Lamp nucleic acid combinations, detection methods and uses thereof for detecting radish partitiviridae 1 in codonopsis pilosula
The LAMP nucleic acid combination with RT-qLAMP technology and physical adsorption enrichment addresses the limitations of existing methods by offering rapid, sensitive, and cost-effective detection of Diacompartitivirus 1 in Codonopsis ginseng, enhancing field applicability and detection efficiency.
Patent Information
- Application Number
- JP2025050077
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-03-25
- Filing Date
- 2025-03-25
- Publication Date
- 2025-10-07
- Estimated Expiration
- 2045-03-25
Smart Images

Figure 2025148312000001_ABST
Abstract
Description
[Technical Field]
[0001] The present invention relates to the technical field of detecting pathogens in traditional Chinese medicines, and particularly to a LAMP nucleic acid combination, detection method and use thereof for detecting Diacompartitivirus 1 in Codonopsis ginseng. [Background technology]
[0002] Gansu Province is one of the important producers of traditional Chinese medicines in China, with abundant genetic resources and a long history of cultivating authentic medicinal herbs such as Codonopsis glabra, with an average cultivation area of more than 90% of China's total in the past five years. However, due to the continuous expansion of the scale and area of artificial plantings and continuous planting, the Codonopsis glabra production area has deteriorated, the seed quality has declined, and diseases, particularly those caused by continuous cropping, have become prevalent, resulting in reduced medicinal yields and quality, causing serious economic losses to growers and becoming an important bottleneck restricting the current development of high-quality traditional Chinese medicines.
[0003] Currently, research on ginseng diseases has focused mainly on fungal and bacterial pathogens, such as root rot and soft rot, with few reports on viral diseases. In fact, viral diseases are extremely serious plant diseases that are difficult to control. Once infected, plant development is retarded, and growth, photosynthesis, physiological, biochemical, and primary and secondary metabolic processes are all inhibited, leading to degeneration of the plant species, weakened resistance, reduced immunity, and increased susceptibility to bacterial and fungal pathogens. In severe cases, harvesting may be impossible.
[0004] From 2021 to 2023, the inventors conducted systematic investigations, detection, and analysis of viral diseases in major ginseng-producing areas in Gansu Province, including Weiyuan, Jiang, Min, Lintao, Yongdeng, and Yuzhong counties. Among 61 samples from different geographical locations, 41 showed symptoms suspected to be viral diseases, such as yellowing, mottling, and mosaic, resulting in on-site detection, with a positive rate of 67.2%. Small RNA sequencing (sRNA-seq) identified Raphanus sativus partitivirus 1 (RsPV1) in some samples, marking the first discovery of RsPV1 viral pathogen infection in ginseng. Reverse transcription-polymerase chain reaction (RT-PCR) analysis of positive field samples and observation of plant morphology and growth showed that when RsPV1 virus is infected with C. chinensis, viral disease symptoms appear on the leaves, and the virus often infects in combination with other viruses. Therefore, it is speculated that RsPV1 virus is a harmful pathogen of C. chinensis, and may affect the growth, development, metabolism, and quality formation of C. chinensis. There is an urgent need to develop corresponding detection, diagnosis, and prevention technologies.
[0005] Currently, there are no relevant reports on the RsPV1 virus pathogen or its gene sequence. Specific antibodies and primer sequences for nucleic acid amplification are not available. Immunological and molecular biological detection techniques commonly used to detect and diagnose known pathogens, such as enzyme-linked immunosorbent assay (ELISA) and RT-PCR, are inapplicable to the RsPV1 virus pathogen. Furthermore, common techniques, such as ELISA and immunocapture-reverse transcription-polymerase chain reaction (IC-RT-PCR), rely on specific antibodies, have high detection costs, and require experienced personnel with specialized operating skills to complete. This limits their scope of use and prevents them from meeting the actual needs of field and agricultural technology extension departments for disease detection, diagnosis, prevention, and control.
[0006] In view of the above, the present invention is proposed. Summary of the Invention [Problem to be solved by the invention]
[0007] The object of the present invention is to provide a LAMP nucleic acid combination, a detection method and its use for detecting Diacompartitivirus 1 in Codonopsis crotonin in order to solve the above problems. [Means for solving the problem]
[0008] Existing ELISA and its derivative technologies rely on antibodies and are prone to false negative results due to limited sensitivity. RT-PCR and its derivative nucleic acid amplification technologies require high-quality RNA extraction, are difficult to detect, and require specialized technicians with laboratory experience to operate, which has limited their popularity and application to some extent. Therefore, there is an urgent need to develop simple, highly sensitive, and rapid technologies and methods for detecting new pathogens.
[0009] The inventors have improved the method of physical adsorption enrichment (PAE) of pathogens by first enriching virions in the test sample, and then combining the enriched virions with RT (reverse transcription)-fluorescence quantitative DNA loop-mediated isothermal amplification (qLAMP) technology for quantitative amplification detection. The entire process does not rely on antibodies or require extraction of viral nucleic acid RNA, achieving the goal of rapid, simple and quantitative pathogen detection. The specific method involves first concentrating and purifying virions in the test sample using a pretreatment device to increase the amount of virus per unit volume. Then, the virions in the test sample are concentrated by physically adsorbing them to the wall of a reaction vessel (e.g., a PCR tube). Reverse transcription (RT) is then performed using the enriched virions and a reverse primer specific to the screened target gene to synthesize the first strand of cDNA. The nucleic acid is then amplified using qLAMP. The amplification product is monitored in real time based on the quantitative peak time, allowing accurate determination of the viral infection status in the sample. This successfully established a PAE-RT-qLAMP technology and method for specifically detecting Diacompartitivirus 1, a new pathogen of Codonopsis chinensis, without the need for antibodies or nucleic acid RNA extraction. Furthermore, quantitative polymerase chain reaction (qPCR) and polymerase chain reaction (PCR) methods and kits for detecting Diacompartitivirus 1, a new pathogen of Codonopsis chinensis, have also been developed.
[0010] The present invention is realized as follows.
[0011] Diapartitivirus 1 is a member of the Alphapartitivirus genus in the Partitiviridae family. Partitiviruses typically contain two genomes, one encoding the virion coat protein gene and the other encoding the viral replicase gene, both ranging in size from 1.4 kbp to 3.0 kbp. Like totiviruses, partitiviruses have a broad host range and are found in large numbers in various fungi, monocotyledonous plants, dicotyledonous plants, and algae. They have also been found to infect protozoa such as small Cryptosporidium, flatworms, tunicates, and roundworms, as well as insects such as sandflies, Siberian springtails, and spiral worms, and even higher animals such as codfish. Among these, reported partitiviruses have primarily been isolated from plants and fungi.
[0012] Partitiviruses, which have been found to infect plants, have spherical virions with diameters of 30–40 nm and are transmitted via pollen or seeds. Their genome structure is similar to that of fungal partitiviruses. They have been reported in plants such as beet, broad bean, Italian ryegrass, alfalfa, carnation, oxtail, clover, red clover, white clover, spinach, carrot, and rapeseed. In axenic cultures of plant tissues, partitiviruses can persist for years and cannot be eliminated by heat treatment. From 2023 to 2024, the inventors conducted germination culture and RT-PCR detection analysis of RsPV1 virus on commercial seeds of C. sieboldii produced in various geographical regions across China. The results showed that only 12 out of 19 batches of seeds germinated, and RsPV1 virus was detected in 11 out of 12 batches of samples, with an RsPV1 infection rate of 91.7%. Based on the transmission characteristics of partitiviruses, it is speculated that RsPV1 may be a seed-borne virus of C. sieboldii, which may be transmitted, spread and survive over long distances through C. sieboldii seeds, posing a high risk of harm and requiring great attention and caution from seed quality supervision and testing departments.
[0013] Most partitiviruses reported to date consist of two similarly sized fragments: one encodes the viral replicase, which plays a central role in viral genome replication and transcription, and the other encodes the proteins that encase the viral genome to form the virion coat. RNA-dependent RNA polymerase (RdRp) is a central component of the viral replicase system, which, together with several virus-encoded proteins and host cell factors, constitutes the viral replicase system and is responsible for replicating the viral genome. Studying the structure and function of RdRp is crucial for elucidating the replication and regulatory mechanisms of sense-strand RNA viruses. There have been few reports, both domestically and internationally, on the gene cloning, prokaryotic expression, and antibody production of RsPV1-dependent RNA polymerase.
[0014] In a first aspect, the present invention provides a LAMP nucleic acid combination for detecting Raphanus sativus partitivirus 1 in Raphanus sativus, comprising a LAMP forward outer primer F3 shown in SEQ ID NO: 2, a LAMP reverse outer primer B3 shown in SEQ ID NO: 3, a LAMP forward inner primer FIP shown in SEQ ID NO: 4, a LAMP reverse inner primer BIP shown in SEQ ID NO: 5, a LAMP forward loop primer LF shown in SEQ ID NO: 6, and a LAMP forward loop primer LB shown in SEQ ID NO: 7.
[0015] The specific sequences of the primers are as follows: SEQ ID NO:1: Reverse transcription primer: 5'-CGCAACATGGCTAGCAACTG-3', SEQ ID NO: 2: F3: 5'-TTTACTATCTAGAGGTTCACAATC-3', SEQ ID NO: 3: B3: 5'-AATATCATTGAGTGAATGTCTCT-3', SEQ ID NO: 4: FIP: 5'-AGCCCAGTTGTAAAGGCGTGGCCAATGTTATGGGGCTA-3', SEQ ID NO: 5: BIP: 5'-AGCTGCCTAAATTTGCATCAGTGATAACAGTGTGTCTTGCGT-3', SEQ ID NO: 6: LF: 5'-CCATCCTCCAGTTGTGGTTTCG-3', SEQ ID NO: 7: LB: 5'-CCTTGACTGGAGCCGCTTC-3'.
[0016] After extensive primer screening and optimization over a long period of time, the inventors finally obtained the above nucleic acid combination, which can detect the Codonopsis ginseng RsPV1 viral pathogen in target samples with high specificity and sensitivity.
[0017] In a preferred embodiment, the LAMP nucleic acid combination further comprises a reverse transcription primer.
