can be included as part of the composition. Tablets, pills, capsules, troches, etc. can contain any of the following ingredients, or compounds of similar nature: binders, such as microcrystalline cellulose, tragacanth gum, or gelatin; excipients, such as starch or lactose; disintegrants, such as alginic acid, primogel, or corn starch; lubricants, such as magnesium stearate or sterotes; glidants, such as colloidal silicon dioxide; sweeteners, such as sucrose or saccharin; or flavorings, such as peppermint, methyl salicylate, or orange flavoring. Formulations for oral delivery may advantageously incorporate agents that improve stability within the gastrointestinal tract and / or enhance absorption.

[0294] For administration by inhalation, the composition of the present invention comprising the purified polypeptide or protein expressed from a mammalian cell line and a delivery agent is preferably delivered in the form of an aerosol spray from a pressurized container or dispenser containing a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer. The present invention specifically contemplates delivery of the composition using a nasal spray, inhaler, or other direct delivery to the upper and / or lower respiratory tract. Intranasal administration of a DNA vaccine directed against influenza virus has been shown to induce a CD8 T cell response, indicating that at least some cells in the respiratory tract can absorb DNA when delivered by this route, and the delivery agent of the present invention will enhance cellular uptake. According to certain embodiments of the present invention, the composition comprising the purified polypeptide expressed from a mammalian cell line and a delivery agent is formulated as a large porous particle for aerosol administration.

[0295] Systemic administration may be by transmucosal or transdermal means.For transmucosal or transdermal administration, a penetrant suitable for the barrier to be permeated is used in the formulation.Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives.Transmucosal administration can be achieved by using nasal sprays or suppositories.For transdermal administration, purified polypeptide or protein and delivery agent are formulated into ointments, salves, gels, or creams generally known in the art.

[0296] The compositions can also be prepared in the form of suppositories (eg, with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.

[0297] In some embodiments, the compositions are prepared with carriers that protect the polypeptide or protein against rapid elimination from the body, such as controlled release formulations, including implants and microencapsulated delivery systems. Biodegradable biocompatible polymers, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactates, can be used. Methods for preparing such formulations will be apparent to those skilled in the art. Materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions, including liposomes targeted to infected cells that contain monoclonal antibodies against viral antigens, can also be used as pharma-ceutically acceptable carriers. These can also be prepared by methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.

[0298] It is advantageous to prepare oral or parenteral composition in unit dosage form for ease of administration and uniformity of dosage.Unit dosage form herein refers to a physically separate unit suitable as a unit dosage for the subject to be treated; each unit contains a predetermined amount of active polypeptide or protein calculated to produce desired therapeutic effect in association with required pharmaceutical carrier.

[0299] The polypeptide or protein expressed by the present invention can be administered at various intervals and for different periods of time as needed, for example, once a week for about 1-10 weeks, for 2-8 weeks, for about 3-7 weeks, for about 4, 5, or 6 weeks, etc. One skilled in the art will appreciate that certain factors may affect the dosage and timing required to effectively treat a subject, including, but not limited to, the severity of the disease or disorder, previous treatments, the overall health and / or age of the subject, and other diseases present. In general, treatment of a subject with a polypeptide or protein described herein may include a single treatment, or in many cases, may include a series of treatments. It is further understood that the appropriate dose may depend on the potency of the polypeptide or protein and may be tailored to the particular recipient, for example, by administration of increasing doses until a preselected desired response is achieved. It is understood that the specific dose level for any particular animal subject may depend on a variety of factors, including the activity of the specific polypeptide or protein used, the age, weight, overall health, sex, and diet of the subject, the time of administration, the route of administration, the excretion rate, any drug combinations, the degree of expression or activity being modulated.

[0300] The present invention includes the use of the composition to treat non-human animals. Thus, the dosage and method of administration can be selected according to known principles of veterinary pharmacology and medicine. Guidance can be found, for example, in Adams, R. (ed.), Veterinary Pharmacology and Therapeutics, 8th edition, Iowa State University Press; ISBN: 0813817439; 2001.

[0301] The pharmaceutical compositions can be included in a container, pack, or dispenser together with instructions for administration.

[0302] The following examples are provided for illustrative purposes only and are not intended to limit the scope of the present invention in any way. Indeed, various modifications of the present invention in addition to those shown and described herein will become apparent to those skilled in the art from the above description and fall within the scope of the appended claims. The contents of all figures and all references, patents, and published patent applications cited throughout this application are expressly incorporated herein by reference. EXAMPLES

[0303] Example 1 Identification of metabolic by-products that accumulate during fed-batch culture and have inhibitory effects on mammalian cell growth in culture the goal: This experiment was carried out to identify major growth inhibitors (metabolic by-products) that accumulate in glucose-limited and conventional fed-batch cultures of mammalian cells using a comprehensive metabolite profiling approach.

[0304] material and method: Cells and media CHO containing the glutamine synthetase expression system (commercially available from Lonza) (hereafter GS-CHO, cell line A) was used in this experiment expressing recombinant antibodies. Two types of media were used in this experiment. The first medium is "Medium A", which is used for inoculation of the experiment on day 0 of the culture. The second medium is "Medium B", which is an enriched nutrient medium used as a feed medium for the conventional and HIPDOG fed-batch processes for the culture (described in the next section).

[0305] Medium A is an enriched version of Insulin-Free Medium 9 (US7294484, Table 14) with slight variations in the concentrations of sodium bicarbonate and potassium chloride and containing Pluronic F68 instead of polyvinyl alcohol. It was enriched by adding 10% Glutamine-Free Medium 5 (US7294484, Table 7) and further increasing the concentrations of eight amino acids (Glu, Tyr, Gly, Phe, Pro, Thr, Trp, and Val). The concentrations of the amino acids are listed below in Table 1.

[0306] [Table 1]

[0307] Medium B has the same composition as medium 5 (US7294484, Table 7), but contains higher levels of amino acids (2.5-fold). The concentrations of amino acids in medium B are shown in Table 2.

[0308] [Table 2]

[0309] Bioreactor setup Two conditions were used, including a conventional fed-batch process and a glucose-limited fed-batch process. In the glucose-limited fed-batch process (hereafter referred to as HIPDOG culture), glucose was limited using HIPDOG technology (Gagnon et al., 2011). The pH deadband used was 7.025 + / - 0.025 while the HIPDOG control was available.

[0310] The conventional process was identical to the HIPDOG process / culture in terms of the targeted inoculation cell density (1E6 cells / mL), the medium used, the culture volume (1 L), the amount of feed added daily to the culture, and process parameters including temperature (36.5 °C), pH (6.9-7.2), and agitation speed (267 rpm). The two cultures only differed in their glucose levels. In the conventional culture, glucose was maintained above 2 g / L between days 2 and 5, whereas in the HIPDOG culture, glucose was naturally consumed by the cells until the glucose level dropped to a point where the cells also started to consume lactate (observed by a slight increase in the pH of the culture) and the HIPDOG technique / feeding strategy was initiated. After day 5, glucose levels in both conditions were maintained at concentrations above 2 g / L by feeding glucose on demand and were treated similarly until day 12. Viable cell density, lactate, and ammonia concentrations in the cell culture medium were measured daily for both conditions. The basal medium used was medium A and the feed medium used was medium B.

[0311] For metabolomic analysis, spent medium samples and cell pellet samples were collected and analyzed from duplicate reactor runs and performed for each condition. Time points considered for analysis included days 0, 2, 3, 5, 7, 9, and 10. The metabolomic approaches used assessed the relative levels of metabolites at different time points of the culture using NMR (groups 4 and 5 in Table 3), LC / MS and GC / MS (groups 1-3 in Table 3) techniques. Details of sample preparation and type of equipment / methods used for NMR, LC / MS, and GC / MS analysis are described below. The relative levels (fold changes) of all metabolites were measured and calculated. Relative levels were determined in both spent medium and cell pellet samples and these were calculated based on fold changes compared to the level of the metabolite when first detected. Fold changes were used to identify metabolites that had accumulated to very high levels by day 7 in HIPDOG and conventional fed-batch cultures.

[0312] Methods of metabolomic analysis Liquid / gas chromatography with mass spectrometry Sample preparation was performed using methanol extraction to remove the protein fraction while allowing maximum recovery of small molecules. The resulting extract was dried under vacuum and used subsequently for sample preparation for the appropriate instrument, LC / MS or GC / MS.

[0313] The LC / MS part of the platform was based on a Waters ACQUITY UPLC and Thermo-Finnigan LTQ mass spectrometer, which consisted of an electrospray ionization (ESI) source and a linear ion trap (LIT) mass analyzer. Samples were analyzed independently in both positive and negative ion modes. For positive ion mode, samples were reconstituted under acidic conditions and gradient eluted using water and methanol, both containing 0.1% formic acid, while for negative ion mode, samples were reconstituted in a basic extract containing 6.5 mM ammonium bicarbonate, also using water / methanol for gradient elution. MS analysis was performed using dynamic exclusion with MS scans and data-dependent MS 2 The scans were alternated.

[0314] Samples destined for GC / MS analysis were redried in a vacuum oven for a minimum of 24 h and then derivatized under dry nitrogen using bistrimethyl-silyl-trifluoroacetamide (BSTFA). The GC column was 5% phenyl. The temperature ramp was 40 °C to 300 °C over a period of 16 min. Samples were analyzed on a Thermo-Finnigan Trace DSQ fast scanning single quadrupole mass spectrometer using electron impact ionization. The instrument was frequently tuned and calibrated for mass resolution and mass accuracy.

[0315] Data was extracted from the raw mass spectral data files and peaks were identified. Peaks were subsequently annotated and quantified (arbitrary intensity values) with compound information by comparison to library entities of purified standards or repetitive unknown entities. The combination of chromatographic properties and mass spectra provided an indication of match to a specific compound or isobaric entity.

[0316] NMR sample preparation, data acquisition and processing 1000 μL of each sample was filtered using Nanosep 3K Omega microcentrifuge filter tubes for 60 min, and 630 μL of the filtered sample was used for NMR analysis. These filters were preserved in glycerol, so some traces of glycerol may appear in the analysis. An internal standard solution was added to each sample solution, and the resulting mixture was vortexed for 30 seconds. 700 μL of the centrifuged solution was transferred to an NMR tube, and data was acquired.

[0317] NMR spectra were acquired on a Varian 4-channel VNMRS 700MHz NMR spectrometer equipped with an autotuned cryogenically cooled 1H / 13C triple resonance biomolecular probe. The pulse sequence used was 1D-tnnoesy with 990ms presaturation for water and 4s acquisition time. Spectra were collected at 298K using 32 transient and 4 steady-state scans.

[0318] Spectra were processed and .cnx files were generated using the Processor module of Chenomx NMR Suite 8.0. Compounds were identified and quantified using the Profiler module of Chenomx NMR Suite 8.0 with the Chenomx Compound Library version 9, which contains 332 compounds. For reporting purposes, profiled concentrations were corrected to reflect the composition of the original sample instead of the contents of the NMR tube. During sample preparation, each sample was diluted by introducing an internal standard to increase the analysis volume of small samples, if necessary.

[0319] result: Initially the cells grew exponentially in both conventional and HIPDOG cultures, achieving peak cell densities on days 6 and 7, respectively, with the HIPDOG culture peaking at a much higher cell density (Figure 1). Lactate levels in the HIPDOG process / culture remained low due to the application of the HIPDOG control (between days 2 and 5), whereas lactate levels accumulated to very high levels in the case of conventional fed-batch culture. Ammonia was also maintained at low levels during conventional and HIPDOG cultures by the use of cells containing the glutamine synthetase expression system. The titer (amount of protein of interest per liter of cell culture medium) was measured at the end of the culture (day 12). The HIPDOG culture achieved a higher titer compared to the conventional process. The differences in cell density and titer value are likely the product of the differences in lactate accumulation observed between the two cultures.

