Method, DNA marker, and kit for identifying variety or production area of plant or animal
The PODiR sequence-based method addresses the challenge of identifying crop varieties and origins by detecting precise mutations in genomic DNA, facilitating easy and accurate identification.
Patent Information
- Application Number
- JP2024065774
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-04-15
- Publication Date
- 2025-10-27
AI Technical Summary
Existing methods for identifying the variety or origin of agricultural crops and processed foods are not suitable when the target region of detection is prone to change or unknown, requiring significant effort to determine the target region.
Utilizing mutations in the Partly Overlapped Direct Repeat (PODiR) sequence, a self-genome editing region, to detect mutations in genomic DNA for accurate identification of variety or origin through PCR amplification and electrophoresis or sequencing.
Enables easy and highly accurate identification of the variety or origin of animals and plants, applicable to both known and newly determined genome sequences, with mutations occurring at low frequency and precision.
Smart Images

Figure 2025162458000001 
Figure 2025162458000002 
Figure 2025162458000003
Abstract
Description
[Technical Field]
[0001] The present invention relates to a method for identifying varieties or origins using mutations in the Partly Overlapped Direct Repeat (PODiR) sequence, which is a self-genome editing region, as an indicator, as well as DNA markers for use in the method and kits containing the DNA markers. [Background technology]
[0002] In recent years, consumer interest in food safety and fraudulent labeling has increased, making it an important issue to establish technology that can accurately identify the varieties and origins of ingredients contained in agricultural products and processed foods. In Japan in particular, the illegal export of high-quality cultivated agricultural products overseas and the false labeling of origins have become problems, and there is a demand for methods to easily identify specific varieties or origins.
[0003] Although it is possible to identify the variety and origin of agricultural crops based on appearance, taste, growth characteristics, etc., agricultural crops, particularly registered varieties, are generally cloned and sold, and therefore their genomes are considered to be largely identical, so in recent years, methods using genome sequence analysis have been used to identify the variety and origin of agricultural crops. Known methods using genome sequence analysis include a method for determining the identity and kinship of organisms based on DNA length polymorphisms (Patent Document 1), a method for identifying rice varieties using hybridization between capture oligonucleotides and nucleic acids derived from a test rice sample as an indicator (Patent Document 2), and a method for identifying varieties using SNP detection (Non-Patent Document 1).
[0004] Technological advances have made it possible to perform genome sequence analysis cheaply and quickly. However, when the target region of detection is prone to change, it is not suitable as an indicator for identifying the variety or origin of raw materials contained in agricultural crops or processed foods. Furthermore, when the target region of detection is unknown, determining the target region requires a great deal of effort. These problems remain. [Prior art documents] [Patent documents]
[0005] [Patent Document 1] Special Publication No. 4-501207 [Patent Document 2] Japanese Patent Application Laid-Open No. 2006-158253 [Non-patent literature]
[0006] [Non-Patent Document 1] Breeding Science 70:363-372(2020) Summary of the Invention [Problem to be solved by the invention]
[0007] The problem to be solved by the present invention is to provide a method for easily and highly accurately identifying the variety or place of origin of an animal or plant. [Means for solving the problem]
[0008] As a result of extensive research into the genome analysis of animals and plants, the present inventors have made the surprising discovery that mutations in the PODiR sequence, which is the self-genome editing region, occur at extremely low frequency and precisely, and that the location of mutations in the PODiR sequence varies depending on the variety or place of origin of the animal or plant, and have thus completed the present invention.
