Lipid Compounds and Lipid Nanoparticle Compositions

Abstract

The present specification relates to lipid compounds and lipid nanoparticle compositions. More specifically, the present specification relates to lipid compounds that can be used in combination with other lipid fractions, such as neutral lipids, cholesterol and polymer-conjugated lipids, to form lipid nanoparticles and deliver therapeutic agents for therapeutic or prophylactic purposes, such as nucleic acid molecules. The present specification also provides lipid nanoparticle compositions that include the lipid compounds.

Description

[Technical field]

[0001] The present invention generally relates to lipid compounds that can be used in combination with other lipid fractions (e.g., neutral lipids, cholesterol and polymer-conjugated lipids) to form lipid nanoparticles for intracellular and extracellular delivery of therapeutic agents (e.g., nucleic acid molecules, including nucleic acid mimetics such as locked nucleic acids (LNA), peptide nucleic acids (PNA) and morpholino oligonucleotides), and further for therapeutic or prophylactic purposes, including vaccination. [Background technology]

[0002] Therapeutic nucleic acids have the potential to completely change vaccination, gene therapy, protein replacement therapy and other genetic disease therapy. Since the first clinical studies on therapeutic nucleic acids were started in the 2000s, great progress has been made by improving the design of nucleic acid molecules and their delivery methods. However, nucleic acid therapeutics still face several challenges, including low cell permeability and high susceptibility of some nucleic acid molecules (including RNA) to degradation. Therefore, there is a need to develop new nucleic acid molecules for therapeutic and / or prophylactic purposes, as well as related methods and compositions, to facilitate their delivery outside or inside cells. Summary of the Invention

[0003] In one embodiment, the present disclosure provides lipid compounds, including pharma- ceutically acceptable salts or stereoisomers thereof, that can be used alone or in combination with other lipid fractions, such as neutral lipids, charged lipids, steroids (including, for example, all sterols) and / or their analogs, and / or lipids conjugated with polymers, to form lipid nanoparticles for delivery of therapeutic agents (e.g., nucleic acid molecules, including nucleic acid mimetics such as locked nucleic acids (LNA), peptide nucleic acids (PNA), and morpholino oligonucleotides). In some cases, the lipid nanoparticles are used to deliver nucleic acids, such as antisense RNA and / or messenger RNA. Methods of using the lipid nanoparticles to treat various diseases or conditions (e.g., diseases or conditions caused by infectious agents and / or protein deficiencies) are also provided.

[0004] In one embodiment, the present specification provides a compound of formula (I): [ka] or a pharma- ceutically acceptable salt or stereoisomer thereof, wherein G, L 1 , L 2 , L 3 , R 1 , R 2 and R 3 Provided is a compound, wherein: is as defined herein or elsewhere, or a pharma- ceutically acceptable salt or stereoisomer thereof.

[0005] In one embodiment, the invention provides a nanoparticle composition comprising a compound provided herein and a therapeutic or prophylactic agent, hi one embodiment, the therapeutic or prophylactic agent comprises at least one mRNA encoding an antigen, or a fragment or epitope thereof.

[0006] Although the present invention has been described in detail with reference to specific embodiments, it will be apparent to those skilled in the art that the same are given by way of example only and not of limitation, and that various changes and modifications within the scope of the invention will be apparent to those skilled in the art. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0007] General Technology The techniques and methods described or referred to in the present invention include conventional methods that are generally understood or commonly used by those skilled in the art, such as those described in, for example, Molecular Cloning: A Laboratory Manual (3d ed. 2001); Current Protocols in Molecular Biology (Ausubel et al. eds., 2003), etc.

[0008] term Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. For the purposes of this specification, the following terms are used and, where appropriate, terms used in the singular also include the plural and vice versa. The disclosures of all patents and other publications referenced herein are incorporated herein by reference in their entirety. In the event that any explanation and interpretation of the terms in this specification contradicts any document incorporated herein by reference, the explanation and interpretation of the terms below shall govern.

[0009] As used herein, unless otherwise stated, the term "lipid" refers to organic compounds, including but not limited to esters of fatty acids, which are generally characterized as being poorly soluble in water, but soluble in many non-polar organics. Lipids are generally poorly soluble in water, although certain categories of lipids (e.g., lipids modified with polar groups such as DMG-PEG2000) have limited water solubility and are soluble in water under certain conditions. Well-known types of lipids include biological molecules such as fatty acids, waxes, sterols, fat-soluble vitamins, monoglycerides, diglycerides, triglycerides, and phospholipids. Lipids can generally be divided into at least three types: (1) "simple lipids," including fats, oils, and waxes; (2) "complex lipids," including phospholipids and glycolipids (e.g., DMPE-PEG2000); and (3) "derived lipids," such as steroids. Lipids, as used herein, also include lipoid compounds. The term "lipidoid compound", also abbreviated as "lipidoid", refers to lipidoid compounds, such as amphipathic compounds, that have the physical properties of lipidoids.

[0010] The term "lipid nanoparticle" or "LNP" refers to a particle having a nanometer size (e.g., 1 nm to 1,000 nm) that includes one or more lipid molecules. The LNPs provided herein can further include at least one non-lipid payload molecule (e.g., one or more nucleic acid molecules). In some embodiments, the LNPs include a non-lipid payload molecule partially or completely encapsulated within a lipid shell. In particular, in some embodiments, the payload is a negatively charged molecule (e.g., an mRNA encoding a viral protein), and the lipid fraction of the LNP includes at least one cationic lipid. It is believed that the cationic lipid can interact with the negatively charged payload molecule and facilitate the incorporation and / or encapsulation of the payload into the LNP during the LNP formation process. Other lipids that can form part of the LNPs, as provided herein, include, but are not limited to, neutral and charged lipids such as steroids, lipids conjugated with polymers, and various zwitterionic lipids. In certain embodiments, the LNPs according to the present invention include one or more lipids of formula (I) (and subformulas thereof) described herein.

[0011] The term "cationic lipid" refers to a lipid that is positively charged at any pH or hydrogen ion activity in its environment, or that can be positively charged in response to the pH or hydrogen ion activity of its environment (e.g., its intended use environment). Thus, the term "cation" encompasses the scope of "permanent cation" and "cationizable". In some embodiments, the positive charge in a cationic lipid is present from a quaternary nitrogen atom. In some embodiments, the cationic lipid includes a zwitterionic lipid that is positively charged in its intended administration environment (e.g., at physiological pH). In some embodiments, the cationic lipid is one or more lipids of formula (I) (and subformulas thereof) as described herein.

[0012] The term "polymer-conjugated lipid" or "polymer-conjugated lipid" refers to a molecule that contains both a lipid portion and a polymer portion. An example of a polymer-conjugated lipid is a pegylated lipid (PEG-lipid), in which the polymer portion comprises polyethylene glycol.

[0013] The term "neutral lipid" encompasses any lipid molecule that exists in an uncharged or neutral zwitterionic form at a selected pH. In some embodiments, the selected useful pH or range corresponds to the pH conditions of the lipid's intended use environment, e.g., physiological pH. As non-limiting examples, neutral lipids that may be used in connection with the present disclosure include, but are not limited to, phosphatidylcholines such as 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 11,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), phosphatidylethanolamines such as 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 2-((2,3-bis(oleoyloxy)propyl)dimethylammonium)ethyl hydrogen phosphate (DOCP), sphingomyelin (SM), ceramides, steroids such as sterols, and derivatives thereof. Neutral lipids can be synthetic or derived (isolated or modified) from natural sources or compounds.

[0014] The term "charged lipid" encompasses any lipid molecule that exists in a positively or negatively charged form within a selected pH or range. In some embodiments, the selected pH or range corresponds to the pH conditions of the lipid's intended use environment, e.g., physiological pH. As non-limiting examples, charged lipids that can be used in connection with the disclosure herein include, but are not limited to, phosphatidylserine, phosphatidic acid, phosphatidylglycerol, phosphatidylinositol, sterol hemisuccinate, dialkyltrimethylammonium-propane (e.g., DOTAP, DOTMA), dialkyldimethylaminopropane, ethylphosphocholine, dimethylaminoethane carbamoyl sterol (e.g., DC-Chol), 1,2-dioleoyl-sn-glycero-3-phospho-L-serine sodium salt (DOPS-Na), 1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol) sodium salt (DOPG-Na), and 1,2-dioleoyl-sn-glycero-3-phosphate sodium salt (DOPA-Na). The charged lipids provided herein can be synthesized or derived (isolated or modified) from natural sources or compounds.

[0015] As used herein, unless otherwise indicated, the term "alkyl" refers to a saturated straight or branched hydrocarbon chain group consisting solely of carbon and hydrogen atoms. In one embodiment, an alkyl group is an alkyl group having, for example, 1 to 24 carbon atoms (C1-C 24 Alkyl), 4 to 20 carbon atoms (C4-C 20 alkyl), 10 to 20 carbon atoms (C 10 -C 20 Alkyl), 6 to 16 carbon atoms (C6-C 16 alkyl), 6 to 9 carbon atoms (C6-C9 alkyl), 1 to 15 carbon atoms (C1-C 15 Alkyl), 1 to 12 carbon atoms (C1-C 12alkyl), 1 to 8 carbon atoms (C1-C8 alkyl), or 1 to 6 carbon atoms (C1-C6 alkyl) and is connected to the remainder of the molecule by a single bond. Examples of alkyl groups include, but are not limited to, methyl, ethyl, propyl, 1-methylethyl (isopropyl), n-butyl, n-pentyl, 1,1-dimethylethyl (t-butyl), 3-methylhexyl, 2-methylhexyl, and the like. Unless otherwise specified, alkyl groups may be optionally substituted.

[0016] As used herein, unless otherwise indicated, the term "alkenyl" refers to a straight or branched hydrocarbon chain radical consisting solely of carbon and hydrogen atoms containing one or more carbon-carbon double bonds. As will be appreciated by one of ordinary skill in the art, the term "alkenyl" also includes radicals having "cis" and "trans" configurations, or "E" and "Z" configurations. In one embodiment, an alkenyl group is an alkyl group having, for example, 2 to 24 carbon atoms (C2-C4). 24 Alkenyl, 4 to 20 carbon atoms (C4-C 20 Alkenyl, 6 to 16 carbon atoms (C6-C 16 alkenyl), 6 to 9 carbon atoms (C6-C9 alkenyl), 2 to 15 carbon atoms (C2-C 15 Alkenyl, 2 to 12 carbon atoms (C2-C 12 Alkenyl groups have from 2 to 8 carbon atoms (C2-C8 alkenyl) or from 2 to 6 carbon atoms (C2-C6 alkenyl) and are linked to the remainder of the molecule by a single bond. Examples of alkenyl groups include, but are not limited to, vinyl, propan-1-enyl, but-1-enyl, pent-1-enyl, penta-1,4-dialkenyl, and the like. Unless otherwise specified, alkenyl groups may be optionally substituted.

[0017] As used herein, unless otherwise indicated, the term "alkynyl" refers to a straight or branched hydrocarbon chain radical consisting solely of carbon and hydrogen atoms containing one or more carbon-carbon triple bonds. In one embodiment, an alkynyl group is an alkyl group having, for example, 2 to 24 carbon atoms (C2-C 24 Alkynyl, 4 to 20 carbon atoms (C4-C 20Alkynyl, 6 to 16 carbon atoms (C6-C 16 alkynyl), 6 to 9 carbon atoms (C6-C9 alkynyl), 2 to 15 carbon atoms (C2-C 15 Alkynyl, 2 to 12 carbon atoms (C2-C 12 C-C alkynyl), 2 to 8 carbon atoms (C2-C8 alkynyl), or 2 to 6 carbon atoms (C2-C6 alkynyl) and is connected to the remainder of the molecule by a single bond. Examples of alkynyl groups include, but are not limited to, ethynyl, propynyl, butynyl, pentynyl, and the like. Unless otherwise specified, alkynyl groups may be optionally substituted.

[0018] As used herein, unless otherwise indicated, the term "alkylene" or "alkylene chain" refers to a straight or branched divalent hydrocarbon chain that is connected to the remainder of the molecule by a group that is saturated with only carbon and hydrogen. In one embodiment, an alkylene group can be any alkyl group having, for example, 1 to 24 carbon atoms (C1-C 24 Alkylene, 1 to 15 carbon atoms (C1-C 15 Alkylene, 1 to 12 carbon atoms (C1-C 12 Alkylene groups have 1 to 8 carbon atoms (C1-C8 alkylene), 1 to 6 carbon atoms (C1-C6 alkylene), 2 to 4 carbon atoms (C2-C4 alkylene), and 1 to 2 carbon atoms (C1-C2 alkylene). Examples of alkylene groups include, but are not limited to, methylene, ethylene, propylene, n-butylene, and the like. The alkylene chain is linked to the rest of the molecule by a single bond and to the radical group by a single bond. Linkage of the alkylene chain to the rest of the molecule and to the radical group can be through one carbon or any two carbons in the chain. Unless otherwise stated, the alkylene chain may be optionally substituted.

[0019] As used herein, unless otherwise indicated, the term "alkenylene" refers to a straight or branched divalent hydrocarbon chain containing one or more carbon-carbon double bonds, with the remainder of the molecule connected to a radical consisting solely of carbon and hydrogen. In one embodiment, an alkenylene group can be, for example, an alkyl group having 2 to 24 carbon atoms (C2-C24 Alkenylene, 2 to 15 carbon atoms (C2-C 15 Alkenylene, 2 to 12 carbon atoms (C2-C 12 Alkenylene groups have 2 to 8 carbon atoms (C2-C8 alkenylene), 2 to 6 carbon atoms (C2-C6 alkenylene) or 2 to 4 carbon atoms (C2-C4 alkenylene). Examples of alkenylene groups include, but are not limited to, ethenylene, propenylene, n-butenylene, and the like. Alkenylene groups are linked to the rest of the molecule by a single or double bond and to the radical group by a single or double bond. The connection of the alkenylene to the rest of the molecule and to the radical group can be through one carbon or any two carbons in the chain. Unless otherwise specified, alkenylene groups may be optionally substituted.

[0020] As used herein, unless otherwise stated, the term "cycloalkyl" refers to a saturated, non-aromatic, monocyclic or polycyclic hydrocarbon group consisting solely of carbon and hydrogen atoms. Cycloalkyl groups can include fused or bridged ring systems. In one embodiment, a cycloalkyl group is a ring system having, for example, 3 to 15 ring carbon atoms (C3-C4). 15 Cycloalkyl), 3 to 10 cyclic carbon atoms (C3-C 10 Cycloalkyl groups have from 1 to 8 ring carbon atoms (C3-C8 cycloalkyl). Cycloalkyls are linked to the remainder of the molecule by a single bond. Examples of monocyclic cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. Examples of polycyclic cycloalkyl groups include, but are not limited to, adamantyl, norbornyl, decalinyl, 7,7-dimethyl-bicyclo[2.2.1]heptyl, and the like. Unless otherwise specified, cycloalkyl groups may be optionally substituted.

[0021] As used herein, unless otherwise stated, the term "cycloalkylene group" refers to a divalent cycloalkyl group. Unless otherwise stated, a cycloalkylene group is optionally substituted.

[0022] As used herein, unless otherwise stated, the term "cycloalkenyl" refers to a non-aromatic monocyclic or polycyclic hydrocarbon group consisting solely of carbon and hydrogen atoms and containing one or more carbon-carbon double bonds. Cycloalkenyl groups can include fused or bridged ring systems. In one embodiment, cycloalkenyl refers to a cyclic ring system having, for example, 3 to 15 ring carbon atoms (C3-C4). 15 Cycloalkenyl, 3 to 10 cyclic carbon atoms (C3-C 10 Cycloalkenyls have from 3 to 8 cyclic carbon atoms (C3-C8 cycloalkenyl). A cycloalkenyl is linked to the remainder of the molecule by a single bond. Examples of monocyclic cycloalkenyl groups include, but are not limited to, cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclohexenyl, cycloheptenyl, cyclooctenyl, and the like. Unless otherwise specified, a cycloalkenyl group may be optionally substituted.

[0023] As used herein, unless otherwise stated, the term "cycloalkenylene" refers to a divalent cycloalkenyl group. Unless otherwise stated, a cycloalkenylene group may be optionally substituted.

[0024] As described herein, unless otherwise stated, the term "heterocyclyl" refers to a non-aromatic monocyclic or polycyclic moiety containing one or more (e.g., 1, 1 or 2, 1-3, or 1-4) heteroatoms independently selected from nitrogen, oxygen, phosphorus, and sulfur. The heterocyclyl can be linked to the main structure at any heteroatom or carbon atom. Heterocyclyl groups can be monocyclic, bicyclic, tricyclic, tetracyclic or other polycyclic ring systems, and polycyclic ring systems can be fused, bridged, or spiro ring systems. Heterocyclyl polycyclic ring systems can contain one or more heteroatoms in one or more rings. Heterocyclyl groups can be saturated or partially unsaturated. Saturated heterocycloalkyl groups can be referred to as "heterocycloalkyls." A partially unsaturated heterocycloalkyl group may be referred to as a "heterocyclyl" if the heterocyclyl contains at least one double bond, and as a "heterocycloalkynyl" if the heterocyclyl contains at least one triple bond. In one embodiment, the heterocyclyl has, for example, 3 to 18 ring atoms (3-18 membered heterocyclyl), 4 to 18 ring atoms (4-18 membered heterocyclyl), 5 to 18 ring atoms (5-18 membered heterocyclyl), 4 to 8 ring atoms (4-8 membered heterocyclyl), or 5 to 8 ring atoms (5-8 membered heterocyclyl). Wherever it appears in this specification, a numerical range, for example "3-18", refers to each integer within the given range. For example, "3-18 membered heterocyclyl" means that the heterocyclyl group may be composed of 3 ring atoms, 4 ring atoms, 5 ring atoms, 6 ring atoms, 7 ring atoms, 8 ring atoms, 9 ring atoms, 10 ring atoms, up to 18 ring atoms, etc. Examples of heterocyclyl include, but are not limited to, imidazolyl, imidazolidinyl, oxazolyl, oxazolidinyl, thiazolyl, thiazolidinyl, pyrazolyl, pyrazolyl, isoxazolidinyl, isoxazolyl, isothiazolylpyrrolyl, isothiazolyl, furyl, furyl, piperidinyl, quinolinyl, and isoquinolinyl. Unless otherwise stated, the heterocyclyl may be optionally substituted.

[0025] As described herein, unless otherwise stated, the term "heterocyclylene" is a divalent heterocyclyl group. Unless otherwise stated, a heterocyclylene group may be optionally substituted.

[0026] As described herein, unless otherwise stated, the term "aryl" refers to monocyclic aromatic groups and / or polycyclic monovalent aromatic groups containing at least one aromatic hydrocarbon ring. In certain embodiments, an aryl group has 6 to 18 annular carbon atoms (C6-C18 aryl), 6 to 14 annular carbon atoms (C6-C14 aryl), or 6 to 10 annular carbon atoms (C6-C10 aryl). Examples of aryl groups include, but are not limited to, phenyl, naphthyl, fluorenyl, azulenyl, anthryl, phenanthryl, pyrenyl, biphenyl, and terphenyl. The term "aryl" also refers to bicyclic, tricyclic, or other polycyclic hydrocarbon rings in which at least one of the rings is aromatic and the others can be saturated, partially unsaturated, or aromatic, such as dihydronaphthyl, indenyl, indanyl, or tetrahydronaphthyl (tetralinyl). Unless otherwise stated, an aryl group may be optionally substituted.

[0027] As used herein, unless otherwise stated, the term "arylene" refers to a divalent aryl group. Unless otherwise stated, an arylene group may be optionally substituted.

[0028] As used herein, unless otherwise stated, the term "heteroaryl" refers to a monocyclic aromatic group and / or a polycyclic aromatic group containing at least one aromatic ring, wherein at least one aromatic ring contains one or more (1-3 or 1-4) heteroatoms independently selected from O, S, and N. The heteroatoms in a heteroaryl group can be linked to the main structure at any carbon atom. In certain embodiments, a heteroaryl group has 5-20, 5-15, or 5-10 ring atoms. The term "heteroaryl" also refers to bicyclic, tricyclic or other polycyclic rings, where at least one of the rings is aromatic and the other rings can be saturated, partially unsaturated or aromatic, and examples of at least one aromatic ring containing one or more monocyclic heteroaryls include, but are not limited to, pyrrolyl, pyrazolyl, pyrazolinyl, imidazolyl, oxazolyl, isoxazolyl, thiazolyl, thiadiazolyl, isothiazolyl, furyl, thienyl, oxadiazolyl, pyrazinyl, pyrimidinyl, pyridazinyl and triazinyl. Examples of bicyclic heteroaryl groups include, but are not limited to, indolyl, benzothiazolyl, benzoxazolyl, benzothienyl, quinolinyl, tetrahydroisoquinolinyl, isoquinolinyl, benzimidazolyl, benzopyranyl, indolizinyl, benzofuranyl, isobenzofuranyl, oxynaphthyl, furopyridinyl, thienopyridinyl, dihydroisoindolyl and tetrahydroquinolinyl. Examples of tricyclic heteroaryls include, but are not limited to, carbazolyl, benzoindolyl, phenanthrolinyl, acridinyl, phenanthridinyl, and xanthenyl.Unless otherwise specified, a heteroaryl group may be optionally substituted.

[0029] As used herein, unless otherwise stated, the term "heteroarylene" refers to a divalent heteroaryl group. Unless otherwise stated, a heteroarylene group may be optionally substituted.

[0030] When groups described herein are "substituted," they may be substituted with any suitable one or more substituents. Illustrative examples of substituents include those shown in the exemplary compounds and embodiments provided herein, as well as halogen atoms such as F, Cl, Br, or I; cyano; oxo (=O); hydroxyl (-OH); alkyl; alkenyl; alkynyl; cycloalkyl; aryl; -(C=O)OR'; -O(C=O)R'; -C(=O)R'; -S(O) x R';-S-SR';-C(=O)SR';-SC(=O)R';-NR'R';-NR'C(=O)R';-C(=O)NR'R';-NR'C(=O)NR'R';-OC(=O)NR'R';-NR'C(=O)OR';-NR'S(O) x NR'R';-NR'S(O) x R', and -S(O) x Including, but not limited to, NR'R', each occurrence of R' is independently H, C1-C 15 alkyl or cycloalkyl, and x is 0, 1 or 2. In some embodiments, the substituent is C-C 12 In another embodiment, the substituent is an alkyl group. In another embodiment, the substituent is a cycloalkyl group. In another embodiment, the substituent is a halogen group, such as fluoro. In another embodiment, the substituent is an oxo group. In another embodiment, the substituent is a hydroxyl group. In another embodiment, the substituent is an alkoxy group (-OR'). In another embodiment, the substituent is a carboxyl group. In another embodiment, the substituent is an amino group (-NR'R').