[0320] Metabolites that accumulated at high levels on day 7 of HIPDOG culture were identified based on fold changes measured using a global metabolite profiling technique. For each of the above identified metabolites, the concentration at which the metabolite negatively affected cell growth was determined by spike-in experiments using purified compounds (see Example 3). The results of these experiments were used to narrow the list of putative novel inhibitors. A total of nine inhibitors were identified by this process. A list of the nine metabolites identified as potential inhibitors and their potential metabolic sources in the cell culture medium is reported in Table 3.

[0321] [Table 3]

[0322] Example 2 Example 2: Determination of the concentration of putative inhibitors that accumulate at late stages in HIPDOG fed-batch cultures the goal: This experiment was performed to assess the concentration of a newly identified putative growth inhibitor (metabolic by-product) at different time points in HIPDOG fed-batch cultures of GS-CHO cells.

[0323] material and method: The experimental setup is the same as that defined in Example 1. Quantification was performed by LC / MS and GC / MS methods for the metabolites in the first two groups of Table 3, and NMR technology was used for the quantification of the metabolites in groups 4 and 5. For the first two groups of metabolites listed in the Metabolite column of Table 3, purified compounds were obtained commercially, and solutions of these compounds with known concentrations were prepared using medium A as the base solvent. Using the same LC / MS and GC / MS global metabolite profiling approach used for inhibitor identification and relative quantification (see Example 1), independent calibration curves were prepared for the four metabolites. These calibration curves are mathematical correlations of the actual amounts of metabolites used in the LC / MS and GS / MS techniques with the intensity values ​​generated by these techniques. The correlations were subsequently used with the intensity values ​​generated in Example 1 to calculate the concentrations of the metabolites at different time points in the culture.

[0324] result: The concentrations of the newly identified metabolites from the first two groups in Table 3 were determined using the drawn calibration curves, and the concentrations of the metabolites listed in groups 4 and 5 were determined by NMR techniques as discussed in the Materials and Methods section of Example 1. The concentrations of six putative inhibitors (phenyllactate, 3-(4-hydroxyphenyl)lactate, 4-hydroxyphenylpyruvate, indole lactate, isovalerate, and formate) on day 7 of the HIPDOG fed-batch culture are listed in Table 4.

[0325] [Table 4]

[0326] Example 3 Experiments to establish the growth inhibitory effect of identified putative inhibitors at concentrations detected on day 7 of HIPDOG fed-batch culture the goal: This experiment was performed to assess the effect of newly identified putative inhibitors on the proliferation of GS-CHO cells in culture at concentrations determined on day 7 of HiPDOG culture. The independent effects of nine metabolites (phenyllactate, 3-(4-hydroxyphenyl)lactate, 4-hydroxyphenylpyruvate, indolactate, indolecarboxylic acid, homocysteine, 2-hydroxybutyrate, isovalerate, and formate) on cell proliferation were first tested. Subsequently, the synergistic effect of four metabolites (phenyllactate, 3-(4-hydroxyphenyl)lactate, 4-hydroxyphenylpyruvate, and indolactate) on cell proliferation was tested.

[0327] material and method: GS-CHO cells producing recombinant antibodies were seeded at low viable cell density (0.1E6 cells / mL) in 5 ml volume, 6-well plate cultures under various conditions, including fresh medium A or fresh medium A spiked in with four putative inhibitors (0.2 mM phenyllactate, 0.38 mM 3-(4-hydroxyphenyl)lactate, 0.08 mM 4-hydroxyphenylpyruvate, 0.26 mM indole lactate) at concentrations detected on day 7 of HIPDOG culture in Example 1. In a separate experiment, GS-CHO cells producing recombinant antibodies were inoculated at low viable cell density in fresh medium A spiked with different concentrations of nine inhibitors (indole carboxylic acid, homocysteine, 2-hydroxybutyrate, phenyllactate, 3-(4-hydroxyphenyl)lactate, 4-hydroxyphenylpyruvate, indole lactate, isovalerate, and formate), one inhibitor per condition. The pH of medium A spiked with any one of the nine metabolites or any combination of the nine metabolites was adjusted to 7 before inoculating the cells (day 0). The concentrations tested were: - Indole carboxylic acid: 0, 0.5, and 1 mM - Homocysteine: 0, 0.5, and 1 mM - 2-hydroxybutyric acid: 0, 1, and 5 mM - Phenyllactate: 0, 1, and 5 mM - 3-(4-hydroxyphenyl)lactate: 0, 0.1, 0.3, 0.5, 1, and 5 mM - 4-hydroxyphenylpyruvate: 0, 0.05, 0.1, and 0.25 mM - Indole lactate: 0, 1, and 3 mM - Isovalerate: 0, 1, 2.5, and 5 mM - Formate: 0, 2, 4, and 6 mM For indole lactate, a stock solution (500 mM) was prepared in DMSO. Thus, a pure DMSO spike-in condition ("DMSO cont" or DMSO control) was included with every concentration of indole lactate tested to control for the effect of DMSO on cell growth. All conditions were performed in duplicate or triplicate. Cell growth in the above conditions was monitored for 5 or 6 days.

[0328] result: The independent effects of all nine inhibitors on the proliferation of GS-CHO cells were investigated (Figures 2, 3, 4, and 5). Indole carboxylic acid and 4-hydroxyphenylpyruvate were observed to have a strong negative effect on the proliferation of cells at 1 mM or lower concentrations. Moderate inhibition of proliferation was observed when GS-CHO cells were exposed to homocysteine, 2-hydroxybutyrate, or 3-(4-hydroxyphenyl)lactate at concentrations higher than 0.5 mM or 1 mM. L-phenyllactate had a mild effect on the proliferation of cells at a concentration of 1 mM. Indole lactate showed little or no effect on the proliferation of cells at concentrations of 3 mM or less. Formate had a negative effect on proliferation at concentrations of 2 mM and above. Isovalerate had a significant negative effect on the proliferation of cells at concentrations above 1 mM.

[0329] Earlier experiments showed that the concentration at which cell growth was inhibited was much higher when each of the nine putative inhibitors was added independently than the concentration observed on day 7 of HIPDOG fed-batch culture. Therefore, the effect of these inhibitors when treated in combination was subsequently investigated. Interestingly, treatment of cells with a combination of four of the nine metabolites [phenyllactate, 4-hydroxyphenylpyruvate, 3-(4-hydroxyphenyl)lactate, and indolactate] at concentrations detected on day 7 of HIPDOG culture significantly inhibited cell growth when compared to cell growth in fresh medium (Figure 6). This data indicates that more than four metabolites act in a synergistic manner to inhibit cell growth. The nine metabolites mentioned above are by-products of phenylalanine, tyrosine, tryptophan, leucine, serine, threonine, methionine, and glycine metabolism. Identifying the enzymes in these pathways that contribute to the biosynthesis of the inhibitors provides strategies to genetically modify cells to suppress their production by genetic engineering.

[0330] These four metabolites are by-products of phenylalanine, tyrosine, and tryptophan metabolism, so reducing the concentrations of these precursor amino acids during culture can limit the formation of the corresponding inhibitory metabolites.In addition, methionine metabolites (homocysteine ​​and 2-hydroxybutyrate), as well as leucine, serine, threonine, and glycine metabolites (isovalerate and formate) also have negative effects on cell proliferation, so reducing methionine, leucine, serine, threonine, and glycine levels during culture can potentially limit the formation of these metabolites and promote cell proliferation.

[0331] Example 4 Reducing the growth-suppressive effect of a newly identified inhibitor by a nutrient-limiting strategy in fed-batch cultures the goal: This experiment was carried out to reduce the formation of the newly identified inhibitors by limiting the supply of carbon sources responsible for their biosynthesis, and the goal of this experiment was to assess whether such reduction in inhibitor formation would alleviate growth inhibition at later stages of culture and result in an increase in maximum viable cell density in fed-batch cultures.

[0332] material and method: Cells and bioreactor setup GS-CHO cells expressing a recombinant antibody (cell line A) were used in this experiment. Two conditions were tested as part of this experiment: A) HIPDOG fed-batch culture with low levels of the four amino acids (tyrosine, methionine, phenylalanine, and tryptophan) (low AA condition), B) HIPDOG fed-batch culture with normal amino acid concentrations (control HIPDOG condition / culture). Exponentially growing cells from the seed culture were added to each production bioreactor at 1 × 10 6 Cells / mL were inoculated into the culture. For both conditions, the HIPDOG strategy was operated between days 2 and 7 of culture. In the low amino acid condition, the concentrations of tyrosine, tryptophan, phenylalanine, and methionine were maintained between 0.5 mM and 1 mM for the first 7 days of culture, after which they were adjusted to the levels of these respective amino acids in the control HIPDOG condition. After day 7, both conditions were treated identically. Viable cell density, lactate, ammonia, and amino acid concentrations were measured daily (amino acids were measured only during the first 7 days). For both conditions, the targeted inoculation viable cell density (1 × 10 6The process parameters including temperature (36.5 °C), pH (6.9-7.2), and agitation speed (267 rpm) were identical, as well as the number of cells / mL and culture volume (1 L). The basal medium used in the control HIPDOG condition was medium A, and the one used in the low AA condition was an improved version of medium A with low concentrations of the four amino acids (approximately 0.6 mM tyrosine, tryptophan, phenylalanine, and methionine). The feed medium used for the control HIPDOG culture was medium B. For the low AA condition, the original medium B or an improved version of medium B with higher concentrations of the four amino acids (tyrosine, tryptophan, methionine, and phenylalanine) were formulated and used as the feed medium (60% higher for methionine and approximately 100% higher levels for tyrosine, tryptophan, and phenylalanine compared to the original feed medium B). The levels of the four amino acids in the improved version of medium B were constructed based on the cell-specific consumption rates of the four amino acids for cell line A in the HIPDOG process of culture and the feeding schedule determined in advance. The amino acid concentrations were measured daily using a UPLC based amino acid method, which is described in more detail below. Based on the levels of amino acids at a given sampling point and the feeding schedule, one of the two types of medium B (original or higher concentration) was selected as the feed medium until the next sampling point such that the concentrations of the four amino acids were between 0.5 and 1 mM at the next sampling point.

[0333] Amino acid analysis Ten microliters of standard amino acid mix solution or spent medium sample (10-fold diluted sample) was mixed with 70 μL of AccQ·Tag Ultra Borate Buffer (Waters UPLC AAA H-Class Applications Kit [176002983]) and 20 μL of AccQ·Tag reagent previously dissolved in 1.0 mL of AccQ·Tag Ultra Reagent Diluent was added. The reaction was allowed to proceed for 10 min at 55 °C. Liquid chromatographic analysis was performed on a Waters Acquity UPLC system equipped with a binary solvent manager, autosampler, column heater, and PDA detector. The separation column was a Waters AccQ·Tag Ultra column (2.1 mm id × 100 mm, 1.7 μm particles). The column heater was set at 55 °C and the mobile phase flow rate was maintained at 0.7 mL / min. Eluent A was 10% AccQ·Tag Ultra concentrated solvent A and eluent B was 100% AccQ·Tag Ultra solvent B. The nonlinear separation gradient was 0–0.54 min (99.9% A), 5.74 min (90.0% A), 7.74 min (78.8% A), 8.04–8.64 min (40.4% A), and 8.73–10 min (99.9% A). One microliter of sample was injected for analysis. The PDA detector was set at 260 nm. The elution times previously determined for the amino acids were used to identify specific amino acid peaks on the chromatograms of each sample. Amino acid concentrations were estimated using the area under the peak and a calibration curve constructed using a standard solution (Amino Acids Standard H, Thermo Scientific, PI-20088).

