Methods of making lipid nanoparticles

Abstract

To provide: nucleic acid lipid nanoparticle (LNP) compositions employing a modifying agent after formation of precursor nucleic acid lipid nanoparticles; methods of producing the same; and nucleic acid lipid nanoparticles useful in delivery of therapeutics and / or prophylactics to regulate polypeptide, protein or gene expression.SOLUTION: A method of producing a nucleic acid lipid nanoparticle composition comprises: mixing a lipid solution comprising an ionizable lipid with a solution comprising a nucleic acid thereby forming precursor nucleic acid lipid nanoparticles; adding a lipid nanoparticle modifier comprising a modifying agent to the precursor nucleic acid lipid nanoparticles thereby forming modified nucleic acid lipid nanoparticles; and processing the precursor nucleic acid lipid nanoparticles and / or the modified nucleic acid lipid nanoparticles thereby forming the nucleic acid lipid nanoparticle composition.SELECTED DRAWING: Figure 1

Description

Technical Field

[0001] Related Applications This application claims the benefit and priority of U.S. Provisional Application No. 62 / 590,193, filed on Nov. 22, 2017; No. 62 / 553,088, filed on Aug. 31, 2017; and No. 62 / 553,085, filed on Aug. 31, 2017, the entire contents of each of which are incorporated herein by reference.

[0002] The present disclosure provides novel methods for generating nucleic acid lipid nanoparticle (LNP) compositions, the generated compositions, and methods for delivering one or more therapeutic and / or prophylactic agents, such as nucleic acids, to mammalian cells or organs and / or producing polypeptides in mammalian cells or organs, comprising nucleic acid lipid nanoparticles.

Background Art

[0003] Effective targeted delivery of bioactive substances, such as small molecule drugs, proteins, and nucleic acids, represents an ongoing medical challenge. In particular, delivery of nucleic acids to cells is complicated by the relative instability and low cell permeability of such species. Accordingly, there is a need to develop methods and compositions for facilitating delivery of therapeutic and prophylactic agents, such as nucleic acids, to cells.

[0004] Lipid-containing nanoparticles or lipid nanoparticles, liposomes, and lipoplexes have proven effective as transport vehicles for bioactive substances, such as small molecule drugs, proteins, and nucleic acids, to cells and / or intracellular compartments. Although various such lipid-containing nanoparticles have been demonstrated, improvements in safety, efficacy, and specificity are still lacking.

Summary of the Invention

[0005] In some embodiments, the present disclosure provides a method for generating a nucleic acid-lipid nanoparticle composition, comprising: i) mixing a lipid solution containing an ionizable lipid with a solution containing a nucleic acid to form precursor nucleic acid-lipid nanoparticles; ii) adding a lipid nanoparticle modifier containing a modifying agent to the precursor nucleic acid-lipid nanoparticles to form modified nucleic acid-lipid nanoparticles; and iii) treating the precursor nucleic acid-lipid nanoparticles, the modified nucleic acid-lipid nanoparticles, or both to form a nucleic acid-lipid nanoparticle composition.

[0006] In some embodiments, the precursor nucleic acid-lipid nanoparticles are not treated prior to addition of the lipid nanoparticle modifier.

[0007] In some embodiments, the precursor nucleic acid-lipid nanoparticles are treated prior to addition of the lipid nanoparticle modifier.

[0008] In some embodiments, the lipid solution further comprises a first PGE lipid.

[0009] In some embodiments, the precursor nucleic acid-lipid nanoparticles further comprise a first PEG lipid.

[0010] In some embodiments, the lipid solution does not contain any PEG lipid.

[0011] In some embodiments, the precursor nucleic acid-lipid nanoparticles do not contain any PEG lipid.

[0012] In some embodiments, the precursor nucleic acid-lipid nanoparticles further comprise a phospholipid.

[0013] In some embodiments, the precursor nucleic acid-lipid nanoparticles further comprise a structural lipid.

[0014] In some embodiments, the modifying agent is at least one agent selected from the group consisting of a second PEG lipid and a surfactant.

[0015] In some embodiments, the modifier is a second PEG lipid.

[0016] In some embodiments, the modifier is a surfactant.

[0017] In some aspects, the present disclosure provides precursor nucleic acid lipid nanoparticles prepared by the methods disclosed herein.

[0018] In some aspects, the present disclosure provides nucleic acid lipid nanoparticle compositions prepared by the methods disclosed herein.

[0019] In some aspects, the present disclosure provides a method for characterizing a nucleic acid lipid nanoparticle composition, comprising generating a quantitative value of the amount of encapsulated nucleic acid in the nucleic acid lipid nanoparticle composition using an ion exchange (IEX) chromatography assay.

[0020] Unless otherwise defined, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. Furthermore, the materials, methods, and examples are illustrative only and not intended to be limiting.

[0021] Other features and advantages of the present disclosure will be apparent from the following detailed description of the invention and the claims.

Brief Description of the Drawings

[0022]

Figure 1

Figure 2-1

Figure 2-2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7-1

Figure 7-2

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13A

Figure 13B

Figure 14

Figure 15

Figure 16

Figure 17

Figure 18

Figure 19

Figure 20

Figure 21

Figure 22

Figure 23

Figure 24

Figure 25

Figure 26

Figure 27

Figure 28

Figure 29

Figure 30

Figure 31A

Figure 31B

Figure 32

Figure 33-1

Figure 33-2

Figure 34-1

Figure 34-2

Figure 35

Figure 36

Figure 37

Figure 38

Figure 39

Figure 40

Figure 41

Figure 42

Figure 43

Figure 44

Figure 45

Figure 46

Figure 47

Figure 48

Figure 49A

Figure 49B

Figure 50

Figure 51

Figure 52A

Figure 52B

Figure 52C

Figure 52D

Figure 52E

Figure 52F

Figure 53

Figure 54

Figure 55

Figure 56

Figure 57

Figure 58A

Figure 58B

Figure 59

Figure 60

DETAILED DESCRIPTION OF THE INVENTION

[0023] The present disclosure is in part based on the discovery that methods of generating lipid nanoparticles affect the distribution of certain components within the lipid nanoparticles, and that this distribution can affect and / or determine the physical (e.g., stability) and / or biological (e.g., efficacy, intracellular delivery, immunogenicity) properties of the lipid nanoparticles.

[0024] In some embodiments, the methods of the present disclosure result in a composition comprising lipid nanoparticles having an advantageous distribution of components.

[0025] In some embodiments, the methods of the present disclosure mitigate undesirable property changes from the generated lipid nanoparticle (LNP) formulation.

[0026] In some embodiments, the undesirable property changes are caused by stress to the LNP formulation or the LNPs therein. In some embodiments, the stress is induced during the generation, purification, packaging, storage, transport, and / or use of the LNP formulation. In some embodiments, the stress is heat, shear, excessive agitation, membrane concentration polarization (change in charge state), dehydration, freeze stress, dry stress, freeze / thaw stress, and / or spray stress. In some embodiments, the stress is induced during the freezing or lyophilization of the LNP formulation.

[0027] In some embodiments, the undesirable property changes are a decrease in the physical stability of the LNP formulation. In some embodiments, the undesirable property changes are an increase in the amount of impurities and / or subvisible particles, or an increase in the average size of the LNPs in the LNP formulation.

[0028] In some embodiments, the method of the present disclosure alleviates a decrease in the physical stability (e.g., an increase in the average size of the LNPs) of the generated LNP formulation as compared to an LNP formulation generated by an equivalent method (e.g., a method that does not include one or more of steps i), ia), ib), ii), iia), iib), iic), iid), iie), and iif) disclosed herein (e.g., a method that does not include step ia) and / or step iia)).

[0029] In some embodiments, the LNP formulation generated by the method of the present disclosure has an average LNP diameter that is about 99% or less, about 98% or less, about 97% or less, about 96% or less, about 95% or less, about 90% or less, about 85% or less, about 80% or less, about 75% or less, about 70% or less, about 65% or less, about 60% or less, about 55% or less, about 50% or less, about 40% or less, about 30% or less, about 20% or less, or about 10% or less as compared to the average LNP diameter of an LNP formulation generated by an equivalent method (e.g., a method that does not include one or more of the steps disclosed herein).

[0030] In some embodiments, the undesirable property change is a decrease in the chemical stability of the LNP formulation. In some embodiments, the undesirable property change is a decrease in the integrity of the nucleic acid (e.g., RNA (e.g., mRNA)) in the LNP formulation.

[0031] In some embodiments, the method of the present disclosure alleviates a decrease in chemical stability (e.g., a decrease in the integrity of the nucleic acid in the LNP formulation) from the generated LNP formulation when compared to an LNP formulation generated by an equivalent method (e.g., a method that does not include one or more of the steps disclosed herein).

[0032] In some embodiments, the LNP formulation produced by the method of the present disclosure has an integrity of the LNP that is substantially the same as the integrity of the LNP used to produce the LNP formulation.

[0033] In some embodiments, the LNP formulations generated by the methods of the present disclosure have an LNP integrity that is about 50% or less, about 40% or less, about 30% or less, about 20% or less, about 15% or less, about 10% or less, about 8% or less, about 6% or less, about 4% or less, about 3% or less, about 2% or less, or about 1% or less lower than the integrity of the LNPs used to generate the LNP formulations.

[0034] In some embodiments, the LNP formulations generated by the methods of the present disclosure have an LNP integrity that is higher than the LNP integrity of LNP formulations generated by equivalent methods (methods that do not include one or more of steps i), ia), ib), ii), iia), iib), iic), iid), iie), and iif) disclosed herein (e.g., methods that do not include one or more of the steps disclosed herein)).

[0035] In some embodiments, the LNP formulations generated by the methods of the present disclosure have an LNP integrity that is about 5% or more, about 10% or more, about 15% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, about 1-fold or more, about 2-fold or more, about 3-fold or more, about 4-fold or more, about 5-fold or more, about 10-fold or more, about 20-fold or more, about 30-fold or more, about 40-fold or more, about 50-fold or more, about 100-fold or more, about 200-fold or more, about 300-fold or more, about 400-fold or more, about 500-fold or more, about 1000-fold or more, about 2000-fold or more, about 3000-fold or more, about 4000-fold or more, about 5000-fold or more, or about 10000-fold or more higher than the LNP integrity of LNP formulations generated by equivalent methods.

[0036] In some embodiments, the undesirable property change is a decrease in the biological properties of the LNP formulation. In some embodiments, the undesirable property change is a decrease in the efficacy, intracellular delivery, and / or immunogenicity of the LNP formulation.

[0037] In some embodiments, the LNP formulations produced by the methods of the present disclosure have higher efficacy, intracellular delivery, and / or immunogenicity than LNP formulations produced by equivalent methods (e.g., methods that do not include one or more of the steps disclosed herein).

[0038] In some embodiments, the LNP formulations produced by the methods of the present disclosure have efficacy, intracellular delivery, and / or immunogenicity that is at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 100-fold, at least about 200-fold, at least about 300-fold, at least about 400-fold, at least about 500-fold, at least about 1000-fold, at least about 2000-fold, at least about 3000-fold, at least about 4000-fold, at least about 5000-fold, or at least about 10000-fold higher than the efficacy, intracellular delivery, and / or immunogenicity of LNP formulations produced by equivalent methods.

[0039] In some embodiments, the LNP formulations produced by the methods of the present disclosure exhibit higher nucleic acid expression (e.g., mRNA expression) than the nucleic acid expression (e.g., mRNA expression) of LNP formulations produced by equivalent methods.

[0040] In some embodiments, the LNP formulations generated by the methods of the present disclosure exhibit nucleic acid expression (e.g., mRNA expression) that is about 5% or more, about 10% or more, about 15% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, about 1-fold or more, about 2-fold or more, about 3-fold or more, about 4-fold or more, about 5-fold or more, about 10-fold or more, about 20-fold or more, about 30-fold or more, about 40-fold or more, about 50-fold or more, about 100-fold or more, about 200-fold or more, about 300-fold or more, about 400-fold or more, about 500-fold or more, about 1000-fold or more, about 2000-fold or more, about 3000-fold or more, about 4000-fold or more, about 5000-fold or more, or about 10000-fold or more higher than the nucleic acid expression (e.g., mRNA expression) of LNP formulations generated by equivalent methods.

[0041] Method for producing lipid nanoparticle (LNP) composition and LNP composition produced thereby The present disclosure provides a method for producing a nucleic acid lipid nanoparticle composition, comprising: i) mixing a lipid solution containing an ionizable lipid with a solution containing a nucleic acid, thereby forming precursor nucleic acid lipid nanoparticles; ii) adding a lipid nanoparticle modifier containing a modifier to the precursor nucleic acid lipid nanoparticles, thereby forming modified nucleic acid lipid nanoparticles; and iii) treating the precursor nucleic acid lipid nanoparticles, the modified nucleic acid lipid nanoparticles, or both, thereby forming a nucleic acid lipid nanoparticle composition.

[0042] In some embodiments, the precursor nucleic acid lipid nanoparticles are not treated before adding the lipid nanoparticle modifier. As used herein, this embodiment may be referred to as the "post-insertion" method or process.

[0043] In some embodiments, the precursor nucleic acid lipid nanoparticles are treated before adding the lipid nanoparticle modifier. As used herein, this embodiment may be referred to as the "post-addition" method or process.

[0044] In some embodiments, the lipid solution further comprises a first PGE lipid.

[0045] In some embodiments, the lipid solution contains no PEG lipids at all.

[0046] In some embodiments, the precursor nucleic acid lipid nanoparticles further contain a first PEG lipid.

[0047] In some embodiments, the precursor nucleic acid lipid nanoparticles contain no PEG lipids at all.

[0048] In some embodiments, the modifier is at least one selected from the group consisting of a second PEG lipid and a surfactant. In some embodiments, the modifier is a second PEG lipid. In some embodiments, the modifier is a surfactant.

[0049] In some embodiments, the modifier is a second PEG lipid. In some embodiments, the first PEG lipid and the second PEG lipid are the same. In some embodiments, the first PEG lipid and the second PEG lipid are not the same.

[0050] In some embodiments, the molar ratio of the first PEG lipid to the modifier is in the range of about 1:100 to about 1:1, preferably about 1:50 to about 1:1, preferably about 1:25 to about 1:1, preferably about 1:10 to about 1:1. In some embodiments, the modifier is a second PEG lipid, and the molar ratio of the first PEG lipid to the second PEG lipid is in the range of about 1:100 to about 1:1, preferably about 1:50 to about 1:1, preferably about 1:25 to about 1:1, preferably about 1:10 to about 1:1. In some embodiments, the modifier is a surfactant, and the molar ratio of the first PEG lipid to the surfactant is in the range of about 1:100 to about 1:1, preferably about 1:50 to about 1:1, preferably about 1:25 to about 1:1, preferably about 1:10 to about 1:1.

[0051] The lipid mixture can be solubilized in a water-miscible organic solvent, preferably absolute ethanol. In some embodiments, the organic solvent is used in its commercially available form. In an exemplary embodiment, the mixture of lipids is a mixture of an ionizable lipid and a first PEG lipid and is co-solubilized in the organic solvent. In some embodiments, the lipid mixture consists essentially of an ionizable lipid and a PEG lipid, and optionally a phospholipid and / or a structural lipid. Preferred molar ranges are 30-60 mol% of the ionizable lipid and 0.01-10 mol% of the first PEG lipid, preferably 0.01-5 mol%, preferably 0.01-4 mol%, preferably 0.01-3 mol%, preferably 0.01-2 mol%, preferably 0.01-1 mol%, preferably 0.01-0.8 mol%, preferably 0.01-0.6 mol%, preferably 0.01-0.5 mol%, preferably 0.01-0.25 mol% of the first PEG lipid. The total concentration of the lipids is preferably less than 25 mg / ml, preferably less than 5 mg / ml. The lipid mixture may be filtered through a membrane, such as a 0.45 or 0.2 μm filter.

[0052] According to the present invention, the lipid mixture can preferably be combined with a nucleic acid solution in the form of a buffered aqueous solution. The buffered aqueous solution can be a solution in which the buffer has a pH lower than the pKa of the protonated lipid in the lipid mixture. Examples of suitable buffers include, but are not limited to, citrate, phosphate, and acetate. A particularly preferred buffer is acetate buffer. The preferred buffer is in the concentration range of 1-1000 mM of anions, depending on the chemical nature of the nucleic acid to be encapsulated, and optimization of the buffer concentration can be important to achieve high loading levels. For example, it may be appropriate to add cryoprotectants and / or non-ionic solutes that balance the osmotic potential across the particle membrane when the particles are dialyzed to remove ethanol, the pH is increased, or the particles are mixed with a pharmaceutically acceptable carrier or diluent. The amount of nucleic acid in the buffer is preferably about 0.01-1.0 mg / mL, preferably 0.08-0.8 mg / mL.

[0053] When adding a lipid solution (e.g., ethanol), the temperature of the aqueous nucleic acid solution is 25 to 45 °C, preferably 30 to 40 °C. In some embodiments, it may be useful to heat the aqueous nucleic acid solution at a high temperature for a short time (e.g., 1 to 2 minutes at 65 °C). The lipid solution can be added to the aqueous solution either by spraying in a narrow stream at the air-water interface or at the liquid-liquid interface between lipid solutions delivered via a tube immersed in the aqueous nucleic acid solution.

[0054] The organic lipid solution can be added by gravity or by a pump that delivers the organic lipid solution to the aqueous nucleic acid solution at a controlled rate, preferably a constant rate. In some embodiments, the delivery of the organic lipid is continuous (e.g., by a pump operating under continuous flow). The delivery of the organic lipid solution can be completed in 1 minute to 6 hours, 1 minute to 100 minutes, or 1 to 25 minutes. The organic lipid solution may be added via a single spray or stream, via a tube or an outlet, or via a multi-outlet system. The lipid organic solution is added to the aqueous nucleic acid solution, and the resulting solution may be mixed by stirring, shaking, or recirculation. As used herein, "mixing" preferably includes turbulent mixing ("T mixing"), vortex mixing ("V mixing"), microfluidic mixing, or both. The addition / mixing step results in a final concentration of 10 to 45% ethanol, preferably 11 to 30% ethanol, more preferably 12.5 to 25% ethanol. Preferably, the formation includes turbulent or microfluidic mixing of the solution that induces precipitation of the lipid in the organic phase and the nucleic acid in the aqueous phase, or extrusion of a pre-phase-separated mixture of nucleic acid and lipid through a membrane to create LNP.

[0055] In one step of the process, a lipid solution containing a first PEG lipid is mixed with a solution containing nucleic acid, thereby forming precursor nucleic acid lipid nanoparticles. In some embodiments, a precursor nucleic acid is provided. In another aspect, precursor lipid nanoparticles are provided. As used herein, "precursor lipid nanoparticles" refers to lipid nanoparticles that are precursors of the lipid nanoparticles described herein. In some embodiments, the precursor lipid nanoparticles can be formed and / or present during one or more steps of the particle formation process. In some embodiments where the lipid nanoparticles contain PEG molecules, the precursor lipid nanoparticles may contain a relatively low proportion of PEG molecules (e.g., at least about 0.01 mol% and about 1.0 mol% or less, at least about 0.05 mol%, at least about 0.1 mol%, at least about 0.2 mol%, at least about 0.3 mol%, at least about 0.4 mol%, at least about 0.5 mol%, at least about 0.6 mol%, at least about 0.7 mol%, or 0.8 mol%).

[0056] In some embodiments, all of the nucleic acid within the precursor nucleic acid lipid nanoparticles is bound to the ionizable lipid. In some embodiments, about 80% to about 100%, about 85% to about 100%, or about 90% to about 100% of the nucleic acid in the precursor nucleic acid lipid nanoparticles is bound to the ionizable lipid, preferably about 95% to about 100%, preferably about 98% to about 100%, preferably about 99% to about 100% is bound.

[0057] In some embodiments where the lipid nanoparticles contain PEG molecules, the precursor lipid nanoparticles can have nucleic acids that bind to more ionizable lipids than PEG molecules. For example, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% of the nucleic acids in the precursor lipid nanoparticles are bound to ionizable lipids. In some such cases, less than about 50%, less than about 40%, less than about 30%, less than about 20%, or less than about 10% of the nucleic acids in the precursor lipid nanoparticles are bound to PEG molecules (e.g., PEG lipids). In some embodiments, the ratio of nucleic acids bound to ionizable lipids to nucleic acids bound to PEG lipids in the precursor lipid nanoparticles is at least about 2:1. In some embodiments, the composition containing the precursor lipid nanoparticles may contain one or more organic solvents (e.g., ethanol). In some embodiments, the nucleic acid-lipid nanoparticle composition may be rich in precursor lipid nanoparticles. For example, at least about 50% of the lipid nanoparticles in the nucleic acid-lipid nanoparticle composition can be precursor lipid nanoparticles.

[0058] In some embodiments, the precursor nucleic acid lipid nanoparticles comprise from about 30 to 60 mol% ionizable lipid; from about 0 to 30 mol% phospholipid; from about 15 to 50 mol% structural lipid; and from about 0.01 to 10 mol% of a first PEG lipid. In some embodiments, the precursor nucleic acid lipid nanoparticles comprise from about 30 to 60 mol% ionizable lipid; from about 0 to 30 mol% phospholipid; from about 15 to 50 mol% structural lipid; and from about 0.01 to 1 mol% of a first PEG lipid. In some embodiments, the precursor nucleic acid lipid nanoparticles comprise from about 40 to 60 mol% ionizable lipid; from about 5 to 15 mol% phospholipid; from about 35 to 45 mol% structural lipid; and from about 0.01 to 10 mol% of a first PEG lipid. In some embodiments, the precursor nucleic acid lipid nanoparticles comprise from about 40 to 60 mol% ionizable lipid; from about 5 to 15 mol% phospholipid; from about 35 to 45 mol% structural lipid; and from about 0.01 to 1 mol% of a first PEG lipid. In some embodiments, the precursor nucleic acid lipid nanoparticles comprise from about 30 to 60 mol% ionizable lipid; from about 0 to 30 mol% phospholipid; from about 15 to 50 mol% structural lipid; and from about 0.01 to 0.75 mol% of a first PEG lipid. In some embodiments, the precursor nucleic acid lipid nanoparticles comprise from about 30 to 60 mol% ionizable lipid; from about 0 to 30 mol% phospholipid; from about 15 to 50 mol% structural lipid; and from about 0.01 to 0.5 mol% of a first PEG lipid.

[0059] In some embodiments, the processing can include removal of the organic solvent (i.e., ethanol) by dialysis or filtration, preferably diafiltration. As used herein, "processing" includes steps of purifying, pH adjusting, buffer exchanging, and / or concentrating the LNP. In some embodiments, the processing includes filtration such as sterile filtration. In a more preferred embodiment, the processing includes tangential flow filtration (TFF). While removing ethanol, the aqueous solution is converted to one buffered at a neutral pH, pH 6.5 - 7.8, pH 6.8 - pH 7.5, preferably pH 7.0 - pH 7.2, for example a phosphate or HEPES buffer. The resulting aqueous solution is preferably sterilized, for example by filtration through a 0.22 μm filter, prior to storage or use.

[0060] In some embodiments, the process may include freezing and / or lyophilization. The lyophilization step can be carried out in a suitable glass container, preferably a cylindrical glass vial of 1 ml to 10 ml (e.g., 3 ml). The glass vial needs to withstand extreme temperature changes below -40°C and above room temperature for a short time and be cut into a uniform shape. The composition containing the nucleic acid lipid nanoparticles is preferably added to the vial in a volume ranging from about 0.1 ml to about 5 ml, 0.2 ml to about 3 ml, 0.3 ml to about 1 ml, or about 0.4 ml to about 0.8 ml (e.g., about 0.5 ml), and preferably contains about 9 mg / ml of lipid. The lyophilization step may include freezing the composition at a temperature above about -40°C or, for example, below about -30°C to form a frozen composition, and then drying the frozen composition to form a lyophilized composition. The freezing step preferably lasts for about 100 to 180 minutes (e.g., about 130 minutes), preferably from 20°C to -40°C at a rate of 0.1 to 1°C / min (e.g., about 0.5°C / min), resulting in a linear decrease in temperature finally. More preferably, 5 to 15% (e.g., 8 to 12%) of sucrose can be used, and the drying step is carried out at about 50 to 150 mTorr, starting at a low temperature of about -15 to about -35°C and then at a high temperature from room temperature to about 25°C, and is completed in 3 to 7 days. In another embodiment of the present disclosure, the drying step is at about 50 to 100 mTorr, starting at a low temperature of about -40°C to about -20°C and then at a higher temperature.

[0061] In some embodiments, the method may further include packaging the nucleic acid lipid nanoparticle composition. As used herein, "storage" or "packaging" may refer to the storage of the final product in its final state before placing it in the final packaging or the storage during the manufacture of the LNP. Modes of storage and / or packaging include, but are not limited to, refrigeration in a sterile bag, refrigeration or freezing of the formulation in a vial, and lyophilized formulation in a vial and syringe.

[0062] In some embodiments, the nucleic acid lipid nanoparticles comprise from about 30 to 60 mol% ionizable lipid; from about 0 to 40 mol% phospholipid; from about 15 to 50 mol% structural lipid; and from about 0.01 to 20 mol% total of a first PEG lipid and a second PEG lipid. In some embodiments, the nucleic acid lipid nanoparticles comprise from about 30 to 60 mol% ionizable lipid; from about 0 to 30 mol% phospholipid; from about 15 to 50 mol% structural lipid; and from about 0.5 to 3.0 mol% total of a first PEG lipid and a second PEG lipid. In some embodiments, the nucleic acid lipid nanoparticles comprise from about 40 to 60 mol% ionizable lipid; from about 5 to 15 mol% phospholipid; from about 35 to 45 mol% structural lipid; and from about 0.01 to 20 mol% total of a first PEG lipid and a second PEG lipid. In some embodiments, the nucleic acid lipid nanoparticles comprise from about 40 to 60 mol% ionizable lipid; from about 5 to 15 mol% phospholipid; from about 35 to 45 mol% structural lipid; and from about 0.5 to 3 mol% total of a first PEG lipid and a second PEG lipid. In some embodiments, the nucleic acid lipid nanoparticles comprise from about 30 to 60 mol% ionizable lipid; from about 0 to 30 mol% phospholipid; from about 15 to 50 mol% structural lipid; and from about 0.5 to 2.5 mol% total of a first PEG lipid and a second PEG lipid. In some embodiments, the nucleic acid lipid nanoparticles comprise from about 30 to 60 mol% ionizable lipid; from about 0 to 30 mol% phospholipid; from about 15 to 50 mol% structural lipid; and from about 0.5 to 2.25 mol% total of a first PEG lipid and a second PEG lipid.

[0063] In some embodiments, the concentration of the non-ionic surfactant in the nucleic acid LNP formulation ranges from about 0.00001% w / v to about 1% w / v, such as from about 0.00005% w / v to about 0.5% w / v, or from about 0.0001% w / v to about 0.1% w / v.

[0064] In some embodiments, the concentration of the non-ionic surfactant in the nucleic acid LNP formulation ranges from about 0.000001 wt% to about 1 wt%, such as from about 0.000002 wt% to about 0.8 wt%, or from about 0.000005 wt% to about 0.5 wt%.

[0065] In some embodiments, the concentration of the PEG lipid in the stabilized LNP formulation ranges from about 0.01 mol% to about 50 mol%, such as from about 0.05 mol% to about 20 mol%, from about 0.07 mol% to about 10 mol%, from about 0.1 mol% to about 8 mol%, from about 0.2 mol% to about 5 mol%, or from about 0.25 mol% to about 3 mol%.

[0066] In some embodiments, the distribution of one or more components in the lipid nanoparticles may be at least partially determined by the process by which the components are assembled. For example, in some embodiments, the distribution (e.g., accessibility, arrangement) of nucleic acids (e.g., mRNA) within the lipid nanoparticles can be at least partially controlled by the formulation process. For example, the formulation process may include one or more steps that allow for adjustment of the mRNA distribution, as described in more detail below. For example, in the formulation process, a particular component (e.g., PEG lipid) can be used at a relatively low weight percentage during the particle formation step (e.g., nanoprecipitation reaction), and / or a particular lipid nanoparticle component can be added after particle formation.

[0067] In some embodiments, regardless of the process used, the distribution of one or more components within the lipid nanoparticles can be at least partially affected by the distribution of another component within the lipid nanoparticles. For example, the distribution of nucleic acids within the lipid nanoparticles can be at least partially determined by the distribution of another component within the lipid nanoparticles, such as a molecule containing polyethylene glycol (also referred to as a "PEG molecule"). Without being bound by theory, it is believed that a particular distribution of PEG molecules facilitates specific binding that results in a beneficial mRNA distribution. Regardless of whether the distribution of molecules containing PEG (e.g., PEG lipids) affects the distribution of mRNA, a particular distribution of molecules containing polyethylene glycol (e.g., PEG lipids) can result in beneficial properties.

[0068] As described herein, in some embodiments, lipid nanoparticles having a particular distribution of molecules comprising polyethylene glycol (e.g., PEG lipids) can have beneficial physical and / or biological properties. In some embodiments, the molecules comprising polyethylene glycol (e.g., PEG lipids) can be distributed such that a relatively high percentage (e.g., the majority) of the molecules comprising polyethylene glycol (e.g., PEG lipids) are accessible from the surface of the lipid nanoparticles. As used herein, the term “accessible” (also referred to as “surface-accessible”) with respect to a molecule comprising polyethylene glycol (e.g., PEG lipids) can refer to PEG molecules that are localized on the surface of the lipid nanoparticles and / or PEG molecules that can be readily localized to the surface of the lipid nanoparticles, such as by facile rearrangement, under certain conditions (e.g., physiological conditions, in serum, in buffer). PEG molecules that are not surface-accessible may be referred to as “residual” PEG molecules. In some embodiments, the residual PEG molecules can be located in one or more internal regions of the lipid nanoparticles. In some embodiments, the surface-accessible PEG molecules can be located within the external region of the lipid nanoparticles.