[0009] The present invention is as follows. [1] A method for identifying the variety or origin of an animal or plant, comprising: detecting mutations from one or more base sequences of a first formula: XYXYX (wherein X represents a different base sequence having four or more bases, and Y represents a different base sequence having two or more bases, provided that the last X is not immediately followed by Y, and the first X is not immediately followed by Y), to one or more corresponding base sequences of a second formula: XYX, in the genomic DNA of a target animal or plant and / or the genomic DNA of an animal or plant whose variety or place of origin is known; Identifying the variety or geographical location of the target animal or plant based on the location of one or more mutations in the genomic DNA of the target animal or plant and / or the genomic DNA of an animal or plant whose variety or geographical location is known; A method comprising: [2] The method according to 1, wherein the position of the mutation in the genomic DNA of the target animal or plant is identified by comparing the size of the base sequence of the first formula: XYXYX in the genomic DNA of the animal or plant whose variety or geographical origin is known with the size of the corresponding base sequence of the second formula: XYX in the genomic DNA of the target animal or plant, and the position of the mutation in the genomic DNA of the animal or plant whose variety or geographical origin is known is identified by comparing the size of the base sequence of the first formula: XYXYX in the genomic DNA of the target animal or plant with the size of the corresponding base sequence of the second formula: XYX in the genomic DNA of the animal or plant whose variety or geographical origin is known. [3] The method according to 1, wherein the number of bases of X is 4 to 1,000, and the number of bases of Y is 2 to 1,000. [4] The method according to 1, wherein the method comprises a step of amplifying, by polymerase chain reaction, a base sequence of the first formula: XYXYX or a base sequence of the second formula: XYX in the genomic DNA of the target animal or plant, and / or a base sequence of the first formula: XYXYX or a base sequence of the second formula: XYX in the genomic DNA of the animal or plant whose variety or place of origin is known. [5] The method of claim 1, wherein the method is performed by electrophoresis, Sanger sequencing, next-generation sequencing, or microarray. [6] The method of claim 5, wherein the method is performed by gel electrophoresis. [7] The method according to any one of 1 to 6, wherein the plant or animal is rice. [8] A DNA marker containing a nucleic acid containing a base sequence of XYXYX (wherein X represents a different base sequence of four or more bases, and Y represents a different base sequence of two or more bases, provided that the last X is not immediately followed by Y, and the first X is not immediately followed by Y) in the genomic DNA of an animal or plant whose variety or place of origin is known, or a base sequence of the second formula: XYX. [9] A kit for identifying the variety or origin of an animal or plant, comprising the DNA marker described in 8. [Effects of the Invention]
[0010] The present invention makes it possible to easily and highly accurately identify the variety or origin of an animal or plant based on the mutation pattern of the PODiR sequence in the genomic DNA, not only for animals and plants whose genome sequences are already known, but also for animals and plants whose genome sequences are to be newly determined. [Brief explanation of the drawings]
[0011] [Figure 1] The region containing one of the PODiR sequences present on rice chromosome 5 (CH05) is shown. [Figure 2] The region containing one of the PODiR sequences present on rice chromosome 12 (CH12) is shown. [Figure 3-1] The distribution of the length of the X sequence in the PODiR sequence present on chromosome 5 of rice (Nipponbare) is shown. [Figure 3-2] The distribution of the length of the Y sequence of the PODiR sequence present on chromosome 5 of rice (Nipponbare) is shown. [Figure 4-1] The distribution of the length of the X sequence in the PODiR sequence present on chromosome 12 of rice (Nipponbare) is shown. [Figure 4-2] The distribution of the length of the Y sequence of the PODiR sequence present on chromosome 12 of rice (Nipponbare) is shown. [Figure 5]The figure shows the frequency of occurrence of "XYXYX" (where the number of bases in X is 4 or more and the number of bases in Y is 2 or more) in each chromosome of four varieties of rice (Nipponbare, Kitaake, Koshihikari, and Indica). [Figure 6] Electrophoresis of CH05 (left) and CH12 (right) from three rice varieties (Nipponbare, Kitaake, and Indica rice) is shown. [Figure 7] Electrophoresis of CH12 (right) of mixed rice of Nipponbare and various proportions of Indica rice (0%, 20%, 40%, 60%, 80% or 100%) is shown.
[0012] The present invention is based on the surprising finding that mutation patterns in PODiR sequences are specific to the variety or geographical origin of an animal or plant. A PODiR sequence is a sequence in which two sequences, XYX and XYX, overlap at X, and is represented by the general formula: XYXYX (hereinafter, also referred to as "overlapping direct repeats"). In the formula, X represents a different base sequence of 4 or more bases, typically 4 to 1000, preferably 5 to 500, and optimally 6 to 250, and Y represents a different base sequence of 2 or more bases, typically 2 to 1000, preferably 2 to 500, and optimally 2 to 250, provided that the last X is not immediately followed by Y, and the first X is not immediately followed by Y. In this regard, Figures 3-1 and 3-2 and Figures 4-1 and 4-2 show the "number of X bases" and the "frequency of occurrence of XYXYX" including X, and the "number of Y bases" and the "frequency of occurrence of XYXYX" including Y, for chromosomes 5 and 12 of rice (Nipponbare), respectively. Figure 5 shows the frequency of occurrence of "XYXYX" (where the number of X bases is 4 or more and the number of Y bases is 2 or more) in each chromosome of four rice varieties (Nipponbare, Kitaake, Koshihikari, and Indica).