[0031] As used herein, unless otherwise indicated, the term "optional" or "optionally" (e.g., optionally substituted) means that the subsequently described event or circumstance may or may not occur, and that the description includes instances in which the event or circumstance occurs, as well as instances in which the event or circumstance does not occur. For example, "optionally substituted alkyl" means that the alkyl may be substituted or unsubstituted, and that the description includes substituted and unsubstituted alkyl groups.

[0032] A "prodrug" refers to a compound that can be decomposed under physiological conditions or by a solvent and converted into a biologically active compound. Thus, the term "prodrug" refers to a metabolic precursor of a biologically active compound that is pharma- ceutically acceptable. A prodrug may be inactive when administered to a subject in need thereof, but is converted in vivo to the biologically active compound of the present invention. Prodrugs are usually rapidly converted in vivo, e.g., by hydrolysis in blood, to yield the parent biologically active compound of the present invention. Prodrug compounds usually offer the advantage of solubility, tissue compatibility, or delayed release in mammalian organisms (see Bundgard, H., Design of Prodrugs (1985), pp. 7-9, 21-24 (Elsevier, Amsterdam)). A review of prodrugs is provided in Higuchi, T., et al., ACS Symposium Series, Vol. 14, and Bioreversible Carriers in Drug Design, Ed. Edward B. Roche, American Pharmaceutical Association and Pergamon Press, 1987.

[0033] In some embodiments, the term "prodrug" is also meant to include any covalently bonded carriers, which release the active compounds of the invention in vivo when the prodrugs are administered to a mammalian subject. Prodrugs of the compounds of the invention can be prepared by modifying functional groups present in the compounds by routine manipulation or in such a way that the modifications are cleaved in vivo to yield the parent compounds of the invention. Prodrugs include compounds of the invention in which a hydroxyl group, an amino group, or a mercapto group is bonded to any of the following groups, which are cleaved to form a free hydroxyl group, a free amino group, or a free mercapto group, respectively, when the prodrug of the compound of the invention is administered to a mammalian subject:

[0034] Examples of "prodrugs" include, but are not limited to, acetate, formate and benzoate derivatives of alcohol, or amide derivatives of amine functional groups in the compounds provided herein, and the like.

[0035] As used herein, unless otherwise indicated, the term "pharmaceutically acceptable salts" includes acid addition salts and base addition salts.

[0036] Examples of "pharmaceutically acceptable acid addition salts" include, but are not limited to, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like, as well as organic acids, including acetic acid, 2,2-dicycloacetic acid, adipic acid, alginic acid, ascorbic acid, aspartic acid, benzenesulfonic acid, benzoic acid, 4-acetamidobenzoic acid, camphanic acid, camphor-10-sulfonic acid, capric acid, caproic acid, caprylic acid, carbonic acid, cinnamic acid, citric acid, cyclamic acid, dodecylsulfuric acid, ethane-1,2-disulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, formic acid, fumaric acid, galactaric acid, gentisic acid, glucoheptonic acid, gluconic acid, curcuronic acid, glutamine acid, and the like. Acids that may be used include, but are not limited to, glutaric acid, 2-oxoglutaric acid, glycerophosphoric acid, glycolic acid, hippuric acid, isobutyric acid, lactic acid, lactobionic acid, lauric acid, maleic acid, malic acid, malonic acid, mandelic acid, methanesulfonic acid, mucic acid, naphthalene-1,5-disulfonic acid, naphthalene-2-sulfonic acid, 1-hydroxy-2-naphthoic acid, nicotinic acid, oleic acid, orotic acid, oxalic acid, palmitic acid, propionic acid, pyroglutamic acid, pyruvic acid, salicylic acid, 4-aminosalicylic acid, sebacic acid, stearic acid, succinic acid, tartaric acid, thiocyanic acid, p-toluenesulfonic acid, trifluoroacetic acid, and undecylenic acid.

[0037] Examples of "pharmacologically acceptable base addition salts" include, but are not limited to, salts prepared by adding an inorganic base or an organic base to a free acid compound. Salts derived from inorganic bases include, but are not limited to, sodium salts, potassium salts, lithium salts, ammonium salts, calcium salts, magnesium salts, iron salts, zinc salts, copper salts, manganese salts, aluminum salts, etc. Preferably, inorganic salts include, but are not limited to, ammonium salts, sodium salts, potassium salts, calcium salts, and magnesium salts. Salts derived from organic bases include, but are not limited to, salts of primary, secondary and tertiary amines, substituted amines (including naturally occurring substituted amines), cyclic amines and basic ion exchange resins such as ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, diethanolamine, ethanolamine, deanol, 2-dimethylaminoethanol, 2-diethylaminoethanol, lysine, arginine, histidine, caffeine, purcaine, hydrabamine, choline, betaine, benethamine, benzathine, ethylenediamine, glucosamine, methylglucosamine, theobromine, triethanolamine, purine, piperazine, piperidine, N-ethylpiperidine, polyamine resins, etc. Preferably, the organic base is isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline and caffeine.

[0038] The compounds provided herein may contain one or more asymmetric centers, which may give rise to enantiomers, diastereoisomers and other stereoisomeric forms, which may be defined as (R)- or (S)-, or as (D)- or (L)-, in terms of absolute stereochemistry for amino acids. Unless otherwise stated, the compounds provided herein are intended to include all such possible isomers, as well as their racemic and optically pure forms. Optically active (+) and (-), (R)- and (S)-, or (D)- and (L)-isomers may be prepared using chiral synthons or chiral agents, or resolved using conventional techniques, such as chromatography and fractional crystallization. Conventional techniques used for the preparation / isolation of individual enantiomers include chiral synthesis from suitable optically pure precursors, or resolution of the racemates (or racemates of salts or derivatives), for example, using chiral high performance liquid chromatography (HPLC). When the compounds described herein contain olefinic double bonds or other centers of geometric asymmetry, unless otherwise stated, the compounds are meant to include both E and Z geometric isomers, as well as all tautomeric forms.

[0039] As described herein, unless otherwise stated, the term "isomer" refers to different compounds that have the same molecular formula. "Stereoisomers" are isomers that differ only in the way the atoms are arranged in space. "Atropisomers" are stereoisomers due to the prevention of rotation of atoms around a single bond. "Enantiomers" are a pair of stereoisomers that are non-superimposable mirror images of each other. Any mixture of a pair of enantiomers in any proportion may be referred to as a "racemic" mixture. "Diastereoisomers" are stereoisomers that have at least two asymmetric atoms but are not mirror images of each other.

[0040] "Stereoisomer" can also include E and Z isomers or mixtures thereof, as well as cis and trans isomers or mixtures thereof. In certain embodiments, the compounds described herein are isolated as E or Z isomers. In other embodiments, the compounds described herein are mixtures of E and Z isomers.

[0041] "Tautomers" refer to isomeric forms of a compound that are in equilibrium with each other. The concentrations of isomeric forms depend on the environment in which the compound is placed and can depend on whether the compound is a solid or in an organic or aqueous solution.

[0042] The compounds described herein may contain unnatural proportions of atomic isotopes at one or more atoms. For example, the compounds may contain, for example, tritium 3 ( 3 H), iodine-125( 125 I), Sulfur 35( 35 S) or carbon 14 ( 14 They may be radiolabeled with radioisotopes such as C, or with deuterium ( 2 H), Carbon 13 ( 13 C) or Nitrogen 15 ( 15N) may be isotopically enriched. As used herein, an "isotope" is an isotopically enriched compound. The term "isotopically enriched" refers to an atom having a composition of isotopes different from the natural isotopic composition of that atom. "Isotopically enriched" may also refer to a compound containing at least one atom whose isotopic composition differs from its natural isotopic composition. The term "isotopic composition" refers to the amount of each isotope present for a given atom. Radiolabeled and isotopically enriched compounds may be used as therapeutic agents, such as cancer therapeutic agents, research reagents (e.g., binding assay reagents), and diagnostic agents (e.g., in vivo imaging agents). All isotopic variants of the compounds described herein, whether radioactive or not, are intended to be included within the scope of the embodiments provided herein. In some embodiments, isotopes of the compounds described herein are provided, for example, isotopes enriched in deuterium, carbon-13, and / or nitrogen-15. As used herein, "deuterated" means that at least one hydrogen (H) is replaced with a deuterium (D or 2 H), i.e., the compound is deuterium enriched at at least one position.

[0043] It should be noted that if there is a discrepancy between a structure described herein and the name of the structure, the greater weight is given to the structure described.

[0044] As used herein, unless otherwise specified, the term "pharmaceutically acceptable carrier, diluent, or excipient" includes, but is not limited to, any adjuvant, carrier, excipient, lubricant, sweetener, diluent, preservative, dye / colorant, flavor enhancer, surfactant, wetting agent, dispersing agent, suspending agent, stabilizer, isotonic agent, solvent, or emulsifying agent approved by the U.S. Food and Drug Administration for use in humans or veterinary medicine.

[0045] The term "composition" is intended to encompass a product containing a given component (eg, an mRNA molecule), optionally in a given amount.

[0046] The terms "polynucleotide" or "nucleic acid" can be used interchangeably herein and refer to a polymer of nucleotides of any length, including, for example, DNA and RNA. Nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and / or their analogs, or any substrate incorporated into a polymer by DNA or RNA polymerase, or by a synthetic reaction. Polynucleotides can include modified nucleotides, such as methylated nucleotides and their analogs. Nucleic acids can be in single-stranded or double-stranded form. As described herein, unless otherwise stated, "nucleic acid" also includes nucleic acid mimetics such as locked nucleic acid (LNA), peptide nucleic acid (PNA), and morpholino oligonucleotides. As used herein, "oligonucleotide" refers to short synthetic polynucleotides, usually, but not necessarily, less than about 200 nucleotides in length. The terms "oligonucleotide" and "polynucleotide" are not mutually exclusive. The above description of polynucleotides applies equally and fully to oligonucleotides. Unless otherwise indicated, the left-hand end of any single-stranded polynucleotide sequence disclosed herein is the 5' end, and the left-hand direction of a double-stranded polynucleotide sequence is referred to as the 5' direction. The 5' to 3' addition direction of the nascent RNA transcript is referred to as the transcription direction, the region of sequence on the DNA strand that is at the 5' to 5' end of the RNA transcript and has the same sequence as the RNA transcript is referred to as the "upstream sequence," and the region of sequence on the DNA strand that is at the 3' to 3' end of the RNA transcript and has the same sequence as the RNA transcript is referred to as the "downstream sequence."

[0047] An "isolated nucleic acid" is a nucleic acid, e.g., RNA, DNA, or mixed nucleic acid, that is substantially naturally isolated from other genomic DNA sequences and proteins or complexes (e.g., ribosomes and polymerases) and that contains a naturally occurring sequence. An "isolated" nucleic acid molecule is a nucleic acid molecule that is isolated from other nucleic acid molecules in its natural source. Furthermore, if produced by recombinant techniques, an "isolated" nucleic acid molecule (e.g., an mRNA molecule) may be substantially free of other cellular materials or culture media, or if chemically synthesized, may be substantially free of chemical precursors or other chemicals. In one specific embodiment, one or more nucleic acid molecules encoding an antigen described herein are isolated or purified. The term includes a nucleic acid sequence that has been removed from its naturally occurring environment, including recombinant or cloned DNA or RNA isolates, and chemically synthesized analogs or analogs biologically synthesized by heterologous systems. A substantially pure molecule may include an isolated form of a molecule.

[0048] The term "encoding nucleic acid" or its grammatical equivalents includes (a) a nucleic acid molecule that, in its natural state or when engineered by methods well known to those of skill in the art, can be transcribed to produce an mRNA that can be translated into a peptide and / or polypeptide, and (b) the mRNA molecule itself. The antisense strand is the complementary sequence of a nucleic acid molecule from which a coding sequence can be derived. The term "coding region" refers to that portion of a coding nucleic acid sequence that can be translated into a peptide or polypeptide. The term "untranslated region" or "UTR" refers to that portion of a coding nucleic acid that is not translated into a peptide or polypeptide. This depends on the orientation of the UTR relative to the coding region of the nucleic acid molecule; if the UTR is located at the 5' end of the coding region, the UTR is referred to as a 5'-UTR, and if it is located at the 3' end of the coding region, the UTR is referred to as a 3'-UTR.

[0049] As used herein, the term "mRNA" refers to a message RNA molecule that contains one or more open reading frames (ORFs) that can be translated by a cell or organism to produce one or more peptide or protein products. The region that contains one or more ORFs is referred to as the coding region of the mRNA molecule. In some embodiments, an mRNA molecule also contains one or more untranslated regions (UTRs).

[0050] In some embodiments, the mRNA is a monocistronic mRNA that contains only one ORF. In some embodiments, the monocistronic mRNA encodes a peptide or protein that contains at least one epitope of a selected antigen (e.g., a pathogenic antigen or a tumor-associated antigen). In other embodiments, the mRNA comprises a multicistronic mRNA of two or more ORFs. In some embodiments, the multicistronic mRNA encodes two or more peptides or proteins that are the same or different from each other. In some embodiments, each peptide or protein encoded by the multicistronic mRNA contains at least one epitope of a selected antigen. In some embodiments, each different peptide or protein encoded by the multicistronic mRNA contains at least one epitope of a different antigen. In any of the embodiments described herein, the at least one epitope can be at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 epitopes of an antigen.

[0051] The term "nucleobase" encompasses purines and pyrimidines, including the natural compounds adenine, thymine, guanine, cytosine, uracil, inosine, and their natural or synthetic analogues or derivatives.

[0052] As used herein, the term "functional nucleotide analog" refers to a modified form of the standard nucleotide A, G, C, U, or T that (a) retains the base pairing properties of the corresponding standard nucleotide, and (b) contains at least one chemical modification of (i) the nucleobase, (ii) a glycosyl group, (iii) a phosphate group, or (iv) that corresponds to any combination of (i)-(iii) of a natural nucleotide. As described herein, base pairing includes not only standard Watson-Crick AT, AU, or CG base pairs, but also base pairs formed between a standard nucleotide and a functional nucleotide analog, or between a pair of functional nucleotide analogs, where the arrangement of hydrogen bond donors and hydrogen bond acceptors allows hydrogen bonds to form between a modified nucleobase and a standard nucleobase, or between two complementary modified nucleobase structures. For example, a functional analog of guanosine (G) retains the ability to base pair with cytosine (C) or a functional analog of cytosine. An example of this non-standard base pair is the base pair between the modified nucleotide inosine and adenine, cytosine or uracil. As described herein, functional nucleotide analogs can be naturally occurring or non-naturally occurring. Thus, nucleic acid molecules that contain functional nucleotide analogs can have at least one modified nucleobase, glycosyl group or internucleoside linkage. Exemplary chemical modifications to the nucleobase, glycosyl group or internucleoside linkage of nucleic acid molecules are provided herein.

[0053] As described herein, the terms "translation enhancer element", "TEE" and "translation enhancer" refer to a region in a nucleic acid molecule that functions to enhance the translation of a coding sequence of the nucleic acid into a protein or peptide product, for example, via cap-dependent or cap-independent translation. TEEs are usually located in the UTR region of a nucleic acid molecule (e.g., mRNA) and can enhance the translation level of a coding sequence located upstream or downstream. For example, a TEE in the 5'-UTR of a nucleic acid molecule can be located between the promoter and the start codon of the nucleic acid molecule. Various TEE sequences are well known in the art (Wellensiek et al. Genome-wide profiling of human cap-independent translation-enhancing elements, Nature Methods, 2013 Aug; 10(8): 747-750; Chappell et al. PNAS June 29, 2004 101 (26) 9590-9594). Some TEEs are known to be conserved in multiple species.

number

[0054] As used herein, the term "stem-loop sequence" refers to a single-stranded polynucleotide sequence having at least two regions that, when read in opposite directions, are complementary or substantially complementary to each other and can form a non-complementary loop with at least one double helix. The resulting loop structure is referred to as a stem-loop structure, hairpin, or hairpin loop, which is also a secondary structure present in many RNA molecules.

[0055] As used herein, the term "peptide" refers to a polymer containing 2 to 50 amino acid residues linked by one or more covalent peptide bonds. The term applies to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are non-naturally occurring amino acids (e.g., amino acid analogs or unnatural amino acids).

[0056] The terms "polypeptide" and "protein" may be used interchangeably herein and refer to a polymer having more than 50 amino acid residues linked by covalent peptide bonds. That is, a description of a polypeptide applies equally to a description of a protein, and vice versa. The terms apply to naturally occurring amino acid polymers and to amino acid polymers in which one or more amino acid residues are non-naturally occurring amino acids (e.g., amino acid analogs). As used herein, the terms encompass amino acid chains of any length, including full-length proteins (e.g., antigens).

[0057] The term "antigen" refers to a substance that can be recognized by a subject's immune system (including the adaptive immune system) and that can generate an immune response (including an antigen-specific immune response) in a subject upon contact with the antigen. In certain embodiments, an antigen is a protein (e.g., a tumor-associated antigen (TAA)) associated with a diseased cell (e.g., a cell infected by a pathogen or a tumor cell).

[0058] In the context of a peptide or polypeptide, the term "fragment" refers to a peptide or polypeptide that comprises less than the full length amino acid sequence. Such fragments can result from truncations at the N-terminus, truncations at the C-terminus, and / or deletion of residues internal to the amino acid sequence. Fragments can be generated from alternative RNA splicing or in vivo proteases. In certain embodiments, a fragment is a sequence of at least 5 contiguous amino acid residues, at least 10 contiguous amino acid residues, at least 15 contiguous amino acid residues, at least 20 contiguous amino acid residues, at least 25 contiguous amino acid residues, at least 30 contiguous amino acid residues, at least 40 contiguous amino acid residues, at least 50 contiguous amino acid residues, at least 60 contiguous amino acid residues, at least 70 contiguous amino acid residues, at least 80 contiguous amino acid residues, at least 90 contiguous amino acid residues, at least 10 ... A fragment of a polypeptide refers to a polypeptide comprising a sequence of amino acid residues, at least 125 contiguous amino acid residues, at least 150 contiguous amino acid residues, at least 175 contiguous amino acid residues, at least 200 contiguous amino acid residues, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, at least 750, at least 800, at least 850, at least 900, or at least 950 contiguous amino acid residues. In a specific embodiment, a fragment of a polypeptide retains at least one, at least two, at least three or more functions of the polypeptide.

[0059] An "epitope" is a site on the surface of an antigen molecule to which an antibody molecule specifically binds, such as a subregion on the surface of an antigen that has antigenic or immunogenic activity in an animal, e.g., a mammal (e.g., a human), and can elicit an immune response, and can bind to one or more antigen-binding regions of an antibody. An epitope with immunogenic activity is a portion of a polypeptide that elicits an antibody response in an animal. An epitope with antigenic activity is a portion of a polypeptide to which an antibody binds, as determined by any method well known in the art, including, for example, immunoassays. An antigenic epitope is not necessarily immunogenic. Epitopes usually consist of chemically active surface groups of molecules, such as amino acids or sugar side chains, and generally have specific three-dimensional structural characteristics, and specific charge characteristics. An antibody epitope can be a linear epitope or a conformational epitope. A linear epitope is formed by a contiguous sequence of amino acids in a protein. A conformational epitope is formed from amino acids that are discontinuous in the protein sequence, but are bound when the protein folds into its three-dimensional structure. When the three-dimensional structure of a protein is in an altered conformation, for example after activation or binding of another protein or ligand, an induced epitope is formed. In some embodiments, an epitope is a three-dimensional surface feature of a polypeptide. In other embodiments, an epitope is a linear feature of a polypeptide. Usually, an antigen has several or many different epitopes and can react with many different antibodies.

[0060] As used herein, the term "genetic vaccine" refers to a therapeutic or prophylactic composition that includes at least one nucleic acid molecule that encodes an antigen associated with a target disease (e.g., an infectious disease or a neoplastic disease). The administration of a vaccine (vaccination) to a subject induces an immune response in the subject against the target disease by encoding and producing a peptide or protein. In some embodiments, the immune response includes an adaptive immune response, which can, for example, produce antibodies against the encoded antigen and / or activate and proliferate immune cells to specifically eliminate diseased cells expressing the antigen. In some embodiments, the immune response also includes an innate immune response. In accordance with the present invention, a vaccine can be administered to a subject before or after clinical symptoms of the target disease develop. In some embodiments, vaccination of a healthy or asymptomatic subject immunizes or reduces the susceptibility of the vaccinated subject to the development of the target disease. In some embodiments, vaccination of a subject with symptoms of a disease can ameliorate the disease condition of the vaccinated subject or treat the disease.

[0061] The terms "innate immune response" and "innate immunity" are well known in the art and refer to a non-specific defense mechanism initiated by the immune system of the human body upon recognition of pathogen-associated molecules, involving different forms of cellular activity, including cytokine production and cell death via various pathways. As described in the present invention, the innate immune response includes, but is not limited to, increased production of inflammatory cytokines (e.g., production of type I interferon or IL-10), activation of the NFκB pathway, increased proliferation, maturation, differentiation and / or survival of immune cells, and in some cases induction of cell apoptosis. The status of activation of innate immunity can be detected by methods well known in the art, such as measuring activation of (NF)-κB.

[0062] The terms "adaptive immune response" and "adaptive immunity" are well known in the art and refer to antigen-specific defense mechanisms, including humoral and cell-mediated responses, initiated by the body's immune system after recognition of a specific antigen. As described in the present invention, the adaptive immune response includes a cellular response that is induced and / or enhanced by a vaccine composition (e.g., a genetic composition described herein). In some embodiments, the vaccine composition includes an antigen that is the target of an antigen-specific adaptive immune response. In other embodiments, the vaccine composition is capable of producing an antigen that is the target of an antigen-specific adaptive immune response in an immunized subject after administration. Methods well known in the art can be used to detect the activation of an adaptive immune response, for example, by monitoring the production of antigen-specific antibodies or the level of antigen-specific cell-mediated cytotoxicity.

