Lipid nanoparticle formulations for crispr / cas components

Abstract

To provide lipid nanoparticle-based compositions and methods useful for delivery of CRISPR / Cas gene editing components.SOLUTION: A lipid nanoparticle (LNP) composition comprises: mRNA encoding a Cas nuclease; guide RNA nucleic acid; and a plurality of component lipids comprising the following: 35 mol% to 55 mol% of lipid A, which is (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate; 35 mol% to 55 mol% of a helper lipid; 5 mol% to 15 mol% of a neutral lipid; and 1 mol% to 5 mol% of a stealth lipid.SELECTED DRAWING: None

Description

[Technical field]

[0001] This application is a continuation of U.S. Provisional Patent Application No. 62 / 315,602, filed March 30, 2016. Detailed Description, U.S. Provisional Patent Application No. 62 / 375,776, filed August 16, 2016; No. 62 / 433,228, filed December 12, 2016; and Priority to U.S. Provisional Patent Application No. 62 / 468,300, filed March 7, 2017 the entire contents of each of which are incorporated herein by reference. [Background technology]

[0002] Delivery of biologically active agents (including compounds of therapeutic interest) to a subject involves the delivery of the agent to targeted cells or tissues. The application of ELISAs to living cells is often hindered by the difficulty of accessing tissues. The transport of many biologically active agents can be restricted by the membrane system of cells.

[0003] One class of biologically active agents that are particularly difficult to deliver to cells are proteins, Biologics include nucleic acid-based drugs and their derivatives. Proteins are stable for a limited period in cells or plasma and are sometimes highly charged. This can complicate delivery across cell membranes. Of particular interest are compositions that can be stabilized and delivered to cells. Lipid carriers, biodegradable polymers and various co-polymers have been used to improve the delivery of biologically active agents. A conjugate system can be used.

[0004] Several components and compositions for editing genes in cells in vivo There are now genetic, viral, bacterial, autoimmune, cancer, age-related and inflammatory causes. These editing technologies offer numerous possibilities for treating sexual disorders. Some are enzymes, e.g. meganucleases, clustered regularly interspersed short palindromic oligonucleotides. Critical ribosomal repeat (CRISPR)-associated ("Cas") nucleases, zinc finger Nucleases ("ZFNs") and Transcription Activator-Like Effector Nucleases ("TA The present study exploits the cellular machinery to repair double-strand breaks ("DSBs") formed by the IL-1 receptor endothelial cell wall (IL-1) and the IL-2 receptor endothelial cell wall (IL-2). When a DSB occurs in a cell, the cell can repair the break in one of several ways. One such method is non-homologous end joining of the broken ends of DNA. ("NHEJ"). During NHEJ, cells add or remove nucleotides In other situations, cells may be able to express Repair DSBs by homozygous directed repair ("HDR") or homologous recombination ("HR") mechanisms In one embodiment, an endogenous or exogenous template having homology to each end of a DSB is used to guide the cleavage. Some of these editing technologies are used to induce repair of single-strand breaks. or exploiting the cellular machinery for repairing double strand breaks ("DSBs"). Summary of the Invention

[0005] CRISPR / Cas gene editing systems are active as ribonucleoprotein complexes in cells. The delivery of CRISPR / Cas protein and nucleic acid constructs to cells, such as cells of a patient. There is a need for compositions for delivery of

[0006] The present inventors have demonstrated that lipids that are beneficial for delivery of CRISPR / Cas gene editing components. Kind Code: A1 Provided herein are compositions based on porous nanoparticles.

[0007] In some embodiments, the inventors provide a method for generating genetically engineered liver cells. Described herein is a method comprising contacting a cell with a lipid nanoparticle (LNP) comprising: Provided: Class 2 Cas nuclease mRNA; Guide RNA nucleic acid; CCD lipid; He luper lipids; neutral lipids; and stealth lipids. Class 2 Cas nuclease mRNA, Lipids including guide RNA nucleic acid, CCD lipids, helper lipids, neutral lipids and stealth lipids Nanoparticles (LNPs) are also provided.

[0008] Further embodiments include a method of gene editing, comprising administering to a subject a Class 2 Cas nuclease mRNA. class 2 CasmR, which delivers NA and guide RNA nucleic acids to liver cells NA and guide RNA nucleic acids are: CCD lipids; helper lipids; neutral lipids; and stealth lipids. The method further comprises the step of: formulating at least one LNP composition comprising a lipid. Further embodiments include a method of administering a CRISPR-Cas complex to liver cells, the method comprising: Cells: Class 2 Cas nuclease mRNA; guide RNA nucleic acid; CCD lipid; helper and contacting the LNP with a LNP comprising a stealth lipid; a neutral lipid; and a stealth lipid. Provide.

[0009] In certain embodiments, a method of altering expression of a gene in a liver cell comprises: Class 2 Cas nuclease mRNA and guide R as one or more LNP formulations administering to a subject a therapeutically effective amount of a NA nucleic acid, wherein at least one LNP formulation comprises: Guide RNA or class 2 Cas nuclease mRNA; CCD lipid; helper A method is provided comprising: a lipid; a neutral lipid; and a stealth lipid.

[0010] In some embodiments, the method of generating genetically engineered liver cells includes: Cas nuclease mRNA; single guide RNA (sgRNA) or a guide RNA nucleic acid encoding the CCD lipid; a helper lipid; a neutral lipid; and a stealth lipid. The method includes contacting the lipid nanoparticle (LNP) with a lipid nanoparticle (LNP) comprising a lipid.

[0011] In certain embodiments, the Class 2 Cas nuclease mRNA is present in the first LNP composition. In another embodiment, the LNP composition is a nucleic acid sequence that is capable of binding to a target nucleic acid, and the guide RNA nucleic acid is formulated in the second LNP composition. The class 2 Cas nuclease mRNA and guide RNA nucleic acid are included in the LNP composition. It is formulated together. [Brief description of the drawings]

[0012] [Figure 1] FIG. 1 shows expression of GFP following delivery of various LNP formulations at amounts of 100 ng and 500 ng of eGFP mRNA per well into mouse hepatocytes (Hepa1.6). [Diagram 2] FIG. 1 shows gLUC expression in mice following administration of various doses of various LNP formulations, which resulted in a dose-dependent response. [Diagram 3] Figure 3A shows the editing efficiency of factor VII targeting in mice after administration of various LNP formulations. Figure 3B shows the editing efficiency of TTR targeting in mice after administration of various LNP formulations. [Figure 4]Figure 4A shows the editing efficiency of TTR targeting in mice after delivery of various LNP formulations with different administration regimens in which gRNA and Cas9 mRNA are formulated separately. Figure 4B shows the editing efficiency of TTR targeting in mice after delivery of LNP formulations in which gRNA and Cas9 mRNA are formulated separately. [Diagram 5] FIG. 1 shows the editing efficiency of Factor VII or TTR targeting in cells following administration of various LNP formulations in which gRNA and Cas9 mRNA were formulated separately. [Figure 6] FIG. 1 shows the editing efficiency of Factor VII or TTR targeting in mice following administration of various LNP formulations in which gRNA and Cas9 mRNA were formulated separately. [Figure 7] FIG. 1 shows the editing efficiency in cells following administration of various LNP formulations in which gRNA and Cas9 mRNA are formulated together and delivered at various concentrations. [Figure 8-1] FIG. 8A shows the editing efficiency of TTR targeting in mice following administration of various LNP formulations. [Figure 8-2] FIG. 8B shows the editing efficiency of Factor VII targeting in mice following administration of various LNP formulations. [Figure 9] FIG. 1 shows PCR amplification of excision site DNA collected from animals administered various LNP formulations. [Figure 10] FIG. 1 shows serum TTR levels in mice administered various LNP formulations in which gRNA and Cas9 mRNA were formulated together. [Figure 11] FIG. 1 shows relative Factor VII activity in mice after administration of various LNP formulations in which gRNA and Cas9 mRNA were formulated together to the animals. [Figure 12-1] FIG. 12A shows the editing efficiency of TTR targeting in mice after administration of various doses of LNP-169, which produced a dose-dependent response. [Figure 12-2]FIG. 12B shows serum TTR levels in mice on various days after administration of various doses of LNP-169, which produced a dose-dependent response. [Figure 13-1] FIG. 13A shows the editing efficiency of TTR targeting in mice following administration of various LNP formulations with different Cas9 mRNA to sgRNA ratios. [Figure 13-2] FIG. 13B shows serum TTR levels in mice on two separate days following administration of various LNP formulations with different Cas9 mRNA to sgRNA ratios. [Figure 14-1] FIG. 14A shows the editing efficiency of TTR targeting in mice following administration of one or two doses of LNP-169. [Figure 14-2] FIG. 14B shows serum TTR levels in mice 9 days after administration of one or two doses of LNP-169. [Figure 15] FIG. 1 shows the editing efficiency of TTR targeting in the spleen of mice following administration of various LNP formulations. [Figure 16] FIG. 1 shows the editing efficiency of TTR targeting in mice following administration of various LNP formulations. [Figure 17] FIG. 13 shows the editing efficiency of TTR targeting in primary mouse hepatocytes following delivery of various concentrations of LNP-169 to the cells in the presence of mouse serum. [Figure 18] FIG. 1 shows increased LNP binding by ApoE with increasing abundance of ApoE. [Figure 19] FIG. 1 shows the editing efficiency of various LNP formulations in which guide RNA was delivered as a DNA expression cassette. [Figure 20] FIG. 1 shows that editing efficiency correlates between primary hepatocyte cultures and in vivo mouse liver cells. [Figure 21] FIG. 1 shows the distinct repair spectra of editing in Neuro 2A in vitro cell lines versus primary mouse hepatocytes. [Figure 22]FIG. 1 shows similar repair spectra of editing in primary mouse hepatocytes versus in vivo mouse hepatocytes. [Figure 23] FIG. 1 shows plasma concentrations of Cas9 mRNA and guide RNA as a function of time. [Figure 24] FIG. 1 shows the concentration of Cas9 mRNA and guide RNA in liver tissue as a function of time. [Diagram 25] FIG. 1 shows the concentration of Cas9 mRNA and guide RNA in spleen tissue as a function of time. [Figure 26-1] FIG. 26A shows the relative concentrations of Cas9 mRNA and guide RNA in plasma and tissues as a function of time. [Figure 26-2] FIG. 26B shows lipid A concentrations in plasma and tissues as a function of time. [Figure 27] FIG. 1 shows changes in plasma cytokine levels as a function of time following administration of LNPs. [Figure 28] FIG. 1 shows serum TTR levels in mice over time after administration of LNPs. [Figure 29-1] FIG. 29A shows TTR editing over time in mice following administration of LNP. [Figure 29-2] FIG. 29B shows TTR editing and serum TTR levels over time in mice following administration of LNP. [Diagram 30] FIG. 1 shows cytokine levels in mouse serum following administration of LNPs containing different mRNA preparations. [Diagram 31] FIG. 1 shows TTR concentration levels in mouse serum after administration of LNPs containing different mRNA preparations. [Diagram 32] FIG. 1 shows TTR editing levels over time in mice following administration of LNPs containing different mRNA preparations. [Diagram 33] FIG. 1 shows TTR concentration levels in mouse serum after administration of LNP stored at −80° C. or 4° C. [Diagram 34]FIG. 13 shows mouse TTR editing levels following administration of LNPs stored at −80° C. or 4° C. [Diagram 35] FIG. 1 shows serum concentration levels in mice after administration of various formulations. [Diagram 36] FIG. 1 shows mouse liver TTR editing levels after administration of various formulations. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0013] The present disclosure provides CRISPR / C vectors for delivery to cells and methods for their use. Embodiments of lipid nanoparticle (LNP) compositions of as component ("cargo") are provided. NPs consist of (i) CCD lipids, (ii) neutral lipids, (iii) helper lipids, and (iv) In certain embodiments, the cargo may contain a stealth lipid. Which Cas nuclease-encoding mRNA and guide RNA or guide RNA The nucleic acid encoding the

[0014] CRISPR / Cas cargo CRISPR / Cas cargo delivered through LNP formulations expresses Cas nucleases. The Cas nuclease comprises an mRNA molecule encoding the Cas nuclease, allowing expression of the Cas nuclease in the cell. The nucleic acid further comprises one or more guide RNAs or a nucleic acid encoding a guide RNA. The cargo can further comprise a template nucleic acid for repair or recombination.

[0015] Cas nuclease One component of the disclosed formulation is Ca, also called Cas nuclease mRNA. s nuclease-encoding mRNA. Improved stability and / or immunogenicity To achieve this, the mRNA can be modified. The modification can be to one or more nucleotides in the mRNA. Examples of chemical modifications to mRNA nucleobases include pseudotypes. Contains uridine, 1-methyl-pseudouridine and 5-methylcytidine. Stability Further known modifications that improve expression and immunogenicity are contemplated. The mRNA encoding the enzyme is expressed in a particular cell type, e.g., a eukaryotic cell, a mammalian cell, or a more specific More specifically, the codons can be optimized for expression in human cells. In this embodiment, the mRNA is transfected with a human codon-optimized Cas9 nuclease as the Cas nuclease. In some embodiments, the mR In some embodiments, the mRNA is purified by precipitation methods (e.g., LiCl precipitation, agarose). or equivalent methods, e.g., as described herein). In some embodiments, the mRNA is purified by chromatography-based methods, such as H Using PLC-based or equivalent methods (e.g., those described herein), In some embodiments, mRNA is purified using precipitation methods (e.g., LiCl precipitation). and HPLC-based methods.

[0016] In addition to the coding sequence of the Cas nuclease, the mRNA contains 3' and 5' untranslated regions ( In some embodiments, the 3' or 5' UTR can include a human genetic Exemplary 3' and 5' UTRs include α- and β-glucosidases. These include robin, albumin, HSD17B4 and eukaryotic elongation factor 1α. Alternatively, 5' and 3' UTRs from viruses can be used, examples of which include orthopox The sequences may include the UTR sequences of viruses and cytomegaloviruses. In an embodiment, the mRNA includes a 5' cap, such as m7G(5')ppp(5')N. In addition, the cap can be cap-0, where nucleotide N does not contain 2'OMe; is a cap-1 in which nucleotide N contains 2'OMe, or a cap-2 in which nucleotides N and N +1 may be capped -2 ​​containing 2'OMe. This cap is an anti-reverse Incorporated by cap analog (ARCA), m2 7,3’O The structure of G(5')N and similar structures such as cap-0, cap-1 and cap-2. In some embodiments, the 5' cap may comprise: Preventing exonucleolytic degradation; promoting translation; and The stabilizing elements for the cap include phosphorothioate, which can promote intron excision. ester linkages, boranophosphate modifications and methylene bridges. is a non-nucleic acid that acts as a binding element for eukaryotic translation initiation factor 4E, eIF4E. In certain embodiments, the mRNA may also contain a poly(A) tail. The tail may be about 40 to about 300 nucleotides in length. In some embodiments, the tail may be about 40 to about 100 nucleotides in length. In some embodiments, the tail may be about 100 to about 300 nucleotides in length. In some embodiments, the tail may be about 100 to about 300 nucleotides in length. In some embodiments, the tail may be about 50 to about 200 nucleotides in length. In certain embodiments, the tail may be from about 50 to about 250 nucleotides in length. In some embodiments, the tail may be about 100, 150 or 200 nucleotides in length. The (A) tail is an exonucleoside that contains phosphorothioate linkages and nucleobase modifications. In addition, the poly(A) tail may contain modifications to prevent enzyme degradation. 3'"Cap" can contain modified or unnatural nucleobases or other synthetic moieties. It may contain "p".

[0017] The mRNAs described herein are capable of altering the intracellular half-life of the RNA In some embodiments, the nucleic acid sequence can include at least one element that increases the half-life of the RNA. In some embodiments, the half-life of the RNA can be decreased. In some embodiments, the element may be capable of increasing the stability of the RNA. In embodiments, the element may be capable of decreasing the stability of the RNA. In embodiments, the element is capable of promoting RNA decay. In some embodiments, the element is In some embodiments, the element is located in the 3'UTR of the RNA, and is capable of activating translation. For example, the element may be an mRNA decay signal. In some embodiments, the element can include a polyadenylation signal (PA). In some embodiments, the PA may be in the 3'UTR of the RNA. However, it may be free of PA, as it undergoes faster degradation in cells after transcription. In some embodiments, the element may include at least one AU-rich element (ARE). In some embodiments, the element does not include an ARE. An ARE can include tissue types, cell types, ARE-binding proteins (AREs) bind to ARE-binding proteins (AREs) in a timing-, cellular localization-, and environment-dependent manner. In some embodiments, the ARE can be a 50-150 nucleotide nucleotide sequence. In some embodiments, an ARE can include at least one of the sequences AUUUA. In some embodiments, the 3'UTR of the RNA may contain at least one copy of the In some embodiments, at least one ARE can be added. Woodchuck hepatitis virus (WHV) transcripts form tertiary structures to enhance expression. In some embodiments, the 3'UTR of the RNA may be a WPRE. In some embodiments, the element can be a fast or slow decay transcription factor. In some embodiments, the motif may be selected from other RNA sequence motifs present in the Each element may be used alone. In some embodiments, an element may be used in combination with one or more can be used in combination with the elements

[0018] In some embodiments, the nuclease encoded by the delivered mRNA is CR The Cas protein may include a Cas protein from an ISPR / Cas system. It can include at least one domain that interacts with a guide RNA ("gRNA"). In addition, Cas proteins can be guided to target sequences by guide RNAs. The guide RNA interacts with the Cas protein as well as the target sequence, thus In some embodiments, the guide RNA is a nucleic acid sequence that directs binding to the target sequence. While Cas proteins provide specificity, they are versatile and can be paired with different guide RNAs. In certain embodiments, the Cas protein is capable of cleaving different target sequences. In certain embodiments, Ca can cleave single-stranded or double-stranded DNA. The s protein is capable of cleaving RNA. In certain embodiments, the Cas protein In some embodiments, the Cas protein can nick the RNA. The molecule comprises at least one DNA binding domain and at least one nuclease domain. In some embodiments, the nuclease domain comprises a different In certain embodiments, the Cas protein may be a species that reduces nuclease activity. Cas proteins can be engineered to reduce or eliminate the binding of DNA sequences. and can be used to modulate its expression or activity.

[0019] In some embodiments, the CRISPR / Cas system comprises a ribonucleoprotein complex, The system may include class 1 or class 2 system components. For example, see Makarova et al., at Rev Microbiol, 13(11): 722-36 (2015);Shmakov et al., Molecular Cell, 60:385- 397 (2015). Class 2 CRISPR / Cas systems are characterized by a single protein effector Types II, V, and VI Cas proteins are referred to as "class 2 Cas nucleosides." A single protein, RNA-guided endonuclease, referred to herein as "endonuclease" Class 2 Cas nucleases include, for example, Cas9, Cpf 1, C2c1, C2c2 and C2c3 proteins. Cpf1 protein, Ze tsche et al., Cell, 163: 1-13 (2015), is homologous to Cas9 and acts as a RuvC-like nuclease. The Cpf1 sequence of Zetsche is incorporated by reference in its entirety. See, for example, Tables S1 and S3 in Zetsche.

[0020] In some embodiments, the Cas protein is from a type II CRISPR / Cas system. i.e., the Cas9 protein from the CRISPR / Cas9 system, or type It may also be a CRISPR / Cas system of V, such as the Cpf1 protein. In embodiments, the Cas protein is from a class 2 CRISPR / Cas system, That is, a single protein Cas nucleic acid such as the Cas9 protein or the Cpf1 protein Proteins of the class 2 Cas nuclease family may be D NA endonuclease activity, which are further described herein. By designing an appropriate guide RNA that It is possible.

[0021] Class 2 CRISPR / Cas system components are type IIA, type IIB, and type The Cas9 and its activators may be from type IIC, type V or type VI systems. The Cas9 protein or other components may be derived from Non-limiting exemplary species include Streptococcus pyogenes, Streptococcus Streptococcus thermophilus, Streptococcus species (St reptococcus sp., Staphylococcus aureus, Listeria inoculum Listeria innocua, Lactobacillus gasseri, Franc Francisella novicida, Wolinella succinogenes succinogenes, Sutterella wadsworthensis, cancer Gamma proteobacterium, Neisseria meningitidis s), Campylobacter jejuni, Pasteurella multocci Pasteurella multocida, Fibrobacter succino gene), Rhodospirillum rubrum, Nocardiopsis Nocardiopsis dassonvillei, Streptomyces pristinespira Squirrel (Streptomyces pristinaespiralis), Streptomyces viridochromogenes ( Streptomyces viridochromogenes, Streptomyces viridochromogenes (Strept omyces viridochromogenes, Streptosporangium roseum m roseum, Alicyclobacillus acidocaldar ius), Bacillus pseudomycoides, Bacillus seleni Bacillus selenitireducens, Exiguobacterium sibiricum (Exiguobacterium sibiricum), Lactobacillus delbrueckii ), Lactobacillus salivarius, Buchner's Lactobacillus (Lactobacillus buchneri), Treponema denticola, Microscilla marina, Burkholderiales s) Bacteria, Polaromonas naphthalenivorans, Polaromonas Polaromonas sp., Crocosphaera wats onii), Cyanothece sp., Microcystis aeruginosa, Synechococcus sp., Acetoha arabaticum lobium arabaticum, Ammonifex degensii, Calde Caldicelulosiruptor becscii, Candidatus des Candidatus Desulforudis, Clostridium botulinum um botulinum, Clostridium difficile, Fine Finegoldia magna, Natranerobius thermophilus aerobius thermophilus, Pelotomaculum the rmopropionium, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Arok Allochromatium vinosum, Marinobacter species er sp.), Nitrosococcus halophilus, Nitrosococcus Nitrosococcus watsoni, Pseudoalteromonas halopran Pseudoalteromonas haloplanktis, Tedonobacter racemifera acter racemifer, Methanohalobium evestigatum ), Anabaena variabilis, Nodularia spumigena ularia spumigena, Nostoc sp., Arthrospira maxima throspira maxima), Arthrospira platensis, Arthrospira Arthrospira sp., Lyngbya sp., Microcole Microcoleus chthonoplastes, Oscillatoria species sp.), Petrotoga mobilis, Thermosipho africanus (T hermosipho africanus, Streptococcus pasteurianus rianus, Neisseria cinerea, Campylobacter lari pylobacter lari, Parvibaculum lavamentivorans orans), Corynebacterium diphtheria or Acaryochloris mali In some embodiments, the Cas9 protein is , Streptococcus pyogenes. In some embodiments, The as9 protein is a member of Streptococcus thermophilus. In some embodiments, the Cas9 protein may be derived from Staphylococcus aureus ( In a further embodiment, the Cpf1 protein may be derived from Staphylococcus aureus. The quality is Francisella tularensis, Lachnospiraceae Bacteria, Butyrivibrio proteoclasticus, Peregrinibacteria bacteria, Parcubacteria cells Fungi, Smithella, Acidaminococcus, Candida Candidatus Methanoplasma termitum, Eubak Eubacterium eligens, Moraxella bovicli oculi), Leptospira inadai, Porphyromonas krebio Porphyromonas crevioricanis, Prevotella diziens siens or Porphyromonas macacae. In certain embodiments, the Cpf1 protein is selected from the group consisting of Acidaminococcus sp. occus) or from the family Lachnospiraceae.

[0022] In some embodiments, the Class 2 Cas nuclease is a Cas9 or Cpf1 nuclease. The protein may include at least one RuvC-like nuclease domain, such as a protein. In some embodiments, the Class 2 Cas nuclease comprises more than one nuclease domain. For example, a Class 2 Cas nuclease can include at least one R A uvC-like nuclease domain and at least one HNH-like nuclease domain. In some embodiments, the Class 2 Cas nuclease can be It may be possible to introduce a DSB. In some embodiments, class 2 Cas nucleic acids The nuclease can be engineered to contain only one functional nuclease domain. For example, class 2 Cas nucleases can be modified with One of the nuclease domains is mutated or completely or partially deleted. In some embodiments, the class 2 Cas nuclease can be modified to can be engineered so that it does not contain a functional RuvC-like nuclease domain. In other embodiments, the Class 2 Cas nuclease, e.g., the Cas9 protein, The nucleic acid sequence may be modified so as not to contain a specific HNH-like nuclease domain. In some embodiments where the nuclease domain is functional, the Class 2 Cas nuclease The enzyme is a nickase that is capable of introducing a single-strand break (a "nick") into a target sequence. In some embodiments, the nuclease domain of a class 2 Cas nuclease may be Conserved amino acids in are substituted to reduce or alter nuclease activity. In some embodiments, the mutation of the nuclease domain inactivates DNA cleavage activity. In some embodiments, the mutation in the nuclease domain is a class 2 It can inactivate one nuclease domain of Cas nuclease, In some embodiments, the nickase provides a RuvC-like nuclease domain. Exemplary amino acid substitutions in the RuvC-like nuclease domain include: The acid substitution was performed using D10A (based on the S. pyogenes Cas9 protein, e.g. For example, see UniProtKB-Q99ZW2 (CAS9_STRP1). Exemplary amino acid substitutions include D917A, E1006A, and D1255A (Flank et al., 2003). Francisella novicida U112Cpf1 (FnCpf1) sequence (U Based on niProtKB-A0Q7Q2 (CPF1_FRATN). In one embodiment, the nickase comprises an amino acid substitution in the HNH-like nuclease domain. Exemplary amino acid substitutions in the HNH-like nuclease domain include E76 2A, H840A, N863A, H983A and D986A (S. pyogenes nes) based on the Cas9 protein. Exemplary mutations include nuclease domain By altering the conserved catalytic residues in the domain, the nucleolytic activity of the domain is altered. In embodiments, the nuclease system described herein comprises a nickase, as well as a target sequence. The nucleic acid sequence may include a pair of guide RNAs that are complementary to the sense and antisense strands of the nucleic acid sequence, respectively. The guide RNA can generate nicks in the opposite strand of the target sequence (i.e., By targeting DSBs (double nicking) and inducing nickases to introduce them, A domain or region of a protein can be substituted with a portion of a different protein. Alternatively, chimeric Class 2 Cas nucleases can be used, e.g. , the nuclease domain is replaced with a domain from a different nuclease, such as Fok1. In certain embodiments, the Class 2 Cas nuclease can be It can be modified to reduce or eliminate ase activity. can be used in combination to modulate its expression or activity.

