CRYSTALLINE C21H22Cl2N4O2 MALONATE

Abstract

To provide pharmaceutical compositions for treating cancer in a mammal.SOLUTION: A pharmaceutical composition comprises: (a) a first active agent which is Form A crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide malonate, having (i) an X-ray powder diffraction (XRPD) pattern comprising specific peaks, and (ii) an infrared spectroscopy (IR) spectrum comprising specific peaks; (b) a second active agent selected from the group consisting of hormones, hormone-interfering compounds, histone deacetylase inhibitors (HDACi), cyclin-dependent kinase inhibitors (CDKi), poly ADP-ribose polymerase (PARP) inhibitors, and combinations thereof; and a pharmaceutically acceptable carrier.SELECTED DRAWING: None

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This patent application claims the benefit of U.S. Provisional Patent Application No. 62 / 110,446, filed January 30, 2015, which is incorporated herein by reference in its entirety.

[0002] FIELD OF THE INVENTION The present invention relates to crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate, which is useful as an inhibitor of ERK protein kinase. [Background technology]

[0003] The mitogen-activated protein kinase (MAPK) pathway mediates signals that control a variety of cellular processes, including growth, differentiation, migration, proliferation, and apoptosis. One MAPK pathway, the extracellular signal-regulated kinase (ERK) signaling pathway, is often found to be upregulated in tumors. Therefore, members of the pathway represent attractive blocking targets in the development of cancer treatments (Kohno and Pouyssegur, 2006). For example, U.S. Patent No. 7,354,939 B2 discloses, inter alia, compounds effective as inhibitors of ERK protein kinase. One of these compounds, 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide, has the formula (I): [ka] It is a compound according to the following:

[0004] Pharmaceutical compositions are often formulated with crystalline solids of active pharmaceutical ingredients (APIs). The specific crystalline form of an API can have a significant impact on properties such as stability and solubility / bioavailability. Instability and solubility characteristics can limit the ability to formulate a composition with an adequate shelf life or to effectively deliver a desired amount of drug over a given time frame. One strategy used to achieve desired physical parameters is the practice of salt selection (Peterson et al., 2006). There is an unmet need for a crystalline form of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide that exhibits improved properties for the formulation of pharmaceutical compositions. The petition is directed to meeting this and other needs. [Prior art documents] [Patent documents]

[0005] [Patent Document 1] U.S. Patent No. 7,354,939 Summary of the Invention [Means for solving the problem]

[0006] It has been discovered that crystalline forms of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate can be prepared and exhibit improved properties, such as surprisingly improved stability and solubility characteristics.

[0007] Thus, the present invention provides a crystalline salt of formula (I): [ka] The present invention provides a malonate salt of the compound of formula (I).

[0008] The present invention relates to a compound of formula (I): [ka] Also provided is the malonate salt of the compound:

[0009] The present invention provides compounds having a molecular weight of about 1573, 1504, 1475, 1253, 1033, and 883 cm -1 Also provided is crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate of Form A, having an infrared spectroscopy (IR) spectrum comprising one or more peaks at

[0010] The present invention provides a crystalline 4-hydroxybenzoate of Form A having an IR spectrum substantially as shown in FIG. -(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate is also provided.

[0011] The present invention provides an XRPD pattern comprising: (i) one or more peaks at about 3.0, 5.2, 8.0, and 10.9 °2θ; and (ii) peaks at about 1573, 1504, 1475, 1253, 1033, and 883 cm -1 Also provided is crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate of Form A, having an IR spectrum comprising one or more peaks at

[0012] The present invention also provides crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate, Form A, having a DSC thermogram with an endotherm with an onset temperature of about 142.1°C.

[0013] The present invention also provides crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate, Form A, having a DSC thermogram substantially as shown in FIG.

[0014] The present invention also provides a pharmaceutical composition comprising a crystalline compound of the present invention and a pharmaceutically acceptable carrier.

[0015] The present invention also provides a method of treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of a crystalline compound of the present invention.

[0016] The present invention also provides a method of treating cancer in a subject in need thereof, comprising the step of administering to the subject an effective amount of a pharmaceutical composition of the present invention.

[0017] The present invention also provides a method of making Form A of crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate, comprising reacting malonic acid with 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide under conditions suitable to form Form A of crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate.

[0018] The following drawings form part of this specification and are incorporated to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein. [Brief explanation of the drawings]

[0019] [Figure 1] FIG. 1 shows an XRPD obtained in transmission mode for the free base of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide.

[0020] [Figure 2] FIG. 2 shows the FT-IR spectrum of the free base of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide.

[0021] [Figure 3] FIG. 3 shows the DSC thermogram for the free base of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide.

[0022] [Figure 4] FIG. 4 shows an XRPD obtained in transmission mode for Form C of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide.

[0023] [Figure 5] FIG. 5 depicts the FT-IR spectrum for Form C of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide.

[0024] [Figure 6]FIG. 6 shows the DSC thermogram for Form C of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide.

[0025] [Figure 7] FIG. 7 depicts an XRPD obtained in transmission mode for Form A of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate.

[0026] [Figure 8] FIG. 8 depicts the FT-IR spectrum for Form A of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate.

[0027] [Figure 9] FIG. 9 shows the DSC thermogram for Form A of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate.

[0028] [Figure 10] Figure 10 shows the solubility of Form C of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide ("Form C") and Form A of the malonate salt. Figure 10A shows solubility in fasted-state simulated gastric fluid (FaSSGF) at pH 1.6. Figure 10B shows solubility in fasted-state simulated intestinal fluid (FaSSIF) at pH 6.5.

[0029] [Figure 11]Figure 11 shows the pharmacokinetics of Form C of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide ("Form C") and Form A of the malonate salt. Figure 11A: Plasma drug concentrations after a single dose of 5 mg / kg. Figure 11B: Area under the curve and coefficient of variation for in vivo pharmacokinetic studies. DETAILED DESCRIPTION OF THE INVENTION

[0030] The present invention relates to a crystalline salt of formula (I): [ka] The present invention provides a malonate salt of the compound of formula (I).

[0031] In some embodiments, the malonate salt of the present invention is characterized by an X-ray powder diffraction (XRPD) pattern comprising a characteristic peak at about 3.0 degrees 2θ.

[0032] In some embodiments, the malonate salt of the present invention is characterized by an X-ray powder diffraction (XRPD) pattern comprising characteristic peaks at about 3.0 and 5.2 degrees 2θ.

[0033] In some embodiments, the malonate salt of the present invention is characterized by an X-ray powder diffraction (XRPD) pattern comprising characteristic peaks selected from the group consisting of about 3.0, 5.2, 8.0, and 10.9 degrees 2θ.

[0034] In some embodiments, the malonate salt of the present invention is characterized by an X-ray powder diffraction (XRPD) pattern comprising XRPD 2θ reflections (°) at about 3.0, 5.2, 8.0, 10.9, 15.7, 18.4, 23.1, and 25.4.

[0035] The present invention also provides a compound of formula (I): having an XRPD pattern substantially as shown in FIG. [ka] The present invention provides a malonate salt of the compound of formula (I).

[0036] The present invention also provides compounds having a molecular weight of about 1573, 1504, 1475, 1253, 1033, and 883 cm -1 1. The present invention provides crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate of Form A, having an infrared spectroscopy (IR) spectrum comprising one or more peaks at

[0037] The present invention also provides crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole- Form A, having an IR spectrum substantially as shown in Figure 8. 2-Carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate is provided.

[0038] The present invention also provides an XRPD pattern comprising: (i) one or more peaks at about 3.0, 5.2, 8.0, and 10.9 °2θ; and (ii) one or more peaks at about 1573, 1504, 1475, 1253, 1033, and 883 cm -1 1. The present invention provides crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate of Form A, having an IR spectrum comprising one or more peaks at

[0039] The present invention also provides crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate, Form A, having a DSC thermogram with an endotherm with an onset temperature of about 142.1°C.

[0040] The present invention also provides crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate, Form A, having a DSC thermogram substantially as shown in FIG.

[0041] The present invention also provides a pharmaceutical composition comprising a crystalline compound of the present invention and a pharmaceutically acceptable carrier.

[0042] The present invention also provides a method of treating cancer in a subject in need thereof, comprising administering to said subject an effective amount of a crystalline compound of the present invention.

[0043] In some embodiments, the subject is a mammal.

[0044] In some embodiments, the mammal is selected from the group consisting of humans, primates, farm animals, and livestock.

[0045] In some embodiments, the mammal is a human.

[0046] In some embodiments, the method further comprises administering to said subject at least one additional anti-cancer agent.

[0047] The present invention also provides a method of treating cancer in a subject in need thereof, comprising the step of administering to said subject an effective amount of a pharmaceutical composition of the present invention.

[0048] In some embodiments, the subject is a mammal.

[0049] In some embodiments, the mammal is selected from the group consisting of humans, primates, farm animals, and livestock.

[0050] In some embodiments, the mammal is a human.

[0051] In some embodiments, the method further comprises administering to said subject at least one additional anti-cancer agent.

[0052] The present invention also relates to Form A of crystalline 4-(5-chloro-2-isopropylaminopyridine- 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate, comprising reacting malonic acid with 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide under conditions suitable to form Form A of crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate.

[0053] In some embodiments, the malonic acid and 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide are reacted in an ethanol slurry.

[0054] The term "solid form" is often used to refer to a class or type of material in the solid state. One kind of solid form is a "polymorph," which refers to two or more compounds that have the same chemical formula but different solid-state structures. Salts can be polymorphic. When polymorphs are elements, they are called allotropes. Carbon has the well-known allotropes graphite, diamond, and buckminsterfullerene. Polymorphs of molecular compounds, such as active pharmaceutical ingredients ("APIs"), are often prepared and studied to identify compounds that meet academic or commercial needs, including, but not limited to, improved solubility, dissolution rate, hygroscopicity, and stability.

[0055] Other solid forms include solvates and hydrates of compounds, including salts.Solvates are compounds in which solvent molecules exist in a crystalline structure together with another compound, such as API.When the solvent is water, the solvate is called a hydrate.Solvates and hydrates can be stoichiometric or non-stoichiometric.Monohydrate is the term used when there is one water molecule in a unit cell, for example, stoichiometrically relative to API.

[0056] To identify the presence of a particular solid form, one skilled in the art will typically use analytical techniques suitable for gathering data about the form for analysis. For example, chemical identification of a solid form is often achieved by: 13 C-NMR spectroscopy or 1 This can be determined by solution-state methods such as H-NMR spectroscopy, and such techniques can also be valuable in determining the stoichiometry and presence of a "guest," such as water or solvent, in a hydrate or solvate, respectively. These spectroscopic methods can also be used, for example, to distinguish solid forms without water or solvent in the unit cell (often referred to as "anhydrates") from hydrates or solvates.

[0057] Because solution-state analytical methods do not provide information about the solid state of a substance, for example, solid-state methods can be used to distinguish between solid forms, such as anhydrates. Examples of solid-state methods that can be used to analyze and characterize solid forms, including anhydrates and hydrates, include single crystal X-ray diffraction, powder X-ray diffraction ("XRPD"), solid 13 These include C-NMR, infrared ("IR") spectroscopy, including Fourier transform infrared (FT-IR) spectroscopy, Raman spectroscopy, and thermal techniques such as differential scanning calorimetry (DSC), melting point, and high temperature microscopy.

[0058] Polymorphs are subsets of crystalline forms that share the same chemical structure but differ in the way the molecules pack within the solid. When attempting to distinguish between polymorphs based on analytical data, data that characterize the form is sought. For example, if two polymorphs of a compound exist (e.g., Form I and Form II), a powder X-ray diffraction peak can be used to characterize the form when a peak in the pattern of Form I is found at an angle where no such peak is found in the pattern of Form II. In such cases, this single peak for Form I may further serve to distinguish Form I from Form II and characterize Form I. Additional Forms If present, the same analysis is also performed on other polymorphs. Thus, to characterize Form I relative to other polymorphs, peaks of Form I are searched for at angles where such peaks are not found in the powder X-ray diffraction patterns of the other polymorphs. The set of peaks, or indeed a single peak, that distinguish Form I from other known polymorphs is the set of peaks that can be used to characterize Form I. For example, if two peaks characterize a polymorph, these two peaks can be used to identify the presence of this polymorph and therefore characterize the polymorph. Those skilled in the art will recognize that there are often multiple ways to characterize a polymorph, including multiple methods using the same analytical method. For example, three powder X-ray diffraction peaks may be found to characterize a polymorph. Additional peaks may be used to characterize a polymorph up to and including the entire diffraction pattern, but are not required. While all peaks in the entire diffractogram can be used to characterize a crystalline form, as disclosed herein, a subset of this data can alternatively be used to characterize such a crystalline form, depending on the circumstances, and may be typical.

[0059] For example, as used herein, "characteristic peaks" are a subset of observed peaks that are used to distinguish one crystalline polymorph from another. Characteristic peaks are determined by assessing which observed peaks, if any, are present in one crystalline polymorph of a compound relative to all other known crystalline polymorphs of that compound, to within ±0.2° 2θ.

[0060] When analyzing data to distinguish anhydrates from hydrates, for example, one can rely on the fact that the two solid forms have different chemical structures (one has water in the unit cell and the other does not). Thus, this feature alone can be used to distinguish between the forms of the compound; it may not be necessary to identify anhydrate peaks (e.g., those not present in the hydrate, or vice versa).

[0061] Powder X-ray diffraction patterns are some of the most commonly used solid-state analytical methods used to characterize solid forms. A powder X-ray diffraction pattern is an xy graph, with the diffraction angle 2θ (°) on the x-axis and intensity on the y-axis. Peaks within this plot can be used to characterize crystalline solid forms. Because peak intensity is particularly sensitive to sample orientation, data are often expressed as peak position on the x-axis rather than peak intensity on the y-axis (see Pharmaceutical Analysis, Lee and Web, pp. 255-257 (2003)). Therefore, those skilled in the art typically do not use intensity to characterize solid forms.

[0062] As with any data measurement, variability exists in powder X-ray diffraction data. In addition to variability in peak intensities, there is also variability in peak position along the x-axis. However, this variability can typically be accounted for when reporting peak positions for characterization purposes. Such variability in peak position along the x-axis stems from several sources. One source is sample preparation. Samples of the same crystalline material prepared under different conditions may yield slightly different diffractograms. Factors such as particle size, water content, solvent content, and orientation can all affect how a sample diffracts X-rays. Another source of variability stems from instrument parameters. Different X-ray instruments operate using different parameters, which can result in slightly different diffraction patterns from the same crystalline solid form. Similarly, different software packages process X-ray data differently, which also introduces variability. These and other sources of variability are known to those skilled in the pharmaceutical arts.

[0063] Due to these sources of variation, X-ray diffraction peaks are represented using the word "about" before the peak value in degrees 2θ (sometimes referred to herein as "2θ reflections (°)"). It is common to report peaks within ±0.1 or 0.2 degrees 2θ, depending on the circumstances, thereby presenting the data within 0.1 or 0.2 degrees 2θ of the reported peak value. Powder X-ray diffraction data corresponding to the solid forms of the present invention were collected on instruments routinely calibrated and operated by skilled researchers. In the present invention, XRPD values ​​are preferably obtained using Cu Kα X-ray radiation according to the method described in Example 1. Thus, the variability associated with these data is expected to be closer to ±0.1 degrees 2θ than ±0.2 degrees 2θ, and is likely to be less than 0.1 degrees 2θ for the instruments used herein. However, recognizing that instruments used elsewhere by those skilled in the art may not be so maintained, for example, all powder X-ray diffraction peaks described herein are reported with a variability on the order of ±0.2 degrees 2θ, and are intended to be reported with such variability whenever disclosed herein, and are reported herein to one significant decimal point, even when the output of the analysis may suggest a higher degree of precision in the nominal value.

[0064] Single crystal X-ray diffraction provides three-dimensional structural information about the positions of atoms and bonds within a crystal, but it is not always possible or reasonable to obtain such structures from crystals due, for example, to insufficient crystal size or the difficulty of preparing crystals of sufficient quality for single crystal X-ray diffraction.

[0065] Powder X-ray diffraction data can also be used, in some circumstances, to determine the crystallographic unit cell of a crystal structure. The method for doing this is called "indexing." Indexing is the process of determining the size and shape of the crystallographic unit cell that corresponds to the peak positions in the appropriate powder X-ray diffraction pattern. Indexing yields three unit cell lengths (a, b, c), three unit cell angles (α, β, γ), and three Miller index labels (h, k, l) for each peak. Lengths are typically reported in angstroms, and angles are typically reported in degrees. Miller index labels are unitless integers. Successful indexing indicates that the sample is composed of one crystalline phase and therefore not a mixture of crystalline phases.