[0063] The term "antibody" is intended to include polypeptide products secreted by effector B cells that can bind to a specific molecular antigen and that consist of two pairs of identical polypeptide chains, each pair having one heavy chain (about 50-70 kDa) and one light chain (about 25 kDa), the N-terminal portion of each chain containing a variable region consisting of about 100 to about 130 or more amino acids, and the C-terminal portion of each chain containing a constant region, and immunoglobulins are not limited to antibodies. See, for example, Antibody Engineering (Borrebaeck ed., 2d ed.1995) and Kuby, Immunology (3d ed.1997). In certain embodiments, the specific molecular antigen comprises a polypeptide, a fragment thereof or an epitope, capable of binding to an antibody described herein. Antibodies also include, but are not limited to, synthetic antibodies, recombinant antibodies, camelized antibodies, intracellular antibodies, anti-Id antibodies, and functional fragments of these antibodies, which functional fragments refer to functional polypeptide fragments isolated from the heavy or light chains of the antibody that can retain some or all of their binding activity. Some non-limiting examples of functional fragments include single chain antibodies (scFv) (including monospecific, bispecific, etc.), Fab fragments, F(ab') fragments, F(ab)2 fragments, F(ab')2 fragments, disulfide bond stabilized (dsFv), Fd fragments, Fv fragments, diabodies, triabodies, tetrabodies, and minibodies. In particular, antibodies as described herein include immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, and can be molecules that contain, for example, an antigen-binding domain or antigen-binding site (e.g., one or more CDRs of an antibody). Such antibody fragments include,

number

[0064] The term "administration" refers to the act of delivering an in vitro substance (e.g., a lipid nanoparticle composition described herein) to a patient, for example, via mucosal, intramuscular / subcutaneous injection, intravenous injection, or other physical methods known in the art. When used to treat a disease, condition, or symptom thereof, administration of the substance generally occurs after the onset of the disease, condition, or symptom thereof. When used to prevent a disease, condition, or symptom, administration of the substance generally occurs before the onset of the disease, condition, or symptom.

[0065] "Chronic" administration refers to administration in a continuous mode (e.g., over a period of days, weeks, months, or years) to maintain an initial therapeutic effect (activity) over an extended period of time, as opposed to an acute administration mode. "Intermittent" administration is non-consecutive, cyclical, without interruption of treatment.

[0066] The term "targeted delivery" or the verb form "target" refers to a process in which delivery to a target location facilitates the arrival of a delivery agent (e.g., a therapeutic payload molecule in a lipid nanoparticle composition described herein) to a particular organ, tissue, cell, and / or intracellular compartment (referred to as a target location) over any other organ, tissue, cell, or intracellular compartment (referred to as a non-target location). Targeted delivery can be detected by methods well known in the art, such as by comparing the concentration of the delivery agent in a targeted cell population following systemic administration to the concentration of the delivery agent in a non-targeted cell population. In certain embodiments, targeted delivery results in at least a two-fold higher concentration in the targeted location compared to non-target locations.

[0067] An "effective amount" is typically an amount sufficient to reduce the severity and / or frequency of symptoms, eliminate symptoms and / or their underlying causes, prevent the occurrence of symptoms and / or their causes, and / or ameliorate or compensate for damage. Diseases caused by or associated with diseases, conditions, or pathologies include infections, tumor formation, and the like. In some embodiments, the effective amount is a therapeutically effective amount or a prophylactically effective amount.

[0068] As described herein, the term "therapeutically effective amount" refers to an amount of an agent (e.g., a vaccine composition) sufficient to reduce and / or ameliorate the severity and / or duration of associated symptoms of a given disease, illness, or condition (e.g., an infectious disease caused by a viral infection, or a neoplastic disease such as cancer). The "therapeutically effective amount" of a substance / molecule / agent according to the present disclosure (e.g., a lipid nanoparticle composition described herein) can vary depending on factors such as the disease state, age, sex, and weight of the individual, as well as the ability of the substance / molecule / agent to induce a desired response in the individual. A therapeutically effective amount includes an amount in which any toxic or detrimental effects of the substance / molecule / agent are offset by the beneficial effects of the treatment. In one embodiment, the term "therapeutically effective amount" refers to an amount of lipid nanoparticle composition, or a therapeutic or prophylactic agent (e.g., a therapeutic mRNA) contained therein, that can effectively "treat" a disease, illness, or condition in a subject or mammal.

[0069] A "prophylactically effective amount" is an amount of a pharmaceutical composition that, when administered to a subject, provides the desired prophylactic effect, e.g., prevents, delays or reduces the likelihood of onset (or recurrence) of a disease, condition or associated condition (e.g., an infectious disease caused by a viral infection, or a neoplastic disease such as cancer). A prophylactically effective amount can be, but is not necessarily, less than a therapeutically effective amount, since a prophylactic dose is typically used in a subject prior to or at an early stage of a disease, condition or associated condition. A complete therapeutic or prophylactic effect does not necessarily occur by administration of one dose, but may occur only after administration of a series of doses. Thus, a therapeutically or prophylactically effective amount can be administered in one or more administrations.

[0070] The term "prophylaxis" means reducing the likelihood of onset of a disease, illness, condition or associated symptom (eg, an infectious disease such as a viral infection, or a neoplastic disease such as cancer).

[0071] The term "management" refers to the beneficial effect a subject derives from a treatment (e.g., a prophylactic or therapeutic agent) that does not result in a cure of the disease. In some embodiments, a subject is administered one or more therapies (e.g., a prophylactic or therapeutic agent, such as a lipid nanoparticle composition described herein) to "manage" one or more symptoms of an infectious or neoplastic disease to prevent the progression or worsening of the disease.

[0072] The term "prophylactic agent" refers to any agent capable of completely or partially inhibiting the development, recurrence, onset or spread of a disease and / or its associated symptoms in a subject.

[0073] The term "therapeutic agent" refers to any agent that can be used to treat, prevent or alleviate a disease, illness or condition, including the treatment, prevention or alleviation of one or more symptoms of the disease, illness or condition and associated symptoms.

[0074] The term "therapy" refers to any protocol, method, and / or agent that may be used to prevent, manage, treat, and / or ameliorate a disease, illness, or condition. In certain embodiments, the term "therapy" refers to therapies known to those of skill in the art, such as medical practitioners, including biological, supportive, and / or other therapies that may be used to prevent, control, treat, and / or ameliorate a known disease, illness, or condition.

[0075] A "prophylactically effective serum titer" is a serum titer of antibodies in a subject (e.g., a human) that completely or partially inhibits the development, recurrence, onset or spread of a disease, illness or condition and its associated symptoms.

[0076] In one embodiment, a "therapeutically effective serum titer" is a serum titer of antibodies in a subject (e.g., a human) that reduces the severity, duration, and / or symptoms associated with a disease, condition, or illness.

[0077] The term "serum titer" refers to the average serum titer in a subject from multiple samples (e.g., at multiple time points) or in a group of at least 10, at least 20, at least 40 subjects, up to about 100, 1000 or more subjects.

[0078] The term "side effects" includes undesirable and / or adverse effects of a therapy (e.g., a prophylactic or therapeutic agent). An adverse effect is not necessarily adverse. An adverse effect of a therapy (e.g., a prophylactic or therapeutic agent) may be harmful, uncomfortable, or dangerous. Examples of side effects include diarrhea, cough, gastroenteritis, asthma, nausea, vomiting, anorexia, abdominal cramps, fever, pain, weight loss, dehydration, hair loss, difficulty breathing, insomnia, dizziness, mucositis, nerve and muscle effects, fatigue, dry mouth, loss of appetite, skin rash or swelling at the site of administration, flu-like symptoms such as fever, chills, fatigue, digestive problems, and allergic reactions. Other undesirable effects experienced by patients are well known in the art, and relevant descriptions are provided in the Physician's Desk Reference (68th ed.2014).

[0079] The terms "subject" and "patient" may be used interchangeably. As described herein, in certain embodiments, the subject is a mammal, such as a non-primate animal (e.g., cows, pigs, horses, cats, dogs, rats, etc.) or a primate animal (e.g., monkeys and humans). In certain embodiments, the subject is a human. In one embodiment, the subject is a mammal (e.g., a human) suffering from an infectious disease or neoplastic disease. In another embodiment, the subject is a mammal (e.g., a human) at risk of developing an infectious disease or neoplastic disease.

[0080] The term "detectable probe" refers to a composition that provides a detectable signal. The term includes, but is not limited to, any fluorophore, chromophore, radiolabel, enzyme, antibody or antibody fragment, etc. that provides a detectable signal through its activity.

[0081] The term "detectable agent" refers to a substance that can be used to identify the presence of a desired molecule, such as an antigen encoded by an mRNA molecule described herein, in a sample or subject. A detectable agent can be a substance that can be visualized or can be a substance that can be determined and / or measured (e.g., by quantification).

[0082] "Substantially all" refers to at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or about 100%.

[0083] As used herein, unless otherwise indicated, the term "about" or "approximate" refers to an acceptable margin of error for a particular value as determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined. In certain embodiments, the term "about" or "approximately" means within 1, 2, 3, or 4 standard deviations. In certain embodiments, the term "about" or "approximately" means within 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.05% of a given value or range.

[0084] As used herein, the singular terms "a," "an," and "the" include the plural forms thereof unless the context clearly indicates otherwise.

[0085] All publications, patent applications, registration numbers, and other references cited herein are hereby incorporated by reference in their entirety, and each individual publication or patent application is specifically and individually incorporated by reference. The publications disclosed herein are those disclosed prior to the filing date of the present application. Nothing herein should be construed as an admission that the present invention is not entitled to antedate such publications by virtue of prior invention. Additionally, the publication dates provided herein may be different from the actual publication dates, which may need to be independently confirmed.

[0086] A number of embodiments are described in the present invention. However, it will be understood that various modifications can be made without departing from the spirit and scope of the present invention. Therefore, the descriptions in the experimental section and examples are intended to be illustrative, and do not limit the scope of the invention described in the claims.

[0087] lipid compounds In one embodiment, the present specification provides a compound of formula (I): [ka] or a pharma- ceutically acceptable salt or stereoisomer thereof, wherein G is N or CH; L 1 , L 2 and L 3 are each independently selected from a bond or C1-C8 alkylene; R 1 -C(O)OR 4 Or -OC(O)R 9 Selected from R 2 -C(O)OR 5 , C3-C8 cycloalkyl, C1-C8 alkyl, -OC(O)R 10 , -C(O)NHC 10 -C 20 Alkyl or -NHC(O)C 10 -C 20 Selected from alkyl, R 3 but [ka] Selected from R 4 C 10 -C 20 is alkyl, R 5 C 10 -C 20 is alkyl, R 6 -C(O)(CH2) 1-8 N(C1-C8 alkyl) C1-C8 alkyl, C1-C8 alkyl or -(CH2) 1-8 C(O)OR 11 Selected from R 7 Ga-(CH2) 1-8 N(C1-C8 alkyl)C1-C8 alkyl; R 8 Ga-(CH2) 1-8N(C1-C8 alkyl)C1-C8 alkyl; R 9 C 10 -C 20 is alkyl, R 10 C 10 -C 20 is alkyl, R 11 C 10 -C 20 is alkyl, Provided is a compound, or a pharma- ceutically acceptable salt or stereoisomer thereof, wherein * represents a linkage site.

[0088] In one embodiment, in formula (I): G is N, L 1 , L 2 and L 3 are each independently C1-C8 alkylene; R 1 -C(O)OR 4 and R 2 -C(O)OR 5 and R 3 but [ka] and R 4 C 10 -C 20 is alkyl, R 5 C 10 -C 20 is alkyl, R 6 -C(O)(CH2) 1-8 N(C1-C8 alkyl)C1-C8 alkyl or C1-C8 alkyl; and * indicates the linking site.

[0089] In one embodiment, in formula (I): G is N, L 1 , L2 and L 3 are each independently C1-C8 alkylene; R 1 -C(O)OR 4 and R 2 -C(O)OR 5 and R 3 but [ka] Selected from R 4 C 10 -C 20 is alkyl, R 5 C 10 -C 20 is alkyl, R 7 Ga-(CH2) 1-8 N(C1-C8 alkyl)C1-C8 alkyl; R 8 Ga-(CH2) 1-8 N(C1-C8 alkyl)C1-C8 alkyl; * indicates the linking site.

[0090] In one embodiment, in formula (I): G is N, L 1 and L 3 are each independently C1-C8 alkylene; L 2 is a bond, R 1 -C(O)OR 4 and R 2 is selected from C3-C8 cycloalkyl or C1-C8 alkyl; R 3 but [ka] and R 4 C 10 -C 20is alkyl, R 6 Ga-(CH2) 1-8 C(O)OR 11 and R 11 C 10 -C 20 is alkyl, * indicates the linking site.

[0091] In one embodiment, in formula (I): G is CH, L 1 , L 2 and L 3 are each independently C1-C8 alkylene; R 1 -OC(O)R 9 and R 2 -OC(O)R 10 and R 3 but [ka] and R 8 Ga-(CH2) 1-8 N(C1-C8 alkyl)C1-C8 alkyl; R 9 C 10 -C 20 is alkyl, R 10 C 10 -C 20 is alkyl, * indicates the linking site.

[0092] In one embodiment, in formula (I), R 4 , R 5 , R 9 , R 10 and R 11 are each independently -(CH2) 1-3 -CH(C5-C 10 Alkyl)(C5-C 10 alkyl).

[0093] In one embodiment, the compound is a compound listed in Table 1: [ka] [ka] It is.

[0094] It should be understood that any of the embodiments of the compounds provided herein, as well as any specific substituents and / or variables of the compounds provided herein, as above, can be combined independently with other embodiments and / or with various variables of the substituents and / or compounds to form embodiments not specifically described. Furthermore, when listing substituents and / or variables for any particular group or variable, it should be understood that each individual substituent and / or variable can be deleted from the particular embodiment and / or claim, and the remaining list of substituents and / or variables is considered to be within the scope of the embodiments provided herein.

[0095] It is to be understood that combinations of substituents and / or variables of the depicted formulae herein are permissible only if they result in stable compounds.

[0096] Nanoparticle Composition In one aspect, described herein are nanoparticle compositions comprising the lipid compounds described herein. In certain embodiments, the nanoparticle compositions comprise compounds according to formula (I) (and subformulas thereof) described herein.

[0097] In some embodiments, the maximum dimension of the nanoparticle compositions provided herein is 1 μm or less (e.g., ≦1 μm, ≦900 nm, ≦800 nm, ≦700 nm, ≦600 nm, ≦500 nm, ≦400 nm, ≦300 nm, ≦200 nm, ≦175 nm, ≦150 nm, ≦125 nm, ≦100 nm, ≦75 nm, ≦50 nm or less) as measured by dynamic light scattering (DLS), transmission electron microscopy, scanning electron microscopy, or other methods. In one embodiment, the lipid nanoparticles provided herein have at least one dimension that is in the range of about 40 to about 200 nm. In one embodiment, at least one dimension is in the range of about 40 to about 100 nm.

[0098] Nanoparticle compositions that may be used in connection with the present invention include lipid nanoparticles (LNPs), nanolipoprotein particles, liposomes, lipid vesicles, lipid complexes, and the like. In some embodiments, the nanoparticle composition comprises one or more lipid bilayer vesicles. In some embodiments, the nanoparticle composition comprises two or more concentric bilayers separated by aqueous compartments. The lipid bilayers may be functionalized and / or crosslinked to each other. The lipid bilayers may comprise one or more ligands, proteins, or channels.

[0099] The properties of a nanoparticle composition may depend on its fractions. For example, a nanoparticle composition that contains cholesterol as a structural lipid may have different properties from a nanoparticle composition that contains a different structural lipid. Similarly, the properties of a nanoparticle composition may depend on the absolute or relative amounts of its fractions. For example, a nanoparticle composition that contains a high molar fraction of phospholipids may have different properties from a nanoparticle composition that contains a low molar fraction of phospholipids. The properties may also differ depending on the preparation method and conditions of the nanoparticle composition.

[0100] Nanoparticle compositions can be characterized by various methods. For example, microscopy (such as transmission electron microscopy or scanning electron microscopy) can be used to examine the morphology and size distribution of nanoparticle compositions. Dynamic light scattering or potentiometry (e.g. potentiometric titration) can be used to measure zeta potential. Dynamic light scattering can also be used to determine particle size. Instruments such as the Zetasizer Nano ZS (Malvem Instruments Ltd, Malvem, and Worcestershire, UK) can also be used to measure several characteristics of nanoparticle compositions, such as particle size, polydispersity index, and zeta potential.

[0101] Dh (size): The average size of the nanoparticle composition can be from 10 nm to 100 nm. For example, the average size can be from about 40 nm to about 150 nm, such as about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm. In some embodiments, the average size of the nanoparticle composition can be about 50 nm to about 100 nm, about 50 nm to about 90 nm, about 50 nm to about 80 nm, about 50 nm to about 70 nm, about 50 nm to about 60 nm, about 60 nm to about 100 nm, about 60 nm to about 90 nm, about 60 nm to about 80 nm, about 60 nm to about 70 nm, about 70 nm to about 100 nm, about 70 nm to about 90 nm, about 70 nm to about 80 nm, about 80 nm to about 100 nm, about 80 nm to about 90 nm, or about 90 nm to about 100 nm. In some embodiments, the average size of the nanoparticle composition can be about 70 nm to about 100 nm. In some embodiments, the average size can be about 80 nm. In other embodiments, the average size can be about 100 nm.

[0102] PDI: The composition of the nanoparticles may be relatively uniform. The polydispersity index may be used to indicate the uniformity of the nanoparticle composition, for example, the particle size distribution of the nanoparticle composition. A small polydispersity index (e.g., less than 0.3) usually indicates a narrow particle size distribution. The nanoparticle composition may have a polydispersity index of about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of the nanoparticle composition may be about 0.10 to about 0.20.

[0103] Encapsulation efficiency: The encapsulation efficiency of a therapeutic and / or prophylactic agent represents the amount of therapeutic and / or prophylactic agent encapsulated or associated with a nanoparticle composition after preparation relative to the amount initially provided. A high encapsulation efficiency (e.g., approaching 100%) is desirable. The encapsulation efficiency can be measured by comparing the amount of therapeutic and / or prophylactic agent contained in the nanoparticle composition before and after dissolving the nanoparticle composition in one or more organic solvents or detergents into solution. Fluorescence can be used to measure the amount of free therapeutic and / or prophylactic agent (e.g., RNA) in solution. The encapsulation efficiency of the nanoparticle compositions, therapeutic and / or prophylactic agents described herein can be at least 50%, e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%. In some embodiments, the encapsulation efficiency may be at least 80%. In certain embodiments, the encapsulation efficiency may be at least 90%.

[0104] Apparent pKa: The zeta potential of a nanoparticle composition can be used to indicate the zeta potential of the composition. For example, the zeta potential can describe the surface charge of a nanoparticle composition. Nanoparticle compositions are generally desired to have a relatively low positive or negative charge, since highly charged species can cause unfavorable interactions with cells, tissues and other elements of the human body. In some embodiments, the zeta potential of the nanoparticle composition can be about -10 mV to about +20 mV, about -10 mV to about +15 mV, about -10 mV to about +10 mV, about -10 mV to about +5 mV, about -10 mV to about 0 mV, about -10 mV to about -5 mV, about -5 mV to about +20 mV, about -5 mV to about +15 mV, about -5 mV to about +10 mV, about -5 mV to about +5 mV, about -5 mV to about 0 mV, about 0 mV to about +20 mV, about 0 mV to about +15 mV, about 0 mV to about +10 mV, about 0 mV to about +5 mV, about +5 mV to about +20 mV, about +5 mV to about +15 mV, or about +5 mV to about +10 mV.

[0105] In another embodiment, self-replicating RNA can be prepared in liposome.As a non-limiting example, self-replicating RNA can be prepared in liposome as described in International Publication No. WO20120067378, which is incorporated herein by reference in its entirety.In one aspect, liposome can contain lipids with pKa values ​​that are favorable for the delivery of mRNA.In another aspect, liposome can have a substantially neutral surface charge at physiological pH, and therefore can be effectively used in immunization (see, for example, the liposome described in International Publication No. WO20120067378, which is incorporated herein by reference in its entirety).

[0106] In some embodiments, the nanoparticle composition comprises at least one lipid fraction, such as a lipid fraction comprising a compound according to formula (I) (and subformulas thereof) described herein. For example, in some embodiments, the nanoparticle composition can comprise a lipid fraction comprising one of the compounds provided herein. The nanoparticle composition can also comprise one or more other lipid or non-lipid fractions described below.

[0107] Cationic / Ionizable LipidsAs described herein, in some embodiments, the nanoparticle compositions provided herein comprise one or more charged or ionizable lipids in addition to lipids according to formula (I) (and subformulas thereof). It is believed that certain charged or zwitterionic lipid fractions of the nanoparticle compositions resemble lipid fractions in cell membranes, thereby improving cellular uptake of the nanoparticles.Exemplary charged or ionizable lipids that can form part of the nanoparticle compositions of the invention are 3-(didodecylamino)-N1,N1,4-tridodecyl-1-piperazineethylamine (KL10), N1-[2-(didodecylamino)ethyl]-N1,N1,N4-tridodecyl-1,4-piperazinediethanamine (KL22), 14,25-ditridodecyl-15,18,21,24-tetraazaoctatriacontane (KL25), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (D DLin-K-DMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), heptatrium-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butanoate (DLin-MC3-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), 1,2-diyloxy-N,N-dimethylaminopropane (DODMA), 2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA), (2R)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA(2R)), ( 2S)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethylethyl-3-[((9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (Octyl-CLinDMA(2S)), (12Z,15Z)-N,N-dimethyl-2-nonylhenicosa-12,15-den-1-amine, N,N-dimethyl-1-{((1S,2R)-2-octylcyclopropyl}heptadecan-8-amine.Other exemplary charged or ionizable lipids (e.g., lipid 5) that can form part of the nanoparticle compositions of the present invention include those described in Sabnis et al., "A Novel Amino Lipid Series for mRNA Delivery: Improved Endosomal Escape and Sustained Pharmacology and Safety in Non-human Primates," Molecular Therapy Vol. 26 No 6, 2018, which is incorporated herein by reference in its entirety.

