Modulating polymer beads for DNA processing

Polymeric beads with adjustable pores address the challenge of accessing intracellular biomolecules, enabling reliable high-throughput nucleic acid sequencing and library preparation by controlling molecular diffusion and retention.

JP2025175051APending Publication Date: 2025-11-28ILLUMINA INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025147687
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2018-10-26
Filing Date
2025-09-05
Publication Date
2025-11-28

AI Technical Summary

Technical Problem

Existing methods for detecting nucleic acid sequences in biological samples are unreliable due to the difficulty in confining and accessing intracellular biomolecules within a single cell, leading to loss of biomolecules during assay execution.

Method used

The use of polymeric beads with adjustable pores that allow diffusion of reagents while retaining biomolecules, enabling multiple sequential co-assays such as lysis, DNA analysis, and nucleic acid sequencing, by adjusting pore size through changes in charge, pH, or temperature.

Benefits of technology

Enables reliable, high-throughput performance of sequential reactions on encapsulated biomolecules, including nucleic acid sequencing and library preparation, with improved retention and controlled diffusion of molecules.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025175051000001
    Figure 2025175051000001
  • Figure 2025175051000002
    Figure 2025175051000002
  • Figure 2025175051000003
    Figure 2025175051000003
Patent Text Reader

Abstract

To provide modulation of polymer beads for DNA processing.SOLUTION: Systems, methods and compositions provided herein relate to preparation of beads encapsulating biomolecules for performing sequential reactions of the biomolecules. Some embodiments include preparation of nucleic acid reactions within the beads, where the beads include pores that allow diffusion of molecules into or out of the beads while retaining other molecules of interest. In some embodiments, the bead is a porous hydrogel bead or a porous hollow bead. In some embodiments, the bead comprises multiple polymer layers, where each layer has a distinct pore size and pore density. In some embodiments, the pores are modulated in a size on the basis of changes in a charge, a pH, or a temperature.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The systems, methods, and compositions provided herein relate to polymeric beads, methods for encapsulating biomolecules within the polymeric beads, and methods for using the polymeric beads to perform assays on the encapsulated biomolecules, including, for example, spatially indexed sequencing and nucleic acid library preparation. [Background technology]

[0002] The detection of specific nucleic acid sequences present in biological samples is used, for example, as a method for identifying and classifying microorganisms, diagnosing infectious diseases, detecting and characterizing genetic abnormalities, identifying genetic changes associated with various diseases such as cancer, studying genetic susceptibility to disease, or measuring response to various types of treatment. Detecting nucleic acid sequences in biological samples requires multiple enzymatic reactions to ultimately determine the nucleic acid sequence or to generate a nucleic acid library.

[0003] Performing multiple enzymatic reactions on a single cell is unreliable due to the difficulty of confining and accessing intracellular biomolecules within a single cell through multiple assays. Many cell-based assays fail to immobilize intracellular molecules, resulting in loss of biomolecules during assay execution. Summary of the Invention [Means for solving the problem]

[0004] Some embodiments relate to polymeric beads for performing multiple co-assay reactions. In some embodiments, the polymeric beads include hydrogel polymer precursors, crosslinkers, and biomolecules disposed within the polymeric beads, and the beads include pores that allow diffusion of one or more reagents through the beads while retaining the biomolecules. In some embodiments, the beads are porous hydrogel beads or porous hollow beads. In some embodiments, the beads include multiple polymer layers, each layer having a distinct pore size and pore density. In some embodiments, the pores adjust in size based on changes in charge, pH, or temperature.

[0005] Some embodiments relate to methods for performing multiple sequential co-assays on biomolecules encapsulated within polymeric beads. In some embodiments, the method includes obtaining polymeric beads encapsulating biomolecules, the polymeric beads comprising hydrogel polymer precursors, a crosslinker, and biomolecules disposed within the polymeric beads, the beads comprising pores that allow diffusion of one or more reagents through the beads while retaining the biomolecules. In some embodiments, the method further includes sequentially contacting single cells with the reagents to perform the multiple sequential co-assays. In some embodiments, the method further includes adjusting the size of the pores in the polymeric beads by adjusting charge, pH, or temperature. In some embodiments, the polymeric beads comprise multiple polymer layers, each polymer layer having pores of a distinct size. In some embodiments, the pore size of each polymer layer is specifically adjusted by varying charge, pH, or temperature. In some embodiments, the multiple sequential co-assays include lysis, DNA analysis, RNA analysis, protein analysis, tagmentation, nucleic acid amplification, nucleic acid sequencing, DNA library preparation, assay for transposase accessible chromatic using sequencing (ATAC-seq), and sequential preservation. These include contiguity-preserving transposition (CPT-seq), single cell combinatorial indexed sequencing (SCI-seq), or single cell genome amplification, or any combination thereof performed serially. [Brief explanation of the drawings]

[0006] [Figure 1A] FIG. 1 is a schematic diagram showing an embodiment for spatial indexing of long DNA by on-flow cell library preparation and seeding.

[0007] [Figure 1B] Schematic showing spatial indexing using polymer beads encapsulating long DNA molecules. Reagents may be used on the polymer beads to spatially generate libraries on the flow cell surface.

[0008] [Figure 2] FIG. 1 is a flow diagram in which long DNA can be encapsulated within polymer beads, libraries can be prepared within the polymer beads, and then clustered and sequenced on a flow cell device.

[0009] [Figure 3] FIG. 1 is a schematic diagram showing the workflow for DNA sequencing of long DNA encapsulated within polymer beads, including DNA fragments of approximately 100 kb (without a multiple displacement amplification (MDA) step (panel (a)) or with an MDA step before tagmentation (panel (b))) and DNA fragments of approximately 10-20 kb (panel (c)).

[0010] [Figure 4] 10 is a graph showing strobe reads of spatially indexed sequencing data of long DNA hydrogels from a 100 kb DNA fragment containing no MDA.

[0011] [Figure 5] 1 shows a line graph of concatenated reads of spatial indexing of long DNA hydrogels on a 100 kb DNA fragment containing MDA.

[0012] [Figure 6] 1 shows a line graph of concatenated reads of spatial indexing of long DNA hydrogels on a 10 kb DNA fragment containing MDA.

[0013] [Figure 7A] 7A shows a line graph of the spatial read of long DNA encapsulated within polymer beads. Figure 7A shows the spatial read of cells encapsulated within polymer beads, and the inset shows a micrograph showing cells within the polymer beads. [Figure 7B] Figure 7B shows a line graph of the spatial read of long DNA encapsulated within polymer beads, and Figure 7C shows the spatial read of long DNA fragments encapsulated within polymer beads, with the inset showing a micrograph showing the fragments encapsulated within the beads.

[0014] [Figure 8] 1 shows micrographs showing the identification of microbial species encapsulated within polymer beads. The polymer beads encapsulated various microbial species and spatial sequencing reads were performed to identify the microorganisms.

[0015] [Figure 9] 1 shows a graph showing the distribution of barcode reads for long DNA encapsulated within polymer beads.

[0016] [Figure 10A] Figure 1 shows a graph showing short reads and concatenated reads from a single experiment of E. coli cells encapsulated within polymer beads. As shown in the figure, the coverage of concatenated reads is spread across repetitive regions, which can improve de novo sequence assembly. [Figure 10B] 1 shows a photomicrograph showing spatially connected leads and short interstitial leads.

[0017] [Figure 11A] FIG. 1 is a schematic diagram showing the diffusion of molecules into polymer beads based on pore size and pore density. [Figure 11B] FIG. 1 is a schematic diagram showing the diffusion of molecules outside a polymer bead.

[0018] [Figure 12] FIG. 1 is a schematic diagram showing retention of a nucleic acid library within polymer beads.

[0019] [Figure 13A] 1 shows a graph illustrating the diffusion of nucleic acids into polymer beads as a function of nucleic acid size. The graph represents the entrance of small amplicons (220 bp to 1 kbp) into the polymer beads; longer amplicons do not diffuse into the polymer beads. [Figure 13B] 1 shows a graph illustrating the diffusion of nucleic acids into polymer beads as a function of nucleic acid size. The graph represents the entrance of small amplicons (220 bp to 1 kbp) into the polymer beads; longer amplicons do not diffuse into the polymer beads.

[0020] [Figure 14] 1 shows a micrograph of porous hollow beads, demonstrating PCR-based amplification within the porous hollow beads for both 200 base pair and 5000 base pair DNA fragments.

[0021] [Figure 15] 1 shows a schematic diagram illustrating multi-layered polymeric beads, each layer having a different pore size, where the pore size of each layer can be adjusted separately based on changing environmental conditions.

[0022] [Figure 16A]Figure 16A shows polymer beads with a stabilized shell containing a sacrificial polyacrylamide core. Figure 16A shows a schematic diagram of the structure of a polymer bead with a shell of N,N'-(1,2-dihydroxyethylene)bisacrylamide (DHEBA) and acrylate-PEG and potassium peroxodisulfate (KPS). The core is a filler core, such as PEG or polyacrylamide, that is mixed with the sample (cells or DNA). [Figure 16B] Figure 16B shows polymer beads with a stabilized shell comprising a sacrificial polyacrylamide core. Figure 16B shows the formation of a shell around the beads. [Figure 16C] Figure 16C shows a polymeric bead with a stabilized shell comprising a sacrificial polyacrylamide core. Figure 16D shows a micrograph of a DHEBA shell comprising a sacrificial polyacrylamide core.

[0023] [Figure 17A] Figure 17A shows polymer beads with a stabilized shell containing a sacrificial agarose core. Figure 17B shows a schematic of the structure of a DHEBA shell containing an agarose core mixed with a sample (cells or DNA). [Figure 17B] Figure 17B shows a polymer bead with a stabilized shell containing a sacrificial agarose core. Figure 17B shows a micrograph of a DHEBA shell containing an agarose core. [Figure 17C] Figure 17C shows a polymeric bead with a stabilized shell containing a sacrificial agarose core. Figure 17D shows a photomicrograph of the melting temperature of a DHEBA shell with an agarose core.