[0069] In some embodiments, the surface-accessibility of PEG molecules can be determined by one or more assays (e.g., in vitro assays). In general, any suitable in vitro assay can be used. In some embodiments, the relative percentages of surface-accessible and residual PEG molecules in the lipid nanoparticles and / or compositions can be determined using PEG shedding from the lipid nanoparticles as evaluated by diffusion-ordered spectroscopy (DOSY) NMR. For PEG shedding and DOSY NMR, Wilson, S.C.; Baryza, J.L.; Reynolds, A. J.; Bowman, K.; Rajan, S.; et al. (2015). Real Time Measurement of PEG Shedding from Lipid Nanoparticles in, which is hereby incorporated by reference in its entirety, can be consulted. Serum via NMR Spectroscopy. Further described in Molecular Pharmaceutics, 12(2):386-92. In some embodiments, the percentage of surface-accessible PEG molecules corresponds to the percentage of PEG molecules shed after a period of time (e.g., 6 hours, 24 hours) under certain conditions (e.g., in mouse serum at 25°C).

[0070] In some embodiments, the PEG molecules may be distributed in a manner that results in a relatively short half-life. As used herein, the "half-life" of a molecule comprising polyethylene glycol is the time it takes for 50% of the molecules comprising polyethylene glycol to shed from the surface of the lipid nanoparticle when determined by DOSY NMR under certain conditions (e.g., in mouse serum at 25°C). In some embodiments, the lipid nanoparticles may have a shorter half-life than certain equivalent lipid nanoparticles.

[0071] In some embodiments, the surface accessibility, arrangement, and / or half-life of the PEG molecules may correlate with one or more biological and / or physical properties of the lipid nanoparticles. For example, in some embodiments, the surface accessibility, arrangement, and / or half-life of the PEG molecules may correlate with the immunogenicity of the lipid nanoparticles and / or compositions. For example, in some embodiments, a relatively high percentage of surface-accessible PEG molecules and / or a relatively short half-life may correspond to low or no immunogenicity. Certain compositions of the present invention may have lower immunogenicity than equivalent compositions.

[0072] In some embodiments, the surface accessibility, arrangement, and / or half-life of the PEG molecules may correlate with one or more physical properties of the lipid nanoparticles. For example, a relatively high percentage of surface-accessible PEG molecules and / or a relatively short half-life may correspond to high nucleic acid encapsulation efficiency. As another example, the surface accessibility, arrangement, and / or half-life of the PEG molecules may correlate with surface polarization. For example, in some embodiments, lipid nanoparticles having a relatively high percentage of surface-accessible PEG molecules and / or a relatively short half-life may have relatively low surface polarization (e.g., low surface polarity).

[0073] As described herein, in some embodiments, the lipid nanoparticles may have a beneficial distribution of one or more components. In some embodiments, the lipid nanoparticles may have a beneficial distribution of two or more components (e.g., three or more components, four or more components, five or more components). For example, the lipid nanoparticles may have a beneficial distribution of nucleic acid and a beneficial distribution of PEG molecules. In some such cases, the lipid nanoparticles may have at least some (e.g., all) of the advantageous properties associated with the beneficial distribution of each component.

[0074] In some embodiments, a composition is provided. The composition may include the lipid nanoparticles described herein. In some embodiments, the composition may include a relatively high percentage of the lipid nanoparticles described herein. In some embodiments, the lipid nanoparticles described herein may have one or more properties that are superior to other lipid nanoparticles in the formulation. Such lipid nanoparticles having one or more properties that are superior to other lipid nanoparticles in the formulation may be referred to as "enhanced lipid nanoparticles". For example, the enhanced lipid nanoparticles may have mRNA that is less accessible than other lipid nanoparticles (e.g., all other lipid nanoparticles) in the composition. In some examples, the enhanced lipid nanoparticles may have mRNA that is less accessible than the accessible mRNA. In certain embodiments, the enhanced lipid nanoparticles may have a relatively high percentage (e.g., at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%) of surface-accessible PEG molecules. In some embodiments where the enhanced lipid nanoparticles constitute a relatively high percentage (e.g., at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%) of the total lipid nanoparticles in the composition, the composition may be referred to as being enriched in enhanced lipid nanoparticles.

[0075] In some embodiments, the lipid nanoparticles and / or compositions described herein may have a low amount of accessible nucleic acid (e.g., mRNA). For example, in some embodiments, of the total amount of nucleic acid in the lipid nanoparticles and / or compositions, about 50% or less, about 45% or less, about 40% or less, about 35% or less, about 30% or less, about 25% or less, about 20% or less, about 15% or less, about 10% or less, or about 5% or less is accessible nucleic acid (e.g., mRNA). In some embodiments, the lipid nanoparticles and / or compositions may contain accessible nucleic acid. In some such embodiments, the lipid nanoparticles and / or compositions may contain at least about 0.01%, at least about 0.05%, at least about 0.1%, at least about 0.5%, at least about 1%, or at least about 2% accessible nucleic acid. All combinations of the above ranges are possible (e.g., at least about 0.01% and about 50% or less).

[0076] In some embodiments, the lipid nanoparticles and / or compositions described herein may have a beneficial amount of inaccessible nucleic acid (e.g., mRNA). For example, in some embodiments, of the total amount of nucleic acid in the lipid nanoparticles and / or compositions, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, about 90% or less, or at least about 95% is inaccessible nucleic acid (e.g., mRNA).

[0077] In some embodiments, the lipid nanoparticles and / or compositions described herein may have a beneficial amount of nucleic acid (e.g., mRNA) disposed in one or more internal regions of the lipid nanoparticles. For example, in some embodiments, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, about 70% or less, at least about 75%, at least about 80%, at least about 85%, about 90% or less, or at least about 95% of the total amount of nucleic acid in the lipid nanoparticles and / or compositions is disposed in the internal region(s) of the lipid nanoparticles.

[0078] In some embodiments, the lipid nanoparticles and / or compositions described herein may have a beneficial amount of nucleic acid (e.g., mRNA) that is at least partially (e.g., completely) encapsulated. For example, in some embodiments, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, about 70% or less, at least about 75%, at least about 80%, at least about 85%, about 90% or less, or at least about 95% of the total amount of nucleic acid in the lipid nanoparticles and / or compositions is at least partially (e.g., completely) encapsulated. In some embodiments, the percentage of nucleic acid that is at least partially (e.g., completely) encapsulated can be determined by the in vitro assays (e.g., IEX) described herein.

[0079] In some embodiments, the lipid nanoparticles and / or compositions described herein may have a beneficial amount of surface-accessible PEG molecules (e.g., PEG lipids). For example, in some embodiments, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, about 90% or less, or at least about 95% of the total amount of molecules containing PEG (e.g., PEG lipids) in the lipid nanoparticles and / or compositions are surface-accessible PEG molecules.

[0080] In some embodiments, the lipid nanoparticles and / or compositions described herein may have residual molecules (e.g., PEG lipids) containing a beneficial amount of PEG. For example, in some embodiments, of the total amount of PEG molecules (e.g., PEG lipids) in the lipid nanoparticles and / or compositions, about 50% or less, about 45% or less, about 40% or less, about 35% or less, about 35% or less, about 30% or less, about 25% or less, about 20% or less, about 15% or less, about 10% or less, or about 5% or less are residual PEG molecules. In some embodiments, the lipid nanoparticles and / or compositions may contain residual PEG molecules. In some such embodiments, the lipid nanoparticles and / or compositions may contain at least about 0.01%, at least about 0.05%, at least about 0.1%, at least about 0.5%, at least about 1%, or at least about 2% of residual PEG molecules. All combinations of the above ranges are possible (e.g., at least about 0.01% and about 50% or less). In some embodiments, the lipid nanoparticles and / or compositions may not contain residual PEG molecules.

[0081] In some embodiments, the lipid nanoparticles and / or compositions described herein may have a beneficial amount of PEG molecules (e.g., PEG lipids) disposed in the external region(s) of the lipid nanoparticle(s). For example, in some embodiments, of the total amount of PEG molecules (e.g., PEG lipids) in the lipid nanoparticles and / or compositions, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, about 70% or less, at least about 75%, at least about 80%, at least about 85%, about 90% or less, or at least about 95% may be disposed in the external region(s) of the lipid nanoparticle(s).

[0082] In some embodiments where the lipid nanoparticles comprise a molecule comprising polyethylene glycol (e.g., PEG-lipid), the half-life of the molecule comprising polyethylene glycol may be relatively short. For example, the half-life can be about 5 hours or less, about 4.5 hours or less, about 4 hours or less, about 3 hours or less, about 2.75 hours or less, about 2.25 hours or less, about 2.0 hours or less, about 1.75 hours or less, about 1.5 hours or less, about 1.25 hours or less, about 1.0 hours or less, about 0.75 hours or less, or about 0.5 hours or less. In some cases, the half-life can be at least about 0.01 hours, at least about 0.05 hours, at least about 0.1 hours, or at least about 0.5 hours. All combinations of the above ranges are possible (e.g., at least about 0.01 hours and about 5 hours or less, at least about 0.01 hours and about 3 hours or less, at least about 0.5 hours and about 3 hours or less).

[0083] In some embodiments where the lipid nanoparticles and / or compositions comprise a molecule comprising polyethylene glycol (e.g., PEG lipid), the molar percentage of PEG molecules in the lipid nanoparticles and / or compositions may be relatively small. For example, in some embodiments, the molar percentage of PEG molecule(s) in the lipid nanoparticles and / or compositions is about 5% or less, about 4.5% or less, about 4.0% or less, about 3.5% or less, about 3.0% or less, about 2.5% or less, about 2.0% or less, about 1.5% or less, about 1.0% or less, or about 0.5% or less. In some embodiments, the lipid nanoparticles and / or compositions may comprise PEG molecule(s). In some such embodiments, the lipid nanoparticles and / or compositions can comprise at least about 0.01%, at least about 0.05%, at least about 0.1%, at least about 0.5%, at least about 1%, or at least about 2% molar percent of PEG molecules. All combinations of the above ranges are possible (e.g., at least about 0.01% and about 5.0% or less). In some embodiments, the molar percentage of PEG molecules (e.g., PEG lipid) in the lipid nanoparticles and / or compositions may be lower than the critical micelle concentration of the PEG molecule(s) (e.g., PEG lipid).

[0084] In some embodiments, the molecule containing polyethylene glycol may be a PEG lipid. In some such embodiments, the PEG lipid may contain one or more aliphatic groups. In some cases, the PEG lipid may contain two or more aliphatic groups. It should be understood that the two or more aliphatic groups refer to aliphatic groups not within the same aliphatic chain. For example, the carbon atoms of the first aliphatic group may not form a direct carbon-carbon covalent bond with the carbon atoms of the second aliphatic group. That is, the two or more aliphatic groups may be indirectly bonded to each other.

[0085] Treatment of the LNP solution As used herein, the term "treatment" includes one or more steps for purifying, pH-adjusting, buffer-exchanging, and / or concentrating the LNP.

[0086] In some embodiments, the treatment steps of the LNP solution include the following: a) Filtering the LNP solution.

[0087] In some embodiments, filtering removes the organic solvent (e.g., ethanol) from the LNP solution. In some embodiments, the treatment includes filtering such as sterile filtration. In some embodiments, the treatment includes tangential flow filtration (TFF). In some embodiments, when the organic solvent (e.g., ethanol) is removed, the LNP solution is converted to a solution buffered at a neutral pH, pH 6.5 - 7.8, pH 6.8 - pH 7.5, preferably pH 7.0 - pH 7.2 (e.g., a phosphate or HEPES buffer). In some embodiments, the resulting LNP solution is preferably sterilized, for example, by filtration (e.g., through a 0.22 μm filter) before storage or use.

[0088] In some embodiments, the treatment steps of the LNP solution further include packaging the LNP solution.

[0089] As used herein, "packaging" may refer to the storage of the formulation in its final state or during the manufacture of the LNP prior to placing the final product into the final packaging. Modes of storage and / or packaging include, but are not limited to, refrigeration in a sterile bag, refrigeration or freezing of the formulation in vials, lyophilized formulations in vials and syringes, etc.

[0090] In some embodiments, the step of packaging the LNP solution comprises one or more of the following steps: b) adding a cryoprotectant to the LNP solution; c) lyophilizing the LNP solution to thereby form a lyophilized LNP composition; d) storing the LNP solution or the lyophilized LNP composition; adding a reconstitution solution to the LNP solution or the lyophilized LNP composition to thereby form an LNP formulation.

[0091] In some embodiments, the cryoprotectant is added to the LNP solution before lyophilization. In some embodiments, the cryoprotectant comprises one or more cryoprotectants, and each of the one or more cryoprotectants is independently a polyol (e.g., a diol or triol such as propylene glycol (i.e., 1,2-propanediol), 1,3-propanediol, glycerol, (+ / -)-2-methyl-2,4-pentanediol, 1,6-hexanediol, 1,2-butanediol, 2,3-butanediol, ethylene glycol, or diethylene glycol), a non-surfactant sulfobetaine (e.g., NDSB-201 (3-(1-pyridino)-1-propanesulfonate)), an osmolyte (e.g., L-proline or trimethylamine N-oxide dihydrate), a polymer (e.g., polyethylene glycol 200 (PEG200), PEG400, PEG600, PEG1000, PEG3350, PEG4000, PEG8000, PEG10000, PEG20000, polyethylene glycol monomethyl ether 550 (mPEG550), mPEG600, mPEG2000, mPEG3350, mPEG4000, mPEG5000, polyvinylpyrrolidone (e.g., polyvinylpyrrolidone K15), pentaerythritol propoxylate, or polypropylene glycol P400), an organic solvent (e.g., dimethyl sulfoxide (DMSO) or ethanol), a sugar (e.g., D-(+)-sucrose, D-sorbitol, trehalose, D-(+)-maltose monohydrate, meso-erythritol, xylitol, myo-inositol, D-(+)-raffinose pentahydrate, D-(+)-trehalose dihydrate, or D-(+)-glucose monohydrate), or a salt (e.g., lithium acetate, lithium chloride, lithium formate, lithium nitrate, lithium sulfate, magnesium acetate, sodium chloride, sodium formate, sodium malonate, sodium nitrate, sodium sulfate, or their hydrates), or any combination thereof. In some embodiments, the cryoprotectant comprises sucrose.

[0092] In some embodiments, lyophilization was carried out in a suitable glass container (e.g., 2, 3, 5, or 10 ml cylindrical glass vial). The glass container preferably withstands extreme temperature changes from below -40 °C to above room temperature for a short time and / or is cut into a uniform shape. In some embodiments, the lyophilization step includes freezing the LNP solution at a temperature below about -40 °C, thereby forming a frozen LNP solution, and drying the frozen LNP solution to form a lyophilized LNP composition. The freezing step preferably lasts for about 100 - 180 minutes (e.g., about 130 minutes), preferably at 0.1 - 1 °C / min (e.g., about 0.5 °C / min) from 20 °C to -40 °C, resulting in a final linear decrease in temperature. More preferably, 5 - 15% (e.g., 8 - 12%) sucrose can be used, and the drying step is carried out under a vacuum in the range of about 50 mTorr to about 150 mTorr, preferably starting at a low temperature below -10 °C (e.g., about -35 °C to about -15 °C), below -20 °C, below -30 °C, or below -40 °C, and then at a higher temperature from room temperature to about 25 °C. Preferably, the drying step is completed in 3 - 7 days. In some embodiments, the drying step is carried out under a vacuum in the range of about 50 mTorr to about 100 mTorr, preferably starting at a low temperature of about 0 °C below, about 10 °C below, about 20 °C below, or about 30 °C below (e.g., about -35 °C), and then at a higher temperature.

[0093] In some embodiments, the LNP solution or the lyophilized LNP composition is stored at a temperature of about -40 °C, about -35 °C, about -30 °C, about -25 °C, about -20 °C, about -15 °C, about -10 °C, about -5 °C, about 0 °C, about 5 °C, about 10 °C, about 15 °C, about 20 °C, or about 25 °C before adding the reconstitution solution.

[0094] In some embodiments, the LNP solution or the lyophilized LNP composition is stored at a temperature in the range of about -40 °C to about 0 °C, about -35 °C to about -5 °C, about -30 °C to about -10 °C, about -25 °C to about -15 °C, about -22 °C to about -18 °C, or about -21 °C to about -19 °C before adding the reconstitution solution.

[0095] In some embodiments, the LNP solution or lyophilized LNP composition is stored at a temperature of about -20°C before adding the reconstitution solution.

[0096] In some embodiments, the LNP solution or lyophilized LNP composition is stored at a temperature in the range of about -15°C to about 25°C, about -10°C to about 20°C, about -5°C to about 15°C, about 0°C to about 10°C, about 1°C to about 9°C, or about 2°C to about 8°C before adding the reconstitution solution.

[0097] In some embodiments, the LNP solution or lyophilized LNP composition is stored for about 30 minutes, about 1 hour, about 2 hours, about 4 hours, about 6 hours, about 12 hours, about 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 1 month, about 2 months, about 3 months, about 4 months, about 6 months, about 9 months, about 1 year, about 2 years, about 3 years, about 4 years, about 5 years, about 6 years, about 7 years, about 8 years, about 9 years, or about 10 years before adding the reconstitution solution.

[0098] In some embodiments, the LNP solution or lyophilized LNP composition is stored for a period in the range of about 1 month to about 10 years, about 3 months to about 8 years, about 6 months to about 6 years, about 9 months to about 4 years, about 1 year to about 3 years, or about 1.5 years to about 2.5 years before adding the reconstitution solution.

[0099] In some embodiments, the LNP solution or lyophilized LNP composition is stored for about 2 years before adding the reconstitution solution.

[0100] Method for stabilizing LNP formulations The present disclosure provides a method for producing a nucleic acid-lipid nanoparticle composition.

[0101] The present disclosure provides a method for stabilizing a lipid nanoparticle (LNP) formulation upon application of stress by adding a modifier to the LNP formulation before or during its generation when stress is applied.

[0102] In some embodiments, stress includes any stress applied to the formulation during manufacture, purification, packaging, storage, transportation, and use of the formulation, such as heat, shear, excessive agitation, membrane concentration polarization (change in charge state), dehydration, freeze stress, dry stress, freeze / thaw stress, spray stress, and the like. For example, stress can cause one or more undesirable property changes in the formulation, such as an increase in impurities, invisible particles, or both, an increase in LNP size, a decrease in encapsulation efficiency, a decrease in therapeutic effect, or both, and a decrease in tolerance (e.g., an increase in immunogenicity).

[0103] In some embodiments, the applied stress is derived from generating an LNP formulation, for example, mixing lipid components in an organic solvent (e.g., ethanol) to generate an organic phase, mixing mRNA into an acidic solution to generate an aqueous phase, adjusting the pH value of the aqueous phase, and / or mixing the organic phase and the aqueous phase to generate an LNP formulation. For example, each of the above mixing steps can include turbulent mixing or microfluidic mixing. For example, before mixing the organic matter with the aqueous phase, each phase can be purified, for example, via filtration (such as tangential flow filtration or TFF). For example, the applied stress is derived from such purification.

[0104] In some embodiments, the applied stress is derived from the treatment of the LNP after LNP formation, for example, downstream purification and concentration by tangential flow filtration (TFF). For example, in a typical TFF process, the LNP dispersion is exposed to various hydrophobic interfaces, shear forces, and turbulent flow. For example, during a typical TFF process, molecules larger than the pores of the membrane (i.e., LNP) accumulate on the membrane surface to form a gel or concentration polarization layer. For example, an increase in the concentration of LNP functions as a destabilizing stress and promotes intermolecular interactions that can generate larger particle species.

[0105] In some embodiments, the applied stress is derived from the purification of the LNP formulation. Accordingly, the present disclosure also features a method for purifying a lipid nanoparticle (LNP) formulation, which includes filtering a first LNP formulation in the presence of an amphiphilic polymer to obtain a second LNP formulation.

[0106] In some embodiments, the stress applied is derived from freezing or lyophilization of the LNP formulation. Accordingly, the present disclosure also features a method of freezing or lyophilizing a lipid nanoparticle (LNP) formulation, which includes freezing or lyophilizing a first LNP formulation in the presence of a modifying agent.

[0107] For example, the modifying agent is present at a concentration in the range of about 0.025% w / v to about 1% w / v (e.g., about 0.025% w / v, about 0.05% w / v, about 0.1% w / v, about 0.5% w / v, about 1% w / v, about 0.025 - 0.5% w / v, about 0.05 - 1% w / v, about 0.1 - 1% w / v, or about 0.1 - 0.5% w / v). For example, the modifying agent is present at a concentration in the range of about 0.025% w / w to about 1% w / w (e.g., about 0.025% w / w, about 0.05% w / w, about 0.1% w / w, about 0.5% w / w, about 1% w / w, about 0.025 - 0.5% w / w, about 0.05 - 1% w / w, about 0.1 - 1% w / w, or about 0.1 - 0.5% w / w).

[0108] For example, the modifying agent is present at a concentration in the range of about 0.025% w / v to about 1% w / v (e.g., about 0.025% w / v, about 0.05% w / v, about 0.1% w / v, about 0.5% w / v, about 1% w / v, about 0.025 - 0.5% w / v, about 0.05 - 1% w / v, about 0.1 - 1% w / v, or about 0.1 - 0.5% w / v). For example, the modifying agent is present at a concentration in the range of about 0.025% w / w to about 1% w / w (e.g., about 0.025% w / w, about 0.05% w / w, about 0.1% w / w, about 0.5% w / w, about 1% w / w, about 0.025 - 0.5% w / w, about 0.05 - 1% w / w, about 0.1 - 1% w / w, or about 0.1 - 0.5% w / w).

[0109] For example, the third amphiphilic polymer is present at a concentration in the range of about 0.1% w / v to about 3% w / v (e.g., about 0.1% w / v, about 0.5% w / v, about 1% w / v, about 2% w / v, about 2.5% w / v, about 0.1 - 2.5% w / v, about 0.1 - 1% w / v, about 0.1 - 0.5% w / v, or about 0.1 - 0.4% w / v). For example, the third amphiphilic polymer is present at a concentration in the range of about 0.1% w / w to about 3% w / w (e.g., about 0.1% w / w, about 0.5% w / w, about 1% w / w, about 2% w / w, about 2.5% w / w, about 0.1 - 2.5% w / w, about 0.1 - 1% w / w, about 0.1 - 0.5% w / w, or about 0.1 - 0.4% w / w).

[0110] For example, the fourth amphiphilic polymer is present at a concentration in the range of about 0.1% w / v to about 3% w / v (e.g., about 0.1% w / v, about 0.5% w / v, about 1% w / v, about 2% w / v, about 0.1 - 2.5% w / v, about 0.1 - 1% w / v, about 0.1 - 0.5% w / v, or about 0.1 - 0.4% w / v). For example, the fourth amphiphilic polymer is present at a concentration in the range of about 0.1% w / w to about 3% w / w (e.g., about 0.1% w / w, about 0.5% w / w, about 1% w / w, about 2% w / w, about 2.5% w / w, about 0.1 - 2.5% w / w, about 0.1 - 1% w / w, about 0.1 - 0.5% w / w, or about 0.1 - 0.4% w / w).

[0111] For example, the weight ratio of the modifier to the nucleic acid is about 0.025:1 to about 100:1.

[0112] For example, the modifier is added such that the weight ratio of the modifier to the LNP is about 0.0004:1 to about 100:1 (e.g., about 0.001:1 to about 10:1, about 0.001:1 to about 5:1, about 0.001:1 to about 0.1:1, about 0.005 to about 0.4:1, or about 0.5:1 to about 4:1, about 0.05:1 to about 5:1, about 0.1:1 to about 5:1, or about 0.05:1 to about 2.5:1, about 1:1 to about 50:1, about 2:1 to about 50:1, or about 1:1 to about 25:1).

[0113] Method for characterizing an LNP composition In some embodiments, the accessibility of the nucleic acid in the LNP composition comprising the LNP can be determined by one or more assays (e.g., in vitro assays). Generally, any suitable in vitro assay can be used. A suitable assay can distinguish between various encapsulation states of the nucleic acid and / or the binding state between the nucleic acid and the components of the lipid nanoparticle. For example, the accessibility of the nucleic acid can be determined by an ion exchange chromatography (IEX) assay. In certain embodiments, as described in more detail below, certain conventional assays may not be suitable for determining the accessibility of the nucleic acid. For example, in some embodiments, the Ribogreen assay is not suitable for determining the accessibility of nucleic acids (e.g., mRNA). In some embodiments, an in vitro assay can be used to generate a quantitative value of the amount of accessible or inaccessible nucleic acid (e.g., mRNA) in the lipid nanoparticle or composition. For example, an ion exchange chromatography (IEX) assay can be used to generate a quantitative value of the amount of accessible or inaccessible mRNA in a composition comprising lipid nanoparticles. Generally, for the entire composition and / or a fraction of the composition (e.g., a fraction comprising certain lipid nanoparticles), the amount of inaccessible or accessible nucleic acid may be determined.

[0114] In some embodiments, the accessibility of the nucleic acid within the lipid nanoparticle may correlate with one or more biological properties of the lipid nanoparticle. In certain embodiments, the accessibility of the nucleic acid within the lipid nanoparticle may correlate with protein expression levels and / or the efficacy of intracellular nucleic acid delivery. For example, in some embodiments, due to a relatively high percentage of inaccessible nucleic acid, a relatively low percentage of accessible nucleic acid may result in higher protein expression levels (e.g., in vitro, in vivo). In such cases, a composition with a low percentage of accessible mRNA may have a higher level of mRNA expression than an equivalent composition with a high percentage of accessible mRNA.

[0115] In some embodiments, the present disclosure provides a method for characterizing an LNP composition (e.g., an LNP composition prepared by the methods of the present disclosure) using a chromatography assay.

[0116] In some embodiments, a quantitative value of the amount of encapsulated nucleic acid (e.g., mRNA) in the LNP composition is measured using a chromatography assay.

[0117] In some embodiments, the chromatography assay is an ion exchange (IEX) chromatography assay.

[0118] In some embodiments, when determined by an ion exchange chromatography (IEX) assay, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 95% of the LNPs in the LNP composition have mRNA encapsulated therein.

[0119] An ion exchange (IEX) chromatography method was developed to accurately determine the encapsulation efficiency of mRNA encapsulated in ionizable lipid-based LNPs generated according to the conventional T mix methodology (Example 4) or V mix methodology. Using IEX chromatography, bound mRNA and free mRNA can be separated. The IEX screening method separates free mRNA from the LNP when there is a gradient change from low salt concentration to high salt concentration. When the gradient changes from low salt concentration to high salt concentration, the LNP elutes in the void (peak 1) and the mRNA elutes (peak 2, referred to as "accessible mRNA").

[0120] Without being bound by theory, within a population of LNPs (e.g., LNPs encapsulating mRNA), the mRNA can be present in a variety of different encapsulation states, such as, for example, fully encapsulated, surface-bound, loosely encapsulated (or other physical states). Methods recognized in the art for determining the encapsulation efficiency of nucleic acids, particularly the routinely used Ribogreen assay, cannot distinguish such physical states (e.g., do not identify important differences in structural features and circumstances). To illustrate the utility of the IEX method of the present invention, a population of LNP samples can be subjected to separation techniques recognized in the art, such as, for example, size exclusion chromatography (SEC). This fractionates the particles based on size. The fractions can be subjected to, for example, biological assays, such as in vitro protein expression assays. The fractions can likewise be used to determine the encapsulation efficiency by the IEX method of the present invention.

[0121] Ionizable lipid The present disclosure provides an ionizable lipid preferably comprising a central amine moiety and at least one biodegradable group. The lipids described herein can be advantageously used in lipid nanoparticles for delivering therapeutic and / or prophylactic agents, such as nucleic acids, to mammalian cells or organs.

[0122] In embodiments, the ionizable lipid of the present disclosure has the formula (IL-1):

Chemical formula

[0123] In some embodiments, a subset of the compounds of formula (IL-I) includes compounds of formula (IL-IA):

Chemical formula

[0124] In some embodiments, a subset of the compounds of formula (I) includes compounds of formula (IL-IB):

Chemical formula

[0125] In some embodiments, a subset of the compounds of formula (IL-I) includes a compound of the formula

Chemical formula

[0126] In one embodiment, the compound of formula (IL-I) is of formula (IL-IIa):

Chemical formula

[0127] In another embodiment, the compound of formula (IL-1) is of formula (IL-IIb):

Chemical formula

[0128] In another embodiment, the compound of formula (IL-I) is of formula (IL-IIc) or (IL-IIe):

Chemical formula

[0129] In another embodiment, the compound of formula (IL-I) is of formula (IL-IIf):

Chemical formula

[0130] In a further embodiment, the compound of formula (IL-I) is of formula (IL-IId):

Chemical formula

[0131] In another embodiment, the compound of formula (IL-1) is of formula (IL-IIg):

Chemical formula

[0132] In some embodiments, the ionizable lipid is one or more of the compounds described in U.S. Application Nos. 62 / 220,091, 62 / 252,316, 62 / 253,433, 62 / 266,460, 62 / 333,557, 62 / 382,740, 62 / 393,940, 62 / 471,937, 62 / 471,949, 62 / 475,140, and 62 / 475,166, and PCT Application No. PCT / US2016 / 052352.

[0133] In some embodiments, the ionizable lipid is selected from Compounds 1-280 described in U.S. Application No. 62 / 475,166.

[0134] In some embodiments, the ionizable lipid is

Chemical Formula

[0135] In some embodiments, the ionizable lipid is [Chemical Formula] , or a salt thereof.

[0136] In some embodiments, the ionizable lipid is [Chemical Formula] , or a salt thereof.

[0137] In some embodiments, the ionizable lipid is [Chemical Formula] , or a salt thereof.