[0013] In this way, non-overlapping sequences (XY) are deleted from the PODiR sequence (XYXYX), resulting in the mutated sequence (XYX). Although mutations in PODiR sequences occur very precisely and at low frequency, they always occur somewhere and are present at thousands to tens of thousands of locations in the genomic DNA of animals and plants. Therefore, the combinations of non-deleted and deleted sequences (XY) in the genomic DNA of animals and plants (i.e., the mutation pattern of the PODiR sequence) vary depending on the variety and geographical origin, and can be said to be specific to the variety or geographical origin of the animal or plant.
[0014] Therefore, in the genomic DNA of a target animal or plant, and / or the genomic DNA of an animal or plant whose variety or geographical origin is known, one or more mutations from a base sequence of a first formula: XYXYX (wherein X represents a different base sequence of 4 or more bases, typically 4 to 1000, preferably 5 to 500, and optimally 6 to 250, and Y represents a different base sequence of 2 or more bases, typically 2 to 1000, preferably 2 to 500, and optimally 2 to 250, provided that the last X is not immediately followed by Y, and the first X is not immediately preceded by Y) to one or more corresponding base sequences of a second formula: XYX are detected, and the variety or geographical origin of the target animal or plant can be identified by using the positions of the one or more mutations in the genomic DNA of the target animal or plant, and / or the genomic DNA of an animal or plant whose variety or geographical origin is known as an index.
[0015] As used herein, the term "target animal or plant" refers to an animal and / or plant that is the target of the method of the present invention. The target animals of the present invention are not particularly limited, and examples thereof include dogs, cats, rabbits, horses, cows, pigs, sheep, goats, poultry, and fish. The target plants of the present invention are also not particularly limited, and examples thereof include plants of the Poaceae, Fabaceae, Brassicaceae, Asteraceae, Solanaceae, Rosaceae, Cucurbitaceae, and Convolvulaceae families. Preferred plants include, for example, rice, alfalfa, barley, kidney beans, canola, cowpeas, cotton, corn, clover, lotus, lentils, lupine, millet, oats, peas, peanuts, rye, sweet clover, sunflower, sweet pea, soybean, sorghum, triticale, jicama, velvet bean, broad bean, wheat, wisteria, nut plants, Arabidopsis thaliana, bedweed, leek, snapdragon, honeywort, peanut, asparagus, scutellaria, oat, bamboo shoots, rapeseed, brome grass, bluebell, camellia, hemp, chili pepper, chickpea, chrysanthemum vulgare, chrysanthemum japonica, citrus, coffee tree, Job's tears, cucumber, Examples of suitable plants include pumpkin, larkspur, orchard grass, Datura stramonium, foxglove, dioscorea, oil palm, Zoysia japonica, fescue, strawberry, owl grass, soybean, sunflower, day lily, rubber tree, henbane, sweet potato, lettuce, lentil, lily, flax, ryegrass, lotus, tomato, marjoram, apple, mango, potato tree, alfalfa, African buttercup, tobacco, sainfoin, pelargonium, Japanese laurel, morning glory, Timothy grass, strawberry vine, cherry blossom, buttercup, radish, gooseberry, castor bean, brambleberry, sugarcane, salmenba, senecio, setaria, white mustard, eggplant, sorghum, lawn grass, cacao, sycamore, bellflower, and grapes.
[0016] When analyzing the location of mutations in PODiR sequences, DNA is typically extracted from the target animal or plant whose variety or place of origin is to be identified, and the extracted DNA is used as a sample. DNA can be extracted from any part of the animal or plant as long as DNA can be obtained, for example, from roots, seeds, leaves, stems, young animals or plants (seed rings), etc. Furthermore, harvested seeds (grains) and processed products thereof can also be used as parts of the animal or plant.
[0017] The DNA extraction method is not particularly limited and conventional methods in the art can be used. For example, a method of crushing seeds and solubilizing them with a surfactant or deproteinizing them with a deproteinizing agent to obtain DNA can be used. In the case of seeds that contain a large amount of oil, a degreasing step using an organic solvent may be further included. When obtaining DNA from processed products, it is preferable to perform a conventional extraction procedure after steps such as washing and degreasing. When extracting DNA from seeds, crudely purified DNA may be used.