[0108] In some embodiments, suitable cationic lipids include N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA); N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP); 1,2-dioleoyl-sn-glycero-3-ethylphosphocholine (DOEPC); 1,2-dilauroyl-sn-glycero-3-ethylphosphocholine (DLEPC); 1,2-dimyristoyl-sn-glycero-3-ethylphosphocholine (DMEPC); 1,2-dimyristoyl-sn-glycero-3-ethylphosphocholine (14:1); N1-[2-((1S)-1-[(3-aminopropyl)amino]-4-[di(3-aminopropyl)amino] butylcarboxamido)ethyl]-3,4-di[oleyloxy]-benzamide (MVL5);dioctadecylamido-glycylspermine (DOGS);3b-[N-(N',N'-dimethylaminoethyl)carbamoyl]cholesterol (DC-Chol);dioctadecyldimethylammonium bromide (DDAB);SAINT-2,N-methyl-4-(dioleyl)methylpyridinium;1,2-dimyristyloxypropyl-3-dimethylhydroxyethylammonium bromide (DMRIE);1,2-dioleoyl-3-dimethyl-hydroxyethylammonium bromide (DORIE);1,2-dioleoyloxypropyl-3-dimethylhydroxyethylammonium chloride (DORI);dialkylated amino acids (DILA 2) (e.g., C18:1-norArg-C16); dioleyldimethylammonium chloride (DODAC); 1-palmitoyl-2-oleoyl-sn-glycero-3-ethylphosphocholine (POEPC); 1,2-dimyristoleoyl-sn-glycero-3-ethylphosphocholine (MOEPC); (R)-5-(dimethylamino)pentane-1,2-diyl dioleate hydrochloride (DODAPen-Cl); (R)-5-guniazinopentane-1,2-diyl dioleate hydrochloride (DOPen-G); (R)-N,N,N-trimethyl-4,5-bis(oleoyloxy)penta-1-ammonium chloride (DOTAPen). Also suitable are cationic lipids with head groups that are charged at physiological pH, such as primary amines (e.g., DODAG N',N'-dioctadecyl-N-4,8-diaza-10-aminodecanoylglycinamide) and guanidinium head groups (e.g., bis-guanidinium-spermidine-cholesterol (BGSC), bis-guanidinium trene-cholesterol (BGTC), PONA, and (R)-5-guanidinopentane-1,2-diyl dioleate hydrochloride (DOPen-G)). Another suitable cationic lipid is (R)-5-(dimethylamino)pentane-1,2-diyl dioleate hydrochloride (DODAPen-Cl). In certain embodiments, the cationic lipid is a specific enantiomeric or racemic form, including various salt forms (e.g., chloride or sulfate) of the cationic lipids as described above. For example, in some embodiments, the cationic lipid is N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP-Cl) or N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP-sulfate).In some embodiments, the cationic lipid is an ionizable cationic lipid, such as, for example, dioctadecyldimethylammonium bromide (DDAB); 1,2-dilinoleyloxy-3-dimethylaminopropane (DLinDMA); 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA); heptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butanoate (DLin-MC3-DMA); 1,2-dioleoyloxy-3-dimethylaminopropane (DODAP); 1,2-dioleyloxy-3-dimethylaminopropane (DODMA); morpholinocholesterol (Mo-CHOL). In some embodiments, the lipid nanoparticle comprises a combination of two or more cationic lipids (e.g., two or more cationic lipids as described above).

[0109] Additionally, in some embodiments, the charged or ionizable lipids that can form part of the nanoparticle composition are lipids that contain cyclic amine groups. Additional cationic lipids that have application in the formulations and methods disclosed herein include those described in WO2015199952, WO2016176330, and WO2015011633, the entire contents of which are incorporated herein by reference in their entirety.

[0110] Polymer-conjugated lipids In some embodiments, the lipid fraction of the nanoparticle composition may include lipids conjugated with one or more polymers (polymer-conjugated lipids), such as PEGylated lipids (PEG lipids). It is believed that the polymer-conjugated lipid fraction in the nanoparticle composition may improve colloidal stability and / or reduce protein absorption of the nanoparticles. Exemplary cationic lipids that may be used in conjunction with the present disclosure include, but are not limited to, PEG-modified phosphatidylethanolamines, PEG-modified phosphatidic acids, PEG-modified ceramides, PEG-modified dialkylamines, PEG-modified diacylglycerols, PEG-modified dialkylglycerols, and mixtures thereof. For example, the PEG lipid may be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, PEG-DSPE, ceramide-PEG2000, or Chol-PEG2000.

[0111] In one embodiment, the polymer-conjugated lipid is a PEGylated lipid. Some embodiments include PEGylated diacylglycerols (PEG-DAGs) such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristylglycerol (PEG-DMG), PEGylated phosphatidylethanolamine (PEG-PE), PEG diacylglycerol succinate (PEG-S-DAGs) such as 4-O-(2',3'-di(tetradecanoyl acyloxy)propyl-1-O-(ω-methoxy(polyethoxy)ethyl)butanedioate (PEG-S-DMG), PEGylated ceramide (PEG-cer), or PEG dialkoxypropyl carbamates such as ω-methoxy(polyethoxy)ethyl-N-(2,3-di(tetradodecyloxy)propyl)carbamate or 2,3-di(tetradecyloxy)propyl-N-(ω-methoxy)(polyethoxy)ethyl)carbamate.

[0112] In one embodiment, the polymer-conjugated lipid is present at a molar concentration of 1.0-2.5%. In one embodiment, the polymer-conjugated lipid is present at a molar concentration of about 1.7%. In one embodiment, the polymer-conjugated lipid is present at a molar concentration of about 1.5%.

[0113] In one embodiment, the molar ratio of cationic lipid to polymer-conjugated lipid is about 35:1 to about 25:1. In one embodiment, the molar ratio of cationic lipid to polymer-conjugated lipid is about 100:1 to about 20:1.

[0114] In one embodiment, the PEGylated lipid has the following formula: [ka] or a pharma- ceutically acceptable salt, tautomer or stereoisomer thereof, wherein R 12 and R 13 are each independently a linear or branched, saturated or unsaturated alkyl chain containing 10 to 30 carbon atoms, the alkyl chain optionally being interrupted by one or more ester bonds; The average value of w is 30 to 60.

[0115] In one embodiment, R 12 and R 13 are each independently a linear saturated alkyl chain containing 12 to 16 carbon atoms. In other embodiments, the average value of w is in the range of 42 to 55, e.g., the average value of w is 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, or 55. In certain embodiments, the average value of w is about 49.

[0116] In one embodiment, the pegylated lipid has a compound represented by the formula: [ka] where the average value of w is about 49.

[0117] structural lipids In some embodiments, the lipid fraction of the nanoparticle composition may include one or more structural lipids. It is believed that the structural lipids can stabilize the amphiphilic structure of the nanoparticles, such as, but not limited to, the lipid bilayer structure of the nanoparticles. Exemplary structural lipids that can be used in conjunction with the present disclosure include, but are not limited to, cholesterol, fecosterol, sitosterol, ergosterol, campesterol, matigsterol, brassisterol, tomatidine, tomatine, ursolic acid, α-tocopherol, and mixtures thereof. In some embodiments, the structural lipid is cholesterol. In some embodiments, the structural lipid includes cholesterol and corticosteroids (e.g., prednisolone, dexamethasone, prednisone, and hydrocortisone) or combinations thereof.

[0118] In one embodiment, the lipid nanoparticles provided herein comprise a steroid or steroid analog. In one embodiment, the steroid or steroid analog is cholesterol. In one embodiment, the steroid is present in a molar range of 39-49%, 40-46%, 40-44%, 40-42%, 42-44% or 44-46%. In one embodiment, the steroid is present in a molar range of 40, 41, 42, 43, 44, 45 or 46%.

[0119] In one embodiment, the molar ratio of cationic lipid to steroid is 1.0:0.9 to 1.0:1.2, or 1.0:1.0 to 1.0:1.2. In one embodiment, the molar ratio of cationic lipid to cholesterol is about 5:1 to 1:1. In one embodiment, the steroid is present at a molar concentration of 32-40% of the steroid.

[0120] Phospholipids In some embodiments, the lipid fraction of the nanoparticle composition may comprise one or more phospholipids, such as one or more (poly)unsaturated lipids. It is believed that the phospholipids may be assembled into one or more lipid bilayer structures. Exemplary phospholipids that can form part of the nanoparticle composition are 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether ... PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinoleyl-sn-glycero-3-phosphorylcholine, 1,2-diarachidonoyl-sn-glycero-3-phosphorylcholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphorylcholine, 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), and sphingomyelin. In some embodiments, the nanoparticle composition comprises DSPC. In some embodiments, the nanoparticle composition comprises DOPE.In some embodiments, the nanoparticle composition comprises DSPC and DOPE.

[0121] Other exemplary neutral lipids include dipalmitoyl phosphatidylglycerol (DPPG), palmitoyl oleoyl-phosphatidylethanolamine (POPE) and dioleoyl-phosphatidylethanolamine-4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoyl phosphatidylethanolamine (DPPE), distearoyl-phosphatidylethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl phosphatidylethanolamine (SOPE) and 1,2-dielideyl-sn-glycero-3-phosphoethanolamine (transDOPE). In one embodiment, the neutral lipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC). In one embodiment, the neutral lipid is selected from DSPC, DPPC, DMPC, DOPC, POPC, DOPE and SM.

[0122] In one embodiment, the neutral lipid is phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylserine (PS), phosphatidic acid (PA) or phosphatidylglycerol (PG).

[0123] Additional phospholipids that may form part of the nanoparticle compositions of the present invention include those described in WO2017 / 112865, the entire contents of which are incorporated herein by reference in their entirety.

[0124] Therapeutic Payloads Nanoparticle compositions described herein may further include one or more therapeutic and / or prophylactic agents. These therapeutic and / or prophylactic agents may be referred to in the present disclosure as "therapeutic payloads" or "payloads." In some embodiments, the nanoparticles may be used as delivery vehicles to administer therapeutic payloads in vivo or in vitro.

[0125] In some embodiments, the nanoparticle compositions may contain as a therapeutic payload an antitumor agent (e.g., vincristine, doxorubicin, mitoxantrone, camptothecin, cisplatin, bleomycin, cyclophosphamide, methotrexate, and streptozotocin), antineoplastic agents (e.g., actinomycin D, vincristine, vinblastine, cytarabine, anthracyclines, alkylating agents, platinum compounds, antimetabolites, and nucleoside analogs such as methotrexate, purine and pyrimidine analogs), anti-infectives, local anesthetics (e.g., dibucaine and chlorpromazine), beta-adrenergic blockers (e.g., propranolol, timolol, and labetalol), antihypertensives (e.g., clonidine and hydralazine), antidepressants (e.g. imipramine, amitriptyline and doxepin), anticonvulsants (e.g. phenytoin), antihistamines (e.g. diphenhydramine, chlorpheniramine and promethazine), antibiotics / antibacterials (such as gentamicin, ciprofloxacin and cefoxitin), antifungals (e.g. miconazole, terconazole, econazole, isoconazole, butaconazole, clotrimazole, itraconazole, nystatin, naftifine and amphotericin B), antiparasitics, hormones, hormone antagonists, immunomodulators, neurotransmitter antagonists, antiglaucoma agents, anesthetics and imaging agents.

[0126] In some embodiments, the therapeutic payload comprises a cytotoxin, a radioactive ion, a chemotherapeutic drug, a vaccine, a compound that induces an immune response, and / or another therapeutic and / or prophylactic agent. A cytotoxin or cytotoxic agent includes any substance that may be harmful to cells. Examples include, but are not limited to, taxol, cytochalasin B, gramindin D, ethidium bromide, emetine, mitomycin, etoposide, teniposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxyanthracin dione, mitoxantrone, 1-dehydrotestosterone, glucocorticoids, procaine, purcaine, tetracaine, lidocaine, propranolol, puromycin, maytansinoids, maytansinol, rachelmycin (CC-1065), and analogs or homologs thereof. Radioactive ions include, but are not limited to, iodine (e.g., iodine-125 or iodine-131), strontium-89, phosphorus, palladium, cesium, iridium, phosphate, cobalt, yttrium-90, samarium-153, and praseodymium.

[0127] In other embodiments, the therapeutic payload of the nanoparticle composition is an antimetabolite (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil, dacarbazine), an alkylating agent (e.g., metallothionein, thiotepa chlorambucil, rachelmycin (CC-1065), melphalan, carmustine (BSNU), lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin These include, but are not limited to, therapeutic and / or prophylactic agents such as C and cis-dichlorodiamineplatinum(II) (DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC)), and antimitotic agents (e.g., vinblastine, vincristine, taxol, and maytansinoids).

[0128] In some embodiments, the nanoparticle composition includes biological molecules, such as peptides and polypeptides, as a therapeutic payload. The biological molecules forming part of the nanoparticle composition can be of natural or synthetic origin. For example, in some embodiments, the therapeutic payload of the nanoparticle composition can include, but is not limited to, gentamicin, amikacin, insulin, erythropoietin (EPO), granulocyte colony stimulating factor (G-CSF), granulocyte-macrophage colony stimulating factor (GM-CSF), factor VIR, luteinizing hormone releasing hormone (LHRH) analogs, interferons, heparin, hepatitis B surface antigen, typhoid vaccine, cholera vaccine, and peptides and polypeptides.

[0129] nucleic acid In some embodiments, the nanoparticle composition comprises one or more nucleic acid molecules (e.g., DNA or RNA molecules) as a therapeutic payload. Exemplary forms of nucleic acid molecules that may be included in the nanoparticle composition as a therapeutic payload include, but are not limited to, deoxyribonucleic acid (DNA), ribonucleic acid (RNA), including messenger mRNA (mRNA), and hybrids thereof, RNAi inducers, RNAi agents, siRNA, shRNA, miRNA, antisense RNA, ribozymes, catalytic DNA, RNA that induces triple helix formation, aptamers, vectors, and the like. In certain embodiments, the therapeutic payload comprises RNA. RNA molecules that may be included in the nanoparticle compositions of the present invention as therapeutic payloads include, but are not limited to, shortmers, agomirs, antagomirs, antisense molecules, ribozymes, small interfering RNA (siRNA), asymmetric interfering RNA (aiRNA), microRNA (miRNA), Dicer-substrate RNA (dsRNA), small hairpin RNA (shRNA), transfer RNA (tRNA), messenger RNA (mRNA), and other forms of RNA molecules known in the art. In certain embodiments, the RNA is mRNA.

[0130] In other embodiments, the nanoparticle composition comprises an siRNA molecule as a therapeutic payload. In particular, in some embodiments, the siRNA molecule can selectively interfere with and downregulate expression of a gene of interest. In some embodiments, when the nanoparticle composition comprising the siRNA is administered to a subject, the siRNA payload selectively silences a gene associated with a particular disease, condition, or pathology. In some embodiments, the siRNA molecule comprises a sequence that is complementary to an mRNA sequence that encodes a protein product of interest. In some embodiments, the siRNA molecule is an immunomodulatory siRNA.

[0131] In some embodiments, the nanoparticle composition comprises an shRNA molecule or a vector encoding an shRNA molecule as a therapeutic payload. In particular, in some embodiments, the therapeutic payload produces shRNA in a target cell after administration to the target cell. The constructs and mechanisms of shRNA are well known in the art.

[0132] In some embodiments, the nanoparticle composition comprises an mRNA molecule as a therapeutic payload. In particular, in some embodiments, the mRNA molecule encodes a polypeptide of interest, including any naturally occurring or non-naturally occurring or modified polypeptide. The polypeptide encoded by the mRNA may have any size and any secondary structure or activity. In some embodiments, the polypeptide encoded by the mRNA payload can have a therapeutic effect when expressed in a cell.

[0133] In some embodiments, the nucleic acid molecule of the present disclosure comprises an mRNA molecule. In certain embodiments, the nucleic acid molecule comprises at least one coding region (e.g., an open reading frame (ORF)) encoding a peptide or polypeptide of interest. In some embodiments, the nucleic acid molecule further comprises at least one untranslated region (UTR). In certain embodiments, the untranslated region (UTR) is located upstream (5' end) of the coding region, referred to herein as the 5'-UTR. In certain embodiments, the untranslated region (UTR) is located downstream (3' end) of the coding region, referred to herein as the 3'-UTR. In certain embodiments, the nucleic acid molecule comprises both a 5'-UTR and a 3'-UTR. In some embodiments, the 5'-UTR comprises a 5'-cap structure. In some embodiments, the nucleic acid molecule comprises a Kozak sequence (e.g., in the 5'-UTR). In some embodiments, the nucleic acid molecule comprises a polyA region (e.g., in the 3'-UTR). In some embodiments, the nucleic acid molecule comprises a polyadenylation signal (e.g., in the 3'-UTR). In some embodiments, the nucleic acid molecule comprises a stabilizing region (e.g., in the 3'-UTR). In some embodiments, the nucleic acid molecule comprises a secondary structure. In some embodiments, the secondary structure is a stem-loop. In some embodiments, the nucleic acid molecule comprises a stem-loop sequence (e.g., in the 5'-UTR and / or the 3'-UTR). In some embodiments, the nucleic acid molecule comprises one or more intron regions that can be excised in a splicing process. In one specific embodiment, the nucleic acid molecule comprises one or more regions selected from a 5'-UTR and a coding region. In one specific embodiment, the nucleic acid molecule comprises one or more regions selected from a coding region and a 3'-UTR. In one specific embodiment, the nucleic acid molecule comprises one or more regions selected from a 5'-UTR, a coding region and a 3'-UTR.

[0134] Code Region In some embodiments, the nucleic acid molecule of the present disclosure comprises at least one coding region. In some embodiments, the coding region is an open reading frame (ORF) that encodes a single peptide or protein. In some embodiments, the coding region comprises at least two ORFs, each encoding a peptide or protein. In embodiments where the coding region comprises one or more ORFs, the peptides and / or proteins encoded by the ORFs may be the same as or different from each other. In some embodiments, the multiple ORFs in the coding region are separated by non-coding sequences. In certain embodiments, the non-coding sequences separating the two ORFs comprise an internal ribosome entry site (IRES).

[0135] It is believed that an internal ribosome entry site (IRES) may function as the only ribosome binding site or as one of multiple ribosome binding sites of an mRNA. An mRNA molecule containing one or more functional ribosome binding sites can encode several peptides or polypeptides that are translated independently by the ribosome (e.g., multicistronic mRNA). Thus, in some embodiments, a nucleic acid molecule (e.g., an mRNA) of the present disclosure comprises one or more internal ribosome entry sites (IRES). Examples of IRES sequences that can be used in connection with the present disclosure include, but are not limited to, sequences from picomaviruses (e.g., FMDV), plague viruses (CFFV), polioviruses (PV), encephalomyocarditis viruses (ECMV), hand, foot and mouth viruses (FMDV), hepatitis C virus (HCV), classical swine fever virus (CSFV), murine leukemia virus (MLV), simian immunodeficiency virus (SIV), or cricket paralysis virus (CrPV).

[0136] In various embodiments, the nucleic acid molecules of the present disclosure encode at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 peptides or proteins. The peptides and proteins encoded by the nucleic acid molecules may be the same or different. In some embodiments, the nucleic acid molecules of the present disclosure encode a dipeptide (e.g., chamocin and anserine). In some embodiments, the nucleic acid molecules encode a tripeptide. In some embodiments, the nucleic acid molecules encode a tetrapeptide. In some embodiments, the nucleic acid molecules encode a pentapeptide. In some embodiments, the nucleic acid molecules encode a hexapeptide. In some embodiments, the nucleic acid molecules encode a heptapeptide. In some embodiments, the nucleic acid molecules encode an octapeptide. In some embodiments, the nucleic acid molecules encode a nonapeptide. In some embodiments, the nucleic acid molecules encode a decapeptide. In some embodiments, the nucleic acid molecules encode a peptide or polypeptide having at least about 15 amino acids. In some embodiments, the nucleic acid molecules encode a peptide or polypeptide having at least about 50 amino acids. In some embodiments, the nucleic acid molecules encode a peptide or polypeptide having at least about 100 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 150 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 300 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 500 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 1000 amino acids.

[0137] In some embodiments, the nucleic acid molecules of the present disclosure are at least about 30 nucleotides (nt) in length. In some embodiments, the nucleic acid molecules are at least about 35 nt in length. In some embodiments, the nucleic acid molecules are at least about 40 nt in length. In some embodiments, the nucleic acid molecules are at least about 45 nt in length. In some embodiments, the nucleic acid molecules are at least about 50 nt in length. In some embodiments, the nucleic acid molecules are at least about 55 nt in length. In some embodiments, the nucleic acid molecules are at least about 60 nt in length. In some embodiments, the nucleic acid molecules are at least about 65 nt in length. In some embodiments, the nucleic acid molecules are at least about 70 nt in length. In some embodiments, the nucleic acid molecules are at least about 75 nt in length. In some embodiments, the nucleic acid molecules are at least about 80 nt in length. In some embodiments, the nucleic acid molecules are at least about 85 nt in length. In some embodiments, the nucleic acid molecules are at least about 90 nt in length. In some embodiments, the nucleic acid molecules are at least about 95 nt in length. In some embodiments, the nucleic acid molecule is at least about 100 nt in length. In some embodiments, the nucleic acid molecule is at least about 120 nt in length. In some embodiments, the nucleic acid molecule is at least about 140 nt in length. In some embodiments, the nucleic acid molecule is at least about 160 nt in length. In some embodiments, the nucleic acid molecule is at least about 180 nt in length. In some embodiments, the nucleic acid molecule is at least about 200 nt in length. In some embodiments, the nucleic acid molecule is at least about 250 nt in length. In some embodiments, the nucleic acid molecule is at least about 300 nt in length. In some embodiments, the nucleic acid molecule is at least about 400 nt in length. In some embodiments, the nucleic acid molecule is at least about 500 nt in length. In some embodiments, the nucleic acid molecule is at least about 600 nt in length. In some embodiments, the nucleic acid molecule is at least about 700 nt in length. In some embodiments, the nucleic acid molecule is at least about 800 nt in length. In some embodiments, the nucleic acid molecule is at least about 900 nt in length. In some embodiments, the nucleic acid molecule is at least about 1000 nt in length. In some embodiments, the nucleic acid molecule is at least about 1100 nt in length.In some embodiments, the nucleic acid molecule is at least about 1200 nt in length. In some embodiments, the nucleic acid molecule is at least about 1300 nt in length. In some embodiments, the nucleic acid molecule is at least about 1400 nt in length. In some embodiments, the nucleic acid molecule is at least about 1500 nt in length. In some embodiments, the nucleic acid molecule is at least about 1600 nt in length. In some embodiments, the nucleic acid molecule is at least about 1700 nt in length. In some embodiments, the nucleic acid molecule is at least about 1800 nt in length. In some embodiments, the nucleic acid molecule is at least about 1900 nt in length. In some embodiments, the nucleic acid molecule is at least about 2000 nt in length. In some embodiments, the nucleic acid molecule is at least about 2500 nt in length. In some embodiments, the nucleic acid molecule is at least about 3000 nt in length. In some embodiments, the nucleic acid molecule is at least about 3500 nt in length. In some embodiments, the nucleic acid molecule is at least about 4000 nt in length. In some embodiments, the nucleic acid molecule is at least about 4500 nt in length. In some embodiments, the nucleic acid molecule is at least about 5000 nt in length.