[0066] IR spectroscopy, particularly FT-IR, is another technique that can be used in conjunction with or independently of powder X-ray diffraction to characterize solid forms. In an IR spectrum, absorbed light is plotted as "wave numbers" (cm) on the x-axis of the graph. -1 ) with intensity on the y-axis. Variation in the position of the IR peaks also exists and can be attributed to sample conditions as well as data collection and processing. Typical variations in the IR spectra reported herein are ±2.0 cm. -1 Because IR peaks are generally within the range of 100 to 1500 nm, the use of the word "about" when referring to IR peaks is meant to include this variation, and all IR peaks disclosed herein are intended to be reported with such variation.

[0067] Thermal methods are another typical technique for characterizing solid forms.Different polymorphs of the same compound often melt at different temperatures.Therefore, the melting point of polymorphs, as measured by methods such as capillary melting point, DSC, and hot-point microscopy alone or in combination with techniques such as powder X-ray diffraction, IR spectroscopy including FT-IR, or both, can be used to characterize polymorphs or other solid forms.

[0068] As with any analytical method, melting point determinations are also subject to variability. In addition to instrumental variability, common sources of variability result from colligative properties, such as the presence of other solid forms or other impurities, in the sample whose melting point is being measured.

[0069] As used herein, the terms "treat," "treating," "treatment," and grammatical variations thereof refer to administering to an individual subject a protocol, regimen, process, or the like, in which it is desired to obtain a physiological response or physiological outcome in that subject, e.g., a patient. "Treatment" means to provide a treatment or treatment. In particular, the methods and compositions of the present invention can be used to slow the onset of disease symptoms, or delay the onset of disease or condition, or stop the progression of disease onset. However, treating does not require that a desired physiological response or physiological outcome be achieved in each and every subject, or in a subject group, for example, a patient population, because every treated subject may not respond to a particular treatment protocol, treatment regimen, treatment course, or treatment therapy. Thus, a given subject or subject group, for example, a patient population, may not respond to treatment, or may respond inadequately to treatment.

[0070] As used herein, the terms "ameliorate," "ameliorating," and grammatical variations thereof, refer to reducing the severity of symptoms of a disease in a subject.

[0071] As used herein, a "subject" is a mammal, preferably a human. In addition to humans, categories of mammals within the scope of the present invention include, for example, farm animals, domestic animals, laboratory animals, etc. Some examples of farm animals include cows, pigs, horses, goats, etc. Some examples of domestic animals include dogs, cats, etc. Some examples of laboratory animals include primates, rats, mice, rabbits, guinea pigs, etc.

[0072] Cancer includes both solid cancers and hematological cancers. Non-limiting examples of solid cancers include adrenocortical carcinoma, anal cancer, bladder cancer, bone cancer (such as osteosarcoma), brain cancer, breast cancer, carcinoid cancer, cervical cancer, colon cancer, endometrial cancer, esophageal cancer, extrahepatic bile duct cancer, Ewing family of cancers, extracranial germ cell cancer, eye cancer, gallbladder cancer, gastric cancer, germ cell tumors, gestational trophoblastic tumors, head and neck cancer, hypopharyngeal cancer, pancreatic islet cell carcinoma, kidney cancer, colorectal cancer, laryngeal cancer, leukemia, lip and oral cavity cancer, liver cancer, lung cancer, lymphoma, malignant mesothelioma, Merkel cell carcinoma, mycosis fungoides, myelodysplastic syndromes, and myeloproliferative disorders. , nasopharyngeal cancer, neuroblastoma, oral cavity cancer, oropharyngeal cancer, osteosarcoma, ovarian epithelial cancer, ovarian germ cell cancer, pancreatic cancer, paranasal and paranasal cavity cancer, parathyroid cancer, penile cancer, pituitary cancer, plasma cell neoplasms, prostate cancer, rhabdomyosarcoma, rectal cancer, renal cell carcinoma, renal pelvis and urinary tract transitional cell carcinoma, salivary gland cancer, Sézary syndrome, skin cancer (including cutaneous T-cell lymphoma, Kaposi's sarcoma, mast cell tumor, and melanoma), small intestine cancer, soft tissue sarcoma, stomach cancer, testicular cancer, thymoma, thyroid cancer, urethral cancer, uterine cancer, vaginal cancer, vulvar cancer, and Wilms' tumor.

[0073] Examples of hematological cancers include, but are not limited to, leukemias such as adult / childhood acute lymphoblastic leukemia, adult / childhood acute myeloid leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia, and hairy cell leukemia; lymphomas, such as AIDS-related lymphoma, cutaneous T-cell lymphoma, adult / childhood Hodgkin's lymphoma, mycosis fungoides, adult / childhood non-Hodgkin's lymphoma, primary central nervous system lymphoma, Sézary syndrome, cutaneous T-cell lymphoma, and Waldenstrom's macroglobulinemia; as well as other proliferative disorders such as chronic myeloproliferative disorders, Langerhans cell histiocytosis, multiple myeloma / plasma cell neoplasm, myelodysplastic syndrome, and myelodysplastic / myeloproliferative neoplasm. A preferred set of cancers that can be treated according to the present invention includes neuroblastoma, leukemia, lymphoma, liver cancer, lung cancer, skin cancer, testicular cancer, and thyroid cancer. Preferably, the cancer is melanoma.

[0074] The methods of the present invention may optionally further comprise administering to the subject at least one additional therapeutic agent effective to treat or ameliorate the effects of cancer. The additional therapeutic agent may be selected from the group consisting of an antibody or fragment thereof, a chemotherapeutic agent, an immunotherapeutic agent, a radionuclide, a photoactive therapeutic agent, a radiosensitizer, and combinations thereof.

[0075] The anti-cancer drugs used in the malonate salt forms of the present invention and co-treatment regimens may be administered in the most appropriate manner for the subject. The malonate salt form of the present invention and the other anti-cancer agent may be administered simultaneously or at different times so as to be considered a single agent. When the malonate salt form of the present invention and the other anti-cancer agent are administered at different times, e.g., by sequential administration, the malonate salt form of the present invention can be administered to the subject before the other anti-cancer agent. Alternatively, the other anti-cancer agent can be administered to the subject before the malonate salt form.

[0076] As used herein, "antibody" encompasses naturally occurring immunoglobulins as well as non-naturally occurring immunoglobulins, including, for example, single-chain antibodies, chimeric antibodies (e.g., humanized mouse antibodies), and heteroconjugate antibodies (e.g., bispecific antibodies). Antibody fragments include antigen-binding fragments (e.g., Fab', F(ab')2, Fab, Fv, and rIgG). See, for example, Pierce Catalog and Handbook, 1994-1995 (Pierce Chemical Co., Rockford, Ill.); Kuby, J., Immunology, 3rd ed., WH See also Freeman & Co., New York (1998). The term antibody also includes bivalent or bispecific molecules, diabodies, triabodies, and tetrabodies. The term "antibody" further includes both polyclonal and monoclonal antibodies.

[0077] Examples of therapeutic antibodies that can be used in the present invention include rituximab (Rituxan), cetuximab (Erbitux), bevacizumab (Avastin), and ibritumomab (Zevalin).

[0078] As used herein, "chemotherapeutic agent" refers to any therapeutic agent that is compatible with the malonate salt form treatment of the present invention and that employs cytotoxic and / or cytostatic agents against cancer cells or cells associated with or supporting cancer cells. In preferred embodiments, the chemotherapeutic agent is an agent selected from the group consisting of antimetabolites, microtubule inhibitors, DNA damaging agents, antibiotics, antiangiogenic agents, vascular disrupting agents, molecular targeted agents, and combinations thereof.

[0079] As used herein, an "antimetabolite" is a substance that reduces or inhibits the use of chemicals by cells as part of normal metabolism. Non-limiting examples of antimetabolites or their analogs according to the present invention include antifolates, purine inhibitors, pyrimidine inhibitors, and combinations thereof.

[0080] As used herein, an "antifolate" is a substance that alters, reduces, or inhibits the use of folic acid (vitamin B9) by cells. Non-limiting examples of antifolates include methotrexate (DuraMed Pharmaceuticals, Inc.), pemetrexed (Eli Lilly), pralatrexate (Spectrum Pharmaceuticals), aminopterin (Sigma Aldrich), pharmaceutically acceptable salts thereof, and combinations thereof.

[0081] As used herein, "purines" are compounds containing fused six- and five-membered nitrogen-containing rings. Non-limiting examples of purines important to cellular metabolism include adenine, guanine, hypoxanthine, and xanthine. A "purine inhibitor" is a substance that alters, reduces, or inhibits the production or use of purines by cells. Non-limiting examples of purine inhibitors include methotrexate (DuraMed Pharmaceuticals, Inc.), pemetrexed (Eli Lilly), hydroxyurea (Bristol-Myers Squibb), 2-mercaptopurine (Sigma-Aldrich), 6-mercaptopurine (Sigma-Aldrich), fludarabine (Ben Venue Laboratories), clofarabine (Genzyme Corp.), nelarabine (GlaxoSmithKline), prasugrel (Phenyx), and prasugrel (Phenyx). These include trexate (Spectrum Pharmaceuticals), 6-thioguanine (Gate Pharmaceuticals), holodesine (BioCryst Pharmaceuticals), pentostatin (Bedford Laboratories), sapacitabine (Cyclacel Pharmaceuticals, Inc.), aminopterin (Sigma Aldrich), azathioprine (GlaxoSmithKline), pharmaceutically acceptable salts thereof, and combinations thereof.

[0082] As used herein, a "pyrimidine" is a compound containing a six-membered nitrogen-containing ring. Non-limiting examples of pyrimidines important to cellular metabolism include uracil, thymine, cytosine, and orotic acid. A "pyrimidine inhibitor" is a substance that alters, reduces, or inhibits the production or use of pyrimidines by cells. Non-limiting examples of pyrimidine inhibitors include 5-fluorouracil (Tocris Bioscience), tegafur (LGM Pharma), capecitabine (Xeloda) (Roche), cladribine (LGM Pharma), gemcitabine (Eli Lilly), cytarabine (Bedford Laboratories), decitabine (Eisai Co., Ltd.), floxuridine (Bedford Laboratories), 5-azacytidine (Pharmion Pharmaceuticals), doxifluridine (Cayman Chemicals), ciarabine (Access Pharmaceuticals), troxacitabine (SGX Pharmaceuticals), raltitrexed (AstraZeneca), carmofur (Santa Cruz Biotechnology, Inc.), 6-azauracil (MP Biomedicals, LLC), pharmaceutically acceptable salts thereof, and combinations thereof.

[0083] In a preferred embodiment of the invention, the antimetabolite is 5-fluorouracil (Tocris Bioscience), tegafur (LGM Pharma), capecitabine (Xeloda) (Roche), cladribine (LGM Pharma), methotrexate (DuraMed Pharmaceuticals, Inc.), pemetrexed (Eli Lilly), hydroxyurea (Bristol-Myers Squibb), 2-mercaptopurine (Sigma-Aldrich), 6-mercaptopurine (Sigma-Aldrich), fludarabine (Ben Venue Laboratories), gemcitabine (Eli Lilly), clofarabine (Genzyme Corp.), cytarabine (Bedford Laboratories), decitabine (Eisai Co., Ltd.), floxuridine (Bedford Laboratories), nelarabine (GlaxoSmithKline), pralatrexate (Spectrum Pharmaceuticals), 6-thioguanine (Gate Pharmaceuticals), 5-azacytidine (Pharmion Pharmaceuticals), doxifluridine (Cayman Chemicals), holodesine (BioCryst Pharmaceuticals), pentostatin (Bedford Laboratories), sapacitabine (Cyclacel Pharmaceuticals, Inc.), ciarabine (Access Pharmaceuticals), troxacitabine (SGX Pharmaceuticals), raltitrexed (AstraZeneca), aminopterin (Sigma Aldrich), carmofur (Santa Cruz Biotechnology, Inc.), azathioprine (GlaxoSmithKline), 6-azauracil (MP Biomedicals, LLC), pharmaceutically acceptable salts thereof, and combinations thereof.

[0084] As used herein, a "microtubule inhibitor" is an agent that disrupts microtubule function, such as the polymerization or depolymerization of individual microtubule units. In one aspect of the invention, a microtubule inhibitor is:The microtubule inhibitor of the present invention may be selected from the group consisting of a microtubule destabilizer, a microtubule stabilizer, and a combination thereof. The microtubule inhibitor of the present invention may also be selected from the group consisting of a taxane, a vinca alkaloid, an epothilone, and a combination thereof.Non-limiting examples of microtubule inhibitors according to the present invention include BT-062 (Biotest), HMN-214 (D. Western Therapeutics), eribulin mesylate (Eisai Co., Ltd.), vindesine (Eli Lilly), EC-1069 (Endocyte), EC-1456 (Endocyte), EC-531 (Endocyte), vintafolide (Endocyte), 2-methoxyestradiol (EntreMed), GTx-230 (GTx), trastuzumab emtansine (Hoffmann-La Roche), chloribulin (Immune Pharmaceuticals), D1302A-maytansinoid conjugate (ImmunoGen), IMGN-529 (ImmunoGen), lorvotuzumab mertansine (ImmunoGen), SAR-3419 (ImmunoGen), SAR-566658 (ImmunoGen), IMP-03138 (Impact Therapeutics), topotecan / vincristine combination (LipoCure), BPH-8 (Molecular Discovery Systems), fosbretabrine tromethamine (OXiGENE), estramustine phosphate sodium (Pfizer), vincristine (Pierre Fabre), vinflunine (Pierre Fabre), vinorelbine (Pierre Fabre), RX-21101 (Rexahn), cabazitaxel (Sanofi), STA-9584 (Synta Pharmaceuticals), vinblastine, epothilone A, patupilone (Novartis), ixabepilone (Bristol-Myers Squibb), epothilone D (Kosan Biosciences), paclitaxel (Bristol-Myers Squibb), docetaxel (Sanofi-Aventis), HAI Abraxane, DJ-927 (Daiichi Sankyo Co., Ltd.), discodermolide (CAS No. 127943-53-7), eluterobin (CAS No. 174545-76-7), pharmaceutically acceptable salts thereof, and combinations thereof.

[0085] DNA damaging agents of the present invention include, but are not limited to, alkylating agents, platinum-based agents, intercalating agents, and DNA replication inhibitors.

[0086] As used herein, an "alkylating agent" refers to a group containing one or more alkyl groups (C n H m [wherein n and m are integers] to nucleic acids. In the present invention, the alkylating agent is selected from the group consisting of nitrogen mustards, nitrosoureas, alkyl sulfonates, triazines, ethyleneimines, and combinations thereof. Non-limiting examples of nitrogen mustards include mechlorethamine (Lundbeck), chlorambucil (GlaxoSmithKline), cyclophosphamide (Mead Johnson Co.), bendamustine (Astellas), ifosfamide (Baxter International), melphalan (Ligand), melphalan flufenamide (Oncopeptides), and pharmaceutically acceptable salts thereof. Non-limiting examples of nitrosoureas include streptozocin (Teva), carmustine (Eisai Co.), lomustine (Sanofi), and pharmaceutically acceptable salts thereof. Non-limiting examples of alkyl sulfonates include busulfan (Jazz Pharmaceuticals) and pharmaceutically acceptable salts thereof. Non-limiting examples of triazines include dacarbazine (Bayer) and temozolomide (Cancer Research Technology) and pharmaceutically acceptable salts thereof. Non-limiting examples of ethylenimines include thiotepa (Bedford Laboratories) and altretamine (MGI Pharma) and pharmaceutically acceptable salts thereof. Other alkylating agents include ProLindac (Access), Ac-225 BC-8 (Actinium Pharmaceuticals), ALF-2111 (Alfact Innovation), trofosfamide (Baxter International), MDX-1 203 (Bristol-Myers Squibb), thioureidobutyronitrile (CellCeutix), mitobronitol (Chinoin), mitolactol (Chinoin), nimustine (Daiichi Sankyo Co., Ltd.), glufosfamide (Eleison Pharmaceuticals), combination of HuMax-TAC ​​and PBD ADC (Genmab), BP-C1 (Meabco), treosulfan (Medac), nifurtimox (Metronomx), improsulfan tosylate (Mitsubishi Tanabe Pharma Corporation), ranimustine (Mitsubishi Tanabe Pharma Corporation), ND-01 (NanoCarrier), HH-1 (Nordic Nanovector), combination of 22P1G cells and ifosfamide (Nuvilex), estramustine phosphate (Pfizer), prednimustine (Pfizer), lurbinectedin (PharmaMar), trabectedin (PharmaMar), altreatam (Sanofi), SGN-CD33A (Seattle Genetics), fotemustine (Servier), nedaplatin (Shionogi & Co., Ltd.), heptaplatin (Sk Holdings), apaziquone (Spectrum Pharmaceuticals), SG-2000 (Spirogen), TLK-58747 (Telik), laromustine (Vion Pharmaceuticals), procarbazine (Alkem Laboratories Ltd.), and pharmaceutically acceptable salts thereof.