[0018] In a preferred embodiment, the reverse transcription primer is set forth in SEQ ID NO:1.
[0019] In a second aspect, the present invention further provides a combination of nucleic acids for detecting Diacompartitivirus 1 in Codonopsis crotoninus, comprising an upstream primer shown in SEQ ID NO: 8 and a downstream primer shown in SEQ ID NO: 9.
[0020] The upstream and downstream primers of the nucleic acid combination are qPCR detection primers; in other embodiments, the upstream and downstream primers can also be used as conventional PCR detection primers. SEQ ID NO: 8: GCAGGTTACCACCCCACATATCAG, SEQ ID NO: 9: AGCATTCGTCCATCAGGCAACAG.
[0021] In a preferred embodiment, the nucleic acid combination further comprises a reverse transcription primer.
[0022] In a preferred embodiment, the reverse transcription primer is set forth in SEQ ID NO:1.
[0023] In a third aspect, the present invention further provides a combination of nucleic acids for detecting Diacompartitivirus 1 in Codonopsis crotoninus, comprising an upstream primer shown in SEQ ID NO: 10 and a downstream primer shown in SEQ ID NO: 11.
[0024] The upstream and downstream primers of the nucleic acid pair are conventional PCR detection primers. SEQ ID NO: 10: GCTCATGGCTCATCCCTTGA, SEQ ID NO: 11: CGCAACATGGCTAGCAACTG.
[0025] In a preferred embodiment, the nucleic acid combination further comprises a reverse transcription primer.
[0026] In a preferred embodiment, the reverse transcription primer is set forth in SEQ ID NO:1.
[0027] In a fourth aspect, the present invention further provides a product for detecting Dicompartitivirus 1 in Copernicia crocephala, wherein the product is a reagent, kit or chip, and the product comprises at least one nucleic acid combination of a LAMP nucleic acid combination for detecting Dicompartitivirus 1 in Copernicia crocephala and the above-mentioned nucleic acid combination for detecting Dicompartitivirus 1 in Copernicia crocephala.
[0028] Chips include, but are not limited to, microfluidic chips.
[0029] When the kit contains the above three nucleic acid combinations simultaneously, the kit can simultaneously have the functions of LAMP amplification, qPCR detection, and PCR detection; when the kit contains only the LAMP nucleic acid combination for detecting Dicompartitivirus 1 in C. cerevisiae, the kit has the function of LAMP amplification (including RT-qLAMP and RT-LAMP amplification); when the kit contains only the nucleic acid combination for qPCR detection for detecting Dicompartitivirus 1 in C. cerevisiae, the kit has the function of RT-qPCR detection; and when the kit contains only the nucleic acid combination for PCR detection for detecting Dicompartitivirus 1 in C. cerevisiae, the kit has the function of RT-PCR detection.
[0030] In a preferred embodiment of the present invention, the above-mentioned product further comprises a reverse transcription reagent, which comprises a reverse transcriptase, a reverse transcriptase buffer, an RNase (ribonuclease) inhibitor, a dNTP (deoxyribonucleoside triphosphate) mixture, and water.
[0031] Reverse transcriptases include, but are not limited to, AMV reverse transcriptase or M-MLV reverse transcriptase, as well as mutants, conjugates, and the like of the above reverse transcriptases.
[0032] The RNase inhibitor can be DEPC (Diethyl Pyrocarbonate), guanidine isothiocyanate, or ribonucleoside-vanadyl complex.
[0033] In a preferred embodiment of the present invention, when the product is used for LAMP amplification, the product further comprises a LAMP amplification reagent, which comprises a dNTP mixture, a ThermoPol reaction buffer, Mg ions, a DNA polymerase, a LAMP fluorescent dye, and water.
[0034] The DNA polymerase is selected from, for example, Bst DNA polymerase. Furthermore, in other embodiments, the type of DNA polymerase can be selected as desired.
[0035] LAMP fluorescent dyes include, but are not limited to, SYBR series dyes, including, but not limited to, Cyber Green I, Cyber Green II, Cyber Gold, and Cyber Safe.
[0036] In a preferred embodiment of the present invention, when the product is used to perform a fluorescent quantitative qPCR reaction, the product further comprises a qPCR fluorescent dye and a fluorescent quantitative PCR reaction premix, where the qPCR fluorescent dye includes, but is not limited to, SYBR series dyes, ROX, EvaGreen, and SYBR series dyes include, but are not limited to, CyberGreen I, CyberGreen II, CyberGold, and CyberSafe.
[0037] In a preferred embodiment of the present invention, when the product is used to perform a PCR reaction, the product further comprises a PCR reaction premix.
[0038] In a preferred embodiment of the present invention, the PCR reaction premix further comprises a DNA polymerase, a PCR buffer, a dNTPs mixture, and water.
[0039] In a preferred embodiment of the present invention, the product further comprises a positive control and a negative control.
[0040] In a preferred embodiment, the positive control is the RdRp gene of Codonopsis rhododendron daikon radish compartitivirus 1. The negative control is water.
[0041] The sequence of the positive control Codonopsis ginseng RsPV1 RdRp gene is as follows: GCTCATGGCTCATCCCTTGAACCTCACATGGTCGATAGACGTATGACGATAGGATCTCTACAATGAGATGTTTTTCATCAATCGACTTAACATTCACCTTATTAAAGATGGATGGATAACCAATAAACACGGACACGATCTTAGATATTGGCATACAGCTCATGCTCGACAGCATTTAGTTGAAGCTAATGAAGAAGACAAAGTTCGACTTGTTTTTGGCGCACCTTCCACCCTTTTGATGGCTGAGCTCATGTTCATTTGGCCGATACAATCTAGTTTACTATCTAGAGGTTCACAATCGCCAATGTTATGGGGCTACGAAACCACAACTGGAGGATGGTCACGCCTTTACAACTGGGCTGCCAAAGAGCTGCCTAAATTTGCATCAGTTGCGACCCTTGACTGGAGCCGCTTCGACAAAGACGCAAGACACACTGTTATCAGAGACATTCACTCAATGATATTGAGGCCTATGTTTGATTTCACTGCAGGTTACCACCCCACATATCAGAATCCCAGGACTACTCCTGACCCCCAAAGGCTTGAAAACCTATGGAATTGGATGACTGACGCCATACTGACAACACCGCTGCTGTTGCCTGATGGACGAATGCTAAGGTTCACTCACTCAGGAATCTACTCTGGCTATTTTCAGACCCAGATTCTAGATTCGATCTACAACTGCGTGATGATTTTCACCATTCTATCAAGAATGGGAATCGACTTAAATACAATCGCGTTGAAAGTACAGGGAGATGACTCTATTATTTTGTTATCTCACAATTTTACTTTACTGCGCAAATCATTTCTACAGATGTTTGCAGAGCTGGCCAACACCTATTTTGGATCAACTCTCAACACAAAGAAGAGCGAACTTCTCCCCTCATTAGAAGGAGCAGAAGTACTGCGATATCGTAATCAGGCACTATGCCATACAGAGACGAATTACAGTTGCTAGCCATGTTGCG。
[0042] In a preferred embodiment of the present invention, the product further comprises a physical adsorption enrichment (PAE) device for tissue separation of the test sample, the physical adsorption enrichment device comprising a filter and an ultrafiltration tube, the filter being provided with a hydrophilic membrane filter.
[0043] In use, Codonopsis carota tissue (roots, stems, leaves, or seeds) is first ground in PBS buffer, the ground solution is centrifuged, and the supernatant is collected as a crude tissue extract. The crude tissue extract is then filtered to remove cellular debris and other large particle aggregates for clarification, and further concentrated through an ultrafiltration tube to increase the amount of virus per unit volume. A concentrated solution of infected tissue is obtained, and the concentrated infected tissue is then cultured. The concentrated infected tissue is then discarded and washed to obtain a test sample. In a preferred embodiment of the present invention, the washed test sample is first denatured and then used for reverse transcription.
[0044] The present invention combines physical adsorption and enrichment with nucleic acid detection for Diacompartitivirus 1, which can rapidly and accurately detect Diacompartitivirus 1 in Codonopsis crohnii without relying on virus-specific antibodies or requiring RNA extraction. The detection product has high specificity, high sensitivity, and low cost. The corresponding detection method is simple and easy to operate, and the detection results can be analyzed by computer and analysis software without the need for nucleic acid gel electrophoresis. This saves detection time, improves detection efficiency, and enhances detection sensitivity, making it suitable for rapid screening and real-time monitoring of pathogens, and provides technical support for quality monitoring of Codonopsis crohnii seeds, tissue culture detoxification of viral pathogens, field management, and comprehensive prevention and control.
[0045] In a fifth aspect, the present invention provides a method for producing a composition comprising: The present invention further provides a method for detecting Diacompartitivirus 1 in Codonopsis cernua, which includes the steps of: performing a reverse transcription reaction on a test sample using the above-mentioned LAMP nucleic acid combination or the reverse transcription primer in the above-mentioned product to obtain cDNA; and then subjecting the cDNA to a LAMP reaction using the above-mentioned LAMP nucleic acid combination under reaction conditions of 56 to 70°C for 30 to 100 minutes and 80°C for 5 to 10 minutes.
[0046] The above reaction conditions enable efficient amplification of the Codonopsis ginseng RsPV1 RdRp gene. LAMP reaction conditions include, for example, 56°C, 57°C, 58°C, 59°C, 60°C, 61°C, 62°C, 62.5°C, 63°C, 64°C, 65°C, 66°C, 67°C, 68°C, 69°C, or 70°C for 30 to 100 minutes and 80°C for 5 to 10 minutes.
[0047] In a preferred embodiment, the LAMP reaction is carried out at 60 to 64° C. for 30 to 100 minutes and at 80° C. for 5 to 10 minutes. The amplification time during the LAMP reaction is any one of the following time points: 30 to 60 minutes, 40 to 80 minutes, 55 to 90 minutes, 65 to 80 minutes, and 70 to 100 minutes.
[0048] In the LAMP reaction, qLAMP amplification can be performed using a device such as a real-time fluorescent quantitative PCR thermal cycler. If such a device is not available, a regular LAMP detection reaction can also be performed using a constant temperature device such as a water bath, a constant temperature incubator, or a regular PCR thermal cycler.