[0023] In an alternative embodiment, the Cas protein is a Cas protein of a type I CRISPR / Cas system. For example, the Cas protein may be a component of a Cas3 protein. In some embodiments, the Cas protein may be a type II CRISP protein. In some embodiments, the Cas protein may be from a Tyrosine / Cas system. In some embodiments, the CRISPR / Cas system may be from a Ca The s protein may be from a type IV CRISPR / Cas system. In an embodiment, the Cas protein is from a type V CRISPR / Cas system. In some embodiments, the Cas protein may be a type VI CRISPR / Ca In some embodiments, the Cas protein has RNA cleavage activity. It can have the following characteristics.

[0024] In some embodiments, the nuclease is fused to at least one heterologous protein domain. At least one protein domain can be linked to the N-terminus of the nuclease, In some embodiments, two or more different The seed protein domain is located at one or more positions in the nuclease.

[0025] In some embodiments, the protein domain facilitates transport of the nuclease to the nucleus of a cell. For example, the protein domain may be a nuclear localization signal (NLS). In some embodiments, the nuclease may be fused to 1-10 NLS(s). In some embodiments, the nuclease can be a nuclease having 1-5 NLS(s). In some embodiments, the nuclease is fused to one NLS. When one NLS is used, the NLS may be located at the N-terminus of the nuclease or In other embodiments, the nuclease may be fused to more than one NLS. In some embodiments, the nuclease can be capable of isolating two, three, four or five NLSs. In some embodiments, the nuclease can be fused to two NLSs. In certain circumstances, the two NLSs may be the same (e.g., In some embodiments, the nuclease may be one SV40 NLS, or different. In some embodiments, the nucleic acid is fused to two SV40 NLS sequences at the carboxy terminus. The lease can be fused to two NLSs, one at the N-terminus and one at the C-terminus. In some embodiments, the nuclease can be fused to three NLSs. In some embodiments, the nuclease may not be fused to an NLS. S is a sequence, e.g., SV40 NLS, PKKKRKV, or PKKKRRV. In some embodiments, the NLS may be a bipartite sequence, such as the NLS of nucleoplasmin, K In a specific embodiment, a single PKKK The NLS of RKV may be at the C-terminus of the nuclease.

[0026] In some embodiments, the protein domain alters the intracellular half-life of the nuclease. In some embodiments, it may be possible to increase the half-life of the nuclease. In some embodiments, the half-life of the nuclease can be reduced. In embodiments, the protein domain is capable of increasing the stability of the nuclease. In some embodiments, the protein domain reduces the stability of the nuclease. In some embodiments, the protein domain may be capable of undergoing proteolytic degradation. In some embodiments, the protein can act as a signal peptide for Protein degradation can be achieved by the use of proteolytic enzymes, such as proteasomes, lysosomal proteases or In some embodiments, the protein domain can be mediated by calpain proteases. In some embodiments, the nuclease can comprise a PEST sequence. It can be modified by the addition of chitin or polyubiquitin chains. Alternatively, the ubiquitin may be a ubiquitin-like protein (UBL). Non-limiting examples of proteins include small ubiquitin-like modifier (SUMO), ubiquitin UCRP, interferon-stimulated gene 15 (ISG15) and also known as ubiquitin-related modifier 1 (URM1), and Vacuole-expressed developmental down-regulated protein 8 (NEDD8, S. cerevisiae e) Rub1), human leukocyte antigen F-related (FAT10), autophagy-8 ( ATG8) and -12 (ATG12), Fau ubiquitin-like protein (FUB1), Membrane-anchored UBL (MUB), ubiquitin fold modifier 1 (UFM1), and These include ubiquitin-like protein 5 (UBL5).

[0027] In some embodiments, the protein domain may be a marker domain. Non-limiting examples of domains include fluorescent proteins, purification tags, epitope tags, and linker tags. In some embodiments, the marker domain comprises a fluorescent tandem gene sequence. Non-limiting examples of suitable fluorescent proteins include green fluorescent protein, Proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, sfGFP, EG FP, Emerald, Azami Green, Monomer Azami Green, C opGFP, AceGFP, ZsGreen1), yellow fluorescent protein (e.g., YF P, EYFP, Citrine, Venus, YPet, PhiYFP, ZsYello w1), blue fluorescent proteins (e.g., EBFP, EBFP2, Azurite, mK alamal, GFPuv, Sapphire, T-sapphire), cyan fluorescent Proteins (e.g., ECFP, Cerulean, CyPet, AmCyan1, Mi doriishi-Cyan), red fluorescent proteins (e.g., mKate, mKat e2, mPlum, DsRed monomer, mCherry, mRFP1, DsRed-E xpress, DsRed2, DsRed monomer, HcRed-Tandem, HcR ed1, AsRed2, eqFP611, mRasberry, mStrawberry , Jred), and orange fluorescent protein (mOrange, mKO, Kusa bira-Orange, monomer Kusabira-Orange, mTangeri ne, tdTomato), or any other suitable fluorescent protein. In embodiments, the marker domain may be a purification tag and / or an epitope tag. Non-limiting exemplary tags include glutathione-S-transferase (GST), chitin binding, Binding protein (CBP), maltose-binding protein (MBP), thioredoxin (T RX), poly(NANP), tandem affinity purification (TAP) tag, myc, AcV5, A U1, AU5, E, ECS, E2, FLAG, HA, nus, Softag1, Soft ag3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5 , VSV-G, 6xHis, 8xHis, biotin carboxyl carrier protein (B CCP), polyHis and calmodulin. Genes include glutathione-S-transferase (GST), horseradish peroxidase (HP). acetyltransferase (HRP), chloramphenicol acetyltransferase (CAT), beta -galactosidase, beta-glucuronidase, luciferase or fluorescent proteins Quality is included.

[0028] In further embodiments, the protein domain is associated with a specific organelle, cell type, tissue or In some embodiments, the protein domain can be targeted to the organelle. In can target nucleases to mitochondria.

[0029] In a further embodiment, the protein domain may be an effector domain. When a nuclease is directed to its target sequence, for example, the Cas9 protein guides the RNase. When guided to a target sequence by A, the effector domain modifies the target sequence. In some embodiments, the effector domain can have a nucleic acid binding ability. domain, nuclease domain, epigenetic modification domain, transcription activation domain, methylation The domain may be selected from a transcriptional repressor domain or a transcriptional repressor domain. In some embodiments, the DNA modifying domain is a methylation domain, e.g., a demethylation or methyltransferase domain. In certain embodiments, the effector domain is a salt In certain embodiments, the DNA-modifying domain is a base-editing domain. In is a nucleic acid editing domain that introduces specific modifications into DNA, such as a deaminase domain. International Application No. WO 2015 / 089406; U.S. Patent Application See Publication No. 2016 / 0304846. International Application No. WO 2015 / 0 No. 89406 and U.S. Patent Application Publication No. 2016 / 0304846 The nucleic acid editing domain, deaminase domain, and Cas9 variants described herein are is incorporated by reference in its entirety.

[0030] Guide RNA In some embodiments of the present disclosure, the cargo for the LNP formulation comprises at least one guide The guide RNA binds the class 2 Cas nuclease to a target sequence on the target nucleic acid molecule. The guide RNA can hybridize to the target sequence and induce the Ca gene. In some embodiments, the guide RNase cleaves or modulates it. A binds to and provides specificity for cleavage by class 2 nucleases. In the form of a ribonucleoprotein (RNP), the guide RNA and the Cas protein are In some embodiments, the CRISPR / Cas complex can be formed. The SPR complex may be a type II CRISPR / Cas9 complex. In morphology, the CRISPR / Cas complex is involved in transcriptional regulation of transcription of target genes, such as the Cpf1 / guide RNA complex. In some embodiments, the Cas nuclease may be a CRISPR / Cas complex of type V. The nuclease is a single protein Cas nuclease, such as the Cas9 protein or Cpf1. In some embodiments, the guide RNA can be a Cas9 protein. The cleavage is targeted by

[0031] The guide RNA for the CRISPR / Cas9 nuclease system is CRISPR RN A (crRNA) and tracr RNA (tracr). The crRNA is complementary to and hybridizes with a target sequence on a target nucleic acid molecule. The crRNA may include a targeting sequence that is complementary to a portion of the tracrRNA. In some embodiments, the marker may include a flagpole that is hybridized with the marker. , crRNA is a naturally occurring crRNA transcribed from the bacterial CRISPR locus. where the targeting sequence corresponds to the spacer of the CRISPR / Cas9 system. The flagpole acts as a promoter and flanks the spacer above the CRISPR locus. It corresponds to a part of the repeat sequence.

[0032] Guide RNA can target any sequence of interest through the targeting sequence of the crRNA. In some embodiments, the targeting sequence of the guide RNA and the target on the target nucleic acid molecule can be The degree of complementarity between the sequences is about 60%, 65%, 70%, 75%, 80%, 85%, 90%, %, 95%, 97%, 98%, 99% or 100%. The targeting sequence of the guide RNA and the target sequence on the target nucleic acid molecule are 100% complementary. In another embodiment, the targeting sequence of the guide RNA and the target on the target nucleic acid molecule may be The sequence may contain at least one mismatch. For example, the target of the guide RNA The target sequence on the target nucleic acid molecule may be 1, 2, 3, 4, 5, 6, 7, 8, 9 or In some embodiments, the targeting of the guide RNA can include 10 mismatches. The sequence and the target sequence on the target nucleic acid molecule can contain from 1 to 6 mismatches. In some embodiments, the targeting sequence of the guide RNA and the target sequence on the target nucleic acid molecule are It may contain 5 or 6 mismatches.

[0033] The length of the targeting sequence may depend on the CRISPR / Cas system and components used. For example, different Cas proteins from different bacterial species have different optimal targeting sequence lengths. Thus, the targeting sequence has the following structure: 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 2 7, 28, 29, 30, 35, 40, 45, 50, or more than 50 nucleotides In some embodiments, the targeting sequence can be 18 to 24 nucleotides in length. In some embodiments, the targeting sequence can be 19-21 nucleotides in length. In some embodiments, the targeting sequence can be 20 nucleotides long. The length of the

[0034] Flagpole is sufficient to promote the formation of functional CRISPR / Cas complexes. In some embodiments, the sequence may include any sequence that has complementarity with tracr RNA. The flagpole is complementary to the tracr RNA of the same CRISPR / Cas system. The entire sequence of the naturally occurring crRNA (also called the "tag" or "handle") In some embodiments, the flagpole may include a naturally occurring The repeat sequences may include all or part of a CRISPR / Cas system. In an embodiment, the flagpole may include a truncated or modified tag or hand In some embodiments, the tracr RNA and the two sequences The portion of the flagpole that hybridizes with tracr RNA along the short length of the The degree of complementarity between the moieties may be about 40%, 50%, 60%, 70%, 80% or more. In some embodiments, the tracr RNA and tracr R The portion of the flagpole that hybridizes with NA is the shorter of the two sequences. The complementarity is not 100% because of one or more raised structures on the tracr. This is due to the presence of and / or wobble base pairing between tracr and flagpole. The length of the flagpole depends on the CRISPR / Cas system or tracr RNA used. For example, a flagpole may be 10-50 nucleotides or more than 50 nucleotides. In some embodiments, the flagpole may include a length of nucleotides that is In another embodiment, the flagpole may be 15 to 40 nucleotides in length. In yet another embodiment, the fragment may have a length of 20 to 30 nucleotides. The guide pole can comprise a length of 22 nucleotides. For example, a double guide RNA If is used, the length of the flagpole may have no upper limit.

[0035] In some embodiments, the tracr RNA is a naturally occurring CRISPR / Cas system. The wild-type tracr RNA sequence may include all or part of the wild-type tracr RNA sequence from In this form, tracr RNA is a truncation or a conserved variant of wild-type tracr RNA. The length of the tracr RNA can be determined by the CRIS used. In some embodiments, the tracr RNA may be 5, 6 , 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100 or more than 100 In certain embodiments, the tracr can include at least In a further embodiment, the tracr is at least 40 nucleotides in length. In some embodiments, the tracr RNA has a particular secondary structure. structure, e.g., one or more hairpin or stem-loop structures, or one or A plurality of raised structures may be included.

[0036] In some embodiments, a guide RNA can comprise two RNA molecules, referred to as a "dual guide RNA." In some embodiments, the dgRNA is referred to herein as a "dgRNA" or "dgRNA." A is a first RNA molecule containing crRNA and a second RNA molecule containing tracrRNA. The first and second RNA molecules can include a flag A molecule on the crRNA. It is possible to form an RNA duplex through base pairing between the pole and the tracr RNA. Cut.

[0037] In further embodiments, the guide RNA may comprise a single RNA molecule and may be referred to as a "single guide RNA." In some embodiments, the sgR is referred to herein as a "sgRNA" or "sgRNA." The NA may comprise a crRNA covalently linked to a tracrRNA. In an embodiment, the crRNA and the tracrRNA are covalently linked through a linker. In some embodiments, the single molecule guide RNA can be a fragment of the crRNA. Involvement of a stem-loop structure through base pairing between the genomic DNA and tracr RNA In some embodiments, the sgRNA can be used to induce RNA-guided D-transcription by the Cas9 protein. In some embodiments, the Cas9 sgRNA is a "Cas9 sgRNA" capable of mediating NA cleavage. sgRNAs can mediate RNA-guided DNA cleavage by Cpf1 protein In certain embodiments, the guide RNA is a Cas 9 protein to form an active complex and mediate RNA-guided DNA cleavage. In certain embodiments, the guide RNA is a C sufficient to form an active complex with the pf1 protein and mediate RNA-guided DNA cleavage Contains crRNA. See Zetsche 2015.

[0038] Certain embodiments of the present invention relate to nucleic acids encoding the guide RNAs described herein. Also provided herein are, for example, expression cassettes. a dgRNA (e.g., sgRNA or dgRNA), and one or more guide RNAs It is used to refer to a guide RNA expression cassette, which is a nucleic acid encoding A.

[0039] In some embodiments, the nucleic acid may be a DNA molecule. In some embodiments, the nucleic acid sequence may include a nucleotide sequence encoding the crRNA. The nucleotide sequence encoding the crRNA is derived from a naturally occurring CRISPR / Cas system. In some embodiments, the nucleic acid comprises a targeting sequence flanked by all or a portion of the repeat sequences. The gene may include a nucleotide sequence encoding tracr RNA. In this form, crRNA and tracrRNA are encoded by two separate nucleic acids. In other embodiments, the crRNA and the tracrRNA may be contained in a single nucleic acid. In some embodiments, the crRNA and tracrRNA may be encoded by may be encoded by opposing strands of a single nucleic acid. A and tracr RNA may be encoded by the same strand of a single nucleic acid. In some embodiments, the expression cassette encodes an sgRNA. The cassette encodes a Cas9 nuclease sgRNA. The cassette encodes a Cpf1 nuclease sgRNA.

[0040] The nucleotide sequence encoding the guide RNA includes at least one transcriptional or regulatory control The sequence can be operably linked to a promoter, a 3'UTR, or a 5'UTR. In one example, the promoter is a tRNA promoter, e.g., a tRNA Lys3 Ma or a tRNA chimera. Mefferd et al., RNA. 2015 21:1683-9; Scherer et al. See, e.g., et al., Nucleic Acids Res. 2007 35: 2620-2628. The promoter can be recognized by RNA polymerase III (Pol III). Non-limiting examples of IIII promoters also include U6 and H1 promoters. In some embodiments, the nucleotide sequence encoding the guide RNA is a mouse or human In some embodiments, the expression cassette can be operably linked to the U6 promoter of In certain embodiments, the expression cassette is a modified nucleic acid. In some embodiments, the expression cassette is integrated into To stabilize and inhibit the expression cassette, modifications of the 5' end, such as modified nucleotides, In some embodiments, the expression cassette comprises a nucleotide sequence on each strand. In certain embodiments, the expression cassette comprises a double-stranded DNA having a 5' end modification. The 5'-terminal modification may be an inverted dideoxy-T or an inverted abasic nucleoside or In some embodiments, the expression cassette comprises a nucleotide sequence selected from the group consisting of biotin, desthiobiotin, Ten-TEG, digoxigenin, and other anti-inflammatory drugs such as FAM, ROX, TAMRA and A Labels include fluorescent markers, including lexaFluor.

[0041] In certain embodiments, more than one guide RNA is used in the CRISPR / Cas nuclease. CRISPR / Cas systems can cleave more than one target sequence. In some embodiments, each guide RNA can contain a different targeting sequence. In this state, one or more guide RNAs are present in the CRISPR / Cas complex, either active or More than one guide RN may have the same or different properties, such as length, length, and stability. When A is used, each guide RNA may be encoded by the same or different expression cassettes. Promoters used to drive expression of more than one guide RNA may be may be the same or different.

[0042] Chemically modified RNA The guide RNA or mRNA contains modified nucleosides or nucleotides. mRNA containing one or more modified nucleosides or nucleotides The guide RNAs or Cas nucleases encoding the canonical A, G, C and U residues one or more non-naturally occurring and / or or "modified" RNA to describe the presence of naturally occurring components or structures. In some embodiments, the modified RNA is referred to herein as "modified." The modified nucleosides and and nucleotides may contain one or more of the following: (i) an unlinked phosphate One or both of the linking phosphate oxygens in the phosphodiester backbone linkages or multiple modifications, e.g., replacements (exemplary backbone modifications); (ii) the ribose sugar moiety, For example, alteration, e.g., replacement, of the 2' hydroxyl on the ribose sugar (an exemplary sugar modification); iii) Extensive replacement of the phosphate moiety with a "dephospho" linker (an exemplary backbone modification); iv) Modification or replacement of naturally occurring nucleobases, including with non-canonical nucleobases (e.g. (v) replacement or modification of the ribose-phosphate backbone (exemplary backbone modifications). (vi) modifications of the 3' or 5' ends of oligonucleotides, e.g., terminal phosphate groups; Removal, modification or replacement of a moiety, cap or linker (Such 3' or 5' cap modifications may include sugar and / or backbone modifications. and (vii) sugar modification or replacement (exemplary sugar modifications).

[0043] Nucleosides and nucleoside complexes that can have two, three, four or more modifications. The above modifications can be combined to provide modified RNAs containing nucleotides (collectively "residues"). For example, the modified residue can be a modified sugar and a modified nucleoside. In some embodiments, every base of the gRNA is modified. For example, all bases have modified phosphate groups, such as phosphorothioate groups. In certain embodiments, all or substantially all of the phosphate groups of the sgRNA molecule are phospho In some embodiments, the modified RNA is an RNA having a thiol group. In some embodiments, the 5′ end of the polypeptide further comprises at least one modified residue at or near the 5′ end. In one embodiment, the modified RNA comprises at least one modified nucleotide at or near the 3' end of the RNA. Contains residues that have been removed.

[0044] In certain embodiments, modified residues can be incorporated into the guide RNA. In certain embodiments, the modified residues can be incorporated into the mRNA. In some embodiments, the guide RNA includes one, two, three or more modified residues. In some embodiments, the guide RNA comprises one or more nucleotides at each of the 5' and 3' ends of the guide RNA. In some embodiments, the mRNA comprises two, three or more modified residues. 5, 10, 15, 50, 100, 200, 300, 400, 500, 600, 700, 8 In some embodiments, the amino acid sequence includes 0, 900, 1000 or more modified residues. At least 5% (e.g., at least 10%) of the positions of the guide RNA or mRNA are modified. at least about 5%, at least about 10%, at least about 15%, at least about 20%, At least about 25%, at least about 30%, at least about 35%, at least about 40%, At least about 45%, at least about 50%, at least about 55%, at least about 60%, At least about 65%, at least about 70%, at least about 75%, at least about 80%, At least about 85%, at least about 90%, at least about 95%, or about 100%) of the It is a nucleoside or nucleotide that has been

[0045] Unmodified nucleic acids may be susceptible to degradation, for example, by cellular nucleases. For example, nucleases can hydrolyze nucleic acid phosphodiester bonds. Thus, in one embodiment, the guide RNAs described herein are capable of inhibiting, for example, nucleases. One or more modified nucleosides or nucleotides to introduce stability In certain embodiments, the mRNA described herein can contain For example, one or more modified nucleases may be added to introduce stability against nucleases. In some embodiments, the in vivo In both vo and ex vivo, the modified RNA molecules described herein can be administered to cells. The term "innate immune response" refers to a reduced innate immune response when introduced into a population of The present invention includes cellular responses to exogenous nucleic acids, including single-stranded nucleic acids, which include cytokines, particularly insulin. These include expression and release of interferon and induction of cell death.

[0046] In some embodiments of the backbone modification, the phosphate group of the modified residue is substituted with one or more of the oxygens. The modified residue can be modified by replacing it with a different substituent. The modified residues present in the modified nucleic acid may be any of the modified groups described herein. In some embodiments, the phosphate group may be replaced by a modified phosphate group. In this study, the backbone modification of the phosphate backbone was carried out by adding uncharged linkers or charged linkers with asymmetric charge distribution. This may include changes that result.

[0047] Examples of modified phosphate groups include phosphorothioates, phosphoroselenates, boranophos, Phosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, arsenic These include alkyl or aryl phosphonates and phosphotriesters. The phosphorus atom in the group is achiral. However, it can be achiralized by one of the above atoms or groups of atoms. The replacement of one of the bridging oxygens can make the phosphorus atom chiral. A stereogenic phosphorus atom is It can have an "R" configuration (herein Rp) or an "S" configuration (herein Sp). The backbone is made up of nitrogen (bridged phosphoramidates), sulfur (bridged phosphorothioates) and and carbon (bridging methylene phosphonate) bridging oxygen (i.e., phosphate to nucleoside) The modification can also be achieved by the replacement of the oxygen (oxygen linked to the amide bond). It can occur at both the valence oxygen and the valence oxygen.

[0048] The phosphate group can be replaced by a non-phosphorus-containing connector in certain backbone modifications. In some embodiments, the charged phosphate group can be replaced by a neutral moiety. Examples of moieties that can replace the phosphate group include, but are not limited to, for example, methyl Phosphonate, hydroxylamino, siloxane, carbonate, carboxymethyl, Carbamates, amides, thioethers, ethylene oxide linkers, sulfonates, sulfos amide, thioformacetal, formacetal, oxime, methyleneimino, methylene methylenemethylimino, methylenehydrazo, methylenedimethylhydrazo and methyleneoxy Methylimino may be included.

[0049] Nuclease-resistant nucleosides or nucleotides with phosphate linkers and ribose sugars We can also build scaffolds that can mimic nucleic acids, which have been replaced by surrogates. Such modifications can include backbone and sugar modifications. In some embodiments, In some embodiments, the nucleobases can be linked by a surrogate backbone. Examples include, but are not limited to, morpholino including cyclobutyl, pyrrolidine and peptide nucleic acid (PNA) nucleoside surrogates It is possible.

[0050] Modified nucleosides and nucleotides include one or more nucleotide modifications to the sugar group. For example, the 2' hydroxyl group (OH) can be Modification with several different "oxy" or "deoxy" substituents, e.g., replacement In some embodiments, the hydroxyl can be deprotonated to give a 2'-alkoxy group. Modifications to the 2' hydroxyl group are no longer able to form hydroxyl ions, making the nucleic acid The stability of the system can be enhanced.