[0087] As used herein, a "platinum-based drug" refers to an anti-cancer agent containing the metal platinum and analogs of such agents. The platinum may be in any oxidation state. Platinum-based drugs of the present invention include 1,2-diaminocyclohexane (DACH) derivatives, phenanthroimidazole Pt(II) complexes, platinum IV compounds, binuclear and trinuclear platinum compounds, demethylcantharidin-incorporated platinum complexes, platinum conjugate compounds, cisplatin nanoparticles and polymeric micelles, sterically hindered platinum complexes, oxaliplatin (Debiopharm), satraplatin (Johnson Matthey), BBR3464 (Novuspharma SpA), and others.), ZD0473 (Astra Zeneca), cisplatin (Nippon Kayaku Co., Ltd.), JM-11 (Johnson Matthey), PAD (cis-dichlorobiscyclopentylamineplatinum(II)), MBA ((trans-1,2-diaminocyclohexane)bisbromoacetatoplatinum(II)), PHM ((1,2-cyclohexanediamine)malonatoplatinum(II)), SHP ((1,2-cyclohexanediamine)sulfatoplatinum(II)), neo-PHM ((trans-R,R-1,2-cyclohexanediamine)malonatoplatinum(II)), neo-SHP ((trans-R,R-1,2-cyclohexanediamine)sulfatoplatinum(II)), JM-82 (Johnson Matthey), PYP ((1,2-cyclohexanediamine)bispyruvatoplatinum(II)), PHIC ((1,2-cyclohexanediamine)isocitratoplatinum(II)), TRK-710 ((trans-R,R-1,2-cyclohexanediamine)[3-acetyl-5-methyl-2,4(3H,5H)-furandionato]platinum(II)), BOP ((1,2-cyclooctanediamine)bisbromoacetatoplatinum(II)), JM-40 (Johnson Matthey), enloplatin (UnionPharma), zeniplatin (LGM Pharma), CI-973 (Parke-Davis), lobaplatin (Zentaris AG / Hainan Tianwang International Pharmaceutical), cycloplatam (LGM Pharma), WA2114R (miboplatin / lobaplatin) (Chembest Research Laboratories, Ltd.), heptaplatin (SKI2053R) (SK Chemicals), TNO-6 (spiroplatin) (Haihang Industry Co., Ltd.), ormaplatin (tetraplatin) (LGM Pharma), JM-9 (iproplatin) (Johnson Matthey), BBR3610 (Novuspharma SpA), BBR3005 (Novuspharma SpA), BBR3571 (Novuspharma SpA), BBR3537 (Novuspharma SpA), and Aropla. Cisplatin (L-NDDP) (BOC Sciences), Pt-ACRAMTU ({[Pt(en)Cl(ACRAMTU-S)](NO3)2 (en = ethane-1,2-diamine, ACRAMTU = 1-[2-(acridin-9-ylamino)ethyl]-1,3-dimethylthiourea)}), cisplatin-loaded liposomes (LiPlasomes), SPI-077 (Alza), lipoplatin (Regulon), lipoxal (Regulon), carboplatin (Johnson Matthey), nedaplatin (Shionogi & Co., Ltd.), miriplatin hydrate (Sumitomo Dainippon Pharma Co., Ltd.), ormaplatin (LGM Pharma), enloplatin (Lederle Laboratories), CI973 (Parke-Davis), PEGylated cisplatin, PEGylated carboplatin, PEGylated oxaliplatin, transplatin (trans-diamminedichloroplatinum(II); mixed Z:trans-[PtCl2{Z-HN=C(OMe)Me}(NH3)]), CD-37 (estradiol-platinum(II) hybrid molecule), picoplatin (Poniard Pharmaceuticals), [ka] , AH44 (Komeda et al., 2006; Harris et al., 2005; Qu et al., 2004), Triplatin NC (Harris et al., 2005; Qu et al., 2004), ProLindac (Access), pharmaceutically acceptable salts thereof, and combinations thereof.

[0088] As used herein, "intercalating agents" include, but are not limited to, doxorubicin (adriamycin), daunorubicin, idarubicin, mitoxantrone, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof.

[0089] Non-limiting examples of DNA replication inhibitors include, but are not limited to, topoisomerase inhibitors. As used herein, a "topoisomerase inhibitor" is a substance that reduces the expression or activity of topoisomerase. The topoisomerase inhibitor according to the present invention can inhibit topoisomerase I, topoisomerase II, or both topoisomerase I and topoisomerase II. Non-limiting examples of topoisomerase I inhibitors according to the present invention include irinotecan (Alchemia), APH-0804 (Aphios), camptothecin (Aphios), cositecan (BioNumerik), topotecan (GlaxoSmithKline), belotecan hydrochloride (Chon Kun Dang), filtecampegol (Enzon), HN-30181A (Hanmi), hRS7-SN-38 (Immunomedics), labetuzumab-SN-38 (Immunomedics), etirinotecampegol (Nektar Therapeutics), NK-012 (Nippon Kayaku Co., Ltd.), SER-203 (Serina Therapeutics), cimetizumab hydrochloride prodrug (Shanghai HaiHe Pharmaceuticals), dimatecan (Sigma-Tau), namitecan (Sigma-Tau), SN-38 (Supratek Pharma), TLC-388 hydrochloride (Taiwan Liposome Company), Lamellarin D (PharmaMar), pharmaceutically acceptable salts thereof, and combinations thereof. Non-limiting examples of type II topoisomerase inhibitors according to the present invention include Adva-27a (Advanomics), zoptarelin doxorubicin (Aeterna Zentaris), valrubicin (Anthra Pharmaceuticals), razoxane (AstraZeneca). , doxorubicin (Avena Therapeutics), amsacrine (Bristol-Myers Squibb), etoposide phosphate (Bristol-Myers Squibb), etoposide (Novartis), dexrazoxane (Cancer Research Technology), cytarabine / daunorubicin combination (Celator Pharmaceuticals), CAP7.1 (CellAct Pharma), aldoxorubicin (CytRx), amrubicin hydrochloride (Sumitomo Dainippon Pharma Co., Ltd.), vosaroxin (Sumitomo Dainippon Pharma Co., Ltd.), daunorubicin (Gilead Sciences), milatuzumab / doxorubicin combination (Immunomedics), aclarubicin (Kyowa Hakko Kirin Co., Ltd.), mitoxantrone (Meda), pirarubicin (Meiji Pharmaceutical Co., Ltd.), epirubicin (Pfizer), teniposide (Novartis), F-14512 (Pierre Fabre), elliptinium acetate (Sanofi), zorubicin (Sanofi), dexrazoxane (TopoTarget), sobuzoxane (Zenyaku Kogyo Co., Ltd.), idarubicin (Pfizer), HU-331 (Cayman Chemical), aurintricarboxylic acid (Sigma Aldrich), pharmaceutically acceptable salts thereof, and combinations thereof.

[0090] Chemotherapeutic antibiotics according to the present invention include, but are not limited to, actinomycin, anthracyclines, valrubicin, epirubicin, bleomycin, plicamycin, mitomycin, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof.

[0091] As used herein, "antiangiogenic agent" refers to any compound that prevents or delays the formation of new blood vessels from pre-existing blood vessels. In the present invention, examples of antiangiogenic agents include pegaptanib, ranibizumab, bevacizumab (avastin), carboxyamidotriazole, TNP-470, CM101, IFN-α, IL-12, platelet factor 4, suramin, SU5416, thrombospondin, VEGFR antagonists, angiostatic steroids and heparin, cartilage-derived angiogenic inhibitory factor, matrix metalloproteinase inhibitors, angiostatin, endostatin, 2-methoxyestradiol, tecogalan, prolactin, α v Antiangiogenic agents include, but are not limited to, β3 inhibitors, linomide, VEGF-Trap, aminosterols, cortisone, tyrosine kinase inhibitors, antiangiogenic siRNA, complement system inhibitors, vascular disrupting agents, and combinations thereof.Preferably, the antiangiogenic agent is bevacizumab.

[0092] VEGFR antagonists of the present invention include, but are not limited to, pazopanib, regorafenib, lenvatinib, sorafenib, sunitinib, axitinib, vandetanib, cabozantinib, vatalanib, semaxanib, ZD6474, SU6668, AG-013736, AZD2171, AEE788, MF1 / MC-18F1, DC101 / IMC-1C11, ramucirumab, and motesanib. VEGFR antagonists can also include VEGF inhibitors, such as bevacizumab, aflibercept, 2C3, r84, VEGF-Trap, and ranibizumab.

[0093] The angiogenesis-inhibiting steroid of the present invention includes any steroid that inhibits, reduces, or prevents angiogenesis or neovascularization, or causes regression of pathological angiogenesis.The angiogenesis-inhibiting steroid of the present invention includes those disclosed in European Application No. EP1236471A2, as well as the 20-substituted steroids disclosed in U.S. Patent No. 4,599,331, the 21-hydroxysteroids disclosed in U.S. Patent No. 4,771,042, the C11-functionalized steroids disclosed in International Application No. WO1987 / 02672, 6α-fluoro-17α,21-dihydroxy-16α-methylpregna-4,9(11)-diene-3,20-dione 21-acetate, 6α-fluoro-17α,21-dihydroxy-16β ... dione, 6α-fluoro-17α,21-dihydroxy-16β-methylpregna-4,9(11)-diene-3,20-dione 21-phosphonooxy, and pharmaceutically acceptable salts thereof, hydrocortisone, tetrahydrocortisol, 17α-hydroxyprogesterone, 11α-epihydrocortisone, cortexolone, corticosterone, desoxycorticosterone, dexamethasone, cortisone Examples of suitable hydroxybenzoates include 17α-hydroxy-6α-methylpregn-4-ene-3,20-dione 17-acetate, hydrocortisone 21-phosphate, 17α-hydroxy-6α-methylpregn-4-ene-3,20-dione 17-acetate, 6α-fluoro-17α,21-dihydroxy-16α-methylpregna-4,9(11)-diene-3,20-dione, and Δ9(11)-ethianate (all disclosed in International Application No. WO 1990 / 015816 A1).

[0094] Cartilage-derived angiogenesis inhibitors include, but are not limited to, the peptides troponin and chondromodulin I.

[0095] Matrix metalloproteinase inhibitors of the present invention include, but are not limited to, succinyl hydroxamates such as marimastat and SC903, sulfonamide hydroxamates such as CGS27023A, phosphinamide hydroxamates, carboxylate inhibitors such as BAY12-9566, thiol inhibitors such as Compound B, aminomethylbenzimidazole analogs, peptides such as regacepin, and tetracyclines such as minocycline.

[0096] αvβ3 inhibitors include, but are not limited to, IS20I, P11 peptide, EMD85189 and 66203, RGD peptides, RGD mimetics such as S 36578-2, echistatin, antibodies or antibody fragments against αvβ3 integrin such as Vitaxin which targets the extracellular domain of the dimer, cilengitide, and peptidomimetics such as S247.

[0097] Anti-angiogenic siRNA includes but is not limited to the siRNA that targets mRNA that is upregulated during angiogenesis, optionally PEGylated siRNA that targets VEGF or VEGFR mRNA, and siRNA that targets UPR (unfolded protein response)-IRE1α, XBP-1 and ATF6 mRNA.In addition, siRNA with a minimum length of 21 nucleotides has been shown to suppress angiogenesis regardless of target sequence (Kleinman et al., 2008), and can be included in the anti-angiogenic siRNA of the present invention.

[0098] Inhibitors of the complement system include, but are not limited to, modified natural complement components, such as soluble type 1 complement receptor, soluble type 1 complement receptor lacking the long homology repeat A, soluble type 1 complement receptor-sialyl Lewis x, type 2 complement receptor, soluble decay-accelerating factor, soluble membrane cofactor protein, soluble CD59, decay-accelerating factor-CD59 hybrid, membrane cofactor protein-decay-accelerating factor hybrid, C1 inhibitor, and C1q receptor, synthetic inhibitors of complement activation, such as complement inhibitory antibodies, such as anti-C5 monoclonal antibodies and anti-C5 single-chain Fv, antagonistic peptides and analogs targeting the C5a receptor, and naturally occurring compounds that block complement activation, such as heparin and related glycosaminoglycan compounds. Additional inhibitors of the complement system are disclosed by Makrides (Makrides, 1998).

[0099] As used herein, the term "vascular disrupting agent" refers to any compound that targets pre-existing vasculature, e.g., tumor vasculature, and damages or destroys said vasculature and / or causes tumor central necrosis. In the present invention, examples of vascular disrupting agents include ABT-751 (Abbott), AVE8062 (Aventis), BCN105 (Bionomics ), BMXAA (Antisoma), CA-4-P (OxiGene), CA-1-P (OxiGene), CYT997 (Cytopia), MPC-6827 (Myriad Pharmaceuticals), MN-029 (MediciNova), NPI-2358 (Nereus), Oxi4503 (Oxigene), TZT-1027 (Daiichi Pharmaceutical Co., Ltd.), ZD6126 (AstraZeneca and Angiogene), pharmaceutically acceptable salts thereof, and combinations thereof.

[0100] As used herein, a "molecularly targeted agent" refers to a substance that, when administered to a subject, interferes with the function of a single molecule or group of molecules, preferably a single molecule or group of molecules involved in tumor growth and progression. Non-limiting examples of molecularly targeted agents of the present invention include signal transduction inhibitors, modulators of gene expression and other cellular functions, immune system modulators, antibody-drug conjugates (ADCs), and combinations thereof.

[0101] As used herein, a "signal transduction inhibitor" is a substance that disrupts communication between cells, such as when an extracellular signaling molecule activates a cell surface receptor. Non-limiting examples of signal transduction inhibitors of the present invention include anaplastic lymphoma kinase (ALK) inhibitors, B-Raf inhibitors, epidermal growth factor inhibitors (EGFRi), ERK inhibitors, Janus kinase inhibitors, MEK inhibitors, mammalian target of rapamycin (mTor) inhibitors, phosphoinositide 3 kinase inhibitors (PI3Ki), and Ras inhibitors.

[0102] As used herein, an "anaplastic lymphoma kinase (ALK) inhibitor" is a substance that (i) directly interacts with ALK, e.g., by binding to ALK, and (ii) reduces the expression or activity of ALK. Non-limiting examples of anaplastic lymphoma kinase (ALK) inhibitors of the present invention include crizotinib (Pfizer, New York, NY), CH5424802 (Chugai Pharmaceutical Co., Ltd., Tokyo, Japan), GSK1838705 (GlaxoSmithKline, United Kingdom), Chugai 13d (Chugai Pharmaceutical Co., Ltd., Tokyo, Japan), CEP28122 (Teva Pharmaceutical Industries, Ltd., Israel), AP26113 (Ariad Pharmaceuticals, Cambridge, MA), Cephalon 30 (Teva Pharmaceutical Industries, Ltd., Israel), X-396 (Xcovery, Inc., West Palm Beach, FL), Amgen 36 (Amgen Pharmaceuticals, Thousand Oaks, CA), ASP3026 (Astellas Pharma US, Inc., Northbrook, Illinois), and Amgen 49 (Amgen Pharmaceuticals, Thousand Oaks, Calif.), pharmaceutically acceptable salts thereof, and combinations thereof.

[0103] As used herein, a "B-Raf inhibitor" of the present invention is a substance that (i) directly interacts with B-Raf, for example, by binding to B-Raf, and (ii) reduces the expression or activity of B-Raf. B-Raf inhibitors can be classified into two types based on their binding mode. As used herein, a "type 1" B-Raf inhibitor is an inhibitor that targets the ATP-binding site of the kinase in its active conformation. A "type 2" B-Raf inhibitor is an inhibitor that preferentially binds to the inactive conformation of the kinase. Non-limiting examples of type 1 B-Raf inhibitors of the present invention are: [ka] [ka] These include dabrafenib (GlaxoSmithKline), GDC-0879 (Genentech), L-779450 B-Raf (Merck), PLX3202 (Plexxikon), PLX4720 (Plexxikon), SB-590885 (GlaxoSmithKline), SB-699393 (GlaxoSmithKline), vemurafenib (Plexxikon), pharmaceutically acceptable salts thereof, and combinations thereof. Preferably, the type 1 RAF inhibitor is dabrafenib or a pharmaceutically acceptable salt thereof.

[0104] Non-limiting examples of type 2 B-Raf inhibitors of the present invention include: [ka] [ka] [ka] [ka] [ka] [ka] Includes sorafenib (Onyx Pharmaceuticals), ZM-336372 (AstraZeneca), pharmaceutically acceptable salts thereof, and combinations thereof.