[0138] In some embodiments, the ionizable lipid of the present disclosure has the formula (IL-III): [Chemical Formula] and may be one or more of the compounds thereof, or a salt or isomer thereof, wherein W is [Chemical Formula] ; Ring A is [Chemical Formula] ; t is 1 or 2; A1 and A2 are each independently selected from CH or N; Z is CH2 or absent. When Z is CH2, the dashed lines (1) and (2) each represent a single bond; when Z is absent, neither of the dashed lines (1) and (2) is present; R1, R2, R3, R4, and R5 are C5-20 Alkyl, C 5-20 is independently selected from the group consisting of alkenyl, -R”MR’, -R*YR”, -YR”, and -R*OR”; R X1 and R X2 are each independently H or C 1-3 alkyl; Each M is independently selected from the group consisting of -C(O)O-, -OC(O)-, -OC(O)O-, -C(O)N(R’)-, -N(R’)C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR’)O-, -S(O)2-, -C(O)S-, -SC(O)-, aryl group, and heteroaryl group; M* is C1-C6 alkyl, W 1 and W 2 are each independently selected from the group consisting of -O- and -N(R6)-; Each R6 is independently selected from the group consisting of H and C 1-5 alkyl; X 1 、X 2 、and X 3 is a bond, -CH2-, -(CH2)2-, -CHR-, -CHY-, -C(O)-, -C(O)O-, -OC(O)-, -(CH2) n -C(O)-, -C(O)-(CH2) n -, -(CH2) n -C(O)O-, -OC(O)-(CH2) n -, -(CH2) n -OC(O)-, -C(O)O-(CH2) n -, -CH(OH)-, -C(S)-, and -CH(SH)-; Each Y is independently a C 3-6 carbocyclic ring; Each R* is independently selected from the group consisting of C 1-12 alkyl and C 2-12 alkenyl; Each R is independently selected from the group consisting of C 1-3 alkyl and C 3-6 carbocyclic ring; Each R’ is independently selected from the group consisting of C 1-12 alkyl, C 2-12 alkenyl, and H; Each R” is independently selected from the group consisting of C 3-12 alkyl, C 3-12 alkenyl, and -R*MR’; and n is an integer from 1 to 6; When ring A is

Chemical formula

[0139] In some embodiments, the compound is any of formulas (IL-IIIa1)-(IL-IIIa8):

Chemical formula

[0140] In some embodiments, the ionizable lipid is one or more of the compounds described in U.S. Application Nos. 62 / 271,146, 62 / 338,474, 62 / 413,345, and 62 / 519,826, and PCT Application No. PCT / US2016 / 068300.

[0141] In some embodiments, the ionizable lipid is selected from Compounds 1-156 described in U.S. Application No. 62 / 519,826.

[0142] In some embodiments, the ionizable lipid is selected from Compounds 1-16, 42-66, 68-76, and 78-156 described in U.S. Application No. 62 / 519,826.

[0143] In some embodiments, the ionizable lipid is

Chemical formula

[0144] The central amine moiety of the lipid according to formula (IL-1), (IL-IA), (IL-IB), (IL-II), (IL-IIa), (IL-IIb), (IL-IIc), (IL-IId), (IL-IIe), (IL-IIf), (IL-IIg), (IL-III), (IL-IIIa1), (IL-IIIa2), (IL-IIIa3), (IL-IIIa4), (IL-IIIa5), (IL-IIIa6), (IL-IIIa7), or (IL-IIIa8) may be protonated at physiological pH. Thus, the lipid may have a positive or partially positive charge at physiological pH. Such lipids may be referred to as cationic or ionizable (amino) lipids. The lipid may be an amphiphile, i.e., a neutral molecule having both a positive and a negative charge.

[0145] In some embodiments, the ionizable lipid is selected from the group consisting of 3-(didodecylamino)-N1,N1,4-tridodecyl-1-piperazineethanamine (KL10), N1-[2-(didodecylamino)ethyl]-N1,N4,N4-tridodecyl-1,4-piperazinediethanamine (KL22), 14,25-ditridecyl-15,18,21,24-tetraaza-octatriacontane (KL25), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLin-DMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), heptatriaconta-6,9,28,31-tetraene-19-yl 4-(dimethylamino)butanoate (DLin-MC3-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), 1,2-dioleyloxy-N,N-dimethylaminopropane (DODMA), 2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propane-1-amine (Octyl-CLinDMA), (2R)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propane-1-amine (Octyl-CLinDMA(2R)), and (2S)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propane-1-amine (Octyl-CLinDMA(2S)).

[0146] Polyethylene glycol (PEG) lipid As used herein, the term "PEG lipid" refers to a polyethylene glycol (PEG)-modified lipid. Non-limiting examples of PEG lipids include PEG-modified phosphatidylethanolamine and phosphatidic acid, PEG-ceramide conjugates (e.g., PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamines, and PEG-modified 1,2-diacyl-oxypropane-3-amine. Such lipids are also referred to as PEGylated lipids. In some embodiments, the PEG lipid can be a PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or PEG-DSPE lipid.

[0147] In some embodiments, PEG lipids include, but are not limited to, 1,2-dimyristoyl-sn-glycerol methoxypolyethylene glycol (PEG-DMG), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)] (PEG-DSPE), PEG-distearyl glycerol (PEG-DSG), PEG-dipalmitoleyl, PEG-dioleyl, PEG-distearyl, PEG-diacylglycamide (PEG-DAG), PEG-dipalmitoyl phosphatidylethanolamine (PEG-DPPE), or PEG-1,2-dimyristyloxylpropyl-3-amine (PEG-c-DMA).

[0148] In one embodiment, the PEG lipid is selected from the group consisting of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and mixtures thereof.

[0149] In some embodiments, the lipid moiety of the PEG lipid has from about C 14 ~ about C 22 , preferably from about C 14 ~ about C 16Those having a length are included. In some embodiments, the PEG moiety, such as mPEG-NH2, has a size of about 1000, 2000, 5000, 10,000, 15,000, or 20,000 daltons. In one embodiment, the PEG lipid is PEG 2k -DMG.

[0150] In one embodiment, the lipid nanoparticles described herein can include a PEG lipid that is non-diffusible PEG. Non-limiting examples of non-diffusible PEG include PEG-DSG and PEG-DSPE.

[0151] PEG lipids are known in the art, such as those described in U.S. Patent No. 8158601 and International Publication WO2015 / 130584 A2, which are hereby incorporated by reference in their entirety.

[0152] Generally, some of the other lipid components of the various formulas described herein (e.g., PEG lipids) can be synthesized as described in International Patent Application PCT / US2016 / 000129 entitled "Compositions and Methods for Delivery of Therapeutic Agents" filed on December 10, 2016, which is hereby incorporated by reference in its entirety.

[0153] The lipid component of the lipid nanoparticle composition may contain one or more molecules including polyethylene glycol such as PEG or PEG-modified lipid. Such species may alternatively be referred to as PEGylated lipids. A PEG lipid is a lipid modified with polyethylene glycol. PEG lipids can be selected from the non-limiting group including PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and mixtures thereof. In some embodiments, the PEG lipid can be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or PEG-DSPE lipid.

[0154] In one embodiment, the PEG lipid useful in the present invention can be the PEGylated lipid described in International Publication WO2012099755, the content of which is incorporated herein by reference in its entirety. Any of these exemplary PEG lipids described herein can be modified to include a hydroxyl group on the PEG chain. In some embodiments, the PEG lipid is a PEG-OH lipid. As generally defined herein, a "PEG-OH lipid" (also referred to herein as a "hydroxy-PEGylated lipid") is a PEGylated lipid having one or more hydroxyl (-OH) groups on the lipid. In some embodiments, the PEG-OH lipid contains one or more hydroxyl groups in the PEG chain. In some embodiments, the PEG-OH or hydroxy-PEGylated lipid contains an -OH group at the end of the PEG chain. Each possibility represents a separate embodiment of the present invention.

[0155] In some embodiments, the PEG lipid useful in the present invention is a compound of formula (PL-1). Provided herein is a compound of formula (PL-1):

Chemical formula

Chemical formula

[0156] In some embodiments, the compound of formula (PL-I) is a PEG-OH lipid (i.e., R 3 is -OR O and R O is hydrogen). In some embodiments, the compound of formula (PL-I) is of formula (PL-I-OH):

Chemical formula

[0157] In some embodiments, the PEG lipid useful in the present invention is a PEGylated fatty acid. In some embodiments, the PEG lipid useful in the present invention is a compound of formula (PL-II). Provided herein is a compound of formula (PL-II):

Chemical formula

[0158] In some embodiments, the compound of formula (PL-II) is of formula (PL-II-OH): [Chemical formula] or a salt thereof, wherein: r is an integer from 1 to 100; R 5 is optionally substituted C 10-40 alkyl, optionally substituted C 10-40 alkenyl, or optionally substituted C 10-40 alkynyl; optionally, one or more methylene groups of R 5 are optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(R N ), O, S, C(O), C(O)N(R N ), -NR N C(O), NR N C(O)N(R N ), C(O)O, OC(O), OC(O)O, OC(O)N(R N ), NR N C(O)O, C(O)S, SC(O), C(=NR N ), C(=NR N )N(R N ), NR N C(=NR N ), NR N C(=NR N )N(R N ), C(S), C(S)N(R N ), NR N C(S), -NR N C(S)N(R N ), S(O), OS(O), S(O)O, OS(O)O, OS(O)2, S(O)2O, OS(O)2O, N(R N )S(O), -S(O)N(R N ), N(R N )S(O)N(R N ), OS(O)N(R N ), N(R N ), S(O)2, N(R N )S(O)2, S(O)2N(R N ), -N(R N)S(O)2N(R N )、OS(O)2N(R N )、 or N(R N )S(O)2O is replaced by; R N Each example of is, independently, hydrogen, optionally substituted alkyl, or a nitrogen protecting group.

[0159] In some embodiments, r is an integer from 10 to 80, 20 to 70, 30 to 60, or 40 to 50.

[0160] In some embodiments, r is 45.

[0161] In some embodiments, R 5 is C 17 alkyl.

[0162] In some embodiments, the compound of formula (PL-II) is:

Chemical formula

[0163] In some embodiments, the compound of formula (PL-II) is

Chemical formula

[0164] In some aspects, the lipid composition of the pharmaceutical composition described herein does not contain PEG lipid.

[0165] In some embodiments, the PEG lipid is any one of the PEG lipids described in U.S. Patent Application No. 62 / 520,530. In some embodiments, the PEG lipid is of formula (PL-III):

Chemical formula

[0166] In some embodiments, the PEG lipid has the following formula:

Chemical formula

[0167] In some embodiments, the modifier is a surfactant.

[0168] In some embodiments, the surfactant is an amphiphilic polymer.

[0169] For example, the amphiphilic polymer is a block copolymer.

[0170] For example, the amphiphilic polymer is a cryoprotectant.

[0171] For example, the amphiphilic polymer has a critical micelle concentration (CMC) of less than 2×10 -4 M in water at about 30°C and atmospheric pressure.

[0172] For example, the amphiphilic polymer has a critical micelle concentration (CMC) in the range of about 0.1×10 -4 M to about 1.3×10 -4 M in water at about 30°C and atmospheric pressure.

[0173] For example, in a formulation, for example, before freezing or lyophilization, the concentration of the amphiphilic polymer ranges from its CMC to about 30 times the CMC (e.g., up to about 25 times, about 20 times, about 15 times, about 10 times, about 5 times, or about 3 times its CMC).

[0174] For example, the amphiphilic polymer is selected from poloxamers (Pluronic®), poloxamines (Tetronic®), polyoxyethylene glycol sorbitan alkyl esters (polysorbates), and polyvinylpyrrolidone (PVP).

[0175] For example, the amphiphilic polymer is a poloxamer. For example, the amphiphilic polymer has the following structure:

Chemical formula

[0176] For example, the amphiphilic polymer is P124, P188, P237, P338, or P407.

[0177] For example, the amphiphilic polymer is P188 (for example, poloxamer 188, CAS number 9003-11-6, also known as Kolliphor P188).

[0178] For example, the amphiphilic polymer is a poloxamine, such as Tetronic 304 or Tetronic 904.

[0179] For example, the amphiphilic polymer is polyvinylpyrrolidone (PVP) such as PVP with a molecular weight of about 3 kDa, 10 kDa, or 29 kDa.

[0180] For example, the amphiphilic polymer is a polysorbate such as PS20.

[0181] In some embodiments, the surfactant is a non-ionic surfactant.

[0182] In some embodiments, the LNP modifier comprises a surfactant. In some embodiments, the surfactant is an amphiphilic polymer. In some embodiments, the surfactant is a nonionic surfactant.

[0183] For example, the nonionic surfactant is selected from the group consisting of polyethylene glycol ethers (Brij), poloxamers, polysorbates, sorbitans, and derivatives thereof.

[0184] For example, the polyethylene glycol ether has the formula (S-1): [Chemical formula] is a compound of or a salt or isomer thereof, wherein: t is an integer from 1 to 100; R 1BRIJ is independently C 10-40 alkyl, C 10-40 alkenyl, or C 10-40 alkynyl; optionally, one or more methylene groups of R 5PEG are C 3-10 carbocyclylene, 4- to 10-membered heterocyclylene, C 6-10 arylene, 4- to 10-membered heteroarylene, -N(R N )-, -O-, -S-, -C(O)-, -C(O)N(R N )-, -NR N C(O)-, -NR N C(O)N(R N )-, -C(O)O-, -OC(O)-, -OC(O)O-, -OC(O)N(R N )-, -NR N C(O)O-, -C(O)S-, -SC(O)-, -C(=NR N )-, -C(=NR N )N(R N )-, -NRNC(=NR N )-, -NR N C(=NR N )N(R N )-, -C(S)-, -C(S)N(R N )-, -NRN C(S)-, -NR N C(S)N(R N )-, -S(O)-, -OS(O)-, -S(O)O-, -OS(O)O-, -OS(O)2-, -S(O)2O-, -OS(O)2O-, -N(R N )S(O)-, -S(O)N(R N )-, -N(R N )S(O)N(R N )-, -OS(O)N(R N )-, -N(R N )S(O)O-, -S(O)2-, -N(R N )S(O)2-, -S(O)2N(R N )-, -N(R N )S(O)2N(R N )-, -OS(O)2N(R N )-, or -N(R N )S(O)2O- is independently replaced by; R N Each example of is, independently, hydrogen, C 1-6 alkyl, or a nitrogen protecting group.

[0185] In some embodiments, R 1BRIJ is C 18 alkyl. For example, polyethylene glycol ether is of the formula (S-1a):

Chemical formula

[0186] In some embodiments, R 1BRIJ is C 18 alkenyl. For example, polyethylene glycol ether is of the formula (S-1b):

Chemical formula

[0187] In some embodiments, the poloxamer is selected from the group consisting of poloxamer 101, poloxamer 105, poloxamer 108, poloxamer 122, poloxamer 123, poloxamer 124, poloxamer 181, poloxamer 182, poloxamer 183, poloxamer 184, poloxamer 185, poloxamer 188, poloxamer 212, poloxamer 215, poloxamer 217, poloxamer 231, poloxamer 234, poloxamer 235, poloxamer 237, poloxamer 238, poloxamer 282, poloxamer 284, poloxamer 288, poloxamer 304, poloxamer 331, poloxamer 333, poloxamer 334, poloxamer 335, poloxamer 338, poloxamer 401, poloxamer 402, poloxamer 403, and poloxamer 407.

[0188] In some embodiments, the surfactant is Tween® 20, Tween® 40, Tween® 60, or Tween® 80.

[0189] In some embodiments, the surfactant is Span® 20, Span® 40, Span® 60, Span® 65, Span® 80, or Span® 85.

[0190] In some embodiments, the surfactant is Brij® C10, Brij® S10, Brij® 58, Brij® S100, Brij® O10, Brij® O20, Brij® S20, Brij® 58, Brij® 93.

[0191] In some embodiments, the surfactant is PVP10k or PVP40k.

[0192] In some embodiments, the concentration of nonionic surfactant in the nucleic acid LNP composition ranges from about 0.00001% w / v to about 1% w / v, such as from about 0.00005% w / v to about 0.5% w / v, or from about 0.0001% w / v to about 0.1% w / v.

[0193] In some embodiments, the concentration of nonionic surfactant in the nucleic acid LNP formulation ranges from about 0.000001 wt% to about 1 wt%, such as from about 0.000002 wt% to about 0.8 wt%, or from about 0.000005 wt% to about 0.5 wt%.

[0194] In some embodiments, the concentration of PEG lipid in the nucleic acid LNP formulation ranges from about 0.01 mol% to about 50 mol%, such as from about 0.05 mol% to about 20 mol%, from about 0.07 mol% to about 10 mol%, from about 0.1 mol% to about 8 mol%, from about 0.2 mol% to about 5 mol%, or from about 0.25 mol% to about 3 mol%.

[0195] Structural lipid As used herein, the term "structural lipid" refers to a sterol and also refers to a lipid containing a sterol moiety.

[0196] The incorporation of structural lipids into lipid nanoparticles helps alleviate the aggregation of other lipids within the particles. The structural lipids can be selected from the group consisting of, but not limited to, cholesterol, fucosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatin, ursolic acid, alpha-tocopherol, hopanoids, phytosterols, steroids, and mixtures thereof. In some embodiments, the structural lipid is a mixture of two or more components each independently selected from cholesterol, fucosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatin, ursolic acid, alpha-tocopherol, hopanoids, phytosterols, and steroids. In some embodiments, the structural lipid is a sterol. In some embodiments, the structural lipid is a mixture of two or more sterols. As defined herein, a "sterol" is a subgroup of steroids consisting of steroid alcohols. In some embodiments, the structural lipid is a steroid. In some embodiments, the structural lipid is cholesterol. In some embodiments, the structural lipid is a cholesterol analog. In some embodiments, the structural lipid is alpha-tocopherol.

[0197] In some embodiments, the structural lipid can be one or more structural lipids described in U.S. Patent Application No. 62 / 520,530.

[0198] Phospholipids Phospholipids may assemble into one or more lipid bilayers. Generally, phospholipids include a phospholipid moiety and one or more fatty acid moieties.

[0199] The phospholipid moiety can be selected from the non-limiting group consisting of, for example, phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylserine, phosphatidic acid, 2-lyso-phosphatidylcholine, and sphingomyelin.

[0200] The fatty acid moiety can be selected from the non-limiting group consisting of, for example, lauric acid, myristic acid, myristoleic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, erucic acid, phytic acid, arachidic acid, arachidonic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid, and docosahexaenoic acid.

[0201] Certain phospholipids can promote fusion to a membrane. In some embodiments, a cationic phospholipid can interact with one or more negatively charged phospholipids of a membrane (e.g., a cell membrane or an intracellular membrane). Fusion of the phospholipid to the membrane enables one or more elements of a lipid-containing composition (e.g., an LNP), such as a therapeutic agent, to pass through the membrane, for example, enabling delivery of the one or more elements to a target tissue.

[0202] Non-natural phospholipid species are also envisioned, including natural species with modifications and substitutions involving branching, oxidation, cyclization, and alkynes. In some embodiments, the phospholipid can be functionalized or cross-linked with one or more alkynes (e.g., an alkenyl group in which one or more double bonds are replaced with triple bonds). Under appropriate reaction conditions, the alkyne group can undergo copper-catalyzed cycloaddition upon exposure to an azide. Such reactions are useful for functionalizing the lipid bilayer of a nanoparticle composition to promote membrane permeation or cell recognition, or for conjugating the nanoparticle composition to useful components such as targeting or imaging moieties (e.g., dyes).

[0203] Phospholipids include, but are not limited to, glycerophospholipids such as phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidylglycerol, and phosphatidic acid. Phospholipids also include sphingoglycolipids such as sphingomyelin.

[0204] In some embodiments, phospholipids useful or potentially useful in the present invention are analogs or variants of DSPC. In some embodiments, phospholipids useful or potentially useful in the present invention are of formula (PL-I):

Chemical formula

Chemical formula

Chemical formula

[0205] In some embodiments, the phospholipid can be one or more of the phospholipids described in U.S. Patent Application No. 62 / 520,530.

[0206] In some embodiments, the phospholipid can be selected from the non-limiting group consisting of 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-didecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesteryl hemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), and sphingomyelin. In some embodiments, the LNP contains DSPC. In some embodiments, the LNP contains DOPE. In some embodiments, the LNP contains both DSPC and DOPE.

[0207] i) Modification of the phospholipid head In some embodiments, phospholipids useful or potentially useful in the present invention include a modified phospholipid head (e.g., a modified choline group). In some embodiments, the phospholipid having a modified head is DSPC or an analog thereof having a modified quaternary amine. In some embodiments, in the embodiments of formula (PL-I), R 1 at least one of which is not methyl. In some embodiments, at least one of R 1 is neither hydrogen nor methyl. In some embodiments, the compound of formula (PL-I) is of the following formula:

Chemical formula

Chemical formula

[0208] In some embodiments, phospholipids useful or potentially useful in the present invention include a cyclic moiety instead of a glyceride moiety. In some embodiments, the phospholipids useful in the present invention are DSPC or an analog thereof having a cyclic moiety instead of a glyceride moiety. In some embodiments, the compound of formula (PL-I) is of formula (PL-I-b):

Chemical formula

[0209] ii) Modification of the phospholipid tail In some embodiments, phospholipids useful or potentially useful in the present invention include modified tails. In some embodiments, phospholipids useful or potentially useful in the present invention are DSPC or analogs thereof having modified tails. As described herein, a "modified tail" can be a shorter or longer aliphatic chain, an aliphatic chain with an introduced branch, an aliphatic chain with an introduced substituent, an aliphatic chain in which one or more methylenes are substituted with a cyclic or heteroatomic group, or any combination thereof. In some embodiments, in some embodiments, the compound of (PL-I) is of formula (PL-I-a) or a salt thereof, wherein R 2 At least one example of 1-30 is optionally substituted C 2 Each example of R 2 One or more of the methylene units of is optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, -N(R N )-, -O-, -S-, -C(O)-, -C(O)N(R N )-, -NR N C(O)-, -NR N C(O)N(R N )-, -C(O)O-, -OC(O)-, -OC(O)O-, -OC(O)N(R N )-, -NR N C(O)O-, -C(O)S-, -SC(O)-, -C(=NR N )-, -C(=NR N )N(R N )-, -NR N C(=NR N )-, -NR N C(=NR N )N(R N )-, -C(S)-, -C(S)N(R N )-, -NR N C(S)-, -NR N C(S)N(R N)-, -S(O)-, -OS(O)-, -S(O)O-, -OS(O)O-, -OS(O)2-, -S(O)2O-, -OS(O)2O-, -N(R N )S(O)-, -S(O)N(R N )-, -N(R N )S(O)N(R N )-, -OS(O)N(R N )-, -N(R N )S(O)O-, -S(O)2-, -N(R N )S(O)2-, -S(O)2N(R N )-, -N(R N )S(O)2N(R N )-, -OS(O)2N(R N )-, or -N(R N ) is independently replaced by S(O)2O.

[0210] In some embodiments, the compound of formula (PL-I) is of formula (PL-I-c): [Chemical formula] or a salt thereof, wherein: each x is independently an integer from 0 to 30, inclusive at both ends; each instance is optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, -N(R N )-, -O-, -S-, -C(O)-, -C(O)N(R N )-, -NR N C(O)-, -NR N C(O)N(R N )-, -C(O)O-, -OC(O)-, -OC(O)O-, -OC(O)N(R N )-, -NR N C(O)O-, -C(O)S-, -SC(O)-, -C(=NR N )-, -C(=NR N )N(R N )-, -NR N C(=NR N )-, -NRN C(=NR N )N(R N )-, -C(S)-, -C(S)N(R N )-, -NR N C(S)-, -NR N C(S)N(R N )-, -S(O)-, -OS(O)-, -S(O)O-, -OS(O)O-, -OS(O)2-, -S(O)2O-, -OS(O)2O-, -N(R N )S(O)-, -S(O)N(R N )-, -N(R N )S(O)N(R N )-, -OS(O)N(R N )-, -N(R N )S(O)O-, -S(O)2-, -N(R N )S(O)2-, -S(O)2N(R N )-, -N(R N )S(O)2N(R N )-, -OS(O)2N(R N )-, or -N(R N )S(O)2O-, and is G independently selected from the group consisting of. Each possibility represents a separate embodiment of the present invention.

[0211] In some embodiments, phospholipids useful or potentially useful in the present invention include a modified phosphocholine moiety, and the alkyl chain linking the quaternary amine to the phosphoryl group is not ethylene (e.g., n is not 2). Thus, in some embodiments, phospholipids useful or potentially useful in the present invention are compounds of formula (PL-I), wherein n is 1, 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, the compound of formula (PL-I) is one of the following formulas:

Chemical formula

[0212] Alternative lipids In some embodiments, alternative lipids are used in place of the phospholipids of the present disclosure. Non-limiting examples of such alternative lipids include the following: [Chemical formula] are included.

[0213] Adjuvant In some embodiments, the LNPs comprising one or more of the lipids described herein may further comprise one or more adjuvants, such as glucopyranosyl lipid adjuvant (GLA), CpG oligodeoxynucleotides (e.g., class A or B), poly(I:C), aluminum hydroxide, and Pam3CSK4.

[0214] Therapeutic agent The lipid nanoparticles may comprise one or more therapeutic and / or prophylactic agents such as nucleic acids. The present disclosure is a method for delivering a therapeutic and / or prophylactic agent such as a nucleic acid to mammalian cells or organs, producing a polypeptide of interest in mammalian cells, and treating a disease or disorder of a mammalian subject in need thereof, comprising administering to the mammalian subject and / or contacting a mammalian cell an LNP comprising a therapeutic and / or prophylactic agent such as a nucleic acid.

[0215] Therapeutic and / or prophylactic agents include biologically active substances, alternatively also referred to as "active agents". A therapeutic and / or prophylactic agent can be a substance that, when delivered to a cell or organ, brings about a desirable change in the cell, organ, or other body tissue or system. Such species can be useful for the treatment of one or more diseases, disorders, or conditions. In some embodiments, the therapeutic and / or prophylactic agent is a small molecule drug useful for the treatment of a particular disease, disorder, or condition. Examples of drugs useful in lipid nanoparticles include anti-cancer drugs (e.g., vincristine, doxorubicin, mitoxantrone, camptothecin, cisplatin, bleomycin, cyclophosphamide, methotrexate, and streptozotocin), anti-tumor drugs (e.g., actinomycin D, vincristine, vinblastine, cytosine arabinoside, anthracyclines, alkylating agents, platinum compounds, antimetabolites, and nucleoside analogs such as methotrexate and purine and pyrimidine analogs), anti-infective drugs, local anesthetics (e.g., dibucaine and chlorpromazine), beta-adrenergic blockers (e.g., propranolol, timolol, and labetalol), antihypertensive agents (e.g., clonidine and hydralazine), antidepressants (e.g., imipramine, amitriptyline, and doxepin), anti-convulsants (e.g., phenytoin), antihistamines (e.g., diphenhydramine, chlorpheniramine, and promethazine), antibiotics / antimicrobial agents (e.g., gentamicin, ciprofloxacin, and cefoxitin), antifungal agents (miconazole, terconazole, econazole, isoconazole, butaconazole, clotrimazole, itraconazole, nystatin, naftifine, and amphotericin B), anthelmintics, hormones, hormone antagonists, immunomodulators, neurotransmitter antagonists, glaucoma therapeutics, vitamins, anesthetics, and contrast agents, but are not limited thereto.

[0216] In some embodiments, the therapeutic and / or prophylactic agent is a cytotoxin, a radioactive ion, a chemotherapeutic agent, a vaccine, a compound that induces an immune response, and / or another therapeutic and / or prophylactic agent. Cytotoxins or cytotoxic agents include any agent that can be harmful to cells. Examples include, but are not limited to, taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, teniposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxyanthracinedione, mitoxantrone, mitramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, puromycin, maytansinoids, such as maytansinol, razoxane (CC-1065), and their analogs or homologs. Radioactive ions include, but are not limited to, iodine (e.g., iodine 125 or iodine 131), strontium 89, phosphorus, palladium, cesium, iridium, phosphate, cobalt, yttrium 90, samarium 153, and praseodymium. Vaccines include compounds and formulations that can provide immunity against one or more conditions associated with infectious diseases such as influenza, measles, human papillomavirus (HPV), rabies, meningitis, whooping cough, tetanus, plague, hepatitis, and tuberculosis, and may include mRNA encoding antigens and / or epitopes derived from the infectious disease. Vaccines also include compounds and formulations that induce an immune response against cancer cells and may include mRNA encoding antigens, epitopes, and / or neoepitopes derived from tumor cells. Compounds that induce an immune response include, but are not limited to, vaccines, corticosteroids (e.g., dexamethasone), and other species.

[0217] In other embodiments, the therapeutic and / or prophylactic agent is a protein. Therapeutic proteins useful in the nanoparticles of the present disclosure include, but are not limited to, gentamicin, amikacin, insulin, erythropoietin (EPO), granulocyte colony-stimulating factor (G-CSF), granulocyte macrophage colony-stimulating factor (GM-CSF), factor VIR, luteinizing hormone-releasing hormone (LHRH) analogs, interferon, heparin, hepatitis B surface antigen, typhoid vaccine, cholera vaccine. In some embodiments, the vaccine and / or compound capable of inducing an immune response is administered intramuscularly via a composition comprising a compound according to formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId), or (IIe) (e.g., compound 3, 18, 20, 26, or 29). Other therapeutic and / or prophylactic agents include, but are not limited to, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating agents (e.g., mechlorethamine, thiotepa chlorambucil, rachelmycin (CC-1065), melphalan, carmustine (BSNU), lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, mitomycin, and anthramycin (AMC)), and mitotic inhibitors (e.g., vincristine, vinblastine, taxol, and mithramycinoids).

[0218] Polynucleotides and Nucleic Acids In some embodiments, the therapeutic agent is a polynucleotide or nucleic acid (e.g., ribonucleic acid or deoxyribonucleic acid). The term "polynucleotide" in its broadest sense includes any compound and / or substance that is incorporated into or can be incorporated into an oligonucleotide chain. Exemplary polynucleotides for use in accordance with the present disclosure include deoxyribonucleic acid (DNA), ribonucleic acid (RNA) including messenger RNA (mRNA), hybrids thereof, RNAi inducers, RNAi agents, siRNA, shRNA, miRNA, antisense RNA, ribozymes, catalytic DNA, RNA that induces triple helix formation, aptamers, vectors, and the like, but are not limited thereto. In some embodiments, the therapeutic and / or prophylactic agent is RNA. RNAs useful in the compositions and methods described herein can be selected from the group consisting of shortmers, antagomers, antisense, ribozymes, small interfering RNAs (siRNAs), asymmetric interfering RNAs (aiRNAs), microRNAs (miRNAs), dicer substrate RNAs (dsRNAs), small hairpin RNAs (shRNAs), transfer RNAs (tRNAs), messenger RNAs (mRNAs), and mixtures thereof, but are not limited thereto. In some embodiments, the RNA is mRNA.

