Pathogen Detection Systems

Abstract

Systems and devices for pathogen detection systems are described herein. For example, the pathogen detection system may include a pathogen detection device including an inlet, an outlet, and a reaction chamber; an imaging system including an excitation source and a fluorescence detection system; a substrate; and a heating element. In some examples, the pathogen detection system may be configured to detect one or more pathogens and / or viruses in a sample. For example, the pathogen detection device may receive a solution including at least one of DNA or RNA and send the solution to the reaction chamber. Upon heating the solution, the pathogen detection device may further receive a probe including one or more fluorescent dyes. The excitation source may excite the solution, and the detection system may detect the emission of the one or more fluorescent dyes.

Description

[Technical field]

[0001] The present application describes a pathogen detection system. [Background technology]

[0002] Polymerase chain reaction (PCR) systems can detect viruses or other pathogens, providing many benefits and opportunities to the general public. For example, PCR allows users to effectively and accurately detect the presence of viruses in biological samples. However, most conventional PCR systems and devices are very labor-intensive, expensive, and require advanced environmental control. Alternatives to conventional PCR devices include microfluidic devices, but these devices are generally expensive. Therefore, users may desire alternative, more affordable PCR devices.

[0003] CROSS-REFERENCE TO RELATED APPLICATIONS This PCT international application claims priority to U.S. patent application Ser. No. 18 / 153,260, entitled "PATHOGEN DETECTION SYSTEM," filed on January 11, 2023, which claims priority to U.S. Provisional Patent Application Ser. No. 63 / 299,156, filed on January 13, 2022, which is a nonprovisional application of said provisional application, the entire contents of which are incorporated herein by reference.

[0004] Reference to sequence listing The sequence listing associated with this application is provided in XML format instead of paper and is incorporated herein by reference. The XML file containing the sequence listing is named W058-0006US.xml. This text file is 158 KB, was created on January 5, 2023, and has been submitted electronically through the Patent Center. [Prior art documents] [Patent documents]

[0005] [Patent Document 1] U.S. Patent No. 5,283,173 [Patent Document 2] U.S. Patent No. 5,468,614

Non-licensed documents

[0006]

Non-patent document 1

Non-patent document 2

Non-patent document 3

Non-patent document 4

Non-patent document 5

Non-patent document 6

Non-patent document 7

Non-patent document 8

Non-licensed literature 9

Non-licensed literature 10

Non-licensed Document 11

Non-licensed Document 12

Non-licensed Document 13

Non-licensed Document 14

Non-licensed Document 15

Non-licensed Document 16

Non-licensed Document 17

Non-licensed Document 18

[0007] DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention will now be described in detail with reference to the accompanying drawings, in which the leftmost digit(s) of a reference number identifies the figure in which the reference number first appears. Use of the same reference number in different drawings indicates similar or identical items. The systems depicted in the accompanying drawings are not to scale, and components in the drawings may not be drawn to scale relative to each other. [Brief description of the drawings]

[0008] [Figure 1] FIG. 1 is a diagram showing an example of a pathogen detection system. [Diagram 2] FIG. 2 is a two-dimensional top view illustrating an example embodiment of a pathogen detection device. [Diagram 3] FIG. 3 is a schematic diagram showing a method for manufacturing a pathogen detection device. [Figure 4] FIG. 4 is a schematic diagram illustrating an alternative method of manufacturing a pathogen detection device. [Figure 5A] Figure 5A shows an example conformation of a pathogen molecular probe designed to bind to the RNA encoding the COVID spike protein. [Figure 5B] Figure 5B shows additional conformational examples of pathogen molecular probes designed to bind to RNA encoding the COVID spike protein. [Figure 6] FIG. 6 illustrates one example of a process for binding molecular probes to RNA or DNA target regions encoding pathogens to detect the presence of the pathogen in a sample. [Figure 7] FIG. 7 shows standard melting curves corresponding to binding of a molecular probe to an RNA or DNA target. [Figure 8]Figure 8 is a proof of principle of a molecular probe designed to bind to a DNA target that replicates the RNA that codes for the COVID spike protein. [Figure 9A] FIG. 9A shows a 3D printed microwell design for proof of principle of detecting molecular probes. [Figure 9B] FIG. 9B is an enlarged view of a portion of the periphery of the dotted square in FIG. 9A. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0009] Detailed Description As mentioned above, the current and traditional standard for detecting and diagnosing viruses and other pathogens is PCR. To detect a virus, the viral genomic deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) is extracted from the virion capsid and the complementary strand is multiplied many times using a special polymerase until the DNA or RNA can be detected (e.g., about one million times). Detection is usually performed using a DNA probe designed with a sequence specific to the virus strain one wants to detect. Probes include, for example, molecular beacons and / or intercalating dyes. Systems used to detect viruses can typically include a benchtop quantitative PCR (qPCR) machine with optical excitation and / or detection and a controlled thermal cycler to activate and copy the polymerase. The process usually requires about 30 to about 60 cycles of low temperature (about 20°C to about 50°C) to high temperature (about 80°C to about 90°C) to amplify the target DNA or RNA and detect the optical signal. A qPCR curve is then typically generated, showing the exponential growth of complementary DNA, if present, in the sample. The amount of original DNA or RNA can be traced back to a number of cycles calibrated to high sensitivity (e.g., down to 1-1000 genome copies / mL).

[0010] Because PCR is highly sensitive, the environment to detect the virus must be highly controlled, necessitating the use of various techniques such as HEPA filters, HVAC controls, laminar flow, and fume hoods. Furthermore, qPCR is performed in centralized laboratories by highly trained staff. To reduce the risk of impurities, some qPCR methods rely on automated equipment for sample preparation and detection of viruses and other pathogens. These automated qPCR methods have been developed for testing in centralized laboratory facilities, facilitating high throughput and rapid test turnaround times. These times are typically around 24 hours to 14 days. However, due to the nature of the viruses detected, patients from whom samples were taken may be quarantined while waiting for results to prevent further spread of the virus. In addition to the role of community health, such long isolation periods may force patients into isolation, resulting in serious psychological effects such as depression. Furthermore, long isolation periods may result in lost productivity, such as time off work. Therefore, a rapid test turnaround time is important. Receiving a negative result quickly allows patients to return to their social and workplace lives, improving their sense of well-being and productivity. Alternatively, receiving a positive result quickly may allow for appropriate contact tracing, retesting, and treatment, effectively avoiding the spread of infection and the progression of the epidemic.

[0011] Point-of-care (POC) pathogen detection devices are one way that patients can get rapid results. POC diagnostics is a medical approach that allows for the detection of viruses or other pathogens at the point where the patient receives medical care, such as a doctor's office, rather than sending the sample to a laboratory. Current PCR automation systems include POC devices that are installed within hospitals. For example, some POC PCR devices rely on a cartridge system. Such systems place the sample into a cartridge, which then places it into a thermal cycler. In some instances, optical detection systems may be used to detect the pathogen. These cartridges are generally made of plastic and may contain the reagents necessary to perform a specific test to detect the virus or other pathogen. However, these cartridges can be bulky and expensive to manufacture.