[0105] Other B-Raf inhibitors include, but are not limited to, AAL881 (Novartis); AB-024 (Ambit Biosciences), ARQ-736 (ArQule), ARQ-761 (ArQule), AZ628 (Axon Medchem BV), BeiGene-283 (BeiGene), BIIB-024 (MLN 2480) (Sunesis & Takeda), b-raf inhibitor (Sareum), BRAF kinase inhibitor (Selexagen Therapeutics), BRAF siRNA 313 (tacaccagcaagctagatgca) and 253 (cctatcgttagagtcttcctg) (Liu et al., 2007), CTT239065 (Institute of Cancer Research)), DP-4978 (Deciphera Pharmaceuticals), HM-95573 (Hanmi), GW5074 (Sigma Aldrich), ISIS 5132 (Novartis), LErafAON (NeoPharm,Inc.), LBT613 (Novartis), LGX-818 (Novartis), pazopanib (GlaxoSmithKline), PLX5568 (Plexxikon), RAF-265 (Novartis), RAF-365 (Novartis), regorafenib (Bayer) Healthcare Pharmaceuticals, Inc.), RO5126766 (Hoffmann-La Roche), TAK 632 (Takeda Pharmaceutical Co., Ltd.), TL-241 (Teligene), XL-281 (Exelixis), pharmaceutically acceptable salts thereof, and combinations thereof.

[0106] As used herein, an "EGFR inhibitor" refers to an agent that (i) binds to, e.g., EGFR. and (ii) a substance that directly interacts with EGFR by inhibiting EGFR expression or activity. Non-limiting examples of EGFR inhibitors according to the present invention include (+)-aeroprisinin-1 (CAS No. 28656-91-9), 3-(4-isopropylbenzylidenyl)-indolin-2-one, ABT-806 (Life Science Pharmaceuticals), AC-480 (Bristol-Myers Squibb), afatinib (Boehringer Ingelheim), AG 1478 (CAS No. 153436-53-4), AG 494 (CAS No. 133550-35-3), AG 555 (CAS No. 133550-34-2), AG 556 (CAS No. 133550-41-1), AG 825 (CAS No. 149092-50-2), AG-490 (CAS No. 134036-52-5), antroquinonol (Golden Biotechnology), AP-26113 (Ariad), ARRY334543 (CAS number 845272-21-1), AST 1306 (CAS number 897383-62-9), AVL-301 (Celgene), AZD8931 (CAS number 848942-61-0), BIBU 1361 (CAS number 793726-84-8), BIBX 1382 (CAS number 196612-93-8), BMS-690514 (Bristol-Myers Squibb), BPIQ-I (CAS number 174709-30-9), canertinib (Pfizer), cetuximab (Actavis), sipatinib (Jiangsu Hengrui Medicine), CL-387,785 (Santa Cruz Biotech), compound 56 (CAS number 171745-13-4), CTX-023 (CytomX Therapeutics), CUDC-101 (Curis), dacomitinib (Pfizer), DAPH (CAS number 145915-58-8), daphnetin (Santa Cruz Biotech), dovitinib lactate (Novartis), EGFR inhibitor (CAS number 879127-07-8), epitinib (Hutchison China MediTech), erbstatin analog (CAS number 63177-57-1), erlotinib (Astellas), gefitinib (AstraZeneca), GT-MAB 5.2-GEX (Glycotope), GW 583340 (CAS No. 388082-81-3), GW2974 (CAS No. 202272-68-2), HDS 029 (CAS No. 881001-19-0), hypericin (Santa Cruz Biotech), icotinib hydrochloride (Betapharma), JNJ-26483327 (Johnson & Johnson), JNJ-28871063 (Johnson & Johnson), KD-020 (Kadmon Pharmaceuticals), lapatinib ditosylate (GlaxoSmithKline), lavendustin A (Sigma), lavendustin C (Sigma), LY-3016859 (Eli Lilly), MEHD-7945A (Hoffmann-La Roche), MM-151 (Merrimack), MT-062 (Medisyn Technologies), necitumumab (Eli Lilly), neratinib (Pfizer), nimotuzumab (Center of Molecular Immunology), NT-004 (NewGen Therapeutics), panitumumab (Amgen), PD 153035 (CAS number 153436-54-5), PD 161570 (CAS number 192705-80-9), PD, 168393, PD 174265 (CAS number 216163-53-0), pyrotinib (Sihuan Pharmaceutical), poziotinib (Hanmi), PP 3 (CAS number 5334-30-5), PR-610 (Proacta), pyrotinib (Jiangsu Hengrui Medicine), RG-13022 (CAS number 136831-48-6), rindopepimt (Celldex Therapeutics), RPI-1 (CAS number 269730-03-2), S-222611 (Shionogi & Co., Ltd.), TAK 285 (CAS number 871026-44-7), TAS-2913 (Taiho Pharmaceutical Co., Ltd.), ceriatinib (Hutchison China MediTech), Tyrphostin 47 (RG-50864, ​​AG-213) (CAS number 118409-60-2), Tyrphostin 51 (CAS number 122520-90-5) , Tyrphostin AG 1478 (CAS No. 175178-82-2), Tyrphostin AG 183 (CAS No. 126433-07-6), Tyrphostin AG 528 (CAS No. 133550-49-9), Tyrphostin AG 99 (CAS No. 118409-59-9), Tyrphostin B42 (Santa Cruz Biotech), Tyrphostin B44 (Santa Cruz Biotech), Tyrphostin RG 14620 (CAS No. 136831-49-7), vandetanib (AstraZeneca), varlitinib (Array BioPharma), vatalanib (Novartis), WZ 3146 (CAS No. 1214265-56-1), WZ 4002 (CAS No. 1213269-23-8), WZ8040 (CAS No. 1214265-57-2), XL-647 (Exelixis), Z-650 (HEC Pharm), ZM 323881 (CAS No. 324077-30-7), pharmaceutically acceptable salts thereof, and combinations thereof. Preferably, the EGFR inhibitor is selected from the group consisting of panitumumab, erlotinib, pharmaceutically acceptable salts thereof, and combinations thereof.

[0107] As described above, the malonate salt of the present invention is an ERK inhibitor. As used herein, an "ERK inhibitor" refers to a substance that (i) directly interacts with ERK, including ERK1 and ERK2, for example, by binding to ERK, and (ii) reduces the expression or activity of ERK protein kinases. Therefore, inhibitors that act upstream of ERK, such as MEK inhibitors and RAF inhibitors, are not ERK inhibitors according to the present invention. The malonate salt of the present invention can be administered in combination with other ERK inhibitors, including, for example, AEZS-131 (Aeterna Zentaris), AEZS-136 (Aeterna Zentaris), SCH-722984 (Merck & Co.), SCH-772984 (Merck & Co.), SCH-900353 (MK-8353) (Merck & Co.), pharmaceutically acceptable salts thereof, and combinations thereof, as a combination therapy.

[0108] As used herein, a "Janus kinase inhibitor" refers to a substance that (i) directly interacts with a Janus kinase, for example, by binding to the Janus kinase, and (ii) reduces the expression or activity of the Janus kinase. Janus kinases of the present invention include Tyk2, Jak1, Jak2, and Jak3. Non-limiting examples of Janus kinase inhibitors of the present invention include ruxolitinib (Incyte Corporation, Wilmington, DE), baricitinib (Incyte Corporation, Wilmington, DE), tofacitinib (Pfizer, New York, NY), VX-509 (Vertex Pharmaceuticals, Inc., Boston, MA), GLPG0634 (Galapagos NV, Belgium), CEP-33779 (Teva Pharmaceuticals, Israel), pharmaceutically acceptable salts thereof, and combinations thereof.

[0109] As used herein, a "MEK inhibitor" refers to a substance that (i) directly interacts with MEK, for example, by binding to MEK, and (ii) reduces the expression or activity of MEK. Therefore, inhibitors that act upstream of MEK, such as RAS inhibitors and RAF inhibitors, are not MEK inhibitors according to the present invention. MEK inhibitors can be classified into two types depending on whether the inhibitor competes with ATP. As used herein, a "type 1" MEK inhibitor is an inhibitor that competes with ATP for binding to MEK. A "type 2" MEK inhibitor is an inhibitor that does not compete with ATP for binding to MEK. Non-limiting examples of type 1 MEK inhibitors according to the present invention include bentamapimod (Merck KGaA), L783277 (Merck), RO092210 (Roche), pharmaceutically acceptable salts thereof, and combinations thereof. Preferably, the type 1 MEK inhibitor is RO092210 (Roche) or a pharmaceutically acceptable salt thereof. Non-limiting examples of type 2 MEK inhibitors according to the present invention include anthrax toxin, the lethal factor portion of anthrax toxin, and the like. , ARRY-142886 (6-(4-bromo-2-chloro-phenylamino)-7-fluoro-3-methyl-3H-benzimidazole-5-carboxylic acid (2-hydroxy-ethoxy)-amide) (Array BioPharma), ARRY-438162 (Array BioPharma), AS-1940477 (Astellas), MEK162 (Array BioPharma), PD 098059 (2-(2'-amino-3'-methoxyphenyl)-oxanaphthalen-4-one), PD 184352 (CI-1040), PD-0325901 (Pfizer), pimasertib (Santhera Pharmaceuticals), refametinib (AstraZeneca), selumetinib (AZD6244) (AstraZeneca), TAK-733 (Takeda Pharmaceutical Company Limited), trametinib (Japan Tobacco Inc.), U0126 (1,4-diamino-2,3-dicyano-1,4-bis(2-aminophenylthio)butadiene) (Sigma), RDEA119 (Ardea Biosciences / Bayer), pharmaceutically acceptable salts thereof, and combinations thereof. Preferably, the type 2 MEK inhibitor is trametinib or a pharmaceutically acceptable salt thereof. Other MEK inhibitors include, but are not limited to, antroquinonol (Golden Biotechnology), AS-1940477 (Astellas), AS-703988 (Merck KGaA), BI-847325 (Boehringer Ingelheim), E-6201 (Eisai Co., Ltd.), GDC-0623 (Hoffmann-La Roche), GDC-0973, RG422, RO4987655, RO5126766, SL327, WX-554 (Wilex), YopJ polypeptides, pharmaceutically acceptable salts thereof, and combinations thereof.

[0110] As used herein, an "mTOR inhibitor" is a substance that (i) directly interacts with mTOR, for example, by binding to mTOR, and (ii) decreases the expression or activity of mTOR. Non-limiting examples of mTOR inhibitors according to the present invention include zotarolimus (AbbVie), umirolimus (Biosensors), temsirolimus (Pfizer), sirolimus (Pfizer), sirolimus NanoCrystal (Elan Pharmaceutical Technologies), sirolimus TransDerm (TransDerm), sirolimus-PNP (Samyang), everolimus (Novartis), Biolimus A9 (Biosensors), ridaforolimus (Ariad), rapamycin, TCD-10023 (Terumo), DE-109 (MacuSight), MS-R001 (MacuSight), MS-R002 (MacuSight), MS-R003 (MacuSight), Perceiva (MacuSight), XL-765 (Exelixis), quinacrine (Cleveland BioLabs), PKI-587 (Pfizer), PF-04691502 (Pfizer), GDC-0980 (Genentech and Piramed), dactolisib (Novartis), CC-223 (Celgene), PWT-33597 (Pathway Therapeutics), P-7170 (Piramal Life Sciences), LY-3023414 (Eli Lilly), INK-128 (Takeda Pharmaceutical Company Limited), GDC-0084 (Genentech), DS-7423 (Daiichi Sankyo Co., Ltd.), DS-3078 (Daiichi Sankyo Co., Ltd.), CC-115 (Celgene), CBLC-137 (Cleveland BioLabs), AZD-2014 (AstraZeneca), X-480 (Xcovery), X-414 (Xcovery), EC-0371 (Endocyte), VS-5584 (Verastem), PQR-401 (Piqur), PQR-316(Piqur), PQR-311(Piqur), PQR-309(Piqur), PF-06465603(Pfizer), NV-128(Novogen), nPT-MTOR(BioticaTechnology), BC-210(Biotica Technology), WAY-600(Biotica Technology), WYE-354(Biotica Technology), WYE-687(Biotica Technology), LOR-22 0 (Lorus Therapeutics), HMPL-518 (Hutchison China MediTech), GNE-317 (Genentech), EC-0565 (Endocyte), CC-214 (Celgene), and ABTL-0812 (Ability Pharmaceuticals).

[0111] As used herein, a "PI3K inhibitor" refers to a substance that reduces the expression or activity of phosphatidylinositol 3-kinase (PI3K) or downstream proteins such as Akt. When activated, PI3K phosphorylates the 3'-OH group of the inositol ring in inositol phospholipids to generate the second messenger phosphatidylinositol-3,4,5-triphosphate (PI-3,4,5-P(3)). Akt interacts with phospholipids, which allows Akt to translocate to endomembranes, where it becomes phosphorylated and activated. Activated Akt modulates the function of numerous substrates involved in regulating cell survival, cell cycle progression, and cell growth.

[0112] Non-limiting examples of PI3K inhibitors according to the present invention include A-674563 (CAS No.: 552325-73-2), AGL 2263, AMG-319 (Amgen, Thousand Oaks, CA), AS-041164 (5-benzo[1,3]dioxol-5-ylmethylene-thiazolidine-2,4-dione), AS-604850 (5-(2,2-difluoro-benzo[1,3]dioxol-5-ylmethylene)-thiazolidine-2,4-dione), AS-605240 (5-quinoxyline-6-methylene-1,3-thiazolidine-2,4-dione), AT7867 (CAS No.: 857531-00-1), Genentech (Roche Holdings Inc., South San Francisco, CA), and others. Benzimidazole series from Gilead Sciences (Foster City, CA), BML-257 (CAS No.: 32387-96-5), CAL-120 (Gilead Sciences, Foster City, CA), CAL-129 (Gilead Sciences), CAL-130 (Gilead Sciences), CAL-253 (Gilead Sciences), CAL-263 (Gilead Sciences), CAS No.: 612847-09-3, CAS No.: 681281-88-9, CAS No.: 75747-14-7, CAS No.: 925681-41-0, CAS No.: 98510-80-6, CCT128930 (CAS No.: 885499-61-6), CH5132799 (CAS No.: 1007207-67-1), CHR-4432 (Chroma Therapeutics, Ltd., Abingdon, UK), FPA 124 (CAS number: 902779-59-3), GS-1101 (CAL-101) (Gilead Sciences), GSK 690693 (CAS number: 937174-76-0), H-89 (CAS number: 127243-85-0), honokiol, IC87114 (Gilead Science), IPI-145 (Intellikine Inc.), KAR-4139 (Karus Therapeutics, Chilworth, UK), KAR-4141 (Karus Therapeutics), KIN-1 (Karus Therapeutics), KT 5720 (CAS number: 108068-98-0), miltefosine, MK-2206 dihydrochloride (CAS number: 1032350-13-2), ML-9 (CAS number: 105637-50-1), naltrindole hydrochloride, OXY-111A (NormOxys Inc., Brighton, MA), perifosine, PHT-427 (CAS number: 1191951-57-1), a PI3 kinase delta inhibitor from Merck KGaA (Merck & Co., Whitehouse Station, NJ), a PI3 kinase delta inhibitor from Genentech (Roche Holdings Inc.), and Incozen (Incozen Therapeutics,Pvt.Ltd.,Hydrabad,India) PI3 kinase delta inhibitor, Incozen (Incozen Therapeutics) PI3 kinase delta inhibitor 2, Roche-4 (Roche Holdings Inc.) PI3 kinase inhibitor, Roche (Roche Holdings Inc.) PI3. kinase inhibitors, PI3 kinase inhibitors from Roche-5 (Roche Holdings Inc.), PI3-alpha / delta inhibitors from Pathway Therapeutics (Pathway Therapeutics Ltd., South San Francisco, CA), PI3-delta inhibitors from Cellzome (Cellzome AG, Heidelberg, Germany), PI3-delta inhibitors from Intellikine (Intellikine Inc., La Jolla, CA), PI3-delta inhibitors from Pathway Therapeutics-1 (Pathway Therapeutics Ltd.), PI3-delta inhibitors from Pathway Therapeutics-2 (Pathway Therapeutics Ltd.), PI3-delta / gamma inhibitors from Cellzome (Cellzome AG), PI3-delta / gamma inhibitors from Intellikine (Intellikine Inc.), PI3-delta / gamma inhibitors from Intellikine (Intellikine Inc.), Pathway PI3-delta / gamma inhibitors from Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-delta / gamma inhibitors from Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-gamma inhibitors from Evotec (Evotec), PI3-gamma inhibitors from Cellzome (Cellzome AG), PI3-gamma inhibitors from Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3K delta / gamma inhibitors from Intellikine-1 (Intellikine Inc.), PI3K delta / gamma inhibitors from Intellikine-1 (Intellikine Inc.), pictilisib (GDC-0941) (Roche Holdings Inc.), PIK-90 (CAS No.: 677338-12-4), SC-103980 (Pfizer, New York, NY), SF-1126 (Semafore Pharmaceuticals, Indianapolis, IN), SH-5, SH-6, tetrahydrocurcumin, TG100-115 (Targegen Inc., San Diego, CA), triciribine, X-339 (Xcovery, West Palm Beach, FL), XL-499 (Evotech, Hamburg, Germany), pharmaceutically acceptable salts thereof, and combinations thereof. Preferably, the PI3K / Akt pathway inhibitor is pictilisib (GDC-0941) or a pharmaceutically acceptable salt thereof.