[0049] In a preferred embodiment, the LAMP reaction system comprises a LAMP reverse outer primer B3 at a final concentration of 0.2 to 0.4 μM, a LAMP forward outer primer F3 at a final concentration of 0.2 to 0.4 μM, a LAMP forward inner primer FIP at a final concentration of 1.5 to 1.7 μM, a LAMP reverse inner primer BIP at a final concentration of 1.5 to 1.7 μM, a LAMP forward loop primer LF at a final concentration of 0.3 to 0.5 μM, and a LAMP forward loop primer LB at a final concentration of 0.3 to 0.5 μM.
[0050] In a preferred embodiment, the LAMP reaction system further comprises Mg ions at a final concentration of 8.0 to 12.5 mM, dNTPs at a final concentration of 1.4 to 2.8 mM, and DNA polymerase at a final concentration of 0.32 to 0.64 U.
[0051] In a preferred embodiment, the method further includes preparing a test sample before performing the reverse transcription reaction, and the test sample is prepared by crudely extracting the test Aspergillus oryzae material with a tissue extract, filtering the sample, transferring the collected filtrate to an ultrafiltration tube, concentrating it, culturing it, and washing it.
[0052] In a preferred embodiment, the washed test sample is subjected to an initial denaturation before use in a reverse transcription reaction, and the initial denaturation conditions are 85 to 95°C for 1 to 5 minutes in an ice bath.
[0053] This product, which combines physical adsorption and enrichment with nucleic acid detection for the detection of Diacompartitivirus 1 in Codonopsis ginseng, overcomes the drawbacks of existing technologies, such as the need to prepare or purchase expensive antibodies in advance or extract high-quality nucleic acid RNA for detection, which is costly, time-consuming, and labor-intensive, and requires extensive training for detection personnel. To purify the virus, the present invention first uses a filtration and concentration device to filter and concentrate crude extracts from the test sample. The virus particles are then enriched by physical adsorption. The first strand of cDNA is synthesized by reverse transcription / RT using selected RsPV1 gene-specific primers. Taking advantage of the highly sensitive technology of fluorometric quantification, the amplified product is directly analyzed using integrated computer and analysis software. The entire detection process does not rely on virus-specific antibodies or the need for tedious RNA extraction, thereby lowering the detection threshold and difficulty. Since qLAMP amplification does not require additional reagents, the risk of contamination is reduced, increasing its value and providing a wide range of applications.
[0054] Detection of Diacomppartitivirus 1 in Codonopsis ginseng by LAMP nucleic acid combinations can be qualitative or quantitative.
[0055] If a clear fluorescent signal is detected in the sample PCR tube, this indicates a positive result and that the sample contains the Codonopsis ginseng RsPV1 virus.
[0056] If no obvious fluorescent signal is detected in the sample PCR tube, this means a negative result, indicating that the sample does not contain the Codonopsis RsPV1 virus.
[0057] Preferably, if one wants to clarify the content of RsPV1 virus in a positive sample, it is necessary to quantitatively determine the copy number of RsPV1 virus in the positive sample by fitting a standard curve based on the amplification Ct value of the positive sample.
[0058] Preferably, in the case of a conventional LAMP amplification reaction, after the completion of the above LAMP reaction, centrifuge or gently shake the PCR tube without opening the lid, mix the Cyber Green I fluorescent dye coloring solution on the inner wall of the PCR tube lid with the LAMP amplification product, mix it upside down, and observe the color change of the mixture in the PCR tube with the naked eye under natural light.
[0059] If the mixture turns green, it means that the SYBR Green I dye has bound to the double-stranded DNA, which is a positive reaction and indicates that the test sample contains the Codonopsis ginseng RsPV1 virus.
[0060] If the mixture is orange, it is a negative reaction, indicating that the sample does not contain the Codonopsis RsPV1 virus.
[0061] In a sixth aspect, the present invention provides a method for producing a composition comprising: (1) A method of performing a reverse transcription reaction on a test sample using the reverse transcription primer in the above nucleic acid combination or the above product to obtain cDNA, and then amplifying the cDNA using the upstream primer and downstream primer in the above nucleic acid combination by qPCR to detect the amplified product; (2) Any one of the methods comprising: performing a reverse transcription reaction on a test sample using the reverse transcription primer in the above nucleic acid combination or the above product to obtain cDNA; and then amplifying the cDNA by PCR using the upstream primer and downstream primer in the above nucleic acid combination. Further provided is a method for detecting Radicpartitivirus 1 in Codonopsis gracilis.
[0062] The above method (1) is a fluorescent quantitative PCR detection, and the method (2) is a conventional PCR detection.
[0063] In a preferred embodiment, the qPCR reaction conditions are 30 to 40 cycles of amplification at 95°C for 30 seconds, 95°C for 5 seconds, and 60°C for 34 seconds.
[0064] In a preferred embodiment, the qPCR reaction system contains an upstream primer at a final concentration of 0.2 to 0.7 μM and a downstream primer at a final concentration of 0.2 to 0.7 μM.
[0065] In a preferred embodiment, the PCR reaction conditions are 95°C for 3 to 5 minutes, followed by 30 to 40 cycles of amplification at 95°C for 5 seconds, 54°C for 30 seconds, and 70 to 72°C for 45 seconds.
[0066] In a preferred embodiment, the PCR reaction system contains 0.2 to 1.0 μM of an upstream primer and 0.2 to 1.0 μM of a downstream primer.
[0067] After the fluorescent quantitative qPCR reaction in Method (1) is completed, observe the fluorescent signal detected by the real-time fluorescent PCR instrument. If a clear fluorescent signal is detected in the sample reaction tube, this indicates a positive result, indicating that the sample contains the Codonopsis ginseng RsPV1 virus.
[0068] If no obvious fluorescent signal is detected in the sample reaction tube, it means negative, indicating that the sample does not contain the Codonopsis ginseng RsPV1 virus.
[0069] When quantitative analysis is performed, a standard curve should be fitted based on the amplification Ct value of the positive sample to quantitatively determine the copy number of RsPV1 virus in the positive sample.
[0070] After a typical PCR amplification reaction is completed, the amplified product is subjected to gel electrophoresis, and the presence or absence of RsPV1 in Codonopsis ginseng is determined based on the size and presence of the product bands. In another embodiment, the amplified product can be directly sequenced, and the presence of RsPV1 virus in the sample can be determined through sequence comparison.
[0071] In a seventh aspect, the present invention further provides a use of a LAMP nucleic acid combination for detecting Dicompartitivirus 1 in C. rhododendron, the above-mentioned nucleic acid combination for detecting Dicompartitivirus 1 in C. rhododendron or the above-mentioned product for detecting Dicompartitivirus 1 in C. rhododendron.
[0072] The above uses include, but are not limited to, directly adding the above nucleic acid combination or using the above product to detect Radish Partitivirus 1 in Codonopsis ginseng, or constructing a gene library using the above nucleic acid combination or product. Application scenarios include, but are not limited to, customs entry-exit quarantine and agricultural disease detection of traditional Chinese medicine materials. [Effects of the Invention]
[0073] (1) The present invention provides a LAMP nucleic acid combination for detecting Codonopsis ginseng RsPV1 virus, which can be used in RT-qLAMP, PAE-RT-qLAMP, or PAE-RT-LAMP amplification reactions. LAMP amplification uses a total of six primers, F3, B3, FIP, BIP, LF, and LB, to recognize eight individual sequences in the RdRp gene of RsPV1 virus, and has the technical advantages of strong specificity and high accuracy.
[0074] (2) The present invention further provides a nucleic acid combination for detecting Codonopsis ginseng RsPV1 virus, which can be used for both conventional PCR detection and qPCR detection, and has high detection specificity and accuracy.
[0075] (3) The kit for rapid and quantitative RT-qLAMP detection of the Codonopsis ginseng RsPV1 virus pathogen provided by the present invention has technical advantages such as simple operation, high speed, and low cost. The detection primer composition can achieve highly sensitive and reliable detection of Codonopsis ginseng RsPV1 virus in target samples. In particular, the PAE-RT-qLAMP kit has the advantages of low cost, no need for nucleic acid extraction, and a simple detection procedure.
[0076] The present invention performs RT-qLAMP amplification with high specificity and sensitivity, improving the specificity of detection and reducing the occurrence of false positives.
[0077] (4) This invention provides a new technical idea for detecting new pathogens in ginseng and other crops, and can be used for accurate quantification and conventional qualitative analysis of ginseng RsPV1 virus, providing technical support for monitoring the occurrence, spread, and cross-species transmission of RsPV1 virus, as well as for biosafety and comprehensive prevention and control.