[0012] One solution to current POC PCR devices has been presented in the form of lab-on-a-chip (LOC) devices. LOC devices are capable of performing tests that are typically performed in a lab, but miniaturized onto a small chip. This offers advantages such as high throughput and automated processing. LOC devices typically contain microfluidic channels to transport the sample in the testing fluid. Using LOC devices for pathogen detection offers many advantages, including reduced sample volume, reagents, and waste footprint. However, LOC devices are typically very expensive to manufacture. For example, conventional LOC devices are manufactured using silicon microfabrication techniques that require clean rooms and highly trained operators.

[0013] The solution presents itself in the form of three-dimensional (3D) printing. 3D printing involves using computer-aided design (CAD) structures to create 3D shapes with material being added, bonded, or solidified in various ways (as opposed to being removed from the bulk material). Thus, LOC devices can be manufactured with 3D printing. Not only are the manufacturing costs of LOC devices significantly lower than traditional techniques, but 3D printing eliminates the need for clean rooms, countless tools, and trained specialists.

[0014] Pathogen Detection Systems The present application describes a 3D printed LOC pathogen detection system. For example, a system for pathogen detection can include a LOC device. The device can include, in some examples, an inlet, an outlet, and / or a reaction chamber. The system can further include an imaging system, which can include an excitation source and / or a fluorescence detection component. Additionally, the system can include a substrate and / or a heating element.

[0015] In some examples, the pathogen detection system may be configured to detect one or more viruses or other pathogens. Although the present disclosure describes a system configured to detect SARS-CoV-2, the system may be used to detect one or more of any virus or pathogen, including variants related to SARS-CoV-2. For example, the system may receive a solution containing a biological sample at an inlet of the pathogen detection device. For example, the system may receive at least one of DNA or RNA associated with the virus or pathogen to be detected by the system. The solution may include, for example, a buffer solution. The system then delivers the solution to a reaction chamber of the pathogen detection device for processing and detection.

[0016] In some examples, the system can heat the solution via a heating element to amplify DNA or RNA. For example, in examples where the solution contains DNA, a heating element can be used to activate the DNA amplification process. A variety of amplification processes can be used, such as PCR, Loop-Mediated Isothermal Amplification (LAMP), Nucleic Acid Sequence Based Amplification (NASBA), Self-Sustained Sequence Replication (3SR), Rolling Circle Amplification (RC), and Ligase Chain Reaction (LCR), to name a few. In some examples, the pathogen detection device containing the solution can be placed directly on the heating element. Heating elements include, for example, Peltier elements, heating blocks, thermoelectric cooling elements, hot plates, and / or resistive heaters.

[0017] The system can then receive at least one of a DNA probe or an RNA probe at the inlet of the pathogen detection system. In some examples, the probe includes one or more fluorescent dyes. Although the use of probes has been described, various other reporting mechanisms may be used, such as intercalating dyes or molecular beacons.

[0018] In some examples, the system can then excite the solution via an excitation source of an imaging system. The excitation source can contain an optical imaging system that includes a series of lenses and mirrors to shape and direct the optical excitation. In response to the excitation of the solution, the system can detect the emission of one or more fluorescent dyes via a fluorescence detection system. For example, the system can rely on various optical responses in detecting the emission of one or more fluorescent dyes, such as Raman scattering and Rayleigh scattering. The system can further rely on various detection devices, such as electron multiplying charge-coupled devices (EMCCDs), photomultiplier tubes (PMTs), charge-coupled devices (CCDs), single-photon avalanche diodes (SPADs), and optical power meters, to name a few.

[0019] In some examples, the LOC device can be fabricated using 3D printing methods. For example, the LOC can be fabricated using stereolithography (SLA) 3D printing, where light can be focused into a vat of undeveloped photocurable resin. The curable resin can have increased absorption as the wavelength of light decreases, thus decreasing the penetration depth of the light. Decreased penetration depth results in less resin polymerizing and more control of the Z-axis of the channel. The resin can also have a light absorption characterized from about 300 nanometers (nm) to about 1000 nm. The light source can include, but is not limited to, a digital light processing (DLP) projector with an LED light source from about 350 nm to about 380 nm. The light source can include, but is not limited to, a laser with a light spot raster scanned using a motorized mirror mount.

[0020] To manufacture the pathogen detection devices disclosed herein, for example, a build platform can be lowered into a vat of resin. As the build platform is lowered into the vat, a light source can be formed in a predetermined pattern. In some examples, the pattern can be preprogrammed by a user and / or another device. Light is projected through the resin vat onto the build platform, and undeveloped resin in contact with the light is solidified to form a single layer of developed resin on the build platform. In some examples, the build platform can be lowered one layer, recoated with new undeveloped resin, and the process repeated until the design is complete. The light source can be programmed to illuminate different patterns such that each layer of developed resin is comprised of a different pattern. In some examples, the pattern can be repeated. Once the process is complete, the build platform can be raised out of the vat of undeveloped resin, and the remaining undeveloped resin can be removed from the completed 3D pathogen detection device.

[0021] In an example, but not limited to, a pathogen detection device can be manufactured with a series of patterns to form a layer of developed resin. For example, once the build platform is lowered into a vat of undeveloped resin, the light source can emit a first pattern such that a first layer of resin is deposited on the build platform, the first layer being the developed resin. Additionally, the light source can emit light in a second pattern such that a second layer of resin is deposited on the first layer of resin. The second pattern can include first and second portions of developed resin and a third portion of undeveloped resin, the third portion being deposited between the first and second portions of the second layer. In this manner, the second layer of resin begins to form an outer wall of the pathogen detection device, the outer wall being comprised of the developed resin.

[0022] In some examples, the light source can emit a third pattern such that a third layer of resin is deposited on the second layer of resin. The third resin layer can include a first portion, a second portion, and a third portion, which can be developed resin. Additionally, the third layer can include a fourth portion and a fifth portion of resin, which can be undeveloped resin. In examples, the fourth portion of the resin of the third layer can be deposited between the first portion and the second portion of the third layer, and the fifth portion of the third layer can be deposited between the second portion and the third portion of the resin of the third layer. By doing so, the third layer can form a part of the pathogen detection device, such as at least a portion of the outer wall and at least a portion of one or more inner walls. In some examples, it can form a part of an outer resin cladding, which can be composed of undeveloped resin and surrounded by developed resin.

[0023] In some examples, the light source can emit a fourth pattern such that a fourth layer of resin is deposited on the third layer of resin. The fourth layer of resin can include a first portion, a second portion, a third portion, and / or a fourth portion, which can be developed resin. Additionally, the fourth layer can include a fifth portion, a sixth portion, and / or a seventh portion of resin, which can be undeveloped resin. In doing so, the fourth layer can be built on the third layer and extend the outer and / or inner walls of the outer cladding and define at least a portion of the inner resin cladding, which can be deposited within the outer resin cladding. In some examples, the inner resin cladding can be comprised of undeveloped resin and surrounded by developed resin.