[0024] [Figure 18A] Fluorescence-initiated gelation is shown. As shown in Figure 18A, live cells are contacted with a gelation initiator, FITC-AETC. The FITC-AETC coated cells are subjected to radiation and monomers that form gel beads around the cells. [Figure 18B]Figure 18B shows photomicrographs, including excitation microscopy, of FITC-AETC-treated cells compared to control cells not treated with FITC-AETC, and Figure 18C shows photomicrographs of FITC-initiated gelation of cells under various conditions. [Figure 18C] Figure 18C shows photomicrographs of FITC-initiated gelation of cells under various conditions. DETAILED DESCRIPTION OF THE INVENTION

[0025] In the following Detailed Description, reference is made to the accompanying drawings, which form a part of this specification. In the drawings, like symbols typically identify like components unless context dictates otherwise. The illustrative embodiments set forth in the Detailed Description, the drawings, and the claims are not intended to be limiting. Other embodiments may be utilized, and other changes may be made without departing from the spirit or scope of the subject matter presented herein. It will be readily understood that the aspects of the present disclosure, as generally described herein and illustrated in the drawings, can be arranged, substituted, combined, separated, and designed in a wide variety of different configurations, all of which are expressly contemplated herein.

[0026] Embodiments relate to compositions, systems, and methods for encapsulating biomolecules within polymeric beads and performing one or more assays on the encapsulated biomolecules. The polymeric beads retain the biomolecules within the beads but allow for the diffusion of smaller molecules, such as reagents, into and out of the polymeric beads while retaining the biomolecules under analysis. As disclosed herein, the polymeric beads contain pores, the size and density of which are adjusted to control the size or molecules that diffuse into or out of the polymeric beads.

[0027] In one embodiment, the polymeric beads are a uniform porous hydrogel matrix that encapsulates or contains one or more biomolecules. In another embodiment, the polymeric beads are hollow beads having a porous hydrogel shell and a hollow interior, with the biomolecules encapsulated in the hollow interior. In some embodiments, the polymeric beads, whether a uniform porous hydrogel matrix or a hollow bead, can include multiple polymer layers, with each polymer layer being a distinct matrix with distinct properties, such as pore size. In some embodiments, each polymer layer can be controllably adjusted to adjust the pore size of each polymer layer, thereby allowing the user to control the diffusion of molecules into and out of the polymeric beads in a user-controllable, stepwise manner. In some embodiments, each polymer layer can be controllably adjusted by changing environmental conditions, such as pH, charge, or temperature, such that the change in environmental condition adjusts the pore size of the bead or bead shell, thereby allowing molecules or reagents to be released from or enter the bead in a controllable, stepwise manner.

[0028] Embodiments described herein include reliable, high-throughput systems and methods for performing sequential reactions on biomolecules encapsulated in polymeric beads. The methods and systems described herein involve performing one or more assays on the encapsulated biomolecules, including, for example, lysis, DNA analysis, RNA analysis, protein analysis, tagmentation, nucleic acid amplification, nucleic acid sequencing, DNA library preparation, assay for transposase-accessible chromatin using sequencing (ATAC-seq), continuous conserved transposition (CPT-seq), single-cell combinatorial indexing sequencing (SCI-seq), or single-cell genome amplification, or any combination thereof performed sequentially.

[0029] One embodiment is a method of encapsulating biomolecules in polymer beads, loading the biomolecule-encapsulating polymer beads onto a flow cell device, preparing a nucleic acid library, releasing the prepared library onto the surface of the flow cell device, and clustering and sequencing the released library. In some embodiments, the biomolecules are cells, proteins, nucleic acids, DNA, RNA, or any derivatives or analogs thereof.

[0030] In some embodiments, preparing the library involves tagmentation of DNA isolated within the polymer beads. Tagmentation of the encapsulated DNA cleaves longer DNA sequences into shorter tagmentation fragments, which are then used to generate clusters of DNA on the surface of the flow cell. The clusters are the product of the tagmentation fragments of the long DNA, each of which can be sequenced, for example, using SBS sequencing. A group of clusters from a single long DNA molecule is referred to herein as a "long DNA island." In some embodiments, a single polymer bead may encapsulate a single long DNA molecule or multiple long DNA molecules. Each long DNA molecule generates a single long DNA island. A cluster of all long DNA islands within a single polymer bead is referred to herein as a "cluster cloud." Thus, a cluster cloud represents all clusters within a single polymer bead and may include many long DNA islands (each long DNA island represents a single long DNA molecule), with each long DNA island comprising multiple clusters.

[0031] The beads may comprise a hydrogel polymer and a crosslinker mixed in the presence of a biomolecule, such as a nucleic acid, such as a long DNA molecule, or a source containing nucleic acid, to form a polymer bead that encapsulates the biomolecule. In some embodiments, the source of nucleic acid is a cell.

[0032] In some embodiments, the bead pores allow diffusion of molecules less than 1000 base pairs, e.g., less than 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 base pairs or less, or an amount within a range defined by any two of the aforementioned values, but retain (or do not allow diffusion of) compounds greater than the aforementioned values. Thus, in some embodiments, the polymeric beads retain (or do not allow diffusion of) compounds greater than 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 3000, more than 4000, or 5000 base pairs or more, or an amount within a range defined by any two of the aforementioned values.

[0033] Some embodiments include methods for using beads encapsulating biomolecules to perform nucleic acid reactions, including, for example, high-throughput spatial indexing of long DNA molecules. As shown in FIG. 1A, library preparation from long DNA molecules can be easily performed by clustering and seeding clusters from single long DNA molecules as "cluster patches" on a surface, which can then be read and spatially mapped. As used herein, the term "long DNA" can include DNA fragments greater than 300 base pairs. As used herein, long DNA fragments refer to DNA fragments greater than 1 kb, 2.5 kb, 5 kb, or more, such as 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, 400, or 500 kb or more in length, including amounts within a range defined by any two of the aforementioned values.

[0034] Some embodiments include a method for fragmenting a genomic sample into a series of long DNA fragments using a single bead. The single bead can then be attached to a specific location on a flow cell, where the long DNA fragments are deposited so that each is positioned adjacent to one another on the flow cell surface. The flow cell can then be used in a nucleotide sequencing system, such as the ILLUMINA HISEQ system, to determine the nucleotide sequence from each long DNA fragment. Because the DNA fragments are positioned adjacent to one another on the flow cell surface, the system can use this spatial position data to more efficiently reconstruct the final nucleotide sequence of the original genomic DNA. The system can directly deposit spatially co-located reads from a single cell, long DNA fragments, or chromosomes. In some embodiments, the method enables a low-input, PCR-free workflow for library preparation. In some embodiments, the method can be performed without the need for molecular barcoding.

[0035] Some embodiments relate to methods for preparing polymeric beads that encapsulate biomolecules. In some embodiments, polymeric beads that encapsulate long DNA can be used to process cellular genomes and perform DNA library preparation within the beads. In some embodiments, polymeric beads that encapsulate long DNA fragments can encapsulate single cells, which can be used to process cellular genomic DNA and perform DNA library preparation entirely within the beads.

[0036] In some embodiments, the pore size of the polymer beads can be engineered to allow diffusion of enzymes, chemicals, and smaller primers (<50 bp) so that long DNA fragments and the resulting DNA libraries can be retained within the polymer beads during processing, while retaining larger nucleic acids (>300 bp). In some embodiments, specific primers can be chemically linked within the polymer bead matrix to hybridize and process specific genomic DNA. DNA libraries from single cells can then be released to specific regions on the flow cell surface, for example, for library seeding. This subsequently results in a spatial distribution of "DNA clusters" on the flow cell arising from the encapsulated long DNA fragments, thus simplifying read alignment during downstream processing.

[0037] As used herein, the term "polymeric beads" refers to porous hydrogel beads or porous hollow beads. In some embodiments, the polymeric beads are prepared as porous hydrogel beads. Porous hydrogel beads are beads with a relatively uniform porous matrix throughout the bead. As described herein, porous hydrogel beads contain pores that encapsulate biomolecules and allow diffusion of molecules into or out of the porous hydrogel beads. The pores may also be adjusted to change pore size based on changes in environmental conditions, such as pH, temperature, or charge, thereby allowing diffusion of molecules into or out of the porous hydrogel beads in a controllable manner. In some embodiments, the porous hydrogel beads may comprise one or more types of polymers, each with a distinct pore size and pore density, and each polymer is separately adjusted to allow diffusion of molecules of different sizes based on changes in environmental conditions.

[0038] In some embodiments, the polymer beads are prepared as porous hollow beads. Porous hollow beads are beads with a porous polymer shell but a hollow interior. As described herein, the porous hollow beads encapsulate biomolecules within the hollow interior. The pores in the polymer shell allow diffusion of molecules into or out of the hollow interior and can be adjusted to change pore size based on changes in environmental conditions, such as pH, temperature, or charge, thereby allowing diffusion of molecules into or out of the hollow interior in a controllable manner. In some embodiments, the porous hollow beads comprise multiple porous polymer shells, each with a distinct pore size and pore density, and each shell is separately adjusted to allow diffusion of molecules of different sizes based on changes in environmental conditions. For example, as shown in Figure 15, the porous hollow beads can have a hollow interior (or hollow core) with multiple polymer shells. Figure 15 shows a porous hollow bead with three porous polymer shells, such as Polymer 1, Polymer 2, and Polymer 3, as referenced in Figure 15. Molecules are retained within the porous hollow beads, and adjustment of the first polymer results in diffusion of the first molecule through the polymer shell. Adjustment of the second polymer results in diffusion of the second molecule through the polymer shell. Those skilled in the art will recognize that the example shown in Figure 15 is illustrative and that multiple porous polymer shells may be used to control the diffusion of molecules into or out of the porous hollow beads. For example, the porous hollow beads may include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more separate polymer shells, each having a particular pore size and pore density, and each polymer shell can be adjusted to control the diffusion of molecules into or out of the porous hollow beads.