[0078] In order to more clearly explain the technical solutions of the embodiments of the present invention, the drawings used in the embodiments are briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention, and that those skilled in the art can obtain other related drawings without any creative efforts. [Brief explanation of the drawings]
[0079] [Figure 1] FIG. 1 is a schematic plan view of a physical adsorption / enrichment PAE purification device for detecting the Codonopsis ginseng RsPV1 viral pathogen by PAE-qRT-LAMP in an embodiment of the present invention. [Figure 2] FIG. 2 is a schematic plan view of a physical adsorption / enrichment PAE concentration device for detecting the Codonopsis ginseng RsPV1 viral pathogen by PAE-qRT-LAMP in an embodiment of the present invention. [Figure 3]FIG. 3 is an analysis diagram of PCR amplification electrophoresis of the RdRp gene of a sample of Codonopsis cerevisiae RsPV1-positive leaves in an example of the present invention. Rails 1 and 2 in the diagram correspond to the Codonopsis cerevisiae RsPV1 RdRp gene-positive amplification, respectively, and rail CK is a negative control. [Figure 4] Figure 4 is a diagram of the fluorometric detection of primer screening when detecting the RsPV1 viral pathogen of Codonopsis ginseng using PAE-RT-qLAMP in an embodiment of the present invention. In the diagram, curve CK is the negative control, curve RsPV1-1 is the RsPV1-LAMP1 primer group, curves RsPV1-2 are the RsPV1-LAMP2 primer group, curve RsPV1-3 is the RsPV1-LAMP3 primer group, and curve RsPV1-4 is the RsPV1-LAMP4 primer group. [Figure 5] Figure 5 shows a typical color-changing LAMP visual observation diagram of the reaction temperature when detecting the RsPV1 viral pathogen of Codonopsis ginseng using PAE-RT-qLAMP in an embodiment of the present invention. In the diagram, the reaction tube CK is the negative control, and the reaction tubes 56°C to 70°C correspond to 56°C, 58°C, 60°C, 62°C, 64°C, 66°C, 68°C, and 70°C, respectively. [Figure 6] Figure 6 is a typical colorimetric LAMP visual observation experiment diagram of the reaction time when detecting the RsPV1 viral pathogen of Codonopsis ginseng using PAE-RT-qLAMP in an embodiment of the present invention. In the diagram, reaction tube CK is the negative control, and reaction tubes 20 minutes to 100 minutes correspond to 20 minutes, 30 minutes, 40 minutes, 50 minutes, 60 minutes, 70 minutes, 80 minutes, 90 minutes, and 100 minutes, respectively. [Figure 7]FIG. 7 is a fluorometric detection diagram of the specificity of detecting the RsPV1 viral pathogen of Codonopsis chinensis by PAE-RT-qLAMP in an embodiment of the present invention. In the diagram, the curve NC is the negative control, the curve HC is the healthy Codonopsis chinensis control, the curve ALSV is the Apple latent spherical virus ALSV tissue infecting Angelica chinensis, the curve LycMoV is the LycMoV tissue infecting Angelica chinensis, the curve LSV is the LSV tissue infecting Lily, the curve CMV is the Cucumber mosaic virus CMV tissue infecting Lily, the curve LMoV is the LMoV tissue infecting Lily, the curve KoMV is the KoMV tissue infecting Angelica chinensis, and the curve RsPV1 is the RsPV1 Codonopsis chinensis-infected tissue. [Figure 8] Figure 8 shows a typical colorimetric LAMP visual observation diagram of the specificity of PAE-RT-qLAMP for detecting the RsPV1 viral pathogen of Codonopsis chinensis in an embodiment of the present invention. In the diagram, reaction tube NC is a negative control, reaction tube HC is a healthy Codonopsis chinensis control, reaction tube ALSV is an Apple latent spherical virus ALSV tissue that infects Angelica chinensis, reaction tube LycMoV is a Celery mottle virus LycMoV tissue that infects Angelica chinensis, reaction tube LSV is a Lily latent virus LSV tissue that infects lily, reaction tube CMV is a Cucumber mosaic virus CMV tissue that infects lily, reaction tube LMoV is a Lily mottle virus LMoV tissue that infects lily, reaction tube KoMV is a Taro mosaic virus KoMV tissue that infects Angelica chinensis, and reaction tube RsPV1 is an RsPV1 Codonopsis chinensis-infected tissue. [Figure 9]FIG. 9 is a fluorometric detection diagram of the sensitivity of detecting the C. sieboldiana RsPV1 viral pathogen by PAE-RT-qLAMP in an embodiment of the present invention, in which curve NC is the negative control, curve HC is the healthy C. sieboldiana control, curve 1 is the C. sieboldiana RsPV1 positive cDNA, curve 10-1 is the C. sieboldiana RsPV1 positive cDNA diluted 101 times, and curve 10-2 is the , curve 10-2 is RsPV1-positive cDNA diluted 102-fold, curve 10-3 is RsPV1-positive cDNA diluted 103-fold, curve 10-4 is RsPV1-positive cDNA diluted 104-fold, curve 10-5 is RsPV1-positive cDNA diluted 105-fold, and curve 10-6 is RsPV1-positive cDNA diluted 106-fold. [Figure 10] FIG. 10 is a fluorometric detection diagram of the sensitivity of detecting the C. sieboldiana RsPV1 viral pathogen by PAE-RT-qPCR in an embodiment of the present invention, in which curve NC is the negative control, curve HC is the healthy C. sieboldiana control, curve 1 is the C. sieboldiana RsPV1 positive cDNA, curve 10-1 is the C. sieboldiana RsPV1 positive cDNA diluted 101 times, and curve 10-2 is the , curve 10-2 is RsPV1-positive cDNA diluted 102-fold, curve 10-3 is RsPV1-positive cDNA diluted 103-fold, curve 10-4 is RsPV1-positive cDNA diluted 104-fold, curve 10-5 is RsPV1-positive cDNA diluted 105-fold, and curve 10-6 is RsPV1-positive cDNA diluted 106-fold. [Figure 11]11 is a fluorometric melting curve diagram for detecting the C. rhododendron RsPV1 viral pathogen by PAE-RT-qPCR in an embodiment of the present invention, in which curve NC is the negative control, curve HC is the healthy C. rhododendron control, curve 1 is the C. rhododendron RsPV1 positive cDNA, curve 10-1 is the C. rhododendron RsPV1 positive cDNA diluted 101 times, and curve 10-2 is the C. rhododendron RsPV1 positive cDNA diluted 101 times. Curve 10-1 is RsPV1-positive cDNA diluted 102-fold, curve 10-2 is RsPV1-positive cDNA diluted 103-fold, curve 10-3 is RsPV1-positive cDNA diluted 103-fold, curve 10-4 is RsPV1-positive cDNA diluted 104-fold, curve 10-5 is RsPV1-positive cDNA diluted 105-fold, and curve 10-6 is RsPV1-positive cDNA diluted 106-fold. [Figure 12] Figure 12 is an electrophoretic analysis diagram of the sensitivity when detecting the C. cerevisiae RsPV1 viral pathogen by PAE-RT-PCR in an embodiment of the present invention, where rail 1 is C. cerevisiae RsPV1-positive cDNA, rail 10-1 is C. cerevisiae RsPV1-positive cDNA diluted 101 times, rail 10-2 is C. cerevisiae RsPV1-positive cDNA diluted 102 times, rail 10-3 is C. cerevisiae RsPV1-positive cDNA diluted 103 times, rail 10-4 is C. cerevisiae RsPV1-positive cDNA diluted 104 times, and rail CK is a negative control. [Figure 13]13 is a fluorometric melting curve diagram for detecting the C. rhododendron RsPV1 viral pathogen by PAE-RT-qLAMP in an embodiment of the present invention, in which curve NC is the negative control, curve HC is the healthy C. rhododendron control, curve 1 is the C. rhododendron RsPV1 positive cDNA, curve 10-1 is the C. rhododendron RsPV1 positive cDNA diluted 101 times, and curve 10-2 is the C. rhododendron RsPV1 positive cDNA diluted 101 times. Curve 10-1 is RsPV1-positive cDNA diluted 102-fold, curve 10-2 is RsPV1-positive cDNA diluted 103-fold, curve 10-3 is RsPV1-positive cDNA diluted 103-fold, curve 10-4 is RsPV1-positive cDNA diluted 104-fold, curve 10-5 is RsPV1-positive cDNA diluted 105-fold, and curve 10-6 is RsPV1-positive cDNA diluted 106-fold. [Figure 14] Figure 14 shows a standard curve for detecting the Codonopsis cerevisiae RsPV1 viral pathogen using PAE-RT-qLAMP in an embodiment of the present invention. The starting concentration of the Codonopsis cerevisiae RsPV1 RdRp gene-positive standard in the figure is 2.49 x 10 copies / μL, and the concentrations of the six dilutions after 10-fold dilution are 2.49 x 10 copies / μL, 2.49 x 10 copies / μL, 2.49 x 10 copies / μL, 2.49 x 10 copies / μL, 2.49 x 10 copies / μL, 2.49 x 10 copies / μL, and 2.49 x 10 copies / μL, respectively. DETAILED DESCRIPTION OF THE INVENTION
[0080] Reference will now be made in detail to the embodiments of the invention, one or more examples of which are described below. Each example is provided by way of explanation, and not as a limitation of the invention. Indeed, it will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention. For example, features illustrated or described as part of one embodiment can be used with another embodiment to yield a still further embodiment.
[0081] Unless otherwise indicated, the practice of the present invention will employ conventional techniques of cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry and immunology, which are within the skill of the art. Such techniques are described, for example, in Molecular Cloning: A Laboratory Manual, 2nd edition (Sambrook et al., 1989), Oligonucleotide Synthesis (M.J. Gait, ed., 1984), Animal Cell Culture (R.I. Freshney, ed., 1987), Methods in Enzymology (Academic Press, Inc.), Handbook of Experimental Immunology (D.M. Weir and C.C. Blackwell, eds.), Gene Transfer Vectors for Mammalian Cells (J.M. Miller and M.P. Calos, eds., 1987), Current Protocols in Molecular Biology (F.M. Ausubel et al., eds., 1987), and PCR: The Polymerase Chain Reaction (PCR). These techniques are described in detail in "Current Protocols in Immunology" (eds. Mullis et al., 1994), and "Current Protocols in Immunology" (eds. J.E. Coligan et al., 1991), each of which is expressly incorporated herein by reference.
[0082] In order to clarify the objectives, technical solutions, and advantages of the embodiments of the present invention, the technical solutions in the embodiments of the present invention are clearly and completely described below. Conditions not specifically described in the examples shall be in accordance with conventional conditions or manufacturer's recommendations. If the manufacturers of the reagents and equipment used are not listed, they shall be conventional products available on the market.
[0083] The features and performance of the present invention will be described in more detail below with reference to examples. [Example]
[0084] This example provides a PAE-RT-qLAMP kit for rapid and quantitative detection of the emerging viral pathogen RsPV1 of Codonopsis ginseng.
[0085] The PAE-RT-qLAMP kit consists of a purification (i.e., filter) and concentration device (i.e., ultrafiltration tube) for the RsPV1 viral pathogen of Codonopsis ginseng, as shown in Figures 1 and 2, a RT-qLAMP-specific primer composition, reverse transcription / RT synthesis reagents, and qLAMP amplification reaction reagents.
[0086] In addition, the PAE-RT-qLAMP kit further includes phosphate buffer PBS, phosphate washing buffer PBST, a negative control, and a positive control.