[0334] result: The concentration of amino acids was successfully maintained between 0.5 mM and 1 mM in the low AA conditions (Figures 8 and 9). The amino acid concentration in the control HIPDOG process remained high over the course of the culture. As shown in Figure 7, the cell density in the low AA condition was 35 x 10 6 The cell density peaked at around 32 × 10 cells / ml, whereas in the control HIPDOG condition the cell density was 32 × 10 6The titer peaked around 1000 cells / mL. The recovered titer level in the low AA condition (5.3 g / L) was 18% higher than in the control condition (4.5 g / L). Clearly, limiting the amino acid supply increased the cell density (and therefore the titer) at the later stage of the culture.

[0335] Example 5 demonstrates that such increases in growth and productivity can be understood as a result of reduced production of the newly identified inhibitor.

[0336] Example 5 (i) Reducing the accumulation of newly identified inhibitors by amino acid limitation in fed-batch cultures, and (ii) demonstrating the reproducibility of the positive effect of such limitation of inhibitory metabolites on the growth of GS-CHO cells (cell line A). the goal: The main goal of this example was to demonstrate the reduction of the accumulation of the newly identified inhibitors in fed-batch cultures by limiting the supply of carbon sources (amino acids) responsible for their biosynthesis. In this example, two experiments were included to demonstrate that such reduction in the levels of the newly identified inhibitors by limiting four or eight amino acids alleviates the growth inhibition in the later stages of fed-batch culture resulting in an increase in the maximum viable cell density.

[0337] material and method: Cells and bioreactor setup Cell line A was used in two experiments performed as part of this example.

[0338] Three conditions were tested in the first experiment: A) HIPDOG fed-batch culture with low levels of tyrosine, methionine, phenylalanine, and tryptophan (low 4AA+HIPDOG conditions of culture); B) HIPDOG fed-batch culture with low levels of tyrosine, methionine, phenylalanine, tryptophan, leucine, serine, threonine, and glycine (low 8AA+HIPDOG conditions), and C) Two HIPDOG fed-batch cultures (HIPDOG1 and HIPDOG2) with normal amino acid concentrations.

[0339] In the second experiment, two conditions were tested: A) HIPDOG fed-batch culture with low levels of tyrosine, methionine, phenylalanine, tryptophan, leucine, serine, threonine, and glycine (low 8AA+HIPDOG conditions), and B) HIPDOG fed-batch culture with low levels of tyrosine, methionine, phenylalanine, and tryptophan (low 4AA+HIPDOG conditions).

[0340] The first experiment was carried out for 12 days, while the second experiment was carried out for 16 days.

[0341] In both experiments, 1 × 10 exponentially growing cells from a seed culture were cultured at 1 × 10 6 Cells were inoculated at 1000 cells / mL. For all conditions, HIPDOG controls were run between days 2 and 7 of culture, and in the low amino acid conditions, the concentrations of the four or eight amino acids mentioned above were maintained between 0.5 mM and 1 mM for the first 7 days of culture, after which they were adjusted to levels close to the respective amino acids in the control HIPDOG conditions. After day 7, both conditions were treated identically. Viable cells, ammonia, and amino acid concentrations were measured daily. For all conditions, the targeted inoculation viable cell density (1 × 10 6The process parameters including the cell / mL, culture volume (1 L), and temperature (36.5°C), pH (6.9-7.2), and agitation speed (259 rpm) were identical. The basal medium used in the HIPDOG condition was medium A, and that used in the low amino acid condition was an improved version of medium A with low concentrations of four amino acids (approximately 0.6 mM tyrosine, tryptophan, phenylalanine, and methionine) or eight amino acids (approximately 0.6 mM tyrosine, tryptophan, phenylalanine, methionine, leucine, serine, threonine, and glycine). The feed medium used for all conditions was medium B. Amino acid concentrations were measured daily using the UPLC amino acid method described in Example 4. In the low amino acid conditions, based on the levels of amino acids at a given sampling point and the feeding schedule that followed, a concentrated solution of amino acids was supplemented to the conditions such that the concentrations of the four or eight amino acids in the corresponding low amino acid condition were between 0.5 mM and 1 mM at the next sampling time point. Spent media samples from various conditions across both experiments were analyzed for levels of the newly identified inhibitor using NMR techniques as described in the Materials and Methods section of Example 1.

[0342] result: In the first experiment, the concentration of amino acids was successfully maintained between 0.5 mM and 1 mM in both the low 4AA and low 8 conditions until day 7 of fed-batch culture (Figures 11-14). Such restriction of amino acid levels in the two conditions resulted in the accumulation of lower levels of newly identified metabolites (Figures 15 and 16). Isovalerate, formate, 3-(4-hydroxyphenyl)lactate, and indole-3-lactate were specifically profiled. Isovalerate and formate are by-products of leucine, serine, glycine, and threonine, which are regulated at low levels only in the low 8AA condition. These amino acids are not regulated at low levels in the low 4AA condition. Correspondingly, significantly lower concentrations of isovalerate are seen only in the low 8AA condition. The levels of isovalerate were higher in the control HIPDOG and low 4AA conditions (Figure 15B). Formate levels were similar across all conditions at day 7 of culture, but on a per cell basis, the amount of formate produced was lower in the low 8AA condition compared to the HIPDOG condition. Two other inhibitors profiled, 3-(4-hydroxyphenyl)lactate and indole-3-lactate, are by-products of the amino acids phenylalanine and tryptophan, which are regulated at lower levels in both the low 8AA and low 4AA conditions. Significantly lower concentrations of these two inhibitors were observed in both the low 8AA and low 4AA conditions compared to the HIDPOG condition at day 7 (Figures 15A and 16).

[0343] Cells in the low 8AA and low 4AA conditions proliferated better than the control conditions (HIPDOG1 and HIPDOG2), reaching cell densities of 50 × 10 6 cells / mL and 45 x 10 6 Cell density peaked at 32 × 10 cells / mL, whereas in the control HIPDOG condition the cell density was 32 × 10 6The titer peaked at around 1000 cells / mL (Figure 10A). This increase in cell proliferation observed later in the low amino acid conditions can be explained as a result of reduced inhibitor accumulation in the cultures (Figures 15 and 16). Furthermore, the titer in the low amino acid conditions was higher compared to the control HIPDOG condition until day 9, and then it gradually decreased to match the titer level in the HIPDOG condition by the end of the culture (Figure 10B). After day 9, a reduction in protein production in the low amino acid conditions occurred until near exhaustion of tyrosine levels in the cultures (Figure 11A).

[0344] The second experiment was performed to verify and replicate the increased positive effect of limiting leucine, serine, glycine, and threonine in the low 8AA condition when compared to the low 4AA condition (Figure 17). Only two conditions were tested in this experiment, including the low 8AA and low 4AA conditions, using cell line A. Eight amino acids or four amino acids were controlled between 0.5 mM and 1 mM until day 7 of culture. Amino acid data is not shown for this experiment, but is similar to the amino acid profile observed for the two conditions in the above experiment with the exception of tyrosine, which was not exhausted in this experiment (Figures 11-14). Cells proliferated better in low 8AA, reaching 42 × 10 6 The cell density peaked at 32 × 10 cells / mL in the low 4AA condition, whereas the cell density in the low 4AA condition was 32 × 10 6 The results showed that the 8AA condition had a higher recovery titer than the 4AA condition, whereas the 8AA condition had a higher recovery titer than the 4AA condition.

[0345] Example 6 (i) Reduction of accumulation of newly identified inhibitors by amino acid limitation, and (ii) demonstration of the positive effect of such limitation of inhibitory metabolites on the growth of a different GS-CHO cell line (cell line B) in fed-batch culture. the goal: This experiment was performed to demonstrate that the beneficial growth effect of limiting the levels of certain amino acids on cell growth was not specific to one cell line (cell line A), but more general and applicable to other cell lines. Two nutrient limitation experiments were performed as part of this example using a different CHO cell line (cell line B) producing a different recombinant antibody. The goal of these experiments was to show that controlling amino acids at lower levels in fed-batch cultures reduces inhibitor accumulation, and that such lower accumulation of inhibitors can explain the increased viable cell density and protein titer seen in low amino acid fed-batch cultures.

[0346] material and method: Cells and bioreactor setup A new GS-CHO cell line (cell line B) expressing a different recombinant antibody was used in this example. Two experiments were performed to understand the effect of limiting four or eight amino acids simultaneously. In the first experiment, two conditions were tested: A) HIPDOG fed-batch culture with low levels of eight amino acids including tyrosine, methionine, phenylalanine, tryptophan, leucine, serine, glycine, and threonine (low 8AA+HIPDOG condition), and B) HIPDOG fed-batch culture with normal amino acid concentrations (HIPDOG condition). In the second experiment, two conditions were tested: A) HIPDOG fed-batch culture with low levels of four amino acids including tyrosine, methionine, phenylalanine, and tryptophan (low 4AA+HIPDOG condition), and B) HIPDOG fed-batch culture with normal amino acid concentrations (HIPDOG condition). The first experiment was performed for 12 days, while the second experiment was performed only until the eighth day of culture.

[0347] Add 1 x 10 exponentially growing cells from the seed culture into each production bioreactor. 6Cells / mL were inoculated for all conditions. For all conditions, the HIPDOG strategy was operated between days 2 and 7 of culture. In the low amino acid conditions, the concentrations of the four or eight amino acids mentioned above were maintained between 0.5 mM and 1 mM for the first 7 days of culture, after which they were adjusted to levels close to the respective amino acids in the control HIPDOG condition. After day 7, both conditions were treated identically. Viable cells, ammonia, and amino acid concentrations were measured daily throughout the culture. For all conditions, the targeted inoculation viable cell density (1 × 10 6 The process parameters including temperature (36.5°C), pH (6.9-7.2), and agitation speed (259 rpm) were identical, as well as the number of cells / mL and culture volume (1 L). The basal medium used in the HIPDOG condition was medium A, and that used in the low AA condition was an improved version of medium A with low concentrations of four amino acids (approximately 0.6 mM tyrosine, tryptophan, phenylalanine, and methionine) or eight amino acids (approximately 0.6 mM tyrosine, tryptophan, phenylalanine, methionine, leucine, serine, threonine, and glycine). The feed medium used for all conditions was medium B. Amino acid concentrations were measured daily using the UPLC amino acid method described in Example 4. In the low amino acid conditions, based on the levels of amino acids at a given sampling point and the subsequent feeding schedule, concentrated solutions of amino acids were supplemented to the conditions such that the concentrations of the four or eight amino acids in the corresponding condition were between 0.5 mM and 1 mM at the next sampling time point. Spent media samples from various conditions across both experiments were analyzed and quantified for levels of the newly identified inhibitor using NMR techniques as described in the Materials and Methods section of Example 1.

[0348] result: In the first experiment, the concentrations of the eight amino acids were successfully maintained between 0.5 mM and 1 mM in the low 8AA condition through day 7 of fed-batch culture. The amino acid culture profile is not shown for this experiment, but is similar to that observed for similar conditions in experiment 1 of Example 5, with the exception of tyrosine, which was not exhausted in this experiment (Figures 11-14). Such restriction of amino acid levels in the low 8AA condition resulted in lower levels of biosynthesis and reduced accumulation of the newly identified metabolites. Four of the nine inhibitors listed in Table 3 were profiled (Figures 19 and 20). Significantly lower accumulation of isovalerate, 3-(4-hydroxyphenyl)lactate, and indole-3-lactate was observed in the low 8AA condition compared to the control HIPDOG condition. Formate levels were observed to be higher in the low 8AA condition at day 10 of culture, but on a per cell basis, the amount of formate produced was similar in the low 8AA condition compared to the HIPDOG condition. Cells in the low 8AA condition were 40 × 10 6 The cells proliferated better than the control condition (HIPDOG), which peaked at a cell density of 100 cells / mL, whereas the cell density in the control HIPDOG condition was 32 × 10 6 The increase in cell growth and productivity observed in the low 8AA conditions peaked at around 1000 cells / mL (Figure 18A). Furthermore, the increased growth observed in the low 8AA conditions resulted in higher titer levels compared to the control HIPDOG conditions (Figure 18B). This increase in cell growth and productivity observed in the low amino acid conditions can be explained as a result of reduced inhibitor biosynthesis and accumulation (Figures 19 and 20).