[0018] In the method of the present invention, the position of the mutation in the genomic DNA of the target animal or plant is identified by comparing the size of the base sequence of the first formula: XYXYX in the genomic DNA of the animal or plant whose variety or geographical origin is known with the size of the corresponding base sequence of the second formula: XYX in the genomic DNA of the target animal or plant, and the position of the mutation in the genomic DNA of the target animal or plant whose variety or geographical origin is known can be identified by comparing the size of the base sequence of the first formula: XYXYX in the genomic DNA of the target animal or plant with the size of the corresponding base sequence of the second formula: XYX in the genomic DNA of the animal or plant whose variety or geographical origin is known.
[0019] The method of the present invention preferably comprises the step of amplifying, by polymerase chain reaction (PCR), a base sequence of the first formula: XYXYX or a base sequence of the second formula: XYX in the genomic DNA of the target animal or plant, and / or a base sequence of the first formula: XYXYX or a base sequence of the second formula: XYX in the genomic DNA of the animal or plant whose variety or place of origin is known.
[0020] For PCR amplification, a primer set capable of amplifying a region containing a base sequence of the first formula: XYXYX or a base sequence of the second formula: XYX in the genomic DNA of the target animal or plant, and / or a base sequence of the first formula: XYXYX or a base sequence of the second formula: XYX in the genomic DNA of the animal or plant whose variety or place of origin is known, is appropriately selected and used. The primers are preferably designed based on a specific sequence of the region. The length of the primers can be set to, for example, 10 bp or more, preferably about 18 to 30 bp. Such primer design can be performed by conventional techniques in the art. For example, if the target plant or animal is rice, a primer set consisting of Rice nip ch05_2 (TTGTGATCTCTACAATGTATAACGC) (SEQ ID NO: 3) and Rice nip ch05_3 (CTCACCMTCGTTCTGTGGAGG:M=A / C) (SEQ ID NO: 4) can be used to amplify "ch05" (a region containing the PODiR sequence on chromosome 5 shown in Figure 1), and a primer set consisting of Rice nip ch12_1 (ATSGAGCAGCGAAGGACATAGC:S=C / G) (SEQ ID NO: 5) and Rice nip ch12_2 (ATCTGCCGTGCATGCTCTTAGC) (SEQ ID NO: 6) can be used to amplify "ch12" (a region containing the PODiR sequence on chromosome 12 shown in Figure 2).
[0021] In the method of the present invention, the amplified DNA fragments can be analyzed by, for example, electrophoresis, Sanger sequencing, next-generation sequencing, or microarrays, with gel electrophoresis being preferred. These detection methods are conventional in the art, and examples of electrophoresis include agarose gel electrophoresis, denaturing or non-denaturing acrylamide gel electrophoresis, and capillary electrophoresis. When gel electrophoresis is used, the length of the amplified fragments from each sample is analyzed using the gel after electrophoresis. Examples of analysis methods include a labeling method using pre-labeled primers for PCR, the ethidium bromide method, and silver staining. Among these, labeling methods are preferred, and fluorescent dyes, radioactive substances, etc. are used as labeling substances. Labeling methods using fluorescent dyes are particularly preferred, and fluorescent dyes can be selected from known dyes. Different fluorescent dyes can also be used in combination depending on the primers. In the labeling method, the 5' end of one of the primers used in PCR is pre-labeled with a fluorescent dye before the reaction, thereby introducing the fluorescent dye into the resulting amplification product. Such primers can be synthesized by known chemical synthesis methods, etc. By using primers, the length of the amplified fragment can be analyzed based on fluorescence after electrophoresis. When capillary electrophoresis is used, a method suitable for the device used can be selected as appropriate, and for example, a labeling method using fluorescence is preferably used.
[0022] In the method of the present invention, the positions of one or more mutations in the genomic DNA of an animal or plant whose variety or geographical origin is known can be determined using a DNA marker containing a base sequence of XYXYX (wherein X represents a different base sequence of 4 or more bases, and Y represents a different base sequence of 2 or more bases, provided that the last X is not immediately followed by Y, and the first X is not immediately followed by Y) in the genomic DNA of the animal or plant, or a nucleic acid containing a base sequence of the second formula: XYX, or a kit for identifying the variety or geographical origin of an animal or plant that contains such a DNA marker.