[0051] Examples of 2' hydroxyl group modifications include alkoxy or aryloxy (OR, "R" is , for example, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar polyethylene glycol (PEG), O(CH2CH2O) n CH2C H2OR, where R is, for example, H or an optionally substituted aryl group. n may be an integer from 0 to 20 (e.g., 0 to 4, 0 to 8, 0 to to 10, 0 to 16, 1 to 4, 1 to 8, 1 to 10, 1 to 16, 1 to 20, 2 to 4, 2 to 8, 2 to 10, 2 to 16, 2 to 20, 4 to 8, 4 to 10, 4 to 16 and 4 to 20). In some embodiments, the 2' hydroxyl group modification can be , 2'-O-Me. In some embodiments, the 2' hydroxyl group modification can be 2' -fluoro modification, which replaces the 2' hydroxyl group with fluoride. In one embodiment, the 2' hydroxyl group modification can include "locked" nucleic acids (LNA). where the 2' hydroxyl is, for example, C 1~6 Alkylene or C 1~6 Heteroar A chiral bridge can be used to connect the 4' carbon of the same ribose sugar, and an exemplary bridge is shown below. is a methylene, propylene, ether or amino bridge; O-amino (amino is, for example, , NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, di arylamino, heteroarylamino, or diheteroarylamino, ethylenediamino aminoalkoxy, O(CH2) n -Ami (amino is, for example, NH2; alkylamino, dialkylamino, heterocyclyl, Arylamino, diarylamino, heteroarylamino or diheteroarylamino In some embodiments, the amine may be ethylenediamine, polyamine, or tert-butylamine. In an embodiment, the 2' hydroxyl group modification is such that the ribose ring lacks a C2'-C3' bond. In some embodiments, the 2' hydroxyl group may be an "unlocked" nucleic acid. The alkyl group modifications include methoxyethyl groups (MOE), (OCH2CH2OCH3, e.g., PEG Derivatives).

[0052] "Deoxy" 2' modifications are hydrogen (i.e., the overhang of a partial dsRNA, for example). deoxyribose sugar in the moiety; halo (e.g., bromo, chloro, fluoro or iodine) amino (amino is, for example, -NH2, alkylamino, dialkylamino, heptane arylamino, diarylamino, heteroarylamino, diheteroarylamino NH(CHCHNH) n CH2CH2- Amino (amino may be, for example, as described herein), -NHC(O) R (R is, for example, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl) or sugar), cyano; mercapto; alkyl-thio-alkyl; thioalkoxy oxy; and optionally substituted, for example, with amino as described herein. , alkyl, cycloalkyl, aryl, alkenyl and alkynyl. do.

[0053] The sugar modification can include a sugar group that is in the opposite orientation to that of the corresponding carbon of ribose. It is also possible for the compound to contain one or more carbons having the same chemical configuration. The nucleic acid thus produced can include nucleotides containing, for example, arabinose as the sugar. Modified nucleic acids can also contain abasic sugars. These abasic sugars are the constituent glycogens. The modified nucleic acid may be further modified in one or more of the L-forms. or multiple sugars, such as L-nucleosides.

[0054] The modified nucleosides described herein that can be incorporated into modified nucleic acids. Modified nucleotides and nucleotides may contain modified bases, also called nucleobases. Examples of nucleobases include, but are not limited to, adenine (A), guanine (G), cytosine (C), and cytosine (D). (C) and uracil (U). These nucleobases can be modified or completely In place of the nucleotides, modified residues can be provided that can be incorporated into modified nucleic acids. The nucleobase of a nucleotide can be a purine, pyrimidine, purine analog, or pyrimidine. In some embodiments, the nucleobase can be independently selected from the analogs, e.g., Naturally occurring and synthetic derivatives of the bases may be included.

[0055] In embodiments using dual guide RNA, each of the crRNA and tracr RNA Such modifications may include modifications to the crRNA and / or tracrRNA. In embodiments involving sgRNA, the sgRNA may be located at one or both ends of the RNA. One or more residues at one or both ends of the RNA may be chemically modified; or Alternatively, the entire sgRNA may be chemically modified. Certain embodiments include modifications at the 5' end. Certain embodiments include modifications at the 3' end. One or more or all of the nucleotides in the single-stranded overhang of a RNA molecule The modified mRNA has a 5'- and / or 3'-terminal deoxynucleotide. It may include edge modifications.

[0056] Template nucleic acid The formulations disclosed herein can include a template nucleic acid. The template is then modified to modify or insert a nucleic acid sequence at or near a target site for It can be used.

[0057] In some embodiments, the template can be used in homologous recombination. In some embodiments, homologous recombination results in the integration of a template sequence or a portion of a template sequence into a target nucleic acid molecule. In some embodiments, a single template may be provided. In some configurations, two or more templates are provided so that homologous recombination can occur at two or more target sites. For example, it is possible to repair a single gene in a cell or two different genes in a cell. In some embodiments, different templates can be provided for In some embodiments, multiple copies of a template are provided to a cell. can provide the different templates in independent amounts.

[0058] In another embodiment, the template comprises a homology-guided DNA strand invasion at the cleavage site of the nucleic acid. In some embodiments, homology-guided repair can be used in the repair of edited In some embodiments, a single target nucleic acid molecule can be synthesized by incorporation of the template sequence into the target nucleic acid molecule. In another embodiment, a single template can be provided. More than one template with the sequence can be used at more than one site. For example, Different templates can be used to repair a single gene in a cell or two different genes in a cell. In some embodiments, multiple copies of at least one template can be provided. In some embodiments, the different templates are provided to the cells in independent copy numbers or independent amounts. A mold can be provided.

[0059] In yet another embodiment, the template for gene editing mediated by non-homologous end joining is In some embodiments, the template sequence may be a nucleic acid sequence near the cleavage site. In some embodiments, the template or a portion of the template sequence is incorporated. In some embodiments, a single template can be provided. By selective end ligation, two or more templates with different sequences can be inserted into two or more sites. For example, it is possible to insert a single template into a cell, or two different templates into a cell. In some embodiments, different templates can be provided for different independent copy numbers. In some embodiments, the template can be provided with adjacent inverted end primers. It contains the ITR sequence.

[0060] In some embodiments, the template sequence can correspond to an endogenous sequence of the target cell. As used herein, the term "endogenous sequence" refers to a sequence that is native to a cell. A "sequence" is a sequence that is not native to a cell, or a sequence at a location that differs from its native location in the genome of the cell. In some embodiments, the endogenous sequence may be a genomic sequence of the cell. In some embodiments, the endogenous sequence may be a chromosomal or extrachromosomal sequence. In some embodiments, the endogenous sequence may be a plasmid sequence of the cell. In this case, the template sequence is substantially identical to a portion of the endogenous sequence in the cell at or near the cleavage site. In some embodiments, the sequence may be a single nucleotide sequence, but may contain at least one nucleotide change. In one embodiment, template-directed repair of a cleaved target nucleic acid molecule involves the deletion of one or more of the target nucleic acid molecules. Mutations can be made including insertions, deletions or substitutions of nucleotides. In embodiments, the mutation is a mutation in a protein expressed from a gene containing the target sequence. or multiple amino acid changes. In some embodiments, the mutations By causing one or more nucleotide changes in the RNA expressed from the target gene. In some embodiments, the mutation can alter the expression level of the target gene. In some embodiments, the mutation results in an increase or decrease in expression of the target gene. In some embodiments, the mutation can result in gene knockdown. In some embodiments, the mutation can result in a gene knockout. In some embodiments, the mutation can result in restoration of gene function. In some embodiments, template-directed repair of a cleaved target nucleic acid molecule comprises cleaving an exon of a target gene. Sequences, intron sequences, regulatory sequences, transcription control sequences, translation control sequences, splicing sites, etc. Changes can be made in the coding or non-coding sequences.

[0061] In other embodiments, the template sequence can include an exogenous sequence. The exogenous sequence is a protein or RNA sequence operably linked to an exogenous promoter sequence. A coding sequence, such that integration of the exogenous sequence into the target nucleic acid molecule results in , the cell expresses the protein or RNA encoded by the integrated sequence. In another embodiment, integration of the exogenous sequence into the target nucleic acid molecule can result in Expression of the inserted sequence can be regulated by the endogenous promoter sequence. In embodiments, the exogenous sequence may be a chromosomal or extrachromosomal sequence. In the form, the exogenous sequence is a cDNA sequence encoding a protein or a portion of a protein. In yet another embodiment, the exogenous sequence can be an exon sequence, an intron sequence, or a sequence that is tron sequence, regulatory sequence, transcription control sequence, translation control sequence, splice site or noncoding In some embodiments, the integration of an exogenous sequence can result in the abrogation of gene function. In some embodiments, the integration of the exogenous sequence can result in restoration of the gene. In some embodiments, the integration of the exogenous sequence can result in a quench. This can result in a lockout.

[0062] The template may be of any suitable length. In some embodiments, the template is 10, 15, 20, 25, 50, 75, 100, 150, 200, 500, 1000, 1500, 20 00, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 60 The template may comprise a single stranded nucleic acid having a length of 0,000 or more nucleotides. The template may be a double-stranded or partially double-stranded nucleic acid. In embodiments, the single stranded template is 20, 30, 40, 50, 75, 100, 125, In some embodiments, the template is 150, 175, or 200 nucleotides. A nucleotide sequence that is complementary to a portion of a target nucleic acid molecule that contains a homology sequence (i.e., a "homology arm"). In some embodiments, the template can include a cleavage site on the target nucleic acid molecule. It may contain arms of homology that are complementary to sequences located upstream or downstream. In an embodiment, the templates are complementary to sequences located upstream and downstream of the cleavage site, respectively. The first and second homology arms (also referred to as the first and second nucleotide sequences) If the template contains two arms of homology, each arm should be of equal length. or different lengths, and the sequence between the arms of homology corresponds to the target sequence between the arms of homology. It may be substantially similar or identical, or it may be completely unrelated. In some embodiments, the first nucleotide sequence on the template and the sequence upstream of the cleavage site and between a second nucleotide sequence on the template and the sequence downstream of the cleavage site. The degree of homologous recombination between the template and the target nucleic acid molecule, e.g., high-fidelity homologous recombination, can be achieved. In some embodiments, the degree of complementarity is about 50%, 55%, 60%, 65%, 70%, 80%, 85%, 90%, 95%, 100%, 105%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 0%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100 In some embodiments, the degree of complementarity may be about 95%, 97%, 98%, 9 9% or 100%. In some embodiments, the degree of complementarity is at least 9 8%, 99% or 100%. In some embodiments, the degree of complementarity is 10 It can be 0%.

[0063] In some embodiments, the template comprises an ssD sequence that includes adjacent inverted terminal repeat (ITR) sequences. In some embodiments, the template comprises a plasmid, a minicircle, or a dsDNA. , supplied as nanocircles or PCR products.

[0064] Nucleic acid purification In some embodiments, the nucleic acid is purified. In some embodiments, the nucleic acid is purified by precipitation techniques (e.g., For example, LiCl precipitation, alcohol precipitation, or equivalent methods described herein. In some embodiments, the nucleic acid is purified using a chromatography-based method. Methods based on HPLC or equivalent methods (e.g., those described herein) may be used. In some embodiments, the nucleic acid is purified using a precipitation method (e.g., The product is purified using both iCl precipitation and HPLC-based methods.

[0065] Target sequence In some embodiments, the CRISPR / Cas system of the present disclosure comprises a target sequence on a target nucleic acid molecule. For example, the target sequence can be a sequence that the Cas nuclease can cleave. In some embodiments, the class 2 Cas nuclease is capable of recognizing and cleaving the nucleotide sequence of the nucleotide sequence of the present invention. can guide a guide RNA to a target sequence of a target nucleic acid molecule, where the guide RNA A hybridizes to the target sequence and the Cas protein cleaves it. In this case, the guide RNA hybridizes to a target sequence containing its cognate PAM and binds to the Cas In some embodiments, the target sequence is a targeting sequence for the guide RNA. In some embodiments, the targeting sequence of the guide RNA and the guide R may be complementary to each other. The degree of complementarity between the portions of the corresponding target sequences that hybridize to the NA is about 50%, 55% , 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% In some embodiments, the homology region of the target may be 99% or 100%. In some embodiments, the target sequence is adjacent to a target PAM sequence of the guide RNA. In another embodiment, the target sequence can include a sequence that is 100% complementary to the targeting sequence. has at least one mismatch, deletion or insertion compared to the targeting sequence of the guide RNA. For example, the target sequence and the targeting sequence of the guide RNA can be optionally In the portion of the target sequence adjacent to the PAM, 1, 2, 3, 4, 5, 6, 7, 8, 9 or In some embodiments, the target sequence and the genomic DNA may contain 10 mismatches. The targeting sequence of the idRNA can contain 1 to 9 mismatches. In this embodiment, the target sequence and the targeting sequence of the guide RNA contain 3 to 6 mismatches. In some embodiments, the target sequence and the targeting sequence of the guide RNA can be Or it may contain six mismatches.

[0066] The length of the target sequence may depend on the nuclease system used. For example, CRISPR The targeting sequences of the guide RNA for the / Cas system are 5, 6, 7, 8, 9, 10, 11, 1 2, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 , 26, 27, 28, 29, 30, 35, 40, 45, 50 or more than 50 The length of the target sequence may include a length of nucleotides, and the target sequence may be of a corresponding length, and optionally a PAM In some embodiments, the target sequence is 15-24 nucleotides in length. In some embodiments, the target sequence may include a sequence having a length of 17 to 21 nucleotides. In some embodiments, the target sequence comprises a length of 20 nucleotides. When a nickase is used, the target sequence can be cleaved by cleaving opposing strands of a DNA molecule. It can contain a pair of target sequences that are recognized by a pair of nickases that cleave the target sequences. In one embodiment, the target sequence is bound to a pair of nickases that cleave the same strand of a DNA molecule. In some embodiments, the target sequence may include a pair of target sequences that are recognized by one or may contain portions of a target sequence recognized by multiple Cas nucleases. .

[0067] A target nucleic acid molecule is any DNA or RNA molecule that is endogenous or exogenous to a cell. In some embodiments, the target nucleic acid molecule may be an enzyme from or in a cell. pisomal DNA, plasmid, genomic DNA, viral genome, mitochondrial DNA, etc. In some embodiments, the target sequence of the target nucleic acid molecule may be a nucleic acid sequence from a cell. or a genomic sequence in the cell. In other embodiments, the cell is a mammalian cell. In some embodiments, the cells may be rodent cells. In some embodiments, the cell may be a human cell. In some embodiments, the cell is a liver cell. In certain embodiments, the cells may be human liver cells. In some embodiments, the liver cells are hepatocytes. In some embodiments, the liver cells are human hepatocytes. In some embodiments, the liver cells are stem cells. In some embodiments, human liver cells are , liver sinusoidal endothelial cells (LSECs). In some embodiments, human liver cells. In some embodiments, the human liver cells may be hepatic stellate cells. In some embodiments, the human liver cells may be tumor cells. In some embodiments, the cells comprise an ApoE-binding receptor. The liver cells may be hepatic stem cells. See, e.g., Wang, et al. Nature, 2015; Font-Bu See rgada, et al. Cell, 2015, 162:766-799.

[0068] In further embodiments, the target sequence may be a viral sequence. In another embodiment, the target sequence is a sequence of a pathogen. In a further embodiment, the target sequence is a chromosomal sequence. In certain embodiments, the target sequence is a translocation junction, e.g., a translocation associated with cancer. In some embodiments, the target sequence may comprise a locus of a eukaryotic chromosome, such as a human chromosome. In certain embodiments, the target sequence may be expressed in liver cells. , a liver-specific sequence.

[0069] In some embodiments, the target sequence is a coding sequence of a gene, an intron sequence of a gene, splice sites or gene sequences, transcriptional regulatory sequences, translational regulatory sequences, splice sites or gene sequences In some embodiments, the gene may be located in a non-coding sequence between the In other embodiments, the gene is a non-coding RNA gene. In some embodiments, the target sequence comprises all or part of a disease-associated gene. In certain cases, the gene is expressed in the liver.

[0070] In some embodiments, the target sequence is a chromatin fragment, such as a scaffold site or a locus control region. The genes may be located at non-genic functional sites in the genome that control aspects of the cell's tissue.

[0071] In embodiments that include a Cas nuclease, such as a Class 2 Cas nuclease, the target sequence is The sequence may be flanked by protospacer adjacent motifs ("PAMs"). In embodiments, the PAM is adjacent to the 3' end of the target sequence or is 1, 2, 3 or 4 spaced from it. The length and sequence of the PAM depend on the Cas gene used. For example, PAMs can be used in the relevant disclosures of each of the above. See Figure 1 and Figure 2 of Ran et al., Nature, 520: 186-191 (2015), which are incorporated herein by reference. Specific Cas9 proteins or Ca proteins, including those disclosed in Fig. S5 of Zetsche 2015, are also known. Consensus or specific PAM sequences for s9 orthologs can be selected In some embodiments, the PAM is 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. Non-limiting exemplary PAM sequences include NGG, NGGNG, N G, NAAAAN, NNAAAAW, NNNNACA, GNNNCNNA, TTN and NNNNGATT (where N is defined as any nucleotide and W is defined as A or T) In some embodiments, the PAM sequence may be NGG. In embodiments, the PAM sequence may be NGGNG. The sequence may be TTN. In some embodiments, the PAM sequence is NNAAAAW. That's fine.

[0072] Lipid formulations Various embodiments of LNP formulations for CRISPR / Cas cargo are disclosed herein. Such LNP formulations include, in addition to helper lipids, neutral lipids, and stealth lipids, The lipid nanoparticles can be physically held together by intermolecular forces. LNPs refer to particles that contain multiple (i.e., more than one) lipid molecules associated with one another. , e.g., microspheres (which in some embodiments are substantially spherical, and in more particular embodiments The morphology may include an aqueous core, e.g., a monolayer or and multilamellar vesicles, e.g., "liposomes" - containing lamellar phase lipid bilayers), dispersions in emulsions The internal phase may be a local phase, a micelle or a suspension. Emulsions, micelles and suspensions are The composition may be suitable for central and / or local delivery.

[0073] The LNP compositions provided herein are preferentially expressed by liver cells (e.g., hepatocytes). Furthermore, the LNP compositions are capable of being administered to the host in vivo at therapeutically effective doses. In some embodiments, the compound is biodegradable in that it does not accumulate to cytotoxic levels. At therapeutic dose levels, the LNP composition inhibits the innate immune response, which leads to substantial adverse effects. In some embodiments, the LNP compositions provided herein do not cause therapeutic The LNP composition does not cause toxicity at the dose level. Apolipoproteins specifically bind to lipids, such as erythropoietin (ApoE). ApoE is a protein that circulates in the plasma and is key in regulating lipoprotein transport. Interacts with cell surface heparin sulfate proteoglycans in liver during protein uptake. , which represents a class of apolipoproteins (see, e.g., Scherphof and Kamps, The rol e of hepatocytes in the clearance of liposomes from the blood circulation. (See Lipid Res. 2001 May;40(3):149-66).

[0074] CCD lipids Lipid compositions for delivery of biologically active agents that preferentially target liver cells or organs In certain embodiments, the lipid composition can be adjusted to Preferentially targets ApoE-binding cells, i.e., cells expressing the ApoE receptor. Delivery of CRISPR / Cas mRNA and guide RNA components to liver cells The lipid composition for delivery comprises a CCD lipid.

[0075] In some embodiments, the CCD lipid is lipid A, which is (9Z,12Z)-3-( (4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethyl Amino)propoxy)carbonyl)oxy)methyl)propyloctadeca-9,12-di Enoate, also known as 3-((4,4-bis(octyloxy)butanoyl)oxy )-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)prop Also known as lopyl(9Z,12Z)-octadeca-9,12-dienoate. Lipid A can be expressed as:

[0076] [ka]

[0077] Lipid A is a compound as described in WO 2015 / 095340 (e.g., pp. 84-86). It can be synthesized by the method described below.

[0078] In some embodiments, the CCD lipid is lipid B, which is ((5-((dimethylamine). (methyl)-1,3-phenylene)bis(oxy)bis(octane-8,1-diyl ) bis(decanoate), also known as ((5-((dimethylamino)methyl)-1,3 -phenylene)bis(oxy))bis(octane-8,1-diyl)bis(decanoate ) Lipid B can be represented as follows:

[0079] [ka]

[0080] Lipid B is described in WO 2014 / 136086 (e.g., 107-0 It can be synthesized by the method described in (p. 9).

[0081] In some embodiments, the CCD lipid is lipid C, which is 2-((4-(((3-( Dimethylamino)propoxy)carbonyl)oxy)hexadecanoyl)oxy)propa 1,3-diyl(9Z,9'Z,12Z,12'Z)-bis(octadeca-9,12 -dienoate). Lipid C can be represented as follows:

[0082] [ka]

[0083] In some embodiments, the CCD lipid is lipid D, which is 3-(((3-(dimethylamino) (amino)propoxy)carbonyl)oxy)-13-(octanoyloxy)tridecyl The compound is 3-octylundecanoate.

[0084] Lipid D can be represented as follows:

[0085] [ka]

[0086] Lipid C and lipid D are It can be synthesized.

[0087] The CCD lipid may be an equivalent of lipid A, lipid B, lipid C or lipid D. In certain embodiments, the CCD lipid is an equivalent of lipid A or an equivalent of lipid B. be.

[0088] CCD lipids suitable for use in the LNPs described herein are bioavailable in vivo. CCD lipids are low toxic (e.g., at doses of 10 mg / kg or more). (It has been tolerated in animal models with no adverse effects.) In certain embodiments, the CCD lipid LNPs containing CCD lipids had at least 75% of their CCD lipids retained for 8, 10, 12, 24, or 48 hours. Within 3, 4, 5, 6, 7, or 10 days, or within 1 hour, In certain embodiments, the LNPs containing CCD lipids contain an mRNA or guide At least 50% of the RNA was detected within 8, 10, 12, 24, or 48 hours, or These include those that are cleared from plasma within 4, 5, 6, 7, or 10 days. In embodiments, LNPs that include CCD lipids include, for example, lipids (e.g., CCD lipids), RNA At least one of the LNPs may be isolated by measuring the (e.g., mRNA) or protein content. 50% within 8, 10, 12, 24, or 48 hours, or within 3, 4, 5, 6, or 7 hours In certain embodiments, the lipid-encapsulated phospholipids are cleared from plasma within 10 days or less. The free lipid, RNA or protein content of the input LNP is measured.

[0089] Lipid clearance can be measured as described in Maier, MA ., et al. Biodegradable Lipids Enabling Rapidly Eliminated Lipid Nanoparticles f or Systemic Delivery of RNAi Therapeutics. Mol. Ther. 2013, 21(8), 1570-78 ("Mai For example, Maier et al., J. Immunol. 1999, 144:1331-1336, 1999, and 2000, 1999. P-siRNA systems were administered at 0.3 mg / kg by intravenous bolus injection via the lateral tail vein. The mice were administered 0.083, 0.25, or 0.01g of 100 mg ... After 5, 1, 2, 4, 8, 24, 48, 96 and 168 hours, blood, liver and spleen Samples were collected. Mice were fasted prior to tissue collection and blood samples were processed to obtain plasma. All samples were processed and analyzed by LC-MS. -Maier describes a procedure for assessing toxicity following administration of siRNA formulations. For example, luciferase-targeting siRNA was administered as a single intravenous bolus at a dose of 5 mL / kg. Male SD rats (5 animals / group) were administered 0, 1, 3, 5, and 10 mg / kg by injection. After 24 hours, approximately 1 mL of blood was obtained from the jugular vein of conscious animals and serum was isolated. Seventy-two hours after dosing, all animals were euthanized for necropsy. Clinical signs, body weight, Serum chemistry, organ weights and histopathology evaluations were performed. Maier Methods for evaluating the P formulations are described, which include evaluating the clearance of administration of the formulations of the present disclosure, It can be applied to assess pharmacokinetics and toxicity.

[0090] CCD lipids lead to increased clearance rates. The lipid clearance rate is the rate at which CCD lipids are cleared from blood, serum or plasma. In some embodiments, the clearance rate is the RNA clearance rate, For example, the rate at which an mRNA or guide RNA is cleared from blood, serum, or plasma. In some embodiments, the clearance rate is the rate at which the LNPs are cleared from the blood, serum, or plasma. In some embodiments, the clearance rate is the rate at which the LNPs are secreted into the liver tissue or spleen. The clearance rate is the rate at which a compound is cleared from a tissue, such as a tissue. In certain embodiments, the clearance rate The high rate of release translates into a safety profile without significant adverse effects. In some embodiments, the LNPs in the circulation and tissues are reduced. The reduction in P accumulation leads to a safety profile without significant adverse effects.

[0091] The CCD lipids of the present disclosure are ionizable depending on the pH of the medium in which they are found. For example, in slightly acidic media, the CCD lipids can be protonated and therefore In contrast, in a slightly basic medium, for example at a pH of approximately 7.35, In blood, where the CCD lipids are circulating, they cannot be protonated and are therefore uncharged. In some embodiments, the CCD lipids of the present disclosure are protonated at a pH of at least about 9. In some embodiments, the CCD lipids of the present disclosure can be soluble at a pH of at least about 9. In some embodiments, the CCD lipid of the present disclosure comprises at least It can be protonated at a pH of about 10.