[0219] In some embodiments, the therapeutic and / or prophylactic agent is mRNA. The mRNA may encode a polypeptide of interest, including any naturally occurring or non-naturally occurring, or otherwise modified polypeptide. The polypeptide encoded by the mRNA can be of any size and can have any secondary structure or activity. In some embodiments, the polypeptide encoded by the mRNA can exhibit a therapeutic effect when expressed intracellularly.

[0220] In other embodiments, the therapeutic and / or prophylactic agent is siRNA. The siRNA may be one that can selectively knockdown or downregulate the expression of a gene of interest. For example, the siRNA may be selected to silence a gene associated with a particular disease, disorder, or condition upon administration of an LNP containing the siRNA to a subject in need thereof. The siRNA may include a sequence complementary to the mRNA sequence encoding the gene or protein of interest. In some embodiments, the siRNA may be an immunomodulatory siRNA.

[0221] In some embodiments, the therapeutic and / or prophylactic agent is shRNA or a vector or plasmid encoding the same. Appropriate delivery of the construct to the nucleus can result in the production of shRNA within the target cell. The constructs and mechanisms associated with shRNA are well known in the relevant art.

[0222] Nucleic acids and polynucleotides useful in the present disclosure typically include a first region of linked nucleosides encoding a polypeptide of interest (e.g., a coding region), a first adjacent region located at the 5' end of the first region (e.g., 5'-UTR), a second adjacent region located at the 3' end of the first region (e.g., 3'-UTR), at least one 5' cap region, and a 3' stabilization region. In some embodiments, the nucleic acid or polynucleotide further includes a polyA region or a Kozak sequence (e.g., within the 5'-UTR). Optionally, the polynucleotide may include one or more intron nucleotide sequences that can be excised from the polynucleotide. In some embodiments, the polynucleotide or nucleic acid (e.g., mRNA) may include a 5' cap structure, a chain-terminating nucleotide, a stem-loop, a polyA sequence, and / or a polyadenylation signal. Any one of the regions of the nucleic acid may include one or more alternative components (e.g., alternative nucleosides). For example, the 3' stabilization region may include alternative nucleosides such as L-nucleosides, reverse thymidine, or 2'-O-methyl nucleosides, and / or the coding region, 5'-UTR, 3'-UTR, or cap region may include alternative nucleosides such as 5-substituted uridine (e.g., 5-methoxyuridine), 1-substituted pseudouridine (e.g., 1-methyl-pseudouridine), and / or 5-substituted cytidine (e.g., 5-methyl-cytidine).

[0223] Generally, the shortest length of a polynucleotide can be the length of a polynucleotide sequence sufficient to encode a dipeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode a tripeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode a tetrapeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode a pentapeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode a hexapeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode a heptapeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode an octapeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode a nonapeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode a decapeptide.

[0224] Examples of dipeptides that can be encoded by alternative polynucleotide sequences include, but are not limited to, carnosine and anserine.

[0225] In some cases, the polynucleotide is longer than 30 nucleotides. In another embodiment, the polynucleotide molecule is longer than 35 nucleotides. In another embodiment, the length is at least 40 nucleotides. In another embodiment, the length is at least 45 nucleotides. In another embodiment, the length is at least 50 nucleotides. In another embodiment, the length is at least 55 nucleotides. In another embodiment, the length is at least 60 nucleotides. In another embodiment, the length is at least 80 nucleotides. In another embodiment, the length is at least 90 nucleotides. In another embodiment, the length is at least 100 nucleotides. In another embodiment, the length is at least 120 nucleotides. In another embodiment, the length is at least 140 nucleotides. In another embodiment, the length is at least 160 nucleotides. In another embodiment, the length is at least 180 nucleotides. In another embodiment, the length is at least 200 nucleotides. In another embodiment, the length is at least 250 nucleotides. In another embodiment, the length is at least 300 nucleotides. In another embodiment, the length is at least 350 nucleotides. In another embodiment, the length is at least 400 nucleotides. In another embodiment, the length is at least 450 nucleotides. In another embodiment, the length is at least 500 nucleotides. In another embodiment, the length is at least 600 nucleotides. In another embodiment, the length is at least 700 nucleotides. In another embodiment, the length is at least 800 nucleotides. In another embodiment, the length is at least 900 nucleotides. In another embodiment, the length is at least 1000 nucleotides. In another embodiment, the length is at least 1100 nucleotides. In another embodiment, the length is at least 1200 nucleotides. In another embodiment, the length is at least 1300 nucleotides. In another embodiment, the length is at least 1400 nucleotides. In another embodiment, the length is at least 1500 nucleotides.In another embodiment, the length is at least 1600 nucleotides. In another embodiment, the length is at least 1800 nucleotides. In another embodiment, the length is at least 2000 nucleotides. In another embodiment, the length is at least 2500 nucleotides. In another embodiment, the length is at least 3000 nucleotides. In another embodiment, the length is at least 4000 nucleotides. In another embodiment, the length is at least 5000 nucleotides or more than 5000 nucleotides.

[0226] Nucleic acids and polynucleotides can include one or more naturally occurring components including standard nucleotides, any of A (adenosine), G (guanosine), C (cytosine), U (uridine), or T (thymidine). In some embodiments, all or substantially all of the nucleotides comprising (a) a 5'-UTR, (b) an open reading frame (ORF), (c) a 3'-UTR, (d) a polyA tail, and any combination of (a, b, c, or d above) include naturally occurring standard nucleotides, A (adenosine), G (guanosine), C (cytosine), U (uridine), or T (thymidine).

[0227] Nucleic acids and polynucleotides may include one or more alternative components described herein that confer useful properties including increased stability and / or substantial lack of induction of the innate immune response of the cells into which the polynucleotide is introduced. For example, an alternative polynucleotide or nucleic acid exhibits reduced degradation in the cells into which the polynucleotide or nucleic acid is introduced as compared to the corresponding unmodified polynucleotide or nucleic acid. These alternative species can enhance protein production efficiency, intracellular retention of the polynucleotide, and / or survival rate of contacted cells and reduce immunogenicity.

[0228] Polynucleotides and nucleic acids can be either naturally occurring or non-naturally occurring. Polynucleotides and nucleic acids may contain one or more modified (e.g., altered or substituted) nucleobases, nucleosides, nucleotides, or combinations thereof. Nucleic acids and polynucleotides useful for LNPs can include any useful modification or alteration to nucleobases, sugars, or internucleoside linkages (e.g., phosphate linkages, phosphodiester linkages, to the phosphodiester backbone). In some embodiments, alterations (e.g., one or more alterations) are present in each of the nucleobases, sugars, and internucleoside linkages. Alterations according to the present disclosure may be alterations of ribonucleic acid (RNA) to deoxyribonucleic acid (DNA), e.g., 2'-H of the 2'-OH of the ribofuranosyl ring, substitution to threose nucleic acid (TNA), glycol nucleic acid (GNA), peptide nucleic acid (PNA), locked nucleic acid (LNA), or hybrids thereof. Further alterations are described herein.

[0229] Polynucleotides and nucleic acids may or may not be uniformly altered along the entire length of the molecule. For example, one or more or all types of nucleotides (e.g., purines or pyrimidines, or one or more or all of A, G, U, C) may or may not be uniformly altered in the polynucleotide or nucleic acid, or in a given sequence region thereof. In some cases, all nucleotides X of a polynucleotide (or a given sequence region thereof) are altered, where X may be any one of the nucleotides A, G, U, C, or any one of the combinations A+G, A+U, A+C, G+U, G+C, U+C, A+G+U, A+G+C, G+U+C, or A+G+U+C.

[0230] At various positions of the polynucleotide, there may be modifications of different sugars and / or internucleoside linkages (e.g., backbone structure). One of ordinary skill in the art will understand that nucleotide analogs or other modifications (s) may be located at any position (s) of the polynucleotide such that the function of the polynucleotide is not substantially reduced. The modification may be a modification at the 5' or 3' end. In some embodiments, the polynucleotide includes a modification at the 3' end. The polynucleotide may contain from about 1% to about 100% (with respect to the total nucleotide content, or with respect to one or more types of nucleotides, i.e., one or more of A, G, U, or C), or intervening percentages (e.g., 1% - 20%, 1% - 25%, 1% - 50%, 1% - 60%, 1% - 70%, 1% - 80%, 1% - 90%, 1% - 95%, 10% - 20%, 10% - 25%, 10% - 50%, 10% - 60%, 10% - 70%, 10% - 80%, 10% - 90%, 10% - 95%, 10% - 100%, 20% - 25%, 20% - 50%, 20% - 60%, 20% - 70%, 20% - 80%, 20% - 90%, 20% - 95%, 20% - 100%, 50% - 60%, 50% - 70%, 50% - 80%, 50% - 90%, 50% - 95%, 50% - 100%, 70% - 80%, 70% - 90%, 70% - 95%, 70% - 100%, 80% - 90%, 80% - 95%, 80% - 100%, 90% - 95%, 90% - 100%, and 95% - 100%) of alternative nucleotides. It will be understood that any remaining percentage is accounted for by the presence of standard nucleotides (such as A, G, U, or C).

[0231] The polynucleotide may contain alternative nucleotides in any intervening percentage, such as from a minimum of zero to a maximum of 100%, or at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, or at least 90% alternative nucleotides. For example, the polynucleotide may contain alternative pyrimidines such as alternative uracil or cytosine. In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90% or 100% of the uracil in the polynucleotide is replaced with alternative uracil (e.g., 5-substituted uracil). The alternative uracil can be replaced with a compound having a single unique structure or can be replaced with a plurality of compounds having different structures (e.g., 2, 3, 4, or more unique structures). In some cases, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90% or 100% of the cytosine in the polynucleotide is replaced with alternative cytosine (e.g., 5-substituted cytosine). The alternative cytosine can be replaced with a compound having a single unique structure or can be replaced with a plurality of compounds having different structures (e.g., 2, 3, 4, or more unique structures).

[0232] In some cases, the nucleic acid does not substantially induce the innate immune response of the cells into which the polynucleotide (e.g., mRNA) is introduced. The characteristics of the induced innate immune response include 1) increased expression of inflammatory cytokines, 2) activation of intracellular PRRs (such as RIG-I, MDA5, etc.), and / or 3) arrest or decrease of protein translation.

[0233] The nucleic acid can optionally include other agents (e.g., RNAi inducers, RNAi agents, siRNA, shRNA, miRNA, antisense RNA, ribozymes, catalytic DNA, tRNA, RNAs that induce triple helix formation, aptamers, vectors). In some embodiments, the nucleic acid may include one or more messenger RNAs (mRNAs) having one or more alternative nucleosides or nucleotides (i.e., alternative mRNA molecules).

[0234] In some embodiments, the nucleic acid (e.g., mRNA) molecule, formulation, composition, or related methods thereof include one or more polynucleotides comprising features described in WO2002 / 098443, WO2003 / 051401, WO2008 / 052770, WO2009127230, WO2006122828, WO2008 / 083949, WO2010088927, WO2010 / 037539, WO2004 / 004743, WO2005 / 016376, WO2006 / 024518, WO2007 / 095976, WO2008 / 014979, WO2008 / 077592, WO2009 / 030481, WO2009 / 095226, WO2011069586, WO2011026641, WO2011 / 144358, WO2012019780, WO2012013326, WO2012089338, WO2012113513, WO2012116811, WO2012116810, WO2013113502, WO2013113501, WO2013113736, WO2013143698, WO2013143699, WO2013143700, WO2013 / 120626, WO2013120627, WO2013120628, WO2013120629, WO2013174409, WO2014127917, WO2015 / 024669, WO2015 / 024668, WO2015 / 024667, WO2015 / 024665, WO2015 / 024666, WO2015 / 024664, WO2015101415, WO2015101414, WO2015024667, WO2015062738, WO2015101416, all of which are incorporated herein by reference.

[0235] Nucleotide base analogs Alternative nucleosides and nucleotides can contain alternative nucleotide bases. The nucleotide bases of nucleic acids are organic bases such as purines or pyrimidines or their derivatives. Nucleotide bases can be standard bases (e.g., adenine, guanine, uracil, thymine, and cytosine). These nucleotide bases can be modified or completely replaced to provide polynucleotide molecules with enhanced properties, such as improved stability like nuclease resistance. Non-standard or modified bases may include one or more substitutions or modifications including, but not limited to, alkyl, aryl, halo, oxo, hydroxyl, alkyloxy, and / or thio substitution, one or more fusions or ring openings; oxidation; and / or reduction.

[0236] Alternative nucleotide base pairing includes not only the standard adenine-thymine, adenine-uracil, or guanine-cytosine base pairs, but also base pairs formed between nucleotides containing non-standard or alternative bases and / or alternative nucleotides, such that hydrogen bonding is possible between non-standard and standard bases or between two complementary non-standard base structures by the arrangement of a hydrogen bond donor and a hydrogen bond acceptor. An example of such non-standard base pairing is the base pairing between inosine of an alternative nucleotide and adenine, cytosine, or uracil.

[0237] In some embodiments, the nucleotide base is an alternative uracil. Exemplary nucleotide bases and nucleosides having alternative uracil include pseudouridine (ψ), pyridin-4-one ribonucleoside, 5-aza-uracil, 6-aza-uracil, 2-thio-5-aza-uracil, 2-thio-uracil (s 2 U), 4-thio-uracil (s 4 U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uracil (ho 5 U), 5-aminoallyl-uracil, 5-halo-uracil (e.g., 5-iodo-uracil or 5-bromo-uracil), 3-methyl-uracil (m 3U), 5-methoxy-uracil (mo 5 U), uracil 5-oxyacetic acid (cmo 5 U), methyl uracil 5-oxyacetate (mcmo 5 U), 5-carboxymethyl-uracil (cm 5 U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uracil (chm 5 U), methyl 5-carboxyhydroxymethyl-uracil (mchm 5 U), 5-methoxycarbonylmethyl-uracil (mcm 5 U), 5-methoxycarbonylmethyl-2-thio-uracil (mcm 5 s 2 U), 5-aminomethyl-2-thio-uracil (nm 5 s 2 U), 5-methylaminomethyl-uracil (mnm 5 U), 5-methylaminomethyl-2-thio-uracil (mnm 5 s 2 U), 5-methylaminomethyl-2-seleno-uracil (mnm 5 se 2 U), 5-carbamoylmethyl-uracil (ncm 5 U), 5-carboxymethylaminomethyl-uracil (cmnm 5 U), 5-carboxymethylaminomethyl-2-thio-uracil (cmnm 5 s 2 U), 5-propynyl-uracil, 1-propynyl-pseudouridine, 5-taurinomethyl-uracil (τm 5 U), 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uracil (τm 5 s 2 U), 1-taurinomethyl-4-thio-pseudouridine, 5-methyl-uracil (m 5 U, i.e., having the nucleobase deoxythymine), 1-methyl-pseudouridine (m 1 ψ), 5-methyl-2-thio-uracil (m 5 s 2 U), 1-methyl-4-thio-pseudouridine (m 1 s4 ψ), 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine (m 3 ψ), 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouracil (D), dihydropseudouridine, 5,6-dihydrouracil, 5-methyl-dihydrouracil (m 5 D), 2-thio-dihydrouracil, 2-thio-dihydropseudouridine, 2-methoxy-uracil, 2-methoxy-4-thio-uracil, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uracil (acp 3 U), 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine (acp 3 ψ), 5-(isopentenylaminomethyl)uracil (inm 5 U), 5-(isopentenylaminomethyl)-2-thio-uracil (inm 5 s 2 U), 5,2’-O-dimethyl-uridine (m 5 Um), 2-thio-2’-O-methyl-uridine (s 2 Um), 5-methoxycarbonylmethyl-2’-O-methyl-uridine (mcm 5 Um), 5-carbamoylmethyl-2’-O-methyl-uridine (ncm 5 Um), 5-carboxymethylaminomethyl-2’-O-methyl-uridine (cmnm 5 Um), 3,2’-O-dimethyl-uridine (m 3 Um), and 5-(isopentenylaminomethyl)-2’-O-methyl-uridine (inm 5Um), 1-thio-uracil, deoxythymidine, 5-(2-carbomethoxyvinyl)-uracil, 5-(carbamoyloxymethyl)-uracil, 5-carbamoylmethyl-2-thio-uracil, 5-carboxymethyl-2-thio-uracil, 5-cyanomethyl-uracil, 5-methoxy-2-thio-uracil, 5-[3-(1-E-propenylamino)]uracil are included, but not limited thereto.

[0238] In some embodiments, the nucleobase is an alternative cytosine. Exemplary nucleobases and nucleosides having alternative cytosine include, but are not limited to, 5-aza-cytosine, 6-aza-cytosine, pseudoisocytidine, 3-methyl-cytosine (m3C), N4-acetyl-cytosine (ac4C), 5-formyl-cytosine (f5C), N4-methyl-cytosine (m4C), 5-methyl-cytosine (m5C), 5-halocytosine (e.g., 5-iodocytosine), 5-hydroxymethyl-cytosine (hm5C), 1-methyl-pseudoisocytidine, pyrrolo-cytosine, pyrrolo-pseudoisocytidine, 2-thio-cytosine (s2C), 2-thio-5methyl-cytosine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytosine, 2-methoxy-5-methyl-cytosine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, lysidine (k2C), 5,2’-O-dimethylcytidine (m5Cm), N4-acetyl-2’-O-methyl-cytidine (ac4Cm), N4,2’-O-dimethyl-cytidine (m4Cm), 5-formyl-2’-O-methyl-cytidine (f5Cm), N4,N4,2’-O-trimethyl-cytidine (m42Cm), 1-thio-cytosine, 5-hydroxy-cytosine, 5-(3-azidopropyl)-cytosine, and 5-(2-azidoethyl)-cytosine.

[0239] In some embodiments, the nucleobase is an alternative adenine. Exemplary nucleobases and nucleosides having alternative adenine include, but are not limited to, 2-amino-purine, 2,6-diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6-chloro-purine), 2-amino-6-methyl-purine, 8-azido-adenine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6-diamino-purine, 7-deaza-8-aza-2,6-diamino-purine, 1-methyl-adenine (m1A), 2-methyl-adenine (m2A), N6-methyl-adenine (m6A), 2-methylthio-N6-methyl-adenine (ms2m6A), N6-isopentenyl-adenine (i6A), 2-methylthio-N6-isopentenyl-adenine (ms2i6A), N6-(cis-hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycinylcarbamoyl-adenine (g6A), N6-threonylcarbamoyl-adenine (t6A), N6-methyl-N6-threonylcarbamoyl-adenine (m6t6A), 2-methylthio-N6-threonylcarbamoyl-adenine (ms2g6A), N6,N6-dimethyl-adenine (m62A), N6-hydroxynorvalylcarbamoyl-adenine (hn6A), 2-methylthio-N6-hydroxynorvalylcarbamoyl-adenine (ms2hn6A), N6-acetyl-adenine (ac6A), 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, N6,2'-O-dimethyl-adenosine (m6Am), N6,N6,2'-O-trimethyl-adenosine (m62Am), 1,2'-O-dimethyl-adenosine (m1Am), 2-amino-N6-methyl-purine, 1-thio-adenine, 8-azido-adenine, N6-(19-amino-pentaoxanonadecyl)-adenine, 2,8-dimethyl-adenine, N6-formyl-adenine, and N6-hydroxymethyl-adenine.

[0240] In some embodiments, the nucleobase is an alternative guanine. Exemplary nucleobases and nucleosides having alternative guanine include, but are not limited to, inosine (I), 1-methyl-inosine (m1I), wyosine (imG), methylwyosine (mimG), 4-demethyl-wyosine (imG-14), isowyosine (imG2), wybutosine (yW), peroxwybutosine (o2yW), hydroxywybutosine (OHyW), hypomodified hydroxywybutosine (OHyW*), 7-deazaguanine, queuosine (Q), epoxyqueuosine (oQ), galactosyl-queuosine (galQ), mannosyl-queuosine (manQ), 7-cyano-7-deaza-guanine (preQ0), 7-aminomethyl-7-deaza-guanine (preQ1), archaeosine (G+), 7-deaza-8-aza-guanine, 6-thio-guanine, 6-thio-7-deaza-guanine, 6-thio-7-deaza-8-aza-guanine, 7-methylguanine (m7G), 6-thio-7-methyl-guanine, 7-methyl-inosine, 6-methoxy-guanine, 1-methyl-guanine (m1G), N2-methyl-guanine (m2G), N2,N2-dimethyl-guanine (m22G), N2,7-dimethyl-guanine (m2,7G), N2,N2,7-dimethyl-guanine (m2,2,7G), 8-oxo-guanine, 7-methyl-8-oxo-guanine, 1-methyl-6-thio-guanine, N2-methyl-6-thio-guanine, N2,N2-dimethyl-6-thio-guanine, N2-methyl-2'-O-methyl-guanosine (m2Gm), N2,N2-dimethyl-2'-O-methyl-guanosine (m22Gm), 1-methyl-2'-O-methyl-guanosine (m1Gm), N2,7-dimethyl-2'-O-methyl-guanosine (m2,7Gm), 2'-O-methyl-inosine (Im), 1,2'-O-dimethyl-inosine (m1Im), 1-thio-guanine, and O-6-methyl-guanine.

[0241] Alternative nucleobases of the nucleotide can independently be purines, pyrimidines, purine or pyrimidine analogs. For example, the nucleobase can be an alternative to adenine, cytosine, guanine, uracil, or hypoxanthine. In another embodiment, the nucleobase is, for example, pyrazolo[3,4-d]pyrimidine, 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo (e.g., 8-bromo, etc.), 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenines and guanines, 5-halo, especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azadenine, deazaguanine, 7-deazaguanine, 3-deazaguanine, deazaadenine, 7-deazaadenine, 3-deazaadenine, pyrazolo[3,4-d]pyrimidine, imidazo[1,5-a]1,3,5triazinone, 9-deazapurine, imidazo[4,5-d]pyrazine, thiazolo[4,5-d]pyrimidine, pyrazin-2-one, 1,2,4-triazine, pyridazine; or 1,3,5triazine, including but not limited to natural and synthetic derivatives of bases. When the nucleotide is represented using the abbreviations A, G, C, T, or U, each letter refers to the representative base and / or its derivative, for example, A includes adenine or an adenine analog, such as 7-deazaadenine).

[0242] Modifications in the sugar Nucleosides contain a sugar molecule (e.g., a five- or six-carbon sugar such as pentose, ribose, arabinose, xylose, glucose, galactose, or their deoxy derivatives) combined with a nucleobase, while nucleotides are nucleosides that contain a nucleoside and a phosphate group or alternative group (e.g., boranophosphate, thiophosphate, selenophosphate, phosphonate, alkyl group, amidate, and glycerol). A nucleoside or nucleotide may be a standard species, e.g., a nucleoside or nucleotide containing a phosphate group in the case of standard nucleobases, sugars, and nucleotides, or an alternative nucleoside or nucleotide containing one or more alternative components. For example, alternative nucleosides and nucleotides may be modified on the sugar of the nucleoside or nucleotide. In some embodiments, alternative nucleosides or nucleotides have the following structures:

Chemical Formula

[0243] In some embodiments, the 2'-hydroxy group (OH) can be modified or substituted with a number of different substituents. Exemplary substitutions at the 2' position include H, azide, halo (e.g., fluoro), optionally substituted C 1-6 alkyl (e.g., methyl), optionally substituted C 1-6 alkoxy (e.g., methoxy or ethoxy); optionally substituted C 6-10 aryloxy; optionally substituted C 3-8 cycloalkyl; optionally substituted C 6-10 aryl-C 1-6 alkoxy, optionally substituted C 1-12 (heterocyclyl)oxy; sugar (e.g., ribose, pentose, or any of those described herein); polyethylene glycol (PEG), -O(CH2CH2O) n CH2CH2OR, wherein R is H or optionally substituted alkyl, and n is an integer from 0 to 20 (e.g., 0 to 4, 0 to 8, 0 to 10, 0 to 16, 1 to 4, 1 to 8, 1 to 10, 1 to 16, 1 to 20, 2 to 4, 2 to 8, 2 to 10, 2 to 16, 2 to 20, 4 to 8, 4 to 10, 4 to 16, and 4 to 20); where the 2'-hydroxy is C 1-6 alkylene or C 1-6 a "locked" nucleic acid (LNA) connected to the 4'-carbon of the same ribose sugar by an alkylene or heteroalkylene bridge, where exemplary bridges include methylene, propylene, ether, or amino bridges; aminoalkyl as defined herein; aminoalkoxy as defined herein; amino as defined herein; and amino acids as defined herein, but are not limited thereto.

[0244] Generally, RNA contains the sugar ribose, a five-membered ring with oxygen. Exemplary non-limiting alternative nucleotides include replacement of the oxygen of ribose (e.g., with S, Se, or an alkylene such as methylene or ethylene); addition of a double bond (e.g., to replace ribose with cyclopentenyl or cyclohexenyl); ring contraction of ribose (e.g., to form a four-membered ring of cyclobutane or oxetane); ring expansion of ribose (e.g., to form a six- or seven-membered ring with additional carbon or heteroatoms such as anhydrohexitol, allitol, mannitol, cyclohexanyl, cyclohexenyl, and morpholino (which also has a phosphoramidate backbone)); polycyclic forms (e.g., tricyclic and “unlocked” forms such as glycol nucleic acid (GNA) and (e.g., R-GNA or S-GNA, where ribose is replaced with a glycol unit linked by a phosphodiester bond), threose nucleic acid (TNA, where ribose is replaced with α-L-threofuranosyl-(3’→2’))), as well as peptide nucleic acid (PNA, where the 2-amino-ethyl-glycine bond replaces the ribose and phosphodiester backbone)).

[0245] In some embodiments, the sugar group contains one or more carbons with a stereochemical configuration opposite to that of the corresponding carbon of ribose. Thus, the polynucleotide molecule can contain nucleotides that include, as the sugar, for example, arabinose or L-ribose.

[0246] In some embodiments, the polynucleotide contains at least one of a nucleoside where the sugar is L-ribose, 2’-O-methyl-ribose, 2’-fluoro-ribose, arabinose, hexitol, LNA, or PNA.

[0247] Modifications at internucleoside linkages Alternative nucleotides can be modified at the internucleoside linkage (e.g., the phosphate backbone). As used herein, in the context of the polynucleotide backbone, the terms "phosphate" and "phosphodiester" are used interchangeably. The backbone phosphate groups can be modified by replacing one or more oxygen atoms with different substituents.

[0248] Alternative nucleotides can, as described herein, include large-scale substitutions by another internucleoside linkage of the unmodified phosphate moiety. Examples of alternative phosphate groups include, but are not limited to, phosphorothioate, phosphorodithioate, phosphorodiamidate, boranophosphate, boranophosphate ester, hydrogen phosphonate, alkyl or aryl phosphonate, and phosphotriester. In phosphorodithioate, both non-bridging oxygens are replaced by sulfur. The phosphate linker can also be modified by replacing the bridging oxygen with nitrogen (bridging phosphoramidate), sulfur (bridging phosphorothioate), and carbon (bridging methylene phosphonate).

[0249] Alternative nucleosides and nucleotides can include replacing one or more of the non-bridging oxygens with a borane moiety (BH3), sulfur (thio), methyl, ethyl, and / or methoxy. As a non-limiting example, two non-bridging oxygens at the same position (e.g., the alpha (α), beta (β), or gamma (γ) position) can be replaced with sulfur (thio) and methoxy.

[0250] Replacement of one or more oxygen atoms at the position of the phosphate moiety (e.g., α-thiophosphate) is provided to confer stability (such as to exonucleases and endonucleases) to RNA and DNA via non-natural phosphorothioate backbone linkages. Phosphorothioate DNA and RNA have increased nuclease resistance and subsequently longer half-lives in the cellular environment.

[0251] Other internucleoside linkages that can be used in accordance with the present disclosure, including internucleoside linkages that do not contain a phosphorus atom, are described herein.

[0252] Internal ribosome entry site The polynucleotide may contain an internal ribosome entry site (IRES). The IRES may function as the sole ribosome binding site or as one of multiple ribosome binding sites of the mRNA. A polynucleotide containing two or more functional ribosome binding sites may encode several peptides or polypeptides that are translated independently by ribosomes (e.g., polycistronic mRNA). When an IRES is provided to the polynucleotide, a second translatable region is further provided if necessary. Examples of IRES sequences that can be used according to the present disclosure include those derived from picornavirus (e.g., FMDV), pestivirus (CFFV), poliovirus (PV), encephalomyocarditis virus (ECMV), foot-and-mouth disease virus (FMDV), hepatitis C virus (HCV), classical swine fever virus (CSFV), murine leukemia virus (MLV), simian immunodeficiency virus (SIV), or cricket paralysis virus (CrPV), but are not limited thereto.

[0253] 5’ cap structure The polynucleotide (e.g., mRNA) may contain a 5’ cap structure. The 5’ cap structure of the polynucleotide is involved in nuclear export and increased stability of the polynucleotide, and binds to the mRNA cap-binding protein (CBP) involved in the stability of the polynucleotide in the cell and the translation ability through the binding of the cap-binding protein (CBP) and the polyA-binding protein to form a mature circular mRNA species. The cap further aids in the removal of the 5’ proximal intron during mRNA splicing.

[0254] An endogenous polynucleotide molecule may be 5'-capped to generate a 5'-ppp-5'-triphosphate bond between the terminal guanosine cap residue and the 5'-terminal transcribed sense nucleotide of the polynucleotide. This 5'-guanylate cap can then be methylated to generate an N7-methyl-guanylate residue. The ribose sugars of the terminal and / or pre-terminal transcribed nucleotides at the 5'-end of the polynucleotide may optionally be 2'-O-methylated. 5'-decapping by hydrolysis and cleavage of the guanylate cap structure can target polynucleotide molecules such as mRNA molecules for degradation.