[0349] A second experiment was performed to investigate the effect of controlling the levels of four amino acids (tyrosine, phenylalanine, tryptophan, and methionine) between 0.5 mM and 1 mM (low 4AA+HIODOG) on the growth and productivity of cell line B when compared to the control HIPDOG condition (Figures 21-23). ​​The amino acid culture profile is not shown for this experiment but is similar to that observed for similar conditions in experiment 1 of Example 5 with the exception of tyrosine, which was not exhausted in this experiment (Figures 11-14). Such restriction of amino acid levels in the low 4AA condition resulted in lower levels of biosynthesis and reduced accumulation of the newly identified metabolites. Four of the nine inhibitors listed in Table 3 were profiled (Figures 22 and 23). With the exception of isovalerate, the levels of the other three inhibitors were lower in the low 4AA condition compared to the HIPDOG condition. Leucine, which is not one of the amino acids regulated at low levels in the low 4AA condition, and its metabolic intermediate isovalerate, accumulate in the low 4AA condition to levels similar to those seen in the control HIPDOG condition. Cells in the low 4AA condition accumulate at 37 × 10 6 The cells proliferated better, peaking at a cell density of 100×10 cells / mL, whereas the cell density in the control HIPDOG condition was 32×10 6 The increase in cell growth and productivity observed in the low 4AA conditions peaked around 100 cells / mL (Figure 21A). Furthermore, the increased growth observed in the low 4AA conditions resulted in higher titer levels compared to the control HIPDOG conditions (Figure 21B). This increase in cell growth and productivity observed in the low amino acid conditions can be explained as a result of reduced inhibitor biosynthesis and accumulation (Figures 22 and 23).

[0350] Example 7 Use of Raman spectroscopy for the online measurement of four (phenylalanine, tyrosine, tryptophan, and methionine) or eight amino acids (phenylalanine, tyrosine, tryptophan, methionine, leucine, serine, glycine, and threonine) as well as newly identified inhibitors Raman spectroscopy is based on the inelastic scattering of monochromatic light (photons) by molecules. The technique determines molecular properties using the frequency shift of light resulting from the change in the energy of photons when they are absorbed and re-emitted by the molecule. The technique has been successfully used in microbial and mammalian cell culture bioreactors to measure the levels of various process parameters. Raman spectroscopy has also been used to determine the concentrations of glucose, lactate, ammonia, glutamine, and glutamic acid in CHO cell culture fluids.

[0351] The Raman spectra of all amino acids have been previously reported in the literature. The Raman spectra of the newly identified inhibitor metabolites have been characterized using solutions of purified metabolites. An empirical model is built by using a training set of spectral data generated using known concentrations of each of the four or eight amino acids, or the newly identified inhibitor, individually. The sample matrix (background) used for the preparation of the calibration samples (used as the training set) is a mix of spent medium samples taken from different time points of different cell culture processes. The model developed using such a training set is more general and can be applied to any other cell culture process. The model is used to measure (online) the concentrations of the four or eight amino acids or metabolites (inhibitors) in the culture medium and thus control the levels of the amino acids by a feedback control feeding strategy.

[0352] Example 8 Suppression of inhibitor formation by controlling amino acids at low levels in fed-batch cultures using on-line measurement of inhibitor concentrations Fed-batch processes are designed to reduce inhibitor formation by controlling four (phenylalanine, tyrosine, tryptophan, and methionine) or eight amino acids (phenylalanine, tyrosine, tryptophan, methionine, leucine, serine, glycine, and threonine) at low levels, e.g., between 0.2 and 1 mM, in the cell culture medium. Such control of inhibitor production is achieved by a feeding strategy that operates as a feedback loop based on online measurements of the inhibitors themselves. Such online measurements can be in the form of Raman spectroscopy or use HPLC- or UPLC-based techniques with an autosampler that draws samples from the reactor in a programmed manner and transfers them to the instrument. As the concentration of the inhibitor is increased above a specified level (e.g., 0.2 mM), the amount of phenylalanine, tyrosine, tryptophan, methionine, leucine, serine, glycine, and threonine fed to the cells decreases until the concentration of the inhibitor falls below a predetermined level (e.g., 0.1 mM).

[0353] Example 9 Suppression of inhibitor formation and control of low levels of amino acids in fed-batch cultures by on-line or off-line measurements The fed-batch process is designed to reduce inhibitor formation by controlling four (phenylalanine, tyrosine, tryptophan, and methionine) or eight amino acids (phenylalanine, tyrosine, tryptophan, methionine, leucine, serine, glycine, and threonine) at low levels (0.2-1 mM). Such control of inhibitor formation is achieved by a feeding strategy that operates as a feedback loop based on online measurements of the amino acids. Such online measurements can be in the form of Raman spectroscopy or using HPLC or UPLC based techniques with an autosampler that draws samples from the reactor in a programmed manner and transfers them to the instrument. As and when the concentration of the amino acids drops to a specified level (e.g., below 0.5 mM), an estimated amount of feed medium (similar to medium B) is added to the culture to maintain the concentration of the four or eight amino acids.

[0354] Alternatively, samples are taken once a day and amino acid concentrations are measured offline using UPLC / HPLC methods. The obtained amino acid concentrations are used to calculate the cell-specific uptake rates of four (phenylalanine, tyrosine, tryptophan, and methionine) or eight amino acids (phenylalanine, tyrosine, tryptophan, methionine, leucine, serine, glycine, and threonine) between the two previous sampling times. Assuming that the cells maintain the same specific rate of amino acid consumption until the next sampling time point, the amount of feed medium (e.g. medium B) added until the next sampling point is determined and provided to the cells so that the concentration of amino acids is always within the desired range (0.2 mM to 1 mM).

[0355] Example 10 Suppression of inhibitor formation by programmed feeding to maintain low amino acid levels in fed-batch cultures The formation of the newly identified inhibitors in the culture is kept low by maintaining the concentrations of four (phenylalanine, tyrosine, tryptophan, and methionine) or eight amino acids (phenylalanine, tyrosine, tryptophan, methionine, leucine, serine, glycine, and threonine) at low levels (0.2-1 mM) in the culture. This is achieved by designing a programmed feeding strategy (using modified medium B) such that the concentration of the amino acids is always within the desired range (0.2 mM-1 mM) at any given time point during the culture. Such a feeding strategy is devised by assessing the specific consumption rate of the amino acids at different time points along the culture and modifying their concentrations in the feed medium (medium B) such that sufficient amounts of the amino acids are provided to the culture to maintain the amino acid concentrations within the desired range (0.2-1 mM), using the feeding strategy / schedule defined above.

[0356] Example 11 Experiments to determine gene targets for metabolic engineering to suppress the biosynthesis of inhibitors associated with the phenylalanine / tyrosine pathway the goal: This experiment was performed to determine the cause of the production of inhibitor molecules including phenyllactate, 4-hydroxyphenylpyruvate, and 3-(4-hydroxyphenyl)lactate. Gene expression of all enzymes in the phenylalanine / tyrosine pathway was probed using real-time quantitative polymerase chain reaction (RT-qPCR) assay. Based on the gene expression and biochemistry of the phenylalanine / tyrosine catabolic pathway, gene targets were identified for metabolic engineering of CHO cell line A to suppress the biosynthesis of the inhibitors mentioned above.

[0357] material and method: Gene expression analysis RT-qPCR assays were used to assess the relative gene expression levels of enzymes in the leucine and phenylalanine / tyrosine metabolic pathways. RT qPCR measures transcript abundance, and therefore gene expression, by amplifying target cDNA sequences using PCR in combination with a detection reagent (i.e., SYBR Green). SYBR green is a molecule that fluoresces when bound to double-stranded DNA, and fluorescence can be measured in real time during an RT qPCR assay. The amount of fluorescence is directly proportional to the amount of double-stranded PCR product (also called amplicon) in the reaction. Relative gene expression levels are determined by measuring the number of PCR cycles required for SYBR green fluorescence to rise above background fluorescence and increase logarithmically. This number of cycles is generally referred to as C T (threshold cycle). Transcripts at high abundance have a lower C T values ​​because it requires fewer PCR cycles for the fluorescence to rise above background fluorescence; conversely, transcripts at lower abundance should have a higher C T value because it would take more PCR cycles for the fluorescence to rise above background levels.

[0358] RT qPCR assays were performed using an Applied Biosystems 7500 real-time PCR system (Applied Biosystems) and PowerUP SYBR Green Master Mix reagent (Life Technologies). PCR primers were designed using the Primer3 algorithm (http: / / bioinfo.ut.ee / primer3-0.4.0 / primer3 / ) based on genomic DNA sequences contained in the Chinese Hamster Ovary (CHO) genome browser (chogenome.org). RNA was prepared from CHO cell line A using the Qiagen RNeasy kit (Qiagen), which in turn was used as a template to synthesize oligo dT primed cDNA using the SuperScript III First-Strand Synthesis system for RT-PCR (Life Technologies). C of the target metabolism-related genes was T Values ​​are tabulated and the C of the well-characterized housekeeping gene, beta-actin. T The C value of the target gene was compared with that of the control gene. T and C for beta-actin T The difference between T It was reported as high ΔC T Values ​​indicate low gene expression levels.

[0359] result: C of genes in the phenylalanine / tyrosine pathway T and ΔC TThe values ​​are shown in FIG. 24. Gene expression data from the phenylalanine / tyrosine pathway shows that CHO cell line A has low expression of PAH, HPD, and HGD genes. Since expressed protein (or enzyme) levels correlate with transcript abundance, low levels of PAH enzymes can result in phenylalanine that is converted to phenylpyruvate and subsequently to phenyllactate by catalysis of GOT1 / GOT2 and MIF enzymes, both of which are expressed at high levels in CHO cell line A. Similarly, due to low levels of HPD and HGD enzymes in CHO cell line, tyrosine is channeled to the production of 4-hydroxyphenylpyruvate and 3-(4-hydroxyphenyl)lactate by catalysis of GOT1 / GOT2 and MIF enzymes. Reducing the channeling of phenylalanine and tyrosine flux towards inhibitor production requires downregulation of expression of GOT1 / GOT2 and MIF genes. However, GOT1 / GOT2 and MIF are crucial for other physiologically important metabolic functions. Therefore, downregulation of the two enzymes should not potentially result in viable cell lines. An alternative way to reduce inhibitor biosynthesis is by overexpression of PAH, HPD, and HGD genes, which then channel flux away from inhibitor production and towards the production of Krebs cycle metabolites, which are used for energy synthesis in mitochondria. Thus, the metabolic targets of the phenylalanine / tyrosine pathway are the PAH, HPD, and HGD genes.

[0360] Example 12 Experiments to determine gene targets for metabolic engineering to suppress the biosynthesis of inhibitors related to the leucine pathway the goal: This experiment was performed to determine the cause of biosynthesis and accumulation of isovaleric acid, a by-product of leucine metabolism that accumulates to very high levels in fed-batch cultures of CHO cells. Gene expression of all enzymes in the leucine pathway was probed using real-time quantitative polymerase chain reaction (RT-qPCR) assays. Furthermore, production of isovaleric acid in human disease states such as isovaleric acidemia was reported to result from "loss-of-function" mutations in enzymes downstream of isovaleryl-CoA, an intermediate in the leucine catabolism pathway. These enzymes include Ivd, Mccc1, and Mccc2, which may harbor loss-of-activity mutations but are expressed at high levels. Therefore, the mutational status of these enzymes in CHO cell line A was investigated. Based on gene expression and mutational analysis of the above-mentioned enzymes in the leucine catabolism pathway, genetic targets for metabolic engineering of CHO cell line A that would suppress the biosynthesis of isovaleric acid were identified.