[0092] The ability of a CCD lipid to carry a charge is related to its intrinsic pKa. Each of the disclosed CCD lipids independently has a pKa within the range of about 5.8 to about 6.2. Cationic lipids having a pKa in the range of about 5.1 to about 7.4 can be used to enhance the absorption and absorption of lipids into the liver. This may be advantageous as it has been found to be effective for the delivery of cargo. In addition, cationic lipids with pKa in the range of about 5.3 to about 6.4 have been shown to be effective in promoting tumor It has been found to be effective for delivery of Please refer to the brochure no.

[0093] More lipids "Neutral lipids" suitable for use in the lipid compositions of the present disclosure include, for example, a variety of neutral, uncharged lipids. Examples of neutral phospholipids suitable for use in the present disclosure include: includes, but is not limited to, 5-heptadecylbenzene-1,3-diol (resorcinol), Dipalmitoylphosphatidylcholine (DPPC), Distearoylphosphatidylcholine choline (DSPC), phosphocholine (DOPC), dimyristoylphosphatidylcholine (D MPC), phosphatidylcholine (PLPC), 1,2-distearoyl-sn-glyceryl DAPC, phosphatidylethanolamine (PE), egg phosphatase Phosphatidylcholine (EPC), dilauroylphosphatidylcholine (DLPC), dimy Myristoylphosphatidylcholine (DMPC), 1-myristoyl-2-palmitoyl phosphatidylcholine Phosphatidylcholine (MPPC), 1-palmitoyl-2-myristoyl phosphatidyl Choline (PMPC), 1-palmitoyl-2-stearoylphosphatidylcholine (PS PC), 1,2-diarachidoyl-sn-glycero-3-phosphocholine (DBPC), 1 -Stearoyl-2-palmitoylphosphatidylcholine (SPPC), 1,2-dienylidene Cosenoyl-sn-glycero-3-phosphocholine (DEPC), palmitoyl oleoyl Phosphatidylcholine (POPC), lysophosphatidylcholine, dioleoylphospha DOPE, Dilinoleoylphosphatidylcholine distearoyl Dimyristoyl phosphatidylethanolamine (DSPE), dimyristoyl phosphatidylethanolamine (DSPE), Dipalmitoyl phosphatidylethanolamine (DMPE), Dipalmitoyl phosphatidylethanolamine (DPPE) ), palmitoyloleoylphosphatidylethanolamine (POPE), lysophosphatidylethanolamine (LPH) phenylalanine, ... distearoylphosphatidylcholine (DSPC) and dimyristoylphosphatidylcholine (DSPC) are dimethylethanolamine (DMPE). In the case of Neutral lipids serve to stabilize and enhance processing of LNPs.

[0094] "Helper lipids" are used to facilitate transfection (e.g., nanoparticles containing biologically active agents). Helper lipids are lipids that enhance the transfection of the target gene. Mechanisms for enhancing the efficacy include enhancing particle stability. Helper lipids enhance membrane fusion induction. Helper lipids include steroids, sterols, and amino acids. Helper lipids suitable for use in the present disclosure include, but are not limited to, Cholesterol, 5-heptadecylresorcinol and cholesterol hemisuccinate were In one embodiment, the helper lipid may be cholesterol. In one embodiment, the helper lipid may be cholesterol hemisuccinate.

[0095] "Stealth lipids" are nanoparticles that exist in vivo (e.g., in the blood). Stealth lipids are lipids that modify the length of time that the particles can be By controlling particle size, it can aid in the formulation process. The stealth lipids can modulate the pharmacokinetic properties of the LNPs. Stealth lipids suitable for use in the lipid composition include, but are not limited to, parent lipids linked to a lipid moiety. Stealth lipids suitable for use in the lipid compositions of the present disclosure include stealth lipids having an aqueous head group. For information on lipids and the biochemistry of such lipids, see Romberg et al., Pharmaceut. ical Research, Vol. 25, No. 1, 2008, pg. 55-71 and Hoekstra et al., Biochimica Further suitable PEG lipids can be found in Wang et al. Biophysica Acta 1660 (2004) 41-52. Qualities are disclosed, for example, in WO 2006 / 007712.

[0096] In one embodiment, the hydrophilic head group of the stealth lipid is PEG (sometimes referred to as poly(ethyleneoxy) Poly(oxazoline), poly(vinyl alcohol), poly(glycerol), Poly(N-vinylpyrrolidone), polyamino acids and poly[N-(2-hydroxyphenyl) The polymer portion comprises a polymer selected from polymers based on (dimethylpropyl methacrylamide).

[0097] The stealth lipid can include a lipid moiety. In some embodiments, the stealth lipid can include a The lipid moiety is an alkyl chain containing, independently, from about C4 to about C40 saturated or unsaturated carbon atoms. glycerol or dialkylglycamide groups having a length of It can be derived from diacylglycerol or diacylglycamide, where the chain is It may contain one or more functional groups, such as amide or ester. The glycerol or dialkylglycamide group contains one or more substituted alkyl groups. It may further include:

[0098] Unless otherwise indicated, the term "PEG" as used herein refers to any polyethylene glycol. In one embodiment, PEG is an alkylene ether or other polyalkylene ether polymer. , optionally substituted linear or branched ethylene glycol or ethylene oxide In one embodiment, the PEG is unsubstituted. In one embodiment, the PEG is , for example, one or more of alkyl, alkoxy, acyl, hydroxy, or aryl In one embodiment, the term refers to a PEG-polyurethane or PE and PEG copolymers such as PEG-polypropylene (see, e.g., J. Milton Harris, Poly(e thylene glycol) chemistry: biotechnical and biomedical applications (1992) In another embodiment, the term does not include PEG copolymers. G is from about 130 to about 50,000, in a subembodiment, from about 150 to about 30,000; In a more particular embodiment, from about 150 to about 20,000, and in a sub-embodiment, from about 150 to about 15,000. 00, in a subembodiment, from about 150 to about 10,000, in a subembodiment, from about 150 to about In a subembodiment, from about 150 to about 6,000, in a subembodiment, from about 150 to about 5,000, in a subembodiment, from about 150 to about 6,000, In a subembodiment, from about 150 to about 3,000, and in a subembodiment, from about 30 0 to about 3,000, in subembodiments, from about 1,000 to about 3,000, in subembodiments has a molecular weight of about 1,500 to about 2,500.

[0099] In certain embodiments, PEG (e.g., conjugated to a lipid, such as a stealth lipid) may be used. The polymer used is also called "PEG 2000" and has an average molecular weight of about 2,000 daltons. PEG-2K is herein represented by the following formula (I): where n is 45, meaning that the number average degree of polymerization contains about 45 subunits.

[0100] [ka] However, for example, the number-average degree of polymerization may be about 23 subunits (n=23) and / or 68 Other PEG embodiments known in the art, including those with n=68 subunits, may also be used. In some embodiments, n may be in the range of about 30 to about 60. In some embodiments, n may be in the range of about 35 to about 55. n may range from about 40 to about 50. In some embodiments, n ranges from about 42 to about 4 In some embodiments, n may be in the range of 8. In some embodiments, n may be 45. wherein R can be selected from H, substituted alkyl, and unsubstituted alkyl. In some embodiments, R can be an unsubstituted alkyl. may be methyl.

[0101] In any of the embodiments described herein, the stealth lipid may be PEG-dilauryl Glycerol, PEG-dimyristoylglycerol (PEG-DMG) (NOF, To Kyo, Japan Catalog #GM-020), PEG-Dipalmitoyl Glycerol PEG-distearoylglycerol (PEG-DSPE) (NOF, Tokyo , Catalog #DSPE-020CN from Japan), PEG-dilauryl glycamide , PEG-dimyristylglycamide, PEG-dipalmitoylglycamide, and PEG -Distearoylglycamide, PEG-cholesterol (1-[8'-(cholesteryl-5- ene-3[beta]-oxy)carboxamide-3',6'-dioxaoctanyl]ca Rubamoyl-[omega]-methyl-poly(ethylene glycol), PEG-DMB(3, 4-Ditetradecoxybenzyl-[omega]-methyl-poly(ethylene glycol) ester 1,2-Dimyristoyl-sn-glycero-3-phosphoethanolamine-N -[Methoxy(polyethylene glycol)-2000] (PEG2k-DMG) (Ava nti Polar Lipids, Alabaster, from Alabama, USA Catalog #880150P), 1,2-distearoyl-sn-glycero-3-phospho Ethanolamine-N-[methoxy(polyethylene glycol)-2000] (PEG2 k-DSPE)(Avanti Polar Lipids, Alabaster, Al ABAMA, USA catalog #880120C), 1,2-distearoyl-sn -Glycerol, methoxypolyethylene glycol (PEG2k-DSG; GS-020 , NOF Tokyo, Japan), Poly(ethylene glycol)-2000-dimeth Acrylate (PEG2k-DMA) and 1,2-distearyloxypropyl-3-acrylate Min-N-[methoxy(polyethylene glycol)-2000] (PEG2k-DSA) In one embodiment, the stealth lipid is PEG2k-DMG. In some embodiments, the stealth lipid may be PEG2k-DSG. In embodiments, the stealth lipid may be PEG2k-DSPE. The stealth lipid may be PEG2k-DMA. In one embodiment, the stealth lipid is In one embodiment, the stealth lipid may be PEG2k-DSA. 1. In some embodiments, the stealth lipid may be PEG2k-C14. In some embodiments, the stealth lipid may be PEG2k-C16. In an embodiment, the stealth lipid may be PEG2k-C18.

[0102] LNP formulation LNPs contain (i) CCD lipids for encapsulation and endosomal escape, and (ii) (iii) a neutral lipid for stabilization; and (iv) a helper lipid for stabilization. (iv) It may contain stealth lipids.

[0103] In certain embodiments, the cargo encodes a Cas nuclease, such as Cas9. In one embodiment, the nucleic acid comprises an mRNA and a guide RNA or a nucleic acid encoding the guide RNA. In the present invention, the LNP composition comprises a CCD lipid, such as lipid A, lipid B, lipid C, or lipid D. In some embodiments, the CCD lipid is lipid A. In some embodiments, the CCD lipid is lipid B. In various embodiments, the LNP composition comprises a CCD lipid. , neutral lipids, helper lipids and stealth lipids. In certain embodiments, the helper lipids In certain embodiments, the neutral lipid is DSPC. In a specific embodiment, the stealth lipid is PEG2k-DMG. In one embodiment, the LNP composition comprises lipid A, a helper lipid, a neutral lipid, and a stealth lipid. In some embodiments, the LNP composition comprises CCD lipids, DSPC, cholesterol, In some embodiments, the LNP composition comprises a PEGylation agent and a stealth lipid. In certain embodiments, the CCD lipids include lipid A, lipid B, lipid C, and lipid D. In further embodiments, the LNP composition is selected from lipid C or lipid D. A or lipid B, cholesterol, DSPC and PEG2k-DMG Contains CCD lipids.

[0104] In one embodiment, the LNP composition encodes a CCD lipid and a Cas nuclease. In one embodiment, the LNP composition comprises a CCD lipid, a Cas nuclease, and / or a cascade of events. The nucleic acid molecule may include an mRNA encoding a nuclease and at least one other lipid component. In some compositions that include mRNA encoding a Cas nuclease, the LNPs At least one other lipid component selected from per lipids, neutral lipids or stealth lipids. In certain compositions comprising mRNA encoding a Cas nuclease, helper The lipid is cholesterol. In the composition, the neutral lipid is DSPC. In yet a further embodiment, the stealth lipid is PEG2k-DMG. In terms of form, the LNP composition comprises a CCD lipid, a helper lipid, a neutral lipid, a stealth lipid, and The mRNA encoding the Cas nuclease can be included. In a specific composition containing mRNA for loading, the CCD lipids are lipid A, lipid B, lipid The present invention further comprises an mRNA encoding a Cas nuclease, the mRNA being selected from the group consisting of lipid C and lipid D. In the composition comprising the CCD lipid, the CCD lipid is selected from lipid A, lipid B, lipid C, or lipid D. The helper lipid was cholesterol, the neutral lipid was DSPC, and the stealth lipid was In some embodiments, the polypeptide is PEG2k-DMG. The CCD lipid in the composition comprising the mRNA is lipid A. In some embodiments, the Cas The CCD lipid in the composition containing the mRNA encoding the nuclease is lipid B. In some embodiments, the CCD lipid in a composition comprising an mRNA encoding a Cas nuclease In some embodiments, the substrate is lipid C. In some embodiments, the mRNA encoding the Cas nuclease The CCD lipid in the composition comprising is lipid D.

[0105] In one embodiment, the LNP composition comprises a CCD lipid and a class 2 Cas nuclease m In one embodiment, the LNP composition comprises a CCD lipid, class 2 It may comprise a Cas nuclease mRNA and at least one other lipid component. In some compositions containing Class 2 Cas nuclease mRNA, the LNPs are provided with helper lipids. The lipid component comprises at least one other lipid component selected from a lipid, a neutral lipid or a stealth lipid. In certain compositions comprising a Class 2 Cas nuclease mRNA, the helper lipid may be In other compositions containing Class 2 Cas nuclease mRNA, The neutral lipid is DSPC. Further experiments containing class 2 Cas nuclease mRNA In an embodiment, the stealth lipid is PEG2k-DMG. The NP composition consists of CCD lipids, helper lipids, neutral lipids, stealth lipids and class 2 C Class 2 Cas nuclease mRNA. In particular compositions comprising the above, the CCD lipid is lipid A, lipid B, lipid C or lipid In a further composition comprising a Class 2 Cas nuclease mRNA, The CCD lipid is selected from lipid A, lipid B, lipid C, or lipid D, and the helper lipid The lipid is cholesterol, the neutral lipid is DSPC, and the stealth lipid is PEG2k-D. In some embodiments, the composition comprises a class 2 Cas nuclease mRNA. The CCD lipid in is lipid A. In some embodiments, the class 2 Cas nuclease In some embodiments, the CCD lipid in the composition comprising the enzyme mRNA is lipid B. The CCD lipid in the composition containing the Cas nuclease mRNA is lipid C. In some embodiments, the CCD lipid in the composition comprising the class 2 Cas nuclease mRNA is lipid D.

[0106] In some embodiments, the LNP composition can include a guide RNA. In embodiments, the LNP composition comprises a CCD lipid, a guide RNA, a helper lipid, a neutral lipid, and and stealth lipids. In certain LNP compositions that include a guide RNA, In some compositions, the helper lipid is cholesterol. In other compositions that include guide RNA, neutral lipids are In a further embodiment comprising a guide RNA, the stealth lipid is P In certain embodiments, the LNP combination is EG2k-DMG or PEG2k-C11. The composition is lipid A, lipid B, lipid C or lipid D; helper lipid; neutral lipid; steatohepatic lipid; and a guide RNA. In certain compositions comprising a guide RNA, the CC The D lipid is lipid A. In certain compositions that include a guide RNA, the CCD lipid is In certain compositions that include a guide RNA, the CCD lipid is lipid C. In certain compositions including a guide RNA, the CCD lipid is lipid D. In further compositions comprising a CCD RNA, the CCD lipids are lipid A, lipid B, lipid C or is lipid D, the helper lipid is cholesterol, and the neutral lipid is DSPC, The stealth lipid is PEG2k-DMG.

[0107] In certain embodiments, the LNP formulation comprises a clathrate concentration in the range of about 25:1 to about 1:25. In certain embodiments, the ratio of Cas nuclease mRNA to gRNA nucleic acid is The LNP formulation comprises a mixture of Class 2 Cas nucleases in the range of about 10:1 to about 1:10. Including the ratio of mRNA to gRNA nucleic acid. As measured herein, the ratio is by weight. In some embodiments, the LNP formulation comprises a Class 2 Cas in the range of about 5:1 to about 1:5. In some embodiments, the LNP formulation comprises a ratio of nuclease mRNA to gRNA nucleic acid. Contains a Class 2 Cas nuclease mRNA to gRNA nucleic acid ratio of approximately 1:1. In embodiments, the LNP formulation comprises about 1:1 to about 1:5 of a Class 2 Cas nuclease m In some embodiments, the LNP formulation comprises a ratio of about 10:1 cRNA to gRNA nucleic acid. In some embodiments, the ratio of Ras2 Cas nuclease mRNA to gRNA nucleic acid is The LNP formulation contains a Class 2 Cas nuclease mRNA to gRNA nucleic acid ratio of approximately 1:10. Ratios include approximately 25:1, 10:1, 5:1, 3:1, 1:1, 1:3, 1:5, 1: It may be 1:10 or 1:25.

[0108] In one embodiment, the LNP composition can include an sgRNA. The LNP composition can include a Cas9 sgRNA. The composition may include a Cpf1 sgRNA. In some compositions that include an sgRNA, , the LNP comprises a CCD lipid, a helper lipid, a neutral lipid and a stealth lipid. In certain compositions comprising A, the helper lipid is cholesterol. In other compositions comprising, the neutral lipid is DSPC. Further embodiments comprising sgRNA In the present case, the stealth lipid is PEG2k-DMG or PEG2k-C11. In an embodiment, the LNP composition comprises a CCD lipid, a helper lipid, a neutral lipid, a stealth lipid, and sgRNA. In a specific composition comprising sgRNA, the CCD lipid The lipid may be lipid A, lipid B, lipid C or lipid D. In the composition, the CCD lipid is lipid A, lipid B, lipid C or lipid D, The per lipid is cholesterol, the neutral lipid is DSPC, and the stealth lipid is PEG2. It is k-DMG.

[0109] In certain embodiments, the LNP composition comprises an mRNA encoding a Cas nuclease. and a guide RNA, which may be an sgRNA. , CCD lipid, mRNA encoding Cas nuclease, guide RNA, helper lipid , neutral lipids and stealth lipids. In certain compositions comprising RNA and a guide RNA, the helper lipid is cholesterol. Some compositions contain mRNAs encoding Cas nucleases and guide RNAs. In this study, the neutral lipid is DSPC. In further embodiments comprising idRNA, the stealth lipid is PEG2k-DMG or P In certain embodiments, the LNP composition comprises a CCD lipid, a heparin lipid, and a glycerol lipid. mRNAs encoding perlipids, neutral lipids, stealth lipids, Cas nucleases, and gas The mRNA encoding the Cas nuclease and the guide RNA may be included. In particular compositions comprising RNA, the CCD lipids are lipid A, lipid B, lipid C or Lipid D. The mRNA encoding the Cas nuclease and the guide RNA are also included. In the composition, the CCD lipid is lipid A, lipid B, lipid C or lipid D. The helper lipid is cholesterol, the neutral lipid is DSPC, and the stealth lipid is P It is EG2k-DMG.

[0110] The LNP compositions disclosed herein can include a template nucleic acid. mRNAs encoding Cas nucleases, such as the Ras2 Cas nuclease mRNA, In some embodiments, the template nucleic acid can be co-formulated with the guide RNA. In some embodiments, the template nucleic acid can be co-formulated with a Cas nuclease. The compound can be co-formulated with both the mRNA encoding the gene and the guide RNA. In some embodiments, the template nucleic acid is an mRNA encoding a Cas nuclease or a guide nucleic acid. The compound can be formulated separately from the RNA. In such a formulation, the compound can be used to induce the desired repair mechanism. The template nucleic acid may be single-stranded or double-stranded. The template may be a target DNA or It may have regions of homology to sequences flanking the target DNA.

[0111] Embodiments of the present disclosure include lipid formulations described by the respective molar ratios of the component lipids in the formulation. Compositions are also provided. In one embodiment, the mole percent of CCD lipids is from about 30 mole percent to about 60 mole percent. In one embodiment, the mole % of CCD lipids may be from about 35 mole % to about 55 mole %. In one embodiment, the mole % of CCD lipids may be from about 40 mole % to about 50 mole %. In one embodiment, the mole % of CCD lipids may be from about 42 mole % to about 47 mole %. In one embodiment, the mole % of CCD lipids may be about 45%. In some embodiments, the CCD lipid mole % of the LNP batch is within ±30%, ±25% of the target mole %. %, ±20%, ±15%, ±10%, ±5% or ±2.5%. In certain embodiments, LNP lot-to-lot variation will be less than 15%, less than 10%, or less than 5%.

[0112] In one embodiment, the mole % of the helper lipid may be from about 30 mole % to about 60 mole %. In one embodiment, the mole percent of the helper lipid is about 35 mole percent to about 55 mole percent. In one embodiment, the mole percent of the helper lipid is about 40 mole percent to about 50 mole percent. In one embodiment, the mole percent of the helper lipid is about 41 mole percent to about 46 mole percent. In one embodiment, the mole percent of helper lipid may be about 44 mole percent. In some embodiments, the helper mole % of the LNP batch is within ±30%, ±25%, or ±10% of the target mole %. ±20%, ±15%, ±10%, ±5% or ±2.5%. The LNP lot-to-lot variation will be less than 15%, less than 10%, or less than 5%.

[0113] In one embodiment, the mole percent of neutral lipids may be from about 1 mole percent to about 20 mole percent. In embodiments, the mole percent of neutral lipids may be from about 5 mole percent to about 15 mole percent. In one embodiment, the mole percent of neutral lipids is from about 7 mole percent to about 12 mole percent. In some embodiments, the mole percent of neutral lipids may be about 9 mole percent. The neutral lipid mole percent of the target was ±30%, ±25%, ±20%, ±15%, or ±10%. %, ±5% or ±2.5%. In certain embodiments, the LNP lot-to-lot variation is It will be less than 15%, less than 10% or less than 5%.

[0114] In one embodiment, the mole % of stealth lipids may be from about 1 mole % to about 10 mole %. In one embodiment, the mole percent of stealth lipids may be from about 1 mole percent to about 5 mole percent. In one embodiment, the mole percent of stealth lipids may be from about 1 mole percent to about 3 mole percent. In an embodiment, the mole percent of stealth lipids may be about 2 mole percent. The mole % of the telse lipid may be about 1 mole %. In some embodiments, the LNP batch The stealth lipid mole percent was ±30%, ±25%, ±20%, ±15%, ±10% of the target mole percent. %, ±5% or ±2.5%. In certain embodiments, the LNP lot-to-lot variation is It will be less than 15%, less than 10% or less than 5%.

[0115] An embodiment of the present disclosure is a method for combining the positively charged amine groups (N) of the CCD lipids with the negatively charged amine groups (N) of the encapsulated nucleic acid. The present invention also provides lipid compositions described by the ratio between the phosphate groups (P) of N / P In one embodiment, the N / P ratio is from about 0.5 to about 10 In one embodiment, the N / P ratio may be from about 1 to about 50. In some embodiments, the N / P ratio may be from about 1 to about 25. In one embodiment, the N / P ratio is about 1 In one embodiment, the N / P ratio may be from about 1 to about 7. In embodiments, the N / P ratio may be from about 3 to about 5. In one embodiment, the N / P ratio is: It may be from about 4 to about 5. In one embodiment, the N / P ratio may be about 4. In some embodiments, the N / P ratio may be about 4.5. In one embodiment, the N / P ratio is about 5. That's fine.

[0116] In some embodiments, LNPs are prepared by dissolving an aqueous RNA solution in an organic solvent-based lipid solution, e.g. It is formed by mixing with 100% ethanol. Suitable solutions or solvents include water, , PBS, Tris buffer, NaCl, citrate buffer, ethanol, chloroform, diene ethyl ether, cyclohexane, tetrahydrofuran, methanol, and isopropanol. For example, for in vivo administration of LNPs, Any pharma- ceutically acceptable buffer can be used. In certain embodiments, the buffer is The pH of the LNP-containing composition is then maintained at or above pH 7.0. In embodiments, the composition has a pH within the range of about 7.3 to about 7.7, or about 7.4 to about 7.6. In further embodiments, the composition has a pH within the range of about 7.3, 7.4, 7.5, The pH of the composition is measured with a micro pH probe. In certain embodiments, a cryoprotectant is included in the composition. Non-limiting examples of substances include sucrose, trehalose, glycerol, DMSO and ethyl acetate. Exemplary compositions include up to 10% cryoprotectant, such as sucrose. In certain embodiments, the LNP composition can include about 1, 2, 3, It may contain 4, 5, 6, 7, 8, 9 or 10% cryoprotectant. In embodiments, the LNP composition comprises about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10% In some embodiments, the LNP composition may include a buffer. In some embodiments, the buffer solution may be phosphate buffered saline (PBS), Tris buffer, In certain exemplary embodiments, the present invention may include acetic acid buffer and mixtures thereof. Exemplary amounts of NaCl range from about 40 mM to about 50 mM. In some embodiments, the amount of NaCl is about 45 mM. In an embodiment, the buffer is a Tris buffer. An exemplary amount of Tris is about 40 mM to about In some embodiments, the amount of Tris is about 50 mM. In some embodiments, the buffer comprises NaCl and Tris. Certain exemplary embodiments include 5% sucrose and 45 mM NaCl in Tris buffer. In another exemplary embodiment, the composition contains sucrose in an amount of about 5 w / v %; It contains 45 mM NaCl and approximately 50 mM Tris. The osmolality of the entire formulation is The amounts of salts, buffers and cryoprotectants can be altered to maintain the The final osmolality can be maintained below 450 mOsm / L. In some embodiments, the osmolality is between 350 and 250 mOsm / L. The formulation has a final osmolality of 300±20 mOsm / L.