[0023] Alternatively, in the method of the present invention, the positions of one or more mutations in the genomic DNA of an animal or plant whose variety or place of origin is known may be determined by referring to a database that stores information on the mutation pattern of the PODiR sequence of the animal or plant, for example, the position and size of the base sequence of the first formula: XYXYX or the base sequence of the second formula: XYX in the genomic DNA of the animal or plant.
[0024] In the PODiR system, only the sequence (XY) is precisely deleted. Therefore, in the present invention, by comparing the sizes of two types of PODiR sequences in the genomic DNA of animals and plants, one in which the sequence (XY) is not deleted and the other in which it is deleted (i.e., the base sequence of the first formula: XYXYX and the base sequence of the second formula: XYX), it becomes possible to quickly and easily identify the variety or place of origin of animals and plants.
[0025] Furthermore, since the PODiR sequence (XYXYX) used in the method of the present invention exists at a limited location and the sequence (XYX) after mutation is predictable, it is very easy to determine the location in genomic DNA to be used for identifying the variety or geographical origin of an animal or plant. Furthermore, since mutation of the PODiR sequence is extremely rare, once the location in genomic DNA to be used for identifying the variety or geographical origin of an animal or plant is determined, it can be used for many years.
[0026] In the method of the present invention, the variety or place of origin of the target animal or plant can also be automatically determined by analyzing image data (e.g., gel electrophoresis image data) that shows information regarding the location of mutations in the genomic DNA of the target animal or plant via a public network (typically the Internet) or an application, etc.
[0027] The present invention will be specifically described below with reference to examples. Example 1
[0028] [Example 1. Identification of varieties based on PODiR sequences] Template (genomic DNA) was prepared from the roots of three rice varieties (Nipponbare, Kitaake, and Indica rice) using NucleoSpin Plant II (MACHEREY-NAGEL). Approximately 10 ng of each prepared template DNA was mixed with 3 pmol of each primer (6 pmol total) of the primer set Rice nip ch05_2 (TTGTGATCTCTACAATGTATAACGC) (SEQ ID NO: 3) and Rice nip ch05_3 (CTCACCMTCGTTCTGTGGAGG:M=A / C) (SEQ ID NO: 4) or the primer set Rice nip ch12_1 (ATSGAGCAGCGAAGGACATAGC:S=C / G) (SEQ ID NO: 5) and Rice nip ch12_2 (ATCTGCCGTGCATGCTCTTAGC) (SEQ ID NO: 6), which amplify "ch05" (a region containing the PODiR sequence present on chromosome 5 shown in Figure 1; SEQ ID NO: 1) or "ch12" (a region containing the PODiR sequence present on chromosome 12 shown in Figure 2; SEQ ID NO: 2), respectively, to a final volume of 10 μL, and the mixture was diluted with MightyAmp DNA PCR. Polymerase Ver. 3 (Takara Bio Inc.) was used to amplify the region containing XYXYX in the target region "ch05" or "ch12." Note that in the region of ch05, only indica rice lacks the XY region, resulting in XYX. While the amplification of 515 bp of XYXYX is expected, a theoretical amplification of 481 bp is expected. Furthermore, in the region of ch12, both Kitaake and indica rice lack the XY region, resulting in XYX. While the amplification of 480 bp of XYXYX is expected, a theoretical amplification of 444 bp is expected. After denaturation at 98°C for 2 minutes, 30 cycles of extension reaction at 98°C for 10 seconds and 68°C for 55 seconds were carried out, followed by treatment at 70°C for 10 minutes and incubation at 4°C to amplify the region. 2.5 μL of the amplified samples of Nipponbare, Kitaake, and Indica rice was applied to 2% agarose and subjected to electrophoresis. After electrophoresis, the agarose was stained and DNA bands were detected using a ChemiDoc Imaging System (BIORAD) (Figure 6). This confirmed that ch05_X1 and ch05_Y1 shown in Figure 1 were deleted in ch05 of indica rice, and that X and Y shown in Figure 2 were deleted in ch12 of Kitaake and indica rice.