[0361] material and method: Mutation analysis Genomic DNA sequences flanking the translated regions of Ivd, Mccc1, and Mccc2 (at the 5' and 3' ends) were identified and used as templates for PCR primer design using the Primer3 algorithm (http: / / bioinfo.ut.ee / primer3-0.4.0 / primer3 / ). RNA was prepared from CHO cell line A using the Qiagen RNeasy kit (Qiagen) which in turn was used as templates for oligo-dT primed cDNA synthesis using the SuperScript III First-Strand Synthesis system for RT-PCR (Life Technologies). PCR reactions with optimized extension temperature and magnesium concentration were performed using Pfu Turbo HotStart 2X Master Mix (Agilent). Samples were purified using the QIAquick PCR Purification Kit (Qiagen) and sent for sequence analysis at Wyzerbio (Cambridge, MA).

[0362] result: C of genes in the leucine pathway T and ΔC T The values ​​are shown in FIG. 25. Gene expression data from the phenylalanine / tyrosine pathway indicates that the level of the AUH enzyme in CHO cell line A is low relative to other enzymes in the pathway. However, this data does not strongly explain the high level of isovaleric acid production reported in earlier experiments, because the enzyme is further downstream of the node that branches towards isovaleric acid production (FIG. 25). Thus, loss of function (enzyme activity) of IVD, MCCC1, and / or MCCC2 can give a better principle of isovaleric acid production. DNA sequencing results will reveal the mutation status and plausible level of function of the encoded enzyme. If an enzymatic activity modifying mutation in the IVD, MCCC1, and MCCC2 genes is found, a metabolic engineering approach will be performed that involves overexpression of the corresponding wild type (non-mutated) gene, in which case the gene origin should be from the CHO cell line, although other origins of the wild type gene, e.g., human, rat, mouse, etc., are available and can be used. In addition to this, the AUH gene will also be overexpressed in the same CHO cell line A.

[0363] A correlation between gene acronyms and full nomenclature for the genes discussed herein is provided below in Table 5.

[0364] [Table 5]

[0365] Example 13 Experiments in which wild-type forms of mouse genes for HPD, HGD, PAH, AUH, and any other gene target determined in Example 12 by mutation analysis were ectopically expressed in CHO cell line A. the goal: Based on low gene expression levels relative to beta-actin as determined by RT qPCR assay, four targets were selected for overexpression in CHO cells: Auh (leucine metabolic pathway) and HPD, HGD, and PAH (phenylalanine / tyrosine metabolic pathway). In addition, wild-type genes of mutant enzymes will be selected for overexpression in CHO cells based on the loss-of-activity mutation status of IVD, MCCC1, and MCCC2. In general, when genes are found to be mutated or inactive, the strategy is to overexpress the wild-type genes. The goal is to clone the mouse mRNA sequences of these genes into commercially available mammalian expression vectors and transfect these expression vectors into CHO cell line A. The resulting cell line has high levels of expression of mouse AUH, HPD, HGD, or PAH genes and thus higher levels of AUH, HPD, HGD, or PAH enzyme activity. Increasing the activity of these key enzymes will likely improve metabolic flux and reduce the cellular concentration of certain known inhibitors.

[0366] material and method: Overexpression cassettes were constructed using mouse cDNA sequences from the MGC collection (http: / / genecollections.nci.nih.gov / MGC / ) for AUH, HPD, HGD, and / or PAH genes. Sequences were provided as E. coli glycerol stocks (GE Dharmacon) containing shuttle vectors with the cDNA of the target genes. PCR primers were designed using the Primer3 algorithm (http: / / bioinfo.ut.ee / primer3-0.4.0 / primer3 / ) to amplify the coding regions of the cDNA in reactions using a proofreading polymerase called Pfu Turbo HotStart 2X Master Mix (Agilent). PCR products were directionally cloned into the pcDNA Gateway Direction TOPO expression vector (Invitrogen). The vector contains a viral promoter sequence (human cytomegalovirus immediate early promoter), a directional TOPO cloning site, an epitope tag (V5) for detection using an anti-V5 antibody, a polyadenylation sequence (herpes simplex virus thymidine kinase), and an antibiotic resistance gene (blasticidin). The vector is sequence verified by WyzerBio and transfected into CHO cell line A for overexpression using a GenePulser XCell electroporator (BioRad) and recovered in the presence of blasticidin for selection pressure. The engineered CHO cells are assessed for expression of the transgene by RT qPCR, Western hybridization, and enzyme assays. After selection in medium containing blasticidin, the cells are cryopreserved for later experiments in bioreactors.

[0367] The transfected cell lines are engineered to express high levels of mouse AUH, HPD, HGD, and / or PAH genes and thus have increased AUH, HPD, HGD, or PAH enzyme activity. Analysis by RT qPCR, Western hybridization, and enzyme assays is performed to demonstrate increased total Auh, Hpd, Hgd, or Pah gene expression and enzyme activity (both endogenous and transgenic) within the newly created transgenic cell lines.

[0368] Example 14 Experiments to Probe the Suppression of Inhibitor Formation in Genetically Engineered Cell Lines Expressing the Target Genes Determined in Examples 11 and 12 the goal: As part of this experiment, the phenotype of clones (and pools) overexpressing the target gene was investigated, mainly involving the peak cell density and productivity of these clones in HIPDOG fed-batch cultures and / or the level of inhibitor molecule accumulation in the culture medium.

[0369] material and method: Cells and bioreactor setup The CHO cells used in the experiments are engineered forms of CHO cell line A resulting from overexpression of wild-type forms of PAH, HPD, HGD, AUH, and any other gene targets determined in Examples 11 and 12 by mutational analysis. Two conditions are tested as part of this experiment: A) HIPDOG fed-batch culture using CHO cells expressing all target genes B) HIPDOG fed-batch culture with CHO cells expressing GFP protein. Details on the use of the HIPDOG technology are described in the Materials and Methods section of Example 1. 1×10 exponentially growing cells from a seed culture were cultured at 1×10 6The cells / mL were inoculated into the production bioreactor using the HiPDOG process. For both conditions, a HiPDOG control is run between days 2 and 7 of culture. Viable cell density, lactate, ammonia, and amino acid concentrations are measured daily up to day 12 (amino acids are measured only for the first 7 days). For both conditions, the targeted inoculation viable cell density (1×10 6 The process parameters including cell number (cells / mL) and culture volume (1 L), as well as temperature (36.5 °C), pH (6.9-7.2), and agitation speed (267 rpm) were identical. For both conditions, the basal medium used will be medium A and the feed medium will be medium B. Supernatant samples from the various conditions across both experiments will be analyzed for levels of the newly identified inhibitors using NMR techniques as described in the Materials and Methods section of Example 1. Amino acid concentrations will be measured for the samples using the UPLC amino acid method as described in detail below.

[0370] Amino acid analysis Ten microliters of standard amino acid mix solution or spent medium sample (10-fold diluted sample) was mixed with 70 μL of AccQ·Tag Ultra Borate Buffer (Waters UPLC AAA H-Class Applications Kit [176002983]) and 20 μL of AccQ·Tag reagent previously dissolved in 1.0 mL of AccQ·Tag Ultra Reagent Diluent was added. The reaction was allowed to proceed for 10 min at 55 °C. Liquid chromatographic analysis was performed on a Waters Acquity UPLC system equipped with a binary solvent manager, autosampler, column heater, and PDA detector. The separation column was a Waters AccQ·Tag Ultra column (2.1 mm id × 100 mm, 1.7 μm particles). The column heater was set at 55 °C. The mobile phase flow rate was maintained at 0.7 mL / min. Eluent A was 10% AccQ·Tag Ultra concentrated solvent A and eluent B was 100% AccQ·Tag Ultra solvent B. The nonlinear separation gradient is: 0–0.54 min (99.9% A), 5.74 min (90.0% A), 7.74 min (78.8% A), 8.04–8.64 min (40.4% A), and 8.73–10 min (99.9% A). Inject one microliter of sample for analysis. Set the PDA detector at 260 nm. Identify specific amino acid peaks on the chromatograms of each sample using the elution times previously determined for the amino acids. Estimate the amino acid concentrations using the area under the peaks and a calibration curve generated using a standard solution (Amino Acids Standard H, Thermo Scientific, PI-20088).

[0371] result: Cells expressing the target genes channel less carbon (phenylalanine, tyrosine, and leucine) towards the biosynthesis of the inhibitor, resulting in a lower accumulation of the compound in the culture medium. However, cells expressing the GFP molecule (negative control) channel more carbon towards inhibitor production, resulting in a higher accumulation of the compound in the culture medium. This difference in the levels of inhibitor production and accumulation results in a growth differential leading to a higher peak cell density in cells expressing the target gene set compared to cells expressing GFP. This increase in total cells also leads to a higher over-yield of the recombinant protein produced by the cells.

[0372] Example 15 Experiments to determine gene targets for metabolic engineering to suppress the biosynthesis of inhibitors associated with the phenylalanine / tyrosine pathway the goal This experiment was performed to determine the cause of the production of inhibitor molecules including phenyllactate, 4-hydroxyphenylpyruvate, and 3-(4-hydroxyphenyl)lactate. Gene expression of all enzymes in the phenylalanine / tyrosine pathway was probed using real-time quantitative polymerase chain reaction (RT-qPCR) assay. Based on the gene expression and biochemistry of the phenylalanine / tyrosine catabolic pathway, genetic targets for metabolic engineering of CHO cells (CHO cell line A, CHO cell line B, and parental cell line) that suppress the biosynthesis of the above-mentioned inhibitors were identified.

[0373] material and method Gene expression analysis RT-qPCR assays were used to assess the relative gene expression levels of enzymes in the phenylalanine / tyrosine metabolic pathway. RT qPCR measures transcript abundance, and therefore gene expression, by amplifying target cDNA sequences using PCR in combination with a detection reagent (i.e., SYBR Green). SYBR green is a molecule that fluoresces when bound to double-stranded DNA, and fluorescence can be measured in real time during an RT qPCR assay. The amount of fluorescence is directly proportional to the amount of double-stranded PCR product (also called amplicon) in the reaction. Relative gene expression levels are determined by measuring the number of PCR cycles required for SYBR green fluorescence to rise above background fluorescence and increase logarithmically. This number of cycles is generally referred to as C T (threshold cycle). Transcripts at high abundance have a lower C T values ​​because it requires fewer PCR cycles for the fluorescence to rise above background fluorescence; conversely, transcripts at lower abundance should have a higher C T value because it would take more PCR cycles for the fluorescence to rise above background levels.

[0374] RT qPCR assays were performed using an Applied Biosystems 7500 real-time PCR system (Applied Biosystems) and PowerUP SYBR Green Master Mix reagent (Life Technologies). PCR primers were designed using the Primer3 algorithm (http: / / bioinfo.ut.ee / primer3-0.4.0 / primer3 / ) based on genomic DNA sequences contained in the Chinese Hamster Ovary (CHO) genome browser (chogenome.org). RNA was prepared from CHO cell line A using the Qiagen RNeasy kit (Qiagen), which in turn was used as a template to synthesize oligo dT primed cDNA using the SuperScript III First-Strand Synthesis system for RT-PCR (Life Technologies). C of the target metabolism-related genes was T Values ​​are tabulated and the C of the well-characterized housekeeping gene, beta-actin. T The C value of the target gene was compared with that of the control gene. T and C for beta-actin T The difference between T It was reported as high ΔC T Values ​​indicate low gene expression levels.