[0117] In some embodiments, microflow mixing, T-mixing, or cross-mixing is used. The flow rate, junction size, junction geometry, junction shape, tube diameter, solution and and / or the RNA and lipid concentrations may be altered. It can be concentrated or purified, for example, through dialysis or chromatography. The LNPs can be stored, for example, as a suspension, emulsion or lyophilized powder. In some embodiments, the LNP composition is stored at 2-8° C., and in certain aspects, the LNP The compositions are stored at room temperature. In further embodiments, the LNP compositions are stored at room temperature, e.g., at -20°C or In other embodiments, the LNP compositions are stored frozen at about 0° C. to about −80° C. The frozen LNP compositions are stored at temperatures ranging from 0° C. to 40° C. at the time of use, e.g., on ice or at room temperature. or can be thawed at 25°C.

[0118] To characterize the polydispersity index ("pdi") and size of the LNPs of the present disclosure, dynamic photoelectron spectroscopy was performed. DLS can be used to measure the amount of light emitted from a sample by exposing the sample to a light source. The PDI determined from DLS measurements is the particle size (average particle size) of the population. PDI represents the distribution of particles (per average particle size) between particles, with a completely uniform population having a PDI of zero. In some embodiments, the pdi may be in the range of about 0.005 to about 0.75. In some embodiments, the pdi may be in the range of about 0.01 to about 0.5. The pdi may be in the range of about 0.02 to about 0.4. In some embodiments, the pdi may be in the range of about 0.03 to about 0.35. In some embodiments, pdi is It may be in the range of about 0.1 to about 0.35.

[0119] The LNPs disclosed herein have a size of about 1 to about 250 nm. In a morphology, the LNPs have a size of about 10 to about 200 nm. In some embodiments, the LNPs have a size of about 20 to about 150 nm. In some embodiments, the LNPs have a size of about 50 to about 150 nm. In some embodiments, the LNPs have a size of about 50 to about 120 nm. In some embodiments, the LNPs have a size of about 75 to about 150 nm. In some embodiments, the LNPs have a size of about 30 to about 200 nm. Unless otherwise specified, all sizes referred to herein are Malvern Zetas The average size of the fully formed nanoparticles (diameter) was measured by dynamic light scattering in a 30-nm NMR spectrometer. The nanoparticle sample was dissolved in phosphate buffer so that the count rate was approximately 200 to 400 kct. The data are presented as a weighted average of the intensity measurements. In embodiments, the LNPs are formed with an average encapsulation efficiency in the range of about 50% to about 100%. In some embodiments, the LNPs are formed with an average encapsulation efficiency in the range of about 50% to about 70%. In some embodiments, the LNPs have an average encapsulation efficiency in the range of about 70% to about 90%. In some embodiments, the LNPs are formed from an average In some embodiments, the LNPs are formed with an encapsulation efficiency in the range of about 75% to about 95%. is formed with an average encapsulation efficiency of

[0120] Methods for engineering cells; engineered cells The LNP compositions disclosed herein are useful for both in vivo and in vitro It can be used in methods of engineering cells through gene editing in vivo. In embodiments, the method comprises contacting a cell with an LNP composition described herein. In some embodiments, the cell may be a mammalian cell. In some embodiments, the cells are human cells. In some embodiments, the cells may be liver cells. In some embodiments, the cells may be human liver cells. In some embodiments, the liver cells are hepatocytes. In some embodiments, the hepatocytes are human hepatocytes. The cells are stem cells. In some embodiments, the human liver cells are hepatic sinusoidal endothelial cells (L In some embodiments, the human liver cells may be Kupffer cells. In some embodiments, the human liver cells may be hepatic stellate cells. In embodiments, the human liver cells may be tumor cells. The liver cells may be hepatic stem cells. In a further embodiment, the cells are ApoE-binding Contains a receptor.

[0121] In some embodiments, an engineered cell, e.g., any one of the cell types in the preceding paragraph. Such engineered cells are described herein. In some embodiments, the engineered cells are produced by the methods described in It is present in a tissue or organ in the elephant, such as the liver.

[0122] In some of the methods and cells described herein, the cells detect modifications in the target sequence, e.g. In some embodiments, the insertion or deletion of a nucleotide ("indel") or substitution is included. The modification may be at least one of 1, 2, 3, 4, or 5 or more nucleotides in the target sequence. In some embodiments, the modification is an insertion of one or two nucleotides in the target sequence. In other embodiments, the modification is at least one of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, , 9, 10, 15, 20 or 25 or more nucleotide deletions. In some embodiments, the modification comprises a deletion of one or two nucleotides in the target sequence. In some embodiments, the modification is an intron that results in a frameshift mutation in the target sequence. In some embodiments, the modification includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, Contains 8, 9, 10, 15, 20, or 25 or more nucleotide substitutions In some embodiments, the modification comprises a substitution of one or two nucleotides in the target sequence. In some embodiments, the modification is to a template nucleic acid, e.g., any of the template nucleic acids described herein. One or more of the insertions, deletions or substitutions of nucleotides resulting from the incorporation of Includes.

[0123] In some embodiments, the population of cells comprising engineered cells, e.g., cells described herein, In some embodiments, a population of cells is provided, the population comprising cells engineered by the method. In some embodiments, the population comprises engineered cells cultured in vitro. In some embodiments, the population is present in a tissue or organ, such as the liver, in the subject. In some cases, at least 5%, at least 10%, at least 15%, or at least a few of the cells in the population at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, At least 65%, at least 70%, at least 75%, at least 80%, at least At least 85%, at least 90%, or at least 95%, or more, are engineered. In certain embodiments, the methods disclosed herein involve the detection of indels. As specified, at least 5%, at least 10%, at least 15%, at least 20% , at least 25%, at least 30%, at least 35%, at least 40%, less At least 45%, at least 50%, at least 55%, at least 60%, at least 65% %, at least 70%, at least 75%, at least 80%, at least 85%, at least yield an editing efficiency (or "percent editing") of at least 90% or at least 95% In other embodiments, the methods disclosed herein include methods for isolating a gene by insertion, deletion, substitution or otherwise. at least 5%, at least 10%, as defined by detection of a change in the sequence, regardless of whether %, at least 15%, at least 20%, at least 25%, at least 30%, at least at least 35%, at least 40%, at least 45%, at least 50%, at least 5 5%, at least 60%, at least 65%, at least 70%, at least 75%, at least at least 80%, at least 85%, at least 90% or at least 95% of the DNA In certain embodiments, the methods disclosed herein result in a modification efficiency of about 5% to about 10%. to about 100%, about 10% to about 50%, about 20% to about 100%, about 20% to about 80%, about An editing efficiency level or DNA modification between 40 and about 100% or between about 40 and about 80%. Brings efficiency levels.

[0124] In some of the methods and cells described herein, the cells in the population are modified, e.g., targeted In some embodiments, the modification comprises an indel or a substitution in the target sequence. The insertion of 1, 2, 3, 4, or 5 or more nucleotides is included. In some embodiments, the modification comprises the insertion of one or two nucleotides in the target sequence. In this embodiment, the modification is at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 32, 36, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, or a deletion of 25 or more nucleotides. The mutation comprises a deletion of one or two nucleotides in the target sequence. The mutations include indels that result in frameshift mutations in the target sequence. In terms of morphology, at least 80%, at least 85%, or at least 10% of the engineered cells in the population are At least 90%, at least 91%, at least 92%, at least 93%, at least 94% %, at least 95%, at least 96%, at least 97%, at least 98% or At least 99% or more contain a frameshift mutation. In this embodiment, the modification is at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 32, 36, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, or 25 or more nucleotide substitutions. The mutation comprises a substitution of one or two nucleotides in the target sequence. The mutation results from the incorporation of a template nucleic acid, such as any of the template nucleic acids described herein. The nucleic acid sequence may include one or more nucleotide insertions, deletions or substitutions.

[0125] Treatment Method The LNP compositions disclosed herein have the potential to inhibit in vivo and in vitro In one embodiment, the subject in need thereof can be administered the method of the present invention. One or more of the LNP compositions described herein can be administered. Thus, a therapeutically effective amount of the compositions described herein is administered to cells of a subject in need thereof. In one embodiment, cells can be contacted with the LNP compositions described herein. By contacting, genetically engineered cells can be produced.

[0126] In some embodiments, the method includes administering an LNP composition to a cell associated with liver damage. In some embodiments, the method includes treating liver damage. In embodiments, the method includes contacting liver cells with an LNP composition. In embodiments, the method includes contacting a liver cell with an LNP composition. In one embodiment, the method includes contacting an ApoE-binding cell with the LNP composition.

[0127] In one embodiment, the vector comprises an mRNA encoding a Cas nuclease, a gRNA, and a template. LNP compositions containing the LNPs can be administered to cells, such as ApoE-binding cells. In this case, the LNP composition comprising the Cas nuclease and the sgRNA is used to bind ApoE. In one embodiment, the Cas nuclease can be administered to a cell, such as a cell. The LNP composition can be administered to liver cells, comprising the mRNA, gRNA and template that In certain instances, a LNP composition comprising a Cas nuclease and an sgRNA can be In some cases, the liver cells are in a subject. In some embodiments, a subject can receive a single dose of the LNP composition. A subject can receive multiple doses of the LNP composition. If more than one dose is administered, In total, the doses are about 1, 2, 3, 4, 5, 6, 7, 14, 21, or 28 days apart; 3, 4, 5, or 6 months apart; or about 1, 2, 3, 4, or 5 years apart It is possible.

[0128] In one embodiment, a LNP composition comprising an mRNA encoding a Cas nuclease is administered to the liver. Administered to liver cells (also called hepatocytes), followed by transfection with a composition containing the gRNA and, optionally, a template. In one embodiment, an mRNA encoding a Cas nuclease can be administered. A and a gRNA-containing LNP composition are administered to liver cells, followed by administration of a template-containing composition. In one embodiment, a Cas nuclease-encoding m The LNP composition comprising RNA is administered to liver cells, followed by the LNP composition comprising gRNA, The LNP composition containing the template can then be sequentially administered to the cells. The LNP composition containing the mRNA encoding the enzyme is administered before the LNP composition containing the gRNA. In certain embodiments, administration is for about 4, 6, 8, 12 or 24 hours; or for 2, 3, 4 , 5, 6 or 7 days apart.

[0129] In one embodiment, the LNP composition is used to edit a gene resulting in a gene knockout. In one embodiment, the LNP composition can be used to induce gene correction. In one embodiment, the LNP composition can be used to edit a gene. It can be used to edit cells that carry the insertion.

[0130] In one embodiment, administration of the LNP composition results in gene editing that results in a durable response. For example, administration can be for up to one day, one month, one year or longer, resulting in a response period. As used herein, a "period of response" refers to the period of time during which the After editing cells using the LNP composition, the resulting modifications are The modification means that the target protein level is still present for a certain period of time. The modification can be detected by detecting the target DNA. In some embodiments, the response period may be at least one week. In one embodiment, the response period may be at least two weeks. In some embodiments, the response period is at least 2 months. In one embodiment, the response period may be at least four months. In embodiments, the response period may be at least 6 months. The response time may be about 26 weeks. In some embodiments, the response time is at least 1 year. In some embodiments, the response period may be at least 5 years. In embodiments, the response period may be at least 10 years. A sustained response was observed for at least six months by measuring or detecting target DNA. It is detectable even after months.

[0131] The LNP compositions can be administered parenterally. The LNP compositions are delivered to the bloodstream, tissue, or muscle. Administration can be directly into the flesh or into internal organs. Administration can be, for example, by injection or infusion. Administration may be systemic. Administration may be local. Suitable means for administration include intravenous. , intra-arterial, subarachnoid, intraventricular, intraurethral, ​​intrasternal, intracranial, subretinal, intravitreal, anterior chamber, intramuscular Suitable devices for administration include needles (including microneedles). Includes needle-free syringes, needle-free injectors and injection technologies.

[0132] LNP compositions typically, but not necessarily, contain one or more pharma- ceutically acceptable excipients. The compound or compounds of the present disclosure are administered in a formulation in combination with an excipient. Optional ingredients other than the above, other lipid ingredient(s) and biologically active agents. The functional (e.g., controlling the drug release rate) and / or non-functional (e.g., The choice of excipient can be influenced by a particular It depends on factors such as the mode of administration, the effect of excipients on solubility and stability, and the nature of the dosage form. Highly depends.

[0133] Parenteral formulations are generally aqueous or oily solutions or suspensions. In some cases, sugars (including but not limited to glucose, mannitol, sorbitol, etc.), salts, charcoal, Excipients such as hydrates and buffers (preferably at a pH of 3 to 9), although for some applications For this purpose, they are more preferably combined with a sterile non-aqueous solution or with a sterile pyrogen-free aqueous solution. It can be formulated as a dry form for use with a suitable vehicle such as water-filled fiber (WFI). .

[0134] In some embodiments, the method of gene editing modifies a Factor VII target gene. In certain embodiments, the LNP composition is administered to liver cells to modify the Factor VII gene. The LNP compositions can be used to treat liver disorders, such as factor VII deficiency. The method can modulate aberrant Factor VII activity. In certain embodiments, the LNP compositions are used to treat or inhibit hemophilia or uncontrolled blood clotting. can be administered prophylactically. See, e.g., Lapecorella, M. and Mariani, G. Fa ctor VII deficiency: defining the clinical picture and optimizing therapeutic op Haemophilia (2008), 14, 1170-1175. In certain embodiments, the LN The P composition is intended to treat or reduce thrombophilia, a condition in which blood has an increased tendency to form clots. The therapeutic agent may be administered prophylactically or prophylactically.

[0135] When tissue damage occurs, an equimolar complex is formed between the factor VII zymogen and tissue factor. This results in cleavage at position 152 of the factor VII sequence, giving rise to activated factor VII or factor VI. This leads to the formation of factor Ia. The factor VIIa / tissue factor complex leads to coagulation. Methods for treating factor II-related disorders include methods for increasing factor VIIa coagulation, methods for inhibiting blood clotting, and methods for treating factor II-related disorders. The present invention relates to a method for improving a blood clotting profile. In embodiments, these methods involve administering an LNP composition to a subject with factor VII deficiency. In some embodiments, the methods include using recombinant factor VII for factor VII deficiency. The LNP composition is administered to a subject who has previously been treated with Factor Ia.

[0136] In some embodiments, the gene editing method modifies a TTR target gene. In embodiments, the present invention is directed to treating disorders associated with TTR expression in the liver, such as amyloidosis. In certain embodiments, the LNP composition can be used to and administering the compound to treat or prevent amyloidosis, including transthyretin-type amyloidosis. See, e.g., Patel, K. and Hawkins, P. Cardiac amyloidosis: where are we today? J. Intern. Med. (2008), 278, 126-144.

[0137] TTR-related disorders can lead to the accumulation of amyloid deposits. Methods for treating or preventing a TTR-related disorder include methods for reducing TTR levels, methods for increasing TTR production, and methods for preventing TTR-related disorders. Methods for reducing amyloid deposition in patients with hereditary transthyretin amyloidosis Methods for treating non-hereditary transthyretin amyloidosis, methods for treating non-hereditary transthyretin amyloidosis, and The present invention provides a method for affecting amyloid deposits in the heart and autonomic and peripheral nerves. In some embodiments, the method of treating or preventing a TTR-related disorder comprises administering amyloin to a subject. In certain embodiments, the method further comprises administering the LNP composition to a subject diagnosed with idiopathic ... In these methods, an LNP composition is administered to a subject in need of reduced TTR production.

[0138] In some embodiments, the method of gene editing includes the step of: SERPING1, KLKB1, KNG1, FXII, ASS1, ASL, BCKDHA , BCKDHB, G6PC, GO / HAO1, AGXT, PCCA, PCCB, OTC, Targeting genes selected from LIPA, ABCB11, GALT, ATP7B and PAH In some embodiments, the method of gene editing includes treating alpha 1 antitrypsin deficiency, blood Hemophilia A, Hemophilia B, HAE, Type 1 citrullinemia, Argininosuccinic aciduria, Maple syrup oxaluria, glycogen storage disease, primary hyperoxaluria type 1, propionate academia, ornithine thrombocytopenia carbamylase deficiency, cholesteryl ester storage disease, progressive familial intrahepatic cholestasis The patient is affected by a disease selected from the group consisting of septicemia, galactosemia, Wilson's disease, and phenylketonuria. The present invention can be used to treat subjects suffering from

[0139] When used in conjunction with the term "comprising" in the claims and / or specification, the words "a," " "An" or "the" can mean "one," but each means "one or more." It also matches the meanings of "a number of," "at least one," and "one or more than one." The use of "or" means "and / or" unless otherwise stated. "(including)" and "containing," as well as other forms such as " "includes", "included", "contains" and " The use of "contained" is non-limiting. All ranges given in this application , inclusive of endpoints unless otherwise stated. EXAMPLES

[0140] [Example 1] material and method. Lipid Nanoparticle ("LNP") Formulations The LNPs were formulated with a molar ratio of CCD lipid amine to RNA phosphate (N:P) of approximately 4.5. The lipid nanoparticle components were dissolved in 100% ethanol in the following molar ratios: 45 mol% (12.7 mM) of CCD lipid (e.g., lipid A or lipid B); 44 mol% (12 0.4 mM) of helper lipid (e.g., cholesterol); 9 mol% (2.53 mM) a hydrophobic lipid (e.g., DSPC); and 2 mol% (.563 mM) PEG (e.g., PE G2k-DMG or PEG2k-C11). The RNA cargo was bound to 50 mM acetate buffer, pH 4. 0.5, resulting in a concentration of RNA cargo of approximately 0.45 mg / mL.

[0141] Precision Nanosystems NanoAssemblr™ Microfluidize the lipid and RNA solutions using a centrifugal separator according to the manufacturer's protocol. LNPs were formed by dynamic mixing. Differential flow rates were used during mixing to separate the aqueous vs. organic phases. A 2:1 ratio of solvents was maintained. After mixing, the LNPs were collected and diluted with phosphate buffered saline (PBS, The mixture was diluted approximately 1:1 and then passed through a 10 kDa Slide-a-Lyzer™ G2 filtration system. Using a precipitation cassette (ThermoFisher Scientific), gently mix the mixture. The remaining buffer was exchanged with PBS (100-fold excess of the sample volume) while stirring at 4°C overnight. The resulting mixture was then filtered using a 0.2 μm sterile filter. The resulting filtrate was stored at 2-8°C. To this end, the isolated LNPs were characterized as follows.

[0142] In vitro transcription of nuclease mRNA and single guide RNA (sgRNA) Photo (“IVT”) In vitro amplification using linearized plasmid DNA template and T7 RNA polymerase ro transcription produces capped and polyadenylated nucleotides containing N1-methyl pseudo-U. The modified Cas9 mRNA was generated by incubating with XbaI at 37°C for 2 hours under the following conditions: By bating Linearized plasmid DNA: 200ng / μL plasmid, 2U / μL Xb aI (NEB) and 1× reaction buffer. The reaction was heated to 65° C. for 20 min. The linearized plasmid was purified by silica maxispin column (Epoch Purify the enzyme and buffer salts using the ELISA kit (DeepLab Life Sciences) to confirm linearization. The IVT reaction generating modified mRNA of Cas9 was analyzed by agarose gel. The reaction was incubated at 37° C. for 4 hours under the following conditions: 50 ng / μL linearization Plasmid; GTP, ATP, CTP and N1-methyl pseudo-UTP (Trilink) 2 mM of each of the following: 10 mM ARCA (Trilink); 5 U / μL of T7 RNA polymerase lysine esterase (NEB); 1U / µL mouse RNase inhibitor (NEB); 0.004U / μL inorganic E. coli pyrophosphatase (NEB); and 1× reaction buffer After 4 hours of incubation, the buffer was diluted with TURBO DNase (ThermoFis her) was added to a final concentration of 0.01 U / μL and the reaction was incubated for an additional 30 min. The DNA template was removed by ELISA following the manufacturer's protocol (ThermoFisher). Use the MegaClear Transcription Cleanup Kit to clean up enzymes and nucleotides. Alternatively, Cas9 mRNA was purified from the precipitation plate, e.g., as shown in Example 15. The mRNA is purified through a protocol, which in some cases is followed by HPLC-based purification. Briefly, after DNase digestion, 0.21 times the volume of 7.5 M LiCl solution was added. The mRNA was precipitated by mixing with 0.5% CO and pelleted by centrifugation. Once the supernatant was removed, the mRNA was renatured in water. The mRNA was precipitated again using ethanol. Together with 2 volumes of 100% EtOH. Add 5 M ammonium acetate to the mRNA solution for a final concentration of 2 M. Mix the solution. The precipitated mRNA was then centrifuged again and incubated at -20°C for 15 minutes. The mixture was pelleted, the supernatant removed, and the mRNA was reconstituted in water. The mRNA was precipitated using 1 / 10 volume of 3M sodium acetate and ethanol. A volume of 100% EtOH was added to the solution along with 2 volumes of 100% EtOH. The solution was mixed. The mixture was incubated at -20°C for 15 min. The precipitated mRNA was centrifuged again and pelleted. The supernatant was removed and the pellet was washed with 70% cold ethanol and air-dried. The mRNA was renatured in water. For HPLC purified mRNA, LiCl precipitation and renaturation were performed. Afterwards, the mRNA was purified by RP-IP HPLC (see, e.g., Kariko, et al. (See Nucleic Acids Research, 2011, Vol. 39, No. 21 e142). The resulting fractions were combined and desalted by sodium acetate / ethanol precipitation as described above. ed).

[0143] For all methods, transcript concentrations were determined by measuring absorbance at 260 nm. (Nanodrop), and the transcripts were analyzed by capillary anal- ysis using a Bioanlayzer (Agilent). The mixture was analyzed by tube electrophoresis.

[0144] IVT was also used to generate sgRNA in a similar manner. The top oligo consisted only of the enzyme promoter sequence and the sgRNA template and The bottom strand, which contains the complementary sequence, is annealed to the promoter site to form the s The DNA template for gRNA was generated. The annealed template was incubated at 37 °C for 1 h .... Used directly in the VT reaction: 125 nM template; GTP, ATP, CTP and UTP 7.5 mM of each of; 5 U / μL T7 RNA polymerase (NEB); 1 U / μL Mouse RNase inhibitor (NEB); 0.004 U / μL inorganic E. coli PI phosphatase (NEB); and 1x reaction buffer. The reaction was incubated at 37°C for 8 hours. Then, 0.01 U of TURBO DNase (ThermoFisher) was added. 1 μL final concentration and incubate the reaction for an additional 30 min to remove the DNA template. MegaClear according to the manufacturer's protocol (ThermoFisher) The sgRNA transcripts were purified by a transcription cleanup kit. Transcript concentrations were determined by centrifugation (Nanodrop) and transcripts were analyzed by PAGE. Ta.

[0145] Formulation Analysis LNP formulations were analyzed for mean particle size, polydispersity (pdi), total RNA content, and RNA encapsulation efficiency. The mean particle size and polydispersity were analyzed using a Malvern Zetasizer D The measurements were performed by dynamic light scattering (DLS) using an LS instrument. Prior to DLS measurements, LNP samples were diluted 30-fold in PBS. Z-average diameter, an intensity-based measure of average particle size reported together with PDI.

[0146] A fluorescence-based assay was used to determine total RNA concentration and encapsulation efficiency. RiboGreen® dye (ThermoFisher Scientific c, Catalog No. R11491) LNP was diluted in 1x TE buffer to fall within the linear range of 50 μl of the diluted LNP was added to 50 μl of 1× TE buffer or 0 The mixture was further mixed in duplicate with 1×TE buffer containing 2% Triton X-100. Iton completely destroys the LNP, exposing total RNA to RiboGreen ( ) Incubate the sample at 37°C for 10 minutes to allow for interaction with the dye. The starting RNA solution used to generate LNPs was used and the same steps were followed as above. Samples for the standard curve were prepared by following the steps below. n® dye (100 μL, 100x in 1× TE buffer, according to manufacturer's instructions) ) was then added to each of the samples and incubated for 10 minutes at room temperature in the absence of light. The samples were read using a SpectraMax M5 microplate reader (Mol The excitation, autocutoff and emission wavelengths were set to The wavelengths were set at 488 nm, 515 nm, and 525 nm, respectively. The encapsulation efficiency (%EE) was as follows: It was calculated using the formula below:

[0147]

number

[0148] The same procedure was used to determine the encapsulation efficiency of DNA-based cargo components. For single stranded DNA, Oligreen dye can be used, for double stranded DNA, For double stranded DNA Picogreen dye can be used.