[0039] As used herein, the term "reagent" refers to an agent or mixture of two or more agents useful for reacting with, interacting with, diluting, or adding to a sample, and may include agents used in nucleic acid reactions, including, for example, buffers, chemicals, enzymes, polymerases, primers having a size of less than 50 base pairs, template nucleic acids, nucleotides, labels, dyes, or nucleases. In some embodiments, reagents include lysozyme, proteinase K, random hexamers, polymerases (e.g., Φ29 DNA polymerase, Taq polymerase, Bsu polymerase), transposases (e.g., Tn5), primers (e.g., P5 and P7 adapter sequences), ligases, catalytic enzymes, deoxynucleotide triphosphates, buffers, or divalent cations. Polymer beads that encapsulate biomolecules

[0040] One embodiment includes beads comprising hydrogel polymers and biomolecules. As used herein, the term "hydrogel" refers to a material formed when organic polymers (natural or synthetic) are crosslinked via covalent, ionic, or hydrogen bonds to create a three-dimensional open lattice structure that traps water molecules to form a gel. In some embodiments, the hydrogel may be a biocompatible hydrogel. As used herein, the term "biocompatible hydrogel" refers to a polymer that forms a gel that is not toxic to living cells and allows sufficient diffusion of oxygen and nutrients to the encapsulated cells to maintain viability. In some embodiments, the hydrogel polymer comprises 60-90% liquid, such as water, and 10-30% polymer. In certain embodiments, the water content of the hydrogel is about 70-80%.

[0041] Hydrogels can be prepared by crosslinking hydrophilic biopolymers or synthetic polymers. Thus, in some embodiments, hydrogels can include a crosslinker. As used herein, the term "crosslinker" refers to a molecule that can form a three-dimensional network when reacted with an appropriate base monomer. Examples of hydrogel polymers that may include one or more crosslinkers include hyaluronan, chitosan, agar, heparin, sulfate, cellulose, alginate (including alginate sulfate), collagen, dextran (including dextran sulfate), pectin, carrageenan, polylysine, gelatin (gelatin type A), agarose, (meth)acrylate-oligolactide-PEO-oligolactide-(meth)acrylate, PEO-PPO-PEO copolymer (Pluronics), poly(phosphazene), poly(methacrylate), poly(N-vinylpyrrolidone), PL(G)A-PEO-PL(G)A copolymer, poly(ethyleneimine), polyethylene glycol (PEG)-thiol, PEG-acrylate, maleimide (MAL), PEG / MAL, acrylamide, N,N'-biphenylylamine, N,N'-bis(2-methyl-2-propanol), ... Poly(acryloyl)cystamine, PEG, polypropylene oxide (PPO), polyacrylic acid, poly(hydroxyethyl methacrylate) (PHEMA), poly(methyl methacrylate) (PMMA), poly(N-isopropylacrylamide) (PNIPAAm), poly(lactic acid) (P LA), poly(lactic-co-glycolic acid) (PLGA), polycaprolactone (PCL), poly(vinylsulfonic acid) (PVSA), poly(L-aspartic acid), poly(L- Examples of suitable crosslinking agents include, but are not limited to, polyethylene glycol (PEG)-thiol / PEG-acrylate, acrylamide / N,N-bis(acryloyl)cystamine (BACy), PEG / polypropylene oxide (PPO), or N,N'-(1,2-dihydroxyethylene)bisacrylamide (DHEBA).

[0042] In some embodiments, the crosslinker forms disulfide bonds in the hydrogel polymers, thereby linking them together. In some embodiments, the hydrogel polymers form a hydrogel matrix or polymer shell with pores. The pores are capable of retaining sufficiently large molecules, such as long DNA fragments, within the polymer bead, while allowing small materials, such as reagents, to pass through the pores and thereby into and out of the polymer bead. In some embodiments, the pore size is fine-tuned by varying the ratio of polymer concentration to crosslinker concentration. In some embodiments, the ratio of polymer to crosslinker is 30:1, 25:1, 20:1, 19:1, 18:1, 17:1, 16:1, 15:1, 14:1, 13:1, 12:1, 11:1, 10:1, 9:1, 8:1, 7:1, 6:1, 5:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, or 1:30, or a ratio within a range defined by any two of the foregoing ratios. In some embodiments, additional functionality, such as DNA primers or charge-sensitive chemical groups, can be grafted onto the polymer matrix to meet the requirements of different applications.

[0043] Additionally, in some embodiments, the pores can be adjusted, tuned, varied, modified, adapted, or adapted in size or density by changing the environmental conditions in which the polymer beads are located, including by changing the pH, charge, or temperature. Tuning of the pores can be done in a controllable manner by making incremental changes to the environment, thereby allowing the diffusion of molecules in a controllable manner.

[0044] As used herein, the term "porosity" refers to the (dimensionless) volume fraction of a hydrogel that is composed of open space, e.g., pores or other openings. Porosity thus measures the void space in a material and is the fraction of void volume relative to the total volume, such as a percentage of 0 to 100% (or 0 to 1). The porosity of a hydrogel can range from 0.5 to 0.99, from about 0.75 to about 0.99, or from about 0.8 to about 0.95.

[0045] Hydrogels can have any pore size. As used herein, the term "pore size" refers to the cross-sectional diameter or effective diameter of a pore. The term "pore size" can also refer to the average cross-sectional diameter or average effective diameter of a pore based on measurements of a large number of pores. The effective diameter of a non-circular cross-section is equal to the diameter of a circular cross-section having the same cross-sectional area as the non-circular cross-section. In some embodiments, hydrogels can swell when the hydrogel is hydrated. The magnitude of the pore size can then vary depending on the water content in the hydrogel. In some embodiments, the pores of the hydrogel can have pores of a size sufficient to retain biomolecules within the polymer beads but allow the passage of reagents, and can be tailored as described herein to allow molecules to pass through in a controllable manner.

[0046] In some embodiments, the crosslinker is a reversible crosslinker. In some embodiments, the reversible crosslinker can reversibly crosslink hydrogel polymers and cannot be crosslinked in the presence of a cleaving agent. In some embodiments, the crosslinker can be cleaved by the presence of a reducing agent, elevated temperature, or an electric field. In some embodiments, the reversible crosslinker can be N,N'-bis(acryloyl)cystamine, a reversible crosslinker for polyacrylamide gels, and the disulfide linkages can be broken in the presence of a suitable reducing agent. In some embodiments, contacting the crosslinker with a reducing agent cleaves the disulfide bonds of the crosslinker and destroys the polymer beads. The polymer beads disintegrate, releasing the contents, such as nucleic acids, held therein. In some embodiments, the crosslinker is cleaved by increasing the temperature to above 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100°C. In some embodiments, the crosslinker is cleaved by contacting the polymer beads with a reducing agent. In some embodiments, the reducing agent includes phosphine compounds, water-soluble phosphines, nitrogen-containing phosphines and their salts and derivatives, dithioerythritol (DTE), dithiothreitol (DTT) (cis and trans isomers, respectively, of 2,3-dihydroxy-1,4-dithiolbutane), 2-mercaptoethanol or β-mercaptoethanol (BME), 2-mercaptoethanol or aminoethanethiol, glutathione, thioglycolate or thioglycolic acid, 2,3-mercaptopropanol, tris(2-carboxyethyl)phosphine (TCE), P), tris(hydroxymethyl)phosphine (THP), or P-[tris(hydroxymethyl)phosphine]propionic acid (THPP).

[0047] In some embodiments, increasing the temperature to increase diffusion or contact with a reducing agent decomposes the crosslinker, thereby releasing the encapsulated biomolecule or molecules derived therefrom from the polymer bead.

[0048] In some embodiments, crosslinking of the crosslinker establishes pores within the polymeric beads. In some embodiments, the pores in the polymeric beads are regularly sized to encapsulate biomolecules, such as DNA fragments greater than about 5,000 base pairs, as shown in FIG. 1B, but are formulated to allow smaller particles, such as reagents, or nucleic acids less than about 50 base pairs in size, such as primers, to pass through the pores. In some embodiments, the reagents include reagents for processing biomolecules or molecules derived therefrom, such as reagents for isolating nucleic acids from cells, amplifying, barcoding, or sequencing nucleic acids, or reagents for preparing nucleic acid libraries. In some embodiments, the reagents include, for example, lysozyme, proteinase K, random hexamers, polymerases (e.g., Φ29 DNA polymerase, Taq polymerase, Bsu polymerase), transposases (e.g., Tn5), primers (e.g., P5 and P7 adapter sequences), ligases, catalytic enzymes, deoxynucleotide triphosphates, buffers, or divalent cations.

[0049] In some embodiments, the long DNA comprises genomic DNA, viral nucleic acid, bacterial nucleic acid, or mammalian nucleic acid. In some embodiments, the polymer bead comprises a source of long DNA, including, for example, a cell. In some embodiments, the cell is a single cell, including a prokaryotic cell or a eukaryotic cell. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a human cell. In some embodiments, the cell is a bacterial cell. Thus, as shown in Figures 7A and 7B, the method may be performed on a long DNA fragment or on a cell, either or both of which are encapsulated in a polymer bead.