[0029] [Example 2. Identifying contamination levels based on PODiR sequences] As in Example 1, mixed template DNA was prepared by mixing Nipponbare and Indica rice template DNA in amounts of 0%, 20%, 40%, 60%, 80%, or 100% Indica rice template DNA relative to the Nipponbare template DNA. Approximately 10 ng of this mixed template DNA was mixed with 6 pmol of the Rice nip ch12_1 (ATSGAGCAGCGAAGGACATAGC:S=C / G) (SEQ ID NO: 5) and Rice nip ch12_2 (AT4CTGCCGTGCATGCTCTTAGC) (SEQ ID NO: 6) primer set, each containing 3 pmol of each primer, to amplify ch12, to a final volume of 10 μL. The region containing XYXYX on the target region ch12 was amplified using MightyAmp DNA Polymerase Ver. 3 (Takara Bio Inc.). In addition, in the relevant region of ch12, the DNA fragment amplified from the Indica rice template lacks the XY region, so when Nipponbare is used as template DNA, 480 bp is amplified, whereas 444 bp is expected to be amplified. After denaturation at 98°C for 2 minutes, 30 cycles of extension at 98°C for 10 seconds and 68°C for 55 seconds were performed, followed by treatment at 70°C for 10 minutes and incubation at 4°C to amplify the region. 4 μL of each amplified sample was applied to 2% agarose gel and subjected to electrophoresis. After electrophoresis, the agarose was stained, and DNA bands were detected using a ChemiDoc Imaging System (BIORAD) (Figure 7). This confirmed that not only could it be detected whether or not there was contaminated rice (in this test, indica rice), but also that the amount of contamination could be easily identified based on the thickness of the detected band.
Claims
1. A method for identifying the variety or origin of an animal or plant, comprising: detecting mutations from one or more base sequences of a first formula: X-Y-X-Y-X (wherein X represents a different base sequence having four or more bases, and Y represents a different base sequence having two or more bases, provided that the last X is not immediately followed by Y, and the first X is not immediately followed by Y), to one or more corresponding base sequences of a second formula: X-Y-X, in the genomic DNA of a target animal or plant and / or the genomic DNA of an animal or plant whose variety or place of origin is known; Identifying the variety or geographical location of the target animal or plant based on the location of one or more mutations in the genomic DNA of the target animal or plant and / or the genomic DNA of an animal or plant whose variety or geographical location is known; A method comprising:
2. 2. The method of claim 1, wherein the position of the mutation in the genomic DNA of the target animal or plant is identified by comparing the size of the base sequence of the first formula: X-Y-X-Y-X in the genomic DNA of the animal or plant whose variety or geographical origin is known with the size of the corresponding base sequence of the second formula: X-Y-X in the genomic DNA of the target animal or plant, and the position of the mutation in the genomic DNA of the animal or plant whose variety or geographical origin is known is identified by comparing the size of the base sequence of the first formula: X-Y-X-Y-X in the genomic DNA of the target animal or plant whose variety or geographical origin is known with the size of the corresponding base sequence of the second formula: X-Y-X in the genomic DNA of the animal or plant whose variety or geographical origin is known.
3. The method according to claim 1, wherein the number of bases of X is 4 to 1000, and the number of bases of Y is 2 to 1000.
4. 2. The method of claim 1, comprising the step of amplifying, by polymerase chain reaction, a base sequence of the first formula: X-Y-X-Y-X or a base sequence of the second formula: X-Y-X in the genomic DNA of the target animal or plant, and / or a base sequence of the first formula: X-Y-X-Y-X or a base sequence of the second formula: X-Y-X in the genomic DNA of the animal or plant whose variety or place of origin is known.
5. 10. The method of claim 1, wherein the method is performed by electrophoresis, Sanger sequencing, next generation sequencing, or microarray.
6. 6. The method of claim 5, wherein the method is performed by gel electrophoresis.
7. The method according to any one of claims 1 to 6, wherein the plant or animal is rice.
8. A DNA marker comprising a base sequence of X-Y-X-Y-X (wherein X represents a different base sequence of 4 or more bases, and Y represents a different base sequence of 2 or more bases, provided that the last X is not immediately followed by Y, and the first X is not immediately followed by Y) in the genomic DNA of an animal or plant whose variety or place of origin is known, or a nucleic acid comprising a base sequence of the second formula: X-Y-X.
9. A kit for identifying the variety or origin of an animal or plant, comprising the DNA marker according to claim 8.
Citation Information
Patent Citations
In a method for analyzing DNA polymorphism region length
JP1992501207A
Equipment for differentiating variety of rice
JP2006158253A