[0375] result C for genes in the phenylalanine / tyrosine pathway of CHO cell line A and the parent cell line T and ΔC TValues ​​are shown in FIG. 26. CHO cell line B has similar levels of gene expression as CHO cell line A (data not shown). Gene expression data from the phenylalanine / tyrosine pathway indicates that CHO cell line A and the parental cell line have low expression of PAH, HPD, and HGD genes. Protein (or enzyme) levels correlate with transcript abundance, and low levels of PAH enzymes can result in phenylalanine being converted to phenylpyruvate and subsequently to phenyllactate by the catalytic action (or non-specific enzymatic reaction) of GOT1 / GOT2 and MIF enzymes, both of which are expressed at high levels in CHO cell line A and the parental cell line. Similarly, due to low levels of HPD and HGD enzymes in CHO cell line A and the parental cell line, tyrosine is channeled to the production of 4-hydroxyphenylpyruvate and 3-(4-hydroxyphenyl)lactate by the catalytic action (or non-specific enzymatic reaction) of GOT1 / GOT2 and MIF enzymes. One way to reduce the channeling of phenylalanine and tyrosine flux towards inhibitor production would be to downregulate the expression of GOT1 / GOT2 and MIF genes. However, GOT1 / GOT2 and MIF are crucial for other physiologically important metabolic functions. Therefore, downregulation or knockout of these two enzymes would not potentially result in viable cell lines. An alternative way to reduce inhibitor biosynthesis is by overexpression of PAH, HPD, and HGD genes, which then channel flux away from inhibitor production towards the production of Krebs cycle metabolites (which are used for energy synthesis in mitochondria). Therefore, the metabolic targets selected for the phenylalanine / tyrosine pathway are PAH, HPD, and HGD genes.

[0376] In addition to the three targets in the phenylalanine / tyrosine pathway identified by RT qPCR (PAH, HGD, and HPD), a fourth target was examined. PAH enzymes rely on tetrahydrobiopterin (BH) for their catalytic activity. 4 Mammalian cells use GTP as a substrate to synthesize BH4 (Figure 27A). BH 4 The enzymes involved in the biosynthesis of BH include GCH1, PTS, and SPR. 4 During the reaction catalyzed by PAH activity, BH 4 -4a-carbinolamine, which is then converted to BH by the activity of PCBD1 and QDPR enzymes. 4 The expression of genes encoding biosynthetic and salvage enzymes was similarly assayed by RT qPCR in CHO cells (cells used for gene expression analysis had undergone a first round of transfection with mouse PAH genes; see Example 16) (Figure 27B). T value, high ΔC T , and therefore, the PCBD1 gene was also selected for overexpression based on low levels of gene expression. 4 All other genes in the pathway were expressed at reasonable levels (see FIG. 27B).

[0377] (Example 16) Experiments overexpressing PAH, HPD, HGD, and PCBD1 in CHO cell lines the goal Based on low gene expression levels relative to B-actin as determined by RT qPCR assays, four targets were selected for overexpression in CHO cells: HPD, HGD, PAH, and PCBD1. The primary goal of this experiment was to clone the mRNA sequences of these genes into commercially available mammalian expression vectors and transfect the expression vectors into CHO parent cell line, CHO cell line A, and CHO cell line B. The resulting cell lines have high levels of expression of HPD, HGD, PAH, and PCBD1 genes and thus higher levels of HPD, HGD, PAH, and PCBD1 enzyme activity. Increasing the activity of these key enzymes improved metabolic flux and reduced cellular concentrations of identified inhibitory substances.

[0378] material and method Expression vectors for the HPD, HGD, PAH, and PCBD1 genes were constructed using mouse cDNA sequences from the MGC collection (http: / / genecollections.nci.nih.gov / MGC / ) (Figure 28). The sequences were provided by GE Dharmacon as E. coli glycerol stocks containing shuttle vectors with the cDNA of the target genes. PCR primers were designed using the Primer3 algorithm (http: / / bioinfo.ut.ee / primer3-0.4.0 / primer3 / ) to amplify the coding region of the cDNA in the reaction using a proofreading polymerase called Pfu Turbo HotStart 2X Master Mix (Agilent). The PCR products were cloned into commercially available constitutive expression vectors containing different antibiotic resistance genes to allow individual selection of the expression plasmids shown in Table 6. In addition, control vectors were also provided by the supplier to serve as negative controls (transfection controls). The vectors were sequence verified by WyzerBiosciences (Cambridge, MA). Expression and control plasmids were transfected into CHO parental cells, CHO cell line A, and CHO cell line B using a GenePulser XCell electroporator (BioRad) and harvested in the presence of antibiotic for selection pressure. A stepwise approach was adopted whereby cells were first transfected with the PAH expression vector and harvested. The PAH-expressing cell pool was then transfected with HPD and HGD together, and the resulting cell pool was transfected with PCBD1 until the final product, a 4-fold transfected cell line, was achieved. After selection in medium containing antibiotic, the cell pool was cryopreserved for later experiments in bioreactors. Figure 28 shows the expressed mouse genes, the expression vectors created in Pfizer's lab, and the antibiotic selection genes. CHO cell line A was only transfected with PAH and no subsequent set of transfections were performed. Table 6 shows an overview of the plasmids used for each expressed gene, including the commercially available expression vector used, the antibiotic used as selection pressure, and the supplier of the expression vector.The null vector used to generate negative transfection control cell lines is also listed.

[0379] [Table 6]

[0380] result Cell pools were generated after transfection of PAH, HPD, HGD, and PCBD1 expression vectors (referred to as 4x-tfxn cell pools) with accompanying negative control vectors (empty vector or vector containing chloramphenicol acetyltransferase (CAT)) (referred to as 4x-control-tfxn cell pools). The 4x-tfxn cell pools resulting from the transfection were designed to express mouse PAH, HPD, HGD, and PCBD1 genes at high levels and have increased PAH, HPD, HGD, and PCBD1 enzyme activity. Analysis by RT qPCR and Western hybridization (data not shown) was used to determine changes in PAH, HPD, HGD, and PCBD1 gene expression (both endogenous and transgenic) within the newly created transgenic cell pools (see Example 17).

[0381] (Example 17) Experiments probing the expression of mouse transgenes (PAH, HPD, HGD, and PCBD1) in cell pools generated from quadruple transfections the goal RT qPCR assays were performed to assess the relative gene expression levels of mouse transgenes PAH, HPD, HGD, and PCBD1 in 4x-tfxn cell pools derived from parental cell lines or CHO cell line B.

[0382] material and method RT qPCR assays were performed using an Applied Biosystems 7500 real-time PCR system (Applied Biosystems) and PowerUP SYBR Green Master Mix reagent (Life Technologies). PCR primers were designed using the Primer3 algorithm (http: / / bioinfo.ut.ee / primer3-0.4.0 / primer3 / ) based on mouse cDNA sequences from the MGC collection (http: / / genecollections.nci.nih.gov / MGC / ) provided by GE Dharmacon. RNA was prepared from 4x-tfxn and 4x-control-tfxn cell pools of CHO cell line A or parental cell line using the Qiagen RNeasy kit (Qiagen), which in turn was used as template for oligo-dT primed cDNA synthesis using the SuperScript III First-Strand Synthesis system for RT-PCR (Life Technologies). The cDNAs of mouse PAH, HPD, HGD, and PCBD1 genes were expressed as 100% chromatin (100% chromatin) and 100% chromatin (100% chromatin). T Values ​​are tabulated and compared with the C of the well-characterized housekeeping gene, B-actin. T The C value of the target gene was compared with that of the control gene. T and C for B-actin. T The delta between ΔC and T The successful expression of mouse transgenes PAH, HPD, HGD, and PCBD1 genes in the 4x-tfxn cell pool was compared with the ΔC T ΔC compared to the value T These were identified by a decrease in the expression level of the gene (and therefore an increase in the level of gene expression).

[0383] result C of mouse PAH, HPD, HGD, and PCBD1 genes in the 4x-tfxn cell pool and the corresponding negative control pool (4x-control-tfxn) TThe values ​​are shown in Table 7. A lower ΔC compared to the corresponding negative control cell pool (4x-control-tfxn). T Values ​​were observed for the mouse transgenes in the 4x-tfxn cell pools of CHO cell line B and the parental cell line. This indicates that targeted gene expression was higher in the 4x-tfxn pools, promoting channeling of amino acid flux away from the phenyllactate, 3-(4-hydroxyphenyl)lactate, and 4-hydroxyphenyllactate inhibitor biosynthetic pathways (see Example 19). The apparent presence of mouse PAH, HPD, HGD, and PCBD1 expression in the 4x-control-tfxn cell pool is due in part to the high level of sequence homology between the transgenic (mouse) and endogenous (hamster) PAH, HPD, HGD, and PCBD1 genes. This suggests that the data accurately reflect the total level of PAH, HPD, HGD, and PCBD1 gene expression, including both transgenic and endogenous genes.

[0384] Table 7 shows the expression levels of mouse PAH, HPD, HGD, and PCBD1 genes in 4x transfected (4x-tfxn) or negative 4x transfected control (4x-control-tfxn) cell pools of CHO parental cell line and CHO cell line B, as assayed by RT-qPCR.

[0385] [Table 7]

[0386] (Example 18) Probing the ability of a cell pool (4x-tfxn) to grow in tyrosine-free medium expressing four transfected mouse genes, including PAH, HPD, HGD, and PCBD1. the goal Expression of PAH and PCBD1 enzyme activities endowed the cells with the ability to catalyze the synthesis of tyrosine from phenylalanine, thus promoting the channeling of amino acid flux away from the phenyllactate, 3-(4-hydroxyphenyl)lactate, and 4-hydroxyphenyllactate inhibitor biosynthetic pathways (see Example 19).The goal of this experiment was to test whether the 4x-tfxn cell pool expressing four mouse genes including PAH, HPD, HGD, and PCBD1 derived from CHO cell line B or the parent host cell line had the ability to grow under tyrosine-free medium conditions.

[0387] material and method Cells, media, and experimental setup 4x-tfxn or 4x-control-tfxn cell pools of CHO cell line B or parental cell line were spun down and the cell pellets were inoculated into medium D (medium C without tyrosine but supplemented with an additional amount (2 mM) of phenylalanine). Medium C has approximately one third the concentration of the various amino acids at the levels in medium A. Medium A is an enriched version of insulin-free medium 9 disclosed in US7294484, Table 14, with slight variations in the concentrations of sodium bicarbonate and potassium chloride and containing Pluronic F68 instead of polyvinyl alcohol. It was enriched by adding 10% glutamine-free medium 5 (US7294484, Table 7) and further increasing the concentration of eight amino acids (Glu, Tyr, Gly, Phe, Pro, Thr, Trp, and Val). The concentrations of the amino acids are listed below in Table 8.

[0388] [Table 8]

[0389] Cells were inoculated at 0.3E6 cells / mL in a 25 mL working volume in a 125 mL shake flask. The shake flask was incubated on a shaking platform (125 rpm) at 36.5° C. and 5% carbon dioxide environment. Cell growth was monitored for 3 days. On day 3, cells were spun down and cell pellets were re-inoculated in fresh medium D at 0.3E6 cells / mL and cell growth was monitored for the next 5 days.

[0390] result In the first passage, over the course of three days, both cell line B derived from the 4x-tfxn cell pool and the parental cell line grew well under tyrosine-free medium conditions, while the 4x-control-tfxn cell pool did not show any growth (Figure 29). In the second passage, similar to the first round, the 4x-tfxn cell pool grew well, while the 4x-control-tfxn cell pool did not show any growth. This data suggested that the 4x-tfxn cell pool could synthesize tyrosine from phenylalanine, thus promoting channeling of amino acid flux away from the phenyllactate, 3-(4-hydroxyphenyl)lactate, and 4-hydroxyphenyllactate inhibitor biosynthetic pathways (see Example 19).