[0050] In some embodiments, the polymeric beads are sacrificial polymeric beads having a sacrificial core encapsulated by a shell. As used herein, the term "sacrificial" has its ordinary meaning as understood herein and refers to beads or portions of beads that are used in bead preparation or assembly but may be melted or discarded at a later stage. In some embodiments, the sacrificial polymeric beads comprise a polymeric material, such as agarose or polyacrylamide, that contacts a sample, such as cells or DNA, thereby forming a polymeric bead. The polymeric beads may then be encapsulated with a shell composed of a different polymeric material with different melting characteristics, such as a shell comprising N,N'-(1,2-dihydroxyethylene)bisacrylamide (DHEBA), acylate-PEG, or KPS, or a combination thereof. After encapsulation, the encapsulated polymeric beads may be subjected to conditions sufficient to remove the inner beads and leave the shell. Conditions may include, for example, a change in temperature, pH, or the addition of a reducing agent.

[0051] In still further embodiments, any of the polymeric beads described herein may include a fluorescent material linked to the polymeric material, such as fluorescein isothiocyanate (FITC) or an acrylate polymer. Examples of fluorescent compounds that can be bound to polymeric materials, such as FITC-acrylate polymer (FITC-AETC), to form fluorescent polymeric materials, such as FITC-acrylate polymer (FITC-AETC). The fluorescent material linked to the polymeric material may be contacted with cells, thereby initiating fluorescent gelation and forming fluorescent polymeric beads that surround the cells. In some embodiments, the polymeric beads with cells therein may be fluorescently imaged without the need for staining. How to make polymer beads

[0052] Some embodiments provided herein relate to methods of making beads that encapsulate biomolecules. In some embodiments, the polymer beads are porous hydrogel beads as described herein or porous hollow beads as described herein.

[0053] In some embodiments, the polymer beads are prepared by vortex-assisted emulsion. As used herein, vortex-assisted emulsion refers to vortexing a hydrogel polymer with long DNA fragments or a source of long DNA fragments in a container such as a tube, vial, or reaction vessel. The components can be mixed, for example, by manual or mechanical vortexing or shaking. In some embodiments, manual mixing results in polymer beads encapsulating biomolecules having a diameter of 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, or 150 μm, or a size within a range defined by any two of the foregoing values. In some embodiments, the beads are non-uniform in size, and thus the size of the beads includes beads of various diameters.

[0054] In some embodiments, the beads are prepared by microfluidic droplet generation. As shown in FIG. 1B, microfluidic droplet generation involves the use of a microfluidic device for assisted gel emulsion generation. In some embodiments, the microfluidic device includes microchannels configured to produce polymer beads of a desired size and to encapsulate a selected amount of biomolecules per bead. In some embodiments, the microfluidic device has a height of 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 μm, or a height within a range defined by any two of the foregoing values. In some embodiments, the microfluidic device includes one or more channels. In some embodiments, the microfluidic device includes a channel for aqueous flow and a channel for an immiscible fluid. In some embodiments, the widths of the one or more channels are the same. In some embodiments, the widths of the one or more channels are different. In some embodiments, the width of one or more channels is 20, 30, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 μm, or a width within a range defined by any two of the foregoing values. In some embodiments, the width of the aqueous channel is 75 μm. In some embodiments, the width of the immiscible fluid channel is 78 μm. One skilled in the art will recognize that the widths can be varied to fine-tune the size of the beads. In addition to the size of the microfluidic device and the widths of the channels, the flow rates of the aqueous and immiscible fluid channels can also affect the size of the polymer beads.

[0055] In some embodiments, the flow rate of the solution in the aqueous channel is 1, 2, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, or 150 μL / min, or a rate within a range defined by any two of the foregoing values. In some embodiments, the flow rate of the immiscible fluid in the immiscible-fluid channel is 20, 30, 50, 80, 100, 150, 160, 170, 180, 190, 200, 225, 250, 275, 300, 325, 350, 375, or 400 μL / min, or a rate within a range defined by any two of the foregoing values. In some embodiments, the aqueous phase solution contains a hydrogel polymer, a crosslinker, and a biomolecule, which flows through an aqueous channel into an immiscible fluid, such as a carrier oil, at a flow rate less than the flow rate of the immiscible fluid, thereby forming droplets. In some embodiments, the immiscible fluid is an oil, such as mineral oil, hydrocarbon oil, silicone oil, polydimethylsiloxane oil, tetramethylethylenediamine (TEMED), or a mixture thereof. In some embodiments, the hydrogel droplets containing the biomolecules are formulated with a uniform size distribution. In some embodiments, the size of the polymer beads is fine-tuned by adjusting the size of the microfluidic device, the size of one or more channels, or the flow rate of either or both the aqueous solution or the immiscible fluid. In some embodiments, the resulting polymeric beads have a diameter in the range of 2 to 150 μm, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, or 150 μm, or a diameter within a range defined by any two of the foregoing values.

[0056] In some embodiments, the size and uniformity of the polymer beads encapsulating biomolecules can be further controlled by contacting the hydrogel polymer prior to bead formation with a fluidity modifier, such as an alcohol, including isopropyl alcohol.

[0057] In some embodiments, the amount of long DNA fragments encapsulated within the beads can be controlled by diluting or concentrating the long DNA fragments within the input sample. The sample containing the long DNA fragments is mixed with a hydrogel polymer, and the hydrogel polymer containing the long DNA fragments undergoes vortex-assisted emulsion or microfluidic droplet generation as described herein.

[0058] In some embodiments, polymeric beads can be functionalized and used for purifying nucleic acids. In some embodiments, the polymeric beads are functionalized with nucleotides. In some embodiments, the nucleotides are oligonucleotides or poly-T nucleotides. In some embodiments, the nucleotides are attached to the polymeric beads, and the functionalized beads can be used for targeted capture of nucleotides of interest.

[0059] In some embodiments, the polymer beads may be encapsulated with a polymer shell that has different characteristics than the polymer beads, such as a different melting temperature, a different pore size, or different melting characteristics. In some embodiments, the polymer shell may comprise a DHEBA material. Method for processing biomolecules encapsulated in polymer beads

[0060] Some embodiments include a method for processing biomolecules in beads, as shown in FIG. 2, which shows a flow diagram for preparing and processing biomolecules in polymer beads. In the first step, a DNA sample, such as from genomic data or cells, is encapsulated within the polymer beads. In some embodiments, long DNA fragments are retained within the polymer beads, and reagents can pass through the pores of the polymer beads. In some embodiments, the reagents can include lysis agents, nucleic acid purification agents, tagmentation agents, PCR agents, or other agents used in processing biomolecules or molecules derived therefrom. Thus, the polymer beads provide a microenvironment for controlled reaction of long DNA fragments within the polymer beads by allowing a barrier of reagents to pass in and out of the polymer beads while retaining the long DNA fragments within the beads. Once the DNA is encapsulated within the beads, the process moves to the next step, where a sample can be loaded into a flow cell to generate long DNA fragments through a library preparation process.

[0061] As used herein, the term "tagmentation" refers to the modification of DNA by a transposome complex containing a transposase enzyme complexed with an adapter containing a transposon end sequence. Tagmentation results in the simultaneous fragmentation of DNA and ligation of adapters to the 5' ends of both strands of the duplex fragment. Following a purification step to remove the transposase enzyme, additional sequences can be added to the ends of the adapted fragments, for example, by PCR, ligation, or any other suitable method known to those skilled in the art.

[0062] In some embodiments, the entire DNA library preparation can be accomplished seamlessly within polymer beads attached to a flow cell using multiple reagent exchanges by passing the gDNA and its library products through a porous hydrogel, while retaining them within the hydrogel matrix. The hydrogel can withstand high temperatures up to 95°C for several hours to support different biochemical reactions.

[0063] In the next step of the process, the polymer beads encapsulating the long DNA fragments from the previous library preparation are treated to release, purify, and isolate the long DNA fragments from the beads. Thus, for example, the polymer beads are contacted with a lysis buffer. As used herein, "lysis" refers to a perturbation or modification to the cell wall or viral particle that facilitates access to or release of cellular RNA or DNA. Neither complete destruction nor disruption of the cell wall is a prerequisite for lysis. The term "lysis buffer" refers to a buffer containing at least one lysis agent. Typical enzymatic lysis agents include, but are not limited to, lysozyme, glucurase, zymolase, lyticase, proteinase K, proteinase E, and viral endolysins and exolysins. Thus, for example, lysis of cells in the beads can be performed by introducing a lysis agent such as lysozyme and proteinase K into the polymer beads. The gDNA from the cells is now contained within the beads. In some embodiments, after the lysis process, the isolated nucleic acids are retained within the polymer beads and can be used for further processing.

[0064] As used herein, the terms "isolated," "isolate," "isolated," "purified," "purify," and grammatical equivalents as used herein, unless otherwise specified, refer to a reduction in the amount of at least one contaminant (such as a protein and / or nucleic acid sequence) from a sample or from the source (e.g., a cell) from which the material is isolated. Purification therefore results in "enrichment," e.g., an increase in the amount of a desired protein and / or nucleic acid sequence in a sample.

[0065] In some embodiments, the encapsulated nucleic acid is fully or partially sequenced within the polymer bead. The encapsulated nucleic acid can be sequenced according to any suitable sequencing method, such as sequencing by synthesis, sequencing by ligation, sequencing by hybridization, direct sequencing, such as nanopore sequencing, etc.

[0066] Some embodiments provided herein relate to sequencing-by-synthesis (SBS) enabled on long DNA fragments. In SBS, a nucleic acid template is The extension of a nucleic acid primer along a template (e.g., a target nucleic acid or an amplicon thereof) is monitored to determine the sequence of nucleotides in the template. The underlying chemical process can be polymerization (e.g., as catalyzed by a polymerase enzyme). In certain polymerase-based SBS embodiments, fluorescently labeled nucleotides are added to the primer (thereby extending the primer) in a template-dependent manner, such that detection of the order and type of nucleotides added to the primer can be used to determine the sequence of the template.