[0149] The mean particle size, polydispersity and %EE values ​​for various LNP compositions are reported in Table 1 below. will be done.

[0150] [Table 1-1]

[0151] [Table 1-2]

[0152] [Table 1-3]

[0153] T7E1 assay Inserts generated through non-homologous end joining (NHEJ) after DNA cleavage by Cas9 To detect mutational events in genomic DNA, such as insertions, deletions, and substitutions, T7E 1 assay was used in some examples (see, e.g., Cho et al., Targeted genome en gineering in human cells with the Cas9 RNA-guided endonuclease. Nature Biotechno logy. 2013; 31, 230-232).

[0154] The genomic DNA region targeted by CRISPR / Cas9 was amplified by PCR and The mixture was denatured at 95°C for 10 minutes, and then the temperature was decreased from 95°C to 25°C at a rate of 0.5°C / sec. The DNA pairs that form heteroduplexes are amplified. The reannealed heteroduplexes were then incubated at 37°C for 1 h at 4°C for 1 h. for 25 minutes or longer with bacteriophage resolvase T7E1 (New Eng The T7E1 nuclease was digested with 500 kDa (Land Biolabs) to generate double-stranded breaks, where the T7E1 nuclease The enzyme recognized the mismatch. The resulting DNA fragments were analyzed using a fragment analyzer. The editing efficiency was then quantified to determine an approximation of the editing efficiency. To do so, next generation sequencing was used as described herein.

[0155] Next generation sequencing ("NGS") and analysis for accurate cleavage efficiency Deep sequencing is used to quantitatively determine the editing efficiency at targeted locations in the genome. The presence of insertions and deletions introduced by gene editing was confirmed.

[0156] Design PCR primers around the target site (e.g., TTR, FVII) and generate the desired gene. The genome region was amplified. The primer sequences are provided below. The chemistry required for sequencing is given below. To add additional PCR was performed according to the manufacturer's protocol (Illumina). Amplicons were sequenced on an Illumina MiSeq instrument. After removing those with cores, the read data are aligned to the human reference genome (e.g., hg38 The resulting file containing the reads was aligned to the reference genome (BAM file). where reads that overlap the target region of interest are selected and mapped to the wild type The number of reads containing insertions, substitutions, or deletions was calculated relative to the number of reads. .

[0157] The editing percentage (e.g., "editing efficiency" or "percent editing") is the percentage of insertions or deletions It is defined as the total number of sequence reads containing wild type divided by the total number of sequence reads containing wild type. do.

[0158] in vitro LNP delivery Mouse cell lines (Neuro2A and Hepa1.6) were cultured in 10% fetal bovine serum supplemented Culture in DMEM medium and lyse and analyze as described herein (e.g., reporter expression). Transfection with LNPs 18-24 hours prior to T7E1 assay and NGS The cells were plated at a density of 15,000 cells / well 24 hours prior to the collagen-coated Using a 6-well plate, culture one mouse hepatocyte in hepatocyte plating medium (Invitrogen). Primary hepatocytes (Invitrogen) were cultured at 15,000 cells per well. After 2 h, the plating medium was removed and replaced with hepatocyte maintenance medium containing LNP and 3% mouse serum. The medium was replaced with 100% lysed PBS (preincubated at 37°C for 5 min). Transfect cells for 42–48 h prior to transfection and analysis (e.g., T7E1 assay, NGS). For both cell lines and primary hepatocytes, LNP was diluted and transfected at 1000 μl / well. Starting with 100ng of Cas9 mRNA and approximately 30nM of guide RNA, cells Plus 0.1ng Cas9 mRNA and 0.03nM guide RNA per well Serial dilutions to A were performed in a semi-logarithmic manner.

[0159] in vivo LNP delivery Female CD-1 mice aged 6-10 weeks were used in each study. To prepare the fluid, animals were weighed and grouped according to body weight. LNP was administered via the lateral tail vein in a volume of 2 mL (approximately 10 mL per kilogram of body weight). Animals were observed for adverse effects approximately 6 hours after dosing. Animals were weighed and exsanguinated at various time points by cardiac puncture under isoflurane anesthesia. The animals were euthanized with 100 mL of serum separator tubes or buffered sodium citrate for plasma as described herein. Blood was collected into tubes containing lysine. For studies involving in vivo editing, For extraction and analysis, liver tissue was extracted from the central lobule from each animal or from three independent For some studies, tissue samples were collected from selected lobules (e.g., right middle, left middle, and left lateral lobes). Spleen tissue was also collected.

[0160] Genomic DNA isolation Homogenize the tissue in lysis buffer (approximately 200 μL per 10 mg of tissue) and extract DNA. 1. Prepare Invitrogen Pure Chromatography (PCR) kit according to the manufacturer's protocol, including precipitation. Using the Link Genomic DNA Kit (catalog K1820-02), 10 mg of tissue was Genomic DNA was extracted from the 100-kDa genomic DNA fragments and subjected to PCR and subsequent NGS analysis as described herein. For analysis, all DNA samples were normalized to a concentration of 100 ng / μL.

[0161] Transthyretin (TTR) ELISA analysis Blood was collected and serum was isolated as shown. Total TTR serum levels were measured in mice prealbumin-induced Min (Transthyretin) ELISA Kit (Aviva Systems Bio The kit reagents and standards were Mouse sera were prepared according to the manufacturer's protocol. Two serial 50-fold dilutions were performed to obtain a 2,500-fold dilution. This was carried out by resulting in a total sample dilution of 10,000 times: A final 4-fold dilution step was performed. Add both the standard curve dilutions (100 μL each) and the diluted serum samples to each well of the plate. The plates were incubated at room temperature for 30 minutes before washing. A 100 μL buffer was added per well for a 20 minute incubation. The bound antibody conjugate is removed, the plate is washed again, and a chromogenic substrate solution is added. The plate was incubated for 10 minutes and then 100 μL of stop solution, e.g., sulfuric acid, was added. (approximately 0.3M) was added. The plate was read at 450 nm absorbance using SpectraMax Read on an M5 plate reader. Standard curve to four parameter logistic curve Using fitting, the data were analyzed using SoftMax Pro software version 6.4.2. Serum TTR levels were calculated using the following formula: Final serum values ​​were adjusted for assay dilution.

[0162] Factor VII (FVII) activity assay Blood was collected for plasma as indicated. Using a smear (Anaria Diagnostics, catalog A221304), The plasma factor VII activity level was measured. The kit reagent was prepared according to the manufacturer's protocol. Two serial 50-fold dilutions were performed resulting in a 2,500-fold dilution. The plasma was diluted 10,000-fold with the sample dilution buffer provided in the kit. For total sample dilution, a final 4-fold dilution step was performed. Diluted sample (30 μL) Kit Reagent 1 (30 μL) was added to the plate. Kit Reagent 2 (60 μL) was then added to the plate. Kit Reagent 3 (60 μL) was added and then incubated at 37° C. for 7 minutes. The plate was then incubated at 37° C. for an additional 5 minutes, after which acetic acid The enzyme reaction was stopped by adding 60 μL of 20 v / v% aqueous solution. The plates were read on a SoftMax M5 plate reader. Relative FVII activity was calculated based on the calibration curve and reported as a percentage of the vehicle control. He declared.

[0163] [Example 2] In vitro delivery of eGFP mRNA-encapsulated LNPs. LNs containing mRNA encoding eGFP (TriLink, catalog L-6101) P was prepared as described in Example 1. The components of each LNP preparation included CC D lipid (45 mol%), cholesterol (44 mol%), DSPC (9 mol%) and P LNP-002, containing EG2k-DMG or PEG2k-C11 (2 mol%) -006, -007, -010 and -011 contain lipid A as the CCD lipid, and L NP-012 and -013 contain lipid B as the CCD lipid. 010 and -012 contain PEG2k-DMG, while LNP-006, -007, -01 -013 and -014 contain PEG2k-C11. Average particle size, polydispersity and encapsulation efficiency Details of the LNPs are provided in Table 1. As described in Example 1, the LNPs were cultured in a mouse hepatocyte cell line ( The total amount of eGFP mRNA delivered was 1.6 for each LNP. The cells were incubated with LNPs for approximately 18 h at 100 or 500 ng per well. The cells were incubated for 2 h and eGFP expression was measured using a CytoFLEX cell analyzer (Bechm Measurements were made using a Coulter (an

[0164] As shown in Figure 1, eGFP expression was observed in each formulation. LNP formulations containing lipid A (LNP-002, -006, -007, -010 and -011) are eGFP mRNAs. LNP formulations containing lipid B (LNP-012 and -013) successfully delivered NA. PEG2k-C11 and PEG2k-DMG stearyl esters also delivered eGFP mRNA. LNPs containing lysine lipids delivered mRNA effectively in both of these experiments, and have demonstrated in vitro delivery of mRNA into a mouse hepatic cell line using LNPs. do.

[0165] [Example 3] In vivo delivery of gLUC mRNA-encapsulated LNPs. Gaussia luciferase (gLUC) (TriLink, catalog L-6123 LNPs containing mRNA encoding the in The delivery of mRNA to animals in vivo was tested. The components of each LNP preparation included: CCD lipid (45 mol%), cholesterol (44 mol%), DSPC (9 mol%) and and PEG2k-DMG (2 mol%). LNP-014 contains lipid A and LN P-015 contained lipid B. The average particle size, polydispersity and encapsulation efficiency of these preparations were Details of the agents are provided in Table 1. gLUC at 0.1 mg / kg and 0.3 mg / kg A dose of mRNA was delivered with each LNP formulation. Animals were euthanized 24 hours later and the results were reported in Example 1. Blood collection and serum isolation were performed as described in Pierce™ G aussia luciferase flash assay kit (ThermoFisher S Scientific, Cat. No. 16158) according to the manufacturer's protocol. Serum luciferase expression was measured.

[0166] As shown in Figure 2, a dose-dependent increase in gLUC expression was observed in each animal ( (n=5 per group) were observed. As measured by luciferase activity, lipid A or lipid B-containing LNPs demonstrated effective in vivo delivery and expression of mRNA. Ta.

[0167] [Example 4] Cas9 mRNA-containing LNPs (mRNA-LNPs) and dual guide RNA-containing LNPs (d In vivo delivery and editing using gRNA-LNPs. For in vivo editing in the liver, CRISPR / Cas RNA components (e.g. The LNPs for delivering the mRNA encoding the gRNA and Cas9 were inserted into the CD-1 In these experiments, dgRNA and mRNA were formulated separately. Ta.

[0168] In vitro transcribed Cas9 mRNA and chemically modified as described in Example 1. LNPs were formulated separately with mutant dgRNAs (targeting TTR or FVII). The dgRNA used in the examples was chemically synthesized and obtained from a commercial supplier. 3′ at both the 5′ and 3′ ends of the crRNA and trRNA that make up the heavy guide Each LNP preparation (LNP -093, -094, -095, -096 and -097) are components of CCD lipids. (Lipid A) (45 mol%), cholesterol (44 mol%), DSPC (9 mol%) and and PEG2k-DMG (2 mol%). Details of these formulations are provided in Table 1. Two different dosing regimens were used: (1) mRNA-LNP formulation (LNP-097) and dgRNA-LNP formulation (LNP -093, -094, -095 or -096) in equal parts (by weight of RNA) The combined formulation will be administered for two consecutive days (1 mg of each RNA component formulation on each day). / kg, total 2 mg / kg); or (2) dgRNA-LNP (LNP- 093, -094, -095 and -096) 4 hours before administration of mRNA-LNP ( LNP-097) on two consecutive days (each formulation was administered at 1 mg / kg). Each group was euthanized 5 days after the first administration. In addition, each experimental group had internal sequencing controls and was sequenced for NGS analysis as described in Example 1. Two PCR reactions were performed for both targets in each animal (n=3 in each group). Mutational DNA was isolated and analyzed by NGS as described in Example 1.

[0169] As shown in Figure 3A and 3B, co-administration (A1(LNP-093 / -097) or A 2 (LNP-094 / -097)) or pretreatment (A3 (LNP-093 / -097)) Using this dosing regimen, i In vivo editing (approximately 1.8% editing to 2.8% editing) was observed. Animals that received LNP were co-administered with Cas9 mRNA (B1(LNP-095 / received B2 (LNP-097) or B2 (LNP-096 / -097) dgRNA, and were pretreated (B3 (LNP-095 / -097) or B4 (LNP-096 / -0 97) In the liver of animals, editing was approximately 2% to 4.5%. Serum and plasma analyses were performed on all animals as described above. There was no statistically significant difference (P<0.05) in either the total serum levels of R or the FVII activity in plasma. BS-treated animals) (not shown).

[0170] [Example 5] In vitro and IVT studies using dgRNA-LNP and IVT sgRNA-LNP and in vivo delivery and editing. LNPs containing chemically modified dgRNA and in vitro transcribed (IVT) sgRNA The efficacy of LNPs containing the Cas9 mRNA was tested in the context of co-administration with Cas9 mRNA-LNPs.

[0171] LNP-115, -116, -117, -120, -121 and -123 were used in Example 1. The formulations were prepared according to the method described in Example 1. Details of the specific formulations are provided in Table 1. The formulations of this example were tested for delivery to Neuro2A cells using the procedure described above.

[0172] LNP-121 (gRNA) and LNP-120 (Cas9 mRNA) were mixed together. and added to gRNA concentrations of 152 nM, 76 nM, and 38 nM per well, respectively. In addition, 570ng, 285ng and 142ng of mRNA were administered; LNP-123( gRNA) and LNP-120 were mixed together, each at 156 nM per well, gRNA concentrations of 78nM and 39nM plus 528ng, 264ng and 132ng g mRNA was administered; and LNP-116 (gRNA) was administered with LNP-120 (C as9 mRNA) were mixed at 124 nM, 62 nM and 31 nM per well, respectively. 460ng, 229ng and 114ng of mRNA were administered in addition to nM gRNA concentrations LNP-121 was administered at gRNA concentrations of 198 nM, 99 nM, and 49.5 nM. LNP-123 was administered at gRNA concentrations of 189 nM, 94.5 nM, and 47 nM. LNP-116 was administered at gRNA concentrations of 124 nM, 62 nM, and 31 nM. Cas9 mRNA (100 ng per well) was incubated with LF The IVT sgRNA-LNP (LNP-123) was added to the LNP ( LNP-120) or LF2K with Cas9 mRNA, as well as chemical modifications Samples containing co-administration of gRNA and gRNA(LNP-121) at test concentrations was observed.

[0173] The formulations of this example were then tested in vivo. On two consecutive days, a mixture of Cas9 mRNA-LNP and one of the gRNA-LNPs was (Animals received 1 mg / kg of each formulation each day), with one formulation administered at 1 The subjects were administered the same drug for only 6 days after the first dose (n=5 in each group). After 7 days (for the group receiving 100 mg / kg of ... Analyzed by GS.

[0174] As shown in Figure 4A, single and double doses were effective for delivery. The group that received one dose (LNP-121 and LNP-120; Fig. 4A, C) and the group that received Cas 9. mRNA-LNPs co-administered with chemically modified dgRNA-LNPs on 2 consecutive days The groups receiving 1 dose each (LNP-116 and LNP-120, A in Fig. 4A; LNP-12 There is no statistical difference between unmodified IVT sg. 1 and LNP-120 (Fig. 4B, B). Cas9 mRNA-LNPs co-administered with RNA-LNPs (LNP-123 and LN Animals receiving P-120 (Figure 4B, D) were treated with the dgRNA-LNP used in this example. These experiments demonstrated relatively low levels of editing compared to Cas9 (Figure 4B). When co-administered with mRNA-LNPs, containing modified dgRNA or IVT sgRNA We demonstrate that LNPs enable in vitro and in vivo editing. In vivo analysis observed when using LNPs containing IVT sgRNA in our experiments The level of aggregation may be affected by impurities in the isolated IVT sgRNA. be.

[0175] [Example 6] In vitro and in vitro studies using modified dgRNA-LNPs or modified sgRNA-LNPs and in vivo delivery and editing. LNPs containing chemically modified dgRNAs and LNPs containing chemically modified sgRNAs was also tested by co-administration with Cas9 mRNA-LNP.

[0176] As described in Example 1, the LNPs were prepared by incorporating chemically modified dgRNA (TTR or FVII (targeting TTR or FVII), chemically modified sgRNA (targeting TTR or FVII) and IVT The dgRNA in this example was chemically synthesized and commercially available. The 5' and 6' ends of the crRNA and trRNA that make up the dual guide are supplied by a supplier. It has phosphorothioate linkages between the three terminal nucleotides at both the 3′ and 4′ ends. The sgRNAs in this example were also chemically synthesized and supplied by a commercial supplier. At and between the three terminal nucleotides at both the 5' and 3' ends of the gRNA The composition of each LNP preparation The components were CCD lipid (lipid A, 45 mol%), cholesterol (44 mol%), DS PC (9 mol%) and PEG2k-DMG (2 mol%). LNP-136, -137, -138, -139 and -140 were used in these experiments. Details including, polydispersity and encapsulation efficiency are provided in Table 1.

[0177] The formulations of this example were tested for delivery to Neuro2A cells as described in Example 1. Each formulation was added directly to the cell culture medium to deliver guide LNP and Ca to cells. s9 mRNA LNPs were co-transfected to yield the concentrations listed in Table 2 and performed Percent editing was determined using the T7E1 assay described in Example 1. represents the formulations listed in Table 2.

[0178] [Table 2]

[0179] The Cas9 mRNA-LNP and co-expression profiles were compared to the dgRNA-LNP formulations tested. Magnitude of editing using transfected chemically modified sgRNA-LNPs A significant increase in C was measured for both targets (Figure 5). Chemically modified sgRNA-LNPs cotransfected with as9 mRNA-LNPs (LNP-138 and -139, Figure 5) were approximately 35-50% and 6% of cells, respectively. This resulted in edits ranging from 5 to 70%.

[0180] The formulations of this example were then tested in vivo. In the first place, the Cas9 mRNA-LNP (LNP-140) and the gRNA-LNP (LN P-136, -137, -138 and -139) were administered to the animals. The component formulation was administered at 1 mg / kg / day for two consecutive days (total 2 mg / kg / day) (each group Six days after the first administration, the animals were euthanized and liver tissue was collected and analyzed as described in Example 1. Analyzed by NGS as described.

[0181] In FIG. 6, A1 and A2 are administration of a mixture of formulations LNP-136 and LNP-140. B1 and B2 represent the administration of a mixture of formulations LNP-139 and LNP-140. C1 and C2 represent the administration of a mixture of formulations LNP-137 and LNP-140. D1 and D2 represent the administration of a mixture of formulations LNP-138 and LNP-140. As shown in Figure 6, the chemically modified sgRNPs co-administered with Cas9 mRNA-LNPs The amount of editing resulting from the use of dgRNA-LNP formulations when A-LNP was used (approximately The increase in edits (roughly 10% to 32%) compared to the previous 2% to 5% Both targets were measured. Animals that received the dgRNA-LNP formulation targeting TTR The sgRNA-LNP formulation resulted in less than 5% editing across two liver biopsies, whereas the sgRNA-LNP formulation resulted in less than 20% editing across two liver biopsies. % (peaking at 30% or more in one animal). Animals receiving the VII-targeting dgRNA-LNP formulation had 3x the mean age at presentation across two liver biopsies. % editing, whereas sgRNA-LNP formulations showed an average percent editing of roughly 10%. (peak of over 12% in one animal).

[0182] These results demonstrate that Cas9 mRNA and gRNA (dgRNA and sgRNA) LNPs formulated separately (both IgG and IgG) showed in vivo editing when co-administered together. achieved when Cas9 mRNA-LNPs were administered before gRNA-LNPs. demonstrated that in vivo editing could be achieved.

[0183] [Example 7] In vitro studies using LNPs containing sgRNA co-formulated with Cas9 mRNA and in vivo delivery and editing. Prepared for delivery of Cas9 mRNA and sgRNA encapsulated together in an LNP composition Formulated LNPs also effectively deliver CRISPR / Cas components.

[0184] Chemically modified sgRNA along with IVT Cas9 mRNA as described in Example 1 LNPs were formulated with either TTR or FVII targeting RNA components by weight. The ratio of mRNA:sgRNA obtained by this experiment was approximately 1:1. The sgRNAs were synthesized locally and supplied by a commercial supplier, with both the 5' and 3' ends of the sgRNAs at the three terminal nucleotides in The components of each LNP preparation included CCD lipids (lipid A, 4 5 mol%), cholesterol (44 mol%), DSPC (9 mol%) and PEG2k- DMG (2 mol%) was included. LNP-152, -153, -154 and -155 Details of these formulations used in these experiments, including average particle size, polydispersity and encapsulation efficiency, are Provided in Table 1.

[0185] The formulations of this example were tested for delivery to Neuro2A cells as described in Example 1. Cells were transfected with the formulations and percent editing was determined by N It was judged using GS.

[0186] In FIG. 7, A represents administration of LNP-152; B represents administration of LNP-153; C represents administration of LNP-153; A represents administration of LNP-154; D represents administration of LNP-155; E represents administration of LNP-1 Each formulation contains 300 ng of Cas9 m RNA and 93 nM gRNA; 100 ng Cas9 mRNA and 31 nM g RNA; 30 ng of Cas9 mRNA and 10 nM of gRNA; and 10 ng of Cas9 mRNA and 3 nM gRNA were administered to each LNP as shown in Figure 7. Administration of the formulations resulted in robust editing efficiencies, with some formulations editing >80% of cells. Two of the LNP formulations targeting FVII were The cells were treated with a combination of two drugs (LNP-152 and LNP-153), which also showed efficient Concentration (approximately 70-90% editing), as well as FVI present between the two delivered sgRNAs This resulted in the excision of a portion of the I gene (Fig. 7 and data not shown).

[0187] The formulations of this example were also tested in vivo. As described in Example 1. The animals were administered a single dose (n=4 in each group). The treatment group that received FVII-targeting LNPs was One treatment group received 2 mg / kg (e.g., LNP-152 and and LNP-153) at a single combined dose (LNP-152 and The treatment group receiving TTR-targeting LNP received two doses (each Each patient received 2 mg / kg of 100 mg ... The animals were euthanized in all groups 8 days after the first dose. Blood and liver tissues were collected and analyzed as described in Example 1. Each formulation was administered to four animals. was administered.

[0188] In Figures 8A, 8B and 9, A represents administration of LNP-152; B represents administration of LNP-153. C represents the administration of a combination of LNP-152 and LNP-153. As shown in Figures 8A and 8B, each LNP formulation tested had robust Treatment with LNP formulations targeting the TTR sequence resulted in excellent in vivo editing efficiency. For animals, more than 50% of liver cells from each biopsy in some animals were inoculated at the target site. The overall mean (across all biopsies in all animals) for each treatment group was 45.2 ± 6.4% ( 51.1 ± 3.7% (LNP-154) and 51.1 ± 3.7% (LNP-155) (Figure 8A).

[0189] Animals treated with LNPs targeting the FVII sequence showed a range of percent editing in liver biopsies. The greatest observed editing was in one animal that received both LNP formulations targeting the FVII sequence. In one study, more than 70% of liver cells were edited from the biopsy sample (e.g., target site(s) ) or between them). 52, LNP-153, and LNP-152 and LNP-153) overall average (all animals (across all biopsies) were 16.9±6.5%, 38.6±13.2%, and The mean IL-1 expression level was 50.7 ± 15.0% (Figure 8B). For this purpose, excision of the intervening genomic DNA between the target sites of each sgRNA occurs at one or both of the target sites. Indels in either or both were detected by PCR (Figure 9).

[0190] In Figures 10 and 11, A represents administration of LNP-152; B represents administration of LNP-153. C represents administration of LNP-154; D represents administration of LNP-155; E represents administration of LNP-155; represents the administration of a combination of LNP-152 and LNP-153. The robust in vivo editing observed when administered in patients also resulted in phenotypic changes. As shown in Figure 10, serum TTR levels were significantly increased in animals treated with LNPs targeting the TTR sequence. Large reductions in TR levels (up to approximately 75%) were observed (but not in controls or FVII (This was not observed in animals treated with LNPs targeting FVII.) Decreased levels of plasma FVII activity were observed in animals treated with the LNPs ( However, this was not observed in control or TTR-targeted LNP-treated animals. Figure 11).

[0191] [Example 8] Variation in formulation parameters. Formulated to deliver Cas9 mRNA and gRNA together in one formulation The LNPs were then mixed with: (1) a range of doses; (2) varying mRNA:gRNA (3) the efficacy of one-dose versus two-dose administration; and (4) the efficacy of LNP in the spleen. We tested whether the expression of ribosomal RNA would result in uptake or editing in the spleen.