[0255] Modifications to the polynucleotide may generate a non-hydrolyzable cap structure that prevents decapping, thereby extending the half-life of the polynucleotide. Since hydrolysis of the cap structure requires cleavage of the 5'-ppp-5' phosphodiester bond, alternative nucleotides may be used during the capping reaction. For example, Vaccinia Capping Enzyme from New England Biolabs (Ipswich, MA) can be used with α-thio-guanosine nucleotides according to the manufacturer's instructions to create phosphorothioate bonds in the 5'-ppp-5' cap. Additional alternative guanosine nucleotides such as α-methyl-phosphonate and selenophosphate nucleotides may also be used.

[0256] Additional modifications include, but are not limited to, 2'-O-methylation (as described above) at the 2'-hydroxy group of the ribose sugar of the 5'-end and / or 5'-pre-terminal nucleotides of the polynucleotide. Multiple different 5'-cap structures can be used to generate the 5'-cap of a polynucleotide such as an mRNA molecule.

[0257] 5'-cap structures include those described in International Patent Publications WO2008127688, WO2008016473, and WO2011015347, each of which is incorporated herein by reference.

[0258] As used herein, cap analogs, also referred to as synthetic cap analogs, chemical caps, chemical cap analogs, or structural or functional cap analogs, have a different chemical structure from natural (i.e., endogenous, wild-type, or physiological) 5' caps but retain the cap function. Cap analogs may be synthesized chemically (i.e., non-enzymatically) or enzymatically and / or may be linked to a polynucleotide.

[0259] 7 For example, the anti-reverse cap analog (ARCA) cap contains two guanosines linked by a 5'-5'-triphosphate group, where one guanosine contains an N7-methyl group and a 3'-O-methyl group (i.e., N7,3'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine, m 7

[0260] 7 G-3'mppp-G, which can be equivalently represented as 3'O-Me-m7G(5')ppp(5')G). The 3'-O atom of the other unmodified guanosine binds to the 5'-terminal nucleotide of the capped polynucleotide (e.g., mRNA). The N7- and 3'-O-methylated guanosine provides the terminal portion of the capped polynucleotide (e.g., mRNA).

[0261]

[0262] Alternatively, the cap analog may be an N7-(4-chlorophenoxyethyl)-substituted dinucleotide cap analog known in the art and / or described herein. Non-limiting examples of N7-(4-chlorophenoxyethyl)-substituted dinucleotide cap analogs include N7-(4-chlorophenoxyethyl)-G(5’)ppp(5’)G and N7-(4-chlorophenoxyethyl)-m3’-OG(5’)ppp(5’)G cap analogs (see, e.g., the various cap analogs and methods for synthesizing cap analogs described in Kore et al. Bioorganic & Medicinal Chemistry 2013 21:4570-4574, the cap structures of which are incorporated herein by reference). In other examples, cap analogs useful for the polynucleotides of the present disclosure are 4-chloro / bromophenoxyethyl analogs.

[0263] The cap analog allows for the simultaneous capping of polynucleotides in an in vitro transcription reaction, but up to 20% of the transcription product remains uncapped. This can lead to a decrease in translation ability and a decrease in cellular stability, similar to the structural differences between the cap analog and the endogenous 5’-cap structure of polynucleotides produced by the endogenous cellular transcription machinery.

[0264] To generate a more reliable 5' cap structure, enzymes can also be used to cap alternative polynucleotides post-transcriptionally. As used herein, the phrase "more reliable" refers to a feature that structurally or functionally strictly reflects or mimics an endogenous or wild-type feature. That is, a "more reliable" feature is a better representative of an endogenous, wild-type, natural or physiological cellular function and / or structure compared to prior art synthetic features or analogs, or in one or more respects, exceeds the corresponding endogenous, wild-type, natural or physiological feature. Non-limiting examples of more reliable 5' cap structures useful in the polynucleotides of the present disclosure include, among other things, enhanced binding of cap-binding proteins, increased half-life, decreased sensitivity to 5'-endonucleases, and / or decreased 5' decapping, compared to synthetic 5' cap structures (or wild-type, natural, or physiological 5' cap structures) known in the art. For example, recombinant vaccinia virus capping enzyme and recombinant 2'-O-methyltransferase enzyme can create a standard 5'-5'-triphosphate bond between the 5'-terminal nucleotide of a polynucleotide and a guanosine cap nucleotide, the cap guanosine includes N7-methylation, and the 5'-terminal nucleotide of the polynucleotide includes 2'-O-methyl. Such a structure is called a Cap1 structure. This cap results in, for example, higher translational ability, cell stability, and reduced activation of pro-inflammatory cytokines in cells compared to other 5' cap analog structures known in the art. Other exemplary cap structures include 7mG(5')ppp(5')N, pN2p (Cap0), 7mG(5')ppp(5')NlmpNp (Cap1), 7mG(5')-ppp(5')NlmpN2mp (Cap2), and m(7)Gpppm(3)(6,6,2')Apm(2')Apm(2')Cpm(2)(3,2')Up (Cap4).

[0265] Alternative polynucleotides may be capped post-transcriptionally, and in some cases, nearly 100% of the alternative polynucleotides may be capped because this process is more efficient, as opposed to approximately 80% when a cap analog is ligated to the polynucleotide during an in vitro transcription reaction.

[0266] The 5′ end cap may include an endogenous cap or a cap analog. The 5′ end cap may include a guanosine analog. Useful guanosine analogs include inosine, N1-methylguanosine, 2′-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.

[0267] In some cases, the polynucleotide includes a modified 5′ cap. Modifications at the 5′ cap can enhance the stability of the polynucleotide, extend the half-life of the polynucleotide, and increase the translation efficiency of the polynucleotide. Modified 5′ caps include, but are not limited to, one or more of the following modifications: modification at the 2′ and / or 3′ position of the capped guanosine triphosphate (GTP), replacement of the sugar ring oxygen with a methylene moiety (to form a carbocyclic ring), modification of the triphosphate bridging portion of the cap structure, or modification of the nucleobase (G) portion.

[0268] 5′-UTR The 5′-UTR may be provided as an adjacent region of a polynucleotide (e.g., mRNA). The 5′-UTR may be homologous or heterologous to the coding region found in the polynucleotide. Multiple 5′-UTRs may be included in the adjacent region, and may be of the same or different sequences. Any portion of the adjacent region, including those that are absent, may be codon-optimized and may independently include one or more different structural or chemical modifications before and / or after codon optimization.

[0269] Incorporated herein by reference, the lists of start and stop sites of alternative polynucleotides (e.g., mRNA) shown in Table 21 of U.S. Provisional Application No. 61 / 775,509, and Tables 21 and 22 of U.S. Provisional Application No. 61 / 829,372, are lists of start and stop sites of alternative polynucleotides (e.g., mRNA). In Table 21, each 5'-UTR (5'-UTR-005 to 5'-UTR68511) is identified by its start and stop sites compared to its native or wild-type (orthologous) transcript (ENST; identifier used in the ENSEMBL database).

[0270] To alter one or more properties of a polynucleotide (e.g., mRNA), a 5'-UTR that is heterologous to the coding region of an alternative polynucleotide (e.g., mRNA) may be modified. The polynucleotide (e.g., mRNA) is then administered to a cell, tissue, or organism, and the resulting effects such as protein level, localization, and / or half-life are measured to evaluate the beneficial effects of the heterologous 5'-UTR on the alternative polynucleotide (mRNA). Variants of the 5'-UTR may be utilized in which one or more nucleotides including A, T, C, or G are added to or removed from the ends. The 5'-UTR may also be modified by codon optimization, or by any method described herein.

[0271] 5'-UTR, 3'-UTR, and translation enhancer elements (TEE) The 5'-UTR of a polynucleotide (e.g., mRNA) may include at least one translation enhancer element. The term "translation enhancer element" refers to a sequence that increases the amount of polypeptide or protein produced from a polynucleotide. As a non-limiting example, the TEE may be located between the transcriptional promoter and the start codon. A polynucleotide (e.g., mRNA) having at least one TEE in its 5'-UTR may include a cap in the 5'-UTR. Further, at least one TEE may be located in the 5'-UTR of a polynucleotide (e.g., mRNA) that undergoes cap-dependent or cap-independent translation.

[0272] In one aspect, the TEE is a conserved element within the UTR that can promote the translational activity of polynucleotides, such as but not limited to cap-dependent or cap-independent translation. The conservation of these sequences across 14 species including humans has been shown previously by Panek et al. (Nucleic Acids Research, 2013, 1 - 10).

[0273] In one non-limiting example, a known TEE can be in the 5’ leader of the Gtx homeodomain protein (Chappell et al., Proc. Natl. Acad. Sci. USA 101:9590 - 9594, 2004, the TEE of which is incorporated herein by reference).

[0274] In another non-limiting example, TEEs are disclosed in U.S. Patent Publications Nos. 2009 / 0226470 and 2013 / 0177581, International Patent Publications WO2009 / 075886, WO2012 / 009644, and WO1999 / 024595, and U.S. Patents Nos. 6,310,197 and 6,849,405, the respective TEE sequences of which are incorporated herein by reference.

[0275] In yet another non-limiting example, the TEE may be an internal ribosome entry site (IRES) within the sequence, an HCV-IRES, or an IRES element such as those described in U.S. Patent No. 7,468,275, U.S. Patent Publications Nos. 2007 / 0048776, 2011 / 012410, and International Patent Publications WO2007 / 025008 and WO2001 / 055369, but is not limited thereto, the respective IRES sequences of which are incorporated herein by reference. IRES elements include those described by Chappell et al. (Proc. The Gtx sequences (e.g., Gtx9-nt, Gtx8-nt, Gtx7-nt) described by Natl. Acad. Sci. USA 101:9590-9594, 2004), and Zhou et al. (PNAS 102:6273-6278, 2005), as well as U.S. Patent Publication Nos. 2007 / 0048776 and 2011 / 0124100, and International Patent Publication WO2007 / 025008 may be included, but are not limited thereto, and each IRES sequence is incorporated herein by reference.

[0276] "Translation enhancer polynucleotide" is a polynucleotide comprising one or more of the specific TEEs disclosed herein and / or in the prior art (see, e.g., U.S. Patent Nos. 6,310,197, 6,849,405, 7,456,273, 7,183,395, U.S. Patent Publication Nos. 20090 / 226470, 2007 / 0048776, 2011 / 0124100, 2009 / 0093049, 2013 / 0177581, International Patent Publications WO2009 / 075886, WO2007 / 025008, WO2012 / 009644, WO2001 / 055371, WO1999 / 024595, and European Patent Nos. 2610341 and 2610340, each TEE sequence is incorporated herein by reference), or variants, homologs, or functional derivatives thereof. One or more copies of a particular TEE may be present in a polynucleotide (e.g., mRNA). The TEEs within the translation enhancer polynucleotide may be organized into one or more sequence segments. The sequence segments can carry one or more of the particular TEEs exemplified herein, and each TEE is present in one or more copies. When multiple sequence segments are present in the translation enhancer polynucleotide, they may be homologous or heterologous. Thus, the multiple sequence segments within the translation enhancer polynucleotide can carry the same or different types of the particular TEEs exemplified herein, the same or different copy numbers of each particular TEE, and / or the same or different organization of the TEEs within each sequence segment.

[0277] The polynucleotide (e.g., mRNA) can include at least one TEE described in International Patent Publications WO1999 / 024595, WO2012 / 009644, WO2009 / 075886, WO2007 / 025008, WO1999 / 024595, European Patent Publications No. 2610341 and No. 2610340, U.S. Patents No. 6,310,197, No. 6,849,405, No. 7,456,273, No. 7,183,395, and U.S. Patent Publications No. 2009 / 0226470, No. 2011 / 0124100, No. 2007 / 0048776, No. 2009 / 0093049, and No. 2013 / 0177581, the respective TEE sequences of which are incorporated herein by reference. The TEE can be located in the 5'-UTR of the polynucleotide (e.g., mRNA).

[0278] Polynucleotides (e.g., mRNA) may contain at least one TEE having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity to the TEEs described in U.S. Patent Publications Nos. 2009 / 0226470, 2007 / 0048776, 2013 / 0177581, and 2011 / 0124100, International Patent Publications WO1999 / 024595, WO2012 / 009644, WO2009 / 075886, and WO2007 / 025008, European Patent Publications Nos. 2610341 and 2610340, and U.S. Patents Nos. 6,310,197, 6,849,405, 7,456,273, and 7,183,395, each of whose TEE sequences is incorporated herein by reference.

[0279] The 5'-UTR of a polynucleotide (e.g., mRNA) may contain at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, or more than 60 TEE sequences. The TEE sequences within the 5'-UTR of a polynucleotide (e.g., mRNA) can be the same or different TEE sequences. The TEE sequences can be in patterns such as ABABAB, AABBAABBAABB, or ABCABCABC, or variants thereof, and can be repeated more than once, twice, or three times. In these patterns, each letter A, B, or C represents a different TEE sequence at the nucleotide level.

[0280] In some cases, the 5’-UTR may include a spacer that separates two TEE sequences. As a non-limiting example, the spacer can be a 15-nucleotide spacer and / or other spacers known in the art. As another non-limiting example, the 5’-UTR may include a sequence-spacer module that repeats at least once, at least twice, at least three times, at least four times, at least five times, at least six times, at least seven times, at least eight times, at least nine times, or more than nine times within the 5’-UTR.

[0281] In other examples, the spacer that separates two TEE sequences can include, but is not limited to, an miR sequence (e.g., an miR binding site and an miR seed), and can include other sequences known in the art that can regulate the translation of the polynucleotides (e.g., mRNAs) of the present disclosure. As a non-limiting example, each spacer used to separate two TEE sequences may include a different miR sequence or a component of an miR sequence (e.g., an miR seed sequence).

[0282] In some cases, the TEEs within the 5'-UTR of a polynucleotide (e.g., mRNA) include at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or more than 99% of the TEE sequences disclosed in U.S. Patent Publications Nos. 2009 / 0226470, 2007 / 0048776, 2013 / 0177581, and 2011 / 0124100, International Patent Publications WO1999 / 024595, WO2012 / 009644, WO2009 / 075886, and WO2007 / 025008, European Patent Publications Nos. 2610341 and 2610340, and U.S. Patents Nos. 6,310,197, 6,849,405, 7,456,273, and 7,183,395, each of which TEE sequences is incorporated herein by reference. In another embodiment, the TEEs within the 5'-UTR of the polynucleotides (e.g., mRNA) of the present disclosure include 5- to 30-nucleotide fragments, 5- to 25-nucleotide fragments, 5- to 20-nucleotide fragments, 5- to 15-nucleotide fragments, 5- to 10-nucleotide fragments of the TEE sequences disclosed in U.S. Patent Publications Nos. 2009 / 0226470, 2007 / 0048776, 2013 / 0177581, and 2011 / 0124100, International Patent Publications WO1999 / 024595, WO2012 / 009644, WO2009 / 075886, WO2007 / 025008, European Patent Publications Nos. 2610341 and 2610340, and U.S. Patents Nos. 6,310,197, 6,849,405, 7,456,273, and 7,183,395, each of which TEE sequences is incorporated herein by reference.

[0283] In some cases, the TEEs within the 5’-UTR of the polynucleotides (e.g., mRNA) of the present disclosure may comprise at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or more than 99% of the TEE sequences disclosed in Supplementary Table 1 and Supplementary Table 2 disclosed in Chappell et al. (Proc. Natl. Acad. Sci. USA 101:9590-9594, 2004) and Zhou et al. (PNAS 102:6273-6278, 2005), and Wellensiek et al (Genome-wide profiling of human cap-independent translation-enhancing elements, Nature Methods, 2013; DOI:10.1038 / NMETH.2522), each of which TEE sequences is incorporated herein by reference. In another embodiment, the TEEs within the 5’-UTR of the polynucleotides (e.g., mRNA) of the present disclosure may comprise 5- to 30-nucleotide fragments, 5- to 25-nucleotide fragments, 5- to 20-nucleotide fragments, 5- to 15-nucleotide fragments, 5- to 10-nucleotide fragments of the TEE sequences disclosed in Supplementary Table 1 and Supplementary Table 2 disclosed in Chappell et al. (Proc. Natl. Acad. Sci. USA 101:9590-9594, 2004) and Zhou et al. (PNAS 102:6273-6278, 2005), and Wellensiek et al (Genome-wide profiling of human cap-independent translation-enhancing elements, Nature Methods, 2013; DOE10.1038 / NMETH.2522), each of which TEE sequences is incorporated herein by reference.

[0284] In some cases, the TEE used in the 5'-UTR of a polynucleotide (e.g., mRNA) is an IRES sequence such as those described in U.S. Patent No. 7,468,275 and International Patent Publication WO2001 / 055369, the respective TEE sequences of which are incorporated herein by reference, but is not limited thereto.

[0285] In some cases, the TEE used in the 5'-UTR of a polynucleotide (e.g., mRNA) can be identified by the methods described in U.S. Patent Publications 2007 / 0048776 and 2011 / 0124100, and International Patent Publications WO2007 / 025008 and WO2012 / 009644, the respective methods of which are incorporated herein by reference.

[0286] In some cases, the TEE used in the 5'-UTR of the polynucleotides (e.g., mRNA) of the present disclosure can be transcriptional regulatory elements described in U.S. Patent Nos. 7,456,273 and 7,183,395, U.S. Patent Publication 2009 / 0093049, and International Publication WO2001 / 055371, the respective TEE sequences of which are incorporated herein by reference. The transcriptional regulatory elements can be identified by methods known in the art such as those described in U.S. Patent Nos. 7,456,273 and 7,183,395, U.S. Patent Publication 2009 / 0093049, and International Publication WO2001 / 055371, but is not limited thereto, and the respective methods are incorporated herein by reference.

[0287] In still other examples, the TEE used in the 5'-UTR of a polynucleotide (e.g., mRNA) is a polypeptide or a portion thereof as described in U.S. Patent Nos. 7,456,273 and 7,183,395, U.S. Patent Publication 2009 / 0093049, and International Publication WO2001 / 055371, the respective TEE sequences of which are incorporated herein by reference.

[0288] The 5'-UTR containing at least one TEE described herein can be incorporated into a monocistronic sequence such as, but not limited to, a vector system or a polynucleotide vector. As non-limiting examples, vector systems and polynucleotide vectors include those described in U.S. Patent Nos. 7,456,273 and 7,183,395, U.S. Patent Publications 2007 / 0048776, 2009 / 0093049, and 2011 / 0124100, and International Patent Publications WO2007 / 025008 and WO2001 / 055371, in which the respective TEE sequences are incorporated herein by reference.

[0289] The TEE described herein may be located in the 5'-UTR and / or 3'-UTR of a polynucleotide (e.g., mRNA). The TEE located in the 3'-UTR may be the same as and / or different from the TEE located in the 5'-UTR and / or described for incorporation into the 5'-UTR.

[0290] Optionally, the 3'-UTR of a polynucleotide (e.g., mRNA) may contain at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, or more than 60 TEE sequences. The TEE sequences within the 3'-UTR of the polynucleotides (e.g., mRNA) of the present disclosure can be the same or different TEE sequences. The TEE sequences can be in a pattern such as ABABAB, AABBAABBAABB, or ABCABCABC, or variants thereof, and can be repeated more than once, twice, or three times. In these patterns, each letter A, B, or C represents a different TEE sequence at the nucleotide level.

[0291] In one example, the 3'-UTR may include a spacer that separates two TEE sequences. As a non-limiting example, the spacer can be a 15-nucleotide spacer and / or other spacers known in the art. As another non-limiting example, the 3'-UTR may include a sequence-spacer module that repeats at least once, at least twice, at least three times, at least four times, at least five times, at least six times, at least seven times, at least eight times, at least nine times, or more than nine times within the 3'-UTR.

[0292] In other examples, the spacer that separates two TEE sequences can be other sequences known in the art that can regulate the translation of the polynucleotides (e.g., mRNA) of the present disclosure, such as the miR sequences (e.g., miR binding sites and miR seeds) described herein, but are not limited thereto. As a non-limiting example, each spacer used to separate two TEE sequences may include different miR sequences or components of miR sequences (e.g., miR seed sequences).

[0293] In some embodiments, the polyribonucleotides of the present disclosure include miR and / or TEE sequences. In some embodiments, the incorporation of miR sequences and / or TEE sequences into the polyribonucleotides of the present disclosure can change the shape of the stem-loop region, which can increase and / or decrease translation. See, for example, Kedde et al., Nature Cell Biology 2010 12(10): 1014-20, which is hereby incorporated by reference in its entirety.

[0294] Sensor sequence and microRNA (miRNA) binding site The sensor array includes, for example, microRNA (miRNA) binding sites, transcription factor binding sites, structured mRNA sequences and / or motifs, artificial binding sites modified to act as pseudoreceptors for endogenous nucleic acid binding molecules, and combinations thereof. Non-limiting examples of sensor arrays are described in U.S. Patent Publication No. 2014 / 0200261, the contents of which are hereby incorporated by reference in their entirety.

[0295] In some embodiments, the polynucleotides of the present disclosure (e.g., ribonucleic acid (RNA), such as messenger RNA (mRNA)) that include an open reading frame (ORF) encoding a polypeptide further include a sensor array. In some embodiments, the sensor array is a miRNA binding site.

[0296] miRNAs are non-coding RNAs 19-25 nucleotides in length that downregulate gene expression by binding to polynucleotides and decreasing the stability of the polynucleotides or inhibiting translation of the polynucleotides. miRNA sequences include a "seed" region, i.e., the sequence within positions 2-8 of the mature miRNA. The miRNA seed can include positions 2-8 or 2-7 of the mature miRNA. In some embodiments, the miRNA seed can include 7 nucleotides (e.g., nucleotides 2-8 of the mature miRNA), and the seed complementary site of the corresponding miRNA binding site has an adenosine (A) opposite position 1 of the miRNA adjacent thereto. In some embodiments, the miRNA seed can include 6 nucleotides (e.g., nucleotides 2-7 of the mature miRNA), and the seed complementary site of the corresponding miRNA binding site has an adenosine (A) opposite position 1 of the miRNA adjacent thereto. For example, Grimson A, Farh KK, Johnston WK, Garrett-Engele P, Lim LP, See Bartel DP; Mol Cell. 2007 Jul 6;27(1):91-105. miRNA profiling of a target cell or tissue can be performed to determine the presence or absence of miRNAs in the cell or tissue. In some embodiments, the polynucleotides of the present disclosure (e.g., ribonucleic acid (RNA), such as messenger RNA (mRNA)) include one or more microRNA target sequences, microRNA sequences, or microRNA seeds. Such sequences can correspond to any known microRNA, such as those taught in U.S. Patent Publication No. 2005 / 0261218 and U.S. Patent Publication No. 2005 / 0059005, the entire contents of each of which are incorporated herein by reference in their entirety.

[0297] As used herein, the term "microRNA (miRNA or miR) binding site" refers to a sequence within a polynucleotide, such as within DNA or an RNA transcript, that includes a 5'UTR and / or 3'UTR and has sufficient complementarity to all or a region of the miRNA for interacting, binding, or associating with the miRNA. In some embodiments, the polynucleotides of the present disclosure that include an ORF encoding a polypeptide further include an miRNA binding site. In an exemplary embodiment, the 5'UTR and / or 3'UTR of the polynucleotide (e.g., ribonucleic acid (RNA), such as messenger RNA (mRNA)) includes an miRNA binding site.

[0298] An miRNA binding site having sufficient complementarity to an miRNA refers to a degree of complementarity sufficient to promote miRNA-mediated regulation of a polynucleotide, such as miRNA-mediated translational repression or degradation of a polynucleotide. In an exemplary embodiment of the present disclosure, an miRNA binding site having sufficient complementarity to an miRNA refers to a degree of complementarity sufficient to promote miRNA-mediated degradation of a polynucleotide, such as miRNA-induced RNA-induced silencing complex (RlSC)-mediated cleavage of mRNA. An miRNA binding site can have complementarity to, for example, a 19-25 nucleotide miRNA sequence, a 19-23 nucleotide miRNA sequence, or a 22 nucleotide miRNA sequence. An miRNA binding site can be complementary to only a portion of the miRNA, for example, only a portion less than 1, 2, 3, or 4 nucleotides of the full length of a naturally occurring miRNA sequence. When the desired regulation is mRNA degradation, complete or perfect complementarity (e.g., complete or perfect complementarity over all or a substantial portion of the length of a naturally occurring miRNA) is preferred.

[0299] In some embodiments, the miRNA binding site includes a sequence having complementarity (e.g., partial or complete complementarity) to the miRNA seed sequence. In some embodiments, the miRNA binding site includes a sequence having complete complementarity to the miRNA seed sequence. In some embodiments, the miRNA binding site includes a sequence having complementarity (such as partial or complete complementarity) to the miRNA sequence. In some embodiments, the miRNA binding site includes a sequence having complete complementarity to the miRNA sequence. In some embodiments, the miRNA binding site has complete complementarity to the miRNA sequence but has 1, 2, or 3 nucleotide substitutions, terminal additions, and / or truncations.

[0300] In some embodiments, the miRNA binding site is the same length as the corresponding miRNA. In other embodiments, the miRNA binding site is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides shorter than the corresponding miRNA at the 5' end, 3' end, or both. In still other embodiments, the microRNA binding site is 2 nucleotides shorter than the corresponding microRNA at the 5' end, 3' end, or both. The miRNA binding site that is shorter than the corresponding miRNA can still be capable of degrading the mRNA incorporating one or more miRNA binding sites or preventing the translation of the mRNA.

[0301] In some embodiments, the miRNA binding site binds to the corresponding mature miRNA that is part of the active RISC containing Dicer. In another embodiment, the binding of the miRNA binding site in the RISC to the corresponding miRNA degrades the mRNA containing the miRNA binding site or prevents the mRNA from being translated. In some embodiments, the miRNA binding site has sufficient complementarity to the miRNA such that the RISC complex containing the miRNA cleaves the polynucleotide containing the miRNA binding site. In other embodiments, the miRNA binding site has imperfect complementarity, such that the RISC complex containing the miRNA induces the instability of the polynucleotide containing the miRNA binding site. In another embodiment, the miRNA binding site has imperfect complementarity, such that the RISC complex containing the miRNA suppresses the transcription of the polynucleotide containing the miRNA binding site.

[0302] In some embodiments, the miRNA binding site has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 mismatches from the corresponding miRNA.

[0303] In some embodiments, the miRNA binding site has at least about 10, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, or at least about 21 consecutive nucleotides that are each complementary to at least about 10, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, or at least about 21 consecutive nucleotides of the corresponding miRNA.

[0304] By modifying one or more miRNA binding sites within the polynucleotides of the present disclosure, if the miRNA in question is available, the polynucleotide can be targeted for degradation or reduced translation. Thereby, the off-target effect upon delivery of the polynucleotide can be reduced. For example, if the polynucleotide of the present disclosure is not intended to be delivered to a tissue or cell but ends up there, the miRNA abundant in that tissue or cell can inhibit the expression of the gene of interest if the binding site of one or more miRNAs is modified to be incorporated into the 5'UTR and / or 3'UTR of the polynucleotide.

[0305] Conversely, the miRNA binding site can be deleted from a naturally occurring polynucleotide sequence to increase protein expression in a particular tissue. For example, removing the binding site of a particular miRNA from a polynucleotide can improve protein expression in a tissue or cell containing the miRNA.

[0306] In some embodiments, the polynucleotides of the present disclosure can include at least one miRNA binding site in the 5’UTR and / or 3’UTR to induce a cytotoxic or cytoprotective mRNA therapeutic in specific cells such as, but not limited to, normal and / or cancerous cells. In another embodiment, the polynucleotides of the present disclosure can include 2, 3, 4, 5, 6, 7, 8, 9, 10, or more miRNA binding sites in the 5’-UTR and / or 3’-UTR to induce a cytotoxic or cytoprotective mRNA therapeutic in specific cells such as, but not limited to, normal and / or cancerous cells.

[0307] Regulation of expression in multiple tissues can be achieved by introduction or removal of one or more miRNA binding sites. The determination of whether to remove or insert an miRNA binding site can be made based on miRNA expression patterns and / or profiling in the disease. Identification of miRNAs, miRNA binding sites, and their expression patterns and roles in biology have been reported (e.g., Bonauer et al., Curr Drug Targets 2010 11:943-949; Anand and Cheresh Curr Opin Hematol 2011 18:171-176; Contreras and Rao Leukemia 2012 26:404-413 (2011 Dec 20. doi: 10.1038 / leu.2011.356); Bartel Cell 2009 136:215-233; Landgraf et al, Cell, 2007 129:1401-1414; Gentner and Naldini, Tissue Antigens. 2012 80:393-403, and references therein; each of which is incorporated herein by reference in its entirety).

[0308] The miRNA and miRNA binding sites can correspond to any known sequence, including the non-limiting examples described in U.S. Publication Nos. 2014 / 0200261, 2005 / 0261218, and 2005 / 0059005, each of which is hereby incorporated by reference in its entirety.

[0309] Examples of tissues in which miRNAs are known to regulate mRNAs and thereby effect protein expression include, but are not limited to, liver (miR-122), muscle (miR-133, miR-206, miR-208), endothelial cells (miR-17-92, miR-126), myeloid cells (miR-142-3p, miR-142-5p, miR-16, miR-21, miR-223, miR-24, miR-27), adipose tissue (let-7, miR-30c), heart (miR-ld, miR-149), kidney (miR-192, miR-194, miR-204), and lung epithelial cells (let-7, miR-133, miR-126).