[0067] One or more amplified encapsulated nucleic acids can be subjected to SBS or other detection techniques involving repeated delivery of reagents in cycles. For example, to initiate the first SBS cycle, one or more labeled nucleotides, DNA polymerase, etc. can be flowed into or through polymer beads containing one or more amplified nucleic acid molecules. These sites where the labeled nucleotide is incorporated by primer extension can be detected. Optionally, the nucleotide can further comprise a reversible termination feature that terminates further primer extension once the nucleotide is added to the primer. For example, a nucleotide analog with a reversible terminator moiety can be added to the primer so that further extension cannot occur until a deblocking agent is delivered to remove the moiety. Thus, in embodiments using reversible termination, a deblocking reagent can be delivered to the flow cell (before or after detection occurs). Washing can be performed between the various delivery steps. The cycle can then be repeated n times to extend the primer with n nucleotides, thereby detecting a sequence of length n. Exemplary SBS procedures, fluidic systems, and detection platforms that can be readily adapted for use with amplicons produced by the methods of the present disclosure are described, for example, in Bentley et al., Nature 456:53-59 (2008), WO 04 / 018497, U.S. Patent No. 7,057,026, WO 91 / 06678, U.S. Patent No. 07 / 123744, U.S. Patent Nos. 7,329,492, 7,211,414, 7,315,019, 7,405,281, and U.S. Patent Application Publication No. 2008 / 0108082, each of which is incorporated herein by reference.

[0068] Other sequencing procedures using cyclic reactions can be used, such as pyrosequencing. Pyrosequencing detects the release of inorganic pyrophosphate (PPi) when a specific nucleotide is incorporated into a nascent nucleic acid strand (Ronaghi, et al., Analytical Biochemistry 242(1), 84-9 (1996); Ronaghi, Genome Res. 11(1), 3-11 (2001); Ronaghi et al. Science 281(5375), 363 (1998); U.S. Patent Nos. 6,210,891, 6,258,568, and 6,274,320, each of which is incorporated herein by reference). In pyrosequencing, the released PPi is immediately converted to adenosine triphosphate (ATP) by ATP sulfurylase. The level of ATP produced can be detected via luciferase-generated photons. Thus, the sequencing reaction can be monitored via a luminescence detection system. The excitation radiation source used in fluorescence-based detection systems is not required for pyrosequencing procedures. Useful fluid systems, detectors, and procedures that can be adapted for pyrosequencing applications to amplicons produced according to the present disclosure are described, for example, in WIPO Patent Application No. PCT / US11 / 57111, U.S. Patent Application Publication No. 2005 / 0191698(A1), U.S. Patent Nos. 7,595,883, and 7,244,559, each of which is incorporated herein by reference.

[0069] Some embodiments may utilize methods involving real-time monitoring of DNA polymerase activity. For example, nucleotide incorporation may be detected by fluorescence resonance energy transfer (FRET) interactions between a fluorophore-bearing polymerase and a gamma-phosphate-labeled nucleotide, or using zero mode waveguides (ZMWs). For FRET-based sequencing, Techniques and reagents are described, for example, in Levene et al. Science 299, 682-686 (2003); Lundquist et al. Opt. Lett. 33, 1026-1028 (2008); Korlach et al. Proc. Natl. Acad. Sci. USA 105, 1176-1181 (2008), the disclosures of which are incorporated herein by reference.

[0070] Some SBS embodiments involve the detection of protons released upon incorporation of a nucleotide into an extension product. For example, sequencing based on detection of released protons can use electrical detectors and related technologies that are commercially available. Examples of such sequencing systems include pyrosequencing (e.g., a platform commercially available from 454 Life Sciences, a subsidiary of Roche), sequencing using γ-phosphate labeled nucleotides (e.g., a platform commercially available from Pacific Biosciences), and sequencing using proton detection (e.g., a platform commercially available from Life Sciences). Examples of suitable sequencing methods and systems include those commercially available from Ion Torrent, a subsidiary of Ion Technologies, or those described in U.S. Patent Application Publication Nos. 2009 / 0026082(A1), 2009 / 0127589(A1), 2010 / 0137143(A1), or 2010 / 0282617(A1), each of which is incorporated herein by reference. The methods described herein for amplifying target nucleic acids using kinetic exclusion can be readily applied to substrates used to detect protons. More specifically, the methods described herein can be used to produce clonal populations of amplicons used to detect protons.

[0071] Another sequencing technique is nanopore sequencing (e.g., Deamer et al. Trends Biotechnol. 18, 147-151 (2000); Deamer et al. Acc. Chem. Res. 35:817-825 (2002); Li et al. al. Nat. Mater. 2:611-615 (2003), the disclosure of which is incorporated herein by reference. In some nanopore embodiments, the target nucleic acid or individual nucleotides removed from the target nucleic acid pass through the nanopore. As the nucleic acid or nucleotide passes through the nanopore, each nucleotide type can be identified by measuring the fluctuation in the electrical conductivity of the pore. (See U.S. Pat. No. 7,001,792, Soni et al. al. Clin. Chem. 53, 1996-2001 2007); Healy, Nanomed. 2, 459-481 2007); Cockroft et al. J. Am. Chem. Soc. 130, 818-820 (2008), the disclosure of which is incorporated herein by reference).

[0072] Exemplary methods for array-based expression and genotyping that can be applied for detection according to the present disclosure are described in U.S. Pat. Nos. 7,582,420, 6,890,741, 6,913,884, or 6,355,431, or U.S. Patent Application Publication Nos. 2005 / 0053980(A1), 2009 / 0186349(A1), or US2005 / 0181440(A1), each of which is incorporated herein by reference.

[0073] The nucleic acid isolation, amplification, and sequencing methods described herein use various reagents for nucleic acid isolation and preparation. These reagents may include, for example, lysozyme, proteinase K, random hexamers, polymerases (e.g., Φ29 DNA polymerase, Taq polymerase, Bsu polymerase), transposases (e.g., Tn5), primers (e.g., P5 and P7 adapter sequences), ligases, catalytic enzymes, deoxynucleotide triphosphates, buffers, or divalent cations. These reagents pass through the pores of the polymer beads, while biomolecules or molecules derived therefrom are retained within the polymer beads. An advantage of the methods described herein is that they provide an enclosed microenvironment for nucleic acid processing within the polymer beads. This allows for single-cell processing for rapid and efficient processing of target nucleic acids.

[0074] The adaptor may include a sequencing primer site, an amplification primer site, and an index. As used herein, an "index" may include a sequence of nucleotides that can be used as a molecular identifier and / or barcode to tag a nucleic acid and / or identify the source of the nucleic acid. In some embodiments, the index can be used to identify a single nucleic acid or a subpopulation of nucleic acids. In some embodiments, nucleic acid libraries can be prepared within polymer beads. In some embodiments, single cells encapsulated within polymer beads can be subjected to combinatorial indexing of single cells, for example, using contiguity preserving transposition (CPTSeq) techniques. In some embodiments, DNA from single cells may be barcoded by encapsulating the single cells after WGA amplification with additional beads carrying barcoded transposons, and the gel matrix may be melted, e.g., by contact with a reducing agent, to release the genomic DNA for barcoding.

[0075] Embodiments of the "spatial indexing" methods and techniques described herein shorten data analysis and simplify the process of library preparation from single cells and long DNA molecules. Existing protocols for single-cell sequencing require efficient physical separation of cells, unique barcoding of each isolated cell, and pooling them all together for sequencing. Current protocols for synthetic long reads also require a tedious barcoding step to distinguish the genetic information resulting from each barcoded cell, and pooling each barcoded fragment together for sequencing and data analysis. During these processes, there can be loss of material, which causes dropouts in the sequence. The embodiments described herein not only shorten the process but also increase the data resolution of single cells. Furthermore, the embodiments provided herein simplify the assembly of genomes of new organisms. The embodiments described herein may also be used to reveal the co-occurrence of rare genetic differences and mutations. In some embodiments, DNA libraries entrapped in polymer beads until release offer the opportunity to control the size of the fragments released onto the surface by controlling the release process and hydrogel formulation.

[0076] In some embodiments, the surface is a flow cell device. In some embodiments, the flow cell is a custom flow cell device having wells, grooves, or patterns. In some embodiments, the flow cell comprises a patterned surface. In some embodiments, the patterned surface comprises wells. In some embodiments, the wells have a diameter of about 10 μm to about 50 μm, e.g., 10 μm, 15 μm, 20 μm, 25 μm, 30 μm, 35 μm, 40 μm, 45 μm, or 50 μm, or within a range defined by any two of the foregoing values, and the wells have a depth of about 0.5 μm to about 1 μm, e.g., 0.5 μm, 0.6 μm, 0.7 μm, 0.8 μm, 0.9 μm, or 1 μm, or within a range defined by any two of the foregoing values. In some embodiments, the wells are comprised of a hydrophobic material. In some embodiments, the hydrophobic material comprises an amorphous fluoropolymer such as CYTOP, Fluoropel®, or Teflon®.

[0077] In some embodiments, the library can be amplified using a primer site in the adapter sequence and sequenced using a sequencing primer site in the adapter sequence. In some embodiments, the adapter sequence can include an index for identifying the nucleic acid source. The efficiency of subsequent amplification steps can be reduced by the formation of primer dimers. To increase the efficiency of subsequent amplification steps, unligated single-stranded adapters can be removed from the ligation product.