[0138] In certain embodiments, the therapeutic payload comprises a vaccine composition (e.g., a genetic vaccine) described herein. In some embodiments, the therapeutic payload comprises a compound capable of inducing immunity against one or more target diseases or conditions. In some embodiments, the target disease is associated with a pathogen or infection therewith, such as, for example, coronavirus (e.g., 2019-nCoV), influenza, measles, human papillomavirus (HPV), rabies, meningitis, whooping cough, tetanus, plague, hepatitis, and pulmonary tuberculosis. In some embodiments, the therapeutic payload comprises a nucleic acid sequence (e.g., mRNA) encoding a pathogenic protein or an antigenic fragment or epitope thereof characteristic of the pathogen. After inoculation into a subject, the vaccine induces immunity against the pathogen in the subject by expressing the encoded pathogenic protein (or antigenic fragment or epitope thereof).

[0139] In some embodiments, the target disease, such as cancer, is associated with or caused by tumor proliferation of cells. In some embodiments, the therapeutic payload comprises a nucleic acid sequence (e.g., mRNA) encoding a tumor-associated antigen (TAA) characteristic of the cancer, or an antigenic fragment or epitope thereof. After administration to a vaccinated subject, the vaccine expresses the encoded TAA (or antigenic fragment or epitope thereof), thereby inducing immunity in the subject against tumor cells expressing the TAA.

[0140] 5'-cap structure The 5'-cap structure of a polynucleotide is believed to bind to mRNA cap-binding protein (CBP), which is involved in nuclear transport and enhances the stability of the polynucleotide, and plays a role in the stability of the polynucleotide in the cell. The binding of CBP to poly-A binding protein results in the formation of a mature circular mRNA, which becomes translationally competent. The 5'-cap structure further assists in the removal of the 5'-proximal intron in the mRNA splicing process. Thus, in some embodiments, the nucleic acid molecule of the present disclosure comprises a 5'-cap.

[0141] Nucleic acid molecules may be capped at the 5' end by the cell's endogenous transcription machinery to generate a 5'-ppp-5'-triphosphate linkage between the guanine cap terminal residue and the 5'-terminal transcribed sense nucleotide of the polynucleotide. This 5'-guanosine cap is then methylated to generate an N7-methyl-guanosine residue. The ribose of the terminal and / or pre-terminal transcribed nucleotide of the 5' end of the polynucleotide may also be optionally 2'-O-methylated. 5'-decapping, which is accomplished by hydrolysis and cleavage of the guanosine cap structure, can target nucleic acid molecules, such as mRNA molecules, for degradation.

[0142] In some embodiments, the nucleic acid molecules of the present disclosure contain one or more modifications of the native 5'-cap structure produced from endogenous processes. Modifications to the 5'-cap can increase the stability of a polynucleotide, increase the half-life of the polynucleotide, and improve the translation efficiency of the polynucleotide.

[0143] Exemplary modifications to the native 5'-Cap structure include generating a non-hydrolyzable cap structure to prevent decapping and increase the half-life of the polynucleotide. In some embodiments, since hydrolysis of the cap structure is required to cleave the 5'-ppp-5' phosphodiester bond, in some embodiments, modified nucleotides can be used during the capping reaction. For example, in some embodiments, vaccinia capping enzyme from New England Biolabs can be used with α-thio-guanosine nucleotides to generate phosphorothioate linkages at 5'-ppp-5', according to the manufacturer's instructions. Other modified guanosine nucleotides, such as α-methylphosphonate and selenophosphonate nucleotides, can also be used.

[0144] Further exemplary modifications of the native 5'-Cap structure include modifications at the 2'- and / or 3'-positions of the capped guanosine triphosphate (GTP), replacement of the sugar ring oxygen (the oxygen involved in the carbon ring) with a methylene moiety (CH2), modifications in the triphosphate bridge portion of the cap structure, or modifications in the nucleobase (G) portion.

[0145] Further exemplary modifications of the native 5'-cap structure include, but are not limited to, 2'-O-methylation at the 5'-terminus of a polynucleotide and / or the 2'-hydroxyl of the ribose of the 5'-terminal nucleic acid, which can generate multiple different 5'-cap structures of a polynucleotide (e.g., an mRNA molecule). Alternative exemplary 5'-cap structures that can be used in connection with the present disclosure also include those described in International Patent Publication Nos. WO2008127688, WO 2008016473, and WO 2011015347, the entire contents of which are incorporated herein by reference.

[0146] In various embodiments, the 5'-cap can comprise a cap analog. A cap analog, also referred to herein as a synthetic cap analog, chemical cap, chemical cap analog, or structural or functional cap analog, differs chemically from the native (i.e., endogenous, wild-type, or physiological) 5'-cap structure while retaining cap function. Cap analogs can be chemically (i.e., non-enzymatically) or enzymatically synthesized and / or linked to a polynucleotide.

[0147] For example, an anti-reverse cap analog (ARCA) cap comprises two guanosines linked by 5'-5'-triphosphate groups, one guanosine comprising an N7-methyl group and a 3'-O-methyl group (i.e., N7,3'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine, m7G-3'mppp-G, which may equivalently be referred to as 3'O-Me-m7G(5')ppp(5')G). The 3'-O atom of the other unmodified guanosine is linked to the 5'-terminal nucleotide of a capped polynucleotide (e.g., an mRNA). The N7- and 3'-O-methylated guanosine provide the terminal portion of the capped polynucleotide (e.g., an mRNA). Another exemplary cap structure is mCAP, which is similar to ARCA but has a 2'-O-methyl on the guanosine (i.e., N7,2'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine, m7Gm-ppp-G).

[0148] In some embodiments, the cap analog can be a dinucleotide cap analog. As a non-limiting example, the dinucleotide cap analog can be modified with boranophosphate or phosphoroselenoate groups at different phosphate positions, such as the dinucleotide cap analogs described in U.S. Patent No. 8,519,110, the entire contents of which are incorporated herein by reference.

[0149] In some embodiments, the cap analog can be an N7-(4-chlorophenoxyethyl) substituted dinucleotide cap analog known in the art and / or described herein. Non-limiting examples of N7-(4-chlorophenoxyethyl) substituted dinucleotide cap analogs include N7-(4-chlorophenoxyethyl)-G(5')ppp(5')G and N7-(4-chlorophenoxyethyl)-m3'-OG(5')ppp(5')G cap analogs (see, e.g., Kore et al. Bioorganic & Medicinal Chemistry 2013 21:4570-4574 for various cap analogs and methods for synthesizing cap analogs, the contents of which are incorporated herein by reference). In other embodiments, the cap analog that can be used in the nucleic acid molecules of the present disclosure is a 4-chloro / bromophenoxyethyl analog.

[0150] In various embodiments, the cap analog may comprise a guanosine analog. Guanosine analogs that may be used include, but are not limited to, inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.

[0151] Although cap analogs are capable of concomitant capping of polynucleotides in in vitro transcription reactions, as high as 20% of transcripts appear to remain uncapped, which may lead to reduced translational capacity and reduced cellular stability due to the structural differences of cap analogs from the native 5'-cap structure of polynucleotides produced from the cell's endogenous transcription machinery.

[0152] Thus, in some embodiments, the nucleic acid molecules of the present disclosure can be post-transcriptionally capped using enzymes to generate a more authentic 5'-cap structure. As used herein, the phrase "more authentic" refers to a feature that closely reflects or mimics an endogenous or wild-type feature, either structurally or functionally. That is, compared to a synthetic feature of the prior art or its analog, a "more authentic" feature is one that better represents an endogenous, wild-type, native or physiological cellular function and / or structure, or is superior in one or more respects to the corresponding endogenous, wild-type natural species, native or physiological feature. Non-limiting examples of more authentic 5'-cap structures that can be used in connection with the nucleic acid molecules of the present disclosure are those that have enhanced cap-binding protein binding, increased half-life, reduced sensitivity to 5'-cap structures, reduced 5'-decapping by β-endonuclease, compared to synthetic 5'-cap structures (or wild-type, native or physiological 5'-cap structures) known in the art. For example, in some embodiments, the recombinant vaccinia virus capping enzyme and the recombinant 2'-O-methyltransferase enzyme can generate a canonical 5'-5'-triphosphate linkage between the 5'-terminal nucleotide of a polynucleotide and a guanosine cap nucleotide. The cap guanine comprises an N7-methylation and the 5'-terminal nucleotide of the polynucleotide comprises a 2'-O-methyl. This structure is referred to as the Cap1 structure. Compared to other 5' cap analog structures known in the art, for example, the cap results in higher translational competence, cellular stability, and reduced activation of cellular proinflammatory cytokines. Other exemplary cap structures include 7mG(5')ppp(5')N, pN2p (Cap 0), 7mG(5')ppp(5')NlmpNp (Cap 1), 7mG(5')-ppp(5')NlmpN2mp (Cap 2), and m(7)Gpppm(3)(6,6,2')Apm(2')Apm(2')Cpm(2)(3,2')Up (Cap 4).

[0153] Nucleic acid molecules according to the present disclosure may be post-transcriptionally capped, and since this process is more efficient, it is believed that nearly 100% of the nucleic acid molecules may be capped.

[0154] Untranslated Regions (UTRs) In some embodiments, the nucleic acid molecule of the present disclosure comprises one or more untranslated regions (UTRs). In some embodiments, the UTRs are located upstream of the nucleic acid molecule coding region and are referred to as 5'-UTRs. In some embodiments, the UTRs are located downstream of the nucleic acid molecule coding region and are referred to as 3'-UTRs. The sequence of the UTRs can be homologous or heterologous to the sequence of the coding region in the nucleic acid molecule. The nucleic acid molecule can comprise multiple UTRs, which can have the same or different sequences and / or genetic origins. According to the present disclosure, any portion (including none) of the UTRs in the nucleic acid molecule can be codon-optimized and can independently comprise one or more different structural or chemical modifications before and / or after codon optimization.

[0155] In some embodiments, a nucleic acid molecule (e.g., mRNA) of the present disclosure comprises UTRs and coding regions that are homologous to each other. In other embodiments, a nucleic acid molecule (e.g., mRNA) of the present disclosure comprises UTRs and coding regions that are heterologous with respect to each other. In some embodiments, to detect activity of a UTR sequence, a nucleic acid molecule comprising a coding sequence of a UTR and a detectable probe can be administered in vitro (e.g., to a cell or tissue culture) or in vivo (e.g., to a subject) and the effect of the UTR sequence (e.g., modulation of expression levels, cellular localization of the encoded product, or half-life of the encoded product) can be measured using methods well known in the art.

[0156] In some embodiments, the UTR of a nucleic acid molecule (e.g., mRNA) of the present disclosure comprises at least one translational enhancer element (TEE) that functions to increase the amount of a polypeptide or protein produced from the nucleic acid molecule. In some embodiments, the TEE is located in the 5'-UTR of the nucleic acid molecule. In other embodiments, the TEE is located in the 3'-UTR of the nucleic acid molecule. In other embodiments, at least two TEEs are located in the 5'-UTR and 3'-UTR of the nucleic acid molecule, respectively. In some embodiments, the nucleic acid molecule (e.g., mRNA) of the present disclosure may comprise one or more copies of a TEE sequence, or may comprise two or more different TEE sequences. In some embodiments, the different TEE sequences in a nucleic acid molecule may be homologous to each other or may be heterologous.

[0157] Various TEE sequences well known in the art can be used in connection with the present disclosure. For example, in some embodiments, the TEE can be an internal ribosome entry site (IRES), HCV-IRES, or an IRES element. Chappell et al. Proc. Natl. Acad. Sci. USA 101:9590-9594, 2004; Zhou et al. Proc. Natl. Acad. Sci. 102:6273-6278, 2005. Other internal ribosome entry sites (IRES) that may be used in connection with the present disclosure include, but are not limited to, those described in U.S. Patent No. 7,468,275, U.S. Patent Publication No. 2007 / 0048776, and U.S. Patent Publication No. 2011 / 0124100, and International Patent Publication No. WO2007 / 025008, and International Patent Publication No. WO2001 / 055369, the contents of all of which are incorporated herein by reference in their entirety. In some embodiments, the TEE may be those described in Supplementary Table 1 and Supplementary Table 2 of Wellensiek et al Genome-wide profiling of human cap-independent translation-enhancing elements, Nature Methods, 2013 Aug;10(8):747-750, the contents of which are incorporated herein by reference in their entirety.

[0158] Other exemplary TEEs that may be used in connection with the present disclosure include U.S. Patent No. 6,310,197, U.S. Patent No. 6,849,405, U.S. Patent No. 7,456,273, U.S. Patent No. 7,183,395, U.S. Patent Publication No. 2009 / 0226470, U.S. Patent Publication No. 2013 / 0177581, U.S. Patent Publication No. 2007 / 0048776, U.S. Patent Publication No. 2011 / 0124100, U.S. Patent Publication No. 2009 / 0093049, International Patent Publication No. 2011 / 012410 ... These include, but are not limited to, the TEE sequences disclosed in Patent Publication No. WO2009 / 075886, International Patent Publication No. WO2012 / 009644, and International Patent Publication No. WO1999 / 024595, International Patent Publication No. WO2007 / 025008, International Patent Publication No. WO2001 / 055371, European Patent No. 2610341, and European Patent No. 2610340, the entire contents of which are incorporated herein by reference in their entirety.

[0159] In various embodiments, the nucleic acid molecules (e.g., mRNA) of the present disclosure comprise at least one UTR that comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, or more than 60 TEE sequences. In some embodiments, the TEE sequences in the UTR of the nucleic acid molecule are copies of the same TEE sequence. In other embodiments, at least two TEE sequences in the UTR of the nucleic acid molecule have different sequences. In some embodiments, the multiple different TEE sequences are arranged in one or more repeat pattern sequences in the UTR region of the nucleic acid molecule. For illustrative purposes only, the repeat pattern may be, for example, ABABAB, ABABBAABBAABB, ABCABCABC, etc., where in these exemplary patterns, each capital letter (A, B, or C) represents a different TEE sequence. In some embodiments, at least two TEE sequences are contiguous with each other in the UTR of the nucleic acid molecule (i.e., there is no spacer sequence between them). In other embodiments, at least two TEE sequences are separated by a spacer sequence. In some embodiments, the UTR may include a TEE sequence-spacer sequence module that is repeated at least once, at least twice, at least three times, at least four times, at least five times, at least six times, at least seven times, at least eight times, at least nine times, or more than nine times. In any of the embodiments described in the paragraph, the UTR may be the 5'-UTR, the 3'-UTR, or both the 5'-UTR and the 3'-UTR of the nucleic acid molecule.

[0160] In some embodiments, the UTR of a nucleic acid molecule (e.g., an mRNA) according to the present disclosure comprises at least one translational repression element that functions to reduce the amount of a polypeptide or protein produced from the nucleic acid molecule. In some embodiments, the UTR of a nucleic acid molecule comprises one or more miR sequences or fragments thereof (e.g., miR seed sequences) that are recognized by one or more microRNAs. In some embodiments, the UTR of a nucleic acid molecule comprises one or more stem-loop structures that downregulate the translational activity of the nucleic acid molecule. Other mechanisms of repressing translational activity associated with a nucleic acid molecule are well known in the art. In any of the embodiments described in the paragraph, the UTR can be the 5'-UTR, the 3'-UTR, or both the 5'-UTR and the 3'-UTR of the nucleic acid molecule.

[0161] Polyadenylation (Poly-A) region In natural RNA processing, long stretches of adenosine nucleotides (poly-A) are typically added to messenger RNA (mRNA) molecules to increase the stability of the molecule. Immediately after transcription, the 3'-end of the transcript is cleaved to release the 3'-hydroxyl. Poly-A polymerase then adds a chain of adenosine nucleotides to the RNA. This process is called polyadenylation, and adds a poly-A stretch of 100-250 residues in length. It is believed that the poly-A stretch can provide various benefits to the nucleic acid molecules of the present invention.

[0162] Thus, in some embodiments, a nucleic acid molecule (e.g., mRNA) of the disclosure comprises a polyadenylation signal. In some embodiments, a nucleic acid molecule (e.g., mRNA) of the disclosure comprises one or more polyadenylation (poly-A) regions. In some embodiments, the polyA region consists entirely of adenine nucleotides or functional analogs thereof. In some embodiments, a nucleic acid molecule comprises at least one polyA region at its 3' end. In some embodiments, a nucleic acid molecule comprises at least one polyA region at its 5' end. In some embodiments, a nucleic acid molecule comprises at least one polyA region at its 5' end and at least one polyA region at its 3' end.

[0163] According to the present disclosure, in different embodiments, the polyA region can vary in length. In particular, in some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 30 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 35 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 40 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 45 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 50 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 55 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 60 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 65 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 70 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 75 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 80 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 85 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 90 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 95 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 100 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 110 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 120 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 130 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 140 nucleotides in length.In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 150 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 160 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 170 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 180 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 190 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 200 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 225 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 250 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 275 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 300 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 350 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 400 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 450 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 500 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 600 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 700 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 800 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 900 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 1000 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 1100 nucleotides in length.In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 1200 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 1300 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 1400 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 1500 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 1600 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 1700 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 1800 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 1900 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 2000 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule disclosed herein is at least 2250 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 2500 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 2750 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 3000 nucleotides in length.

[0164] In some embodiments, the length of the polyA region in a nucleic acid molecule can be selected based on the total length of the nucleic acid molecule or a portion thereof (e.g., the length of the coding region or the length of the open reading frame). For example, in some embodiments, the polyA region comprises about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more of the total length of the nucleic acid molecule containing the polyA region.

[0165] It is believed that certain RNA binding proteins can bind to the polyA region located at the 3' end of an mRNA molecule. These polyA binding proteins (PABPs) can regulate mRNA expression, such as by interacting with the translation initiation machinery in the cell and / or protecting the 3'-poly-A tail from degradation. Thus, in some embodiments, the nucleic acid molecules (e.g., mRNA) of the present disclosure contain at least one binding site for polyA binding protein (PABP). In other embodiments, the nucleic acid molecules are conjugated or complexed with PABP before being loaded into a delivery vehicle (e.g., lipid nanoparticles).

[0166] In some embodiments, the nucleic acid molecule (e.g., mRNA) of the present disclosure comprises a poly-AG quartet. A G-quartet is a cyclic hydrogen-bonded array of four guanosine nucleotides that can be formed from G-rich sequences in DNA and RNA. In this embodiment, the G-quartet is attached to the end of a poly-A region. Other parameters including the stability of the resulting polynucleotide (e.g., mRNA), protein production, and half-life at different times can be measured. After investigation, it was found that the amount of protein produced from the poly-AG quartet structure is at least equal to 75% of the amount of protein produced in a poly-A region using only 120 nucleotides.

[0167] In some embodiments, the nucleic acid molecules (e.g., mRNA) of the present disclosure may contain a polyA region and may be stabilized by the addition of a 3' stabilization region. In some embodiments, the 3' stabilization region for stabilization of the nucleic acid molecule (e.g., mRNA) comprises a polyA or polyAG quartet structure as described in International Patent Publication No. WO2013 / 103659, the contents of which are incorporated herein by reference in their entirety.

[0168] In other embodiments, 3' stabilization regions that may be used in connection with the nucleic acid molecules of the present disclosure include 3'-deoxyadenosine (cordycepin), 3'-deoxyuridine, 3'-deoxycytosine, 3'-deoxyguanosine, 3'-deoxythymine, 2',3'-dideoxynucleosides, 2',3'-dideoxyadenosine, 2',3'-dideoxyuridine, 2',3'-dideoxycytosine, 2',3'- Chain terminating nucleosides include, but are not limited to, 2'-dideoxyguanosine, 2',3'-dideoxythymine, 2'-deoxynucleosides or O-methyl nucleosides, 3'-deoxynucleosides, 2',3'-dideoxynucleosides 3'-O-methyl nucleosides, 3'-O-ethyl nucleosides, 3'-arabinosides, as well as other alternative nucleosides described herein or known in the art.

[0169] secondary structure Stem-loop structures can direct RNA folding, protect the structural stability of nucleic acid molecules (e.g., mRNA), provide recognition sites for RNA-binding proteins, and serve as substrates for enzymatic reactions. For example, the incorporation of miR and / or TEE sequences alters the shape of the stem-loop region, which can increase and / or decrease translation (Kedde et al. A Pumilio-induced RNA structure switch in p27-3'UTR controls miR-221 and miR-222 accessibility. Nat Cell Biol., 2010 Oct;12(10):1014-20, the contents of which are incorporated herein by reference in their entirety).

[0170] Thus, in some embodiments, the nucleic acid molecules (e.g., mRNAs) or portions thereof described herein may adopt a stem-loop structure, such as, but not limited to, a histone stem-loop. In some embodiments, the stem-loop structure is formed from a stem-loop sequence that is about 25 or about 26 nucleotides in length, such as, but not limited to, those described in International Patent Publication No. WO2013 / 103659, the contents of which are incorporated herein by reference in their entirety. Further examples of stem-loop sequences include those described in International Patent Publication No. WO2012 / 019780 and International Patent Publication No. WO201502667, the contents of which are incorporated herein by reference. In some embodiments, the stem-loop sequence comprises a TEE as described herein. In some embodiments, the stem-loop sequence comprises a miR sequence as described herein. In certain embodiments, the stem-loop sequence may comprise a miR-122 seed sequence. In certain embodiments, the nucleic acid molecule comprises the stem-loop sequence CAAAGGCTCTTTTCAGAGCCACCA (SEQ ID NO: 1). In other embodiments, the nucleic acid molecule comprises the stem-loop sequence CAAAGGCUCUUUUCAGAGCCACCA (SEQ ID NO:2).