[0087] Therein, the RT-qLAMP-specific primer composition includes the RT reverse primer RsPV1-R (i.e., reverse transcription primer) shown in SEQ ID NO: 1, the qLAMP forward outer primer F3 shown in SEQ ID NO: 2, the qLAMP reverse outer primer B3 shown in SEQ ID NO: 3, the qLAMP forward inner primer FIP shown in SEQ ID NO: 4, the qLAMP reverse inner primer BIP shown in SEQ ID NO: 5, the qLAMP forward loop primer LF shown in SEQ ID NO: 6, and the qLAMP forward loop primer LB shown in SEQ ID NO: 7.
[0088] The specific sequences of the primers are as follows: RsPV1-R:5'-CGCAACATGGCTAGCAACTG-3', F3:5'-TTTACTATTCTAGAGGTTCACAATC-3', B3:5'-AATATCATTGAGTGAATGTCTCT-3', FIP:5'-AGCCCAGTGTAAAGGCGTGGCCAATGTTATGGGGCTA-3', BIP:5'-AGCTGCCTAAATTTGCATCAGTGATAACAGTGTGTCTTGCGT-3', LF:5'-CCATCCTCCAGTTGTGGTTTCG-3', LB:5'-CCTTGACTGGAGCCGCTTC-3'.
[0089] The reverse transcription RT synthesis reagent consisted of 10 mM dNTP mixture, 5× M-MLV reaction buffer, 30 U / μL RNase inhibitor, 200 U / μL M-MLV reverse transcriptase, and RNA-free H O.
[0090] The qLAMP amplification reaction reagents consisted of 10 mM dNTP mixture, 10× ThermoPol reaction buffer, 100 mM MgSO 4 , 8 U / μL Bst DNA polymerase, 50× LAMP fluorescent dye, and nuclease-free H 2 O.
[0091] The concentration of the phosphate buffer PBS and the phosphate washing buffer PBST is 0.02M and the pH value is 7.4.
[0092] The negative control was nuclease-free H2O.
[0093] The positive control product is a standard product positive for the RsPV1 RdRp gene of Codonopsis glabra.
[0094] This example further provides a method for preparing a Codonopsis ginseng RsPV1 RdRp gene-positive standard. The specific preparation method is as follows:
[0095] 1. Extraction of total RNA from leaves of Codonopsis glabra Grind 50–100 mg of RsPV1-infected C. chinensis leaves with liquid nitrogen and extract total RNA from the infected C. chinensis leaf tissue using a plant total RNA extraction kit.
[0096] 2. Primer design and synthesis Based on the contig of RsPV1 from Codonopsis ginseng obtained by small RNA sequencing, forward (RsPV1-F1) and reverse primers (RsPV1-R1) specific for the RdRp gene were designed and synthesized. The primer sequences are as follows: RsPV1-F1:5'-GCTCATGGCTCATCCCTTGA-3', RsPV1-R1:5'-CGCAACATGGCTAGCAACTG-3'.
[0097] 3. Preparation of positive control 1) RT reaction The first strand of cDNA was synthesized by RT using the RsPV1 reverse primer RsPV1-R1 and M-MLV reverse transcriptase. A 10 μL RT reaction mixture consisted of 2 μL total RNA, 1 μL 10 μM RsPV1-specific reverse primer RsPV1-R1, 3 μL RNA-free HO, denatured at 70°C for 10 minutes, rapidly cooled on ice for 2 minutes, and then added to 2 μL 5x M-MLV buffer, 1 μL 10 mM dNTP mixture, 0.34 μL 30 U / μL RNase inhibitor, 0.35 μL 200 U / μL M-MLV reverse transcriptase, and 0.31 μL RNA-free HO. Mixing was completed, followed by incubation in a 42°C water bath for 1 hour, incubation at 70°C for 15 minutes, and then storage on ice until use.
[0098] 2) PCR reaction Using the first strand of the above cDNA as a template, PCR amplification of the Codonopsis ginseng RsPV1RdRp gene was carried out using Ex Taq DNA polymerase.
[0099] The PCR reaction system was 25.0 μL and contained 1.0 μL of 50 ng cDNA, 0.2 μL of 5 U / μL Ex Taq DNA polymerase, 2.5 μL of 10× PCR buffer, 2 μL of 2.5 mM dNTP mixture, 0.5 μL of 10 μM forward primer RsPV1-F1, and 0.5 μL of 10 μM reverse primer RsPV1-R1, and was made up to 25.0 μL with nuclease-free HO.
[0100] The PCR amplification conditions were as follows: pre-denaturation at 95°C for 3 minutes, denaturation at 95°C for 30 seconds, annealing at 54°C for 30 seconds, and extension at 72°C for 45 seconds; 35 cycles of amplification were performed, followed by a final extension at 72°C for 5 minutes.
[0101] As shown in Figure 3, the PCR product was detected by 1.5% agarose gel electrophoresis, and the target fragment was recovered. The target fragment was then ligated into the pMD18-T vector using a clone vector kit and transformed into DH5α susceptible cells. Screening was performed on blue-white plates. Three white-spotted colonies were randomly selected and inoculated into ampicillin LB medium, shaken at 37°C for 12 hours. The plasmids were extracted using a plasmid microextraction kit. 1 μL of each plasmid was then amplified by PCR under the same conditions as the PCR reaction system described above. The positive recombinant plasmids detected by PCR were sequenced. The sequence of the positive plasmid was confirmed to be completely correct, i.e., the positive control. The length of the corresponding Codonopsis ginseng RsPV1RdRp viral gene fragment was 968 bp. The plasmid concentration of the standard was measured using a NanoDrop ND-1000 nucleic acid / protein analyzer.
[0102] 4. Positive control sequence After sequencing, the RdRp gene positive standard of Codonopsis ginseng RsPV1 was consistent with the expectation, and the sequence of the recovered control fragment was as follows:
[0103] The sequence of the RdRp gene positive standard of RsPV1 from Codonopsis ginseng is: GCTCATGGCTCATCCCTTGAACCTCACATGGTCGATAGACGTATGACGATAGGATCTCTACAATGAGATGTTTTTCATCAATCGACTTAACATTCACCTTATTAAAGATGGATGGATAACCAATAAACACGGACACGATCTTAGATATTGGCATACAGCTCATGCTCGACAGCATTTAGTTGAAGCTAATGAAGAAGACAAAGTTCGACTTGTTTTTGGCGCACCTTCCACCCTTTTGATGGCTGAGCTCATGTTCATTTGGCCGATACAATCTAGTTTACTATCTAGAGGTTCACAATCGCCAATGTTATGGGGCTACGAAACCACAACTGGAGGATGGTCACGCCTTTACAACTGGGCTGCCAAAGAGCTGCCTAAATTTGCATCAGTTGCGACCCTTGACTGGAGCCGCTTCGACAAAGACGCAAGACACACTGTTATCAGAGACATTCACTCAATGATATTGAGGCCTATGTTTGATTTCACTGCAGGTTACCACCCCACATATCAGAATCCCAGGACTACTCCTGACCCCCAAAGGCTTGAAAACCTATGGAATTGGATGACTGACGCCATACTGACAACACCGCTGCTGTTGCCTGATGGACGAATGCTAAGGTTCACTCACTCAGGAATCTACTCTGGCTATTTTCAGACCCAGATTCTAGATTCGATCTACAACTGCGTGATGATTTTCACCATTCTATCAAGAATGGGAATCGACTTAAATACAATCGCGTTGAAAGTACAGGGAGATGACTCTATTATTTTGTTATCTCACAATTTTACTTTACTGCGCAAATCATTTCTACAGATGTTTGCAGAGCTGGCCAACACCTATTTTGGATCAACTCTCAACACAAAGAAGAGCGAACTTCTCCCCTCATTAGAAGGAGCAGAAGTACTGCGATATCGTAATCAGGCACTATGCCATACAGAGACGAATTACAGTTGCTAGCCATGTTGCG is as follows.
Example
[0104] This example further provides a method for rapid detection of the emerging viral pathogen RsPV1 of Codonopsis ginseng by a PAE-RT-qLAMP kit.
[0105] 1. Concentration, Purification, and PAE Adsorption / Enrichment of Codonopsis ginseng RsPV1 Virions 1) Take 50-100 mg of tissue material such as leaves or seeds of the test plant, add 1 mL of phosphate buffer (PBS) and grind it. Then, transfer the grinding liquid to a 1.5 mL sterile centrifuge tube and centrifuge it at 3000 rpm for 2 minutes. The supernatant is a crude extract of the infectious tissue.
[0106] 2) As shown in Figure 1, the crude extract of the above infectious tissue was filtered through a 0.45 μm hydrophilic membrane filter to remove cellular debris and other large particle aggregates, achieving the purpose of clarification and purification.
[0107] 3) As shown in Figure 2, the virus solution purified by the above filtration was further concentrated using a centrifugal ultrafiltration tube to obtain a concentrated solution of infected tissue.
[0108] 4) 100 μL of the concentrated solution from the infected tissue was taken and added to a 0.5 mL PCR tube, and incubated at 4°C for 15 minutes.
[0109] 5) The crude extract of the infected tissue was discarded, washed once with phosphate wash buffer PBST, washed once with RNA-free HO, briefly centrifuged, and the residual liquid was aspirated.
[0110] 2. Initial Denaturation of Virions Add 10 μL of RNA-free HO containing 15 units (U) of RNase inhibitor to the bottom of the PCR tube, incubate at 95°C for 1 minute to denature, immediately place in an ice bath for 1 minute, and use in the subsequent reaction.
[0111] 3.RT Reaction 1) Take a new PCR tube and add 2 μL of the above denatured solution, 1 μL of RsPV1-specific reverse primer RsPV1-R (10 μM), and 2 μL of RNA-free H2O. Mix and incubate at 70°C for 10 minutes, then immediately place in an ice bath for 2 minutes.
[0112] 2) Add 2 μL of 5x M-MLV buffer, 1 μL of 10 mM dNTP mixture, 0.34 μL of 30 U / μL RNase inhibitor, and 0.35 μL of 200 U / μL M-MLV reverse transcriptase to the PCR tube, add RNA-free HO to make 10 μL, mix thoroughly, and then incubate at 42°C for 1 hour in a water bath and then at 70°C for 15 minutes to obtain the first strand of cDNA, which will be used for the subsequent LAMP amplification.