[0078] In some embodiments, a model system can be prepared to determine the porosity of polymer beads. As shown in Figures 11A and 11B, polymer beads can encapsulate streptavidin compounds (shown as SA in Figures 11A and 11B), retaining the streptavidin compounds within the beads. In some embodiments, biotin compounds linked to amplicons of a certain size are mixed with polymer beads (Figure 11A). Biotin-linked amplicons of sufficient size can diffuse into the polymer beads and bind to streptavidin within the beads, thereby retaining the biotin-linked amplicons within the beads. Conversely, biotin-linked amplicons that are too large will not pass through the polymer beads, and the amplicons will not be retained within the beads. Similarly, polymer beads with streptavidin linked to biotin-linked amplicons can be prepared, and reagents can be passed through to perform reactions such as PCR (Figure 11B). Fragments of sufficient size will diffuse out of the polymer, but fragments that are too large will not diffuse through the polymer bead and will be retained within the bead. Preparation of nucleic acid libraries using polymer beads

[0079] Some embodiments of the systems, methods, and compositions provided herein include methods in which an adaptor is ligated to a target nucleic acid. The adaptor may include a sequencing primer binding site, an amplification primer binding site, and an index. For example, the adaptor may include a P5 sequence, a P7 sequence, or a complement thereof. As used herein, the P5 sequence includes the sequence defined by SEQ ID NO:1 (AATGATACGGCGACCACCGA), and the P7 sequence includes the sequence defined by SEQ ID NO:2 (CAAGCAGAAGACGGCATACGA). In some embodiments, the P5 or P7 sequence may further include a spacer polynucleotide, which may be 1 to 20, e.g., 1 to 15, or 1 to 10 nucleotides in length, e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. In some embodiments, the spacer includes 10 nucleotides. In some embodiments, the spacer is a poly-T spacer, such as a 10T spacer. The spacer nucleotide may be included at the 5' end of the polynucleotide or may be attached to a suitable support via a linkage to the 5' end of the polynucleotide. Attachment can be achieved by a sulfur-containing nucleophile, such as a phosphorothioate, present at the 5' end of the polynucleotide. In some embodiments, the polynucleotide comprises a poly-T spacer and a 5' phosphorothioate group. Thus, in some embodiments, the P5 sequence is 5' phosphorothioate-TTTTTTTTTTAATGATACGGCGACCACCGA-3' (SEQ ID NO:3), and in some embodiments, the P7 sequence is 5' phosphorothioate-TTTTTTTTTTCAAGCAGAAGACGGCATACGA-3' (SEQ ID NO:4).

[0080] The index can be useful for identifying the source of the nucleic acid molecule. In some embodiments, the adaptor can be modified to prevent the formation of concatemers, for example, by adding a blocking group that prevents extension of the adaptor at one or both ends. Examples of 3' blocking groups include a 3'-spacer C3, a dideoxynucleotide, and attachment to a substrate. Examples of 5' blocking groups include a dephosphorylated 5' nucleotide and attachment to a substrate.

[0081] The adaptor comprises a nucleic acid, such as a single-stranded nucleic acid. The adaptor may comprise a short nucleic acid having a length less than, greater than, or equal to about 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, or a range between any two of the aforementioned sizes. In some embodiments, the adaptor has a size sufficient to pass through the pores of the polymer bead. The target nucleic acid may include DNA, such as genomic or cDNA, RNA, such as mRNA, sRNA, or rRNA, or a hybrid of DNA and RNA. The nucleic acid may be isolated from a single cell encapsulated within the polymer bead. The nucleic acid may contain phosphodiester bonds and other types of backbones, including, for example, phosphoramide, phosphorothioate, phosphorodithioate, O-methylphosphoramidite, and peptide nucleic acid backbones and linkages. Nucleic acids can contain any combination of deoxyribonucleotides and ribonucleotides, as well as base analogs such as uracil, adenine, thymine, cytosine, guanine, inosine, xanthanine, hypoxanthanine, isocytosine, isoguanine, and nitropyrroles (including 3-nitropyrrole) and nitroindoles (including 5-nitroindole). In some embodiments, nucleic acids can contain at least one non-specific base. For example, non-specific bases can base pair with two or more different types of bases and can be useful when included in oligonucleotide primers or inserts used for random hybridization in complex nucleic acid samples, such as genomic DNA samples. Examples of non-specific bases include inosine, which can pair with adenine, thymine, or cytosine. Other examples include hypoxanthine, 5-nitroindole, acyl 5-nitroindole, 4-nitropyrazole, 4-nitroimidazole, and 3-nitropyrrole. A non-specific base that can base pair with at least two, three, four or more types of bases can be used.

[0082] An exemplary method includes dephosphorylating the 5' end of a target nucleic acid to prevent the formation of concatemers in a subsequent ligation step; ligating a first adaptor to the 3' end of the dephosphorylated target using a ligase, wherein the 3' end of the first adaptor is blocked; rephosphorylating the 5' end of the ligated target; and ligating a second adaptor to the 5' end of the dephosphorylated target using a single-stranded ligase, wherein the 5' end of the second adaptor is not phosphorylated.

[0083] Another example includes partially digesting a nucleic acid with a 5' exonuclease to form a double-stranded nucleic acid with a single-stranded 3' overhang. An adaptor containing a 3' blocking group can be ligated to the 3' end of the double-stranded nucleic acid with a 3' overhang. The double-stranded nucleic acid with the ligated adaptor and the 3' overhang can be dehybridized to form a single-stranded nucleic acid. An adaptor containing a non-phosphorylated 5' end can be ligated to the 5' end of the single-stranded nucleic acid.

[0084] Methods for dephosphorylating a nucleic acid, such as the 5' nucleotide of a nucleic acid, include contacting the nucleic acid with a phosphatase. Examples of phosphatases include calf intestinal phosphatase, shrimp alkaline phosphatase, antarctic phosphatase, and APEX alkaline phosphatase (Epicentre).

[0085] Methods for ligating nucleic acids include contacting the nucleic acids with a ligase, examples of which include T4 RNA ligase 1, T4 RNA ligase 2, RtcB ligase, Methanobacterium RNA ligase, and TS2126 RNA ligase (CIRC ligase).

[0086] A method for phosphorylating a nucleic acid, such as the 5' nucleotide of a nucleic acid, includes contacting the nucleic acid with a kinase. An example of a kinase is T4 polynucleotide kinase.

[0087] Embodiments provided herein relate to preparing nucleic acid libraries in polymeric beads such that the nucleic acid library is prepared in a single reaction volume.

[0088] Embodiments of the systems and methods provided herein include kits containing any one or more of a hydrogel polymer, a crosslinker, or a microfluidic device for preparing polymeric beads that encapsulate biomolecules, and further include components useful for processing biomolecules or molecules derived therefrom, including reagents for cell lysis and nucleic acid amplification and sequencing or nucleic acid library preparation, including lysozyme, proteinase K, random hexamers, polymerases (e.g., Φ29 DNA polymerase, Taq polymerase, Bsu polymerase), transposases (e.g., Tn5), primers (e.g., P5 and P7 adapter sequences), and ligases, catalytic enzymes, deoxynucleotide triphosphates, buffers, or divalent cations, as described herein and used in the processing of biomolecules or molecules derived therefrom, respectively.

[0089] Polymer beads encapsulating cells are prepared as shown in Figure 12. The polymer beads are exposed to reagents for cell lysis and tagmentation. Treatment of the polymer beads with detergents such as SDS results in fragmentation, and small molecules can diffuse out of the polymer beads. In some embodiments, retention of cellular biomolecules can be limited by a minimum threshold limit that restricts bidirectional access of enzymes into the cells.

[0090] Alternatively, in some embodiments, the library preparation method is performed to increase the physical size of the genome molecules contained within the polymer beads beyond a threshold limit. Thus, as shown in Figure 12, during gDNA library preparation, tagmented gDNA fragments are held together by Tn5 bonds, preventing diffusion out of the polymer beads. However, after SDS treatment, Tn5 is released, and the resulting library fragments may be too small to diffuse. To prevent this, Tn5 enzymes with overhanging transposon ends may be used for tagmentation. Chemicals can be implemented with overhanging 5' or 3' transposon ends to increase the size of the library elements or to enable binding to beads or other biomolecules. Various transposon designs and modifications can be used to increase the physical size of the library fragments.

[0091] For example, transposons with 3' overhangs may be used to tagment DNA. The 3' overhangs can serve as substrates for enzymes, such as terminal transferase (TdT), in a template-independent manner. A certain number of bases can be added. For example, TdT may be used to add 100 to 300 bases to the transposon. If TdT transposon extension is not sufficient, the elongated transposon can be hybridized to polymer beads, complementary amplicons, or oligo-bound beads present in polyA-tailed cellular mRNA. If hybridized to an oligonucleotide, an extension reaction may be performed. For example, if an ssDNA plasmid is annealed, a rolling circle amplification (RCA) reaction may be performed to increase the size of the transposon ends. Alternatively, the hybridized oligonucleotide can be ligated to the transposon ends. Other methods, such as cycle ligation assembly (CLA), are also available. Successive ligations of amplicons can be performed to assemble long stretches of DNA from smaller fragments that can diffuse within the polymer beads.

[0092] The addition of modified bases to transposons can also serve as targets for the attachment of additional molecules. Modified bases can be present in the transposon before tagmentation or can be added enzymatically after tagmentation. For example, TdT can be used to add the modified base dioxygenin-11-UTP, which can then be bound by an anti-DIG antibody. Other modifications include biotin and 5mC, which can bind to streptavidin and 5mC antibodies, respectively.

[0093] In some embodiments, simultaneous indexing of gDNA fragments and cDNA originating from the same polymer beads and additional amplification of library elements can be performed by rolling circle amplification. [Example]

[0094] Example 1 - Preparation of polymer beads The following example demonstrates an embodiment of using a microfluidic droplet generator to prepare polymer beads encapsulating long DNA fragments.

[0095] Polymer beads were generated using a droplet generator: a sample containing long DNA fragments was mixed with a polymer precursor, and the mixture was loaded into the sample reservoir on the cartridge. Within 2 minutes, approximately 50,000 polymer beads containing long DNA were generated from each channel (8 channels for 8 independent sample processing on each cartridge). The long DNA polymer beads were loaded onto a flow cell, where the polymer beads were internally attached (100 μm channel height and 120 μm polymer bead diameter) for hands-free library preparation. Enzymes and reagents, including nucleic acid library preparation enzymes and reagents, were introduced into the flow cell and contacted with the long DNA embedded within the polymer beads, cleaving the long DNA molecules by tagmentation to form a DNA library. The library was then seeded from the beads onto the flow cell. During library seeding, oil was loaded to fill the voids between the beads, and the flow cell was heated to accelerate library diffusion onto the flow cell surface. In the presence of oil, seeding of each tagmented library occurred in close proximity to the footprint of each polymer bead (from a 120 μm diameter polymer bead, library seeding was confined to an approximately 120 μm diameter area).