[0113] As used herein, a "RAS inhibitor" refers to a substance that (i) directly interacts with RAS, for example, by binding to RAS, and (ii) reduces the expression or activity of RAS. Non-limiting examples of RAS inhibitors according to the present invention include farnesyltransferase inhibitors (such as tipifarnib and lonafarnib), farnesyl group-containing small molecules (such as salirasib and TLN-4601), DCAIs as described in Maurer (Maurer et al., 2012), Kobe0065 and Kobe2602 as described in Shima (Shima et al., 2013), and HBS3 (Patgiri et al., 2011), and AIK-4 (Allinky), their pharmaceutically acceptable salts, and combinations thereof.

[0114] As used herein, "gene expression" refers to the process by which information from DNA is used to form polypeptides. "Modulators of gene expression and other cellular functions" refer to substances that affect gene expression and other cellular processes. Non-limiting examples of such modulators include hormones, histone deacetylase inhibitors (HDACi), cyclin-dependent kinase inhibitors (CDKi), and poly ADP-ribose polymerase (PARP) inhibitors.

[0115] For the purposes of the present invention, a "hormone" is a substance released by cells in one part of the body that affects cells in another part of the body. Non-limiting examples of hormones according to the present invention are prostaglandins, prostaglandins, and steroid hormones. hmm gin, leukotrienes, prostacyclin, thromboxane, amylin, anti-Müllerian hormone, adiponectin, adrenocorticotropic hormone, angiotensinogen, angiotensin, vasopressin, atriopeptin, brain natriuretic peptide, calcitonin, cholecystokinin, corticotropin-releasing hormone, encephalin, endothelin, erythropoietin, follicle-stimulating hormone, galanin, gastrin, ghrelin, glucagon, gonadotropin-releasing hormone, growth hormone-releasing hormone, human chorionic gonadotropin, human placental lactogen, growth hormone, inhibin, in These include, but are not limited to, threonine, somatomedin, leptin, lipotropin, luteinizing hormone, melanocyte-stimulating hormone, motilin, orexin, oxytocin, pancreatic polypeptide, parathyroid hormone, prolactin, prolactin-releasing hormone, relaxin, renin, secretin, somatostatin, thrombopoietin, thyroid-stimulating hormone, testosterone, dehydroepiandrosterone, androstenedione, dihydrotestosterone, aldosterone, estradiol, estrone, estriol, cortisol, progesterone, calcitriol, and calcidiol.

[0116] Some compounds interfere with the activity of certain hormones or stop the production of certain hormones. Non-limiting examples of hormone interference compounds according to the present invention include tamoxifen (Nolvadex®), anastrozole (Arimidex®), letrozole (Femara®), and fulvestrant (Faslodex®). Such compounds also fall within the meaning of hormone in the present invention.

[0117] As used herein, an "HDAC inhibitor" is a substance that (i) interacts directly with HDAC, e.g., by binding to HDAC, and (ii) reduces the expression or activity of HDAC. Non-limiting examples of HDAC inhibitors according to the present invention include 4SC-201 (4SC AG), 4SC-202 (Takeda Pharmaceutical Co., Ltd.), abexinostat (Celera), AN-1 (Titan Pharmaceuticals, Inc.), apicidine (Merck & Co., Inc.), AR-42 (Arno Therapeutics), ARQ-700RP (ArQule), Avugane (TopoTarget AS), azelaic-1-hydroxamate-9-anilide (AAHA), belinostat (TopoTarget), butyrate (Enzo Life Sciences, Inc.), CG-1255 (Errant Gene Therapeutics, LLC), CG-1521 (Errant Gene Therapeutics, LLC), CG-200745 (Crystal Genomics, Inc.), chidamide (Shenzhen Chipscreen Biosciences), CHR-3996 (Chroma Therapeutics), CRA-024781 (Pharmacyclics), CS-3158 (Shenzhen Chipscreen Biosciences), CU-903 (Curis), DAC-60 (Genextra), entinostat (Bayer), hyaluronic acid butyrate (HA-But), IKH-02 (IkerChem), IKH-35 (IkerChem), ITF-2357 (Italfarmaco), ITF-A (Italfarmaco), JNJ-16241199 (Johnson & Johnson), KA-001 (Karus Therapeutics), KAR-3000 (Karus Therapeutics), KD-5150 (Kalypsys), KD-5170 (Kalypsys), KLYP-278 (Kalypsys), KLYP-298 (Kalypsys), KLYP-319 (Kalypsys), KLYP-722 (Kalypsys), m-carboxycinnamic acid bis-hydroxamide (CBHA), MG-2856 (MethylGene), MG-3290 (MethylGene), MG-4230 (MethylGene), MG-4915 (MethylGene), MG-502 6 (MethylGene), MGCD-0103 (MethylGene Inc.), mocetinostat (MethylGene), MS-27-275 (Schering AG), NBM-HD-1 (NatureWise), NVP-LAQ824 (Novartis), OCID-4681-S-01 (Orchid Pharmaceuticals), oxamflatin ((2E)-5-[3-[(phenylsulfonyl)aminolphenyl]-pent-2-en-4-ynohydroxamic acid), panobinostat (Novartis), PCI-34051 (Pharmacyclics), phenylbutyrate (Enzo Life Sciences, Inc.), pivaloyloxymethyl butyrate (AN-9, Titan Pharmaceuticals, Inc.), Pivanex (Titan Pharmaceuticals, Inc.), pracinostat (SBIO), PX-117794 (TopoTarget AS), PXD-118490 (LEO-80140) (TopoTarget AS), pyroxamide (suberoyl-3-aminopyridine amide hydroxamic acid), resminostat (Takeda Pharmaceutical Co., Ltd.), RG-2833 (RepliGen), licorinostat (Acetylon), romidepsin (Astellas), SB-1304 (S * BIO), SB-1354(S * BIO), SB-623(Merrion Research I Limited), SB-624(Merrion Research I Limited), SB-639(Merrion Research I Limited), SB-939(S *BIO), Scriptaid (N-hydroxy-1,3-dioxo-1H-benz[de]isoquinoline-2(3H)-hexanamide), SK-7041 (In2Gen / SK Chemical Co.), SK-7068 (In2Gen / SK Chemical Co.), suberoylanilide hydroxamic acid (SAHA), sulfonamide hydroxamic acid, tributyrin (Sigma Aldrich), trichostatin A (TSA) (Sigma Aldrich), valporic acid (VPA) (Sigma Aldrich), vorinostat (Zolinza), WF-27082B (Fujisawa Pharmaceutical Co.), pharmaceutically acceptable salts thereof, and combinations thereof. Preferably, the HDAC inhibitor is romidepsin, pharmaceutically acceptable salts thereof, and combinations thereof.

[0118] As used herein, "CDK" refers to a family of protein kinases that regulate the cell cycle. Known CDKs include cdk1, cdk2, ckd3, ckd4, cdk5, cdk6, cdk7, cdk8, cdk9, cdk10, and cdk11. A "CDK inhibitor" is a substance that (i) directly interacts with a CDK, for example, by binding to the CDK, and (ii) reduces the expression or activity of the CDK. Non-limiting examples of CDK inhibitors according to the present invention include 2-hydroxybohemin, 3-ATA, 5-iodo-indirubin-3'-monoxime, 9-cyanopaulone, aloisine A, alsterpaullone 2-cyanoethyl, alvocidib (Sanofi), AM-5992 (Amgen), aminopurvalanol A, arcyliaflavin A, AT-7519 (Astex Pharmaceuticals), AZD 5438 (CAS number: 602306-29-6), BMS-265246 (CAS number: 582315-72-8), BS-181 (CAS number: 1092443-52-1), butyrolactone I (CAS number: 87414-49-1), Cdk / Crk inhibitor (CAS number: 784211-09-2), Cdk1 / 5 inhibitor (CAS number: 40254-90-8), Cdk2 inhibitor II (CAS No.: 222035-13-4), Cdk2 inhibitor IV, NU6140 (CAS No.: 444723-13-1), Cdk4 inhibitor (CAS No.: 546102-60-7), Cdk4 inhibitor III (CAS No.: 265312-55-8), Cdk4 / 6 inhibitor IV (CAS No.: 359886-84-3), Cdk9 inhibitor II (CAS No.: 140651-18-9), CGP 74514A, CR8, CYC-065 (Cyclacel), dinaciclib (Ligand), (R)-DRF053 dihydrochloride (CAS No.: 1056016-06-8), fascaplysin, flavopiridol, hygrolysine, ibuprofen Ndirubin, LEE-011 (Astex Pharmaceuticals), LY-2835219 (Eli Lilly), milciclib maleate (Nerviano Medical Sciences), MM-D37K (Maxwell Biotech), N9-isopropyl-olomoucine, NSC 625987 (CAS number: 141992-47-4), NU2058 (CAS number: 161058-83-9), NU6102 (CAS number: 444722-95-6), olomoucine, ON-108600 (Onconova), ON-123300 (Onconova), oxindole I, P-1446-05 (Piramal), P-276-00 (Piramal), palbociclib (Pfize r), PHA-767491 (CAS number: 845714-00-3), PHA-793887 (CAS number: 718630-59-2), PHA-848125 (CAS number: 802539-81-7), Purvalanol A, Purvalanol B, R547 (CAS number: 741713-40-6), RO-3306 (CAS number: 872573-93-8), Roscovitine, SB-1317 (SBIO), SCH 900776 (CAS No.: 891494-63-6), SEL-120 (Selvita), seliciclib (Cyclacel), SNS-032 (CAS No.: 345627-80-7), SU9516 (CAS No.: 377090-84-1), WHI-P180 (CAS No.: 211555-08-7), pharmaceutically acceptable salts thereof, and combinations thereof.Preferably, the CDK inhibitor is selected from the group consisting of dinaciclib, palbociclib, pharmaceutically acceptable salts thereof, and combinations thereof.

[0119] As used herein, " poly ADP-ribose polymerase (PARP) inhibitor " refers to the substance that reduces the expression or activity of poly ADP-ribose polymerase (PARP) or downstream protein.Non-limiting examples of the poly ADP-ribose polymerase (PARP) inhibitor of the present invention include PF01367338 (Pfizer, New York, NY), olaparib (AstraZeneca, United Kingdom), iniparib (Sanofi-Aventis, Paris, France), veliparib (Abbott Laboratories, Abbott Park, IL), MK 4827 (Merck, White House Station, NJ), CEP 9722 (Teva Pharmaceuticals, Israel), LT-673 (Biomarin, San Rafael, CA) and BSI 401 (Sanofi-Aventis, Paris, France), their pharmaceutically acceptable salts, and their combinations.

[0120] As used herein, "immunotherapeutic agent" refers to any anti-cancer agent compatible with the solid forms of the present invention, which uses a substance to alter the immune response by enhancing or reducing the immune system's ability to produce antibodies or sensitized cells that recognize and react with the antigen that triggered their production. Immunotherapeutic agents can be recombinant, synthetic, or natural preparations, and include cytokines, corticosteroids, cytotoxic agents, thymosin, and immunoglobulins. Some immunotherapeutic agents occur naturally in the body, and some of these are available in pharmacological preparations. Examples of immunotherapeutic agents include, but are not limited to, granulocyte colony-stimulating factor (G-CSF), interferon, imiquimod, bacterial membrane fractions, IL-2, IL-7, IL-12, CCL3, CCL26, CXCL7, and synthetic cytosine phosphate-guanosine (CpG).

[0121] In a preferred embodiment, the immunotherapeutic agent is an immune checkpoint inhibitor. As used herein, "immune checkpoint inhibitor" refers to a substance that blocks the activity of molecules involved in mitigating immune responses. Such molecules include, for example, cytotoxic T-lymphocyte-associated antigen 4 (CTLA-4) and programmed cell death protein 1 (PD-1). Immune checkpoint inhibitors of the present invention include ipilimumab (Bristol-Myers Squibb), tremelimumab (Pfizer), MDX-1106, and others. (Medarex, Inc.), MK3475 (Merck), CT-011 (CureTech, Ltd.), AMP-224 (AmpImmune), MDX-1105 (Medarex, Inc.), IMP321 (Immutep SA), and MGA271 (Macrogenics).

[0122] As used herein, the term "radionuclide" refers to a radioactive substance that is administered to a patient, for example, intravenously or orally, and then penetrates, via the patient's normal metabolism, to a target organ or tissue where it delivers localized radiation over a short period of time. Examples of radionuclides include, but are not limited to, I-125, At-211, Lu-177, Cu-67, I-131, Sm-153, Re-186, P-32, Re-188, In-114m, and Y-90.

[0123] As used herein, the term "photoactive therapeutic agent" refers to compounds and compositions that become active upon exposure to light. Certain examples of photoactive therapeutic agents are disclosed, for example, in U.S. Patent Application Publication No. 2011 / 0152230A1, "Photoactive Metal Nitrosyls For Blood Pressure Regulation And Cancer Therapy."

[0124] As used herein, the term "radiosensitizer" refers to a compound that makes tumor cells more sensitive to radiation therapy. Examples of radiosensitizers include misonidazole, metronidazole, tirapazamine, and trans-sodium crocetinate.

[0125] In the present invention, an "effective amount" or "therapeutically effective amount" of a malonate form of the present invention or other anti-cancer agent of the present invention, including a pharmaceutical composition containing the malonate form of the present invention or other anti-cancer agent of the present invention, is an amount of such malonate form or composition that, when administered to a subject, is sufficient to produce the beneficial or desired results described herein. Effective dosage forms, modes of administration, and dosage amounts can be determined empirically, and making such determinations is within the skill of those in the art. Those skilled in the art will understand that dosage amounts will vary with the route of administration, rate of excretion, duration of treatment, identity of any other drugs administered, age, size, and species of the subject, e.g., human patient, and similar factors well known in the medical and veterinary arts. In general, an appropriate dose of one or more malonate forms of the present invention or a pharmaceutical composition according to the present invention is the amount of the malonate form or pharmaceutical composition that is the minimum dose effective to produce the desired effect. An effective dose of the malonate salt form or pharmaceutical composition of the present invention can be administered as two, three, four, five, six, or more subdoses administered individually at appropriate intervals throughout the day.

[0126] Suitable non-limiting examples of dosages of the malonate salt form of the invention, or another anti-cancer agent disclosed herein, are from about 1 mg / kg to about 2400 mg / kg per day, including from about 1 mg / kg to about 100 mg / kg per day, from about 1 mg / kg to about 1200 mg / kg per day, from 75 mg / kg to about 300 mg / kg per day, etc. Other representative dosages of such agents are from about 1 mg / kg, 5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 60 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 90 mg / kg, 100 mg / kg, 125 mg / kg, 150 mg / kg, 175 mg / kg, 185 mg / kg, 195 mg / kg, 200 mg / kg, 210 mg / kg, 220 mg / kg, 230 mg / kg, 240 mg / kg, 250 mg / kg, 260 mg / kg, 270 mg / kg, 280 mg / kg, 290 mg / kg, 300 mg / kg, 310 mg / kg, 325 mg / kg, 330 mg / kg, 340 mg / kg, 350 mg / kg, 360 mg / kg, 375 mg / kg, 380 mg / kg, 390 mg / kg, 400 mg / kg, 410 mg / kg, 420 mg / kg, 430 mg / kg, 440 mg / kg, 450 mg / kg, 460 mg / kg, 470 mg / kg, 480 mg / g / kg, 200mg / kg, 250mg / kg, 300mg / kg, 400mg / kg, 500mg / kg, 600mg / kg, 700mg / kg, 800mg / kg, 900mg / kg, 1000m g / kg, 1100mg / kg, 1200mg / kg, 1300mg / kg, 1400mg / kg, 1500mg / kg, 1600mg / kg, 1700mg / kg, 1800mg / kg, 1900mg / kg, 2000mg / kg, 2100mg / kg, 2200mg / kg, and 2300mg / kg. An effective dose of the malonate salt form of the present invention, or other anti-cancer agent disclosed herein, can be administered as two, three, four, five, six, or more sub-doses administered individually at appropriate intervals throughout the day.

[0127] The malonate salt forms of the present invention, or other anti-cancer agents, or pharmaceutical compositions containing them, can be administered in any desired and effective manner, such as orally, as an ointment or eye drops for topical administration to the eye, or for parenteral or other administration, by any suitable method, including intraperitoneal, subcutaneous, topical, intradermal, inhalation, pulmonary, rectal, vaginal, sublingual, intramuscular, intravenous, intraarterial, intrathecal, or intralymphatic administration. Furthermore, the malonate salt forms of the present invention, or other anti-cancer agents, or pharmaceutical compositions containing them of the present invention can be administered together with other treatments. The malonate salt forms of the present invention, or other anti-cancer agents, or pharmaceutical compositions of the present invention can be encapsulated or otherwise protected against gastric or other secretions, if desired.