[0024] In some examples, the light source may emit light in a third pattern such that a fifth layer of resin may be deposited on the fourth layer of resin. A fifth portion of the fourth layer of resin may be deposited between the first and second portions of the fourth layer, a sixth portion of the fourth layer of resin may be deposited between the second and third portions of the fourth layer, and a seventh portion of the fourth layer of resin may be deposited between the third and fourth portions of the fourth layer. As a result, the fifth layer may be built on the fourth layer, further extending the outer and / or inner walls of the outer cladding, completely forming an inner resin cladding surrounded by developed resin.

[0025] In some examples, the light source may emit light in a second pattern such that a sixth layer of resin may be deposited on the fifth layer of resin. By depositing the sixth layer, the outer and / or inner walls of the outer cladding are further elongated. Additionally, the light source may emit light in the first pattern such that a seventh layer of resin may be deposited on the sixth layer of resin. By doing so, the pathogen detection device is fully formed and an inner resin cladding may be deposited within the outer resin cladding.

[0026] To provide support for the internal structures, a user and / or another device can program the light source to create temporary support structures between layers and / or portions of layers, which can be later removed during fabrication.

[0027] In other examples, the manufacture of the pathogen detection device can include a "bottom-up" approach using inverted stereolithography. This process can require the manufacturing process to begin with lowering a build platform into contact with the bottom of a vat of resin. A light source can emit a first pattern upward through the vat of resin and into contact with the build platform, thereby solidifying and developing any undeveloped resin that the light may contact. In some examples, the vat can be tilted at a predetermined angle (up to 5 degrees as an example) and peeled away from the now-cured developed resin, leaving the developed resin attached to the build platform and peeling away from the bottom of the vat. New liquid undeveloped resin flows into the newly created space between the developed resin and the bottom of the vat, and the process is repeated until the pathogen detection device is completed.

[0028] In some instances, the pathogen detection device may undergo a surface roughening process called microfluidic curing. After 3D printing is used to fabricate the pathogen detection device, residual unpolymerized undeveloped resin may be present within the channels of the device. To remove this undeveloped resin, the channels are patterned to connect to microfluidic connectors and the remaining undeveloped resin is drained, leaving at least a layer of undeveloped resin. The remaining resin can be polymerized by exposure to a UVA lamp after drainage.

[0029] Pathogen Probes In addition to systems and methods for pathogen detection, the present application describes a pathogen probe designed to be used in the pathogen detection system (above) to detect viruses such as the virus SARS-CoV-2. For example, a pathogen probe was designed specifically for the spike protein of SARS-CoV-2. The probe was designed in silico using the National Center for Biotechnology Information (NCBI) protein and DNA sequence databases that contain currently known SARS-CoV-2 strains (as of October 2021). A specific conserved region of the genome (responsible for encoding the spike protein) was selected, and a 36-base hairpin shaped pathogen probe was designed to denature at approximately 60°C: 5'-GCGGGCGAAAAGTAGATCTTCAATAAATGAGCCCGC-3' (SEQ ID NO: 1). Simulation of likely RNA sequences yielded five likely confirmations, as described below with respect to FIG. 4. SARS-CoV-2 specific pathogen probes were then ordered from Integrated DNA Technologies, Inc. along with the corresponding red dye (TYE665), quencher, and a 100 base oligonucleotide corresponding to the SARS-CoV-2 genome: 5'-ACAAATATTACCAGATCCATCAAAACCAAAGCAAGAGG TCATTTATTGAAGATCTACTTTTC AACAAAGTGACACTTGCAGATGCTGGCTCATCAAACAA-3' (SEQ ID NO: 2), where the underlined portion is complementary to the pathogen probe. Melting curves were obtained to confirm the functionality of the probe using a thermal cycler. A proof-of-principle experiment was performed by 3D printing a microarray with 1,166 microwell reaction chambers measuring approximately 116 μm by approximately 116 μm, as described below with reference to FIG. 7. EXAMPLES

[0030] Example Pathogen Detection System Embodiments 1-4 show exemplary embodiments for detecting pathogens using pathogen detection systems and pathogen detection devices. For example, FIG. 1 shows an exemplary pathogen detection system 100. The pathogen detection system 100 may include a pathogen detection device 102, which will be described below with respect to FIG. 2. The pathogen detection device 102 may include an inlet 104, an outlet 106, and a reaction chamber (not shown in this embodiment). In some examples, the pathogen detection system 100 may be configured to detect one or more pathogens or viruses. For example, the system may receive a solution at the inlet of the pathogen detection device 102. The solution may contain at least one of DNA and / or RNA of one or more viruses and / or pathogens that the pathogen detection system 100 may detect. The DNA or RNA may be, in some examples, from Streptococcus, Staphylococcus aureus, Methicillin-resistant Staphylococcus aureus (MRSA), Escherichia coli, E. Coli, Salmonella, Shigella, Clostridium difficile (C.difficile, tuberculosis, anthrax, mycoplasma, chlamydophila, legionella, Bordetella pertussis, Clostridium tetani, Borrelia burgdorferi, Borrelia mayonii, Clostridium botulinum, Vibrio cholera, Neisseria meningitides, Haemophilus influenza, Listeria monocytogenes, Treponema pallidum, Gardnerella vaginalis, Neisseria gonorrhoeae and encoding a product that may be the complement of one or more pathogens such as C. gonorrhoeae, candida albicans, lactobacillus, microsporum canis, tinea pedis, Candida, Aspergillus, Histoplasma, Cryptococcus neoformans (C. neoformans), Blastomyces, Coccidioides, protozoa, helminths, and ectoparasites that cause diseases such as malaria, toxoplasmosis, trichomoniasis, giardiasis, tapeworms, roundworms, lice, scabies, leishmaniasis, and river blindness.

[0031] In some examples, the solution may also include a buffer, which may consist of TE buffer, TAE buffer, TBE buffer, tris(hydroxymethyl)aminomethane (tris), ethylenediaminetetraacetic acid (EDTA), boric acid, acetic acid, HCl, NaOH, NaCl, MgCl, cetyltrimethylammonium bromide (CTAB), polyvinylpyrrolidone (PVP), isopropanol, ethanol, RNase, DNase, potassium acetate, ultrapure water, water (HO), or NHCl. In some examples, the pathogen detection device 102 may be coupled to a substrate that may comprise silicon, a glass slide, fused silica, quartz, sapphire, gallium nitride, germanium, Gorilla Glass, indium tin oxide, lithium tantalate, silicon nitride, germanium silicon, silicon carbide, epitaxial silicon, silicon-on-insulator (SOI), single crystal quartz, aluminum oxide, Corning Eagle Glass, borosilicate, BK7 glass, soda-lime glass, thermal oxide, zinc oxide, II-V semiconductors, II-VI semiconductors, solar cells, charged coupled devices, and liquid crystal displays, to name a few.

[0032] In some examples, the pathogen detection device 102 may be coupled to a heating element 110. The heating element may include a Peltier element, a heating block, a thermoelectric cooler, a hot plate, and / or a resistive heater, to name a few non-limiting examples. In some examples, the application of heat to the pathogen detection device 102 may initiate amplification of the DNA and / or RNA contained in the solution. A variety of amplification processes may be used, such as PCR, Loop-Mediated Isothermal Amplification (LAMP), Nucleic Acid Sequence Based Amplification (NASBA), Self-Sustained Sequence Replication (3SR), Rolling Circle Amplification (RC), and Ligase Chain Reaction (LCR), to name a few.