[0171] In some embodiments, the nucleic acid molecule (e.g., mRNA) of the disclosure comprises a stem-loop sequence located upstream (5' end) of the nucleic acid molecule coding region. In some embodiments, the stem-loop sequence is located in the 5'-UTR of the nucleic acid molecule. In some embodiments, the nucleic acid molecule (e.g., mRNA) of the disclosure comprises a stem-loop sequence located downstream (3' end) of the nucleic acid molecule coding region. In some embodiments, the stem-loop sequence is located in the 3'-UTR of the nucleic acid molecule. In some cases, the nucleic acid molecule may comprise one or more stem-loop sequences. In some embodiments, the nucleic acid molecule comprises at least one stem-loop sequence in the 5'-UTR and at least one stem-loop sequence in the 3'-UTR.

[0172] In some embodiments, the nucleic acid molecule comprising the stem-loop structure further comprises a stabilizing region, which in some embodiments comprises at least one chain-terminating nucleoside that functions to increase the half-life of the nucleic acid molecule by slowing degradation. Exemplary chain-terminating nucleosides that may be used in connection with the present disclosure include, but are not limited to, 3'-deoxyadenosine (cordycepin), 3'-deoxyuridine, 3'-deoxycytosine, 3'-deoxyguanosine, 3'-deoxythymine, 2',3'-dideoxynucleosides, 2',3'-dideoxyadenosine, 2',3'-dideoxyuridine, 2',3'-dideoxycytosine, 2',3'-dideoxyguanosine, 2',3'-dideoxythymine, 2'-deoxynucleosides or O-methyl nucleosides, 3'-deoxynucleosides, 2',3'-dideoxynucleosides 3'-O-methyl nucleosides, 3'-O-ethyl nucleosides, 3'-arabinosides, as well as other alternative nucleosides described herein or known in the art. In other embodiments, the stem-loop structure may be stabilized by modifications to the 3' region of the polynucleotide that can prevent and / or inhibit the addition of oligo(U) (International Patent Publication No. WO2013 / 103659, incorporated herein by reference in its entirety).

[0173] In some embodiments, the nucleic acid molecule of the present disclosure comprises at least one stem-loop sequence and a polyA region or a polyadenylation signal. Non-limiting examples of polynucleotide sequences comprising at least one stem-loop sequence and a polyA region or a polyadenylation signal include those described in International Patent Publication No. WO2013 / 120497, International Patent Publication No. WO2013 / 120629, International Patent Publication No. WO2013 / 120500, International Patent Publication No. WO2013 / 120627, International Patent Publication No. WO2013 / 120498, International Patent Publication No. WO2013 / 120626, International Patent Publication No. WO2013 / 120499 and International Patent Publication No. WO2013 / 120628, the contents of all of which are incorporated herein by reference in their entirety.

[0174] In some embodiments, a nucleic acid molecule comprising a stem loop sequence and a polyA region or polyadenylation signal can encode a pathogenic antigen or a fragment thereof, such as those described in International Patent Publication No. WO2013 / 120499 and International Patent Publication No. WO2013 / 120628, the contents of which are incorporated herein by reference in their entireties.

[0175] In some embodiments, a nucleic acid molecule comprising a stem loop sequence and a polyA tract or polyadenylation signal can encode a therapeutic protein, such as those described in International Patent Publication No. WO2013 / 120497 and International Patent Publication No. WO2013 / 120629, the contents of which are incorporated herein by reference in their entireties.

[0176] In some embodiments, a nucleic acid molecule comprising a stem loop sequence and a polyA tract or polyadenylation signal can encode a tumor antigen or a fragment thereof, such as those described in International Patent Publication No. WO2013 / 120500 and International Patent Publication No. WO2013 / 120627, the contents of which are incorporated herein by reference in their entireties.

[0177] In some embodiments, a nucleic acid molecule comprising a stem loop sequence and a polyA tract or polyadenylation signal can encode an allergenic antigen or an autoimmune autoantigen, such as those described in International Patent Publication No. WO2013 / 120498 and International Patent Publication No. WO2013 / 120626, the contents of which are incorporated herein by reference in their entireties.

[0178] Functional Nucleotide Analogues In some embodiments, a nucleic acid molecule comprising a stem loop sequence and a polyA tract or polyadenylation signal can encode an allergenic antigen or an autoimmune autoantigen, such as those described in International Patent Publication No. WO2013 / 120498 and International Patent Publication No. WO2013 / 120626, the contents of which are incorporated herein by reference in their entireties.

[0179] Thus, in some embodiments, the payload nucleic acid molecule comprises at least one functional nucleotide analogue as described herein. In some embodiments, the functional nucleotide analogue comprises at least one chemical modification to the nucleobase, glycosyl group and / or phosphate group. Thus, the payload nucleic acid molecule comprising at least one functional nucleotide analogue contains at least one chemical modification to the nucleobase, glycosyl group and / or internucleoside linkage. Exemplary chemical modifications to the nucleobase, glycosyl group or internucleoside linkage of the nucleic acid molecule are provided herein.

[0180] As described herein, all nucleotides in a payload nucleic acid molecule, in the range of 0% to 100%, may be functional nucleotide analogs as described herein. For example, in various embodiments, about 1% to about 20%, about 1% to about 25%, about 1% to about 50%, about 1% to about 60%, about 1% to about 70%, about 1% to about 80%, about 1% to about 90%, about 1% to about 95%, about 10% to about 20%, about 10% to about 25%, about 10% to about 50%, about 10% to about 60%, about 10% to about 70%, about 10% to about 80%, about 10% to about 90%, about 10% to about 95%, about 10% to about 100%, about 20% to about 25%, about 20% to about 50%, about 20% to about 60%, about 20% to about 70%, about 20% to about 8 0%, about 20% to about 90%, about 20% to about 95%, about 20% to about 100%, about 50% to about 60%, about 50% to about 70%, about 50% to about 80%, about 50% to about 90%, about 50% to about 95%, about 50% to about 100%, about 70% to about 80%, about 70% to about 90%, about 70% to about 95%, about 70% to about 100%, about 80% to about 90%, about 80% to about 95%, about 80% to about 100%, about 90% to about 95%, about 90% to about 100%, or about 95% to about 100% is a functional nucleotide analog as described herein. In any of these embodiments, the functional nucleotide analogue can be present at any position in the nucleic acid molecule, including at the 5'-terminus, the 3'-terminus, and / or at one or more internal positions. In some embodiments, a single nucleic acid molecule can contain different sugar modifications, different nucleobase modifications, and / or different types of internucleoside linkages (e.g., backbone structures).

[0181] As described herein, 0%-100% of all nucleotides of a species (e.g., all purine-containing nucleotides of a species, or all pyrimidine-containing nucleotides of a species, or all A, G, C, T or U "as a species" in a payload nucleic acid molecule ranging from 0%-100%) can be a functional nucleotide analog as described herein. For example, in various embodiments, about 1% to about 20%, about 1% to about 25%, about 1% to about 50%, about 1% to about 60%, about 1% to about 70%, about 1% to about 80%, about 1% to about 90%, about 1% to about 95%, about 10% to about 20%, about 10% to about 25%, about 10% to about 50%, about 10% to about 60%, about 10% to about 70%, about 10% to about 80%, about 10% to about 90%, about 10% to about 95%, about 10% to about 100%, about 20% to about 25%, about 20% to about 50%, about 20% to about 60%, about 20% to about 70%, about 20% to about 8 0%, about 20% to about 90%, about 20% to about 95%, about 20% to about 100%, about 50% to about 60%, about 50% to about 70%, about 50% to about 80%, about 50% to about 90%, about 50% to about 95%, about 50% to about 100%, about 70% to about 80%, about 70% to about 90%, about 70% to about 95%, about 70% to about 100%, about 80% to about 90%, about 80% to about 95%, about 80% to about 100%, about 90% to about 95%, about 90% to about 100%, or about 95% to about 100% is a functional nucleotide analog as described herein. In any of these embodiments, the functional nucleotide analogue can be present at any position in the nucleic acid molecule, including at the 5'-terminus, the 3'-terminus, and / or at one or more internal positions. In some embodiments, a single nucleic acid molecule can contain different sugar modifications, different nucleobase modifications, and / or different types of internucleoside linkages (e.g., backbone structures).

[0182] Modifications to bases In some embodiments, functional nucleotide analogs include non-standard nucleobases. In some embodiments, standard nucleobases (e.g., adenine, guanine, uracil, thymine and cytosine) in a nucleotide can be modified or substituted to provide one or more functional analogs of the nucleotide. Exemplary modifications to nucleobases include, but are not limited to, one or more substitutions or modifications, including, but not limited to, alkyl, aryl, halogen, oxo, hydroxyl, alkoxy and / or thio substitutions, one or more fused or open rings, oxidation and / or reduction.

[0183] In some embodiments, the non-standard nucleobase is a modified uracil. Exemplary nucleobases and nucleosides having modified uracil include pseudouridine (ψ), pyridin-4-one ribose nucleosides, 5-azauracil, 6-azauracil, 2-thio-5-azauracil, 2-thiouracil (s 2 U), 4-thio-uracil (s 4 U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uracil (ho 5 U), 5-aminoallyl-uracil, 5-halo-uracil (e.g., 5-iodo-uracil or 5-bromouracil), 3-methyluracil (m 3 U), 5-methoxyuracil (mo 5 U), uracil 5-oxyacetic acid (cmo 5 U), uracyl 5-oxyacetate methyl (mcmo 5 U), 5-carboxymethyl-uracil (cm 5 U), 1-carboxymethyl-pseudouridine, 5-carboxylhydroxymethyl-uracil (CHM 5 U), 5-carboxyhydroxymethyl-uracil methyl ester (mchm 5 U), 5-methoxycarbonylmethyluracil (mcm 5 U), 5-methoxycarbonylmethyl-2-thiouracil (mcm 5 s 2 U), 5-aminomethyl-2-thio-uracil (nm 5 s 2U), 5-methylaminomethyl-2-uracil (mnm 5 U), 5-methylaminomethyl-2-thio-uracil (mnm 5 s 2 U), 5-methylaminomethyl-2-selenouracil (mnm 5 se 2 U), 5-carbamoylmethyluracil (ncm5U), 5-carboxymethylaminomethyluracil (cmnm 5 U), 5-carboxymethylaminomethyl-2-thio-uracil (cmnm 5 s 2 U), 5-propynyluracil, 1-propynyl-pseudouracil, 5-taurinomethyluracil (τm 5 U), 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thiouracil (τm 5 s 2 U), 1-taurinomethyl-4-thio-pseudouridine, 5-methyl-uracil (m 5 U, i.e., having the nucleic acid base deoxythymine), 1-methyl-pseudouridine (m 1 ψ), 1-ethyl-pseudouridine (Et 1 ψ), 5-methyl-2-thio-uracil (m 5 s 2 U), 1-methyl-4-thio-pseudouridine (m 1 s 4 ψ), 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine (m 3 ψ), 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouracil (D), dihydropseudouridine, 5,6-dihydrouracil, 5-methyl-dihydrouracil (m 5 D), 2-thio-dihydrouracil, 2-thio-dihydropseudouridine, 2-methoxy-uracil, 2-methoxy-4-thio-uracil, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uracil (acp 3U), 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine (acp 3 ψ), 5-(isopentenylaminomethyl)uracil (m 5 U), 5-(isopentenyl)aminomethyl)-2-thiouracil (m 5 s 2 U), 5,2'-O-dimethyluridine (m 5 Um), 2-thio-2'-O-methyluridine (s 2 Um), 5-methoxycarbonylmethyl-2'-O-methyluridine (mcm 5 Um), 5-carbamoylmethyl-2'-O-methyluridine (ncm 5 Um), 5-carboxymethylaminomethyl-2'-O-methyluridine (cmnm 5 Um), 3,2'-O-dimethyluridine (m 3 Um), and 5-(isopentenylaminomethyl)-2'-O-methyl-uridine (inm 5 Um), 1-thio-uracil, deoxythymidine, 5-(2-carbomethoxyvinyl)-uracil, 5-(carbamoylhydroxymethyl)-uracil, 5-carbamoylmethyl-2-thiouracil, 5-carboxymethyl-2-thiouracil, 5-cyanomethyluracil, 5-methoxy-2-thiouracil, and 5-3-(1-E-propenylamino)uracil.

[0184] In some embodiments, the non-standard nucleobase is a modified cytosine. Exemplary nucleobases and nucleosides having modified cytosines include 5-azacytosine, 6-azacytosine, pseudoisocytosine, 3-methylcytosine (m3C), N4-acetylcytosine (ac4C), 5-formylcytosine (f5C), N4-methyl-cytosine (m4C), 5-methyl-cytosine (m5C), 5-halo-cytosine (e.g., 5-iodo-cytosine), 5-hydroxymethyl-cytosine (hm5C), 1-methylcytosine ( ... -pseudoisocytosine, pyrrolocytosine, pyrrolopseudoisocytosine, 2-thiocytosine (s2C), 2-thio-5-methylcytosine, 4-thio-pseudoisocytosine, 4-thio-1-methyl-pseudoisocytosine, 4-thio-1-methyl-1-deaza-pseudoisocytosine, 1-methyl-1-deaza-pseudoisocytosine, zebularine, 5-aza-zebu larine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytosine, 2-methoxy-5-methylcytosine, 4-methoxy-pseudoisocytosine, 4-methoxy-1-methyl-pseudoisocytosine, lysine (k2C) , 5,2'-O-dimethylcytosine (m5Cm), N4-acetyl-2'-O-methylcytidine (ac4Cm), N4,2'-O-dimethylcytidine (m4Cm), 5-formyl-2'-O-methylcytidine (fSCm), N4,N4,2'-O-trimethylcytidine (m42Cm), 1-thio-cytosine, 5-hydroxy-cytosine, 5-(3-azidopropyl)-cytosine and 5-(2-azidoethyl)-cytosine.

[0185] In some embodiments, the non-standard nucleobase is a modified adenine. Exemplary nucleobases and nucleosides having an alternative adenine include 2-aminopurine, 2,6-diaminopurine, 2-amino-6-halopurine (e.g., 2-amino-6-chloropurine), 6-halopurine (e.g., 6-chloropurine), 2-amino-6-methylpurine, 8-azidoadenine, 7-deazaadenine, 7-deaza-8-azaadenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6 -Diaminopurine, 1-methyladenine (m1A), 2-methyladenine (m2A), N6-methyladenine (m6A), 2-methylthio-N6-methyladenine (ms2m6A), N6-isopentenyladenine (i6A), 2-methylthio-N6-isopentenyladenine (ms2i6A), N6-(cis-hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycinylcarbamoyl- Adenine (g6A), N6-threonylcarbamoyl-adenine (t6A), N6-methyl-N6-threonylcarbamoyl-adenine (m6t6A), 2-methylthio-N6-threonylcarbamoyl-adenine (ms2g6A), N6,N6-dimethyl-adenine (m62A), N6-hydroxy-norvalylcarbamoyl-adenine (hn6A), 2-methylthio-N6-hydroxy-norvalylcarbamoyl-adenine (ms2hn6A), N6-acetyladenine (ac6A), 7 -methyladenine, 2-methylthioadenine, 2-methoxyadenine, N6,2'-O-dimethyladenosine (m6Am), N6,N6,2'-O-trimethyladenosine (m62Am), 1,2'-O-dimethyladenosine (m1Am), 2-amino-N6-methylpurine, 1-thio-adenine, 8-azidoadenine, N6-(19-amino-pentaoxanonadecyl)-adenine, 2,8-dimethyl-adenine, N6-formyl-adenine and N6-hydroxymethyl-adenine.

[0186] In some embodiments, the non-standard nucleobase is a modified guanine. Exemplary nucleobases and nucleosides having modified guanine are inosine (I), 1-methylinosine (m1I), inosine (imG), methylinosine (mimG), 4-demethylinosine (imG-14), isowyosine (imG2), wybutosine (yW), peroxywybutosine (o2yW), hydroxywybutosine (OHyW), hypomodified hydroxywybutosine (OHyW*), 7-deazaguanine, , queuosine (Q), epoxyqueuosine (oQ), galactosylqueuosine (galQ), mannosylqueuosine, 7-cyano-7-deazaguanine (preQO), 7-aminomethyl-7-deazaguanine (preQ1), archaeosine (G+), 7-deaza-8-azaguanine, 6-thio-guanine, 6-thio-7-deaza-guanine, 6-thio-7-deaza-8-aza-guanine, 7-methyl-guanine (m7G), 6- Thio-7-methylguanine, 7-methyl-inosine, 6-methoxy-guanine, 1-methylguanine (m1G), N2-methylguanine (m2G), N2,N2-dimethylguanine (m22G), N2,7-dimethylguanine (m2,7G), N2,N2,7-dimethylguanine (m2,2,7G), 8-oxoguanine, 7-methyl-8-oxoguanine, 1-methyl-6-thio-guanine, N2-methyl-6-thio-guanine, N2,N These include 2-dimethyl-6-thio-guanine, N2-methyl-2'-O-methyl-guanosine (m2Gm), N2,N2-dimethyl-2'-O-methylguanosine (m22Gm), 1-methyl-2'-O-methylguanosine (m1Gm), N2,7-dimethyl-2'-O-methylguanosine (m2,7Gm), 2'-O-methylinosine (Im), 1,2'-O-dimethylinosine (mIm), 1-thio-guanine and O-6-methylguanine.

[0187] In some embodiments, the non-standard nucleobase of a functional nucleotide analog can be independently a purine, a pyrimidine, a purine or a pyrimidine analog, for example, in some embodiments, the non-standard nucleobase can be a modified adenine, cytosine, guanine, uracil, or hypoxanthine. In other embodiments, non-standard nucleobases include, for example, pyrazolo[3,4-d]pyrimidine, 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo (e.g., 8-bromo), 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenines. and naturally occurring and synthetic derivatives of bases including guanine, 5-halo, especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, deazaguanine, 7-deazaguanine, 3-deazaguanine, deazaadenosine, 7-deazaadenosine, 3-deazaadenosine, pyrazolo[3,4-d]pyrimidines, imidazo[1,5-a]1,3,5-triazinones, 9-deazapurines, imidazo[4,5-d]pyrazines, thiazolo[4,5-d]pyrimidines, pyrazin-2-ones, 1,2,4-triazines, pyridazines, or 1,3,5 triazines.

[0188] Sugar modification In some embodiments, the functional nucleotide analog comprises a non-standard glycosyl group. In various embodiments, the non-standard glycosyl group can be a 5-carbon or 6-carbon sugar (e.g., pentose, ribose, arabinose, xylose, glucose, galactose, or deoxy derivatives thereof) bearing one or more substituents, such as a halo group, a hydroxy group, a thiol group, an alkyl group, an alkoxy group, an alkenyloxy group, an alkynyloxy group, a cycloalkyl group, an aminoalkoxy group, an alkoxyalkoxy group, a hydroxyalkoxy group, an amino group, an azido group, an aryl group, an aminoalkyl group, an aminoalkenyl group, an aminoalkynyl group, and the like.

[0189] Typically, RNA molecules contain a ribosyl group, which is a five-membered ring with oxygen. Exemplary non-limiting alternative nucleotides include replacement of oxygen in ribose (e.g., with S, Se, or an alkylene such as methylene or ethylene); addition of a double bond (e.g., replacing ribose with cyclopentenyl or cyclohexenyl); ring contraction of ribose (e.g., forming a four-membered ring of cyclobutane or oxetane); ring expansion of ribose (e.g., adding additional rings such as anhydrohexitol, anthritol, mannitol, cyclohexanyl, cyclohexenyl, and morpholino (which also have phosphoramidate backbones), etc. forming 6- or 7-membered rings with carbon or heteroatoms; polycyclic forms (e.g., tricyclic and "unlocked" forms such as ethylene glycol nucleic acid (GNA) (e.g., R-GNA or S-GNA) in which the ribose is replaced by a glycol unit attached to a phosphodiester bond), threose nucleic acid (TNA in which the ribose is replaced by α-L-threofuranosyl-(3'→2')), and peptide nucleic acid (PNA in which a 2-amino-ethyl-glycine bond replaces the ribose and phosphodiester backbone).

[0190] In some embodiments, a glycosyl group contains one or more carbons that have the opposite stereochemical configuration to the corresponding carbon in ribose. Thus, a nucleic acid molecule can contain nucleotides that contain, for example, arabinose or L-ribose as the sugar. In some embodiments, a nucleic acid molecule contains at least one nucleoside, where the sugar is L-ribose, 2'-O-methylribose, 2'-fluororibose, arabinose, hexitol, LNA, or PNA.

[0191] Internucleoside bond modification In some embodiments, the payload nucleic acid molecules of the present disclosure can include one or more modified internucleoside linkages (e.g., a phosphate backbone). The phosphate group of the backbone can be altered by replacing one or more oxygen atoms with a different substituent.

[0192] In some embodiments, functional nucleotide analogs may contain unmodified phosphate moieties replaced with alternative internucleoside bonds. Examples of alternative phosphate ester groups include, but are not limited to, phosphorothioates, phosphoroselenates, boranophosphates, boranophosphates, hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates, and phosphotriesters. The two non-linked oxygens of phosphorodithioates are all replaced with sulfur. Modified phosphate ester bonds can also be linked by replacing oxygen with nitrogen (bridged phosphoramidates), sulfur (bridged phosphorothioates), and carbon (bridged methylene phosphonates).

[0193] Alternative nucleosides and nucleotides include one or more non-bridging oxygens replaced by borane moiety (BH3), sulfur (thio), methyl, ethyl, and / or methoxy. As a non-limiting example, two non-bridging oxygens at the same position (e.g., α, β, or γ positions) can be replaced by sulfur (thio) and methoxy. Substitution of one or more oxygen atoms at the position of a phosphate moiety (e.g., α-phosphorothioate) enhances the stability (e.g., against exonucleases and endonucleases) of RNA and DNA through unnatural phosphorothioate backbone linkages. Phosphorothioate DNA and RNA have enhanced nuclease resistance and therefore longer half-life in cellular environments.