[0128] The pharmaceutical compositions of the present invention may comprise one or more active ingredients, for example, the malonate salt form of the present invention, optionally combined with other anti-cancer agents, mixed with one or more pharmaceutically acceptable diluents or carriers, and optionally one or more other compounds, drugs, ingredients, and / or materials. Regardless of the route of administration selected, the agents / compounds of the present invention are formulated into pharmaceutically acceptable dosage forms by conventional methods known to those skilled in the art. See, for example, Remington, The Science and Practice of Pharmacy (21st ed., Lippincott Williams and Wilkins, Philadelphia, PA).

[0129] Pharmaceutically acceptable diluents or carriers are well known in the art (see, e.g., Remington, The Science and Practice of Pharmacy (21st ed., Lippincott Williams and Wilkins, Philadelphia, PA.) and The National Formulary (American Pharmaceutical Association, Washington, DC)), sugars (e.g., lactose, sucrose, mannitol, and sorbitol), starch, cellulose preparations, calcium phosphates (e.g., dicalcium phosphate, tricalcium phosphate, and calcium hydrogen phosphate), sodium citrate, water, aqueous solutions (e.g., saline, sodium chloride injection, Ringer's injection, dextrose injection, dextrose and sodium chloride injection, lactated Ringer's injection), alcohols (e.g., ethyl alcohol, propyl alcohol, and benzyl alcohol). , polyols (e.g., glycerol, propylene glycol, and polyethylene glycol), organic esters (e.g., ethyl oleate and triglycerides), biodegradable polymers (e.g., polylactide-polyglycolide, poly(orthoesters), and poly(anhydrides)), elastomeric matrices, liposomes, microspheres, oils (e.g., corn oil, germ oil, olive oil, castor oil, sesame oil, cottonseed oil, and peanut oil), cocoa butter, waxes (e.g., suppository wax), paraffin, silicones, talc, silicylate, and the like. Each pharmaceutically acceptable diluent or carrier used in the pharmaceutical compositions of the present invention must be "acceptable," in the sense of being compatible with the other ingredients of the formulation and not toxic to the subject. Diluents or carriers suitable for a selected dosage form and intended route of administration are well known in the art, and acceptable diluents or carriers for a selected dosage form and administration method can be determined using ordinary skill in the art.

[0130] The pharmaceutical compositions of the present invention may optionally contain additional components and / or materials commonly used in pharmaceutical compositions. These components and materials are well known in the art and include (1) fillers or extenders such as starch, lactose, sucrose, glucose, mannitol, and silicic acid; (2) binders such as carboxymethylcellulose, alginate, gelatin, polyvinylpyrrolidone, hydroxypropylmethylcellulose, sucrose, and acacia; (3) humectants such as glycerol; (4) agar, calcium carbonate, potato starch or tapioca starch, alginic acid, certain silicates, sodium starch glycolate, cross-linked sodium carboxymethylcellulose, and the like. (5) disintegrants such as paraffin and sodium carbonate; (6) absorption enhancers such as quaternary ammonium compounds; (7) wetting agents such as cetyl alcohol and glycerol monostearate; (8) absorbents such as kaolin clay and bentonite clay; (9) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycol, and sodium lauryl sulfate; (10) ethoxylated isostearyl alcohol, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, (12) excipients such as lactose, milk sugar, polyethylene glycol, animal and vegetable fats, oils, waxes, paraffin, cocoa butter, starch, tragacanth, cellulose derivatives, polyethylene glycol, silicones, bentonite, silicic acid, talc, salicylates, zinc oxide, aluminum hydroxide, calcium silicate, and polyamide powder; (13) inert diluents such as water or other solvents; (14) preservatives; (15) surfactants; (16) dispersing agents; (17) release-controlling or absorption-retarding agents such as hydroxypropyl methylcellulose, other polymer matrices, biodegradable polymers, liposomes, microspheres, aluminum monostearate, gelatin, and waxes; (18) opacifying agents; (19) adjuvants; (20) wetting agents; (21) emulsifying and suspending agents;(22) solubilizing and emulsifying agents such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oils (especially cottonseed oil, peanut oil, corn oil, germ oil, olive oil, castor oil, and sesame oil), glycerol, tetrahydrofuryl alcohol, polyethylene glycol, and fatty acid esters of sorbitan; (23) propellants such as chlorofluorohydrocarbons and volatile unsubstituted hydrocarbons such as butane and propane; (24) antioxidants; (25) agents that render the formulation isotonic with the blood of the intended recipient, such as sugars and sodium chloride; (26) thickening agents; (27) coating materials such as lecithin; and (28) sweetening agents, flavoring agents, coloring agents, fragrances, and preservatives. Each such ingredient or material must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject. Ingredients and materials suitable for a selected dosage form and intended route of administration are well known in the art, and acceptable ingredients and materials for a selected dosage form and administration method can be determined using ordinary skills in the art;

[0131] Pharmaceutical compositions of the present invention suitable for oral administration may be in the form of a capsule, cachet, pill, tablet, powder, granule, aqueous or non-aqueous liquid solution or suspension, oil-in-water liquid emulsion or water-in-oil liquid emulsion, elixir or syrup, troche, bolus, electuary, or paste. These formulations can be prepared by methods known in the art, for example, via conventional pan-coating, mixing, granulating, or lyophilizing processes.

[0132] Solid dosage forms for oral administration (capsules, tablets, pills, dragees, powders, granules, etc.) may, for example, comprise the active ingredient(s) in combination with one or more pharmaceutically acceptable diluents or carriers, and, optionally, one or more fillers, extenders, binders, humectants, disintegrants, dissolution retard ... The solid dosage forms may be prepared by mixing with an agent, an absorption enhancer, a wetting agent, an absorbent, a lubricant, and / or a coloring agent. Using appropriate excipients, similar types of solid compositions can also be used as fillers in soft-filled and hard-filled gelatin capsules. Tablets can be made by compression or molding, optionally with one or more accessory ingredients. Compressed tablets can be prepared using suitable binders, lubricants, inert diluents, preservatives, disintegrants, surfactants, or dispersing agents. Molded tablets can be made by molding in a suitable machine. Tablets and other solid dosage forms, such as dragees, capsules, pills, and granules, can optionally be scored or prepared with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical arts. They can also be formulated to provide delayed or controlled release of the active ingredient therein. They can be sterilized, for example, by filtration through a bacteria-retaining filter. These compositions may also optionally contain opacifying agents and may be of a composition that they release the active ingredient(s) only, or preferentially, in a certain portion of the gastrointestinal tract, optionally, in a delayed manner. The active ingredient(s) can also be in microencapsulated form.

[0133] Oral liquid dosage forms include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs.Liquid dosage forms can contain suitable inert diluents commonly used in the art.In addition to inert diluents, oral compositions can also contain adjuvants such as wetting agents, emulsifying and suspending agents, sweeteners, flavoring agents, coloring agents, fragrances and preservatives.Suppositories can contain suspending agents.

[0134] Pharmaceutical compositions of the present invention for rectal or vaginal administration can be provided as suppositories, which can be prepared by mixing one or more active ingredients with one or more suitable non-irritating diluents or carriers that are solid at room temperature but liquid at body temperature, and therefore melt in the rectal or vaginal cavity to release the active compound. Pharmaceutical compositions of the present invention suitable for vaginal administration also include pessaries, tampons, creams, gels, pastes, foams, or spray formulations containing such pharmaceutically acceptable diluents or carriers known in the art to be appropriate.

[0135] Dosage forms for topical or transdermal administration include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches, eye drops, and inhalants.The active agent(s) / compound(s) including the malonate salt form of the present invention can be mixed with a suitable pharmaceutically acceptable diluent or carrier under sterile conditions.Ointments, pastes, creams, and gels can contain excipients.Powder and sprays can contain excipients and propellants.

[0136] Pharmaceutical compositions of the present invention suitable for parenteral administration may contain one or more drug(s) / compound(s) in combination with one or more pharmaceutically acceptable sterile isotonic aqueous or nonaqueous solutions, dispersions, suspensions, or emulsions, or sterile powders that can be reconstituted immediately before use into sterile injectable solutions or dispersions, which may contain suitable antioxidants, buffers, solutes that render the formulation isotonic with the blood of the intended recipient, or suspending or thickening agents. Proper fluidity can be maintained, for example, by the use of coating materials, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. These pharmaceutical compositions may also contain suitable adjuvants such as wetting agents, emulsifying agents, and dispersing agents. It may also be desirable to include an isotonic agent. In addition, prolonged absorption of injectable pharmaceutical forms can be achieved by incorporating agents that delay absorption.

[0137] In some cases, to prolong the effect of a drug (e.g., a pharmaceutical formulation), a subcutaneous injection or an intramuscular injection Slow absorption from injection is desirable and can be accomplished by the use of a liquid suspension of crystalline or amorphous material with poor water solubility.

[0138] The rate of absorption of the active agent / drug, including the malonate salt form of the present invention, then depends on its dissolution rate, which may further depend on the crystal size and crystalline form. Alternatively, delayed absorption of parenterally administered agents / drugs can be achieved by dissolving or suspending the active agent / drug in an oil vehicle. Injectable depot forms can be prepared by forming microencapsule matrices of the active ingredient in biodegradable polymers. Depending on the ratio of the active ingredient to the polymer and the properties of the particular polymer employed, the release rate of the active ingredient can be controlled. Injectable depot formulations can also be prepared by encapsulating the drug in liposomes or microemulsions that are compatible with body tissues. Injectable materials can be sterilized, for example, by filtration through a bacteria-retaining filter.

[0139] The formulations may be presented in unit-dose or multi-dose hermetically sealed containers, for example, ampoules and vials, and may be stored in a freeze-dried condition requiring only the addition of a sterile liquid diluent or liquid carrier, for example, water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules, and tablets of the kind described above.

[0140] The following examples are presented for the purpose of further illustrating the compounds, compositions and methods of the present invention. These examples are illustrative only and are not intended to limit the scope of the invention in any way. [Example]

[0141] Example 1 Experimental Method X-ray powder diffraction (XRPD) XRPD patterns in transmission mode were collected using an incident beam of Cu radiation generated using a microfocus source. An elliptical tilted multilayer mirror was used to focus the Cu Kα X-ray radiation through the sample onto the detector. Prior to analysis, the silicon sample (NIST SRM 640d) to verify that the position of the observed Si 111 peak matched the position certified by NIST. Sample specimens were sandwiched between 3 μm-thick thin films and analyzed in a transmission geometry. A beam stop, a short anti-scatter extension, and an anti-scatter knife edge were used to minimize background caused by air. Soller slits for the incident and diffracted beams were used to minimize broadening from axial divergence. Diffraction patterns were collected using a scanning position-sensitive detector positioned 240 mm from the specimen. Preferred orientation and static particle effects were not assessed.

[0142] Reflection mode XRPD patterns were collected using an incident beam of Cu Kα radiation generated using a fine focus source and a nickel filter. The diffractometer was configured using a symmetric Bragg-Brentano geometry. Prior to analysis, a silicon specimen (NIST SRM 640d) was analyzed to verify that the observed Si 111 peak position matched the NIST-certified position. Sample preparations were prepared as thin circular layers in the center of a silicon background-free substrate. Anti-scatter slits were used to minimize background caused by air. Soller slits for the incident and diffracted beams were used to minimize broadening due to axial divergence. Diffraction patterns were collected using a scanning position-sensitive detector positioned 240 mm from the sample. Preferred orientation and static particle effects were not assessed.

[0143] Under most circumstances, peaks within a range of up to approximately 30°2θ were selected. Peak positions along the x-axis (°2θ) were rounded to one significant digit. Peak position variability is given to within ±0.2°2θ, based on recommendations outlined in the USP's Discussion of Variability in Powder X-ray Diffraction. The accuracy and precision associated with any particular measurement were not determined. Furthermore, third-party measurements of independently prepared samples on different instruments may result in variability exceeding ±0.2°2θ. According to USP guidelines, variable hydrates and solvates may exhibit peak variability exceeding 0.2°2θ; therefore, the 0.2°2θ peak variability is not applicable to these materials. For the d-spacing listing, the wavelength used to calculate d-spacing was 1.5405929 Å, the wavelength for Cu-Kα1. The variability associated with the d interval estimates was calculated from the USP recommendations for each d interval and presented in the respective data tables.

[0144] Fourier transform infrared (FT-IR) spectroscopy FT-IR spectra were obtained using a Fourier transform infrared spectrophotometer equipped with a mid- / far-IR source, an extended-range potassium bromide (KBr) beam splitter, and a deuterated triglycine sulfate (DTGS) detector. Wavelength verification was performed using NIST SRM 1921b (polystyrene). An attenuated total reflectance (ATR) accessory with a germanium (Ge) crystal was used to acquire the data. 256 overlapping scans were taken at a 2 cm -1 The data sets were collected with a spectral resolution of 1 / R. A background data set was acquired on a pure Ge crystal. The log 1 / R (R = reflectance) spectrum was obtained by taking the ratio of these two data sets to each other. Peak selection was performed using an absolute threshold near the baseline and a sensitivity of 75.

[0145] Differential scanning calorimetry (DSC) DSC analysis was performed using a differential scanning calorimeter. Temperature calibration was performed using NIST-traceable indium metal. Samples were placed in aluminum DSC pans, covered with lids, and the weights were accurately recorded. A weighed aluminum TOHSMP pan, configured as the sample pan, was placed on the reference side of the cell. Unless otherwise specified, reported temperatures were rounded to the nearest degree.

[0146] Example 2 Preparation of crystalline free base 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide The free base of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide was prepared according to the following synthetic scheme. [ka]

[0147] In step 1, a clean, dry 200 L glass-lined reactor was evacuated to below -0.08 MPa three times and then backfilled with nitrogen to atmospheric pressure. Absolute ethanol (49.90 kg) was charged to the 200 L glass-lined reactor. Subsequently, ASYM-111606 (Asymchem) (12.70 kg) and isopropylamine (29.00 kg) were added to the mixture. The mixture was heated to reflux at 65-75°C. The mixture was reacted at 65-75°C. After 20 hours, the reaction mixture was sampled and analyzed by HPLC every 4-6 hours until the ASYM-111606 content was ≤1%. The mixture was cooled to 40-45°C and concentrated under reduced pressure (≤-0.08 MPa) at 45°C or below until 13-26 L remained. The organic phase was washed with sodium chloride solution, stirred for 20–30 minutes, and then allowed to stand for 20–30 minutes before separation. The organic phase was concentrated under reduced pressure (<−0.06 MPa) at 30°C or below until 13–20 L remained. Petroleum ether (8.55 kg) was added to the concentrated mixture. The mixture was transferred to a 20 L rotary evaporator and continued to be concentrated under reduced pressure (<−0.06 MPa) at 30°C or below until 13–20 L remained. Petroleum ether (8.55 kg) was then added to the concentrated mixture. The mixture was cooled to 0–5°C and stirred for crystallization. After 1 hour, the mixture was sampled and analyzed for wt% every 1–2 hours until the mother liquor wt% was ≤11% or the change in wt% between consecutive samples was ≤1%. The mixture was filtered into a 10 L filter flask. The filter cake was sampled and analyzed for purity by HPLC. 10.50 kg of product was recovered as a tan solid with a purity of 99.39%.