[0033] In some examples, the pathogen detection device 102 can receive at least one of a DNA and / or RNA probe at an inlet 104 of the pathogen detection device 102, as described below with respect to Figures 4-6. In response to receiving the probe, the pathogen detection system 100 can then excite the solution containing the DNA and / or RNA and the probe via an excitation source 114. The excitation source can include an optical imaging system including a series of lenses and mirrors for shaping and directing optical excitation.

[0034] In response to excitation of the solution containing the DNA and / or RNA and the probes, the pathogen detection system 100 can then detect the emission 118 of one or more fluorescent dyes via the detection system 116. For example, the pathogen detection system 100 may rely on various optical responses, such as Raman scattering and Rayleigh scattering, in detecting the emission of the one or more fluorescent dyes. The system may further rely on various detection devices, such as electron multiplying charge-coupled devices (EMCCDs), photomultiplier tubes (PMTs), charge-coupled devices (CCDs), single photon avalanche diodes (SPADs), and optical power meters, to name a few.

[0035] 2 is a two-dimensional top view of an exemplary pathogen detection device 200. As described above with respect to FIG. 1 and similar to the pathogen detection device 102, the pathogen detection device 200 may be implemented in a pathogen detection system such as the pathogen detection system 100. For example, the pathogen detection device 200 may include an inlet 202, an outlet 204, and / or a reaction chamber 206. In some examples, an input sample, such as a buffer solution containing DNA and / or RNA, may be introduced into the pathogen detection device 200 via the inlet 202. The solution is then sent to the reaction chamber 206 for processing and detection. As an example, in the case of DNA detection, viral genomic DNA is mixed with a reagent and sent to the reaction chamber 206 for DNA amplification.

[0036] In some examples, the inlet 202 and / or outlet 204 may be connected using syringes and / or other pumps via microfluidic tubing that may transfer samples from one reaction chamber to another and introduce reagents, fluids, and / or gases, to name a few non-limiting examples.

[0037] Although the current embodiment depicts a simple inlet 202, outlet 204, and reaction chamber 206, the pathogen detection device 200 may include any number of inlets 202, outlets 204, and reaction chambers 206, which may perform multiplexed sample testing for one or more samples of DNA and / or RNA corresponding to detectable pathogens and / or viruses. In the case of multiple reaction chambers 206, the same or different reagent(s) may be introduced into the inlet 202 depending on the pathogens and / or viruses being tested for.

[0038] Figures 3 and 4 show schematic diagrams of a method of manufacturing a pathogen detection device, which may be the same as or similar to that described with respect to Figures 1 and 2. Although the operations described with respect to Figures 3 and 4 are described in stepwise steps, it should be understood that the steps may be performed in a different order and / or in parallel and may include more or fewer steps than are illustrated.

[0039] 3 shows a schematic 300 of a method for manufacturing a pathogen detection device. In an example, the pathogen detection device may be manufactured using a series of patterns to generate layers of developed resin. For example, but not limited to, the pathogen detection device may be manufactured using SLA 3D printing using a DLP projector that emits light in a user specified pattern.

[0040] In step 1, the build platform 302 may be lowered into a vat of undeveloped UV-curable resin, but is not limited to this. The resin may be made from a formulation consisting of poly(ethylene glycol) diacrylate (PEGDA) monomer as a base and cured with a photoinitiator, bis(2,4,6-trimethylbenzoyl)-phenylphosphine oxide (Irgacure 819). In some examples, an additive UV absorber may be added to optimize the z-height details of the microfluidic channel. The UV absorber may contain, but is not limited to, avobenzone. In some examples, the resin may be sensitive to the light source of the 3D printer, for example, light at about 365 nm. This sensitivity makes the resin transparent to visible light when printing the pathogen detection device, allowing the light to travel through the pathogen detection device. In some examples, the resin may be multi-layered. The layers may include, for example, microfluidic channels, mixers, optical waveguides, heaters, filters, photodetectors, chemical detector reaction chambers, power sources, conductors, etc.

[0041] In some examples, the light source can emit one or more lasers of specified wavelengths in a first pattern of light that is directed toward the build platform 302. Upon contact with the undeveloped resin, the undeveloped resin polymerizes and forms a first layer 304 of developed resin deposited on the build platform 302. In examples, the pattern of light can be pre-programmed and determined by a user and / or another machine.

[0042] In step 2, the light source can emit light in a second pattern toward the build platform 302 and the first layer of developed resin 304, depositing a second layer of resin onto the first layer of developed resin 304. In some examples, the second pattern can emit light such that certain portions of the undeveloped resin come into contact with the light and polymerize the undeveloped resin to produce developed resin, while other portions of the undeveloped resin remain undeveloped. For example, the light source can emit light in the second pattern such that the second layer of resin can include portions of developed resin 306, while a second portion remains undeveloped resin 308, and the second layer of undeveloped resin 306 is deposited between portions of the second layer of developed resin 308.

[0043] In step 3, the light source can emit light in a third pattern such that a third layer of resin is deposited on the second layer of resin, including the second layer of developed resin 304 and the second layer of undeveloped resin 308. Similar to step 2, the third pattern can include portions of developed resin 310 and portions of undeveloped resin 312, with portions of the third layer of undeveloped resin 312 deposited between the third layer of developed resin 310.

[0044] In step 4, the light source can emit light in a fourth pattern such that a fourth layer of resin is deposited on the third layer of resin, including the third layer of developed resin 310 and the third layer of undeveloped resin 312. Similar to steps 2 and 3, the fourth pattern can include portions of developed resin 314 and portions of undeveloped resin 316, with portions of the fourth layer of undeveloped resin 316 deposited between portions of the fourth layer of developed resin 314.

[0045] In step 5, the light source may emit light in a third pattern such that a fifth layer of resin is deposited on the fourth layer of resin, including the fourth layer of developed resin 314 and the fourth layer of undeveloped resin 316, similar to step 3. Similar to steps 2, 3, and 4, the fifth pattern may include portions of developed resin 318 and undeveloped resin 320, with portions of the fifth layer of undeveloped resin 320 deposited between portions of the fifth layer of developed resin 318.

[0046] In step 6, the light source may emit light in a second pattern similar to step 2 such that a sixth resin layer is deposited on the fifth resin layer including the fifth developed resin layer 318 and the fifth undeveloped resin layer 320. Similar to steps 2, 3, 4, and 5, the sixth pattern may include portions of developed resin 322 and undeveloped resin 324, with portions of the sixth layer of undeveloped resin 324 deposited between portions of the sixth layer of developed resin 322.

[0047] In step 7, the light source can emit light in a first pattern such that a seventh layer of resin is deposited over the sixth layer of resin, which includes sixth layer of developed resin 322 and sixth layer of undeveloped resin 324, similar to step 1. Similar to step 1, the seventh layer can include a portion of developed resin 326.

[0048] In step 8, the pathogen detection device is inverted and the undeveloped resin is drained.