[0391] Furthermore, it was also observed that 3x-tfxn cell pools (with overexpression of PAH, HPD, and HGD) derived from both cell line B and the parental cell line were unable to grow in tyrosine-free medium (data not shown). This suggested that expression of PCBD1 is crucial for the cells' ability to biosynthesize tyrosine. It has been previously reported that the activity of PAH enzymes is enhanced at high pH (Parniak et al., 1988). Cultivation of 4x-tfxn cell pools under tyrosine-free conditions at higher pH (>7.0) further increased cell growth rate and viability (data not shown).

[0392] (Example 19) (i) demonstration of similar or better growth / productivity of 4x-tfxn cell pools in tyrosine-free fed-batch cultures compared to 4x-control-tfxn cell pools in tyrosine-supplemented cultures, and (ii) reduced accumulation of 3-(4-hydroxyphenyl)lactate, a by-product of the tyrosine pathway, in 4x-tfxn cultures. the goal The goal of this experiment was to demonstrate that 4x-tfxn cell pools can grow in tyrosine-free HiPDOG culture at similar or higher growth rates, reach similar or higher peak cell densities, and produce similar or higher titers when compared to 4x-control-tfxn cell pools in typical (tyrosine-supplemented) HiPDOG cultures. Another goal was to establish that the combination of PAH, HPD, HGD, and PCBD1 expression with culture in tyrosine-free medium suppresses production of the tyrosine pathway metabolic by-product, 3-(4-hydroxyphenyl)lactate.

[0393] material and method: Cells and bioreactor setup 4x-tfxn cells and 4x-control-tfxn cell pools derived from recombinant antibody expressing CHO cell line B were used in this example. The 4x-tfxn cell pool expressed the four mouse enzymes (PAH, HPD, HGD, and PCBD1), while the 4x-control-tfxn cell pool was a control cell that expressed only resistance markers to the selection pressure.

[0394] Cell line B, derived from the 4x-control-tfxn cell pool, was inoculated at 1.2E6 cells / mL in HIPDOG fed-batch cultures using tyrosine-free medium A or the original formulation of medium A (containing tyrosine), respectively (see Example 18 for information on medium A). To supplement nutrients during the culture, tyrosine-free feed medium B was used for the 4x-tfxn cell pool fed-batch cultures, while the original composition of feed medium B (containing tyrosine) was used for the 4x-control-tfxn fed-batch cultures (see below for information on medium B). For both conditions, the culture volume (1 L) and process parameters, including temperature (36.5° C.), pH (up to day 2: 7.15-7.20, after day 2: 7.10-7.15), and agitation speed (259 rpm), were identical. The HiPDOG strategy was used throughout the run. Viable cell density, glucose, lactate, ammonia, and amino acid concentrations were measured daily for up to day 12. Supernatant samples from both conditions were analyzed for levels of 3-(4-hydroxylphenyl)lactate using NMR techniques described below. Culture amino acid levels were measured using the amino acid analysis methods described below.

[0395] Medium B has the same composition as medium 5 (US7294484, Table 7) but contains higher levels of amino acids (2.5-fold). The concentrations of amino acids in medium B are shown in Table 9.

[0396] [Table 9]

[0397] NMR sample preparation, data acquisition and processing 1000 μL of each sample was filtered using Nanosep 3K Omega microcentrifuge filter tubes for 60 min, and 630 μL of the filtered sample was used for NMR analysis. These filters were preserved in glycerol, so some traces of glycerol may appear in the analysis. An internal standard solution was added to each sample solution, and the resulting mixture was vortexed for 30 seconds. 700 μL of the centrifuged solution was transferred to an NMR tube, and data was acquired.

[0398] NMR spectra were acquired on a Varian 4-channel VNMRS 700MHz NMR spectrometer equipped with an autotuned cryogenically cooled 1H / 13C triple resonance biomolecular probe. The pulse sequence used was 1D-tnnoesy with 990ms presaturation for water and 4s acquisition time. Spectra were collected at 298K using 32 transient and 4 steady-state scans.

[0399] Spectra were processed and .cnx files were generated using the Processor module of Chenomx NMR Suite 8.0. Compounds were identified and quantified using the Profiler module of Chenomx NMR Suite 8.0 with the Chenomx Compound Library version 9, which contains 332 compounds. For reporting purposes, profiled concentrations were corrected to reflect the composition of the original sample instead of the contents of the NMR tube. During sample preparation, each sample was diluted by introducing an internal standard to increase the analysis volume of small samples, if necessary.

[0400] Amino acid analysis Ten microliters of standard amino acid mix solution or spent medium sample (10-fold diluted sample) was mixed with 70 μL of AccQ·Tag Ultra Borate Buffer (Waters UPLC AAA H-Class Applications Kit [176002983]) and 20 μL of AccQ·Tag reagent previously dissolved in 1.0 mL of AccQ·Tag Ultra Reagent Diluent was added. The reaction was allowed to proceed for 10 min at 55 °C. Liquid chromatographic analysis was performed on a Waters Acquity UPLC system equipped with a binary solvent manager, autosampler, column heater, and PDA detector. The separation column was a Waters AccQ·Tag Ultra column (2.1 mm id × 100 mm, 1.7 μm particles). The column heater was set at 55 °C and the mobile phase flow rate was maintained at 0.7 mL / min. Eluent A was 10% AccQ·Tag Ultra concentrated solvent A and eluent B was 100% AccQ·Tag Ultra solvent B. The nonlinear separation gradient was 0–0.54 min (99.9% A), 5.74 min (90.0% A), 7.74 min (78.8% A), 8.04–8.64 min (40.4% A), and 8.73–10 min (99.9% A). One microliter of sample was injected for analysis. The PDA detector was set at 260 nm. The elution times previously determined for the amino acids were used to identify specific amino acid peaks on the chromatograms of each sample. Amino acid concentrations were estimated using the area under the peak and a calibration curve constructed using a standard solution (Amino Acids Standard H, Thermo Scientific, PI-20088).

[0401] result The cell pools in both cultures grew in an exponential manner, with slightly better growth observed in the 4x-tfxn cell tyrosine-free fed-batch culture compared to the 4x-control-tfxn culture (Figure 30A). Both cultures achieved a peak cell density of 35E6 cells / mL between days 7 and 9 of culture. In both cultures, cell viability was greater than 97% through day 12 of culture (Figure 30B). The titer profiles of both cultures were very similar, with a titer of 2.5 g / L on day 11 (Figure 30C). Additionally, 4x-tfxn cells were observed to consume phenylalanine at a faster rate than 4x-control-tfxn cells (data not shown). Tyrosine accumulation was observed in the 4x-tfxn culture (data not shown). This suggested that 4x-tfxn cells converted phenylalanine to tyrosine to supply it for the physiological needs of the cells (biomass and protein synthesis). Excess tyrosine was secreted into the culture medium. 4x-control-tfxn cultures were supplemented with exogenous tyrosine in the inoculation and feed medium. The levels of tyrosine declined over the course of the 4x-control-tfxn cultures, indicating consumption of tyrosine by these cells (data not shown). Furthermore, the levels of a by-product of tyrosine metabolism, 3-(4-hydroxyphenyl)lactate, were significantly lower in 4x-tfxn cultures compared to 4x-control-tfxn cultures, indicating lower channeling of phenylalanine and / or tyrosine towards by-product synthesis (Figure 30D).

[0402] (Example 20) Probing the effects of 2-methylbutyrate and isobutyrate on the growth of CHO cells the goal: 2-Methylbutyrate and isobutyrate are by-products of the isoleucine and valine pathways, which were observed to accumulate in HiPDOG fed-batch cultures of CHO cell line A. The levels of accumulation at day 7 were approximately 9 mM for 2-methylbutyrate and 2 mM for isobutyrate (data not shown; accumulation in CHO cell line C is in the same order (see Example 21)). This experiment was set up to individually probe the effect of these two compounds on the growth of CHO cell line A within the concentration range observed in HiPDOG fed-batch cultures.

[0403] material and method: CHO cell line A producing recombinant antibody was seeded at low cell density (0.1E6 cells / mL) in 6-well plate culture medium in triplicate under various conditions. Working volume of each well on day 0 was 4 mL. Conditions tested included fresh medium A or fresh medium A supplemented with 2-methylbutyrate or isobutyrate individually at various concentrations. Concentrations tested for 2-methylbutyrate were [0, 5, 10, and 20 mM], and concentrations tested for isobutyrate were [0, 1, 2, and 4 mM]. 6-well plates were incubated on a shaking platform at 36.5° C. and 5% carbon dioxide. Cell growth under all conditions was monitored for 5 days.

[0404] result: Figure 31 shows the independent effects of 2-methylbutyrate or isobutyrate on the growth of CHO cell line A. Cells cultured in fresh medium grew very well. Cell growth was suppressed when cells were cultured in fresh medium supplemented with 2-methylbutyrate (Figure 31A) or isobutyrate (Figure 31B) at concentrations above 5 mM or 1 mM, respectively. This demonstrates that 2-methylbutyrate and isobutyrate inhibit cell growth. 2-Methylbutyrate is a metabolic by-product of isoleucine metabolism, and isobutyrate is a metabolic by-product of valine metabolism.

[0405] Example 21 Demonstration of reduced accumulation of 2-methylbutyrate or isobutyrate by limitation of isoleucine or valine, respectively, in fed-batch cultures of CHO cells (CHO cell line C). the goal The primary goal of this example was to demonstrate the reduction of 2-methylbutyrate or isobutyrate accumulation in fed-batch cultures of CHO cells by limiting the supply of isoleucine or valine, respectively.

[0406] material and method Cells and bioreactor setup A GS-CHO cell line expressing a recombinant antibody (cell line C) was used in this example. Two conditions were tested as part of this example: A) Fed-batch culture with low levels of isoleucine and valine (low AA), B) Fed-batch culture with normal amino acid concentrations (control). The experiment was run for 12 days.

[0407] Exponentially growing cells from the seed culture were inoculated at approximately 4E6 cells / mL into production bioreactors using a typical fed-batch process (with typical levels of amino acids) or a low amino acid fed-batch process. In the low amino acid condition, the concentrations of isoleucine and valine were maintained between 0.5 mM and 1 mM for the first 7 days of culture, after which they were increased to above 1 mM. Viable cell density, glucose, lactate, ammonia, and amino acid concentrations were measured daily until day 12. For both conditions, the culture volume (1 L) and process parameters including temperature (36.5 °C), pH (6.9-7.2), and agitation speed (259 rpm) were identical. The basal medium used in the control condition was medium A, and that used in the low amino acid condition was a modified version of medium A with low concentrations of amino acids including tyrosine, phenylalanine, methionine, tryptophan, serine, glycine, threonine, leucine, isoleucine, and valine. The feed medium used for both conditions was medium B. The amino acid levels in medium B were adjusted so that the amount of amino acids delivered by feeding medium B in a semi-continuous manner was approximately equal to the amount of amino acids absorbed by the culture. The feed rate used was proportional to the vital viable cells in the culture. Supernatant samples from both conditions were analyzed for 2-methylbutyrate and isobutyrate levels using NMR techniques as described in Example 19. Culture amino acid levels were measured using the amino acid analysis method described in Example 19.

[0408] result The concentrations of the amino acids, isoleucine, and valine, were successfully maintained between 0.5 mM and 1 mM under low AA conditions (Figures 32A and 32C). This restriction of amino acid levels under low AA conditions led to lower accumulation of 2-methylbutyrate (Figure 32B) and isobutyrate (Figure 32D).

[0409] Example 22 Experiments to determine genetic targets for metabolic engineering to suppress the biosynthesis of inhibitors (isovalerate, 2-methylbutyrate, and isobutyrate) produced from the branched-chain amino acid pathway the goal This experiment was conducted to determine the cause of the biosynthesis of isovalerate, 2-methylbutyrate, and isobutyrate, which are by-products of branched-chain amino acid metabolism that accumulated to very high levels in fed-batch cultures of CHO cells. Gene expression of all enzymes in the branched-chain amino acid pathway (BCAA) was probed. Based on gene expression analysis in the BCAA catabolic pathway, genetic targets for metabolic engineering of CHO cells (CHO cell line B and parental cell line) that suppress the biosynthesis of isovalerate, isobutyrate, and 2-methylbutyrate were identified.