[0113] 4. Fluorometric Quantitative qLAMP Amplification Reaction Fluorescent quantitative qLAMP amplification was performed in a new PCR tube by adding the following reagents. The reaction volume was 12.5 μL. The qLAMP amplification reagents were 50 ng cDNA (1.0 μL), 10× ThermoPol buffer (2.5 μL), 100 mM MgSO (1.5 μL), 10 mM dNTP mixture (3.5 μL), 10 μM F3 and B3 primers (0.5 μL each), 10 μM FIP and BIP primers (2.0 μL each), 10 μM LF and LB primers (0.5 μL each), and 8 U / μL Bst. The mixture contained 1.0 μL of DNA polymerase and 0.25 μL of LAMP fluorescent dye, and was made up to 12.5 μL with nuclease-free H2O. Nuclease-free H2O was also used as a negative control, and a positive control for the RdRp gene of Codonopsis ginseng RsPV1 was used as a positive control. LAMP amplification was performed in a real-time fluorescent quantitative PCR thermal cycler, and the reaction conditions were amplification at 60°C for 60 minutes, followed by denaturation at 80°C for 5 minutes.
[0114] In another embodiment, when detecting the content of RsPV1 virus in a sample, a positive standard of the RdRp gene of RsPV1 from Codonopsis ginseng diluted 10-fold should be simultaneously amplified during the qLAMP amplification reaction to plot a standard curve.
[0115] 5.Analysis and determination of reaction products After the above fluorometric quantitative qLAMP amplification reaction is completed, observe whether the real-time fluorescent PCR thermal cycler detects a fluorescent signal in the PCR tube.
[0116] If a clear fluorescent signal is detected in the sample PCR tube, this indicates a positive result and that the sample contains the Codonopsis ginseng RsPV1 virus.
[0117] If no obvious fluorescent signal is detected in the sample PCR tube, this means a negative result, indicating that the sample does not contain the Codonopsis RsPV1 virus.
[0118] In another embodiment, if you want to clarify the content of RsPV1 virus in a positive sample, you need to quantitatively determine the copy number of RsPV1 virus in the positive sample by fitting a standard curve based on the amplification Ct value of the positive sample. [Example]
[0119] This example provides a method (PAE-RT-LAMP) for rapid detection of the RsPV1 viral pathogen of Codonopsis ginseng using a conventional PCR thermal cycler based on the PAE-RT-qLAMP kit of Example 1. The method does not require a real-time fluorescent quantitative PCR thermal cycler. In other embodiments, constant temperature devices such as a water bath, constant temperature incubator, or metal bath can be selected for the conventional LAMP detection reaction.
[0120] The difference compared to Example 2 is that the LAMP amplification reaction in step 4 is as follows.
[0121] The reaction system was 12.5 μL, and the LAMP amplification reagents were 1.0 μL of 50 ng cDNA, 2.5 μL of 10× ThermoPol buffer, 1.5 μL of 100 mM MgSO4, 3.5 μL of 10 mM dNTP mixture, 0.5 μL each of 10 μM B3 and F3 primers, 2.0 μL each of 10 μM FIP and BIP primers, 0.5 μL each of 10 μM LF and LB primers, and 8 U / μL Bst. The reaction mixture contained 1.0 μL of DNA polymerase and was made up to 12.5 μL with nuclease-free H2O. Nuclease-free H2O was used as the negative control, and a positive control was used for the RdRp gene of Codonopsis ginseng RsPV1. After the reaction system was completed, 1 μL of 100x Cyber Green I fluorescent dye coloring solution was added to the inner wall of the PCR tube lid, and the PCR tube lid was tightly closed to perform LAMP amplification. The LAMP reaction conditions were amplification at 64°C for 60 minutes, followed by denaturation at 80°C for 5 minutes to terminate the reaction.
[0122] Analysis and determination of reaction products After the LAMP reaction is complete, centrifuge or gently shake the PCR tube without opening the lid to mix the Cyber Green I fluorescent dye on the inner wall of the PCR tube lid with the LAMP amplified product. Mix the tube upside down and observe the color change of the mixture in the PCR tube under natural light with the naked eye.
[0123] If the mixture turns green, it means that the SYBR Green I dye has bound to the double-stranded DNA, which is a positive reaction and indicates that the test sample contains the Codonopsis ginseng RsPV1 virus.
[0124] If the mixture is orange, it is a negative reaction, indicating that the sample does not contain the Codonopsis RsPV1 virus. [Example]
[0125] This example provides a method for detecting the RsPV1 viral pathogen of Codonopsis ginseng by RT-qPCR.
[0126] The primers for fluorescent quantitative qPCR amplification and amplification of the RsPV1 RdRp gene are as follows:
[0127] [Table 1]
[0128] The fluorescent quantitative qPCR reaction system consisted of 10 μL and contained 1.0 μL of 50 ng cDNA, 5.0 μL of TB Green Premix Ex Taq (2X) (Tli RNase H Plus), 0.2 μL of 10 μM forward primer RsPV1-qPCR-F1, 0.2 μL of 10 μM reverse primer RsPV1-qPCR-R1, and 0.2 μL of ROX reference dye (50X). Nuclease-free HO was added to the reaction mixture to make a final volume of 10 μL. Nuclease-free HO was also used as a negative control. The qPCR amplification was performed using a real-time fluorescent quantitative PCR thermal cycler. The reaction conditions were 95°C for 30 seconds, followed by denaturation at 95°C for 5 seconds, and annealing at 60°C for 34 seconds, for a total of 35 cycles.
[0129] To assess the accuracy of the method results, in this example, melting curve amplification was also performed with the following parameters: 95°C for 15 seconds, 60°C for 60 seconds, 95°C for 15 seconds. [Example]
[0130] This example provides a method for detecting the Codonopsis ginseng RsPV1 pathogen by RT-PCR.
[0131] The primers for conventional PCR amplification and the RsPV1 RdRp gene are as follows:
[0132] [Table 2]
[0133] A typical PCR reaction system was 25.0 μL and contained 1.0 μL of 50 ng cDNA, 0.2 μL of 5 U / μL Ex Taq DNA polymerase, 2.5 μL of 10× PCR buffer, 2 μL of 2.5 mM dNTP mixture, 0.5 μL of 10 μM forward primer RsPV1-PCR-F1, and 0.5 μL of 10 μM reverse primer RsPV1-PCR-R1. The volume was adjusted to 25.0 μL with nuclease-free HO. The PCR amplification conditions were as follows: pre-denaturation at 95°C for 3 minutes, denaturation at 95°C for 30 seconds, annealing at 54°C for 30 seconds, and extension at 72°C for 45 seconds. 35 cycles of amplification were performed, followed by a final extension at 72°C for 5 minutes.
[0134] The amplification products were collected and analyzed by gel electrophoresis. [Experimental Example 1]
[0135] Screening of qLAMP primers To screen for optimal primers for qLAMP amplification, four sets of LAMP primers were designed for the RdRp gene region of Codonopsis cerevisiae RsPV1 using Primer Explorer 5 software with default settings. The primers were synthesized by Seiko Biotechnology (Shanghai) Co., Ltd. cDNA from a healthy Codonopsis cerevisiae plant was used as a negative control, and cDNA from the Codonopsis cerevisiae RsPV1-positive leaf sample from the previous example was used as the reaction sample. qLAMP reactions were performed using the Mx3000p real-time PCR thermal cycler using the qLAMP detection system and detection method described in the previous example. The reaction process consisted of amplification at 60°C for 60 minutes and denaturation at 80°C for 5 minutes. After amplification, the fluorescent signal amplification curves of each reaction sample were observed. The experiment was repeated three times, and the primer sequences are listed in the table below.
[0136] [Table 3]
[0137] As shown in Figure 4, the amplification results showed that among the four primer groups, the RsPV1-LAMP3 and RsPV1-LAMP4 primer groups were unable to amplify the RdRp gene of RsPV1 in C. sclerotinii. The other two primer groups, RsPV1-LAMP1 and RsPV1-LAMP2, were both able to rapidly amplify cDNA from C. sclerotinii RsPV1-positive leaf samples. The RsPV1-LAMP2 primer group had the fastest peak time of 20 minutes, while the RsPV1-LAMP1 primer group had a peak time of 30 minutes. After extensive screening and repeated validation, the RsPV1-LAMP2 primer group was ultimately determined to be the most sensitive for cDNA from C. sclerotinii RsPV1 disease-positive samples and was used in subsequent experiments. [Experimental Example 2]
[0138] This experimental example provides a general colorimetric LAMP visual observation experiment for the rapid detection of Codonopsis ginseng RsPV1 virus using the PAE-RT-qLAMP kit in Example 2 at different reaction temperatures and reaction times. The detection method is as shown in Example 2.
[0139] The results of 80-minute amplifications at RT-LAMP temperatures of 56°C, 58°C, 60°C, 62°C, 64°C, 66°C, 68°C, and 70°C were tested. As shown in FIG. 5, the reaction tube CK in the figure is the negative control, and the reaction tubes 56°C to 70°C correspond to 56°C, 58°C, 60°C, 62°C, 64°C, 66°C, 68°C, and 70°C, respectively. As can be seen from the figure, the amplification primers provided in the examples of the present invention were able to efficiently amplify the RdRp gene of Codonopsis ginseng RsPV1 at temperatures between 56°C and 70°C.