[0049] FIG. 4 shows a schematic 400 of an alternative method of manufacturing a pathogen detection device. The method illustrated in FIG. 4 may be the same as or similar to the method illustrated in FIG. 3 described above. For example, in step 1, by way of non-limiting example, a build platform 402 may be lowered into a vat of undeveloped UV-curable resin. In some examples, the resin may be sensitive to a 3D printer light source, such as 365 nm light. In some examples, the light source may emit one or more lasers of a specified wavelength in a first pattern of light directed toward the build platform 402. Upon contact with the undeveloped resin, the undeveloped resin polymerizes to form a first layer of developed resin 404.

[0050] In step 2, the light source can emit light in a second pattern toward the build platform 402 and the first layer of developed resin 404 such that a second layer of resin can be deposited on the first layer of developed resin 404. In some examples, the second pattern can emit light such that certain portions of the undeveloped resin come into contact with the light and polymerize the undeveloped resin to produce developed resin, while other portions of the undeveloped resin remain undeveloped. For example, the light source can emit light in the second pattern such that the second layer of resin includes portions of developed resin 406, while a second portion remains undeveloped resin 408, and the second layer of undeveloped resin 406 is deposited between portions of the second layer of the second developed resin 408.

[0051] In step 3, the light source can emit light in a third pattern such that a third layer of resin is deposited on the second layer of resin, including the second layer of developed resin 404 and the second layer of undeveloped resin 408. Similar to step 2, the third pattern can include portions of developed resin 410 and portions of undeveloped resin 412, with portions of the third layer of undeveloped resin 412 deposited between the third layer of developed resin 410.

[0052] In step 4, the pathogen detection device is inverted and the undeveloped resin is discharged.

[0053] Example Pathogen Probe Embodiments 5A and 5B show exemplary conformations 500a and 500b of pathogen probes, depicted in the current embodiment as hairpin probes, designed to the spike protein of SARS-CoV-2. For example, pathogen probes were designed using NCBI's protein and DNA sequence databases that contained SARS-CoV-2 strains as they were known at the time. A specific conserved region of the genome was selected, and a 36 base pathogen probe was designed to denature at approximately 60° C.:

[0054] 5'-GCGGGCGAAAAGTAGATCTTCAATAAATGAGCCCGC-3' (sequence number 1).

[0055] Possible derivatives of the probe include, for example, but are not limited to, the following: 5'-GCGGGCTCATTTATTGAAGATCTACTTTTCGCCCGC-3' (SEQ ID NO: 3), 5'-CGCCCGCTTTTCATCTAGAAGTTATTTACTCGGGCG-3) (SEQ ID NO: 4), 5'-GCGGGCGAAAAGUAGAUCUUCAAUAAAUGAGCCCGC-3' (SEQ ID NO:5), 5'-GCGGGCUCAUUUAUUGAAGAUCUACUUUUCGCCCGC-3' (SEQ ID NO: 6), 5'-CGCCCGCUUUUCAUCUAGAAGUUAUUUACUCGGGCG-3' (sequence number 7). From the simulation of the likely RNA sequences, we obtained 5 likely conformations 400 with the highest melting temperature of approximately 63.4 °C. In some examples, the pathogen probe can include a corresponding dye, such as a red dye (TYE665), a quencher, and / or a 100 base oligonucleotide corresponding to the SARS-CoV-2 genome: 5'-ACAAATATTACCAGATCCATCAAAACCAAAGCAAGAGG TCATTTATTGAAGATCTACTTTTCAACAAAGTGACACTTGCAGATGCTGGCTCATCAAACAA-3' (SEQ ID NO:2), where the underlined portion is complementary to the pathogen probe.

[0056] Alternatively, a different segment of the SARS-CoV2 genome was selected 5'-AGUCAGUGUGUUAAUCUUACAACCAGAACUCAAUUACCCCCUGCAUACACUAAUUCUUUCACACGUGGUGUUUAUUACCCUGACA-3' (SEQ ID NO: 15) or its DNA equivalent 5'-AGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACA-3' (SEQ ID NO: 16). The DNA equivalent, reverse complement, of the target SARS-CoV2 genome sequence is 5'-TGTCAGGGTAATAAACACCACGTGTGAAAGAATTAGTGTATGCAGGGGGTAATTGAGTTCTGGTTGTAAGATTAACACACTGACT-3' (SEQ ID NO: 27).

[0057] These correspond to the following primers: Forward primer: 5'-AGTCAGTGTGTTAATCTTACAACC-3' (SEQ ID NO: 17) and Reverse primer: 5'-TGTCAGGGTAATAAACACCACG-3' (sequence number 18).

[0058] The reverse complements of these primers are as follows: Forward primer: 5'-GGTTGTAAGATTAACACACTGACT-3' (SEQ ID NO: 19) and Reverse primer: 5'-CGTGGTGTTTATTACCCTGACA-3' (sequence number 20).

[0059] Various pathogen probes were designed from the genomic sequences of SEQ ID NO: 15 and 16. Possible probe designs include, but are not limited to, the following: 5'-GCGCCCTGTCAGGGTAATAAACACCACGTGTGAAAGAATTGGGCGC-3' (SEQ ID NO: 21), 5'-TGCAGGGGGTAA-3' (SEQ ID NO: 22), 5'-CGCCCGTTCTGGTTGTAAGATTAACACACTGACTCGGGCG-3' (SEQ ID NO: 23), 5'-GCGCCCAATTCTTTCACACGTGGTGTTTATTACCCTGACAGGGCGC-3' (SEQ ID NO: 24), 5'-TTACCCCCTGCA-3' (SEQ ID NO: 25), 5'-CGCCCGAGTCAGTGTGTTAATCTTACAACCAGAACGGGCG-3' (SEQ ID NO: 26), 5'-GCGCCCUGUCAGGGUAAUAAACACCACGUGUGAAAGAAUUGGGCGC -3' (SEQ ID NO: 28), 5'-UGCAGGGGGUAA-3' (SEQ ID NO:29), 5'-CGCCCGUUCUGGUUGUAAGAUUAACACACUGACUCGGGCG-3' (SEQ ID NO: 30), 5'-CGCGGGACAGUCCCAUUAUUUGUGGUGCACACUUUCUUAACCCGCG-3' (SEQ ID NO: 31), 5'-UUACCCCCUGCA-3' (SEQ ID NO:32), and 5'-CGCCCGAGUCAGUGUGUUAAUCUUACAACCAGAACGGGCG-3' (sequence number 33).

[0060] FIG. 6 illustrates an exemplary process 600 for binding a probe to the spike protein of SARS-CoV-2 to detect the presence of the virus in a sample. Process 600 can be implemented in a pathogen detection device in a pathogen detection system, as described above and with respect to FIGS. 1-4. For example, step 1 (designated "1") illustrates a pathogen probe 502 designed to bind to the spike protein of SARS-CoV-2. The probe 602 can include a fluorophore 604, which can be a type of fluorescent probe that fluoresces when illuminated with a particular wavelength of light. The probe can also include a quencher 606, which absorbs light of a particular frequency and / or color range. In some examples, one or more portions of the stem 608 of the pathogen probe 602 are complementary to allow the quencher to bind to the fluorophore.