[0310] Specifically, miRNAs are known to be differentially expressed in immune cells (also called hematopoietic cells) such as antigen-presenting cells (APCs) (e.g., dendritic cells and macrophages), macrophages, monocytes, B lymphocytes, T lymphocytes, granulocytes, and natural killers. Immune cell-specific miRNAs are involved in immunogenicity, autoimmunity, immune responses to infection, inflammation, and unwanted immune responses after gene therapy and tissue / organ transplantation. miRNAs specific to immune cells also control many aspects of the development, proliferation, differentiation, and apoptosis of hematopoietic cells (immune cells). For example, miR-142 and miR-146 are expressed only in immune cells and are particularly abundant in bone marrow dendritic cells. It has been demonstrated that by adding the miR-142 binding site to the 3'-UTR of a polynucleotide, the immune response to the polynucleotide can be blocked, enabling more stable gene transfer in tissues and cells. miR-142 efficiently degrades exogenous polynucleotides in antigen-presenting cells and suppresses the cytotoxic elimination of transduced cells (e.g., Annoni A et al., blood, 2009, 114, 5152-5161; Brown BD, et al., Nat med. 2006, 12(5), 585-591; Brown BD, et al., blood, 2007, 110(13): 4144-4152, each of which is incorporated herein by reference).

[0311] An antigen-mediated immune response refers to an immune response induced by a foreign antigen, which, when invading an organism, is processed by antigen-presenting cells and presented on the surface of the antigen-presenting cells. T cells can recognize the presented antigen and induce the cytotoxic elimination of cells expressing the antigen.

[0312] When a miR-142 binding site is introduced into the 5’UTR and / or 3’UTR of the polynucleotide of the present disclosure, gene expression in antigen-presenting cells can be selectively suppressed by degradation via miR-142, antigen presentation by antigen-presenting cells (e.g., dendritic cells) can be restricted, thereby preventing an antigen-mediated immune response after delivery of the polynucleotide. The polynucleotide is stably expressed in the target tissue or cells without inducing cytotoxic elimination.

[0313] In some embodiments, the binding site of a miRNA known to be expressed in immune cells and antigen-presenting cells is modified to be incorporated into the polynucleotide of the present disclosure, and the expression of the polynucleotide in antigen-presenting cells can be suppressed by miRNA-mediated RNA degradation, thereby suppressing the antigen-mediated immune response. The expression of the polynucleotide is maintained in non-immune cells where immune cell-specific miRNAs are not expressed. For example, in some embodiments, to prevent an immunogenic reaction against a liver-specific protein, the miR-122 binding site is removed, and the miR-142 (and / or mirR-146) binding site can be modified to be incorporated into the 5’UTR and / or 3’UTR of the polynucleotide of the present disclosure.

[0314] To further promote the selective degradation and suppression of APCs and macrophages, the polynucleotide of the present disclosure can contain additional negative regulatory elements in the 5’UTR and / or 3’UTR, either alone or in combination with the miR-142 and / or miR-146 binding site. As a non-limiting example, the additional negative regulatory element is a constitutive decay element (CDE).

[0315] Immune cell-specific miRNAs include hsa-let-7a-2-3p, hsa-let-7a-3p, hsa-7a-5p, hsa-let-7c, hsa-let-7e-3p, hsa-let-7e-5p, hsa-let-7g-3p, hsa-let-7g-5p, hsa-let-7i-3p, hsa-let-7i-5p, miR-10a-3p, miR-10a-5p, miR-1184, hsa-let-7f-l-3p, hsa-let-7f-2-5p, hsa-let-7f-5p, miR-125b-1-3p, miR-125b-2-3p, miR-125b-5p, miR-1279, miR-130a-3p, miR-130a-5p, miR-132-3p, miR-132-5p, miR-142-3p, miR-142-5p, miR-143-3p, miR-143-5p, miR-146a-3p, miR-146a-5p, miR-146b-3p, miR-146b-5p, miR-147a, miR-147b, miR-148a-5p, miR-148a-3p, miR-150-3p, miR-150-5p, miR-151b, miR-155-3p, miR-155-5p, miR-15a-3p, miR-15a-5p, miR-15b-5p, miR-15b-3p, miR-16-1-3p, miR-16-2-3p, miR-16-5p, miR-17-5p, miR-181a-3p, miR-181a-5p, miR-181a-2-3p, miR-182-3p, miR-182-5p, miR-197-3p, miR-197-5p, miR-21-5p, miR-21-3p, miR-214-3p, miR-214-5p, miR-223-3p, miR-223-5p, miR-221-3p, miR-221-5p, miR-23b-3p, miR-23b-5p, miR-24-1-5p, miR-24-2-5p, miR-24-3p, miR-26a-1-3p, miR-26a-2-3p, miR-26a-5p, miR-26b-3p, miR-26b-5p, miR-27a-3p, miR-27a-5p, miR-27b-3p, miR-27b-5p, miR-28-3p, miR-28-5p, miR-2909, miR-29a-3p, miR-29a-5p, miR-29b-1-5p, miR-29b-2-5p,Including, but not limited to, miR-29c-3p, miR-29c-5p, miR-30e-3p, miR-30e-5p, miR-331-5p, miR-339-3p, miR-339-5p, miR-345-3p, miR-345-5p, miR-346, miR-34a-3p, miR-34a-5p, miR-363-3p, miR-363-5p, miR-372, miR-377-3p, miR-377-5p, miR-493-3p, miR-493-5p, miR-542, miR-548b-5p, miR548c-5p, miR-548i, miR-548j, miR-548n, miR-574-3p, miR-598, miR-718, miR-935, miR-99a-3p, miR-99a-5p, miR-99b-3p, and miR-99b-5p. Furthermore, novel miRNAs can be identified in immune cells by microarray hybridization and microtome analysis (e.g., Jima DD et al, Blood, 2010, 116:el18-el27; Vaz C et al., BMC Genomics, 2010, 11,288, the entire contents of each of which are hereby incorporated by reference in their entirety).

[0316] miRNAs known to be expressed in the liver include, but are not limited to, miR-107, miR-122-3p, miR-122-5p, miR-1228-3p, miR-1228-5p, miR-1249, miR-129-5p, miR-1303, miR-151a-3p, miR-151a-5p, miR-152, miR-194-3p, miR-194-5p, miR-199a-3p, miR-199a-5p, miR-199b-3p, miR-199b-5p, miR-296-5p, miR-557, miR-581, miR-939-3p, and miR-939-5p. The miRNA binding sites from any liver-specific miRNA can be introduced into or removed from the polynucleotides of the present disclosure to regulate the expression of the polynucleotides in the liver. The liver-specific miRNA binding sites can be modified alone or in further combination with immune cell (e.g., APC) miRNA binding sites in the polynucleotides of the present disclosure.

[0317] miRNAs known to be expressed in the lung include, but are not limited to, let-7a-2-3p, let-7a-3p, let-7a-5p, miR-126-3p, miR-126-5p, miR-127-3p, miR-127-5p, miR-130a-3p, miR-130a-5p, miR-130b-3p, miR-130b-5p, miR-133a, miR-133b, miR-134, miR-18a-3p, miR-18a-5p, miR-18b-3p, miR-18b-5p, miR-24-1-5p, miR-24-2-5p, miR-24-3p, miR-296-3p, miR-296-5p, miR-32-3p, miR-337-3p, miR-337-5p, miR-381-3p, and miR-381-5p. The miRNA binding sites from any lung-specific miRNA can be introduced into or removed from the polynucleotides of the present disclosure to regulate the expression of the polynucleotides in the lung. The lung-specific miRNA binding sites can be modified alone or in further combination with immune cell (e.g., APC) miRNA binding sites in the polynucleotides of the present disclosure.

[0318] miRNAs known to be expressed in the heart include, but are not limited to, miR-1, miR-133a, miR-133b, miR-149-3p, miR-149-5p, miR-186-3p, miR-186-5p, miR-208a, miR-208b, miR-210, miR-296-3p, miR-320, miR-451a, miR-451b, miR-499a-3p, miR-499a-5p, miR-499b-3p, miR-499b-5p, miR-744-3p, miR-744-5p, miR-92b-3p, and miR-92b-5p. The miRNA binding sites from any heart-specific microRNA can be introduced into or removed from the polynucleotides of the present disclosure to regulate the expression of the polynucleotides in the heart. The heart-specific miRNA binding sites can be modified alone or in further combination with immune cell (e.g., APC) miRNA binding sites in the polynucleotides of the present disclosure.

[0319] Known miRNAs expressed in the nervous system include, but are not limited to, miR-124-5p, miR-125a-3p, miR-125a-5p, miR-125b-1-3p, miR-125b-2-3p, miR-125b-5p, miR-1271-3p, miR-1271-5p, miR-128, miR-132-5p, miR-135a-3p, miR-135a-5p, miR-135b-3p, miR-135b-5p, miR-137, miR-139-5p, miR-139-3p, miR-149-3p, miR-149-5p, miR-153, miR-181c-3p, miR-181c-5p, miR-183-3p, miR-183-5p, miR-190a, miR-190b, miR-212-3p, miR-212-5p, miR-219-1-3p, miR-219-2-3p, miR-23a-3p, miR-23a-5p, miR-30a-5p, miR-30b-3p, miR-30b-5p, miR-30c-1-3p, miR-30c-2-3p, miR-30c-5p, miR-30d-3p, miR-30d-5p, miR-329, miR-342-3p, miR-3665, miR-3666, miR-380-3p, miR-380-5p, miR-383, miR-410, miR-425-3p, miR-425-5p, miR-454-3p, miR-454-5p, miR-483, miR-510, miR-516a-3p, miR-548b-5p, miR-548c-5p, miR-571, miR-7-1-3p, miR-7-2-3p, miR-7-5p, miR-802, miR-922, miR-9-3p, and miR-9-5p.Neurons specifically expressing miRNAs that are abundant in the nervous system, including but not limited to miR-132-3p, miR-132-3p, miR-148b-3p, miR-148b-5p, miR-151a-3p, miR-151a-5p, miR-212-3p, miR-212-5p, miR-320b, miR-320e, miR-323a-3p, miR-323a-5p, miR-324-5p, miR-325, miR-326, miR-328, miR-922, and those specifically expressed in glial cells, including but not limited to miR-1250, miR-219-1-3p, miR-219-2-3p, miR-219-5p, miR-23a-3p, miR-23a-5p, miR-3065-3p, miR-3065-5p, miR-30e-3p, miR-30e-5p, miR-32-5p, miR-338-5p, and miR-657, are further included. The miRNA binding site from any CNS-specific miRNA can be introduced into or removed from the polynucleotide of the present disclosure to regulate the expression of the polynucleotide in the nervous system. The nervous system-specific miRNA binding site can be modified alone or in further combination with an immune cell (e.g., APC) miRNA binding site in the polynucleotide of the present disclosure.

[0320] MiRNAs known to be expressed in the pancreas include, but are not limited to, miR-105-3p, miR-105-5p, miR-184, miR-195-3p, miR-195-5p, miR-196a-3p, miR-196a-5p, miR-214-3p, miR-214-5p, miR-216a-3p, miR-216a-5p, miR-30a-3p, miR-33a-3p, miR-33a-5p, miR-375, miR-7-1-3p, miR-7-2-3p, miR-493-3p, miR-493-5p, and miR-944. The miRNA binding sites from any pancreatic-specific miRNA can be introduced into or removed from the polynucleotides of the present disclosure to regulate the expression of the polynucleotides in the pancreas. The pancreatic-specific miRNA binding sites can be modified alone or in further combination with immune cell (e.g., APC) miRNA binding sites in the polynucleotides of the present disclosure.

[0321] MiRNAs known to be expressed in the kidney include, but are not limited to, miR-122-3p, miR-145-5p, miR-17-5p, miR-192-3p, miR-192-5p, miR-194-3p, miR-194-5p, miR-20a-3p, miR-20a-5p, miR-204-3p, miR-204-5p, miR-210, miR-216a-3p, miR-216a-5p, miR-296-3p, miR-30a-3p, miR-30a-5p, miR-30b-3p, miR-30b-5p, miR-30c-1-3p, miR-30c-2-3p, miR30c-5p, miR-324-3p, miR-335-3p, miR-335-5p, miR-363-3p, miR-363-5p, and miR-562. The miRNA binding sites from any kidney-specific miRNA can be introduced into or removed from the polynucleotides of the present disclosure to regulate the expression of the polynucleotides in the kidney. The kidney-specific miRNA binding sites can be modified alone or in further combination with immune cell (e.g., APC) miRNA binding sites in the polynucleotides of the present disclosure.

[0322] miRNAs known to be expressed in muscle include, but are not limited to, let-7g-3p, let-7g-5p, miR-1, miR-1286, miR-133a, miR-133b, miR-140-3p, miR-143-3p, miR-143-5p, miR-145-3p, miR-145-5p, miR-188-3p, miR-188-5p, miR-206, miR-208a, miR-208b, miR-25-3p, and miR-25-5p. The miRNA binding sites from any muscle-specific miRNA can be introduced into or removed from the polynucleotides of the present disclosure to regulate the expression of the polynucleotides in muscle. The muscle-specific miRNA binding sites can be modified alone or further in combination with immune cell (e.g., APC) miRNA binding sites in the polynucleotides of the present disclosure.

[0323] miRNAs are also differentially expressed in various types of cells including, but not limited to, endothelial cells, epithelial cells, and adipocytes.

[0324] miRNAs known to be expressed in endothelial cells include, but are not limited to, let-7b-3p, let-7b-5p, miR-100-3p, miR-100-5p, miR-101-3p, miR-101-5p, miR-126-3p, miR-126-5p, miR-1236-3p, miR-1236-5p, miR-130a-3p, miR-130a-5p, miR-17-5p, miR-17-3p, miR-18a-3p, miR-18a-5p, miR-19a-3p, miR-19a-5p, miR-19b-1-5p, miR-19b-2-5p, miR-19b-3p, miR-20a-3p, miR-20a-5p, miR-217, miR-210, miR-21-3p, miR-21-5p, miR-221-3p, miR-221-5p, miR-222-3p, miR-222-5p, miR-23a-3p, miR-23a-5p, miR-296-5p, miR-361-3p, miR-361-5p, miR-421, miR-424-3p, miR-424-5p, miR-513a-5p, miR-92a-1-5p, miR-92a-2-5p, miR-92a-3p, miR-92b-3p, and miR-92b-5p. Many novel miRNAs have been discovered in endothelial cells from deep sequencing analysis (see, e.g., Voellenkle C et al., RNA, 2012, 18, 472-484, which is incorporated herein by reference in its entirety). The miRNA binding sites from any endothelial cell-specific miRNA can be introduced into or removed from the polynucleotides of the present disclosure to regulate the expression of the polynucleotides in endothelial cells.

[0325] miRNAs known to be expressed in epithelial cells include, but are not limited to, let-7b-3p, let-7b-5p, miR-1246, miR-200a-3p, miR-200a-5p, miR-200b-3p, miR-200b-5p, miR-200c-3p, miR-200c-5p, miR-338-3p, miR-429, miR-451a, miR-451b, miR-494, miR-802, and miR-34a, miR-34b-5p, miR-34c-5p, miR-449a, miR-449b-3p, miR-449b-5p specific to respiratory ciliated epithelial cells, the let-7 family, miR-133a, miR-133b, miR-126 specific to lung epithelial cells, miR-382-3p, miR-382-5p specific to renal epithelial cells, miR-762 specific to corneal epithelial cells. The miRNA binding site from any epithelial cell-specific miRNA can be introduced into or removed from the polynucleotide of the present disclosure to regulate the expression of the polynucleotide in epithelial cells.

[0326] Furthermore, a large group of miRNAs is enriched in embryonic stem cells and controls stem cell self-renewal and the development and / or differentiation of various cell lineages such as neurons, heart, hematopoietic cells, skin cells, osteogenic cells, and muscle cells (e.g., Kuppusamy KT et al., Curr. Mol Med, 2013, 13(5), 757-764; Vidigal JA and Ventura A, Semin Cancer Biol. 2012, 22(5-6), 428-436; Goff LA et al., PLoS One, 2009, 4:e7192; Morin RD et al., Genome Res, 2008, 18, 610-621; Yoo JK et al., Stem Cells Dev. 2012, 21(11), 2049-2057, which are incorporated herein by reference in their entirety).miRNAs that are abundant in embryonic stem cells include, but are not limited to, let-7a-2-3p, let-a-3p, let-7a-5p, let7d-3p, let-7d-5p, miR-103a-2-3p, miR-103a-5p, miR-106b-3p, miR-106b-5p, miR-1246, miR-1275, miR-138-1-3p, miR-138-2-3p, miR-138-5p, miR-154-3p, miR-154-5p, miR-200c-3p, miR-200c-5p, miR-290, miR-301a-3p, miR-301a-5p, miR-302a-3p, miR-302a-5p, miR-302b-3p, miR-302b-5p, miR-302c-3p, miR-302c-5p, miR-302d-3p, miR-302d-5p, miR-302e, miR-367-3p, miR-367-5p, miR-369-3p, miR-369-5p, miR-370, miR-371, miR-373, miR-380-5p, miR-423-3p, miR-423-5p, miR-486-5p, miR-520c-3p, miR-548e, miR-548f, miR-548g-3p, miR-548g-5p, miR-548i, miR-548k, miR-548l, miR-548m, miR-548n, miR-548o-3p, miR-548o-5p, miR-548p, miR-664a-3p, miR-664a-5p, miR-664b-3p, miR-664b-5p, miR-766-3p, miR-766-5p, miR-885-3p, miR-885-5p, miR-93-3p, miR-93-5p, miR-941, miR-96-3p, miR-96-5p, miR-99b-3p and miR-99b-5p. Many predicted novel miRNAs are discovered by deep sequencing of human embryonic stem cells (e.g., Morin RD et al., Genome Res, 2008, 18, 610-621; Goff LA et al.,). PLoS One, 2009, 4:e7192; Bar M et al., Stem cells, 2008, 26, 2496-2505 (each of these is incorporated herein by reference in its entirety).

[0327] In some embodiments, the binding sites for embryonic stem cell-specific miRNAs are included in or removed from the 3’UTR of the polynucleotides of the present disclosure to regulate embryonic stem cell development and / or differentiation, inhibit the senescence of stem cells in a degenerative state (e.g., a degenerative disease), or stimulate the senescence and apoptosis of stem cells in a diseased state (e.g., cancer stem cells).

[0328] Many miRNA expression studies have been conducted to profile differential expression of miRNAs in various cancer cells / tissues and other diseases. Some miRNAs are abnormally overexpressed in specific cancer cells, while other miRNAs are underexpressed. For example, miRNAs are differentially expressed in cancer cells (WO2008 / 154098, US2013 / 0059015, US2013 / 0042333, WO2011 / 157294); cancer stem cells (US2012 / 0053224); pancreatic cancer and diseases (US2009 / 0131348, US2011 / 0171646, US2010 / 0286232, US8389210); asthma and inflammation (US8415096); prostate cancer (US2013 / 0053264); hepatocellular carcinoma (WO2012 / 151212, US2012 / 0329672, WO2008 / 054828, US8252538); germ cell carcinoma (WO2011 / 076143, WO2013 / 033640, WO2009 / 070653, US2010 / 0323357); cutaneous T cell lymphoma (WO2013 / 011378); colorectal cancer cells (WO2011 / 0281756, WO2011 / 076142); cancer-positive lymph nodes (WO2009 / 100430, US2009 / 0263803); nasopharyngeal cancer (EP2112235); chronic obstructive pulmonary disease (US2012 / 0264626, US2013 / 0053263); thyroid cancer (WO2013 / 066678); ovarian cancer cells (US2012 / 0309645, WO2011 / 095623); breast cancer cells (WO2008 / 154098, WO2007 / 081740, US2012 / 0214699), leukemia and lymphoma (WO2008 / 073915, US2009 / 0092974, US2012 / 0316081, US2012 / 0283310, WO2010 / 018563), and the respective contents of which are hereby incorporated by reference in their entirety.

[0329] As a non-limiting example, the miRNA binding sites of miRNAs overexpressed in certain cancers and / or tumor cells are removed from the 3’UTR of the polynucleotides of the present disclosure, and the expression suppressed by the miRNAs overexpressed in cancer cells can be restored, thus improving the corresponding biological functions such as, for example, transcriptional stimulation and / or repression, cell cycle arrest, apoptosis and cell death. Normal cells and tissues in which the expression of miRNAs is not upregulated are not affected.

[0330] MiRNAs can also regulate complex biological processes such as angiogenesis (e.g., miR-132) (Anand and Cheresh Curr Opin Hematol 2011 18:171-176). In the polynucleotides of the present disclosure, miRNA binding sites involved in such processes can be removed or introduced in order to tailor the expression of the polynucleotides to biologically relevant cell types or relevant biological processes. In this regard, the polynucleotides of the present disclosure are defined as auxotrophic polynucleotides.

[0331] Stem-loop A polynucleotide (e.g., mRNA) may contain a stem-loop, such as, but not limited to, a histone stem-loop. The stem-loop may be a nucleotide sequence of about 25 or about 26 nucleotides in length, such as those described in International Patent Publication WO2013 / 103659, which is incorporated herein by reference, but not limited thereto. The histone stem-loop may be located 3' relative to the coding region (e.g., at the 3' end of the coding region). As a non-limiting example, the stem-loop may be located at the 3' end of the polynucleotide described herein. In some cases, the polynucleotide (e.g., mRNA) contains more than one stem-loop (e.g., two stem-loops). Examples of stem-loop sequences are described in International Patent Publications WO2012 / 019780 and WO2015 / 02667, the stem-loop sequences of which are incorporated herein by reference. In some cases, the polynucleotide contains the stem-loop sequence, CAAAGGCTCTTTTCAGAGCCACCA (SEQ ID NO: 1). In other cases, the polynucleotide contains the stem-loop sequence, CAAAGGCUCUUUUCAGAGCCACCA (SEQ ID NO: 2).

[0332] The stem-loop may be located in the second terminal region of the polynucleotide. As a non-limiting example, the stem-loop may be located within the untranslated region (e.g., 3'-UTR) of the second terminal region.

[0333] In some cases, a polynucleotide, such as, but not limited to, mRNA containing a histone stem-loop, may be stabilized by the addition of a 3'-stabilizing region (e.g., a 3'-stabilizing region containing at least one chain-terminating nucleoside). Without wishing to be bound by theory, the addition of at least one chain-terminating nucleoside can delay the degradation of the polynucleotide and thus increase the half-life of the polynucleotide.

[0334] In other cases, polynucleotides, such as but not limited to mRNA containing a histone stem loop, can be stabilized by modification of the 3' region of the polynucleotide that can prevent and / or inhibit the addition of oligo(U) (see, for example, International Patent Publication WO2013 / 103659).

[0335] In still other cases, polynucleotides, such as but not limited to mRNA containing a histone stem loop, can be stabilized by the addition of oligonucleotides terminating with 3'-deoxynucleoside, 2',3'-dideoxynucleoside, 3'-O-methyl nucleoside, 3'-O-ethyl nucleoside, 3'-arabinoside, and other alternative nucleosides known in the art and / or described herein.

[0336] In some cases, the polynucleotides of the present disclosure may include a histone stem loop, a polyA region, and / or a 5' cap structure. The histone stem loop may be before and / or after the polyA region. Polynucleotides containing a histone stem loop and polyA region sequences may include the chain-terminating nucleosides described herein.

[0337] In other examples, the polynucleotides of the present disclosure may include a histone stem loop and a 5' cap structure. The 5' cap structure can include, but is not limited to, those described herein and / or known in the art.

[0338] In some cases, the conserved stem loop region may include the miR sequences described herein. As a non-limiting example, the stem loop region may include the seed sequence of the miR sequences described herein. In another non-limiting example, the stem loop region may include the miR-122 seed sequence.

[0339] In certain examples, the conserved stem loop region may include the miR sequences described herein and may also include the TEE sequence.

[0340] In some cases, incorporation of the miR sequence and / or the TEE sequence may change the shape of the stem-loop region and increase and / or decrease translation. (See, for example, Kedde et al. A Pumilio-induced RNA structure switch in p27-3’UTR, which is incorporated herein by reference in its entirety controls miR-221 and miR- 22 accessibility. Nature Cell Biology. 2010).

[0341] The polynucleotide may comprise at least one histone stem-loop and a polyA region or polyadenylation signal. Non-limiting examples of polynucleotide sequences encoding at least one histone stem-loop and a polyA region or polyadenylation signal are described in International Patent Publications WO2013 / 120497, WO2013 / 120629, WO2013 / 120500, WO2013 / 120627, WO2013 / 120498, WO2013 / 120626, WO2013 / 120499 and WO2013 / 120628, and each of these sequences is incorporated herein by reference. In certain cases, the polynucleotide encoding a histone stem-loop and a polyA region or polyadenylation signal may encode a pathogen antigen or a fragment thereof, such as the polynucleotide sequences described in International Patent Publications WO2013 / 120499 and WO2013 / 120628, both of which sequences are incorporated herein by reference. In other cases, the polynucleotide encoding a histone stem-loop and a polyA region or polyadenylation signal may encode a therapeutic protein, such as the polynucleotide sequences described in International Patent Publications WO2013 / 120497 and WO2013 / 120629, both of which sequences are incorporated herein by reference. In some cases, the polynucleotide encoding a histone stem-loop and a polyA region or polyadenylation signal may encode a tumor antigen or a fragment thereof, such as the polynucleotide sequences described in International Patent Publications WO2013 / 120500 and WO2013 / 120627, both of which sequences are incorporated herein by reference. In other cases, the polynucleotide encoding a histone stem-loop and a polyA region or polyadenylation signal may encode an allergen antigen or an autoimmune autoantigen, such as the polynucleotide sequences described in International Patent Publications WO2013 / 120498 and WO2013 / 120626, both of which sequences are incorporated herein by reference.

[0342] PolyA region A polynucleotide or nucleic acid (e.g., mRNA) may contain a polyA sequence and / or a polyadenylation signal. The polyA sequence may be composed entirely or mostly of adenine nucleotides or analogs or derivatives thereof. The polyA sequence may be a tail located adjacent to the 3' untranslated region of the nucleic acid.

[0343] During RNA processing, typically a long chain of adenosine nucleotides (the polyA region) is added to the messenger RNA (mRNA) molecule to enhance the stability of the molecule. Immediately after transcription, the 3' end of the transcript is cleaved to expose a 3'-hydroxy. Then, polyA polymerase adds a chain of adenosine nucleotides to the RNA. This process is called polyadenylation and adds a polyA region that is 100 - 250 residues in length.

[0344] The length of the native polyA region may provide certain advantages to the alternative polynucleotides of the present disclosure.

[0345] Generally, the length of the polyA region of the present disclosure is at least 30 nucleotides in length. In another embodiment, the polyA region is at least 35 nucleotides in length. In another embodiment, the length is at least 40 nucleotides. In another embodiment, the length is at least 45 nucleotides. In another embodiment, the length is at least 55 nucleotides. In another embodiment, the length is at least 60 nucleotides. In another embodiment, the length is at least 70 nucleotides. In another embodiment, the length is at least 80 nucleotides. In another embodiment, the length is at least 90 nucleotides. In another embodiment, the length is at least 100 nucleotides. In another embodiment, the length is at least 120 nucleotides. In another embodiment, the length is at least 140 nucleotides. In another embodiment, the length is at least 160 nucleotides. In another embodiment, the length is at least 180 nucleotides. In another embodiment, the length is at least 200 nucleotides. In another embodiment, the length is at least 250 nucleotides. In another embodiment, the length is at least 300 nucleotides. In another embodiment, the length is at least 350 nucleotides. In another embodiment, the length is at least 400 nucleotides. In another embodiment, the length is at least 450 nucleotides. In another embodiment, the length is at least 500 nucleotides. In another embodiment, the length is at least 600 nucleotides. In another embodiment, the length is at least 700 nucleotides. In another embodiment, the length is at least 800 nucleotides. In another embodiment, the length is at least 900 nucleotides. In another embodiment, the length is at least 1000 nucleotides. In another embodiment, the length is at least 1100 nucleotides. In another embodiment, the length is at least 1200 nucleotides. In another embodiment, the length is at least 1300 nucleotides. In another embodiment, the length is at least 1400 nucleotides. In another embodiment, the length is at least 1500 nucleotides.In another embodiment, the length is at least 1600 nucleotides. In another embodiment, the length is at least 1700 nucleotides. In another embodiment, the length is at least 1800 nucleotides. In another embodiment, the length is at least 1900 nucleotides. In another embodiment, the length is at least 2000 nucleotides. In another embodiment, the length is at least 2500 nucleotides. In another embodiment, the length is at least 3000 nucleotides.

[0346] In some cases, the polyA region may be 80 nucleotides, 120 nucleotides, or 160 nucleotides in length on the alternative polynucleotide molecule described herein.

[0347] In other examples, the polyA region may be 20, 40, 80, 100, 120, 140, or 160 nucleotides in length on the alternative polynucleotide molecule described herein.

[0348] In some cases, the polyA region is designed relative to the length of the entire alternative polynucleotide. This design may be based on the length of the coding region of the alternative polynucleotide, the length of a particular feature or region of the alternative polynucleotide (such as mRNA), or the length of the final product expressed from the alternative polynucleotide. When relative to any feature of the alternative polynucleotide (for example, other than the mRNA portion containing the polyA region), the polyA region may be 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% larger in length than the additional feature. The polyA region may also be designed as part of the alternative polynucleotide to which it belongs. In this context, the polyA region may be 10, 20, 30, 40, 50, 60, 70, 80, or 90% or more of the full length of the construct, or of the full length of the construct minus the polyA region.

[0349] In certain cases, enhanced expression can be achieved using a modified binding site for polyA-binding protein and / or conjugation of a polynucleotide (e.g., mRNA). The modified binding site may be a sensor sequence that can function as a binding site for a ligand in the local microenvironment of the polynucleotide (e.g., mRNA). As a non-limiting example, a polynucleotide (e.g., mRNA) may contain at least one modified binding site to alter the binding affinity of polyA-binding protein (PABP) and its analogs. Incorporation of at least one modified binding site may increase the binding affinity of PABP and its analogs.

[0350] Furthermore, alternative nucleotides at the 3' end of the polyA region can be used to bind multiple different polynucleotides (e.g., mRNA) together via the 3' end to PABP (polyA-binding protein). Transfection experiments can be performed in relevant cell lines, and protein production can be assayed by ELISA at 12 hours, 24 hours, 48 hours, 72 hours, and 7 days after transfection. As a non-limiting example, transfection experiments can be used to evaluate the effect on the binding affinity of PABP or its analogs as a result of the addition of at least one modified binding site.