[0096] This example demonstrates that long DNA molecules can be loaded and captured into polymer beads (approximately 120 μm in diameter), and library preparation is performed on these long DNA molecules embedded within the polymer beads. As a result, all DNA libraries from a particular long DNA molecule were stored within the same polymer bead. The libraries were then released from the polymer beads onto the flow cell surface, seeding them as a group on the flow cell surface. Clusters released from the long DNA molecules were grouped together as "cluster patches" on the flow cell. Clusters within a single patch from a single long DNA molecule simplify genome reconstruction with higher accuracy and fewer scaffolding gaps. Example 2 - Spatial indexing of long DNA

[0097] The following example illustrates the embodiment of stroboscopically reading 100 kb long DNA fragments encapsulated within polymer beads with or without MDA.

[0098] Polymer beads were prepared by mixing polymers in the presence of approximately 100 kb of Corriell genomic DNA and forming polymer beads using a microdroplet generator. The formed polymer beads encapsulating DNA fragments were placed on a flow cell device, and the DNA was subjected to spatially indexed sequencing by contacting the flow cell with reagents. MDA was not performed. The beads disassembled and clusters formed on the flow cell device. As shown in Figure 5, there were an average of approximately 33 clusters per long DNA island, the average long DNA island size was 64,000 base pairs, and there were approximately 405 long DNA islands per bead.

[0099] A second set of polymer beads was prepared by mixing polymers in the presence of approximately 100 kb of Corriell genomic DNA and forming polymer beads using a microdroplet generator. The formed polymer beads encapsulating DNA fragments were placed on a flow cell device, and the DNA was subjected to spatially indexed sequencing by contacting the flow cell with reagents. MDA was performed before tagmentation. The beads disassembled, and clusters formed on the flow cell device. As shown in Figure 6, the average clusters per long DNA island increased to approximately 85, the average long DNA island size was 58,000 base pairs, and there were approximately 166 long DNA islands per bead.

[0100] A third set of polymer beads was prepared by mixing polymers in the presence of approximately 10 kb of Corriell genomic DNA and forming polymer beads using a microdroplet generator. The formed polymer beads encapsulating DNA fragments were placed on a flow cell device, and the DNA was subjected to spatially indexed sequencing by contacting the flow cell with reagents. MDA was performed before tagmentation. The beads disassembled, and clusters formed on the flow cell device. As shown in Figure 7, there were approximately 57 clusters per long DNA island, the average long DNA island size was 10,461 base pairs, and there were approximately 85 long DNA islands per bead. Example 3 - Metagenomics on complex mixtures of microbial species

[0101] The following example demonstrates an embodiment of identifying single-cell microorganisms encapsulated within a hydrogel.

[0102] Polymer beads were prepared as described herein using a microfluidics microdroplet generator. The polymer material was mixed with a sample containing a number of microorganisms, including L. gasseri, S. aureus, B. cereus, B. vulgatus, A. baumannii, S. agalactiae, and P. acnes. The encapsulated cells were then lysed and subjected to library preparation, the polymer beads were disassembled, and the library was deposited on a surface. As shown in Figure 9, spatial compartmentalization on the flow cell device allowed for the identification of each microorganism. Thus, encapsulation and subsequent nucleic acid reactions enable strain-level identification of microbial species in complex mixtures using lead compartmentalization in miniaturized metagenomics assays. Example 4 - Spatial indexing on a flow cell

[0103] The following example demonstrates an embodiment of spatial indexing on a flow cell.

[0104] The flow cell device was obtained and washed with 200 μl of PR2 (loading buffer). The beads for processing were also washed with PR2. Diluted hydrogels were prepared in PR2. Increasing dilution increases the spacing between the hydrogels. The hydrogels were embedded in the flow cell to avoid introducing air bubbles into the flow cell. 200 μl of PR2 was flowed into the flow cell, and the process was carried out while the beads remained immobilized. 100 μl of RSB was flowed into the flow cell.

[0105] A tagmentation mix was prepared by mixing 25 μl of tagmentation reagent, 23 μl of RSB, and 2 μl of enzyme. The tagmentation mix was introduced into the narrow channel to remove any possible air bubbles at the inlet. The tagmentation mix was then slowly flowed through the inlet. The flow cell was sealed and incubated at 55°C for 10 minutes.

[0106] A stop buffer mix was prepared by mixing 25 μl of tagmentation buffer, 25 μl of RSB, and 10 μl of stop buffer. The stop buffer mix was slowly flowed onto the flow cell without introducing air bubbles and incubated at room temperature for 5 minutes. After incubation, 200 μl of PR2 was flowed into the device.

[0107] NPM was prepared by mixing 175 μl of RSB and 75 μl of NPM. The NPM mix was slowly flowed onto the flow cell device without introducing air bubbles and incubated at room temperature for 3 minutes. 200 μl of oil containing surfactant was flowed onto the flow cell device. Micrographs revealed that the hydrogel was surrounded by the NPM mix and oil. The flow cell was sealed and incubated at 72°C for 3 minutes for the gap-filling reaction.

[0108] 20-30 μl of surfactant-containing oil and DTT-containing oil (29 / 2 ratio) were flowed onto the flow cell device, and the device was sealed. The initial temperature release process was 90°C for 3 min, 60°C for 5 min, 40°C for 2 min, and 20°C for 2 min. The flow cell was washed with 400 μl of PR2 and 200 μl of CLM (cleavage mix). The flow cell was then washed with 400 μl of PR2. If phix seeding was desired, Phix was prepared at a concentration of 2-3 pM, and the phix library was flowed onto the device and incubated at room temperature for 5 min. The flow cell was washed with 200 μl of PR2. 100-200 μl of AMX for the first extension was flowed and incubated at 50°C for 5 min. The flow cell was washed with PR2, and 24 or 30 cycles of amplification were performed. Example 5 - Simultaneous indexing of gDNA fragments and cDNA

[0109] The following example demonstrates an embodiment of simultaneous indexing of gDNA fragments and cDNA from the same polymer beads.

[0110] Polymer beads were prepared as hollow polymer shells containing cells. Approximately 25–50 polymer beads were dispensed into wells of a microtiter plate and treated with cell lysis buffer to disrupt the cell membrane. Subsequently, gDNA was translocated using indexed Y-adapter transposomes, which consisted of transposons phosphorylated at the 5' end of both strands. Terminal transferase (TdT) was added to add multiple Ts to the 3' end of the non-transferred strand, allowing hybridization to the poly(A) tail of mRNA.

[0111] The gap between the gDNA and non-transferred strand of the transposon was filled in and ligated, and cDNA synthesis was performed by MMLV reverse transcriptase (RT). MMLVRT also added several additional dCMP bases to the 3' end of the cDNA molecule, which were then inserted into the template switching primer. The annealing primer (TSP) was base-paired with the oligo G sequence at the 3' end. The resulting TSP was extended and its sequence transferred to the 3' end of newly synthesized cDNA in a template switching reaction. The gDNA-cDNA hybrids formed contained three distinct consensus sequences, one at each end and one in the middle of the strand, separating the gDNA and cDNA portions of the hybrid molecules. These consensus sequences were used for both gDNA and cDNA library preparation.

[0112] In the lateral reaction, elongation of mRNA and template switching at the 3' end of the transposon were observed, but these activities did not affect the results. After RNAse H treatment and a brief wash, the contents of the polymer beads were heat-denatured and subjected to a circle ligation reaction. During this reaction, all single-stranded DNA molecules with phosphorylated 5' ends self-ligated into circles and served as templates for rolling circle amplification (RCA). In addition to gDNA-cDNA hybrids, individual tagmented DNAs and cDNA molecules generated from mRNA annealed to free-floating transposomes were also circularly ligated and amplified in the RCA reaction. Longer concatemers, containing multiple copies of the starting molecule, were retained within the polymer beads, increasing the sensitivity of the assay.

[0113] dsDNA less than approximately 1 kbp in length can pass through 15% PEG-MAL hollow polymer beads. Briefly, streptavidin-coated beads (approximately 10 μm in diameter) were encapsulated within the polymer beads. Following this, biotinylated amplicons of different sizes were allowed to diffuse within the polymer beads. As shown in Figures 13A-B, threshold diffusion limits, representing molecular size cutoffs, were determined across a range of amplicon sizes (e.g., 220 bp to 5000 bp).

[0114] Similarly, to test the compatibility of polymerase chain reaction (PCR) and the retention of genomic products, we designed a confinement model in which amplicon-conjugated polymer beads (using biotin-streptavidin conjugation chemistry) were loaded within the polymer beads. Linear amplification of these amplicons of variable sizes on the beads not only suggested that the polymer beads were PCR-compatible, but also allowed us to determine the molecular retention of 200 bp and 5 kbp amplified DNA fragments. The 200 bp product was able to diffuse into the surrounding polymer beads, while the 5 kbp product was retained within the polymer beads (Figure 14).

[0115] In addition to biomolecular assays that can increase the size of products that retain small molecules, polymeric beads can be composed of multilayered polymers that can control the diffusion of molecules based on charge, pH, temperature, or other environmental factors (Figure 15). Examples of such systems can include materials such as ionic and nonionic polymers, including alginate, polyethylene glycol, N-isopropylacrylamide, N,N-dimethylacrylamide, or other polymers described herein. Example 6 - Polymer beads with sacrificial cores

[0116] The following examples demonstrate embodiments for preparing polymeric beads with sacrificial cores.