[0192] Chemically modified sgRNA along with IVT Cas9 mRNA as described in Example 1 (targeting TTR). The tested ratios of mRNA:sgRNA (R The weight ratio of the NA components is approximately 1:1 (LNP-169), approximately 10:1 (LNP The ratio of sg used in this example was approximately 1:10 (LNP-170) or approximately 1:10 (LNP-171). The RNA is terminated with three terminal nucleotides at both the 5' and 3' ends of the sgRNA. and each of which contains a 2'-O-methyl modification and a phosphorothioate linkage therebetween. The components of the LNP preparation included lipid A (45 mol%), cholesterol (44 mol%) , DSPC (9 mol%) and PEG2k-DMG (2 mol%). 69, -170 and LNP-171 were used in these experiments. Details including the concentration and encapsulation efficiency are provided in Table 1.

[0193] Dose-response studies In this study, LNP-169 was administered at 0.1 mg / kg and 0. Animals were administered 5 mg / kg or 2 mg / kg (n=5 in each group). Blood was collected on days 1 and 9 for analysis of serum levels of TTR. Livers and spleens were collected at necropsy on day 9 for NGS analysis.

[0194] As shown in FIG. 12A, administration of all three doses resulted in significant editing efficiency in the liver. , the observed linear dose-response was r of 0.9441. 2 The highest dose group (2 mg / In a study of 100 animals, 60% of liver cells were edited at the TTR target site, and the liver On average, approximately 50% of cells were edited. The highest mean mean was 1.1% when measured 5 and 9 days after treatment. Each dose-treated animal also showed a statistically significant reduction in serum TTR levels, The average reduction in R levels was 75% (compared to PBS-treated animals; FIG. 12B).

[0195] Varying the mRNA:gRNA ratio On day 1, LNPs were cultured at a 1:1 mRNA:gRNA ratio as described in Example 1. -169 (i.e., 1 mg / kg mRNA, 1 mg / kg gRNA, total 2 mg / kg kg RNA dose), LNP-170 at a ratio of 10:1 (i.e., 1.8 mg / kg m RNA, 0.18 mg / kg gRNA, total RNA dose of 1.98 mg / kg), and 1:10 ratio of LNP-171 (i.e., 0.18 mg / kg mRNA, 1.8 The animals were administered 1.98 mg / kg of gRNA (total RNA dose of 1.98 mg / kg) (each (n=5 per group). (Note: Groups and data received 1:1 mRNA:gRNA ratio. are the same groups and data as described in the dose response study of this example above.) 5 days Blood was collected on the first and ninth days and serum TTR levels were measured. , liver and spleen were harvested at necropsy on day 9 for NGS analysis.

[0196] As shown in FIG. 13A, administration of LNP-169 (mRNA:gRNA ratio of 1:1) One animal resulted in nearly 60% editing at the TTR target site, with the group averaging approximately 50% Animals receiving the 1:10 and 10:1 LNP formulations also demonstrated editing, In this study, the average percent edited in the group receiving LNP-171 was approximately 32%. The group that received LNP-170 showed approximately 17% editing. As shown, at day 5, a statistically significant reduction in serum TTR levels was detected in each treatment group. (compared to PBS control). By day 9, 1:1 mRNA:sgRNA and 1:10 The group receiving mRNA:sgRNA maintained a statistically significant reduction in serum TTR levels did.

[0197] One dose vs. two doses In this study, animals in one group received a single dose of LNP-169 (2 mg / kg) on ​​day 1. while another group received two doses of LNP-169 (each 2 mg / kg), with the first dose administered on day 1 and the second dose administered on day 5. (n=5 in both groups). (Note: Groups and data receiving a single dose of LNP-169 are listed above. The same groups and data as described in the dose response and mRNA:gRNA ratio studies of the examples. ) on day 5 (before administration of the second dose for those receiving the second dose). and at necropsy on day 9, blood was collected for TTR serum levels, again as described in Example 1. were collected from both groups.

[0198] As shown in Figure 14A, the group receiving a single dose of LNP-169 showed a significant increase in TTR target sites. Approximately 60% editing was observed in one animal, and the group had an average of approximately 50% editing. Similar mean numbers were achieved with lower standard deviations in animals receiving two doses of -169. Both groups had an average TTR target site editing of approximately 55%. As shown in Figure 14B, both groups A significant reduction in serum TTR levels was observed.

[0199] Assessment of uptake by and editing in the spleen The LNPs are directed to and taken up by the spleen, thereby effecting gene editing. Spleens were necropsied from each animal in the above study (in this example) to determine whether Genomic DNA was extracted from the spleen tissue and subjected to NGS analysis as described in Example 1. did.

[0200] In FIG. 15, A represents LNP-169 administered at 2 mg / kg for two doses. B has a 1:1 mRNA:gRNA ratio at 0.1 mg / kg as a single dose C represents LNP-169; C represents 0.5 mg / kg of 1:1 mRNA as a single dose: D represents the ratio of LNP-169 with gRNA; D represents the ratio of 1 to 2 mg / kg as a single dose. E represents LNP-169 with an mRNA:gRNA ratio of 1:1; E represents LNP-169 as a single dose represents 2 mg / kg of LNP-170 with a 10:1 mRNA:gRNA ratio; F represents , LNP- with a 1:10 mRNA:gRNA ratio at 2 mg / kg as a single dose As shown in FIG. 15, the spleens of these animals were significantly higher than those of their livers. In these studies, significantly fewer edits (generally less than 2% of cells) were observed. Approximately 50% editing was observed in the liver (e.g., in the group receiving LNP-169). These results indicate that the LNPs provided herein are primarily directed toward the liver, as opposed to the spleen. indicates that it targets

[0201] [Example 9] (1) A modified dgRNA-LNP co-administered with a Cas9 mRNA-LNP; 2) LNPs containing Cas9 mRNA and modified dgRNA together in one formulation In vivo comparative study between Cas9 mRNA and modified IgG as separate LNPs or together in one formulation The LNPs formulated for delivery of engineered dgRNAs contain CRISPR / Cas components. Effectively deliver.

[0202] As described in Example 1, the L NP-174, -175) or separately (LNP-172, -173) IVT Cas 9 mRNA was used to formulate LNP. Both trRNA and trRNA have three terminal nucleotides at both the 5' and 3' ends of each RNA. The components of each LNP preparation included C CD lipid (lipid A, 45 mol%), cholesterol (44 mol%), DSPC (9 mol%) %) and PEG2k-DMG (2 mol %). LNP-175 was used to construct dgRNA. The resulting crRNA and trRNA are first preannealed to each other before being formulated in LNP. The compositions of LNP-174 and LNP-175 were identical except that they were mixed. This was done by first incubating crRNA and trRNA together at 95°C for 10 min as described above. This was achieved by incubating the mixture at room temperature and then cooling it to room temperature before proceeding to formulation. Other details regarding the LNPs, including average particle size, polydispersity and encapsulation efficiency, are provided in Table 1.

[0203] Animals were administered each LNP at 2 mg / kg (n=5 in each group) as described in Example 1. Livers were harvested at necropsy 8 days after dosing, and genomic DNA was isolated as described in Example 1. and subjected to NGS analysis.

[0204] In FIG. 16, A shows dgRNA split formulations (LNP-172 and LNP-173). A represents administration of dgRNA co-formulation (LNP-174); B represents administration of dgRNA co-formulation (LNP-174); C represents administration of dgRNA co-formulation (LNP-174); NA represents administration of a preannealed formulation (LNP-175). As shown in FIG. Editing was detected in the liver from each group (approximately 4–6% editing). Cas9 mRNA and Animals that received LNPs co-formulated with dgRNA, as well as LNPs formulated separately Animals that received mRNA and dgRNA from NP showed editing. Editing efficiency measured using LNPs (together with or separately from Cas9 mRNA) is substantially lower than that detected using LNPs formulated with sgRNA (e.g. , see Examples 6 to 8).

[0205] [Example 10] ApoE conjugation of LNPs and transfection of primary hepatocytes. As demonstrated in Example 8, the LNPs provided herein are effectively metabolized by the liver. This example shows that the primary hepatocyte is taken up by the spleen, but only to a lesser extent by the liver. We provide data on ApoE-mediated uptake in cells and demonstrate that LNPs bind to ApoE. The present invention provides an assay for testing LNP-ApoE binding that has been demonstrated to be effective.

[0206] Delivery of LNPs to primary hepatocytes In addition to other proteins, serum provides a source of ApoE to the culture medium and thus LN P requires serum (e.g., as a source of ApoE) for uptake into primary hepatocytes. This was done by incubating LNPs with primary hepatocytes in the presence or absence of serum. This was achieved by adding in vitro

[0207] LNPs were delivered to primary mouse hepatocytes as described in Example 1. In the absence of serum, However, no editing was detected by the T7E1 assay for any of the LNPs tested. However, when LNPs were incubated with 3% mouse serum prior to transfection, When incubated, the LNPs were taken up by hepatocytes resulting in editing. A statistical data set is shown in Figure 17. In this experiment, LNP-169 (targeting TTR) Preincubated in 3% mouse serum and then added to primary mouse hepatocytes at various concentrations The labels in Figure 17 are defined in Table 3 and indicate the concentration of LNP-169 administered. As shown in Figure 7, the addition of serum increased the likelihood of editing at the TTR target site as measured by NGS. These results suggest that ApoE present in serum increases the expression of ApoE in hepatocytes. These results suggest that LNP uptake in the IL-16 / IL-2 complex may be mediated by IL-16.

[0208] [Table 3]

[0209] ApoE binding assay The LNPs were then incubated with recombinant ApoE3, the most common form of ApoE, and then The HPLC run was then separated on a heparin affinity column using an upper salt gradient. In the ELISA, two peaks were observed, corresponding to LNP bound to ApoE3 and unbound LNP. The free LNPs that did not bind to ApoE3 and flowed freely through the heparin column were unbound. The bound LNP / A was bound to the heparin column and eluted in a salt gradient. The peak with the longer retention time corresponds to the poE3 complex. To determine the area of ​​the peak corresponding to LNP bound to ApoE3, we calculated the area of ​​both peaks. The percentage of bound peak area was calculated by dividing by the total.

[0210] LNP with Cas9 mRNA and chemically modified sgRNA as described in Example 1. The sgRNAs used in this example were chemically synthesized and purchased from a commercial supplier. The sgRNA was generated using three terminal nucleotides at both the 5' and 3' ends of the sgRNA. thiol, and having 2'-O-methyl modifications and phosphorothioate linkages between them The components of each LNP preparation (LNP-169 and LNP-171) contained lipids. De A (45 mol%), cholesterol (44 mol%), DSPC (9 mol%) and PE G2k-DMG (2 mol%) was included. These parameters, including the average particle size, polydispersity and encapsulation efficiency, Formulation details are provided in Table 1. Storage ApoE3 (recombinant human apolipoprotein E3, R&D Systems, Catalog No. 4144-AE-500) solution, 0.5 mg / mL, and ApoE3 was administered at 25 μg / mL, 50 μg / mL, 100 μg / mL, and 2 The LNP samples were incubated at room temperature overnight. Incubated.

[0211] Two buffers were prepared (500 mL each); Buffer A was 20 mL of 100% ethanol adjusted to pH 8.0. Buffer A is 1 mM Tris buffer adjusted to pH 8.0 with 1 M NaCl The gradient and flow rate for HPLC analysis were as follows: be.

[0212] [Table 4]

[0213] After overnight incubation, each sample was analyzed by HPLC to determine the bound peaks. The percent area of ​​the crust was calculated as previously described.

[0214] As shown in FIG. 18, with increasing amounts of ApoE3, As a result, more LNPs (both LNP-169 (represented by the dashed line) and -17 1 (represented by the solid line)) bound to the heparin column. These results indicate that LNP Shown to bind to ApoE3.

[0215] [Example 11] In vitro and in vitro analyses using sgRNA and LNP expressed from a DNA expression cassette and in vivo delivery and editing. This example shows a plasmid carrying an expression cassette encoding Cas9 mRNA and sgRNA. We demonstrate gene editing using the engineered LNPs.

[0216] in vitro LNP delivery DNA containing the U6 promoter linked as sgRNA targeting mouse TTR Amplicons encoding sgRNAs were prepared by PCR amplification of the A sequence. To prevent incorporation of the DNA amplicon into the DNA, each primer contains a 5' end It contained an inverted dideoxy T nucleotide. The PCR products were purified by methanol precipitation. The DNA pellet was dried and diluted with TE buffer. The cells were resuspended in buffer.

[0217] As described in Example 1, LNPs were injected with IVT Cas9 mRNA ("mRNA-LNPs"). " or LNP-178) or sgRNA expression cassette ("DNA-LNP" or L IVT Cas9 mRNA and sgRNA expression cassettes The cells were incubated with Lipofectamine 2000 (Thermo Fisher) ("mRNA LF2K" or "DN A LF2K was added directly to the cell culture medium in each well according to the following regimen: The formulation was applied to mouse Neuro2A cells by diluting (100 ng of Cas 9 mRNA and 100ng sgRNA expression cassette): · Co-delivery of Cas9 mRNA and sgRNA expression cassettes; an sgRNA expression cassette administered 2 hours prior to Cas9 mRNA; and · Cas9 mRNA administered 2 h prior to the sgRNA expression cassette.

[0218] After transfection, the cells were incubated for 48 hours and the cell lysates were analyzed using the method described in Example 1. The mRNA and D were analyzed by T7E1 analysis as described in. When both NA components were formulated into LNPs, one component or the other was Lipofectamine. A higher percentage of TTR editing was observed when compared to when formulated with ctamine 2000. was observed.

[0219] [Example 12] In vitro versus in vivo editing. Cas9 mRNA and different mouse TTR sequences were targeted as described in Example 1. Chemically modified sgRNA was formulated and administered to mice (2 mg / kg). The same LNP preparation was used to transfect hepatocytes in vitro The sgRNAs in this example were chemically synthesized and obtained from commercial suppliers, each at the three terminal nucleotides at both the 5' and 3' ends of the sgRNA, and has a 2'-O-methyl modification and a phosphorothioate linkage between them.

[0220] [Table 5-1]

[0221] [Table 5-2]

[0222] For in vitro studies, a seven-point semi-log dose response was performed (100 ng / 48 hours after transfection, genomic DNA was collected and The percentages were measured by NGS. Figure 20 shows these in vitro and in vivo The editing percentages in the in vivo experiment are shown, and the editing efficiency was evaluated in cultured and in vivo primary liver It has been demonstrated that there is a correlation between cells.

[0223] NGS provides specific sequencing results in addition to overall editing efficiency, so sequence-specific editing The patterns were compared with those of Neuro2A cells. s9 mRNA and gRNA) and mouse primary hepatocytes (Cas 9) between the mRNA and the gRNA-containing LNP (transfected) Representative data are shown demonstrating that the deletion patterns are significantly different from the normal deletion patterns. The cells were similar to those observed in vivo (containing Cas9 mRNA and gRNA). LNP) (Figure 22). As shown in 22, 53.2% of edits measured in primary mouse hepatocytes were deletions (mainly 1bp 16.8% were insertions (mainly 1-bp insertions), for a total of 70% of edits. Of the total 70% edits, 64.5% of the edits contained frameshift mutations. This accounts for approximately 92% of the total editing measured (not shown). Observations from LNP-based delivery of Cas9 mRNA and gRNA into mouse liver cells in vitro Representative data for observed editing percentage and editing type are shown: 46.6% of edits measured in vivo were deletions (again, primarily 1-bp deletions). , 12.9% were insertions (again, mostly 1-bp insertions), for a total of 59.5% edits. Of the total 59.5% edits, 57.4% of the edits resulted in frameshift mutations. This accounts for approximately 96% of the editing measured in vivo (not shown).

[0224] [Example 13] Pharmacokinetics of CRISPR / Cas9 constructs delivered by LNPs. LNP-2 containing Cas9 mRNA and sgRNA targeting mouse TTR 94 was formulated as described in Example 1. The ratio of mRNA to guide RNA was determined by HPLC. Each LNP was administered to animals at 2 mg / kg as described in Example 1 (each (n=3 per group) and dissected at the following time points: 5 min, 15 min, 30 min, 60 min, 2 h, and 4 h. At autopsy, Cas9 mRNA and Plasma, liver and spleen were harvested for qPCR analysis of levels of ribosomal and guide RNA. Figure 23 shows the plasma concentrations of these components, Figure 24 shows the concentrations in the liver, and Figure 25 shows the The concentrations in the spleen are shown. For the plasma concentrations, the following pharmacokinetic parameters were calculated:

[0225] [Table 6]

[0226] FIG. 26A shows the relative ratio of sgRNA to Cas9 mRNA in plasma and tissues. .

[0227] Cytokine induction in treated mice was also measured. For this analysis, serum cytokines were Approximately 50-100 μL of blood was collected via tail vein nick for the in vitro assay. Blood was allowed to clot for approximately 2 hours and serum was collected after centrifugation at 1000 xg for 10 minutes. For cytokine analysis in collected samples, IL-6, TNF-alpha, IFN-alpha, A Luminex-based magnetic bead multiplex assay (Aff) measuring α-amycin and MCP-1 ymetrix ProcartaPlus, Catalog Number Exp040-00000- 801) was used. Kit reagents and standards were prepared according to the manufacturer's protocol. The mouse serum was diluted 4-fold using the provided sample diluent, and 50 μL of the diluted serum was Add 50 μL of the antibody-coated magnetic beads to the wells containing the plate. Allow the plate to sit at room temperature for 2 hours. After incubation and washing, diluted biotin antibody (50 μL) was added to the beads. The beads were washed again and then diluted streptavidin was added to the beads and incubated at room temperature for 1 hour. 50 μL of Dyn-PE was added to each well, followed by incubation for 30 min. The cells were washed again and then suspended in 100 μL of washing buffer and loaded onto a Bio-Plex 200 instrument (Bi The PCR was performed using Bioplex Manager version 6.1 analysis package. Analyze the data using CAGE and five-parameter logistic curve fitting Cytokine concentrations were calculated from the standard curve. Figure 27 shows the plasma cytokines over time in treated mice. As shown in FIG. 27, each of the cytokines was increased 2 to 4 hours after treatment. had measurable increases in , , and returned to baseline by 12 to 24 hours, respectively.

[0228] Three different guide sequences were formulated separately according to Example 1 to enhance the pharmacokinetics of lipid A. Mice (n=3) were injected with 100 mg of 10 ... The levels of lipid A in plasma were measured by LC / MS. and liver concentrations over time. max was achieved within 30 minutes of administration. However, plasma and liver T1 / 2 This was achieved within approximately 5 to 6 hours after LNP administration. Ta.

[0229] [Example 14] Duration of in vivo editing response Chemically modified sgRNA targeting Cas9 mRNA and mouse TTR sequence was performed. It was formulated as described in Example 1.

[0230] [Table 7]

[0231] LNPs were administered to mice (3 mg / kg, 1 mg / kg or 0.3 mg / kg) as described in Example 1. Cohorts of mice were administered 1, 2, 4, 9, 13 and 20 mg / kg of 10 ... and serum TTR levels at 1, 2, 9, and 16 weeks after administration. To measure hepatic TTR editing, DNA extraction and Liver tissue samples were taken from the median lobe from each animal in a particular cohort for analysis. The MagMAX-96 DNA multi-sample kit (ThermoF isher, catalogue no. 4413020) according to the manufacturer's protocol. Genomic DNA was extracted from 10 mg of tissue in lysis buffer (approximately 100 mL / 10 mg of tissue). This involves homogenizing the tissue with 400 μL of PBS and precipitating the DNA. All DNA samples were normalized to a concentration of 100 ng / μL for subsequent NGS analysis.

[0232] The sgRNAs in this example were chemically synthesized and supplied by a commercial supplier and are listed below. As shown in Fig. 1, the 2'-O-methyl modification and phosphorothioate linkages (m = 2'-O-methyl) e;*=phosphorothioate):

[0233] sg282:

[0234] [ka]

[0235] Figure 28 shows TTR levels in mouse serum over time, and Figure 29A shows TTR levels measured by NGS. Figure 29B shows the corresponding percentage of editing in mice over time up to 16 weeks after administration. Serum TTR levels and corresponding editing percentages as measured by NGS are shown.

[0236] [Example 15] Formulation using mRNA preparations As described in Example 1, Cas9 mRNA was prepared by precipitation only and HPLC purification. Both HPLC-purified mRNA and LNPs were formulated using HPLC-purified mRNA. NP492), and LNPs formulated using mRNA treated with precipitation alone (LNP490 The Cas9 mRNA cargo of LNP494 was compared with that of LNP494 (LNP494). Different synthetic lots of mRNA were used for the preparation.

[0237] [Table 8]

[0238] As described in Example 1, in vivo LNP delivery, mice were administered 0.5 or 100 mg of each formulation. The sgRNA used in this example was as described in Example 14. It was sea urchin sg282.

[0239] Figure 30 shows cytokine activity in mouse serum 4 hours after administration. Figure 31 shows TTR concentration levels in mouse serum, and Figure 32 shows TTR editing levels in mouse liver.

[0240] [Table 9]

[0241] [Example 16] Frozen preparations The LNPs were formulated with a lipid A to RNA phosphate (N:P) molar ratio of approximately 4.5. The nanoparticle components were dissolved in 100% ethanol in the following molar ratios: 45 mol% (12. 7 mM) lipid A; 44 mol% (12.4 mM) cholesterol; 9 mol% (2.5 3 mM) DSPC; and 2 mol% (0.563 mM) PEG2k-DMG. RNA The cargo was dissolved in 50 mM acetate buffer, pH 4.5, at approximately 0.45 mg / mL of RNA cargo. For this study, sg282, as described in Example 14, was used. Ta.

[0242] [Table 10]

[0243] Precision Nanosystems NanoAssemblr™ Microfluidize the lipid and RNA solutions using a centrifugal separator according to the manufacturer's protocol. LNPs (LNP493, LNP496) were formed by dynamic mixing. A 2:1 ratio of aqueous to organic solvent was maintained during mixing using The formulated LNPs were then diluted in 50 mM Tris buffer, pH 7.5. The resulting filtrate was diluted with 50 mM Trisodium fumarate at pH 7.5 and filtered using a sterile filter. The mixture was mixed 1:1 with 10 w / v% sucrose, 90 mM NaCl, prepared in sucrose buffer. The final LNP formulation was: w / v% sucrose, 45 mM NaCl, 50 mM Tris buffer. The mixture was stored at 4°C and -80°C for 1.5 days until the day of administration.

[0244] At 0.5 and 1 mg / kg (frozen preparations were thawed at 25°C 1 hour prior to administration), P was administered to mice. Figure 33 shows the TTR concentration levels in mouse serum, and Figure 34 shows the TTR concentration levels after administration. 1 shows TTR editing levels in mouse liver.

[0245] [Table 11]

[0246] The sgRNAs in this example were chemically synthesized and supplied by a commercial supplier and are listed below. As shown in Fig. 1, the 2'-O-methyl modification and phosphorothioate linkages (m = 2'-O-methyl) e;*=phosphorothioate): sg396:

[0247] [ka]

[0248] [Example 17] Alternative LNP formulation processes The LNPs were formulated with a lipid A to RNA phosphate (N:P) molar ratio of approximately 4.5. The nanoparticle components were dissolved in 100% ethanol in the following molar ratios: 45 mol% (12. 7 mM) lipid A; 44 mol% (12.4 mM) cholesterol; 9 mol% (2.5 3 mM) DSPC; and 2 mol% (0.563 mM) PEG2k-DMG. Buffer (sodium acetate at a final concentration of 25 mM, pH 4.5) or citrate buffer (at a final concentration of Dissolve the RNA cargo in 25 mM sodium citrate, 100 mM NaCl, pH 5. The resulting RNA cargo was dissolved in 0.45 mg / mL of PBS. sg282, as described in Example 14, was used.

[0249] Precision Nanosystems NanoAssemblr™ Use a countertop device according to the manufacturer's protocol or use cross-flow mixing. LNPs were formed by microfluidic mixing of lipid and RNA solutions using a 100-μL centrifuge. 563 and LNP564 were prepared using NanoAssemblr preparations and are described here During mixing, differential flow rates were used: 8 mL / min for the aqueous phase and 4 mL / min for the organic phase. A 2:1 ratio of aqueous to organic solvent was maintained. After mixing, the LNPs were taken and diluted with 50 mM trisodium phosphate. The LNPs were then dialyzed overnight against 50 mM Tris pH 7.5. The resulting filtrate was filtered the next day using a 0.2 μm sterile filter. 90 mM 10 w / v % sucrose, concentrated and prepared in 50 mM Tris buffer, pH 7.5 5w / v% sucrose, 45mM NaCl, 50mM The final LNP formulation in Tris buffer was stored at 4°C and -80°C for 1.5 days until the day of administration. did.

[0250] [Table 12]

[0251] LNP561 and LNP562 were prepared using cross-flow technology and syringe-inserted. The pump was used with two syringes of RNA at 0.45 mg / mL and one syringe containing the lipid-containing organic phase. One syringe was water. These were mixed at 40 mL / min with a variable tube length, and the aqueous phase The organic phase was then extruded through a 0.5 mm peak cross and the output was piped into a water tube. The LNPs were incubated at room temperature for 1 h and then washed with water. Briefly, LNP and water were pumped into a 1 mm Tee by a syringe pump. The flow rate was 25 mL / min.