[0061] Step 2 (designated "2") shows the probe 602 after being exposed to heat, such as the heating element 106 described in Figure 1. For example, in response to the application of heat to a sample containing the probe 602, the probe 602 can unbind and the fluorophore 604 and quencher 606 can separate from one another. In some examples, the fluorophore 604 and quencher 606 can be at a distance from one another such that the fluorophore can fluoresce.

[0062] In step 3 (denoted with "3"), SARS-CoV-2 complementary DNA (cDNA) can bind to the probe 602. For example, if the sample contains SARS-CoV-2 cDNA, the cDNA will preferentially bind to the probe 602. In some instances, the temperature increased in step 2 may be decreased. Probe 602 that is bound to the cDNA may be prevented from refolding and may fluoresce. However, unbound probe 602 may refold in a manner similar to that depicted in step 1. Thus, the more target DNA present in the sample, the more fluorescence may be detected from the sample.

[0063] FIG. 7 shows a standard melting curve corresponding to the process shown in FIG. 6. For example, the probe is bound at a first temperature, as shown at "1". However, increasing the temperature beyond the melting point 702 causes the probe to become unbound, as shown at "2". In some instances, the sample containing the probe contains complementary DNA, which binds to the unbound probe and fluoresces. However, in some instances, the sample does not contain complementary DNA, as shown at "3", and the probe remains unbound to the complementary DNA. In response to decreasing the temperature, the unbound probe rebinds to itself and fluoresces little.

[0064] FIG. 8 shows the proof of principle of the probe. For example, to generate images 800(a) and 800(b) and corresponding intensity plots 800(c) and 800(d), the probe containing no complementary target DNA was introduced into a qPCR thermal cycler and the temperature was increased from about 25° C. to about 90° C., held for about 20 seconds, and decreased to about 25° C. for five cycles. Reagents were then introduced using various conditions and probed using qPCR to obtain melting curves. In some instances, when the probe itself was introduced into the qPCR alone, the fluorescence was low, indicating the absence of target DNA. Similarly, when the probe was mixed with random plasmid DNA and introduced into the qPCR cycle, the fluorescence was also low, indicating the absence of target DNA. However, when the designed probe mixed with complementary synthetic target DNA was introduced into the qPCR cycle, the probe bound to the complementary DNA and emitted high fluorescence, indicating the presence of target DNA.

[0065] Combinations of these reagents were introduced into a 3D printed microwell array device, such as the pathogen detection device described in Figures 1-4, and imaged with a confocal microscope system using orange excitation and collection red fluorescence bandpass filters. 800a shows an image of fluorescence imaged using a confocal microscope, in which the probe and negative plasmin random DNA were present. As shown, no fluorescence was detected. Alternatively, as shown in 800b, target DNA complementary to the probe was introduced, resulting in a high level of fluorescence, indicating positive and specific detection of the target DNA strand (synthetic SARS-CoV-2 nucleic acid).

[0066] Intensities were extracted from portions of images 800(a) and 800(b) and plotted in 800(c) and 800(d), respectively. As depicted, for the plasmid DNA sample shown in 800(b), the intensity is 2 ± 1 relative units. However, when target DNA is present, the intensity is 80 ± 1, resulting in a signal-to-noise ratio (SNR) of ~7 for a positive sample, suggesting that a limit-of-detection (LOD) of less than ~300 nM is possible.

[0067] 9A and 9B show alternative embodiments of the proof of principle of the probe. FIG. 9A shows a 3D printed microwell design 900(a) of an exemplary pathogen detection device. For example, a proof of principle experiment was performed by 3D printing a microarray reaction chamber consisting of 1,166 microwells with dimensions of about 116 μm by about 116 μm, similar to that described with respect to FIG. 8. FIG. 9B shows an example bright field microscope image 900(b) of a 3D printed microwell similar to that depicted in FIG. 9A. For example, FIG. 9B shows an image showing the presence of target DNA in the pathogen detection device. For example, when the designed probe mixed with complementary synthetic target DNA is introduced into the pathogen detection device, the probe binds to the complementary DNA and emits high fluorescence, indicating the presence of the target DNA.

[0068] Variants of the sequences disclosed and referenced herein are also included. Variants of the nucleic acid sequences of the probes disclosed herein include sequences having at least 70% sequence identity, 80% sequence identity, 85% sequence identity, 90% sequence identity, 95% sequence identity, 96% sequence identity, 97% sequence identity, 98% sequence identity, or 99% sequence identity to the nucleic acid sequences disclosed herein.

[0069] "Percent sequence identity" refers to the relationship between two or more sequences, as determined by comparing the sequences. In the art, "identity" also means the degree of sequence relatedness between nucleic acid sequences, as determined by the match between strings of such sequences. "Identity" (often called "similarity") can be readily calculated by known methods, including those described in: Computational Molecular Biology (Lesk, A. M., ed.) Oxford University Press, NY (1988) (Non-Patent Document 1); Biocomputing: Informatics and Genome Projects (Smith, D. W., ed.) Academic Press, NY (1994) (Non-Patent Document 2); Computer Analysis of Sequence Data, Part I (Griffin, A. M., and Griffin, H. G., Humana Press, NJ (1994) (Non-Patent Document 3); Sequence Analysis in Molecular Biology (Von Heijne, G., ed.) Academic Press (1987) (Non-Patent Document 4); and Sequence Analysis Primer (Gribskov, M. and Devereux, J., eds.) Oxford University Press, NY (1997) (Non-Patent Document 5). Press, NY (1992) (Non-Patent Document 5). Preferred methods for determining identity are designed to give the best match between the sequences tested. Methods for determining identity and similarity are codified in publicly available computer programs. Sequence alignment and percent identity calculation can be performed using the Megalign program of the LASERGENE bioinformatics computing suite (DNASTAR, Inc. Madison, Wisconsin). Multiple alignment of sequences can also be performed using the Clustal method of alignment (Higgins and Sharp CABIOS, 5, 151-153 (1989) (Non-Patent Document 6)) with default parameters (GAP PENALTY=10, GAP LENGTH PENALTY=10).Related programs include the GCG family of programs (Wisconsin Package Version 9.0, Genetics Computer Group (GCG), Madison, Wisconsin); BLASTP, BLASTN, BLASTX (Altschul, et al. Biol. 215:403-410 (1990) (Non-Patent Document 7); DNASTAR (DNASTAR, Inc., Madison, Wisconsin); and the FASTA program incorporating the Smith-Waterman algorithm (Pearson, Comput. Methods Genome Res., [Proc. Int Symp.] (1994), Meeting Date 1992, 111-20. Editor: Suhai, Sandor. Publisher: Plenum, New York, N ... In the context of this disclosure, when sequence analysis software is used for analysis, it will be understood that the analysis results will be based on the "default values" of the program referenced. As used herein, "default values" refers to a set of values ​​or parameters that are initially loaded into the software when it is first initialized.