[0194] Other internucleoside linkages that can be used in accordance with the present disclosure include internucleoside linkages that do not contain a phosphorus atom.

[0195] Further examples of nucleic acid molecules (e.g., mRNA), compositions, formulations and / or methods relating thereto that may be used in connection with the present disclosure can be found in WO2002 / 098443, WO2003 / 051401, WO2008 / 052770, WO2009127230, WO2006122828, WO2008 / 083949, WO 2010088927, WO2010 / 037539, WO2004 / 004743, WO2005 / 016376, WO2006 / 024518, WO 2007 / 095976, WO2008 / 014979, WO2008 / 077592, WO2009 / 030481, WO2009 / 095226, WO 2011069586, WO2011026641, WO2011 / 144358, WO2012019780, WO2012013326, WO201 2089338, WO2012113513, WO2012116811, WO2012116810, WO2013113502, WO20131135 01, WO2013113736, WO2013143698, WO2013143699, WO2013143700, WO2013 / 120626, W O2013120627, WO2013120628, WO2013120629, WO2013174409 / WO2015127917, WO2015

[0026] The present invention further includes those described in WO2015 / 024667, WO2015 / 024665, WO2015 / 024666, WO2015 / 024664, WO2015101415, WO2015101414, WO2015024667, WO2015062738, WO2015101416, the contents of each of which are incorporated herein in their entirety.

[0196] Dosage form According to the present disclosure, the nanoparticle composition described herein may include at least one lipid fraction and one or more other fractions, such as therapeutic and / or prophylactic agents. The nanoparticle composition may be designed for one or more specific applications or goals. The elements of the nanoparticle composition may be selected based on the specific application or goal and / or based on the efficacy, toxicity, cost, ease of use, availability or other characteristics of one or more of the elements. Similarly, the efficacy and toxicity of a particular combination of elements may be used to select a particular formulation of the nanoparticle composition for a particular application or goal.

[0197] The lipid fraction of the nanoparticle composition may include lipids of formula (I) (and subformulas thereof) as described herein, phospholipids (e.g., unsaturated lipids such as DOPE or DSPC, etc.), PEG lipids, and structural lipids. The elements of the lipid fraction may be provided in specific ratios.

[0198] In one embodiment, provided herein is a nanoparticle composition comprising a cationic or ionizable lipid compound provided herein, a therapeutic agent, and one or more excipients. In one embodiment, the cationic or ionizable lipid compound comprises a compound of formula (I) (and subformulas thereof) as described herein, and any one or more other ionizable lipid compounds. In one embodiment, the one or more excipients are selected from neutral lipids, steroids, and polymer-conjugated lipids. In one embodiment, the therapeutic agent is encapsulated within or associated with the lipid nanoparticles.

[0199] In one embodiment, provided herein is a nanoparticle composition (lipid nanoparticle) comprising the following components: i) 40 to 50 mol% cationic lipid; ii) neutral lipids, iii) steroids, iv) polymer-conjugated lipids, and v) Therapeutic agents.

[0200] As used herein, "mole percent" refers to the molar percent of a given fraction relative to the total number of moles of all lipid fractions in the LNP (i.e., the total number of moles of cationic lipids, neutral lipids, steroid and polymer-conjugated lipids).

[0201] In one embodiment, the cationic lipid comprises 41-49 mol%, 41-48 mol%, 42-48 mol%, 43-48 mol%, 44-48 mol%, 45-48 mol%, 46-48 mol%, or 47.2-47.8 mol% of the lipid nanoparticle. In one embodiment, the cationic lipid comprises about 47.0, 47.1, 47.2, 47.3, 47.4, 47.5, 47.6, 47.7, 47.8, 47.9, or 48.0 mol% of the lipid nanoparticle.

[0202] In one embodiment, the neutral lipid is present at a concentration of 5-15 mol%, 7-13 mol%, or 9-11 mol%. In one embodiment, the neutral lipid is present at a concentration of about 9.5, 10, or 10.5 mol%. In one embodiment, the molar ratio of cationic lipid to neutral lipid is about 4.1:1.0 to about 4.9:1.0, about 4.5:1.0 to about 4.8:1.0, or about 4.7:1.0 to 4.8:1.0.

[0203] In one embodiment, the steroid is present in a concentration range of 39-49 mol%, 40-46 mol%, 40-44 mol%, 40-42 mol%, 42-44 mol%, or 44-46 mol%. In one embodiment, the steroid is present in a concentration of 40, 41, 42, 43, 44, 45, or 46 mol%. In one embodiment, the molar ratio of cationic lipid to steroid is 1.0:0.9 to 1.0:1.2, or 1.0:1.0 to 1.0:1.2. In one embodiment, the steroid is cholesterol.

[0204] In one embodiment, the ratio of therapeutic agent to lipid in the LNP (i.e., N / P, where N represents the number of moles of cationic lipid and P represents the number of moles of phosphate present as part of the nucleic acid backbone) is between 2:1 and 30:1, e.g., between 3:1 and 22:1. In one embodiment, N / P is between 6:1 and 20:1, or between 2:1 and 12:1. Exemplary N / P ranges include about 3:1, about 6:1, about 12:1, and about 22:1.

[0205] In one embodiment, provided herein is a lipid nanoparticle comprising the following components: i) cationic lipids with an effective pKa greater than 6.0; ii) 5 to 15 mol% neutral lipids; iv) 30-45 mol % steroids; v) polymer-conjugated lipids, and vi) A therapeutic agent or a pharma- ceutically acceptable salt or prodrug thereof. In particular, the mole percentage is determined based on the total number of moles of lipid present in the lipid nanoparticle.

[0206] In one embodiment, the cationic lipid can be any one of a number of lipids that carry a net positive charge at a selected pH (e.g., physiological pH). Exemplary cationic lipids are described below. In one embodiment, the pKa of the cationic lipid is greater than 6.25. In one embodiment, the pKa of the cationic lipid is greater than 6.5. In one embodiment, the cationic lipid has a pKa of greater than 6.1, greater than 6.2, greater than 6.3, greater than 6.35, greater than 6.4, greater than 6.45, greater than 6.55, greater than 6.6, greater than 6.65, or greater than 6.7.

[0207] In one embodiment, the lipid nanoparticles comprise 40-45 mol % of cationic lipid.In one embodiment, the lipid nanoparticles comprise 45-50 mol % of cationic lipid.

[0208] In one embodiment, the molar ratio of cationic lipid to neutral lipid is about 2: 1 to about 8: 1. In one embodiment, the neutral lipid accounts for 5-10 mol % of the lipid in the lipid nanoparticle.

[0209] Exemplary anionic lipids include, but are not limited to, phosphatidylglycerol, dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG) or 1,2-distearoyl-sn-glycero-3-phospho-(1'-rac-glycerol) (DSPG).

[0210] In one embodiment, the lipid nanoparticles contain 1-10 mol% anionic lipid. In one embodiment, the lipid nanoparticles contain 1-5 mol% anionic lipid. In one embodiment, the lipid nanoparticles contain 1-9 mol%, 1-8 mol%, 1-7 mol%, or 1-6 mol% anionic lipid. In one embodiment, the molar ratio of anionic lipid to neutral lipid is 1:1 to 1:10.

[0211] In one embodiment, the steroid is cholesterol. In one embodiment, the molar ratio of cationic lipid to cholesterol is about 5:1 to 1:1. In one embodiment, the lipid nanoparticles contain 32 to 40 mol % of a steroid.

[0212] In one embodiment, the sum of the molar percentage of neutral lipids and the molar percentage of anionic lipids is between 5 and 15 molar percentage. In one embodiment, the sum of the molar percentage of neutral lipids and the molar percentage of anionic lipids is between 7 and 12 molar percentage.

[0213] In one embodiment, the molar ratio of anionic lipid to neutral lipid is 1: 1 to 1: 10. In one embodiment, the sum of the mol% of neutral lipid and steroid is 35 to 45 mol percent.

[0214] In one embodiment, the lipid nanoparticles comprise the following components: i) 45 to 55 mol% cationic lipid; ii) 5 to 10 mol% neutral lipids; iii) 1 to 5 mol % of an anionic lipid, and iv) 32-40 mol% steroids.

[0215] In one embodiment, the lipid nanoparticles contain 1.0-2.5 mol% polymer-conjugated lipid. In one embodiment, the polymer-conjugated lipid is present at a concentration of about 1.5 mol%.

[0216] In one embodiment, the neutral lipid is present at a concentration of 5-15 mol%, 7-13 mol%, or 9-11 mol%. In one embodiment, the neutral lipid is present at a concentration of about 9.5, 10, or 10.5 mol%. In one embodiment, the molar ratio of cationic lipid to neutral lipid is about 4.1:1.0 to about 4.9:1.0, about 4.5:1.0 to about 4.8:1.0, or about 4.7:1.0 to 4.8:1.0.

[0217] In one embodiment, the steroid is cholesterol. In some embodiments, the steroid is present in a concentration range of 39-49 mol%, 40-46 mol%, 40-44 mol%, 40-42 mol%, 42-44 mol%, or 44-46 mol%. In one embodiment, the steroid is present in a concentration of 40, 41, 42, 43, 44, 45, or 46 mol%. In some embodiments, the molar ratio of cationic lipid to steroid is 1.0:0.9 to 1.0:1.2, or 1.0:1.0 to 1.0:1.2.

[0218] In one embodiment, the molar ratio of cationic lipid to steroid is between 5:1 and 1:1.

[0219] In one embodiment, the lipid nanoparticles contain 1.0-2.5 mol% polymer-conjugated lipid. In one embodiment, the polymer-conjugated lipid is present at a concentration of about 1.5 mol%.

[0220] In one embodiment, the molar ratio of cationic lipid to polymer-conjugated lipid is about 100:1 to about 20:1. In one embodiment, the molar ratio of cationic lipid to polymer-conjugated lipid is about 35:1 to about 25:1.

[0221] In one embodiment, the average diameter of the lipid nanoparticles is between 50 nm and 100 nm, or between 60 nm and 85 nm.

[0222] In one embodiment, the composition comprises a cationic lipid provided herein, DSPC, cholesterol and PEG-lipid, and mRNA. In one embodiment, the molar ratio of the cationic lipid provided herein, DSPC, cholesterol and PEG-lipid is about 50:10:38.5:1.5.

[0223] Nanoparticle compositions can be designed for one or more specific uses or goals. For example, nanoparticle compositions can be designed to deliver therapeutic and / or prophylactic agents (e.g., RNA) to specific cells, tissues, organs, or systems thereof, etc., in the mammalian body. The physicochemical properties of the nanoparticle composition can be altered to increase selectivity for specific body targets. For example, particle size can be adjusted based on fenestration size of different organs. The therapeutic and / or prophylactic agents included in the nanoparticle composition can also be selected based on one or more desired delivery targets. For example, therapeutic and / or prophylactic agents can be selected for use in a particular indication, condition, disease, or condition and / or delivered (e.g., locally or specifically delivered) to a particular cell, tissue, organ, or system, etc. In some embodiments, the nanoparticle composition can include an mRNA encoding a target polypeptide that can be translated in a cell to produce the target polypeptide. The composition can be designed to be specifically delivered to a particular organ. In some embodiments, the composition can be designed to be specifically delivered to the liver of a mammal.

[0224] The amount of therapeutic and / or prophylactic agent in the nanoparticle composition can depend on the size, composition, desired targeting and / or other properties of the nanoparticle composition, and the properties of the therapeutic and / or prophylactic agent. For example, the amount of RNA that can be used in the nanoparticle composition can depend on the size, sequence and other characteristics of the RNA. The relative amounts of therapeutic and / or prophylactic agent and other components (e.g., lipids) in the nanoparticle composition can also be adjusted. In some embodiments, the wt / wt ratio of lipid fraction to therapeutic and / or prophylactic agent in the nanoparticle composition can be about 5:1 to about 60:1, e.g., 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 25:1, 30:1, 35:1, 40:1, 45:1, 50:1 and 60:1. The wt / wt ratio of the lipid fraction to the therapeutic and / or prophylactic agent can be from about 10: 1 to about 40: 1. In one embodiment, the weight / weight ratio is about 20: 1. The amount of therapeutic and / or prophylactic agent in the nanoparticle composition can be measured by absorption spectroscopy (e.g., UV-Vis spectroscopy).

[0225] In some embodiments, the nanoparticle composition comprises one or more RNAs, and the one or more RNAs, lipids, and the amounts thereof used can be selected to provide a particular N:P ratio. The N:P ratio of a composition refers to the molar ratio of nitrogen atoms in one or more lipids to the number of phosphate groups in the RNA. In some embodiments, a low N:P ratio is selected. The one or more RNAs, lipids, and the amounts thereof used can be selected to provide an N:P ratio of about 2:1 to about 30:1, such as 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 12:1, 14:1, 16:1, 18:1, 20:1, 22:1, 24:1, 26:1, 28:1, or 30:1. In some embodiments, the N:P ratio can be about 2:1 to about 8:1. In other embodiments, the N:P ratio is about 5:1 to about 8:1. For example, the N:P ratio can be about 5.0:1, about 5.5:1, about 5.67:1, about 6.0:1, about 6.5:1, or about 7.0:1. For example, the N:P ratio can be about 5.67:1.

[0226] The physical properties of a nanoparticle composition may depend on its fraction. For example, a nanoparticle composition that contains cholesterol as a structural lipid may have different properties compared to a nanoparticle composition that contains a different structural lipid. Similarly, the properties of a nanoparticle composition may depend on the absolute or relative amounts of its fractions. For example, a nanoparticle composition that contains a high molar fraction of phospholipids has different properties than a nanoparticle composition that contains a low molar fraction of phospholipids. The properties can also be changed by the method and conditions of preparation of the nanoparticle composition.

[0227] Nanoparticle compositions can be characterized by various methods. For example, microscopy (e.g., transmission electron microscopy or scanning electron microscopy) can be used to examine the morphology and size distribution of nanoparticle compositions. Dynamic light scattering or potentiometric methods (e.g., potentiometric titration) can be used to measure the zeta potential. Dynamic light scattering can also be used to determine particle size. The Zetasizer Nano ZS (Malvem Instruments Ltd, Malvem, Worcestershire, UK) can also be used to measure several characteristics of nanoparticle compositions, such as particle size, polydispersity index, and Zeta potential.

[0228] In various embodiments, the average size of the nanoparticle composition can be between 10 nm and 100 nm, for example, the average size can be between about 40 nm and about 150 nm, such as about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm. In some embodiments, the average size of the nanoparticle composition can be about 50 nm to about 100 nm, about 50 nm to about 90 nm, about 50 nm to about 80 nm, about 50 nm to about 70 nm, about 50 nm to about 60 nm, about 60 nm to about 100 nm, about 60 nm to about 90 nm, about 60 nm to about 80 nm, about 60 nm to about 70 nm, about 70 nm to about 100 nm, about 70 nm to about 90 nm, about 70 nm to about 80 nm, about 80 nm to about 100 nm, about 80 nm to about 90 nm, or about 90 nm to about 100 nm. In some embodiments, the average size of the nanoparticle composition can be about 70 nm to about 100 nm. In some embodiments, the average size can be about 80 nm. In other embodiments, the average size can be about 100 nm.

[0229] The nanoparticle composition may be relatively homogeneous. The polydispersity index may be used to indicate the homogeneity of the nanoparticle composition, for example, the particle size distribution of the nanoparticle composition. A small (e.g., less than 0.3) polydispersity index usually indicates a narrow particle size distribution. The nanoparticle composition may have a polydispersity index of about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of the nanoparticle composition may be about 0.10 to about 0.20.

[0230] The zeta potential of a nanoparticle composition can be used to indicate the zeta potential of the composition. For example, the zeta potential can describe the surface charge of the nanoparticle composition. Nanoparticle compositions with a relatively low positive or negative charge are generally desirable because more highly charged species can cause undesirable interactions with cells, tissues, and other elements of the human body. In some embodiments, the zeta potential of the nanoparticle composition is about -10 mV to about +20 mV, about -10 mV to about +15 mV, about -10 mV to about +10 mV, about -10. about -10 mV to about 0 mV, about -10 mV to about -5 mV, about -5 mV to about +20 mV, about -5 mV to about +15 mV, about -5 mV to about +10 mV, about -5 mV to about +5 mV, about -5 mV to about 0 mV, about 0 mV to about +20 mV, about 0 mV to about +15 mV, about 0 mV to about +10 mV, about 0 mV to about +5 mV, about +5 mV to about +20 mV, about +5 mV to about +15 mV, or about +5 mV to about +10 mV.

[0231] The encapsulation efficiency of a therapeutic and / or prophylactic agent describes the amount of therapeutic and / or prophylactic agent that is encapsulated or associated with a nanoparticle composition after preparation relative to the initial amount provided. It is desirable for the encapsulation efficiency to be high (e.g., close to 100%). The encapsulation efficiency can be measured, for example, by comparing the amount of therapeutic and / or prophylactic agent before disintegrating the nanoparticle composition with one or more organic solvents or detergents and after processing into a solution containing the nanoparticle composition. Fluorescence can be used to measure the amount of free therapeutic and / or prophylactic agent (e.g., RNA) in solution. For the nanoparticle compositions described herein, the encapsulation efficiency of a therapeutic and / or prophylactic agent can be at least 50%, e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency can be at least 80%. In certain embodiments, the encapsulation efficiency may be at least 90%.

[0232] Nanoparticle compositions can optionally include one or more coatings.For example, nanoparticle compositions can be formulated into capsules, films or tablets with coatings.Capsules, films or tablets of the compositions described herein can have any useful size, tensile strength, hardness or density.

[0233] Pharmaceutical Compositions According to the present disclosure, the nanoparticle composition may be formulated into a part or all of a pharmaceutical composition. The pharmaceutical composition may include one or more nanoparticle compositions. For example, the pharmaceutical composition may include one or more nanoparticle compositions and one or more different therapeutic and / or prophylactic agents. The pharmaceutical composition may further include one or more pharma- ceutically acceptable excipients or auxiliary ingredients, such as those described herein. General guidelines for the preparation and production of pharmaceutical compositions and formulations are found in, for example, Remington's The Science and Practice of Pharmacy, 21st Edition, AR Gennaro; Lippincott, Williams & Wilkins, Baltimore, Md., 2006. Conventional excipients and auxiliary ingredients may be used in any pharmaceutical composition, as long as they are compatible with one or more fractions of the nanoparticle composition. If the excipient or auxiliary ingredient is incompatible with a fraction of the nanoparticle composition, the combination will result in undesirable biological effects or adverse effects.

[0234] In some embodiments, one or more excipients or auxiliary ingredients can comprise more than 50% of the total mass or volume of a pharmaceutical composition comprising a nanoparticle composition. For example, typically, one or more excipients or auxiliary ingredients can comprise 50%, 60%, 70%, 80%, 90% or more of pharmaceutical convention. In some embodiments, a pharma- ceutically acceptable excipient is at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% pure. In some embodiments, the excipient is approved for human and veterinary use. In some embodiments, the excipient is approved by the U.S. Food and Drug Administration. In some embodiments, the excipient is pharmaceutical grade. In some embodiments, the excipient meets the standards of the United States Pharmacopoeia (USP), the European Pharmacopoeia (EP), the British Pharmacopoeia and / or the International Pharmacopoeia.

[0235] The relative amounts of one or more nanoparticle compositions, one or more pharma- ceutically acceptable excipients, and / or any other components in a pharmaceutical composition according to the present disclosure may vary depending on the relevant circumstances, such as their characteristics, size, etc., and further depending on the subject and route of administration of the composition. For example, a pharmaceutical composition may contain 0.1% to 100% (wt / wt) of one or more nanoparticle compositions.

[0236] In some embodiments, the nanoparticle compositions and / or pharmaceutical compositions according to the present disclosure are stored and transported refrigerated or frozen, for example at temperatures below 4°C, about -150°C to 0°C, or about -80°C to about -20°C (e.g., about -5°C, -10°C, -15°C, -20°C, -25°C, -30°C, -40°C, -50°C, -60°C, -70°C, -80°C, -90°C, -130°C, or -150°C). Pharmaceutical compositions comprising compounds of formula (I) and its subformulas in solution form are stored or transported refrigerated, for example, at about -20°C, -30°C, -40°C, -50°C, -60°C, -70°C, or -80°C. In some embodiments, the present disclosure also relates to methods of improving the stability of nanoparticle compositions and / or pharmaceutical compositions comprising a compound of Formula (I) (and subformulas thereof) by storing the nanoparticle compositions and / or pharmaceutical compositions at a temperature of 4° C. or lower, such as from about −150° C. to about 0° C., or from about −80° C. to about −20° C. (e.g., at a temperature of about −5° C., −10° C., −15° C., −20° C., −25° C., −30° C., −40° C., −50° C., −60° C., −70° C., −80° C., −90° C., −130° C., or −150° C.). The nanoparticle compositions and / or pharmaceutical compositions disclosed herein are stabilized at temperatures below 4° C. (e.g., about 4° C. to −20° C.) for about at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 1 month, at least 2 months, at least 4 months, at least 6 months, at least 8 months, at least 10 months, at least 12 months, at least 14 months, at least 16 months, at least 18 months, at least 20 months, at least 22 months, or at least 24 months. In one embodiment, the formulation is stabilized at about 4° C. for at least 4 weeks. In an embodiment, the pharmaceutical composition of the present disclosure comprises a nanoparticle composition disclosed herein and one or more pharma- ceutically acceptable carriers selected from Tris, acetate (e.g., acetic acid), citrate (e.g., sodium citrate), saline, PBS, and sucrose.In certain embodiments, the pH of the pharmaceutical composition of the present disclosure is about 7-8 (e.g., 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, or 8.0, or 7.5-8, or 7-7.8). A pharmaceutical composition according to the present disclosure comprises a nanoparticle composition disclosed herein, Tris, saline, and sucrose, and has a pH of about 7.5-8, e.g., suitable for storage or transportation at about -20°C. For example, a pharmaceutical composition of the present disclosure comprises a nanoparticle composition disclosed herein and PBS, and has a pH of about 7-7.8, e.g., suitable for storage or transportation at a temperature of about 4°C or less. In the context of this disclosure, "stable" and "stability" refer to the resistance of a nanoparticle composition or pharmaceutical composition disclosed herein to chemical or physical changes (e.g., degradation, change in particle size, change in aggregation) under given manufacturing, preparation, transportation, storage and / or use conditions (e.g., when subjected to stress (shear forces, freeze / thaw stresses, etc.)).