[0140] The amplification results were tested by RT-LAMP at an amplification temperature of 64°C for 20, 30, 40, 50, 60, 70, 80, 90, and 100 minutes. As shown in Figure 6, reaction tube CK in the figure is a negative control, and reaction tubes 20 to 100 minutes correspond to 20, 30, 40, 50, 60, 70, 80, 90, and 100 minutes, respectively. As can be seen from the figure, the amplification primer combinations provided in the examples of the present invention were able to efficiently amplify the RdRp gene of Codonopsis ginseng RsPV1 within the 30 to 100 minute conditions. [Experimental Example 3]
[0141] Specificity of the PAE-RT-qLAMP kit for rapid detection of RsPV1, an emerging viral pathogen of Codonopsis ginseng To analyze the specificity of the PAE-RT-qLAMP kit to detect the emerging viral pathogen RsPV1 in Chinese ginseng, we tested the Apple latent spherical virus ALSV and LycMoV infecting Chinese angelica, the Lily latent virus LSV infecting lilies, the Cucumber mosaic virus CMV, and the Lily mottle virus LMoV infecting lilies, the Taro mosaic virus KoMV infecting Chinese angelica, and the Radish partitivirus 1 infecting Chinese ginseng. Leaves infected with seven plant viruses, including RsPV1, were used as samples. Crude and concentrated extracts of infected tissue were prepared by grinding with phosphate buffered saline (PBS). RT-qLAMP amplification was performed using the PAE-RT-qLAMP detection system and method described in the previous example. The amplification reaction was carried out at 60°C for 60 minutes, followed by denaturation at 80°C for 5 minutes to terminate the reaction. After amplification was completed, the fluorescent signal was detected using a real-time fluorescent PCR thermal cycler. Nuclease-free H2O was used as the blank control, and healthy Codonopsis ginseng leaves were used as the negative control. The experiment was repeated three times.
[0142] As shown in Figure 7, the fluorescent signal observation results showed that only the RsPV1-infected Codonopsis ginseng leaves amplified the fluorescent curve, while no obvious fluorescent signals were detected in the amplification products of other infected leaves, the blank control, or healthy Codonopsis ginseng leaves. This indicated that the PAE-RT-qLAMP method established in this invention has high specificity for Codonopsis ginseng RsPV1 virus and does not cross-react with other common Chinese herbal medicine viruses.
[0143] For comparative detection, leaves infected with the seven plant viruses mentioned above were used as samples. These were ground with phosphate buffered saline (PBS) to obtain crude extracts and concentrates of the infected tissues. RT reactions were performed to synthesize the first strand of cDNA according to the detection system and method described in Example 3 above, followed by a standard LAMP color reaction. The reaction process involved amplification at 64°C for 60 minutes, followed by denaturation at 80°C for 5 minutes. After amplification was complete, the PCR tubes were centrifuged or gently shaken without opening the lids. The Cyber Green I fluorescent dye on the inner wall of the PCR tube lid was mixed with the LAMP amplified product, and the tubes were then mixed upside down. The color change of the mixture in the PCR tubes was observed with the naked eye under natural light. Nuclease-free H2O was used as the blank control, and healthy Codonopsis ginseng leaves were used as the negative control. The experiment was repeated three times.
[0144] The color development results were observed with the naked eye under natural light. As shown in Figure 8, only the sample mixture from RsPV1-infected Codonopsis ginseng leaves turned green, while the amplification products from other infectious leaves, the blank control, and healthy Codonopsis ginseng leaves were all orange. This indicates that the PAE-RT-LAMP method established in this invention has high specificity for Codonopsis ginseng RsPV1 virus and does not cross-react with other common Chinese medicinal material viruses.
[0145] The above results indicated that the two detection methods, PAE-RT-qLAMP and PAE-RT-LAMP, showed complete agreement in detecting specificity for the Codonopsis ginseng RsPV1 virus. [Experimental Example 4]
[0146] Sensitivity of the PAE-RT-qLAMP kit for rapid detection of RsPV1, an emerging viral pathogen of Codonopsis ginseng
[0147] To evaluate the sensitivity of the PAE-RT-qLAMP kit for quantitative detection of RsPV1 viral pathogens, cDNA from the RsPV1-infected leaves of Codonopsis fasciatus (see above) was used as a sample. The cDNA sample was diluted 10-fold with nuclease-free HO and stored at -20°C to serve as a template. After 10-fold dilutions, 1.0 μL of each diluted solution was used as a template. Fluorescent quantitative qLAMP amplification was performed using the qLAMP reaction reagents described in Example 1 above. The amplification reaction was performed at 60°C for 60 minutes, followed by denaturation at 80°C for 5 minutes. After amplification, the fluorescent signal was monitored using a real-time fluorescent PCR thermal cycler. Nuclease-free HO served as a blank control, and healthy Codonopsis fasciatus leaves served as a negative control. The experiment was repeated three times.
[0148] For comparative detection, fluorescent quantitative qPCR amplification (Example 4) and conventional PCR amplification (Example 5) were performed on each diluted solution after dilution at the above 10-fold ratio.
[0149] After the qLAMP reaction was completed, the fluorescent signal detected by the real-time fluorescent PCR thermal cycler was observed. As shown in Figure 9, the PAE-RT-qLAMP reaction sensitivity for the RsPV1-positive leaf sample cDNA was 10 -4 Dilute with.
[0150] After the fluorescent quantitative qPCR reaction was completed, the fluorescent signal detected by the real-time fluorescent PCR device was observed. As shown in Figure 10, the PAE-RT-qPCR reaction sensitivity for the C. ginseng RsPV1-positive sample cDNA was also 10 -4The melting curve analysis showed that the melting temperature of the RsPV1 target product was approximately 84°C, as shown in Figure 11. The amplified product was single, with a specific melting peak, no impurity peaks, and the peak values were relatively consistent, indicating that the PAE-RT-qPCR quantification results were reliable.
[0151] After the PCR reaction was completed, 5 μL of the amplified product was loaded and subjected to agarose gel electrophoresis. As shown in Figure 12, the size of the product was consistent with the expected size (968 bp). The sensitivity of PAE-RT-PCR to the cDNA of the RsPV1-positive leaf sample was 10 -2 is.
[0152] In summary, the sensitivity of PAE-RT-qLAMP to detect RsPV1 in Codonopsis ginseng is the same as that of PAE-RT-qPCR, and both methods are 100-fold more sensitive than PAE-RT-PCR to detect RsPV1-positive sample cDNA. [Experimental Example 5]
[0153] Melting curves for rapid detection of the RsPV1 viral pathogen of Codonopsis ginseng by the PAE-RT-qLAMP kit To quantitatively detect RsPV1 viral pathogens using the PAE-RT-qLAMP kit, cDNA from the RsPV1-infected, positive leaves of Codonopsis ginseng (Example 1) was used as the sample. The cDNA sample was diluted 10-fold with nuclease-free HO and stored at -20°C to serve as the template. After 10-fold dilution, 1.0 μL of each diluted solution was used as the template. Fluorescent quantitative qLAMP amplification was performed with the qLAMP reaction reagent (Example 1). The reaction was amplified at 60°C for 60 minutes, denatured at 80°C for 5 minutes, and then heated to 50-95°C to obtain a melting curve at a rate of 1°C / sec. Nuclease-free HO served as the blank control, and healthy leaves served as the negative control. The experiment was repeated three times.
[0154] After the qLAMP reaction was completed, the fluorescent signal and melting curve detected by a real-time fluorescent PCR thermal cycler were observed. As shown in Figure 13, the original concentration and the 10 1 , 10 2 , 10 3 , 10 4 Each of the diluted cDNA samples produced a single melting peak with a melting temperature of approximately 88°C. 5 and 10 6 The 2x diluted cDNA sample, the blank control of nuclease-free H2O, and the cDNA negative control from healthy leaves all showed no amplified fluorescent signals, indicating that nonspecific products and dimers did not appear in the qLAMP amplification and that the PAE-RT-qLAMP kit was highly reliable for detecting the Codonopsis ginseng RsPV1 viral pathogen. [Experimental Example 6]
[0155] Establishment of a standard curve for quantitative detection of the RsPV1 viral pathogen of Codonopsis ginseng using the PAE-RT-qLAMP kit To accurately quantify the content of RsPV1 viral particles in the sample, the positive standard of RdRp gene of Codonopsis ginseng RsPV1 was used as the sample, and the starting concentration was 100 ng / μL, i.e., 2.49 x 10 10 The RdRp gene positive standard of Codonopsis ginseng RsPV1 was diluted 10-fold with nuclease-free HO and stored at -20°C. Six 10-fold dilutions from the starting concentration were performed. 1.0 μL of each dilution was used as template. Fluorometric qLAMP amplification was performed with the qLAMP reaction reagents described in the previous example. The reaction was amplified at 60°C for 60 minutes, followed by denaturation at 80°C for 5 minutes. Nuclease-free HO was used as a negative control. The experiment was repeated three times.
[0156] After the qLAMP reaction was completed, the fluorescent signal detected by the real-time fluorescent PCR thermal cycler was observed to obtain an amplification curve, as shown in Figure 14. A standard curve was plotted with the logarithm of the copy number on the x-axis and the cycle number of the fluorescent signal baseline (Cycle threshold, Ct value) on the y-axis. The standard curve for PAE-RT-qLAMP of Codonopsis ginseng RsPV1 was obtained, y = -5.770x + 71.379, R 2 =0.98, the curve is 2.49x10 10 -2.49x10 4 The results showed an excellent linear relationship in the range of copies / μL, indicating that the RsPV1 viral pathogen of Codonopsis ginseng could be accurately quantified. [Experimental Example 7]
[0157] PAE-RT-qLAMP kit detects laboratory-detoxified and field-derived Codonopsis ginseng samples Samples of leaves, seeds, etc. from laboratory-detoxified or field-derived Codonopsis glabra were taken and polished with phosphate buffer solution (PBS). After that, they were filtered, purified, and concentrated according to the PAE method in Example 2 above to obtain a concentrated solution of infected tissue. RT-qLAMP amplification was performed using the PAE-RT-qLAMP detection system in Example 2 above. Nuclease-free H2O was used as the negative control, and a positive control of the RdRp gene of Codonopsis glabra RsPV1 diluted 10 times was used as the positive control. The experiment was repeated three times, and after amplification was completed, the fluorescent signal in the PCR tube was observed using a real-time fluorescent PCR thermal cycler.
[0158] If a clear fluorescent signal is detected in the sample PCR tube, this indicates a positive result and that the sample contains the Codonopsis ginseng RsPV1 virus.
[0159] If no obvious fluorescent signal is detected in the sample PCR tube, this means a negative result, indicating that the sample does not contain the Codonopsis RsPV1 virus.
[0160] Preferably, to detect the content of RsPV1 virus in a sample, a positive standard of the RdRp gene of RsPV1 from Codonopsis ginseng diluted 10-fold should be simultaneously amplified, a standard curve should be drawn, the Ct value of the sample amplification should be detected, and the standard curve should be aligned to quantitatively obtain the copy number of RsPV1 virus in the test sample.