[0148] In step 2, a clean, dry 300 L glass-lined reactor was evacuated three times to below -0.08 MPa and then backfilled with nitrogen to atmospheric pressure. Glycol dimethyl ether (73.10 kg) was charged to the 300 L glass-lined reactor at 20-30°C. Subsequently, ASYM-112060 (Asymchem) (10.46 kg) and ASYM-111938 (Asymchem) (12.34 kg, corrected to 11.64 kg) were added to the mixture under nitrogen protection. The temperature was maintained at 20-30°C, and purified water (10.50 kg) and anhydrous sodium carbonate (5.67 kg) were added to the mixture. Palladium acetate (0.239 kg) and tricyclohexylphosphonium tetrafluoroborate (0.522 kg) were added to the mixture under nitrogen protection. After the addition, the mixture was evacuated to below -0.06 MPa and then backfilled with nitrogen to atmospheric pressure. This was repeated 10 times until the residual oxygen level was ≦300 ppm. The mixture was heated to reflux at 75-85°C. The mixture was allowed to react at 75-85°C. After 4 hours, the mixture was sampled and analyzed by HPLC every 2-3 hours for ASYM-112060 content. When the ASYM-112060 content reached 6.18%, additional ASYM-111938 (0.72 kg) was added, and the reaction was continued until the ASYM-112060 content was ≦3%. The mixture was cooled to 25-35°C and filtered through a 30 L stainless steel vacuum filter. The filter cake was soaked and washed twice with THF (14.10 kg). The filtrate and washings were combined and concentrated under reduced pressure (-0.08 MPa or less) at 50°C or less until 10-15 L remained. The mixture was cooled to 15-25°C. Methanol (11.05 kg) was added to the concentrated mixture. The mixture was then stirred for crystallization. After 2 hours, the mixture was sampled and analyzed by HPLC every 2-4 hours until the mother liquor wt% was ≤2%. The mixture was filtered through a 30 L stainless steel vacuum filter. The filter cake was soaked and washed twice with methanol (8.30 kg). The filter cake was transferred to a 50 L plastic drum.Ethyl acetate (7.10 kg) and petroleum ether (46.30 kg) were then added to the drum. The mixture was stirred for 1.5 to 2 hours and then filtered through a Nutsche filter. The filter cake was soaked and washed with petroleum ether (20.50 kg). The filter cake was dried in the Nutsche filter under nitrogen at 30 to 40°C. After 8 hours, the solid was sampled and Karl Fischer (KF) analysis was performed at 4 to 8 hour intervals to monitor the drying process. Drying was complete when the KF result was ≤1.0% water. The solid was turned over and mixed every 4 to 6 hours during drying. 12.15 kg of product was recovered as a tan solid with a purity of 98.32%.

[0149] In step 3, a clean, dry 300-L glass-lined reactor was evacuated three times to below -0.08 MPa and then backfilled with nitrogen to atmospheric pressure. THF (62.58 kg) was charged to the 300-L glass-lined reactor at 15-30°C. The agitator was then started. ASYM-112393 (12.00 kg, adjusted to 11.70 kg) was added to the mixture. The mixture was stirred until the solids were completely dissolved. The temperature was maintained at 15-30°C, and a lithium hydroxide solution prepared from lithium hydroxide monohydrate (5.50 kg) in purified water (70.28 kg) was added to the mixture. Diethylamine (3.86 kg) was then added. The mixture was heated to 60-70°C to reflux. The mixture was allowed to react at 60-70°C. After 30 hours, the reaction mixture was sampled and analyzed by HPLC every 4-6 hours until the content of the intermediate at relative retention time (RRT) = 1.39-1.44 was <1% and the content of ASYM-112393 was <1%. The HPLC conditions for this analysis are shown in Table 1. [Table 1]

[0150] The mixture was cooled to 25-35°C, and MTBE (25.97 kg) was added to the mixture. The mixture was stirred for 20-30 minutes and filtered through an in-line fluid filter. The filtrate was transferred to a 300 L glass-lined reactor, allowed to stand for 20-30 minutes, and then separated. The pH of the resulting aqueous phase was adjusted to 1-2 with a 6N hydrochloric acid solution prepared from concentrated hydrochloric acid (14.86 kg) in purified water (10.88 kg) at a rate of 5-8 kg / h at 15-25°C. The pH of the mixture was again adjusted to 6.4-6.7 with a saturated sodium carbonate solution prepared from sodium carbonate (5.03 kg) in purified water (23.56 kg) at a rate of 3-5 kg / h at 15-25°C. The pH of the mixture was then adjusted to 6.2-6.4 with a hydrochloric acid solution prepared from concentrated hydrochloric acid (1.09 kg) in purified water (0.80 kg). The mixture was filtered through a Nutsche filter. The filter cake was transferred to a 300 L glass-lined reactor, and purified water (117.00 kg) was added. The mixture was stirred, sampled, and analyzed by HPLC until the p-toluenesulfonic acid residue on the filter cake was ≤0.5%. The mixture was then filtered. The filter cake was dried in a tray oven under nitrogen at 55-65°C until the KF was ≤10%. The solids and MTBE (8.81 kg) were charged to a 50 L stainless steel drum. The mixture was stirred for 1-2 hours. The mixture was filtered through a 30 L stainless steel vacuum filter. The filter cake was dried in a Nutsche filter at 50-60°C. After 8 hours, the solid was sampled and analyzed by KF every 4-8 hours until KF ≤ 5%. The solid was turned over and mixed every 4-6 hours during drying. 6.3 kg of product was recovered as an off-white solid with a purity of 98.07%.

[0151] In step 4, a dry, impurity-free 50 L flask was purged with nitrogen for 20 minutes. DMF (30.20 kg) was charged to the 50 L flask reactor. The agitator was then started. The temperature was maintained at 15-25°C, and ASYM-112394 (3.22 kg, corrected to 2.76 kg) was added to the mixture. The mixture was stirred until the solids were completely dissolved. The mixture was cooled to -10 to -20°C, and 1-hydroxybenzotriazole hydrate (2.10 kg) was added to the mixture at -10 to -20°C. EDCI (2.41 kg) was then added to the mixture in five portions, approximately 5-10 minutes apart. The mixture The mixture was cooled to -20 to -30°C, and ASYM-111888 (Asymchem) (1.96 kg) was added to the mixture at -20 to -30°C. DIEA (1.77 kg) was then added to the mixture at a rate of 3 to 4 kg / hour. The mixture was heated to 15 to 25°C at a rate of 5 to 10°C / hour. The mixture was allowed to react at 15 to 25°C. After 6 to 8 hours, the mixture was sampled and analyzed by HPLC every 2 to 4 hours until the ASYM-112394 content was ≦2%. The mixture was cooled to 0 to 10°C, and the reaction mixture was quenched at 0 to 10°C with a solution prepared from ethyl acetate (28.80 kg) in purified water (12.80 kg). The mixture was extracted three times with ethyl acetate (28.80 kg). For each extraction, the mixture was stirred for 20-30 minutes, allowed to stand for 20-30 minutes, and then separated. The organic phases were combined and washed twice with purified water (12.80 kg). For each extraction, the mixture was stirred for 20-30 minutes, allowed to stand for 20-30 minutes, and then separated. The resulting organic phase was then filtered through an in-line fluid filter. The filtrate was transferred to a 300 L glass-lined reactor. The mixture was washed twice with a 5% acetic acid solution prepared from acetic acid (2.24 kg) in purified water (42.50 kg). The solution was added at a rate of 10-20 kg / hour. The organic phase was washed twice with a sodium carbonate solution prepared from sodium carbonate (9.41 kg) in purified water (48.00 kg). The organic phase was washed twice with a sodium chloride solution prepared from sodium chloride (16.00 kg) in purified water (44.80 kg). The organic phase was transferred to a 300 L glass-lined reactor. Anhydrous sodium sulfate (9.70 kg) was added to the mixture, and the mixture was stirred at 15-30°C for 2-4 hours. The mixture was filtered through a Nutsche filter pre-loaded with approximately 1 cm of silica gel (7.50 kg). The filter cake was soaked and washed with ethyl acetate (14.40 kg) before filtering. The filtrates were combined, and the combined filtrate was added to a 72 L flask through an in-line fluid filter. The mixture was concentrated under reduced pressure (P ≦ -0.08 MPa) at T ≦ 40°C until 3-4 L remained. MTBE (4.78 kg) was then added to the mixture.The mixture was cooled to 0-10°C with stirring for crystallization. After 1 hour, the mixture was sampled and analyzed for wt% every 1-2 hours until the mother liquor wt% was ≤5% or the change in wt% between consecutive samples was ≤1%. The mixture was filtered through a vacuum filter flask, and the filter cake was dried in a tray oven under nitrogen at 30-40°C until the KF was ≤0.5%. 3.55 kg of product was recovered as an off-white solid with 100% purity.

[0152] The resulting 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide free base was analyzed by XRPD (Figure 1). The peaks shown in Figure 1 are listed in Table 2, and prominent peaks are listed in Table 3. Table 2: XRPD peaks observed for the free base of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide [Table 2-1] [Table 2-2] Table 3: Prominent XRPD peaks for the free base of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide [Table 3]

[0153] FT-IR was performed on a sample of the free base of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide as described in Example 1 ( FIG. 2 ). The observed peaks from FIG. 2 are listed in Table 4. Table 4: FT-IR peaks observed for the free base of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide [Table 4-1] [Table 4-2]

[0154] DSC performed on a sample of the free base of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide as described in Example 1 ( FIG. 3 ) showed an endotherm with an onset temperature of approximately 184° C.

[0155] Example 3A Preparation of Form C of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide [ka] Form C of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide was prepared from the free base of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide as follows: ASYM-111935 (10.4 kg) was added to a stirred mixture of absolute ethanol (73.9 kg), methanol (4.1 kg), and isopropanol (4.1 kg). The mixture was heated to 70-75°C and stirred until all solids were dissolved. Anhydrous HCl (37 wt%, 1.1 equivalents) in a mixture of ethanol / methanol / isopropanol (90:5:5) was added, and the mixture was maintained at 70-75°C for 2 hours after the addition was complete. The mixture was then cooled to 15-25°C at a rate of 5-15°C per hour and stirred at this temperature until the desired polymorphic purity was reached. The end point of crystallization / polymorphic conversion was determined by the absence of an XRPD peak at approximately 10.5°2θ in three consecutive samples.

[0156] The mixture was then filtered and washed successively with a pre-prepared solution of absolute ethanol (14.8 kg), methanol (0.8 kg), and isopropanol (0.8 kg), followed by MTBE (two 21 kg portions). Because the polymorph may be unstable in the wet filter cake in the presence of reagent alcohols, it is preferable to avoid delays in washing the filter cake; improved stability was observed after washing with MTBE. The wet filter cake was then dried at 40-50°C in a heated filter funnel or tray oven until dry. Typical yields were approximately 85-90%.

[0157] Example 3B Alternative Preparation of Form C of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide [ka] Form C of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide was also prepared from the free base of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide as follows: A dry, impurity-free 72-L flask was purged with nitrogen for 20 minutes. Absolute ethanol (21.35 kg), methanol (1.17 kg), and isopropanol (1.19 kg) were charged to the 72-L flask at 15-25°C, and the mixture was stirred for 20-30 minutes. ASYM-111935 (3.01 kg) was added to the mixture, which was heated to 70-75°C at a rate of 15-25°C / hour and stirred until the solids were completely dissolved.

[0158] An alcohol / HCl solution was prepared as follows: absolute ethanol (1.500 kg), methanol (0.088 kg), and isopropanol (0.087 kg) were charged to a 5 L flask at 15-25°C, and the mixture was stirred for 20-30 minutes. Hydrogen chloride was bubbled into the mixture through a dip tube at 10-25°C with stirring. After 2 hours, the mixture was sampled and analyzed every 2-4 hours until the wt% of hydrogen chloride was ≥ 35%.

[0159] The alcohol / HCl solution (0.519 kg) prepared above was added dropwise to the mixture at 70-75°C at a rate of 0.5-1.0 kg / hr. Seed crystals (0.009 kg) were added to the mixture, and the alcohol / HCl solution (0.173 kg) prepared above was added to the mixture at 70-75°C at a rate of 0.5-1.0 kg / hr. After the addition, the mixture was stirred at 70-75°C for 1-2 hours. The mixture was cooled to 15-25°C at a rate of 5-15°C / hr and stirred for 4-6 hours. The mixture was then heated to 70-75°C at a rate of 15-25°C / hr. The mixture was heated to 70-75°C and stirred for 8-10 hours. The mixture was cooled to 15-25°C at a rate of 5-15°C / hour and stirred for 4-6 hours. The mixture was filtered through a vacuum filter flask. The filter cake was soaked with a solution prepared from absolute ethanol (4.25 kg), methanol (0.24 kg), and isopropanol (0.24 kg), rinsed, and then filtered. The filter cake was dried under nitrogen in a drying chamber at 40-50°C until residual ethanol was <0.5%, residual methanol was <0.3%, and residual isopropanol was <0.3%. 2.89 kg of product was recovered as a white solid with a purity of 99.97%.

[0160] The resulting 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide Form C was analyzed by XRPD (FIG. 4). The peaks shown in FIG. 4 are listed in Table 5, and prominent peaks are listed in Table 6. Table 5: XRPD peaks observed for Form C of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide [Table 5-1] [Table 5-2] Table 6: Prominent XRPD peaks for Form C of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide [Table 6]

[0161] FT-IR was performed on a sample of Form C (Figure 5) as described in Example 1. The observed peaks from Figure 5 are listed in Table 7. Table 7: Observed FT-IR peaks for Form C of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide [Table 7-1] [Table 7-2]

[0162] DSC was performed on a sample of Form C as described in Example 1 (Figure 6) and showed a prominent endotherm with an onset temperature of approximately 239°C.

[0163] Example 4 Salt screen of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide Salt formers for screening were selected based on the predicted pKa (approximately 5) of the free base of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide. The molar ratio of starting material to salt former during mixing was approximately 1:1 for most experiments. Selected experiments using the appropriate acid were performed using approximately a two-fold excess of the free base. Experiments were designed based on the solubility kinetics of the starting material estimated for this purpose by the solvent addition method. Mostly, cooling and slurry techniques, or a combination of these, were utilized, primarily on medium-scale (approximately 50–100 mg) amounts of starting material. XRPD was the primary analytical technique for the initial identification of new materials. The XRPD patterns obtained for the isolated solids, those of the free base and those of the salt formers, were compared with each other.

[0164] Table 8 summarizes the salt formers tested, the conditions used, the results observed, and a description of the preliminary XRPD analysis. Table 9 defines the abbreviations used in this series of experiments. Table 8: Salt screen of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide [Table 8-1] [Table 8-2] [Table 8-3] [Table 8-4] [Table 8-5] [Table 9]

[0165] A screen using 19 pharmaceutically acceptable salt formers identified three materials exhibiting unique XRPD patterns. Unique materials were produced with oxalic, sulfuric, and malonic acids. Attempted salt screens with α-ketoglutaric, phosphoric, L-tartaric, and sulfonic acid derivatives resulted in X-ray amorphous material, difficult-to-handle gums, or no solids. The remaining acids evaluated in this screen resulted in the free base of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide or a physical mixture with the free salt former. Repeated attempts to produce easily handled crystalline material with sulfonic acids were unsuccessful.

[0166] The latent oxalate was generated by slurrying in ethanol / methyl tert-butyl ether (55 / 45) at ambient temperature. The sample exhibited a unique XRPD pattern consistent with a slightly disordered crystalline material. Further investigation of this latent oxalate revealed that There was nothing to do.

[0167] The latent sulfates were generated using a variety of crystallization techniques and solvent systems either via salt-forming reactions or by recrystallization of the corresponding latent salts. The samples generated in this study were generally poorly crystalline, and therefore the materials were not investigated further.

[0168] Example 5 Preparation of Form A of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate The free base of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide was reacted with malonic acid (1:1 molar ratio) in an ethanolic slurry in a 100 mg scale. After 1 day at room temperature, the product was purified by vacuum filtration and evaporation of the filtrate. The resulting 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide malonate Form A formed needle-like crystals.

[0169] In a scale-up experiment, 1 g of the free base of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide was suspended in ethanol at ambient temperature with stirring, and approximately 1.1 equivalents of malonic acid (268 mg) was added. The mixture was then stirred at ambient temperature for approximately 4 days, after which the solid was collected by vacuum filtration. Approximately 500 mg of the isolated solid was dried under vacuum at 45° C. overnight and analyzed by XRPD. The remaining solid was analyzed without drying. All samples were consistent with Form A of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide malonate.

[0170] A sample of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate Form A was analyzed by XRPD (FIG. 7). The peaks shown in FIG. 7 are listed in Table 10, and prominent peaks are listed in Table 11. Table 10: XRPD peaks observed for Form A of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate [Table 10-1] [Table 10-2] Table 11: Prominent XRPD peaks for Form A of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate [Table 11]

[0171] FT-IR was performed on a sample of Form A of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate as described in Example 1 ( FIG. 8 ). The observed peaks from FIG. 8 are listed in Table 12. Table 12: FT-IR peaks observed for Form A of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate [Table 12-1] [Table 12-2]

[0172] DSC was performed on a sample of Form A of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate as described in Example 1 ( FIG. 9 ), which showed a prominent endotherm with an onset temperature of about 142.1° C.

[0173] Example 6 Dissolution of Form A of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate in water Samples of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide Form C and 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide malonate Form A were each shaken in fasting-state simulated gastric fluid (FaSSGF) at pH 1.6 at ambient temperature for 30 minutes. The concentration of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide was measured at 5, 15, and 30 minutes.