[0351] In certain cases, the polyA region may be used to regulate translation initiation. Without wishing to be bound by theory, the polyA region may recruit PABP, and PABP may be able to interact with the translation initiation complex and thus may be essential for protein synthesis.

[0352] In some cases, the polyA region can also be used in the present disclosure to protect against 3'-5'-exonuclease digestion.

[0353] In some cases, the polynucleotide (e.g., mRNA) may contain a polyA-G cassette. The G cassette is a cyclic hydrogen-bonded array of four guanosine nucleotides that can be formed by G-rich sequences in both DNA and RNA. In this embodiment, the G cassette is incorporated at the end of the polyA region. The resulting polynucleotide (e.g., mRNA) can be assayed for other parameters including stability, protein production, and half-life at various time points. The polyA-G cassette has been found to result in protein production comparable to at least 75% of the protein production seen when using only a 120-nucleotide polyA region.

[0354] In some cases, the polynucleotide (e.g., mRNA) may contain a polyA region and may be stabilized by the addition of a 3' stabilizing region. The polynucleotide (e.g., mRNA) having a polyA region may further contain a 5' cap structure.

[0355] In other cases, the polynucleotide (e.g., mRNA) may contain a polyA-G cassette. The polynucleotide (e.g., mRNA) having a polyA-G cassette may further contain a 5' cap structure.

[0356] In some cases, the 3'-stabilizing region that can be used to stabilize a polynucleotide (e.g., mRNA) containing a polyA region or a polyA-G cassette may be those described in International Patent Publication WO2013 / 103659, but is not limited thereto, and the polyA region and the polyA-G cassette are incorporated herein by reference. In other cases, the 3'-stabilizing regions that can be used in the present disclosure include chain-terminating nucleosides such as 3'-deoxyadenosine (cordycepin), 3'-deoxyuridine, 3'-deoxycytidine, 3'-deoxyguanosine, 3'-deoxythymidine, 2',3'-dideoxynucleoside, 2',3'-dideoxyadenosine, 2',3'-dideoxyuridine, 2',3'-dideoxycytidine, 2',3'-dideoxyguanosine, 2',3'-dideoxythymidine, 2'-deoxynucleoside, or O-methylnucleoside.

[0357] In other cases, polynucleotides such as, but not limited to, mRNA containing a polyA region or a polyA-G cassette can be stabilized by modification of the 3' region of the polynucleotide that can prevent and / or inhibit the addition of oligo(U) (see, e.g., International Patent Publication No. WO2013 / 103659).

[0358] In still other cases, polynucleotides such as, but not limited to, mRNA containing a polyA region or a polyA-G cassette can be stabilized by the addition of oligonucleotides terminated with 3'-deoxynucleoside, 2',3'-dideoxynucleoside, 3'-O-methylnucleoside, 3'-O-ethylnucleoside, 3'-arabinoside, and other alternative nucleosides known in the art and / or described herein.

[0359] Chain-terminating nucleoside The nucleic acid may contain a chain-terminating nucleoside. For example, chain-terminating nucleosides may include nucleosides deoxygenated at their sugar 2' and / or 3' positions. Such species may include 3'-deoxyadenosine (cordycepin), 3'-deoxyuridine, 3'-deoxycytosine, 3'-deoxyguanosine, 3'-deoxythymidine, and 2',3'-dideoxynucleosides such as 2',3'-dideoxyadenosine, 2',3'-dideoxyuridine, 2',3'-dideoxycytosine, 2',3'-dideoxyguanosine, and 2',3'-dideoxythymidine.

[0360] Genome editing technology In some embodiments, the nucleic acid is suitable for genome editing technology.

[0361] In some embodiments, the genome editing technology is clustered regularly interspaced short palindromic repeats (CRISPR) or transcription activator-like effector nuclease (TALEN).

[0362] In some embodiments, the nucleic acid is at least one nucleic acid suitable for genome editing technology selected from the group consisting of CRISPR RNA (crRNA), trans-activating crRNA (tracrRNA), single-guide RNA (sgRNA), and DNA repair templates.

[0363] Other components The LNP can include one or more components in addition to the components described in the preceding section. For example, the LNP may include one or more small hydrophobic molecules such as vitamins (e.g., vitamin A or vitamin E) or sterols.

[0364] Lipid nanoparticles may also contain one or more permeation enhancer molecules, sugars, polymers, surface modifiers, or other components. The permeation enhancer molecules may be, for example, the molecules described in U.S. Patent Application Publication No. 2005 / 0222064. Carbohydrates can include monosaccharides (e.g., glucose) and polysaccharides (e.g., glycogen and its derivatives and analogs).

[0365] The polymer may be included and / or used to encapsulate or partially encapsulate the LNP. The polymer can be biodegradable and / or biocompatible. The polymer can be selected from, but not limited to, polyamines, polyethers, polyamides, polyesters, polyurethanes, polyureas, polycarbonates, polystyrenes, polyimides, polysulfones, polyurethanes, polyacetylenes, polyethylene, polyethyleneimine, polyisocyanates, polyacrylates, polymethacrylates, polyacrylonitriles, and polyarylates. For example, the polymer may include poly(caprolactone) (PCL), ethylene vinyl acetate polymer (EVA), poly(lactic acid) (PLA), poly(L-lactic acid) (PLLA), poly(glycolic acid) (PGA), poly(lactic-co-glycolic acid) (PLGA), poly(L-lactic-co-glycolic acid) (PLLGA), poly(D,L-lactide) (PDLA), poly(L-lactide) (PLLA), poly(D,L-lactide-co-caprolactone), poly(D,L-lactide-co-caprolactone-co-glycolide), poly(D,L-lactide-co-PEO-co-D,L-lactide), poly(D,L-lactide-co-PPO-co-D,L-lactide), polyalkyl cyanoacrylate, polyurethane, poly-L-lysine (PLL), hydroxypropyl methacrylate (HPMA), polyethylene glycol, poly-L-glutamic acid, poly(hydroxy acid), polyanhydride, polyorthoester, poly(ester amide), polyamide, poly(ester ether), polycarbonate, polyalkylene such as polyethylene and polypropylene, polyalkylene glycol such as poly(ethylene glycol) (PEG), polyalkylene oxide (PEO), polyalkylene terephthalate such as poly(ethylene terephthalate), polyvinyl alcohol (PVA), polyvinyl ether, polyvinyl ester such as poly(vinyl acetate), polyvinyl halide such as poly(vinyl chloride) (PVC), polyvinyl pyrrolidone (PVP), polysiloxane, polystyrene, polyurethane, derivatized cellulose such as alkyl cellulose, hydroxyalkyl cellulose, cellulose ether, cellulose ester, nitrocellulose, hydroxypropyl cellulose, carboxymethyl cellulose, poly(methyl (meth)acrylate) (PMMA), poly(ethyl (meth)acrylate), poly(butyl (meth)acrylate), poly(isobutyl (meth)acrylate), poly(hexyl (meth)acrylate), poly(isodecyl (meth)acrylate), poly(lauryl (meth)acrylate), poly(phenyl (meth)acrylate), poly(methyl acrylate), poly(isopropyl acrylate), poly(isobutyl acrylate), poly(octadecyl acrylate) and other polymers of acrylic acid and their copolymers and mixtures, polydioxanone and its copolymers, polyhydroxyalkanoate, polypropylene fumarate, polyoxymethylene, poloxamer, poloxamine, poly(ortho)ester, poly(butyric acid), poly(valeric acid), poly(lactide-co-caprolactone), trimethylene carbonate, poly(A'-acryloylmorpholine) (PAcM), poly(2-methyl-2-oxazoline) (PMOX), poly(2-ethyl-2-oxazoline) (PEOZ), and polyglycerol may be included.,

[0366] Surface modifiers can include, but are not limited to, anionic proteins (e.g., bovine serum albumin), surfactants (e.g., cationic surfactants such as dimethyldioctadecylammonium bromide), sugars or sugar derivatives (e.g., cyclodextrin), nucleic acids, polymers (e.g., heparin, polyethylene glycol, and poloxamer), mucolytics (e.g., acetylcysteine, mugwort, bromelain, papain, clerodendrum, bromhexine, carbocysteine, epratrizone, mesna, ambroxol, sobrerol, domiodol, lectostain, streptonin, tiopronin, gelsolin, thymosin β4, dornase alfa, nertenexin, and erdostain), and DNase (e.g., rhDNase). The surface modifier can be disposed within the nanoparticles and / or on the surface of the LNP (e.g., by coating, adsorption, covalent bonding, or other processes).

[0367] The LNP may also include one or more functionalized lipids. For example, the lipid can be functionalized with an alkyne group and can undergo a cycloaddition reaction when exposed to an azide under appropriate reaction conditions. In particular, the lipid bilayer may be thus functionalized with one or more groups useful for promoting membrane permeation, cell recognition, or imaging. The surface of the LNP may also be conjugated with one or more useful antibodies. Functional groups and conjugates useful for targeted cell delivery, imaging, and membrane permeation are well known in the art.

[0368] In addition to these components, the lipid nanoparticles may contain any substance useful in a pharmaceutical composition. For example, the lipid nanoparticles may contain one or more pharmaceutically acceptable excipients or accessory components such as, but not limited to, one or more solvents, dispersion media, diluents, dispersion aids, suspending aids, granulation aids, disintegrants, fillers, glidants, liquid vehicles, binders, surfactants, isotonic agents, thickeners or emulsifiers, buffering agents, lubricants, oils, protective agents, and other species. Excipients such as waxes, butters, colorants, coating agents, flavoring agents, perfumes, etc. may also be included. Pharmaceutically acceptable excipients are well known in the art (see, for example, Remington’s The Science and Practice of Pharmacy, 21 st Edition, A. R. Gennaro;Lippincott, Williams & Wilkins, Baltimore, MD, 2006).

[0369] Examples of diluents can include, but are not limited to, calcium carbonate, sodium carbonate, calcium phosphate, dicalcium phosphate, calcium sulfate, calcium hydrogen phosphate, sodium phosphate lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, inositol, sodium chloride, dried starch, corn starch, powdered sugar, and / or combinations thereof. Granulating agents and dispersing agents can be selected from the non-limiting list consisting of potato starch, corn starch, tapioca starch, sodium starch glycolate, clay, alginic acid, guar gum, citrus pulp, agar, bentonite, cellulose and wood products, natural sponges, cation exchange resins, calcium carbonate, silicates, sodium carbonate, cross-linked polyvinylpyrrolidone (crospovidone), sodium carboxymethyl starch (sodium starch glycolate), carboxymethyl cellulose, cross-linked sodium carboxymethyl cellulose (croscarmellose), methyl cellulose, pregelatinized starch (starch 1500), microcrystalline starch, water-insoluble starch, calcium carboxymethyl cellulose, magnesium aluminum silicate (VEEGUM (registered trademark)), sodium lauryl sulfate, quaternary ammonium compounds, and / or combinations thereof.

[0370] Surfactants and / or emulsifiers include natural emulsifiers (e.g., gum acacia, agar, alginic acid, sodium alginate, tragacanth, condrox, cholesterol, xanthan, pectin, gelatin, egg yolk, casein, lanolin, cholesterol, wax, and lecithin), colloidal clays (e.g., bentonite [aluminum silicate] and VEEGUM® [magnesium aluminum silicate]), long-chain amino acid derivatives, high molecular weight alcohols (e.g., stearyl alcohol, cetyl alcohol, oleyl alcohol, triacetin monostearate, ethylene glycol distearate, glyceryl monostearate, and propylene glycol monostearate, polyvinyl alcohol), carbomers (e.g., carboxypolymethylene, polyacrylic acid, acrylic acid polymer, and carboxyvinyl polymer), carrageenan, cellulose derivatives (e.g., sodium carboxymethyl cellulose, powdered cellulose, hydroxymethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, methyl cellulose), sorbitan fatty acid esters (e.g., polyoxyethylene sorbitan monolaurate [TWEEN® 20], polyoxyethylene sorbitan [TWEEN® 60], polyoxyethylene sorbitan monooleate [TWEEN® 80], sorbitan monopalmitate [SPAN® 40], sorbitan monostearate [SPAN® 60], sorbitan tristearate [SPAN® 65], glyceryl monooleate, sorbitan monooleate [SPAN® 80]), polyoxyethylene esters (e.g., polyoxyethylene monostearate [MYRJ® 45], polyoxyethylene hydrogenated castor oil, polyethoxylated castor oil, polyoxymethylene stearate, and SOLUTOL®), sucrose fatty acid esters, polyethylene glycol fatty acid esters (e.g., CREMOPHOR®), polyoxyethylene ethers (e.g., polyoxyethylene lauryl ether [BRIJ® 30]), poly(vinyl pyrrolidone), diethylene glycol monolaurate, triethanolamine oleate, sodium oleate,Potassium oleate, ethyl oleate, oleic acid, ethyl laurate, sodium lauryl sulfate, PLURONIC® F68, POLOXAMER® 188, cetrimonium bromide, cetylpyridinium chloride, benzalkonium chloride, sodium docusate, and / or combinations thereof may be included, but are not limited thereto.

[0371] Binders include starch (e.g., corn starch and starch paste); gelatin; sugars (e.g., sucrose, glucose, dextrose, dextrin, molasses, lactose, lactitol, mannitol); natural and synthetic rubbers (acacia gum, sodium alginate, extract of Irish moss, panwar gum, ghatti gum, mucilage of isapol husk, carboxymethyl cellulose, methyl cellulose, ethyl cellulose, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, microcrystalline cellulose, cellulose acetate, poly(vinyl pyrrolidone), magnesium aluminum silicate (VEEGUM®), larch arabogalactan); alginates; polyethylene oxide; polyethylene glycol; inorganic calcium salts; silicic acid; polymethacrylate; waxes; water; alcohol; and combinations thereof, or any other suitable binder.

[0372] Examples of preservatives can include, but are not limited to, antioxidants, chelating agents, antibacterial preservatives, antifungal preservatives, alcohol preservatives, acidic preservatives, and / or other preservatives. Examples of antioxidants include, but are not limited to, alpha tocopherol, ascorbic acid, ascorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, monothioglycerol, potassium metabisulfite, propionic acid, propyl gallate, sodium ascorbate, sodium bisulfite, sodium metabisulfite, and / or sodium sulfite. Examples of chelating agents include ethylenediaminetetraacetic acid (EDTA), citric acid monohydrate, disodium edetate, dipotassium edetate, edetic acid, fumaric acid, malic acid, phosphoric acid, sodium edetate, tartaric acid, and / or trisodium edetate. Examples of antibacterial preservatives include, but are not limited to, benzalkonium chloride, benzethonium chloride, benzyl alcohol, bronopol, cetrimide, cetylpyridinium chloride, chlorhexidine, chlorobutanol, chlorocresol, chloroxylenol, cresol, ethyl alcohol, glycerin, hexetidine, imidurea, phenol, phenoxyethanol, phenylethyl alcohol, phenylmercuric nitrate, propylene glycol, and / or thimerosal. Examples of antifungal preservatives include, but are not limited to, butyl paraben, methyl paraben, ethyl paraben, propyl paraben, benzoic acid, hydroxybenzoic acid, potassium benzoate, potassium sorbate, sodium benzoate, sodium propionate, and / or sorbic acid. Examples of alcohol preservatives include, but are not limited to, ethanol, polyethylene glycol, benzyl alcohol, phenol, phenolic compounds, bisphenol, chlorobutanol, hydroxybenzoic acid, and / or phenylethyl alcohol. Examples of acidic preservatives include, but are not limited to, vitamin A, vitamin C, vitamin E, beta carotene, citric acid, acetic acid, dehydroascorbic acid, ascorbic acid, sorbic acid, and / or phytic acid.Other preservatives include, but are not limited to, tocopherol, tocopherol acetate, decyloxime mesylate, cetrimide, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), ethylenediamine, sodium lauryl sulfate (SLS), sodium laureth sulfate (SLES), sodium bisulfite, sodium metabisulfite, potassium sulfite, potassium metabisulfite, GLYDANT PLUS®, PHENONIP®, methylparaben, GERMALL® 115, GERMABEN® II, NEOLONE™, KATHON™, and / or EUXYL®.

[0373] Examples of buffers include, but are not limited to, citrate buffer, acetate buffer, phosphate buffer, ammonium chloride, calcium carbonate, calcium chloride, calcium citrate, calcium gluconate, calcium glycerophosphate, calcium lactate, calcium lactobionate, propanoic acid, calcium levulinate, pentanoic acid, dibasic calcium phosphate, phosphoric acid, tribasic calcium phosphate, calcium phosphate hydroxide, potassium acetate, potassium chloride, potassium gluconate, potassium mixture, dibasic potassium phosphate, monobasic potassium phosphate, potassium phosphate mixture, sodium acetate, sodium bicarbonate, sodium chloride, sodium citrate, sodium lactate, dibasic sodium phosphate, monobasic sodium phosphate, sodium phosphate mixture, tromethamine, amino sulfonic acid buffer (e.g., HEPES), magnesium hydroxide, aluminum hydroxide, alginic acid, pyrogen-free water, isotonic saline, Ringer's solution, ethyl alcohol, and / or combinations thereof. Lubricants can be selected from the non-limiting group consisting of magnesium stearate, calcium stearate, stearic acid, silica, talc, malt, glyceryl behenate, hydrogenated vegetable oil, polyethylene glycol, sodium benzoate, sodium acetate, sodium chloride, leucine, magnesium lauryl sulfate, sodium lauryl sulfate, and combinations thereof.

[0374] Examples of oils include almond, apricot kernel, avocado, babassu, bergamot, blackcurrant seed, borage, cade, camomile, canola, caraway, carnauba, castor, cinnamon, cocoa butter, coconut, cod liver, coffee, corn, cottonseed, emu, eucalyptus, evening primrose, fish, flaxseed, geraniol, gourd, grape seed, hazelnut, hyssop, isopropyl myristate, jojoba, kukui nut, lavandin, lavender, lemon, litsea cubeba, macadamia nut, meadowfoam seed, mink, nutmeg, olive, orange, orange raffia, palm, palm kernel, peach kernel, peanut, poppy seed, pumpkin seed, rapeseed, rice bran, rosemary, safflower, sandalwood, sasakania, savory, seabuckthorn, sesame, shea butter, silicone, soybean, sunflower, tea tree, thistle, camellia, vetiver, walnut, and wheat germ oil, as well as butyl stearate, tricaprylin, tricaprin, cyclomethicone, diethyl sebacate, dimethicone 360, simethicone, isopropyl myristate, mineral oil, octyldodecanol, oleyl alcohol, silicone oil, and / or combinations thereof, but are not limited thereto.

[0375] Formulations The formulations of the present disclosure include at least one lipid nanoparticle component. The lipid nanoparticles may include a lipid component and one or more additional components such as a therapeutic agent and / or a prophylactic agent such as a nucleic acid. The LNP can be designed for one or more specific uses or targets. The elements of the LNP can be selected based on a specific use or target and / or based on the effectiveness, toxicity, cost, ease of use, availability, or other characteristics of one or more of the elements. Similarly, a specific formulation of the LNP can be selected for a specific use or target, for example, according to the effectiveness and toxicity of a specific combination of elements. The effectiveness and tolerability of the LNP formulation may be affected by the stability of the formulation.

[0376] In some embodiments, the weight ratio of the modifier to the LNP is from about 0.0004:1 to about 100:1 (e.g., from about 0.001:1 to about 10:1, from about 0.001:1 to about 5:1, from about 0.001:1 to about 0.1:1, from about 0.005 to about 0.4:1, or from about 0.5:1 to about 4:1, from about 0.05:1 to about 5:1, from about 0.1:1 to about 5:1, or from about 0.05:1 to about 2.5:1, from about 1:1 to about 50:1, from about 2:1 to about 50:1, or from about 1:1 to about 25:1).

[0377] The lipid component of the LNP can include, for example, lipids according to formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId), or (IIe), phospholipids (such as unsaturated lipids like DOPE or DSPC), PEG lipids, and structural lipids. The lipid component of the LNP can include, for example, lipids according to formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId), or (IIe), phospholipids (such as unsaturated lipids like DOPE or DSPC), and structural lipids. The elements of the lipid component may be provided in specific fractions.

[0378] In some embodiments, the lipid component of the LNP includes lipids, phospholipids, PEG lipids, and structural lipids according to formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId), or (IIe). In some embodiments, the lipid component of the lipid nanoparticles includes about 30 mol% to about 60 mol% of the compound of formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId), or (IIe), about 0 mol% to about 30 mol% of phospholipids, about 18.5 mol% to about 48.5 mol% of structural lipids, and about 0 mol% to about 10 mol% of PEG lipids, provided that the total mol% does not exceed 100%. In some embodiments, the lipid component of the lipid nanoparticles includes about 35 mol% to about 55 mol% of the compound of formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId), or (IIe), about 5 mol% to about 25 mol% of phospholipids, about 30 mol% to about 40 mol% of structural lipids, and about 0 mol% to about 10 mol% of PEG lipids. In certain embodiments, the lipid component includes about 50 mol% of said compound, about 10 mol% of phospholipids, about 38.5 mol% of structural lipids, and about 1.5 mol% of PEG lipids. In another embodiment, the lipid component includes about 40 mol% of said compound, about 20 mol% of phospholipids, about 38.5 mol% of structural lipids, and about 1.5 mol% of PEG lipids. In some embodiments, the phospholipid may be DOPE or DSPC. In other embodiments, the PEG lipid may be PEG-DMG and / or the structural lipid may be cholesterol.

[0379] Lipid nanoparticles can be designed for one or more specific uses or targets. For example, LNPs may be designed to deliver therapeutic and / or prophylactic agents such as RNA to specific cells, tissues, organs, or systems or groups within a mammalian body. The physicochemical properties of the lipid nanoparticles can be altered to enhance selectivity for a particular body target. For example, the particle size can be adjusted based on the fenestration sizes of various organs. The therapeutic and / or prophylactic agents included in the LNP can also be selected based on one or more desired delivery targets. For example, the therapeutic and / or prophylactic agents can be selected for a particular indication, condition, disease, or disorder, and / or for delivery to a specific cell, tissue, organ, or its system or group (e.g., local or specific delivery). In some embodiments, the LNP may include mRNA encoding a polypeptide of interest that can be translated intracellularly to produce the polypeptide of interest. Such compositions may be designed to be specifically delivered to a particular organ. In some embodiments, the composition may be designed to be specifically delivered to the liver of a mammal.

[0380] The amount of therapeutic and / or prophylactic agent in the LNP can depend on the size, composition, desired target and / or use, or other properties of the lipid nanoparticle, as well as the properties of the therapeutic and / or prophylactic agent. For example, the amount of RNA useful in the LNP can depend on the size, sequence, and other properties of the RNA. The relative amounts of the therapeutic and / or prophylactic agent and other elements (e.g., lipids) in the LNP can also vary. In some embodiments, the wt / wt ratio of the lipid component to the therapeutic and / or prophylactic agent such as nucleic acid in the LNP can be from about 5:1 to about 60:1, such as 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 25:1, 30:1, 35:1, 40:1, 45:1, 50:1, and 60:1. For example, the wt / wt ratio of the lipid component to the therapeutic and / or prophylactic agent can be from about 10:1 to about 40:1. In some embodiments, the wt / wt ratio is about 20:1. The amount of the therapeutic and / or prophylactic agent in the LNP can be measured, for example, using absorption spectroscopy (e.g., ultraviolet-visible spectroscopy).

[0381] In some embodiments, the LNP contains one or more RNAs, and the one or more RNAs, lipids, and their amounts can be selected to provide a specific N:P ratio. The N:P ratio of the composition refers to the molar ratio of the number of nitrogen atoms in one or more lipids to the number of phosphate groups in the RNA. Generally, a low N:P ratio is preferred. The one or more RNAs, lipids, and their amounts can be selected to provide an N:P ratio of about 2:1 to about 30:1, such as 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 12:1, 14:1, 16:1, 18:1, 20:1, 22:1, 24:1, 26:1, 28:1, or 30:1. In some embodiments, the N:P ratio is from about 2:1 to about 8:1. In other embodiments, the N:P ratio is from about 5:1 to about 8:1. For example, the N:P ratio can be about 5.0:1, about 5.5:1, about 5.67:1, about 6.0:1, about 6.5:1, or about 7.0:1. For example, the N:P ratio can be about 5.67:1.

[0382] In some embodiments, formulations comprising LNPs may further comprise salts such as chloride salts.

[0383] In some embodiments, formulations comprising LNPs may further comprise sugars such as disaccharides. In some embodiments, the formulation further comprises sugar but does not comprise salts such as chloride salts.

[0384] Physical properties The properties of LNPs depend on their components. For example, LNPs containing cholesterol as a structural lipid may have different properties from LNPs containing different structural lipids. Similarly, the properties of LNPs may depend on the absolute or relative amounts of their components. For example, LNPs containing a higher mole fraction of phospholipids may have different properties from LNPs containing a lower mole fraction of phospholipids. The properties may also vary depending on the method and conditions of preparation of the lipid nanoparticles.

[0385] Lipid nanoparticles can be characterized in various ways. For example, microscopy (e.g., transmission electron microscopy or scanning electron microscopy) can be used to examine the morphology and size distribution of LNPs. Dynamic light scattering or potentiometry (e.g., potentiometric titration) can be used to measure zeta potential. Dynamic light scattering can also be utilized to determine the particle size. Instruments such as the Zetasizer Nano ZS (Malvern Instruments Ltd, Malvern, Worcestershire, UK) can be used to measure multiple properties of LNPs such as particle size, polydispersity index, and zeta potential.

[0386] The average size of the LNPs can be in the range of several tens of nm to several hundreds of nm, for example, measured by dynamic light scattering (DLS). For example, the average size can be from about 40 nm to about 150 nm, such as about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm. In some embodiments, the average size of the LNPs can be from about 50 nm to about 100 nm, from about 50 nm to about 90 nm, from about 50 nm to about 80 nm, from about 50 nm to about 70 nm, from about 50 nm to about 60 nm, from about 60 nm to about 100 nm, from about 60 nm to about 90 nm, from about 60 nm to about 80 nm, from about 60 nm to about 70 nm, from about 70 nm to about 100 nm, from about 70 nm to about 90 nm, from about 70 nm to about 80 nm, from about 80 nm to about 100 nm, from about 80 nm to about 90 nm, or from about 90 nm to about 100 nm. In some embodiments, the average size of the LNPs can be from about 70 nm to about 100 nm. In certain embodiments, the average size can be about 80 nm. In other embodiments, the average size can be about 100 nm.

[0387] The LNPs may be relatively homogeneous. The polydispersity index can be used to indicate the uniformity of the LNPs, such as the particle size distribution of the lipid nanoparticles. A small (e.g., less than 0.3) polydispersity index generally indicates a narrow particle size distribution. The LNPs can have a polydispersity index of about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of the LNPs can be from about 0.10 to about 0.20.

[0388] The zeta potential of the LNP can be used to indicate the electrokinetic potential of the composition. For example, the zeta potential can represent the surface charge of the LNP. Lipid nanoparticles with relatively low positive or negative charges are generally desirable because species with higher charges may interact undesirably with cells, tissues, and other elements in the body. In some embodiments, the zeta potential of the LNP is from about -10 mV to about +20 mV, from about -10 mV to about +15 mV, from about -10 mV to about +10 mV, from about -10 mV to about +5 mV, from about -10 mV to about 0 mV, from about -10 mV to about -5 mV, from about -5 mV to about +20 mV, from about -5 mV to about +15 mV, from about -5 mV to about +10 mV, from about -5 mV to about +5 mV, from about -5 mV to about 0 mV, from about 0 mV to about +20 mV, from about 0 mV to about +15 mV, from about 0 mV to about +10 mV, from about 0 mV to about +5 mV, from about +5 mV to about +20 mV, from about +5 mV to about +15 mV, or from about +5 mV to about +10 mV.

[0389] The efficiency of encapsulation of therapeutic and / or prophylactic agents such as nucleic acids represents the amount of therapeutic and / or prophylactic agent encapsulated or otherwise bound to the LNP after preparation, compared to the initial amount provided. The encapsulation efficiency is desirably high (e.g., close to 100%). The encapsulation efficiency can be measured, for example, by comparing the amount of therapeutic and / or prophylactic agent in a solution containing lipid nanoparticles before and after milling the lipid nanoparticles with one or more organic solvents or surfactants. Fluorescence can be used to measure the amount of free therapeutic and / or prophylactic agent (e.g., RNA) in the solution. For the lipid nanoparticles described herein, the encapsulation efficiency of the therapeutic and / or prophylactic agent can be at least 50%, such as 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency can be at least 80%. In some embodiments, the encapsulation efficiency can be at least 90%.

[0390] The LNP may optionally include one or more coatings. For example, the LNP may be formulated into a capsule, film, or tablet having a coating. Capsules, films, or tablets containing the compositions described herein may have any useful size, tensile strength, hardness, or density.

[0391] Pharmaceutical composition Formulations containing lipid nanoparticles can be formulated wholly or in part as pharmaceutical compositions. The pharmaceutical composition may include one or more lipid nanoparticles. For example, the pharmaceutical composition may include one or more lipid nanoparticles containing one or more different therapeutic and / or prophylactic agents. The pharmaceutical composition may further include one or more pharmaceutically acceptable excipients or adjuncts as described herein. General guidelines regarding the formulation and manufacture of pharmaceutical compositions and medicaments are available, for example, in Remington’s The Science and Practice of Pharmacy, 21 st Edition, A. R. Gennaro; Lippincott, Williams & Wilkins, Baltimore, MD, 2006. Conventional excipients and adjuncts can be used in any pharmaceutical composition, except where any conventional excipient or adjunct is incompatible with one or more components of the LNP in the formulation. An excipient or adjunct may be incompatible with a component of the LNP in the formulation if, in combination with the component or LNP, it may cause an undesirable biological effect or otherwise a harmful effect.