[0070] Variants also include nucleic acid molecules that hybridize to the sequences disclosed herein under stringent hybridization conditions and provide the same function as the reference sequences. Exemplary stringent hybridization conditions include overnight incubation at 42°C in a solution containing 50% formamide, 5X SSC (750mM NaCl, 75mM trisodium citrate), 50mM sodium phosphate (pH 7.6), 5X Denhardt's solution, 10% dextran sulfate, and 20μg / ml denatured, sheared salmon sperm DNA, followed by washing in 0.1X SSC at 50°C. The change in stringency of hybridization and signal detection is mainly achieved by manipulating formamide concentration (lower percentage of formamide results in lower stringency), salt conditions, or temperature. For example, moderately stringent conditions include overnight incubation at 37°C in a solution containing 6XSSPE (20XSSPE=3M NaCl; 0.2M NaH2PO4; 0.02M EDTA, pH 7.4), 0.5% SDS, 30% formamide, 100 μg / ml salmon sperm blocking DNA, followed by washing with 1XSSPE, 0.1% SDS at 50°C. In addition, to achieve even lower stringency, post-stringent hybridization washes can be performed at higher salt concentrations (e.g., 5X SSC). Modifications to the above conditions are accomplished by including or substituting alternative blocking reagents used to suppress background in hybridization experiments. Typical blocking reagents include Denhardt's reagent, BLOTTO, heparin, denatured salmon sperm DNA, and commercially available proprietary formulations. The inclusion of certain blocking reagents may require adjustments to the above hybridization conditions due to compatibility issues.

[0071] "Specifically binds" means that the affinity or Ka (i.e., the equilibrium association constant for a particular binding interaction, expressed in units of 1 / M) is greater than or equal to 10 5 M -1"Specific binding" refers to the association of two binding molecules that are as described above, but do not significantly associate with other molecules or components in the relevant environmental sample. As used herein, "specific binding" is also referred to as "binding." Binding can be classified as "high affinity" or "low affinity." In certain embodiments, "high affinity" refers to a binding that is at least 10 7 M -1 , at least 10 8 M -1 , at least 10 9 M -1 , at least 10 10 M -1 , at least 10 11 M -1 , at least 10 12 M -1 , or at least 10 13 M -1 In certain embodiments, "low affinity" refers to binding with a Ka of up to 10 7 M -1 , up to 10 6 M -1 , up to 10 5 M -1 A Ka of 0.01 or less is used to refer to binding having a Ka of 0.01 or less. Various assays for detecting binding as well as determining binding affinity are known, such as Western blot, ELISA, and BIACORE® analysis (see, for example, Scatchard et al., 1949, Ann. NY Acad. Sci. 51:660 (Non-Patent Document 9); and U.S. Patent No. 5,283,173 (US 5,283,173), U.S. Patent No. 5,468,614 (US 5,468,614), or equivalents thereof).

[0072] Unless otherwise indicated, embodiments of the present disclosure may employ conventional techniques of immunology, molecular biology, microbiology, cell biology, and recombinant DNA. These methods are described in the following publications: For example, Sambrook et al., Molecular Cloning. A Laboratory Manual, 2nd Edition (1989) (Non-Patent Document 10); FMA Usubel, et al. eds., Current Protocols in Molecular Biology, (1987) (Non-Patent Document 11); series Methods IN Enzymology (Academic Press, Inc.) (Non-Patent Document 12); M. MacPherson, et al., PCR: A Practical Approach, IRL Press at Oxford University Press (1991) (Non-Patent Document 13); MacPherson et al., eds. PCR 2 (Non-Patent Document 14): Practical Approach, (1995) (Non-Patent Document 15); Harlow and Lane, eds. Antibodies, A Laboratory Manual, (1988) (Non-Patent Document 16); and RIFreshney, eds. Animal Cell Culture (1987) (Non-Patent Document 17).

[0073] The RNA encoding the viral protein may be derived from adenovirus, arenavirus, bunyavirus, coronavirus, flavivirus, hantavirus, hepadnavirus, herpesvirus, papillomavirus, paramyxovirus, parvovirus, picornavirus, poxvirus, orthomyxovirus, retrovirus, reovirus, rhabdovirus, rotavirus, sponge virus, or togavirus. In certain embodiments, the RNA encoding the viral protein may be derived from SARS-COV-2, CMV, EBV, flu viruses, hepatitis A, B, or C, herpes simplex, HIV, influenza, Japanese encephalitis, measles, polio, rabies, respiratory syncytial (RS), rubella, smallpox, varicella, West Nile, and / or Zika.

[0074] CMV proteins include envelope glycoprotein B and CMV pp65, EBV proteins include EBV EBNAI, EBV P18 and EBV P23, hepatitis proteins include hepatitis B virus S, M and L proteins, hepatitis B virus Pre-S antigen, HBCAG DELTA, HBV HBE, hepatitis C virus RNA, HCV NS3 and HCV NS4, herpes simplex proteins include immediate early protein and glycoprotein D, human immunodeficiency virus (HIV) proteins include HIV gp32, HIV gp41, HIV gp120, HIV gp160, HIV P17 / 24, HIV P24, HIV P55 GAG, HIV P66 POL, HIV TAT, HIV These include gene products of the gag, pol and env genes such as GP36, Nef proteins and reverse transcriptase, human papillomavirus (HPV) viral antigens include the L1 protein, influenza proteins include hemagglutinin and neuraminidase, Japanese encephalitis proteins include proteins E, ME, ME-NS1, NS1, NS1-NS2A and 80%E, malaria proteins include the Plasmodium proteins circumsporozoite, circumsporozoite (CSP), glutamate dehydrogenase, lactate dehydrogenase and fructose bisphosphate aldolase, measles proteins include measles virus fusion protein, rabies proteins include rabies glycoprotein and rabies nucleoprotein, respiratory syncytial proteins include RSV fusion protein and M2 protein, rotavirus proteins include VP7sc, rubella proteins include E1 protein and E2 protein, varicella zoster proteins include gpl and gpll, and Zika proteins include pre-membrane, envelope (E), domain III of E protein, and nonstructural proteins 1-5.

[0075] Additional specific exemplary viral protein sequences include:

[0076] [Table 1]

[0077] For examples of other viral antigens, see Fundamental Virology, Second Edition, eds. Fields, BN and Knipe, DM (Raven Press, New York, 1991) (Non-Patent Document 18).

[0078] conclusion Although the above discussion illustrates example implementations of the described apparatus and techniques, other architectures may be used to achieve the described functionality and are intended to be within the scope of this disclosure. Moreover, while the subject matter has been described in language specific to structural features and / or methodological acts, it should be understood that the subject matter defined in the appended claims is not necessarily limited to the specific features or acts described. Rather, the specific features and acts are disclosed as example forms of implementing the claims.

Claims

1. entrance, Exit, and reaction Chamber A pathogen detection device comprising: An excitation source, and Fluorescence Detection System an imaging system including: A substrate; Heating element and A pathogen detection system comprising: The pathogen detection system comprises: receiving a solution containing at least one of DNA or RNA at an inlet of the pathogen detection device; delivering said solution to a reaction chamber of said pathogen detection device; heating the solution via the heating element; receiving at least one of a DNA probe or an RNA probe, and one or more fluorescent dyes containing said probe, at an inlet of the pathogen detection device; exciting the solution and the probe via an excitation source of the imaging system; Detecting the emission of one or more fluorescent dyes via a fluorescence detection system. The pathogen detection system is configured to:

2. The heating element comprises: Peltier element, Heating block, thermoelectric cooler, Hot plate or resistance heater The system of claim 1 , comprising at least one of:

3. The system of claim 1 , wherein the pathogen detection device is manufactured using three-dimensional (3D) printing.

4. The pathogen detection device includes a resin, the resin comprising: Poly(ethylene glycol) diacrylate (PEGDA), Bis(2,4,6-trimethylbenzoyl)-phenylphosphine oxide (Irgacure 819); and Avobenzone The system of claim 1 , comprising:

5. 10. The system of claim 1, wherein the pathogen detection device further comprises one or more microwells, the microwells having dimensions of about 116 μm by about 116 μm.