[0410] result RT qPCR analysis was performed on leucine catabolic pathway genes. Log expression values ​​of genes in the leucine pathway are shown in Figure 33A. Gene expression data from the leucine pathway indicate that all enzymes in the pathway were expressed at similar levels. Gene expression of enzymes in the isoleucine and valine pathways was also observed to be relatively high in the parental cell line (data not shown). The data did not point towards obvious targets in the BCAA pathway that could explain the high rates of isovalerate, isobutyrate, and 2-methylbutyrate biosynthesis and secretion. However, enzymes downstream of the isovalerate, isobutyrate, or 2-methylbutyrate nodes may harbor loss-of-function mutations that could explain the channeling of flux towards isovalerate, isobutyrate, or 2-methylbutyrate. Because BCAT1 (or BCAT2) and BCKDHA / BCKDHB enzymes catalyze the first two steps in all three branched-chain amino acid pathways, knockdown or knockout or inhibition of the activity of any of the above-mentioned enzymes was performed with the aim of reducing the biosynthesis of isovalerate, isobutyrate, and 2-methylbutyrate (Figure 33B).

[0411] (Example 23) Generation of a transient BCAT1 knockdown CHO cell pool that suppresses the production of BCAA pathway inhibitors (isovalerate, 2-methylbutyrate, and isobutyrate) biosynthesis the goal This experiment was set up to knock down BCAT1 gene expression in CHO cell line B and the CHO parental cell line in order to limit the amount of isovalerate, isobutyrate, and 2-methylbutyrate produced in the respective cell cultures.

[0412] material and method miRNA knockdown works by expressing small RNA sequences (approximately 20-25 bases) that are complementary to a target gene sequence (e.g., BCAT1). miRNAs bind to the messenger RNA (mRNA) of the target gene and form a region of double-stranded RNA. This double-stranded RNA is targeted for cleavage and degradation by the cell, resulting in a net reduction in the mRNA being translated, and therefore the protein being produced. MicroRNA knockdown of BCAT1 was performed using the BLOCK-iT Inducible Pol II miR RNAi Expression Vector Kit (Invitrogen) with EmGFP. Five miRNA oligonucleotide pairs (complementary top and bottom strands of BCAT1) were designed using an online tool called Block-iT RNAi Designer (https: / / rnaidesigner.thermofisher.com / rnaiexpress / ), and DNA oligonucleotides were prepared by Integrated DNA Technology (www.idtdna.com). The oligonucleotide pairs were annealed and ligated into the pcDNA™6.2-GW / EmGFP-miR vector. The vectors (five of these) were sequence confirmed by WyzerBiosciences (Cambridge, MA). The five miRNA vectors or a negative control vector named pcDNA™6.2-GW / EmGFP-miR-neg (provided by Invitrogen with the kit) were transfected into CHO parental cell line or CHO cell line B using a GenePulser XCell electroporator (BioRad) and allowed to recover for two days. After 2 days, cells were subjected to antibiotic (plastocidin, 10 μg / mL) selection pressure to generate stable cell pools (see Example 24), or cell lysates from transfected (or non-transfected) cells were prepared with M-PER Protein Extraction Reagent (Thermo Fisher) supplemented with cOmplete, Mini, EDTA-free protease inhibitor cocktail (Roche).Samples were analyzed by Western blot using a Novex NuPage system (Thermo Fisher). The system provides polyacrylamide gels, sample loading buffer, sample reducing agent, gel running buffer, protein mass standards, nitrocellulose membranes, and chemiluminescence detection reagents. Blots were probed with rabbit polyclonal anti-BCAT1 antibody (AbCam, catalog number ab110761) or B-actin antibody (AbCam, catalog number ab8227). Western blots were imaged and analyzed for levels of B-actin and BCAT1 using a BioRad ChemiDoc system.

[0413] BCAT1 miRNA sequence used: miRNA seq1.1a:TGGGAGAAGCCTCACATTAAA miRNA seq2.1a:TCTGCTGTGAGGACCACTTTG miRNA seq3.1a:AGTGGGCACGATGAATCTGTT miRNA seq4.1a:CACGATGAATCTGTTCCTCTA miRNA seq5.1a:CTTGGGCAAACTGACTGATAT

[0414] result Figure 34 shows a Western blot of BCAT1 and B-actin protein levels in transiently transfected cells. B-actin was included as a housekeeping gene (or protein) and used as an internal comparator of protein expression. The levels of B-actin were similar across all five miRNA (transient) transfections, negative miRNA control transfected and non-transfected cells (for both CHO cell line B and parental cell line). This evenly demonstrated protein loading across all conditions (Figures 34A and 34C). In the CHO parental cell line transient transfections, lower levels of BCAT1 protein were observed in the case of knockdown using miRNA Seq 2.1a, miRNA Seq 3.1a, miRNA Seq 4.1a and miRNA Seq 5.1a. In the parental cell line transient transfections, lower levels of BCAT1 protein were observed under all five knockdown conditions tested. The non-transfected and negative controls showed a more intense banding pattern, indicating higher levels of BCAT1 protein.

[0415] Example 24 Generation of a stable BCAT1 knockdown CHO cell pool that suppresses the production of BCAA pathway inhibitors (isovalerate, 2-methylbutyrate, and isobutyrate) biosynthesis the goal The primary goal of this experiment was to develop stable CHO cell pools with reduced levels of BCAT1, with the aim to further demonstrate that these stable pools had a reduced ability to produce BCAA pathway inhibitor metabolites (isovalerate, 2-methylbutyrate, and isobutyrate), which resulted in better growth and productivity.

[0416] result Parental and CHO cell line B cells transfected with five BCAT1 miRNA knockdown vectors were selected for stable cell pools. The stable pools were then probed for BCAT1 protein levels. All stable pools of parental cell lines generated from transfection with five miRNAs reduced BCAT1 protein levels to various degrees when compared with stable pools generated from transfection with negative miRN sequence controls (Figures 35A and 35B). This indicated successful generation of stable cell pools with BCAT1 knockdown. Pools with lower BCAT1 protein levels were selected and tested for production of inhibitors including isovalerate, 2-methylbutyrate, and isobutyrate in fed-batch cultures (with or without HiPDOG strategy). Cultures producing lower levels of these inhibitory metabolites grew to higher cell densities and produced higher titers. An equivalent knockdown of the isoenzyme BCAT2 was also performed to demonstrate reduced levels of BCAT2 production in order to test for reduced production of inhibitors including isovalerate, 2-methylbutyrate, and isobutyrate. BCAT2 is an isoenzyme form of BCAT1, which is catalytically and functionally equivalent to BCAT1 and performs the same functions in the leucine, isoleucine, and valine pathway depicted in Figure 33B.

[0417] [Table 10-1]

[0418] [Table 10-2]

[0419] References Altamirano C、Illanes A、Becerra S、Cairo JJ、Godia F(2006)、Considerations on the lactate consumption by CHO cells in the presence of galactose. Journal of biotechnology、125:547~556 Bertoni JM(1981)、Competitive inhibition of rat brain hexokinase by 2-deoxyglucose、glucosamine、and metrizamide.Journal of neurochemistry、37:1523~1528 Clem B、Telang S、Clem A、Yalcin A、Meier J、Simmons A、Rasku MA、Arumugam S、Dean WL、Eaton J、Lane A、Trent JO、Chesney J(2008) Small-molecule inhibition of 6-phosphofructo-2-kinase activity suppresses glycolytic flux and tumor growth.、Molecular cancer therapeutics、7:110~120 Duvel K、Yecies JL、Menon S、Raman P、Lipovsky AI、Souza AL、Triantafellow E、Ma Q、Gorski R、Cleaver S、Vander Heiden MG、MacKeigan JP、Finan PM、Clish CB、Murphy LO、Manning BD(2010)、Activation of a metabolic gene regulatory network downstream of mTOR complex 1. Molecular cell、39:171~183 Gagnon M、Hiller G、Luan YT、Kittredge A、DeFelice J、Drapeau D(2011)、High-end pH-controlled delivery of glucose effectively suppresses lactate accumulation in CHO fed-batch cultures.Biotechnology and bioengineering、108:1328~1337 Kim SH、Lee GM(2007a)、Down-regulation of lactate dehydrogenase-A by siRNAs for reduced lactic acid formation of Chinese hamster ovary cells producing thrombopoietin.Applied microbiology and biotechnology、74:152~159 Kim SH、Lee GM(2007b)、Functional expression of human pyruvate carboxylase for reduced lactic acid formation of Chinese hamster ovary cells (DG44).Applied microbiology and biotechnology、76:659~665 Lee HLT、Boccazzi P、Gorret N、Ram RJ、Sinskey AJ(2004)、In situ bioprocess monitoring of Escherichia coli bioreactions using Raman spectroscopy.Vibrational Spectroscopy、35:131~137 Lee JS、Lee GM(2012)、Rapamycin treatment inhibits CHO cell death in a serum-free suspension culture by autophagy induction.Biotechnology and bioengineering、109:3093~3102 Li B、Ryan PW、Ray BH、Leister KJ、Sirimuthu NM、Ryder AG(2010)、Rapid characterization and quality control of complex cell culture media solutions using raman spectroscopy and chemometrics.Biotechnology and bioengineering、107:290~301 Morgan HP、O’Reilly FJ、Wear MA、O’Neill JR、Fothergill-Gilmore LA、Hupp T、Walkinshaw MD(2013)、M2 pyruvate kinase provides a mechanism for nutrient sensing and regulation of cell proliferation.Proceedings of the National Academy of Sciences of the United States of America、110:5881~5886 Mulukutla BC、Gramer M、Hu WS(2012)、On metabolic shift to lactate consumption in fed-batch culture of mammalian cells.Metabolic engineering、14:138~149 Whelan J、Craven S、Glennon B(2012)、In situ Raman spectroscopy for simultaneous monitoring of multiple process parameters in mammalian cell culture bioreactors. Biotechnology progress、28:1355~1362 Whitehouse S、Cooper RH、Randle PJ(1974)Mechanism of activation of pyruvate dehydrogenase by dichloroacetate and other halogenated carboxylic acids.The Biochemical journal、141:761~774 Wlaschin KF、Hu WS(2007)Engineering cell metabolism for high-density cell culture via manipulation of sugar transport.Journal of biotechnology、131:168~176 Yi W、Clark PM、Mason DE、Keenan MC、Hill C、Goddard WA、3rd、Peters EC、Driggers EM、Hsieh-Wilson LC(2012)、Phosphofructokinase 1 glycosylation regulates cell growth and metabolism.Science、337:975~980 Zhou M、Crawford Y、Ng D、Tung J、Pynn AF、Meier A、Yuk IH、Vijayasankaran N、Leach K、Joly J、Snedecor B、Shen A(2011)Decreasing lactate level and increasing antibody production in Chinese Hamster Ovary cells (CHO) by reducing the expression of lactate dehydrogenase and pyruvate dehydrogenase kinases.Journal of biotechnology、153:27~34 Zhu G、Zhu X、Fan Q、Wan X(2011)Raman spectra of amino acids and their aqueous solutions.Spectrochimica acta Part A、Molecular and biomolecular spectroscopy、78:1187~1195 Parniak、M.A.、Davis、M.D.、およびKaufman、S.(1988)Effect of alkaline pH on the activity of rat liver phenylalanine hydroxylase.、The Journal of biological chemistry、263、1223~1230。

Claims

[Claim 1] 1. A method of cell culture comprising the step of (i) initiating a cell culture process by providing cells in a cell culture medium, the cells having been modified to reduce levels of proliferation and / or synthesis of a productive inhibitor by the cells.

Images