[0117] Cores bearing sacrificial polymers were prepared with samples (cells or DNA). The cores contained a filler such as PEG or polyacrylamide, which was mixed with the sample to form polymer beads, as shown in Figure 16A. The beads were condensed with 50% isopropyl alcohol (IPA) and mixed with DHEBA / acrylamide containing KPS / TEMED (Figure 16B). This resulted in polymer beads encapsulated with a DHEBA shell. The DHEBA shell is unstable at the temperatures used for dehybridization and seeding, and elevated temperatures release the core from the DHEBA shell. Furthermore, the DHEBA polymer beads were treated with a reducing agent such as DTT, which, upon swelling in water, resulted in a DHEBA-acrylamide shell. Figure 16C shows a micrograph of DHEBA polymer beads corresponding to the schematic diagram shown in Figure 16B.

[0118] Another embodiment is a polymer bead with a DHEBA shell containing an agarose core, as shown in Figure 17A. Agarose-core beads were prepared in a similar manner to the polyacrylamide-core beads. A cell or DNA sample was mixed with agarose to form polymer beads using the methods described herein. The agarose beads can be functionalized and used to purify samples such as DNA. As shown in Figure 17B, the polymer beads were contacted with DHEBA to encapsulate the polymer beads. UV light may be used to initiate the construction of a DHEBA shell around the polymer beads. The agarose core was subjected to temperature or chemical digestion to melt the core, resulting in a hollow DHEBA shell, as shown in Figure 17C. Example 7 - Fluorescence-initiated gelation of polymer beads

[0119] The following examples demonstrate embodiments for preparing polymer beads using the fluorescence initiated gelation method.

[0120] A sample, such as cells or DNA, was obtained. The sample was contacted with a polymer having fluorescein isothiocyanate (FITC)-conjugated acrylate polymer (FITC-AETC) to coat the sample. As shown schematically in Figure 18A, the FITC-AETC-conjugated sample was contacted with radiation, such as light radiation, and a monomer to result in FITC-conjugated cells within the polymer gel. The resulting cells could be imaged without staining due to FITC interactions on the cell surface, as shown in Figures 18B and 18C. A control sample not coated with FITC-AETC showed no excitation. The fluorescein-initiated gelation described herein may also be performed in solution. When performed in solution, polymerization was initiated at the center of the bulk solution droplets. Triethanolamine (Triethanolamine) , TEA) was added in an amount of 210 mM to initiate gelation, and 0.05% NaHSO3 was also added.

[0121] The embodiments, examples, and figures described herein provide compositions, methods, and systems for maintaining biomolecules in a physically confined space during the process from lysis to library generation. Some embodiments provide libraries generated from single long DNA molecules or single cells that are released onto the surface of a flow cell in a confined space. As libraries from single DNA molecules or single cells in individual compartments are released onto the surface of the flow cell, the libraries from each compartment are seeded in close proximity to one another.

[0122] As used herein, the term "comprising" means "including ), "containing," or "characterized by" Synonymous, inclusive or open-ended, and does not exclude additional, unrecited elements or method steps.

[0123] The above description discloses some methods and materials of the present invention. The invention is susceptible to modifications of the methods and materials, and to changes in processing methods and equipment. Such modifications will become apparent to those skilled in the art from consideration of this disclosure or practice of the invention disclosed herein. Accordingly, it is not intended that the invention be limited to the particular embodiments disclosed herein, and it is not intended to cover all modifications and alternatives that fall within the true scope and spirit of the invention.

[0124] All references cited herein, including, but not limited to, published and unpublished applications, patents, and literature references, are incorporated by reference in their entirety and are hereby made a part of this specification. To the extent that publications and patents or patent applications incorporated by reference conflict with the disclosure contained herein, it is intended that the present specification supersede and / or supersede any such conflicting material. In certain embodiments, for example, the following items are provided: (Item 1) 1. A polymeric bead for carrying out multiple co-assay reactions, comprising: a hydrogel polymer precursor; a cross-linking agent; a biomolecule disposed within the polymer bead, the bead comprising pores that retain the biomolecule while allowing diffusion of reagents through the bead. (Item 2) 2. The beads according to item 1, wherein the beads are porous hydrogel beads or porous hollow beads. (Item 3) Item 10. The beads of item 1, wherein the beads comprise multiple polymer layers, each layer having a distinct pore size and pore density. (Item 4) 2. The bead of claim 1, wherein the pores are sized based on charge, pH, or temperature. (Item 5) Item 2. The beads according to item 1, wherein the beads have a diameter of about 50 μm to about 150 μm. (Item 6) The hydrogel polymer may be polyethylene glycol (PEG)-thiol / PEG-acrylate, PEG / maleimide (PEG / MAL), acrylamide / N,N'-bis(acryloyl)cystamine (BACy), N,N'-(1,2-dihydroxyethylene)bisacrylamide (DHEBA), PEG / polypropylene oxide (PPO), polyacrylic acid, poly(hydroxyethyl methacrylate) (PHEMA), poly(methyl methacrylate) (PMMA), poly(N-isopropyl methacrylate ... 2. The bead of item 1, comprising poly(p-acrylamide) (PNIPAAm), poly(lactic acid) (PLA), poly(lactic-co-glycolic acid) (PLGA), polycaprolactone (PCL), poly(vinyl sulfonic acid) (PVSA), poly(L-aspartic acid), poly(L-glutamic acid), polylysine, agar, agarose, alginate, heparin, alginate sulfate, dextran sulfate, hyaluronan, pectin, carrageenan, gelatin, chitosan, cellulose, or collagen. (Item 7) 2. The beads of claim 1, wherein the crosslinker comprises bisacrylamide, diacrylate, diallylamine, triallylamine, divinyl sulfone, diethylene glycol diallyl ether, ethylene glycol diacrylate, polymethylene glycol diacrylate, polyethylene glycol diacrylate, trimethylolpropane trimethacrylate, ethoxylated trimethylol triacrylate, or ethoxylated pentaerythritol tetraacrylate. (Item 8) 2. The bead according to item 1, wherein the biomolecule is a nucleic acid. (Item 9) 9. The bead according to item 8, wherein the nucleic acid is a DNA molecule of 50,000 base pairs or more. (Item 10) 2. The bead according to claim 1, wherein the reagents comprise an enzyme, a chemical, and a primer having a size of less than 50 base pairs. (Item 11) 2. The beads of item 1, wherein the reagents comprise lysozyme, proteinase K, random hexamers, polymerase (Φ29 DNA polymerase, Taq polymerase, Bsu polymerase), transposase (Tn5), primers (P5 and P7 adapter sequences), ligase, catalytic enzyme, deoxynucleotide triphosphates, buffer, or divalent cations. (Item 12) 2. The bead according to claim 1, wherein the bead further comprises a stabilizing shell encapsulating the bead. (Item 13) 13. The beads of claim 12, wherein the stabilizing shell comprises N,N'-(1,2-dihydroxyethylene)bisacrylamide (DHEBA), acrylate-PEG, and potassium peroxodisulfate (KPS). (Item 14) 2. The bead of claim 1, further comprising a fluorescent compound bound to the hydrogel polymer precursor. (Item 15) 15. The beads according to item 14, wherein the fluorescent compound is fluorescein isothiocyanate (FITC). (Item 16) 1. A method for performing multiple sequential co-assays on biomolecules encapsulated within polymer beads, comprising: Obtaining polymer beads encapsulating biomolecules according to item 1; and sequentially contacting the single cells with the reagents to perform multiple sequential co-assays. (Item 17) 17. The method of claim 16, further comprising adjusting the pore size of the polymer beads by adjusting the charge, pH, or temperature. (Item 18) 17. The method of claim 16, wherein the polymeric beads comprise multiple polymer layers, each polymer layer having pores of a distinct size, and the pore size of each polymer layer is specifically adjusted by varying the charge, pH, or temperature. (Item 19) 17. The method of claim 16, wherein the plurality of sequential co-assays comprises lysis, DNA analysis, RNA analysis, protein analysis, tagmentation, nucleic acid amplification, nucleic acid sequencing, DNA library preparation, assay for transposase-accessible chromatin using sequencing (ATAC-seq), continuous conserved transposition (CPT-seq), single-cell combinatorial indexing sequencing (SCI-seq), or single-cell genome amplification, or any combination thereof performed sequentially. (Item 20) 17. The method of claim 16, wherein the polymer beads encapsulating biomolecules are seeded on a solid support. (Item 21) 21. The method of claim 20, wherein the solid support is an etched surface, a well, a flow cell device, a microfluidic channel, a bead, or a column. (Item 22) 17. The method of claim 16, wherein the biomolecule is a nucleic acid. (Item 23) 23. The method of claim 22, wherein the nucleic acid is a DNA molecule of 50,000 base pairs or more. (Item 24) 17. The method of claim 16, further comprising performing a nucleic acid amplification reaction on the nucleic acid encapsulated in the polymer beads before performing a tagmentation reaction. (Item 25) 25. The method of claim 24, wherein the nucleic acid amplification reaction comprises multiple displacement amplification (MDA). (Item 26) 26. The method of claim 25, wherein the tagmentation reaction comprises contacting the biomolecule with a transposase mixture comprising an adapter sequence and a transposome. (Item 27) 20. The method of claim 19, further comprising plating the DNA library onto a solid support. (Item 28) 28. The method of claim 27, wherein seeding comprises cleaving the beads to release the DNA library from the beads. (Item 29) 29. The method of claim 28, wherein the beads are cleaved to release the DNA library by contacting the beads with a cleavage mix or by heating the beads to about 90°C. (Item 30) 30. The method of claim 29, wherein the cleavage mix comprises dithiothreitol (DTT), tris(2-carboxyethyl)phosphine (TCEP), or tris(3-hydroxypropyl)phosphine (THP). (Item 31) 28. The method of claim 27, wherein the solid support is a flow cell device.

Claims

[Claim 1] The invention as set forth in the drawings.