6. 1. A pathogen detection device, comprising: receiving a solution containing at least one of DNA or RNA at an inlet of the pathogen detection device; delivering said solution to a reaction chamber of said pathogen detection device; heating the solution with a heating element; receiving at least one of a DNA probe or an RNA probe containing one or more fluorescent dyes at an inlet of the pathogen detection device; exciting the solution and the probe with an excitation source of an imaging system of the pathogen detection device; and The fluorescence detection system of the pathogen detection device detects the emission of one or more fluorescent dyes. A pathogen detection device configured as described above. An apparatus comprising:

7. The heating element comprises: Peltier element, Heating block, thermoelectric cooler, Hot plate, or resistance heater The apparatus of claim 6 , comprising at least one of:

8. The device of claim 6 , wherein the pathogen detection device is manufactured using three-dimensional (3D) printing.

9. The pathogen detection device includes a resin, the resin comprising: Poly(ethylene glycol) diacrylate (PEGDA), Bis(2,4,6-trimethylbenzoyl)-phenylphosphine oxide (Irgacure 819), and Avobenzone The apparatus of claim 6 , comprising:

10. 7. The device of claim 6, wherein the pathogen detection device further comprises one or more microwells, the microwells having dimensions of about 116 μm by about 116 μm.

11. (a) a nucleic acid having a sequence as set forth in SEQ ID NO: 1, 3, 4, 5, 6 or 7, or a nucleic acid having a sequence having at least 95% sequence identity to the sequence as set forth in SEQ ID NO: 1, 3, 4, 5, 6 or 7, (b) linked to a nucleic acid having a sequence that is the reverse complement of the sequence set forth in SEQ ID NO:2, or a sequence that has at least 85% sequence identity to the sequence set forth in SEQ ID NO:2; or (c) a nucleic acid having a sequence set forth in SEQ ID NO: 21, 22, 23, 24, 25, 26, 28, 29, 30, 31, 32, or 33, or a nucleic acid having a sequence having at least 85% sequence identity to the sequence set forth in SEQ ID NO: 21, 22, 23, 24, 25, 26, 28, 29, 30, 31, 32, or 33, (d) linked to a nucleic acid having a sequence that is the reverse complement of the sequence set forth in SEQ ID NO: 15, 16, or 27, or a sequence that has at least 85% sequence identity to the sequence set forth in SEQ ID NO: 15, 16, or 27; A composition comprising: A composition, wherein sequences (a) and (b), or (c) and (d), are linked by hybridizing at about 90°C to form a double helix structure, and the nucleic acid of (a) is linked to a fluorophore and is located distal from the quencher, thereby producing a fluorescent signal.

12. The composition of claim 11, wherein the nucleic acid of (a) has at least 95% sequence identity to the sequence set forth in SEQ ID NO: 1, 3, 4, 5, 6 or 7, the nucleic acid of (b) has at least 99% sequence identity to the reverse complement of the sequence set forth in SEQ ID NO: 2, or the nucleic acid of (c) has at least 95% sequence identity to the sequence set forth in SEQ ID NO: 21, 22, 23, 24, 25, 26, 28, 29, 30, 31, 32 or 33, and the nucleic acid of (d) has at least 95% sequence identity to the reverse complement of the sequence set forth in SEQ ID NO: 15, 16 or 27.

13. The composition of claim 11, wherein the nucleic acid of (a) has a sequence set forth in SEQ ID NO: 1, 3, 4, 5, 6 or 7, the nucleic acid of (b) has the reverse complement of the sequence set forth in SEQ ID NO: 2, or the nucleic acid of (c) has the sequence set forth in SEQ ID NO: 21, 22, 23, 24, 25, 26, 28, 29, 30, 31, 32 or 33, and the nucleic acid of (d) has the reverse complement of the sequence set forth in SEQ ID NO: 15, 16 or 27.

14. The composition of claim 11, wherein the nucleic acid forming the loop structure has a sequence set forth in SEQ ID NO: 1, 3, 4, 5, 6, 7, 21, 22, 23, 24, 25, 26, 28, 29, 30, 31, 32 or 33, or a sequence having at least 95% sequence identity to the sequence set forth in SEQ ID NO: 1, 3, 4, 5, 6, 7, 21, 22, 23, 24, 25, 26, 28, 29, 30, 31, 32 or 33.

15. The composition of claim 11, wherein the nucleic acid forming the loop structure has at least 99% sequence identity to the sequence set forth in SEQ ID NO: 1, 3, 4, 5, 6, 7, 21, 22, 23, 24, 25, 26, 28, 29, 30, 31, 32 or 33.

16. Bacterial RNA or DNA can be detected by a variety of bacteria, including streptococcus, staphylococcus aureus, methicillin-resistant staphylococcus aureus (MRSA), coliform bacteria, E. coli, Salmonella, Shigella, Clostridium difficile, and others. C. difficile, tuberculosis, anthrax, mycoplasma, chlamydophila, legionella, Bordetella pertussis, Clostridium tetani, Borrelia burgdorferi, Borrelia mayonii, Clostridium botulinum, Vibrio cholera, Neisseria meningitidis 12. The composition of claim 11, wherein the bacterium is derived from a strain of bacteria selected from the group consisting of: N. meningitides, Haemophilus influenza, Listeria monocytogenes, Treponema pallidum, Gardnerella vaginalis, and Neisseria gonorrhoeae.

17. 12. The composition of claim 11, wherein the fungal RNA or DNA encodes Candida albicans, Lactobacillus, Microsporum canis, Tinea pedis, Candida, Aspergillus, Histoplasma, Cryptococcus neoformans, Blastomyces or Coccidioides.

18. 12. The composition of claim 11, wherein the parasite RNA or DNA encodes a protozoan, helminth, or ectoparasite that causes a disease such as malaria, toxoplasmosis, trichomoniasis, giardiasis, tapeworms, roundworms, lice, scabies, leishmaniasis, or river blindness.

19. The fluorophore or the quencher is a derivative of cyanine (tetramethylindo(di)-carbocyanine), fluorescein amidite (FAM), hexachlorofluorescein (HEX), carboxyrhodamine (ROX), rhodamine, tetrachlorofluorescein, and the quencher is dimethylaminoazobenzenesulfonic acid (Dabsyl), IRDye (C ５３ H ６２ ClN ４ Na ３ O １６ S ４ ), Iowa Black, a black hole quencher.

20. The composition according to claim 11, wherein said RNA or DNA is a PCR product capable of being a complement of said pathogens in claims 11 to 20.

Images