[0174] After 30 minutes, the samples were removed from the FaSSGF and placed in fasting-state simulated intestinal fluid (FaSSIF) at pH 6.5 with shaking for an additional 5 hours. The concentration of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide was measured at 10, 30, 60, 90, 120, 180, 270, and 300 minutes. The results are summarized in Table 13 and shown in Figure 10A (FaSSGF) and Figure 10B (FaSSIF). Table 13: Solubility of Form C of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide and Form A of the malonate salt [Table 13]

[0175] Example 7 Pharmacokinetic evaluation of Form A of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate Eight non-naive male beagle dogs received Form C of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide and Form A of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate in a two-way crossover design with at least 7 days washout between doses. Each animal received 2 doses by oral gavage. A single 5 mg / kg dose of drug was given, and plasma analysis for 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide was performed pre-dose (time point = 0), 0.5, 1, 2, 4, 6, 8, 12, and 24 hours. Plasma drug concentrations are shown in Figure 11A, and mean area under the curve (AUC) is shown in Figure 11B. The error bars shown in FIG. 11B are coefficients of variation (CV) of 39% and 50% for Form C of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide and Form A of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate, respectively.

[0176] Although illustrative embodiments of the present invention have been described herein, it should be understood that the invention is not limited to the described embodiments, and that various other changes or modifications may be made by those skilled in the art without departing from the scope or spirit of the invention. References

number

[0177] The following items are provided: (Item 1) A crystalline salt of formula (I): [ka] Malonate salt of the compound. (Item 2) Item 1, wherein the malonate salt is characterized by an X-ray powder diffraction (XRPD) pattern containing a characteristic peak at about 3.0° 2θ. (Item 3) Item 1, wherein the malonate salt is characterized by an X-ray powder diffraction (XRPD) pattern containing characteristic peaks at about 3.0 and 5.2 degrees 2θ. (Item 4) 2. The malonate salt according to item 1, characterized by an X-ray powder diffraction (XRPD) pattern comprising characteristic peaks selected from the group consisting of about 3.0, 5.2, 8.0, and 10.9 degrees 2θ. (Item 5) Item 1, wherein the malonate salt is characterized by an X-ray powder diffraction (XRPD) pattern comprising XRPD 2θ reflections (°) at about 3.0, 5.2, 8.0, 10.9, 15.7, 18.4, 23.1, and 25.4. (Item 6) 7, having an XRPD pattern substantially as shown in FIG. 7, of formula (I): [ka] Malonate salt of the compound. (Item 7) Approximately 1573, 1504, 1475, 1253, 1033, and 883 cm -1 Item 1. The crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate of Form A, having an infrared spectroscopy (IR) spectrum comprising one or more peaks at (Item 8) Item 1, Form A of crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate, having an IR spectrum substantially as shown in Figure 8. (Item 9) (i) an XRPD pattern comprising one or more peaks at about 3.0, 5.2, 8.0, and 10.9 °2θ; and (ii) at about 1573, 1504, 1475, 1253, 1033, and 883 cm -1 Item 1. The crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate of Form A having an IR spectrum comprising one or more peaks at (Item 10) Item 1. The crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate of Form A, having a DSC thermogram with an endotherm with an onset temperature of about 142.1 °C. (Item 11) Item 1. The crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate of Form A having a DSC thermogram substantially as shown in Figure 9. (Item 12) 12. A pharmaceutical composition comprising the crystalline compound according to any one of items 1 to 11 and a pharmaceutically acceptable carrier. (Item 13) Item 14. A method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of the crystalline compound of any one of items 1 to 11. Item 14. The method of item 13, wherein the subject is a mammal. (Item 15) 15. The method of claim 14, wherein the mammal is selected from the group consisting of humans, primates, farm animals, and livestock. (Item 16) 15. The method of claim 14, wherein the mammal is a human. (Item 17) Item 14. The method of item 13, further comprising administering to the subject at least one additional anticancer agent. (Item 18) 13. A method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of the pharmaceutical composition of item 12. (Item 19) 19. The method of claim 18, wherein the subject is a mammal. (Item 20) 20. The method of claim 19, wherein the mammal is selected from the group consisting of humans, primates, farm animals, and livestock. (Item 21) 20. The method of claim 19, wherein the mammal is a human. (Item 22) Item 1, further comprising administering to the subject at least one additional anti-cancer agent. 8. The method according to claim 8. (Item 23) A method for making crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate Form A, comprising reacting malonic acid with 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide under conditions suitable for forming crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate Form A. (Item 24) 24. The method of claim 23, wherein the malonic acid and 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide are reacted in an ethanol slurry. In addition, the following items are provided: (Item 1A) A crystalline salt of formula (I): characterized by an X-ray powder diffraction (XRPD) pattern containing a characteristic peak at about 3.0° 2θ: [ka] Malonate salt of the compound. (Item 3A) The malonate salt according to item 1A, characterized by an X-ray powder diffraction (XRPD) pattern containing characteristic peaks at about 3.0 and 5.2 degrees 2θ. (Item 4A) The malonate salt according to item 1A, characterized by an X-ray powder diffraction (XRPD) pattern comprising additional characteristic peaks selected from the group consisting of about 5.2, 8.0, and 10.9 degrees 2θ. (Item 5A) The malonate salt according to item 1A, characterized by an X-ray powder diffraction (XRPD) pattern comprising XRPD 2θ reflections (°) at about 3.0, 5.2, 8.0, 10.9, 15.7, 18.4, 23.1, and 25.4. (Item 6A) 7, having an XRPD pattern substantially as shown in FIG. 7, of formula (I): [ka] Malonate salt of the compound. (Item 7A) Approximately 1573, 1504, 1475, 1253, 1033, and 883 cm -1 The crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate according to item 1A of Form A, having an infrared spectroscopy (IR) spectrum comprising one or more peaks at (Item 8A) The crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate according to item 1A in Form A, having an IR spectrum substantially as shown in Figure 8. (Item 9A) (i) an XRPD pattern comprising one or more peaks at about 3.0, 5.2, 8.0, and 10.9 °2θ; and (ii) at about 1573, 1504, 1475, 1253, 1033, and 883 cm -1 The crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate according to item 1A of Form A, having an IR spectrum including one or more peaks at (Item 10A) The crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate salt according to Item 1A of Form A, having a DSC thermogram with an endotherm with an onset temperature of about 142.1 °C. (Item 11A) The crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate according to item 1A of Form A, having a DSC thermogram substantially as shown in Figure 9. (Item 12A) A pharmaceutical composition comprising the crystalline compound of any one of paragraphs 1A to 11A and a pharmaceutically acceptable carrier. (Item 13A) 10. A method of treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of a crystalline compound of any one of paragraphs 1A to 11A. (Item 14A) The method of claim 13A, wherein the subject is a mammal. (Item 15A) The method of claim 14A, wherein the mammal is selected from the group consisting of humans, primates, farm animals, and livestock. (Item 16A) The method of claim 14A, wherein the mammal is a human. (Item 17A) The method of claim 13A, further comprising administering to the subject at least one additional anticancer agent. (Item 18A) 12. A method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of the pharmaceutical composition of item 12A. (Item 19A) The method of claim 18A, wherein the subject is a mammal. (Item 20A) The method of claim 19A, wherein the mammal is selected from the group consisting of humans, primates, farm animals, and livestock. (Item 21A) The method of claim 19A, wherein the mammal is a human. (Item 22A) The method of claim 18A, further comprising administering to the subject at least one additional anticancer agent.

Claims

1. A pharmaceutical composition comprising: (a) a first active agent, the first active agent being a crystalline Form A of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amidomalonate having (i) an X-ray powder diffraction (XRPD) pattern comprising one or more peaks at 3.0±0.2, 5.2±0.2, 8.0±0.2, and 10.9±0.2 degrees two-theta, and (ii) an infrared spectroscopy (IR) spectrum comprising one or more peaks at about 1573±2.0, 1504±2.0, 1475±2.0, 1253±2.0, 1033±2.0, and 883±2.0 cm −1 ; (b) a second active agent selected from the group consisting of a hormone, a hormone interfering compound, a histone deacetylase inhibitor (HDACi), a cyclin-dependent kinase inhibitor (CDKi), a poly ADP-ribose polymerase (PARP) inhibitor, and combinations thereof; and Pharmaceutically acceptable carrier A pharmaceutical composition comprising:

2. The second active agent is selected from the group consisting of prostaglandins, leukotrienes, prostacyclin, thromboxane, amylin, anti-Müllerian hormone, adiponectin, adrenocorticotropic hormone, angiotensinogen, angiotensin, vasopressin, atriopeptin, brain natriuretic peptide, calcitonin, cholecystokinin, corticotropin-releasing hormone, encephalin, endothelin, erythropoietin, follicle-stimulating hormone, galanin, gastrin, ghrelin, glucagon, gonadotropin-releasing hormone, growth hormone-releasing hormone, human chorionic gonadotropin, human placental lactogen, growth hormone, inhibin, insulin, 2. The pharmaceutical composition of claim 1, wherein the hormone is selected from the group consisting of somatomedin, leptin, liptropin, luteinizing hormone, melanocyte-stimulating hormone, motilin, orexin, oxytocin, pancreatic polypeptide, parathyroid hormone, prolactin, prolactin-releasing hormone, relaxin, renin, secretin, somatostatin, thrombopoietin, thyroid-stimulating hormone, testosterone, dehydroepiandrosterone, androstenedione, dihydrotestosterone, aldosterone, estradiol, estrone, estriol, cortisol, progesterone, calcitriol, calcidiol, and combinations thereof.

3. The pharmaceutical composition of claim 1, wherein the second active agent is a hormone-interfering compound selected from the group consisting of tamoxifen (Nolvadex®), anastrozole (Arimidex®), letrozole (Femara®), fulvestrant (Faslodex®), and combinations thereof.

4. The second active agent is selected from the group consisting of 4SC-201 (4SC AG), 4SC-202 (Takeda Pharmaceutical Company Limited), abexinostat (Celera), AN-1 (Titan Pharmaceuticals, Inc.), apicidine (Merck & Co., Inc.), AR-42 (Arno Therapeutics), ARQ-700RP (ArQule), Avugane (TopoTarget AS), azelaic-1-hydroxamate-9-anilide (AAHA), belinostat (TopoTarget), butyrate (Enzo Life Sciences, Inc.), and CG-1255 (Errant Gene Therapeutics, LLC), CG-1521 (Errant Gene Therapeutics, LLC), CG-200745 (CrystalGenomics,Inc. ), Kidamide (Shenzhen Chipscreen Biosciences), CHR-3996 (Chroma Therapeutics), CRA-024781 (Pharmacyclics), CS-3158 (Shenzhen Chip screen Biosciences), CU-903 (Curis), DAC-60 (Genextra), entinostat (Bayer), hyaluronic acid butyrate (HA-But), IKH-02 (IkerChem), IKH-35 (IkerChem), ITF-2357 (Italfarmaco), ITF-A (Italfarmaco), JNJ-16241199 (Johnson & Johnson), KA-001 (Karus Therapeutics), KAR-3000 (Karus Therapeutics), KD-5150 (Kal- ypsys), KD-5170 (Kal- ypsys), KLYP-278 (Kal- ypsys), KLYP-298 (Kal- ypsys), KLYP-319 (Kal- ypsys), KLYP-722 (Kal- ypsys), m-carboxycinnamic acid bis-hydroxamide (CBHA), MG-2856 (MethylGene), MG-3290 (MethylGene), MG-4230 (MethylGene), MG-4915 (MethylGene), MG-5026 (MethylGene), MGCD-0103 (MethylGene Inc.), mocetinostat (MethylGene), MS-27-275 (Schering AG), NBM-HD-1 (NatureWise), NVP-LAQ824 (Novartis), OCID-4681-S-01 (Orchid Pharmaceuticals), oxamflatin ((2E)-5-[3-[(phenylsulfonyl)aminolphenyl]-pent-2-en-4-ynohydroxamic acid), panobinostat (Novartis), PCI-34051 (Pharmacyclics), phenylbutyrate (Enzo Life Sciences, Inc.), pivaloyloxymethylbutyrate (AN-9, Titan Pharmaceuticals, Inc. ), Pivanex (Titan Pharmaceuticals,Inc. ), pracinostat (SBIO), PX-117794 (TopoTarget AS), PXD-118490 (LEO-80140) (TopoTarget AS), pyroxamide (suberoyl-3-aminopyridine amide hydroxamic acid), resminostat (Takeda Pharmaceutical Co., Ltd.), RG-2833 (RepliGen), licorinostat (Acetylon), romidepsin (Astellas), SB-1304 (S*BIO), SB-1354 (S*BIO), SB-623 (Merrion Research I Limited), SB-624 (Merrion Research I Limited), SB-639 (Merrion Research I Limited), SB-939 (S*BIO), Scriptaid (N-hydroxy-1,3-dioxo-1H-benz[de]isoquinoline-2(3H)-hexanamide), SK-7041 (In2Gen / SK Chemical Co.), SK-7068 (In2Gen / SK Chemical Co.), suberoylanilide hydroxamic acid (SAHA), sulfonamide hydroxamic acid, tributyrin (Sigma Aldrich), trichostatin A (TSA) (Sigma Aldrich), valproic acid (VPA) (Sigma Aldrich).

2. The pharmaceutical composition according to claim 1, wherein the HDACi is selected from the group consisting of benzodiazepine (Bordeaux®), ...vorino

5. The pharmaceutical composition described in claim 4, wherein the HDACi is romidepsin or a pharmaceutically acceptable salt thereof.

6. The second active agent is 2-hydroxybohemin, 3-ATA, 5-iodo-indirubin-3'-monoxime, 9-cyanopaullone, aloisine A, arterpaullone 2-cyanoethyl, alvocidib (Sanofi), AM-5992 (Amgen), aminopurvalanol A, arcyliaflavin A, AT-7519 (Astex Pharmaceuticals), AZD 5438 (CAS number: 602306-29-6), BMS-265246 (CAS number: 582315-72-8), BS-181 (CAS number: 1092443-52-1), butyrolactone I (CAS number: 87414-49-1), Cdk / Crk inhibitor (CAS number: 784211-09-2), Cdk1 / 5 inhibitor (CAS number: 40254-90-8), Cdk2 inhibitor II (CAS number: 222035-13-4), Cdk2 inhibitor IV, NU6140 (CAS number: 444723-13-1), Cdk4 inhibitor (CAS number: 546102-60-7), Cdk4 inhibitor III (CAS number: 265312-55-8), Cdk4 / 6 inhibitor IV (CAS number: 359886-84-3), Cdk9 inhibitor II (CAS number: 140651-18-9), CGP 74514A, CR8, CYC-065 (Cyclacel), dinaciclib (Ligand), (R)-DRF053 dihydrochloride (CAS number: 1056016-06-8), fascaplysin, flavopiridol, hygrolysine, indirubin, LEE-011 (Astex Pharmaceuticals), LY-2835219 (Eli Lilly), milciclib maleate (Nerviano Medical Sciences), MM-D37K (Maxwell Biotech), N9-isopropyl-olomoucine, NSC625987 (CAS number: 141992-47-4), NU2058 (CAS number: 161058-83-9), NU6102 (CAS number: 444722-95-6), olomoucine, ON-108600 (Onconova), ON-123300 (Onconova), oxindole I, P-1446-05 (Piramal), P-276-00 (Piramal), palbociclib (Pfize r), PHA-767491 (CAS number: 845714-00-3), PHA-793887 (CAS number: 718630-59-2), PHA-848125 (CAS number: 802539-81-7), Purvalanol A, Purvalanol B, R547 (CAS number: 741713-40-6), RO-3306 (CAS number: 872573-93-8), Roscovitine, SB-1317 (SBIO), SCH 900776 (CAS No.: 891494-63-6), SEL-120 (Selvita), seliciclib (Cyclacel), SNS-032 (CAS No.: 345627-80-7), SU9516 (CAS No.: 377090-84-1), WHI-P180 (CAS No.: 211555-08-7), pharmaceutically acceptable salts thereof, and combinations thereof.

7. The pharmaceutical composition described in claim 6, wherein the CDKi is selected from the group consisting of dinaciclib, palbociclib, pharmaceutically acceptable salts thereof, and combinations thereof.

8. The second active agent is selected from the group consisting of PF01367338 (Pfizer, New York, NY), olaparib (AstraZeneca, United Kingdom), iniparib (Sanofi-Aventis, Paris, France), veliparib (Abbott Laboratories, Abbott Park, IL), MK 4827 (Merck, White House Station, NJ), CEP 9722 (Teva Pharmaceuticals, Israel), LT-673 (Biomarin, San Rafael, CA), and BSI 401 (Sanofi-Aventis, Paris, France), pharmaceutically acceptable salts thereof, and combinations thereof.

9. A pharmaceutical composition described in any one of claims 1 to 8 for treating cancer in a subject in need thereof.

10. The pharmaceutical composition described in claim 9, wherein the subject is a mammal.

11. The pharmaceutical composition of claim 10, wherein the mammal is selected from the group consisting of primates, farm animals, and livestock.

12. The pharmaceutical composition described in claim 10, wherein the mammal is a human.

Images