[0392] In some embodiments, one or more excipients or co - components may constitute more than 50% of the total mass or volume of the pharmaceutical composition comprising the LNPs. For example, one or more excipients or co - components may constitute 50%, 60%, 70%, 80%, 90%, or more of pharmaceutical convention. In some embodiments, the pharmaceutically acceptable excipients are at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% pure. In some embodiments, the excipients are approved for human and veterinary use. In some embodiments, the excipients are approved by the US Food and Drug Administration. In some embodiments, the excipients are of pharmaceutical grade. In some embodiments, the excipients meet the standards of the United States Pharmacopeia (USP), European Pharmacopeia (EP), British Pharmacopeia, and / or International Pharmacopeia.

[0393] The relative amounts of one or more lipid nanoparticles, one or more pharmaceutically acceptable excipients, and / or any additional components in the pharmaceutical composition according to the present disclosure vary depending on their identity, size, and / or the condition of the subject being treated, and further depend on the route by which the composition is administered. By way of example, the pharmaceutical composition may comprise 0.1% - 100% (wt / wt) of one or more lipid nanoparticles. As another example, the pharmaceutical composition may comprise 0.1% - 15% (wt / vol) of one or more amphiphilic polymers (e.g., 0.5%, 1%, 2.5%, 5%, 10%, or 12.5% w / v).

[0394] In some embodiments, the lipid nanoparticles and / or pharmaceutical compositions of the present disclosure are refrigerated or frozen for storage and / or transportation (e.g., at a temperature of about -150°C to about 0°C or about -80°C to about -20°C (e.g., about -5°C, -10°C, -15°C, -20°C, -25°C, -30°C, -40°C, -50°C, -60°C, -70°C, -80°C, -90°C, -130°C, or -150°C), such as stored at a temperature below 4°C). For example, a pharmaceutical composition comprising one or more lipid nanoparticles is a solution or solid (e.g., by lyophilization) that is refrigerated for storage and / or transportation, for example, at about -20°C, -30°C, -40°C, -50°C, -60°C, -70°C, or -80°C. In some embodiments, the present disclosure also relates to a method of increasing the stability of lipid nanoparticles, for example, by storing the lipid nanoparticles and / or their pharmaceutical compositions at a temperature below 4°C, such as about -150°C to about 0°C or about -80°C to about -20°C, for example, about -5°C, -10°C, -15°C, -20°C, -25°C, -30°C, -40°C, -50°C, -60°C, -70°C, -80°C, -90°C, -130°C, or -150°C.

[0395] The lipid nanoparticles and / or pharmaceutical compositions comprising one or more lipid nanoparticles can be administered to any patient or subject, including a patient or subject who may benefit from the therapeutic effects provided by the delivery of a therapeutic and / or prophylactic agent to one or more specific cells, tissues, organs, or systems or groups, such as the renal system. The descriptions of the lipid nanoparticles and pharmaceutical compositions comprising lipid nanoparticles provided herein are primarily directed to compositions suitable for administration to humans, but one of ordinary skill in the art will understand that such compositions are generally suitable for administration to any other mammal. Modifications of compositions suitable for administration to humans to render them suitable for administration to various animals are well understood, and an ordinary veterinary pharmacologist can design and / or perform such modifications, if any, with routine experimentation. Subjects to which administration of the composition is contemplated include humans, other primates, and other mammals, including, but not limited to, commercially relevant mammals such as cows, pigs, horses, sheep, cats, dogs, mice, and / or rats.

[0396] A pharmaceutical composition comprising one or more lipid nanoparticles can be prepared by any method known in the art of pharmacology or developed in the future. Generally, such preparation methods include combining the active ingredient with excipients and / or one or more other auxiliary components, and then, if necessary or as desired, dividing, shaping, and / or packaging the product into the desired single-dose units or multiple-dose units.

[0397] The pharmaceutical compositions according to the present disclosure can be prepared, packaged, and / or sold in bulk as single-dose units and / or as multiple single-dose units. As used herein, a "unit dose" is an individual quantity of a pharmaceutical composition containing a predetermined amount of an active ingredient (e.g., lipid nanoparticles). The amount of the active ingredient generally equals the dosage of the active ingredient administered to a subject and / or a convenient fraction of such a dosage, such as half or one-third of such a dosage.

[0398] Pharmaceutical compositions can be prepared in a variety of forms suitable for various routes and methods of administration. For example, the pharmaceutical compositions can be prepared in liquid dosage forms (e.g., emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups, and elixirs), injectable forms, solid dosage forms (e.g., capsules, tablets, pills, powders, and granules), dosage forms for topical and / or transdermal administration (e.g., ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants, and patches), suspensions, powders, and other forms.

[0399] Liquid dosage forms for oral and parenteral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups, and / or elixirs. In addition to the active ingredient, the liquid dosage form may contain inert diluents commonly used in the art, such as solubilizing and emulsifying agents, for example, water or other solvents, ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (especially cottonseed oil, peanut oil, corn oil, germ oil, olive oil, castor oil, sesame oil), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycol, fatty acid esters of sorbitan, and mixtures thereof. In addition to the inert diluent, the oral composition may contain additional agents, such as additional therapeutic and / or prophylactic agents, wetting agents, emulsifying and suspending agents, sweetening agents, flavoring agents, and / or perfumes. In some embodiments of parenteral administration, the composition is admixed with solubilizing agents such as Cremophor®, alcohol, oil, modified oil, glycol, polysorbate, cyclodextrin, polymer, and / or combinations thereof.

[0400] Injectable formulations, for example, sterile aqueous or oily suspensions, can be formulated according to known techniques using suitable dispersing, wetting, and / or suspending agents. Sterile injectable formulations can be, for example, sterile injectable solutions, suspensions, and / or emulsions in a non-toxic parenterally acceptable diluent and / or solvent, such as a 1,3-butanediol solution. Acceptable vehicles and solvents that can be used are water, Ringer's solution, U.S.P., and physiological saline solution. Sterile, fixed oils have conventionally been used as a solvent or suspending medium. For this purpose, any bland fixed oil containing synthetic monoglycerides or diglycerides can be used. Fatty acids such as oleic acid can also be used in the preparation of injectables.

[0401] Injectable preparations can be sterilized, for example, by filtration through a bacteria-retaining filter and / or by incorporating a sterilizing agent in the form of a sterile solid composition that can be dissolved or dispersed in sterile water or other sterile injectable medium before use.

[0402] To prolong the effect of the active ingredient, it is often desirable to delay the absorption of the active ingredient from subcutaneous or intramuscular injection. This can be achieved by using a liquid suspension of a crystalline or amorphous material with low solubility in water. Thus, the drug absorption rate depends on its dissolution rate and, as a result, can depend on crystal size and crystal form. Alternatively, delayed absorption of parenterally administered drug forms is achieved by dissolving or suspending the drug in an oily vehicle. Injectable depot preparations are made by forming a matrix in which the drug is microencapsulated in a biodegradable polymer such as polylactide-polyglycolide. The rate of drug release can be controlled depending on the ratio of the drug to the polymer and the nature of the particular polymer used. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injection preparations are prepared by entrapping the drug in liposomes or microemulsions that are compatible with body tissues.

[0403] Compositions for rectal or vaginal administration are typically suppositories that can be prepared by mixing the composition with a suitable non-irritating excipient such as cocoa butter, polyethylene glycol or suppository wax that is solid at ambient temperature but liquid at body temperature and thus dissolves in the rectal or vaginal cavity to release the active ingredient.

[0404] Solid dosage forms for oral administration include capsules, tablets, pills, films, powders, and granules. In such solid dosage forms, the active ingredient is mixed with at least one inert pharmaceutically acceptable excipient such as sodium citrate or dicalcium phosphate and / or a filler or diluent (e.g., starch, lactose, sucrose, glucose, mannitol, and silicic acid), a binder (e.g., carboxymethyl cellulose, alginates, gelatin, polyvinylpyrrolidone, sucrose, acacia gum), a humectant (e.g., glycerol), a disintegrant (e.g., agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, sodium carbonate), a solution retarder (e.g., paraffin), an absorption enhancer (e.g., quaternary ammonium compounds), a wetting agent (e.g., cetyl alcohol and glycerol monostearate), an absorbent (e.g., kaolin and bentonite clay, silicates), and a lubricant (e.g., talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium lauryl sulfate), and mixtures thereof. In the case of capsules, tablets, and pills, the dosage form may contain a buffering agent.

[0405] Solid compositions of the same type can be used as fillers for soft and hard filled gelatin capsules using excipients such as lactose or milk sugar, and high molecular weight polyethylene glycol. Solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings and other coatings well known in pharmaceutical formulation technology. They may optionally contain opacifying agents and may be compositions that release the active ingredient(s) in a delayed manner, if necessary, only in or preferentially in certain parts of the intestinal tract. Examples of embedding compositions that can be used include polymeric substances and waxes. Solid compositions of the same type can be used as fillers for soft and hard filled gelatin capsules using excipients such as lactose or milk sugar, and high molecular weight polyethylene glycol.

[0406] Dosage forms for topical and / or transdermal administration of the composition can include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants, and / or patches. Generally, the active ingredient is mixed under sterile conditions with pharmaceutically acceptable excipients and / or preservatives and / or buffers as required. Further, the present disclosure contemplates the use of transdermal patches, which often have the additional advantage of providing controlled delivery of the compound to the body. Such dosage forms can be prepared, for example, by dissolving and / or dispensing the compound in a suitable medium. Alternatively or additionally, the rate can be controlled by providing a rate-controlling membrane and / or by dispersing the compound in a polymeric matrix and / or gel.

[0407] Devices suitable for use in delivering the intradermal pharmaceutical compositions described herein include short needle devices such as those described in U.S. Patent Nos. 4,886,499; 5,190,521; 5,328,483; 5,527,288; 4,270,537; 5,015,235; 5,141,496; and 5,417,662. The intradermal composition can be administered by a device that limits the effective penetration length of the needle into the skin, such as those described in PCT Publication WO99 / 34850 and its functional equivalents. A liquid jet injector and / or a jet injection device that delivers a liquid composition to the dermis through a needle that generates a jet that pierces the stratum corneum and reaches the dermis is suitable. Jet injection devices are described, for example, in U.S. Patent Nos. 5,480,381; 5,599,302; 5,334,144; 5,993,412; 5,649,912; 5,569,189; 5,704,911; 5,383,851; 5,893,397; 5,466,220; 5,339,163; 5,312,335; 5,503,627; 5,064,413; 5,520,639; 4,596,556; 4,790,824; 4,941,880; 4,940,460; and PCT Publications WO97 / 37705 and WO97 / 13537. A ballistic powder / particle delivery device that uses compressed gas to accelerate a vaccine in powder form from the outer layer of the skin to the dermis is suitable. Alternatively or additionally, a conventional syringe may be used in the classical Mantoux method of intradermal administration.

[0408] Formulations suitable for topical administration include, but are not limited to, oil-in-water and / or water-in-oil emulsions, and / or liquid and / or semi-liquid formulations such as liniments, lotions, creams, ointments and / or pastes. Topically administrable formulations may contain, for example, from about 1% to about 10% (wt / wt) of the active ingredient, although the concentration of the active ingredient may be as high as the solubility limit of the active ingredient in the solvent. Formulations for topical administration may further contain one or more additional ingredients described herein.

[0409] The pharmaceutical composition can be prepared, packaged, and / or sold in a formulation suitable for pulmonary administration via the oral cavity. Such formulations may contain dry particles containing the active ingredient. Such compositions preferably use a device containing a dry powder reservoir such that the flow of the propellant can be directed to disperse the powder, and / or a self-propelling solvent / powder dispensing container such as a device containing the active ingredient dissolved and / or suspended in a low-boiling propellant within a sealed container, in the form of a dry powder for administration. The dry powder composition can contain a solid fine powder diluent such as sugar and is conveniently provided in unit dosage form.

[0410] Low-boiling propellants generally include liquid propellants having a boiling point of less than 65°F at atmospheric pressure. Generally, the propellant may constitute 50% - 99.9% (wt / wt) of the composition, and the active ingredient may constitute 0.1% - 20% (wt / wt) of the composition. The propellant may further contain additional ingredients such as liquid non-ionic and / or solid anionic surfactants and / or solid diluents (which may have a particle size comparable to that of the particles containing the active ingredient).

[0411] The pharmaceutical composition formulated for pulmonary delivery can provide the active ingredient in the form of droplets of a solution and / or suspension. Such formulations can be prepared, packaged, and / or sold as a sterile aqueous and / or dilute alcohol solution and / or suspension containing the active ingredient, and can be conveniently administered using any spraying and / or nebulizing device. Such formulations may further contain one or more additional ingredients including, but not limited to, flavoring agents such as sodium saccharin, volatile oils, buffering agents, surfactants, and / or preservatives such as methyl hydroxybenzoate. The droplets provided by this route of administration can have an average diameter in the range of about 1 nm to about 200 nm.

[0412] The formulations described herein as being useful for pulmonary delivery are useful for intranasal delivery of pharmaceutical compositions. Another formulation suitable for intranasal administration is a coarse powder containing the active ingredient and having an average particle size of about 0.2 μm to 500 μm. Such formulations are administered by the method of inhaling snuff, i.e., by rapidly inhaling through the nasal passages from a powder container held near the nose.

[0413] Formulations suitable for nasal administration may contain, for example, amounts of the active ingredient ranging from a small amount such as about 0.1% (wt / wt) to a large amount such as about 100% (wt / wt), and may contain one or more of the additional ingredients described herein. The pharmaceutical composition can be prepared, packaged, and / or sold in a formulation suitable for buccal administration. Such formulations can be, for example, in the form of tablets and / or lozenges made using conventional methods, and can contain, for example, from 0.1% to 20% (wt / wt) of the active ingredient, the remainder being an orally soluble and / or degradable composition, and optionally one or more of the additional ingredients described herein. Alternatively, formulations suitable for oral administration can include powders and / or aerosolized and / or nebulized solutions and / or suspensions containing the active ingredient. Such powders, aerosolized, and / or nebulized formulations have an average particle and / or droplet size in the range of about 0.1 nm to about 200 nm when dispersed, and may further contain one or more of the additional ingredients described herein.

[0414] The pharmaceutical composition can be prepared, packaged, and / or sold in a formulation suitable for ophthalmic administration. Such formulations can be, for example, in the form of eye drops containing a 0.1 / 1.0% (wt / wt) solution and / or suspension of the active ingredient in an aqueous or oily liquid excipient. Such droplets can further contain one or more of a buffering agent, a salt, and / or any of the additional ingredients described herein. Other useful ophthalmically administrable formulations include those containing the active ingredient in microcrystalline form and / or liposomal formulations. Ear drops and / or eye drops are considered to be within the scope of the present disclosure.

[0415] Method for producing a polypeptide intracellularly The present disclosure provides a method for producing a polypeptide of interest in mammalian cells. The method for producing the polypeptide involves contacting a cell with a formulation of the present disclosure comprising an LNP containing mRNA encoding the polypeptide of interest. When the cell is contacted with the lipid nanoparticle, the mRNA is taken up and translated intracellularly to produce the polypeptide of interest.

[0416] Generally, the step of contacting mammalian cells with an LNP containing mRNA encoding the polypeptide of interest can be performed in vivo, ex vivo, in culture, or in vitro. The amount of lipid nanoparticles contacting the cells, and / or the amount of mRNA therein, can depend on the type of cells or tissues being contacted, the means of administration, the physicochemical properties (e.g., size, charge, chemical composition) of the lipid nanoparticles and mRNA therein, as well as other factors. Generally, an effective amount of the lipid nanoparticles enables efficient polypeptide production intracellularly. Criteria for measuring efficiency can include translation of the polypeptide (as indicated by expression of the polypeptide), the level of mRNA degradation, and indicators of the immune response.

[0417] The step of contacting the cell with the LNP containing mRNA may include or cause transfection. The phospholipids contained in the lipid component of the LNP can promote transfection and / or increase transfection efficiency, for example, by interacting and / or fusing with the cell membrane or intracellular membranes, enabling translation of the mRNA intracellularly.

[0418] In some embodiments, the lipid nanoparticles described herein can be used therapeutically. For example, the mRNA contained in the LNP encodes a therapeutic polypeptide (e.g., within the translatable region) and can produce the therapeutic polypeptide upon contact with and / or entry into the cell (e.g., transfection). In other embodiments, the mRNA contained in the LNP may encode a polypeptide that has the potential to improve or increase the immunity of the subject. For example, the mRNA may encode granulocyte colony-stimulating factor or trastuzumab.

[0419] In some embodiments, the mRNA contained in the LNP can encode a recombinant polypeptide that can replace one or more polypeptides that may not substantially exist in cells that contact the lipid nanoparticles. One or more polypeptides that do not substantially exist may be missing due to genetic mutations in the coding gene or its regulatory pathways. Alternatively, the recombinant polypeptide produced by translation of the mRNA may antagonize the activity of an endogenous protein that is present intracellularly, on the cell surface, or secreted from the cell. Antagonistic recombinant polypeptides may be desirable to combat detrimental effects caused by the activity of endogenous proteins, such as changes in activity or localization caused by mutations. As another alternative, the recombinant polypeptide produced by translation of the mRNA may indirectly or directly antagonize the activity of a biological moiety that is present intracellularly, on the cell surface, or secreted from the cell. Biological moieties that are antagonized include, but are not limited to, lipids (e.g., cholesterol), lipoproteins (e.g., low density lipoprotein), nucleic acids, carbohydrates, and small molecule toxins. The recombinant polypeptide produced by translation of the mRNA can be modified for intracellular localization, such as within a specific compartment such as the nucleus, or for secretion from the cell or translocation to the plasma membrane of the cell.

[0420] In some embodiments, contacting a cell with an LNP containing mRNA can reduce the cell's innate immune response to exogenous nucleic acids. The cell can be contacted with a first lipid nanoparticle containing a first amount of a first exogenous mRNA comprising a translatable region, and the level of the cell's innate immune response to the first exogenous mRNA can be determined. Subsequently, the cell can be contacted with a second composition containing a second amount of the first exogenous mRNA that is less than the first amount as compared thereto. Alternatively, the second composition may contain a second exogenous mRNA different from the first exogenous mRNA in the first amount. The step of contacting the cell with the first and second compositions may be repeated one or more times. Further, the efficiency of polypeptide production (e.g., translation) in the cell can be determined as needed, and the cell can be repeatedly contacted with the first and / or second compositions until the target protein production efficiency is achieved.

[0421] Method for delivering therapeutic agents to cells and organs The present disclosure provides a method for delivering therapeutic and / or prophylactic agents, such as nucleic acids, to mammalian cells or organs. Delivery of a therapeutic and / or prophylactic agent to a cell includes administering to a subject a formulation of the present disclosure comprising an LNP containing a therapeutic and / or prophylactic agent such as a nucleic acid, and administration of the composition includes contacting the cell with the composition. For example, a protein, a cytotoxic agent, a radioactive ion, a chemotherapeutic agent, or a nucleic acid (RNA, such as mRNA, etc.) may be delivered to a cell or an organ. When the therapeutic and / or prophylactic agent is mRNA, contacting the cell with a lipid nanoparticle can result in translation of the translatable mRNA inside the cell to produce the polypeptide of interest. However, mRNA that is substantially non-translatable can also be delivered to the cell. Substantially non-translatable mRNA can be useful as a vaccine and / or can sequester the cell's translation components to reduce the expression of other species inside the cell.

[0422] In some embodiments, the LNP can target a specific type or class of cells (e.g., cells of a specific organ or its system). For example, an LNP containing a therapeutic agent and / or prophylactic agent of interest can be specifically delivered to the liver, kidney, spleen, femur, or lung of a mammal. Specific delivery to a particular class of cells, organs, or their system or group means that a higher percentage of the lipid nanoparticles containing the therapeutic agent and / or prophylactic agent is delivered to the destination of interest (e.g., tissue) compared to other destinations, for example, upon administration of the LNP to a mammal. In some embodiments, due to specific delivery, the amount of the therapeutic agent and / or prophylactic agent per gram of tissue in the target destination (e.g., the tissue of interest such as the liver) can be increased by more than 2-fold, 5-fold, 10-fold, 15-fold, or 20-fold compared to another destination (e.g., the spleen). In some embodiments, the tissue of interest is selected from the group consisting of the liver, kidney, lung, spleen, femur, vascular endothelium within blood vessels (e.g., intracoronary or intrathigh), and tumor tissue (e.g., intratumoral injection).

[0423] As another example of targeting or specific delivery, the LNP may contain an mRNA encoding a protein binding partner (e.g., an antibody or a functional fragment thereof, a scaffold protein, or a peptide) or a receptor on the cell surface. Additionally or alternatively, mRNA may be used to induce the synthesis and extracellular localization of lipids, sugars, or other biological moieties. Alternatively, other therapeutic and / or prophylactic agents or elements of the LNP (e.g., lipids or ligands) may be selected based on their affinity for a particular receptor (e.g., the low density lipoprotein receptor) such that the LNP can more readily interact with a target cell population containing the receptor. For example, ligands can include members of a specific binding pair, antibodies, monoclonal antibodies, Fv fragments, single-chain Fv (scFv) fragments, Fab’ fragments, F(ab’)2 fragments, single-domain antibodies, camelized antibodies and fragments thereof, humanized antibodies and fragments thereof, and multivalent versions thereof; multivalent binding reagents including single- or bispecific antibodies such as disulfide-stabilized Fv fragments, scFv tandems, diabodies, tribodies, or tetrabodies; and aptamers, receptors, fusion proteins, but are not limited thereto.

[0424] In some embodiments, the ligand may be a surface-binding antibody that can allow for modulation of cell targeting specificity. This is particularly useful since very specific antibodies can be produced against the desired epitope at the target site of interest. In some embodiments, multiple antibodies are expressed on the surface of the cell and each antibody may have a different specificity for the desired target. Such an approach can enhance the binding strength and specificity of the targeting interaction.

[0425] The ligand can be selected by those skilled in the art of biology, for example, based on the desired localization or function of the cell. For example, estrogen receptor ligands such as tamoxifen can target estrogen-dependent breast cancer cells with an increased number of estrogen receptors on the cell surface. Other non-limiting examples of ligand / receptor interactions include CCR1 (for example, for the treatment of inflamed joint tissue or the brain in rheumatoid arthritis and / or multiple sclerosis), CCR7, CCR8 (for example, targeting lymph node tissue), CCR6, CCR9, CCR10 (for example, targeting intestinal tissue), CCR4, CCR10 (for example, for targeting the skin), CXCR4 (for example, promoting general migration), HCELL (for example, for the treatment of inflammation and inflammatory disorders, bone marrow), Alpha4beta7 (for example, for targeting the intestinal mucosa), and VLA-4NCAM-1 (for example, targeting endothelium). Generally, any receptor involved in targeting (e.g., cancer metastasis) can be utilized for use in the methods and compositions described herein.

[0426] Target cells include, but are not limited to, hepatocytes, epithelial cells, hematopoietic cells, epithelial cells, endothelial cells, lung cells, bone cells, stem cells, mesenchymal cells, nerve cells, heart cells, adipocytes, vascular smooth muscle cells, cardiomyocytes, skeletal muscle cells, beta cells, pituitary cells, synovial cells, ovarian cells, testicular cells, fibroblasts, B cells, T cells, reticulocytes, white blood cells, granulocytes, and tumor cells.

[0427] In some embodiments, the LNP may target hepatocytes. Apolipoproteins such as apolipoprotein E (apoE) have been shown to bind to neutral or near-neutral lipid-containing lipid nanoparticles in the body and are known to bind to receptors such as low-density lipoprotein receptors (LDLR) found on the surface of hepatocytes. Thus, an LNP containing a lipid component with a neutral or near-neutral charge administered to a subject can acquire apoE in the subject's body and then deliver a therapeutic and / or prophylactic agent (e.g., RNA) to hepatocytes containing LDLR in a targeted manner.

[0428] Methods for treating diseases and disorders Lipid nanoparticles can be useful for treating a disease, disorder, or condition. In particular, such compositions can be useful for treating a disease, disorder, or condition characterized by a lack or abnormality of the activity of a protein or polypeptide. For example, the formulations of the present disclosure comprising LNPs containing mRNA encoding a lacking or abnormal polypeptide may be administered or delivered to cells. Subsequent translation of the mRNA produces the polypeptide, thereby reducing or eliminating problems caused by the lack of activity or abnormal activity caused by the polypeptide. Because translation can occur rapidly, this method and composition can be useful for treating acute diseases, disorders, or conditions such as sepsis, stroke, and myocardial infarction. The therapeutic and / or prophylactic agents contained in the LNP can also change the transcription rate of a particular species, thereby affecting gene expression.

[0429] Diseases, disorders, and / or conditions characterized by a dysfunctional or abnormal protein or polypeptide activity for which a composition can be administered include, but are not limited to, rare diseases, infectious diseases (both as vaccines and therapeutics), cancer and proliferative diseases, genetic diseases (e.g., cystic fibrosis), autoimmune diseases, diabetes, neurodegenerative diseases, cardiovascular and renal vascular diseases, and metabolic diseases. A plurality of diseases, disorders, and / or conditions can be characterized by a lack of protein activity (or a substantial decrease such that appropriate protein function does not occur). Such a protein may be absent or essentially non-functional. A specific example of a dysfunctional protein is a missense variant of the CFTR gene that produces a dysfunctional protein variant of the cystic fibrosis transmembrane conductance regulator (CFTR) protein that causes cystic fibrosis. The present disclosure provides a method of treating such diseases, disorders, and / or conditions in a subject by administering an LNP comprising RNA and a lipid component comprising a lipid, a phospholipid (unsaturated if desired), a PEG lipid, and a structural lipid according to formula (I), wherein the RNA can be an mRNA encoding a polypeptide that antagonizes or otherwise overcomes an abnormal protein activity present in the cells of the subject.

[0430] The present disclosure provides a method comprising administration of lipid nanoparticles comprising one or more therapeutic and / or prophylactic agents, such as nucleic acids, and pharmaceutical compositions comprising the same. The terms therapeutic and prophylactic agent can be used interchangeably herein with respect to the features and embodiments of the present disclosure. A therapeutic composition, or an imaging, diagnostic, or prophylactic composition thereof, can be administered to a subject using any reasonable amount and any route of administration effective for the prevention, treatment, diagnosis, or imaging of a disease, disorder, and / or condition, and / or for other purposes. The specific amount administered to a particular subject can vary depending on the species, age, and general condition of the subject; the purpose of the administration; the particular composition; the mode of administration; etc. The compositions according to the present disclosure can be formulated in unit dosage form for ease of administration and uniformity of dosage. However, it will be understood that the total daily usage of the compositions of the present disclosure will be determined by the attending physician within the scope of sound medical judgment. The particular therapeutically effective, prophylactically effective, or other appropriate dosage level (e.g., for imaging) for a particular patient will depend on various factors including, if present, the severity and identification of the disorder being treated; the one or more therapeutic and / or prophylactic agents being used; the particular composition employed; the age, weight, general health, sex, and diet of the patient; the time of administration, route of administration, and rate of excretion of the particular pharmaceutical composition employed; the duration of the treatment; drugs used in combination with or concurrently with the particular pharmaceutical composition employed; and similar factors well known in the medical arts.

[0431] An LNP containing one or more therapeutic and / or prophylactic agents such as nucleic acids can be administered by any route. In some embodiments, a composition comprising a prophylactic, diagnostic, or imaging composition comprising one or more lipid nanoparticles described herein is administered by one or more of a variety of routes including oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, subcutaneous, intraventricular, transdermal or intradermal, intracutaneous, rectal, intravaginal, intraperitoneal, topical (e.g., by powder, ointment, cream, gel, lotion, and / or droplet), mucosal, nasal, buccal, enteral, intravitreal, intratumoral, sublingual, intranasal; by endotracheal instillation, bronchial instillation, and / or inhalation; as an oral spray and / or powder, nasal spray, and / or aerosol, and / or through a portal catheter. In some embodiments, the composition can be administered intravenously, intramuscularly, intradermally, intraarterially, intratumorally, subcutaneously, or by inhalation. However, the present disclosure encompasses delivery or administration of the compositions described herein by any suitable route taking into account possible advances in the science of drug delivery. Generally, the most appropriate route of administration will depend on a variety of factors including the nature of the lipid nanoparticles containing one or more therapeutic and / or prophylactic agents (e.g., stability in various body environments such as the bloodstream and the gastrointestinal tract), the condition of the patient (e.g., whether the patient can tolerate a particular route of administration), and the like.

[0432] In some embodiments, the compositions according to the present disclosure are administered in a dosage sufficient to deliver a therapeutic and / or prophylactic agent (e.g., mRNA) of about 0.0001 mg / kg to about 10 mg / kg, about 0.001 mg / kg to about 10 mg / kg, about 0.005 mg / kg to about 10 mg / kg, about 0.01 mg / kg to about 10 mg / kg, about 0.05 mg / kg to about 10 mg / kg, about 0.1 mg / kg to about 10 mg / kg, about 1 mg / kg to about 10 mg / kg, about 2 mg / kg to about 10 mg / kg, about 5 mg / kg to about 10 mg / kg, about 0.0001 mg / kg to about 5 mg / kg, about 0.001 mg / kg to about 5 mg / kg, about 0.005 mg / kg to about 5 mg / kg, about 0.01 mg / kg to about 5 mg / kg, about 0.05 mg / kg to about 5 mg / kg, about 0.1 mg / kg to about 5 mg / kg, about 1 mg / kg to about 5 mg / kg, about 2 mg / kg to about 5 mg / kg, about 0.0001 mg / kg to about 2.5 mg / kg, about 0.001 mg / kg to about 2.5 mg / kg, about 0.005 mg / kg to about 2.5 mg / kg, about 0.01 mg / kg to about 2.5 mg / kg, about 0.05 mg / kg to about 2.5 mg / kg, about 0.1 mg / kg to about 2.5 mg / kg, about 1 mg / kg to about 2.5 mg / kg, about 2 mg / kg to about 2.5 mg / kg, about 0.0001 mg / kg to about 1 mg / kg, about 0.001 mg / kg to about 1 mg / kg, about 0.005 mg / kg to about 1 mg / kg, ...

Claims

【Claim 1】 The invention described in the specification of this application.

Images