[0161] Preferably, if experimental equipment such as a real-time fluorescent PCR thermal cycler is not available, a conventional RT-LAMP color reaction is performed using the PAE-RT-LAMP detection system described in Example 2 above. After the LAMP reaction is completed, the PCR tube is centrifuged or gently shaken without opening the lid to mix the Cyber Green I fluorescent dye on the inner wall of the PCR tube lid with the LAMP amplified product, and then mixed upside down. The color change of the mixture in the PCR tube is observed with the naked eye under natural light.
[0162] If the mixture turns green, this is a positive reaction, indicating that the test sample contains the Codonopsis ginseng RsPV1 virus.
[0163] If the mixture is orange, it is a negative reaction, indicating that the sample does not contain the Codonopsis RsPV1 virus.
[0164] The above description is only a preferred embodiment of the present invention, and is not intended to limit the present invention to those skilled in the art. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.
Claims
1. A combination of LAMP nucleic acids for investigating Raphanus sativus partitivirus 1 in Raphanus sativus, comprising a LAMP forward outer primer F3 shown in SEQ ID NO: 2, a LAMP reverse outer primer B3 shown in SEQ ID NO: 3, a LAMP forward inner primer FIP shown in SEQ ID NO: 4, a LAMP reverse inner primer BIP shown in SEQ ID NO: 5, a LAMP forward loop primer LF shown in SEQ ID NO: 6, and a LAMP forward loop primer LB shown in SEQ ID NO:
7.
2. The LAMP nucleic acid combination for detecting Raphanus sativus partitivirus 1 in Codonopsis chinensis according to claim 1, characterized in that the LAMP nucleic acid combination further comprises a reverse transcription primer.
3. The LAMP nucleic acid combination for detecting Raphanus sativus partitivirus 1 in Codonopsis gracilis according to claim 2, wherein the reverse transcription primer is set forth in SEQ ID NO:
1.
4. A nucleic acid combination for detecting Diacompartitivirus 1 in Codonopsis crotonin, characterized by comprising an upstream primer shown in SEQ ID NO: 8 and a downstream primer shown in SEQ ID NO:
9.
5. The nucleic acid combination for detecting Dicompartitivirus 1 in Codonopsis crotoninus according to claim 4, characterized in that the nucleic acid combination further comprises a reverse transcription primer.
6. The nucleic acid combination for detecting Dicompartitivirus 1 in Codonopsis crotoninus according to claim 5, characterized in that the reverse transcription primer is set forth in SEQ ID NO:
1.
7. A nucleic acid combination for detecting Diacomppartitivirus 1 in Codonopsis crotonin, characterized by comprising an upstream primer shown in SEQ ID NO: 10 and a downstream primer shown in SEQ ID NO:
11.
8. The nucleic acid combination for detecting Dicompartitivirus 1 in Codonopsis crotoninus according to claim 7, characterized in that the nucleic acid combination further comprises a reverse transcription primer.
9. The nucleic acid combination for detecting Dicompartitivirus 1 in Codonopsis crotoninus according to claim 8, characterized in that the reverse transcription primer is set forth in SEQ ID NO:
1.
10. A product comprising at least one combination of nucleic acids, the combination of LAMP nucleic acids for detecting Dicompartitivirus 1 in Colocynthia crocephala according to any one of claims 1 to 3, the combination of nucleic acids for detecting Dicompartitivirus 1 in Colocynthia crocephala according to any one of claims 4 to 6, or the combination of nucleic acids for detecting Dicompartitivirus 1 in Colocynthia crocephala according to any one of claims 7 to 9, wherein the product is a reagent, a kit, or a chip. A product for detecting radicpartitivirus 1 in rhododendron amurense, characterized in that
11. 11. The article of manufacture of claim 10, further comprising a reverse transcription reagent, the reverse transcription reagent comprising a reverse transcriptase, a reverse transcriptase buffer, an RNase inhibitor, a dNTP mix, and water.
12. 12. The product of claim 11, wherein when the product is used to amplify LAMP, the product further comprises a LAMP amplification reagent, and the LAMP amplification reagent comprises dNTPs, ThermoPol reaction buffer, Mg ions, DNA polymerase, LAMP fluorescent dye, and water.
13. 12. The product of claim 11, wherein when the product is used to perform a fluorescent quantitative qPCR reaction, the product further comprises a qPCR fluorescent dye and a fluorescent quantitative PCR reaction premix.
14. 12. The product of claim 11, wherein when said product is used in a PCR reaction, said product further comprises a PCR reaction premix.
15. 15. The article of manufacture of claim 14, wherein the PCR reaction premix further comprises a DNA polymerase, a PCR buffer, a dNTP mix, and water.
16. 11. The product of claim 10, wherein the product further comprises a positive control and a negative control.
17. 17. The product of claim 16, wherein the positive control is the RdRp gene of Codonopsis radix compartitivirus 1.
18. The product of claim 10, further comprising a physical adsorption / accumulation device for tissue separation of the test sample, the physical adsorption / accumulation device comprising a filter and an ultrafiltration tube, the filter being provided with a hydrophilic membrane filter.
19. A method for detecting Diacomppartitivirus 1 in Coprinus gracilis, characterized by comprising the steps of: subjecting a test sample to a reverse transcription reaction using a reverse transcription primer in a combination of LAMP nucleic acids described in any one of claims 2 to 3 or a product described in any one of claims 11 to 18 to obtain cDNA; and then subjecting the cDNA to a LAMP reaction using a combination of LAMP nucleic acids described in any one of claims 1 to 3 under reaction conditions of 56 to 70°C for 30 to 100 minutes and 80°C for 5 to 10 minutes.
20. The method for detecting Diacompartitivirus 1 in Coprinus gracilis according to claim 19, characterized in that the LAMP reaction is carried out under conditions of 60 to 64°C for 30 to 100 minutes and 80°C for 5 to 10 minutes.
21. The method for detecting Diacomppartitivirus 1 in Codonopsis crotoninus according to claim 19, characterized in that the LAMP reaction system comprises a LAMP reverse outer primer B3 having a final concentration of 0.2-0.4 μM, a LAMP forward outer primer F3 having a final concentration of 0.2-0.4 μM, a LAMP forward inner primer FIP having a final concentration of 1.5-1.7 μM, a LAMP reverse inner primer BIP having a final concentration of 1.5-1.7 μM, a LAMP forward loop primer LF having a final concentration of 0.3-0.5 μM, and a LAMP forward loop primer LB having a final concentration of 0.3-0.5 μM.
22. The method for detecting Diacompartitivirus 1 in Codonopsis crotoninus according to claim 21, characterized in that the LAMP reaction system further comprises Mg ions at a final concentration of 8.0 to 12.5 mM, dNTPs at a final concentration of 1.4 to 2.8 mM, and DNA polymerase at a final concentration of 0.32 to 0.64 U.
23. The method for detecting Dicompartitivirus 1 in Coleoptera crotalaria, described in claim 19, further comprises preparing a test sample before performing a reverse transcription reaction, wherein the test sample is prepared by crudely extracting the test Coleoptera crotalaria material with a tissue extract, filtering the sample through a filter, transferring the collected filtrate to an ultrafiltration tube for concentration, culturing, and washing.
24. The method for detecting Diacompartitivirus 1 in Codonopsis crotoninus according to claim 23, characterized in that the washed test sample is subjected to an initial denaturation and then used for reverse transcription, and the initial denaturation conditions are 85 to 95°C for 1 to 5 minutes in an ice bath.
25. (1) A method for detecting an amplified product by reverse transcription of a test sample using a reverse transcription primer in the nucleic acid combination according to any one of claims 4 to 6 or the product according to any one of claims 11 to 18 to obtain cDNA, and then amplifying the cDNA using the upstream primer and downstream primer in the nucleic acid combination according to any one of claims 4 to 6 using qPCR. (2) A method for PCR amplification of a test sample using a reverse transcription primer in the nucleic acid combination according to any one of claims 7 to 9 or the product according to any one of claims 11 to 18 to obtain cDNA, and then using an upstream primer and a downstream primer in the nucleic acid combination according to any one of claims 7 to 9, A method for detecting Diacompartitivirus 1 in Codonopsis gracilis, comprising:
26. The method for detecting Diacompartitivirus 1 in Codonopsis crotoninus according to claim 25, characterized in that the qPCR reaction conditions are 30 to 40 cycles of amplification at 95°C for 30 seconds, 95°C for 5 seconds, and 60°C for 34 seconds.
27. The method for detecting Diacompartitivirus 1 in Codonopsis crotoninus according to claim 26, characterized in that the qPCR reaction system contains an upstream primer with a final concentration of 0.2 to 0.7 μM and a downstream primer with a final concentration of 0.2 to 0.7 μM.
28. The method for detecting Diacompartitivirus 1 in Codonopsis crotoninus according to claim 26, characterized in that the PCR reaction conditions are 95°C for 3 to 5 minutes, 95°C for 5 seconds, 54°C for 30 seconds, and 70 to 72°C for 45 seconds, with 30 to 40 cycles of amplification.
29. The method for detecting Diacompartitivirus 1 in Codonopsis crotoninus according to claim 26, characterized in that the PCR reaction system comprises 0.2-1.0 μM of an upstream primer and 0.2-1.0 μM of a downstream primer.
30. Use of a combination of LAMP nucleic acids for detecting Dicompartitivirus 1 in siberian ginseng described in any one of claims 1 to 3, a combination of nucleic acids for detecting Dicompartitivirus 1 in siberian ginseng described in any one of claims 4 to 6, or a combination of nucleic acids for detecting Dicompartitivirus 1 in siberian ginseng described in any one of claims 7 to 9 for detecting Dicompartitivirus 1 in siberian ginseng.
31. Use of the product according to claim 10 for detecting Diacomppartitivirus 1 in Codonopsis ginseng.
Citation Information
Patent Citations
Reagent set and method for detecting four alfalfa RNA viruses
CN112680441A
Method of manufacturing a blood sensor
KR1020250125220A
Compositions and methods comprising viral reverse transcriptase
US20200157513A1