[0252] For purification and concentration, tangential flow filtration was used. For this procedure, Sar Priming a Vivaflow50 cartridge from torius with 500mL of water The L was then analyzed using a Pall Minimate system at a feed rate of 60 mL / min. Introduce NPs. Adjust the filtrate line to maintain a constant flow rate of approximately 1.7 mL / min. Once the LNPs are concentrated, add 15x the volume of PBS or 5% sucrose, 45 mM NaCl, 50 mM Tris, pH 7.5, was introduced under vacuum at a feed rate of 80 mL / min. Tighten the filtrate line to maintain a flow rate of 1.9 mL / min. Upon completion, the LNPs are concentrated and collected in sterile, DNase-free, RNase-free collection tubes and stored until the day of administration. , at 4 °C for PBS formulations, or at 4 °C for TSS (i.e., Tris, sucrose and salts) ) Store at 4°C or -80°C for formulation.

[0253] LN was administered at 1.0 and 2 mg / kg (frozen preparations were thawed at 25°C 1 hour prior to administration). P was administered to mice. Figure 35 shows the serum TTR concentration levels in mice, and Figure 36 shows the different 1 shows TTR editing levels in mouse liver after administration of the formulations.

[0254] [Table 13]

[0255] [Example 18] Delivery of LNPs to higher species. Formulations were prepared similarly to those described in Example 14. In one particular experiment, sg28 The sgRNA was modified with the same chemical modifications as in 2, but specific for the rat TTR sequence. Efficient editing was observed in rat liver. The 5 mg / kg (total cargo) and 5 mg / kg (total cargo) doses were well tolerated in the study. A similar formulation containing mRNA encoding GFP was also available at 1 mg / kg and 3 mg / kg. was well tolerated in non-human primates at doses of

[0256] array The sequences described in the above examples are listed as follows (5' to 3' polynucleotides): Otid sequence):

[0257] Cas9 mRNA (Cas9 coding sequence in bold; HA tag in bold; underlined (2 x NLS):

[0258] [ka]

[0259] [ka]

[0260] [ka]

[0261] [ka]

[0262] "Cas9 1xNLS, no HA tag" referenced in Table 11 and used in Example 17 :

[0263] [ka]

[0264] [ka]

[0265] [ka]

[0266] [ka]

[0267] tr001(trRNA):

[0268] [ka]

[0269] cr002 (crRNA targeting FVII; targeting sequence underlined):

[0270] [ka]

[0271] sg001 (sgRNA targeting FVII; targeting sequence underlined):

[0272] [ka]

[0273] cr003 (crRNA targeting TTR; targeting sequence underlined):

[0274] [ka]

[0275] sg006 (sgRNA targeting TTR generated by IVT; underlined Target Array):

[0276] [ka]

[0277] sg003 (sgRNA targeting TTR; targeting sequence underlined):

[0278] [ka]

[0279] sg007 (sgRNA targeting FVII; targeting sequence underlined):

[0280] [ka]

[0281] sg002 (sgRNA targeting FVII; targeting sequence underlined):

[0282] [ka]

[0283] sg004 (sgRNA targeting TTR; targeting sequence underlined):

[0284] [ka]

[0285] sg005 (sgRNA targeting TTR; targeting sequence underlined):

[0286] [ka] *= phosphorothioate linkage m=2'OMe

[0287] tr002(trRNA):

[0288] [ka]

[0289] cr004 (crRNA targeting FVII; targeting sequence underlined):

[0290] [ka]

[0291] cr005 (crRNA targeting TTR; targeting sequence underlined):

[0292] [ka]

[0293] sg008 (sgRNA targeting FVII; targeting sequence underlined):

[0294] [ka]

[0295] sg009 (sgRNA targeting TTR; targeting sequence underlined):

[0296] [ka]

[0297] sg010 (sgRNA targeting FVII; targeting sequence underlined):

[0298] [ka]

[0299] sg002 (sgRNA targeting FVII; targeting sequence underlined):

[0300] [ka]

[0301] sg011 (sgRNA targeting TTR; targeting sequence underlined):

[0302] [ka]

[0303] sg012 (sgRNA targeting TTR; targeting sequence underlined):

[0304] [ka]

[0305] ec001 (expression cassette - an amplicon for expressing sgRNA targeting TTR) Con; U6 promoter in bold, targeting sequence underlined; constructs have inverted nucleotides at each 5' end containing dideoxy T):

[0306] [ka]

[0307] Primer pair for NGS analysis of the FVII target site targeted by cr001: forward:

[0308] [ka] Reverse:

[0309] [ka]

[0310] A platform for NGS analysis of the FVII target sites targeted by cr002 and sg001. Immer vs: forward:

[0311] [ka] Reverse:

[0312] [ka]

[0313] Primer pair for NGS analysis of the FVII target site targeted by sg002:

[0314] [ka] Reverse:

[0315] [ka]

[0316] A primer for NGS analysis of TTR target sites targeted by cr003 and sg003. Ma vs: forward:

[0317] [ka] Reverse:

[0318] [ka]

[0319] Primer pair for NGS analysis of the TTR target site targeted by sg004: forward:

[0320] [ka] Reverse:

[0321] [ka]

[0322] Primer pair for NGS analysis of the TTR target site targeted by sg005: forward:

[0323] [ka] Reverse:

[0324] [ka]

[0325] Primer pair for PCR amplification of the sg004 expression cassette: / 5InvddT / =inverted dideoxy T forward: / 5InvddT / GCTGCAAGGCGATTAAGTTG Reverse: / 5InvddT / TAGCTCACTCATTAGGCACC

[0326] [Table 14-1]

[0327]

Table 14-2

[0328]

Table 14-3

[0329]

Table 14-4

[0330]

Table 14-5

[0331]

Table 15-1

[0332]

Table 15-2

[0333]

Table 15-3

[0334]

Table 15-4

Claims

1. 1. A method for producing genetically engineered liver cells, comprising: Cells, Class 2 Cas nuclease mRNA; A guide RNA nucleic acid; CCD lipids; Helper lipids; Neutral lipids; and Stealth lipids The method comprises contacting the lipid nanoparticle (LNP) comprising:

2. Class 2 Cas nuclease mRNA and guide RNA nucleic acids are delivered to liver cells A method of gene editing comprising: The RNA nucleic acid is CCD lipids; Helper lipids; Neutral lipids; and Stealth lipids The method is formulated as at least one LNP composition comprising:

3. Class 2 Cas nuclease mRNA and guide RNA nucleic acids target ApoE binding A method of gene editing comprising administering to a sex cell the Class 2 Cas mRN. A and the guide RNA nucleic acid CCD lipids; Helper lipids; Neutral lipids; and Stealth lipids The method is formulated as at least one LNP composition comprising:

4. Liver cells, an mRNA encoding a Cas nuclease; A guide RNA nucleic acid; CCD lipids; Helper lipids; Neutral lipids; and Stealth lipids A method of gene editing comprising contacting a gene with an LNP comprising:

5. A method for altering gene expression in liver cells, comprising using one or more LNP formulations. A therapeutically effective amount of Class 2 Cas nuclease mRNA and guide RNA nucleic acid is administered as a administering to the subject at least one LNP formulation comprising: a guide RNA nucleic acid or a class 2 Cas nuclease mRNA; CCD lipids; Helper lipids; Neutral lipids; and Stealth lipids A method comprising:

6. 1. A method for producing genetically engineered liver cells, comprising: Cells, Class 2 Cas nuclease mRNA; A guide RNA nucleic acid that is or encodes a single guide RNA (sgRNA); CCD lipids; Helper lipids; Neutral lipids; and Stealth lipids The method comprises contacting the lipid nanoparticle (LNP) comprising:

7. 1. A method for producing genetically engineered liver cells, comprising: Cells, Class 2 Cas nuclease mRNA; A guide RNA nucleic acid that is or encodes an sgRNA; CCD lipids; Helper lipids; Neutral lipids; and Stealth lipids The method comprises contacting the LNP with a

8. 1. A method for producing genetically engineered liver cells, comprising: Cells, Class 2 Cas nuclease mRNA; A guide RNA nucleic acid; Means for delivering said RNA in a liver-specific manner A method comprising contacting a lipid nanoparticle composition comprising:

9. 1. A method for producing genetically engineered liver cells, comprising: Cells, Class 2 Cas nuclease mRNA; A guide RNA nucleic acid that is or encodes an sgRNA; Means for delivering said RNA to liver cells The method comprises contacting the lipid nanoparticles comprising:

10. 1. A method of administering a CRISPR-Cas complex to a liver cell, comprising: For gene editing in liver cells, Cas9 nuclease mRNA; A guide RNA that is or encodes an sgRNA; Biodegradable means for delivering said RNA to liver cells The method comprises administering to a subject an LNP composition comprising:

11. The method according to any one of claims 1 to 10, wherein the liver cells are hepatocytes.

12. The method of claim 11 , wherein the hepatocytes are primary hepatocytes.

13. The method of claim 11 , wherein the liver cells are stem cells.

14. The method of any one of claims 1 to 13, wherein the cell is in a subject.

15. The method of claim 14, wherein the subject is a human.

16. The mRNA is formulated in a first LNP composition and the guide RNA nucleic acid is formulated in a second LNP composition. The method according to any one of claims 1 to 15, wherein the composition is formulated in a P composition.

17. 17. The method of claim 16, wherein the first and second LNP compositions are administered simultaneously.

18. 17. The method of claim 16, wherein the first and second LNP compositions are administered sequentially.

19. The mRNA and the guide RNA nucleic acid are formulated into a single LNP composition; The method according to any one of claims 1 to 15.

20. The method of any one of claims 1 to 19, further comprising at least one template.

21. 21. Any one of claims 1 to 20, wherein the mRNA is a Cas9 nuclease mRNA. The method described above.

22. 16. The Cas9 mRNA is a human codon-optimized Cas9 nuclease. The method described above.

23. 2. The method according to claim 1, wherein the guide RNA nucleic acid is an expression cassette encoding a guide RNA.

3. The method according to any one of claims 2 to 3.

24. 24. The method of claim 23, wherein the expression cassette further comprises a regulatory element.

25. The nucleic acid according to any one of claims 1 to 22, wherein the guide RNA nucleic acid is a guide RNA. method.

26. The method according to any one of claims 23 to 25, wherein the guide RNA is an sgRNA. 。

27. Any of claims 23 to 25, wherein the guide RNA is a dual guide RNA (dgRNA). The method according to any one of claims 1 to 5.

28. 28. The method according to claim 1, wherein the guide RNA nucleic acid comprises modified residues. How to.

29. the modified residue comprises a modification selected from a backbone modification, a sugar modification, and a base modification; 30. The method of claim 28.

30. 30. The method of any one of claims 1 to 29, wherein the CCD lipid is lipid A.

31. The CCD lipid is selected from lipid A, lipid B, lipid C and lipid D.

30. The method according to any one of claims 1 to 29.

32. The helper lipid is cholesterol, 5-heptadecylresorcinol and cholesterol The method according to any one of claims 1 to 31, wherein the active ingredient is selected from terol hemisuccinate. 。

33. 33. The method of claim 32, wherein the helper lipid is cholesterol.

34. 34. The method according to claim 1, wherein the neutral lipid is selected from DSPC and DMPE. The method according to claim 5.

35. 35. The method of claim 34, wherein the neutral lipid is DSPC.

36. The stealth lipid is selected from PEG2k-DMG and PEG2k-C11. The method according to any one of claims 1 to 35.

37. The method of claim 36, wherein the stealth lipid is PEG2k-DMG.

38. At least one LNP comprises lipid A, cholesterol, DSPC and PEG2k-D The method of any one of claims 1 to 37, comprising MG.

39. At least one LNP comprises lipid B, cholesterol, DSPC and PEG2k-D The method of any one of claims 1 to 37, comprising MG.

40. The composition comprises the CCD lipid in an amount ranging from about 30 mol% to about 60 mol%. The method according to any one of claims 1 to 39.

41. The composition comprises the helper lipid in an amount ranging from about 30 mol% to about 60 mol%.

41. The method according to any one of claims 1 to 40.

42. 2. The composition of claim 1 , wherein the neutral lipid is present in an amount ranging from about 1 mol % to about 20 mol %.

42. The method according to any one of 1 to 41.

43. The composition comprises the stealth lipid in an amount ranging from about 1 mol % to about 10 mol %.

43. The method according to any one of claims 1 to 42.

44. 44. Any one of claims 1 to 43, wherein the composition comprises the CCD lipid in an amount of about 45 mol %. The method according to claim 5.

45. 45. Any of claims 1 to 44, wherein the composition comprises the helper lipid in an amount of about 44 mol %.

13. The method according to claim 1.

46. 46. ​​The composition according to any one of claims 1 to 45, wherein the neutral lipid is present in an amount of about 9 mol %. The method described.

47. 47. Any one of claims 1 to 46, wherein the composition comprises the stealth lipid in an amount of about 2 mol%. The method according to claim 5.

48. The class 2 Cas nuclease mRNA and the guide RNA nucleic acid are about 1 48. The composition according to any one of claims 1 to 47, which is present in a ratio ranging from 0:1 to about 1:

10. method.

49. The class 2 Cas nuclease mRNA and the guide RNA are about 1:1 by weight. The method of any one of claims 1 to 48, wherein

50. 4. The method of claim 3, wherein the ratio of said CCD lipid amines to said RNA phosphates is within the range of about 3 to about 5.

50. The method of any one of 1 to 49.

51. 51. The method of claim 1, wherein the ratio of the CCD lipid amines to the RNA phosphates is about 4.

5. The method according to any one of claims 1 to 5.

52. Any one of claims 1 to 51, wherein the particle size of the composition is within the range of about 50 nm to about 120 nm. The method according to any one of claims 1 to 5.

53. Any one of claims 1 to 52, wherein the particle size of the composition is within the range of about 75 nm to about 150 nm. The method according to any one of claims 1 to 5.

54. Any of claims 1 to 53, wherein the encapsulation efficiency of the composition is in the range of about 70% to about 100%. The method according to any one of claims 1 to 5.

55. 55. The composition of claim 1, wherein the polydispersity index is in the range of about .005 to about 0.

5.

2. The method according to any one of claims 1 to 11.

56. Claims 1 to 55. The polydispersity index of the composition is in the range of about 0.02 to about 0.

35.

2. The method according to claim 1 .

57. The method of any one of claims 1 to 56, wherein administration of the composition results in gene editing. Law.

58. 58. The method of claim 57, wherein the gene editing results in a gene knockout.

59. 59. The method of claim 58, wherein the gene editing results in gene correction.

60. The method of any one of claims 57 to 59, wherein the gene editing results in a durable response. Law.

61. Any of claims 57 to 59, wherein the gene editing results in a response period of about 1 day to about 1 year.

3. The method according to claim 1 .

62. Any of claims 57 to 59, wherein the gene editing results in a response period of at least one week.

3. The method according to claim 1 .

63. Any of claims 57 to 59, wherein the gene editing results in a response period of at least two weeks.

3. The method according to claim 1 .

64. Any of claims 57 to 59, wherein the gene editing results in a response period of at least one month.

3. The method according to claim 1 .

65. Any of claims 57 to 59, wherein the gene editing results in a response period of at least 4 months.

3. The method according to claim 1 .

66. Any of claims 57 to 59, wherein the gene editing results in a response period of at least one year.

13. The method according to claim 1.

67. an mRNA encoding a Cas nuclease; A guide RNA nucleic acid; CCD lipids; Helper lipids; Neutral lipids; and Stealth lipids 1. An LNP composition comprising:

68. Class 2 Cas nuclease mRNA; A guide RNA nucleic acid that is or encodes an sgRNA; CCD lipids; Helper lipids; Neutral lipids; and Stealth lipids 1. An LNP composition comprising:

69. 1. An LNP composition for gene editing in liver cells, comprising: Class 2 Cas nuclease mRNA; A guide RNA nucleic acid that is or encodes an sgRNA; CCD lipids; Helper lipids; Neutral lipids; and Stealth lipids 1. An LNP composition comprising:

70. Class 2 Cas nuclease mRNA; A guide RNA nucleic acid; Means for delivering said RNA in a liver-specific manner 1. An LNP composition comprising:

71. Class 2 Cas nuclease mRNA; A guide RNA nucleic acid that is or encodes an sgRNA; Means for delivering said RNA to liver cells 1. An LNP composition comprising:

72. 1. An LNP composition for gene editing in liver cells, comprising: Cas9 nuclease mRNA A guide RNA that is or encodes an sgRNA; Biodegradable means for delivering said RNA to liver cells 1. An LNP composition comprising:

73. The mRNA and the guide RNA nucleic acid are separately encapsulated in LNPs, and these LNPs 73. The method according to any one of claims 67 to 72, wherein NPs are combined to form the LNP composition. Composition of.

74. The mRNA and the guide RNA nucleic acids are encapsulated together in the LNP composition. The composition according to any one of claims 67 to 72.

75. The composition of any one of claims 67 to 74, further comprising at least one template. 。

76. Any one of claims 67 to 75, wherein the mRNA is a Cas9 nuclease mRNA. The composition according to item 3.

77. The Cas9 nuclease mRNA is a human codon-optimized Cas9 nuclease; 77. The composition of claim 76.

78. The method according to claim 67, wherein the guide RNA nucleic acid is an expression cassette encoding a guide RNA.

77. The composition of any one of claims 77.

79. 79. The composition of claim 78, wherein the expression cassette further comprises a regulatory element.

80. The method according to any one of claims 67 to 77, wherein the guide RNA nucleic acid is a guide RNA. Composition of.

81. The composition of any one of claims 78 to 80, wherein the guide RNA is an sgRNA. thing.

82. Any of claims 73 to 80, wherein the guide RNA is a dual guide RNA (dgRNA). The composition according to any one of claims 1 to 4.

83. 83. The method according to any one of claims 67 to 82, wherein the guide RNA nucleic acid comprises modified residues. The composition described above.

84. the modified residue comprises a modification selected from a backbone modification, a sugar modification, and a base modification; 84. The composition of claim 83.

85. 75. The composition of any one of claims 67 to 74, wherein the CCD lipid is lipid A.

86. The CCD lipid is selected from lipid A, lipid B, lipid C and lipid D. The composition of any one of claims 67 to 85.

87. The helper lipid is cholesterol, 5-heptadecylresorcinol and cholesterol The combination according to any one of claims 67 to 86, selected from terol hemisuccinate. Composition.

88. 88. The composition of claim 87, wherein the helper lipid is cholesterol.

89. 89. Any of claims 67 to 88, wherein the neutral lipid is selected from DSPC and DMPE. The composition described in claim 1.

90. 90. The composition of claim 89, wherein the neutral lipid is DSPC.

91. The stealth lipid is selected from PEG2k-DMG and PEG2k-C11. The composition according to any one of claims 67 to 90.

92. 92. The composition of claim 91, wherein the stealth lipid is PEG2k-DMG.

93. At least one LNP comprises lipid A, cholesterol, DSPC and PEG2k-D The composition according to any one of claims 67 to 92, comprising MG.

94. At least one LNP comprises lipid B, cholesterol, DSPC and PEG2k-D The composition according to any one of claims 67 to 93, comprising MG.

95. Claims 67 to 9, comprising the CCD lipid in an amount ranging from about 30 mol% to about 60 mol%.

5. The composition according to any one of claims 4 to 4.

96. The amount of the helper lipid is in the range of about 30 mol % to about 60 mol %.

95. The composition of any one of claims 95.

97. The neutral lipid is contained in an amount ranging from about 1 mol% to about 20 mol% according to claims 67 to 96. The composition described in any one of claims 1 to 4.

98. The stealth lipid is contained in an amount ranging from about 1 mol% to about 10 mol%.

8. The composition according to any one of claims 7 to 7.

99. The method according to any one of claims 67 to 98, comprising about 45 mol% of the CCD lipid. composition.

100. The method according to any one of claims 67 to 99, comprising the helper lipid in an amount of about 44 mol%. Composition of.

101. The composition according to any one of claims 67 to 100, comprising neutral lipids in an amount of about 9 mol %. Composition.

102. The method according to any one of claims 67 to 101, comprising the stealth lipid in an amount of about 2 mol%. Composition of.

103. The class 2 Cas nuclease mRNA and the guide RNA nucleic acid are about 1 103. The method according to claim 67, wherein the ratio of the hydroxyl group to the hydroxyl group is in the range of 0:1 to about 1:

10. The composition described above.

104. The class 2 Cas nuclease mRNA and the guide RNA nucleic acid are about 1 104. The composition of any one of claims 67 to 103, wherein said composition is present in a molar ratio of:

105. 4. The method of claim 3, wherein the ratio of said CCD lipid amines to said RNA phosphates is within the range of about 3 to about 5. 67-104. The composition according to any one of claims 67-104.

106. Claims 67-105, wherein the ratio of the CCD lipid amines to the RNA phosphates is about 4.5 The composition according to any one of the preceding claims.

107. Claims 67 to 106, wherein the particle size of the composition is within the range of about 50 nm to about 120 nm. The composition according to any one of the preceding claims.

108. Claims 67 to 107, wherein the particle size of the composition is within the range of about 75 nm to about 150 nm. The composition according to any one of the preceding claims.

109. Claims 67-108, wherein the encapsulation efficiency of the composition is in the range of about 70% to about 100%. The composition according to any one of the preceding claims.

110. Claims 67-10, wherein the polydispersity index of the composition is in the range of about 0.005 to about 0.

5.

10. The composition according to any one of claims 9.

111. Claims 67-11, wherein the polydispersity index of the composition is in the range of about 0.02 to about 0.

35.

10. The composition of any one of claims 0 to 9.

112. A composition according to any one of claims 67 to 111, which is liver-selective.

113. The composition of claim 112, which is hepatocyte-selective.

114. The composition of claim 112, which is ApoE receptor selective.

115. 60. A genetically engineered liver cell produced by the method of any one of claims 1 to 59.

116. A genetically engineered liver cell produced with the composition of any of claims 67 to 114.

117. 117. The genetically engineered hepatocyte of claim 115 or 116, wherein the hepatocyte is a primary hepatocyte. Liver cells.

118. The composition of any one of claims 67 to 114, further comprising a cryoprotectant.

119. 118. The method of claim 118, wherein the cryoprotectant is present in an amount in the range of about 1% to about 10% w / v. The composition described in

120. The cryoprotectant may be sucrose, trehalose, glycerol, DMSO, or ethyl acetate.

120. The composition of claim 118 or 119, wherein the copolymer is selected from ethylene glycol.

121. The cryoprotectant according to any one of claims 118 to 120, wherein the cryoprotectant is sucrose. composition.

122. 122. The method according to any one of claims 67 to 114 or 118 to 121, further comprising a buffer. Composition of.

123. The buffer solution may be a phosphate buffer solution (PBS), a Tris buffer solution, a citrate buffer solution, or any of the above. The composition of claim 122, wherein the mixture is selected from the group consisting of:

124. 124. The composition of claim 122 or 123, further comprising NaCl.

125. the cryoprotectant is sucrose; the sucrose is present in an amount ranging from about 1% to about 10% w / v; the buffer is a mixture of the Tris buffer and a NaCl buffer; the NaCl buffer is present in an amount in the range of about 40 mM to about 50 mM; the Tris buffer is present in an amount ranging from about 40 mM to about 60 mM; The composition of claim 124.

126. the sucrose is present in an amount of about 5% w / v; the NaCl buffer is present in an amount of about 45 mM; the Tris buffer is present in an amount of about 50 mM; The composition of claim 125.

127. 127. The composition of claim 125 or 126, having a pH in the range of about 7.3 to about 7.

7. Composition.

128. 128. The method of claim 127, having a pH of about 7.3, about 7.4, about 7.5 or about 7.

6. composition.

129. 129. The composition of claim 127 or 128, having a pH in the range of about 7.4 to about 7.

6. Composition.

130. 130. The composition of claim 129 having a pH of about 7.

5.

131. 67. Any of claims 1 to 66, further comprising achieving an editing efficiency of at least 20%.

13. The method according to claim 1.

132. 67. Any of claims 1 to 66, further comprising achieving an editing efficiency of at least 50%.

13. The method according to claim 1.

133. 67. Any of claims 1 to 66, further comprising achieving an editing efficiency of at least 80%.

13. The method according to claim 1.

134. The method according to any one of claims 1 to 66, further comprising achieving a DNA modification efficiency of at least 20%. The method according to any one of claims 1 to 5.

135. The method according to any one of claims 1 to 66, further comprising achieving a DNA modification efficiency of at least 50%. The method according to any one of claims 1 to 5.

136. The method according to any one of claims 1 to 66, further comprising achieving a DNA modification efficiency of at least 80%. The method according to any one of claims 1 to 5.

Images