[0237] Nanoparticle compositions and / or pharmaceutical compositions comprising one or more nanoparticle compositions can be administered to any patient or subject, including those who may benefit from the delivery of therapeutic and / or prophylactic agents to specific cells, tissues, organs, or systems thereof, such as the renal system. Although the description herein of nanoparticle compositions and pharmaceutical compositions comprising nanoparticle compositions is directed primarily to compositions suitable for administration to humans, it will be understood by those skilled in the art that such compositions are generally suitable for administration to any other mammal. Modifications of compositions suitable for administration to humans to make them suitable for administration to a variety of animals are well known and can be designed and / or performed by an ordinarily skilled veterinary pharmacologist with no more than routine experimentation. Subjects to which the compositions are intended for administration include, but are not limited to, humans, other primates, and other mammals, including commercially relevant mammals such as cows, pigs, horses, sheep, cats, dogs, mice, and rats.

[0238] Pharmaceutical compositions containing one or more nanoparticle compositions may be prepared by any method known or hereafter developed in the art of pharmacology. Typically, such methods of preparation include bringing the active ingredient into association with an excipient and / or one or more other accessory ingredients, and then, if necessary, dividing, shaping, and / or packaging the product into desired single or multiple dosage units.

[0239] Pharmaceutical compositions according to the present disclosure may be prepared, packaged, and / or sold in bulk as a single unit dose and / or as a plurality of single unit doses. A "unit dose" is a discrete amount of a pharmaceutical composition comprising a predetermined amount of an active ingredient (e.g., a nanoparticle composition). The amount of active ingredient is typically equal to the dose of the active ingredient that would be administered to a subject, and / or a convenient fraction of that dose, such as one-half or one-third of that dose.

[0240] Pharmaceutical compositions can be prepared in various forms suitable for various routes and methods of administration. For example, pharmaceutical compositions can be prepared in liquid dosage forms (e.g., emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups and elixirs), injectable dosage forms, solid dosage forms (e.g., capsules, tablets, pills, powders and granules), dosage forms for topical and / or transdermal administration (e.g., ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants and patches), suspensions, powders and other forms.

[0241] Liquid dosage forms for oral and parenteral administration include, but are not limited to, pharma- ceutically acceptable emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups, and / or elixirs. In addition to the active ingredient, liquid dosage forms can contain inert diluents commonly used in the art, such as water or other solvents, solubilizers, and emulsifiers, such as ethanol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (especially cottonseed oil, peanut oil, corn oil, germ oil, olive oil, castor oil, and sesame oil), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycol, and sorbitan fatty acid esters, and mixtures thereof. In addition to inert diluents, oral compositions can contain other therapeutic and / or prophylactic agents, such as wetting agents, emulsifying suspending agents, other formulations such as sweeteners, flavoring agents, and / or fragrances. In certain embodiments for parenteral administration, the compositions are mixed with a solubilizing agent such as Cremophor™, alcohols, oils, modified oils, glycols, polysorbates, cyclodextrin polymers, and / or combinations thereof.

[0242] Injectable preparations, for example, sterile injectable aqueous or oleaginous suspensions, can be prepared according to well-known techniques using suitable dispersing agents, wetting agents and / or suspending agents. Sterile injectable preparations can be sterile injectable solutions, suspensions and / or emulsions in non-toxic parenterally acceptable diluents and / or solvents, for example, as solutions in 1,3-butylene glycol. Acceptable carriers and solvents that can be used include water, US Ringer's solution and isotonic sodium chloride solution. Sterile, fixed oils are usually used as solvents or suspending media. For this purpose, any non-irritating fixed oil can be used, including synthetic glycerin monoesters or diglycerides. Fatty acids such as oleic acid can be used in the preparation of injectables.

[0243] The injectable preparations can be sterilized by filtration through a bacterial-retaining filter and / or by incorporating sterilizing agents in the form of sterile solid compositions which are dissolved or dispersed in sterile water or other sterile injectable medium prior to use.

[0244] The present invention discloses a method for delivering a therapeutic and / or prophylactic agent to a cell or organ of a mammal, producing a target polypeptide in the cells of the mammal, administering to the mammal, and / or contacting the cells of the mammal with a nanoparticle composition comprising the therapeutic and / or prophylactic agent to treat a disease or condition in the mammal.

[0245] Working Example The examples in this section are offered by way of illustration only and not by way of limitation.

[0246] Common methods Typical preparative HPLC method: HPLC purification is performed on a Waters 2767 equipped with a diode array detector (DAD) on an Inertsil Pre-C8 OBD column, typically using water containing 0.1% TFA as solvent A and acetonitrile as solvent B.

[0247] General LCMS method: LCMS analysis is performed on a Shimadzu (LC-MS2020) system. Chromatography is typically performed on a SunFire C18 using water containing 0.1% formic acid as solvent A and acetonitrile containing 0.1% formic acid as solvent B.

[0248] Example 1: Synthesis of Compound 1 [ka] Synthesis of compound 1 Compound 3-4 (80 mg, 0.09 mmol, 1.0 eq.), compound SM1 (16 mg, 0.11 mmol, 1.2 eq.), HATU (42 mg, 0.11 mmol, 1.2 eq.) and DIEA (35 mg, 0.27 mmol, 3.0 eq.) were dissolved in dichloromethane (3 mL) and stirred at room temperature for 1 hour. The mixture was concentrated and purified by high performance liquid chromatography to obtain colorless oily compound 1 (32 mg, 34.2% yield). (MC20-1207-108) 1 HNMR(400MHz,CDCl3)δ:0.81-0.94(m,12H),1.16-1.35(m,54H),1.36-1.49(m,5H),1.50-1.69(m,20H),1.76-1.86(m,2H),2.17-2 .42(m,14H),2.45-2.53(m,3H),2.92-3.03(m,1H),3.34-3.46(m,1H),3.62-3.74(m,1H),3.97(d,J=5.6Hz,3H),4.36-4.48(m,1H). LCMS:Rt:1.270min;MSm / z(ESI):976.9[M+H] + .

[0249] Example 2: Synthesis of Compound 2 [ka] Synthesis of compound 2 Compound 3-4 (150 mg, 0.17 mmol, 1.0 eq.) was dissolved in methanol (4 mL), 37% aqueous formaldehyde (0.1 mL) and acetic acid (1 drop) were added, and the mixture was stirred at room temperature for 2 h. NaCNBH3 (21 mg, 0.34 mmol, 2.0 eq.) was then added, and the resulting mixture was stirred at room temperature for 16 h. LCMS showed that the reaction was complete. The reaction mixture was concentrated and purified using high performance liquid chromatography to give compound 2 (41 mg, 27% yield) as a colorless oil. 1HNMR(400MHz,CDCl3)δ:0.86-0.90(m,12H),1.26-1.32(m,61H),1.41-1.50(m,4H),1.52-1.70(m,10H),2.30(t ,J=7.4Hz,4H),2.37-2.47(m,4H),2.49-2.52(m,6H),2.69-2.77(m,2H),3.43-3.55(m,1H),3.96-3.97(m,4H). LCMS:Rt:2.360min;MS m / z(ESI):877.8[M+H] + .

[0250] Example 3: Synthesis of Compound 3 [ka] Step 1: Synthesis of compound 3-2 Compound 3-2 (1 g, 3.85 mmol, 1.0 eq.) and Pd / C were added to ethyl acetate (40 mL) under a hydrogen gas atmosphere and stirred at 40° C. overnight. The reaction solution was filtered through diatomaceous earth, and the filtrate was concentrated to obtain colorless oily compound 3-2 (789 mg, 89.2% yield). (MC20-1207-092) LCMS:Rt:0.380min;MSm / z(ESI):231.2[M+H] + . Step 2: Synthesis of compound 3-3 Compound 3-2 (82 mg, 0.36 mmol, 1.0 eq.), compound SM2 (400 mg, 0.89 mmol, 2.5 eq.), K2CO3 (149 mg, 1.08 mmol, 3.0 eq.), and Cs2CO3 (3 mg, 0.01 mmol, 0.03 eq.) were added to acetonitrile (10 mL) and stirred at 100°C overnight. The reaction solution was concentrated and then purified by silica gel column chromatography (MeOH:DCM = 0% to 3%) to obtain yellow oily compound 3-3 (162 mg, yield 47.2%). (MC20-1207-094) LCMS:Rt:2.200min;MSm / z(ESI):963.9[M+H] + . Step 3: Synthesis of Compound 3-4 Compound 3-4 (162 mg, 0.17 mmol, 1.0 eq.) was dissolved in dichloromethane (3 mL), TFA (1 mL, 13.5 mmol, 79.0 eq.) was added, and the mixture was stirred at room temperature for 3 hours. The reaction solution was concentrated to obtain 177 mg of crude product of yellow oily compound 3-4. (MC20-1207-095) LCMS:Rt:1.950min;MSm / z(ESI):863.8[M+H] + . Step 4: Synthesis of compound 3 Compound 3-4 (84 mg, 0.10 mmol, 1.0 eq.), compound SM3 (15 mg, 0.15 mmol, 1.5 eq.), HATU (46 mg, 0.12 mmol, 1.2 eq.) and DIEA (65 mg, 0.5 mmol, 5.0 eq.) were added to dichloromethane (3 mL) and stirred at room temperature for 1 hour. The reaction solution was concentrated and purified by high performance liquid chromatography to obtain colorless oily compound 3 (35 mg, yield 38.0%). (MC20-1207-099). 1 HNMR(400MHz,CDCl3)δ:0.82-0.94(m,12H),1.03-1.35(m,59H),1.35-1.49(m,5H),1.49-1.71(m,15H),2.19-2.29(m,6H),2.29-2.38(m,4H) ),2.43-2.54(m,3H),2.94-3.09(m,2H),3.12-3.20(m,1H),3.33-3.45(m,1H),3.84-3.93(m,1H),3.97(d,J=6.0Hz,3H),4.32-4.47(m,1H). LCMS:Rt:1.900min;MSm / z(ESI):948.8[M+H] + . Step 5: Synthesis of compound SM2 Compound SM2-1 (2.0 g, 7.394 mmol, 1.0 eq.), compound SM10 (2.2 g, 11.09 mmol, 1.5 eq.) and TsOH (500 mg) were added to toluene (20 mL) and stirred at reflux for 2 h. TLC showed that the reaction was complete. The mixture was concentrated and then purified by column chromatography to obtain yellow oily compound SM2 (3 g, yield 90.90%). (MC20-1195-029)

[0251] Example 4: Synthesis of Compound 4 [ka] Synthesis of compound 4 Compound 3-4 (80 mg, 0.09 mmol, 1.0 eq.), compound SM4 (18 mg, 0.10 mmol, 1.1 eq.), HATU (42 mg, 0.11 mmol, 1.2 eq.) and DIEA (36 mg, 0.27 mmol, 3.0 eq.) were added to dichloromethane (3 mL) and stirred at room temperature for 1 hour. The mixture was concentrated and purified by high performance liquid chromatography to obtain colorless oily compound 4 (26 mg, 28.3% yield). (MC20-1207-101) 1 HNMR(400MHz,CDCl3)δ:0.81-0.93(m,12H),1.08-1.35(m,60H),1.35-1.74(m,23H),2.18-2.40(m,14H),2.44- 2.57(m,3H),2.91-3.03(m,1H),3.36-3.48(m,1H),3.60-3.71(m,1H),3.97(d,J=6.0Hz,3H),4.36-4.48(m,1H). LCMS:Rt:1.900min;MSm / z(ESI):990.9[M+H] + .

[0252] Example 5: Synthesis of Compound 5 [ka] Synthesis of compound 5 Compound 3-4 (80 mg, 0.09 mmol, 1.0 eq.), compound SM5 (16 mg, 0.11 mmol, 1.2 eq.), HATU (42 mg, 0.11 mmol, 1.2 eq.) and DIEA (35 mg, 0.27 mmol, 3.0 eq.) were added to dichloromethane (3 mL) and stirred at room temperature for 1 hour. The mixture was concentrated and purified by high performance liquid chromatography to obtain pale yellow oily compound 5 (37 mg, 40.0% yield). (MC20-1207-110). 1 HNMR(400MHz,CDCl3)δ:0.80-0.94(m,12H),1.12-1.35(m,57H),1.36-1.49(m,5H),1.50-1.69(m,17H),1.91-2.06(m,1H),2.16-2.38(m,10 H),2.43-2.57(m,5H),2.61-2.71(m,1H),2.92-3.03(m,1H),3.36-3.5 0(m,1H),3.60-3.73(m,1H),3.97(d,J=6.0Hz,3H),4.36-4.48(m,1H). LCMS:Rt:1.890min;MSm / z(ESI):962.9[M+H] + .

[0253] Example 6: Synthesis of Compound 6 [ka] Step 1: Synthesis of Compound 3-4 Compound 3-3 (500 mg, 0.57 mmol, 1.0 eq.) was dissolved in dichloromethane (6 mL), TFA (1 mL) was added, and the mixture was stirred at room temperature for 1 h, when TLC showed the reaction was complete. The reaction was quenched with water, extracted with ethyl acetate, and concentrated to give compound 3-4 (412 mg, 84% yield) as a yellow oil. (MC21-151-055) Step 2: Synthesis of compound 6 Compound 3-4 (200 mg, 0.23 mmol, 1.0 eq.) and compound SM6 (14 mg, 0.23 mmol, 1.0 eq.) were dissolved in methanol (10 mL), one drop of acetic acid was added, and the mixture was stirred at room temperature for 5 hours. The reagent NaCNBH3 (20 mg) was added to the mixture and stirred for 1 hour. LCMS showed that the reaction was complete. After concentration, the mixture was purified by high performance liquid chromatography to obtain yellow oily compound 6 (58 mg, 28% yield). 1 HNMR(400MHz,CDCl3):0.81-0.91(m,12H),0.92-1.00(m,3H),1.15-1.35(m,62H),1.36-1.51(m,5H),1.52-1 .71(m,11H),1.73-1.91(m,2H),2.23-2.36(m,4H),2.37-2.43(m,2H),2.44-2.55(m,7H),3.91-4.02(m,4H). LCMS:Rt:2.080min;MSm / z(ESI):905.9[M+H] + .

[0254] Example 7: Synthesis of Compound 7 [ka] Step 1: Synthesis of compound 7-2 Compound 7-1 (1.0 g, 4.7 mmol, 1.0 eq.) and compound SM7 (11.7 mL, 23.5 mmol, 5.0 eq. 2M in THF) were dissolved in ACN (10.0 mL) and stirred at room temperature for 16 h. LCMS showed the reaction was complete, and after concentrating the mixture, compound 7-2 (1.2 g, crude product) was obtained as a yellow oil. (MC20-1234-065) LCMS:Rt:0.733min;MSm / z(ESI):259.2[M+H] + . Step 2: Synthesis of compound 7-3 Compound 7-2 (1.2 g, 40.65 mmol, 1.0 eq.) was dissolved in dichloromethane (10.0 mL), and hydrochloric acid dioxane (10.0 mL) was added at 0° C. and stirred for 16 h. LCMS showed the reaction was complete, and after concentrating the mixture, brown solid compound 7-3 (1.0 g, crude product) was obtained. (MC20-1234-067) LCMS:Rt:0.278min;MSm / z(ESI):159.2[M+H] + . Step 3: Synthesis of compound 7 Compound 7-3 (200.0 mg, 1.26 mmol, 1.0 eq.) and compound SM8 (1.0 g, 1.26 mmol, 1.0 eq.) were dissolved in dichloromethane (10.0 mL), and DIEA (812.0 mg, 6.3 mmol, 5.0 eq.) and HATU (625.0 mg, 1.64 mmol, 1.3 eq.) were added at 0° C. and stirred at room temperature for 16 hours. LCMS showed that the reaction was complete, and the mixture was concentrated and purified by high performance liquid chromatography to obtain yellow oily compound 7 (20.0 mg, 2% yield). (MC20-1234-079). 1 HNMR(400MHz,CDCl3)δ:0.86-0.90(m,12H),1.14-1.36(m,63H),1.56-1.68(m,13H),2.28-2.38(m,6H),2.47(s, 6H),2.75(s,5H),3.00-3.06(m,3H),3.38-3.50(m,1H),3.65-3.71(m,1H),3.95-3.97(m,4H),4.34-4.44(m,1H). LCMS:Rt:0.530min;MSm / z(ESI):962.8[M+H] + . Step 4: Synthesis of compound SM8-1 Compound SM2 (2 g, 4.469 mmol, 3.0 eq.) was dissolved in acetonitrile (30 mL), PMBNH2 (200 mg, 1.490 mmol, 1.0 eq.), K2CO3 (0.62 g, 4.469 mmol, 3.0 eq.), Cs2CO3 (150 mg, 0.4469 mmol, 0.3 eq.), NaI (22 mg, 0.1490 mmol, 0.1 eq.) were added, and the reaction mixture was stirred at 85 °C for 16 h. Thin layer chromatography showed the reaction was complete. After concentration and purification, yellow oily compound SM8-1 (1.1 g, 84.84% yield) was obtained. (MC20-1144-082) Step 5: Synthesis of compound SM8-2 Compound SM8-1 (1.1 g, 1.264 mmol) was dissolved in ethyl acetate (40 mL) under hydrogen atmosphere, and Pd / C (200 mg) was added. The reaction mixture was stirred at 40° C. for 16 h. Thin layer chromatography showed the reaction was complete. After filtration through a Celite pad, it was washed with ethyl acetate, concentrated and purified by silica gel column chromatography to obtain yellow oily compound SM8-2 (0.9 g, yield 94.91%). (MC20-1195-083) Step 6: Synthesis of compound SM8 Compound SM8-2 (434 mg, 0.58 mmol, 1.0 eq.), 3-bromopropionic acid (266 mg, 1.74 mmol, 3.0 eq.), DIEA (374 mg, 2.90 mmol, 5.0 eq.), NaI (44 mg, 0.29 mmol, 0.5 eq.) were added to tetrahydrofuran (20 ml) and the mixture was stirred at 70° C. overnight. The mixture was concentrated to give white solid compound SM8 (821 mg, crude product). (MC20-1207-115) LCMS:Rt:1.547min;MSm / z(ESI):822.7[M+H] + .

[0255] Example 8: Synthesis of Compound 8 [ka] Step 1: Synthesis of compound 8-1 Compound 8-1 (460.0 mg, 2.0 mmol, 1.0 eq.) and compound SM9 (168.0 mg, 2.4 mmol, 1.2 eq.) were dissolved in methanol (10.0 mL), tetrapropyl titanate (804.0 mg, 3.0 mmol, 1.5 eq.) was added at room temperature, the mixture was stirred at 50° C. for 2 hours, then NaCNBH3 (136.0 mg, 4.0 mmol, 2.0 eq.) was added, and the mixture was stirred at 50° C. for 16 hours. LCMS showed that the reaction was complete, water (20.0 mL) was added, and the mixture was concentrated and purified through a column (DCM / MeOH=1 / 0-10 / 1) to obtain yellow oily compound 8-1 (0.4 g, crude product). (MC20-1234-074) LCMS:Rt:0.703min;MSm / z(ESI):285.2[M+H] + . Step 2: Synthesis of compound 8-2 Compound 8-1 (0.4 g, 1.4 mmol, 1.0 eq.) and compound SM2 (628.0 mg, 1.4 mmol, 1.0 eq.) were dissolved in tetrahydrofuran (10.0 mL), and DIEA (903.0 mg, 7.0 mmol, 5.0 eq.) and NaI (20.0 mg, 0.04 mmol, 0.1 eq.) were added at 0° C. The mixture was stirred at 70° C. for 16 hours. LCMS showed the reaction was complete, and the mixture was concentrated and purified by column chromatography (DCM / MeOH=1 / 0-20 / 1) to obtain yellow oily compound 8-2 (0.2 g, 22% yield). (MC20-1234-077) LCMS:Rt:0.942min;MSm / z(ESI):651.6[M+H] + . Step 3: Synthesis of compound 8-3 Compound 8-2 (0.2 g, 0.31 mmol, 1.0 eq.) was dissolved in dichloromethane (10.0 mL) and TFA (1.0 mL) was added at 0° C. The mixture was stirred at room temperature for 16 h, when LCMS showed the reaction was complete, the mixture was concentrated to give brown oily compound 8-3 (0.19 g, crude product). (MC20-1234-078) LCMS:Rt:0.808min;MSm / z(ESI):551.5[M+H] + . Step 4: Synthesis of compound 8 Compound 8-3 (190.0 mg, 0.345 mmol, 1.0 eq.) and compound SM2 (154.0 mg, 0.345 mmol, 1.0 eq.) were dissolved in tetrahydrofuran (10.0 mL), and DIEA (222.0 mg, 1.73 mmol, 5.0 eq.) and NaI (5.0 mg, 0.034 mmol, 0.1 eq.) were added at 0° C. The mixture was stirred at 70° C. for 16 hours. LCMS showed the reaction was complete, and the mixture was concentrated and purified by high performance liquid chromatography to give compound 8 (20.0 mg, 6% yield) as a yellow oil. (MC20-1234-080). 1 HNMR(400MHz,CDCl3)δ:0.86-0.90(m,12H),1.14-1.36(m,62H),1.54-1.69(m,17H),1.79 -1.98(m,6H),2.27-2.36(m,7H),2.50-2.54(m,3H),3.33-3.35(m,1H),3.95-3.97(m,4H). LCMS:Rt:0.524min;MSm / z(ESI):917.8[M+H] + .

[0256] Example 9: Synthesis of Compound 9 [ka] Step 1: Synthesis of compound 9-1 Compound 7-3 (200.0 mg, 1.0 mmol, 1.0 eq.) and compound SM10 (0.94 g, 1.0 mmol, 1.0 eq.) were dissolved in DMF (10.0 mL), and DIEA (516.0 mg, 4.0 mmol, 4.0 eq.) and HATU (494.0 mg, 1.3 mmol, 1.3 eq.) were added at 0° C. The mixture was stirred at room temperature for 16 hours, and the reaction was shown to be complete by LCMS. The reaction solution was concentrated and then purified by column (DCM / MeOH=1 / 0-20 / 1) to obtain yellow oily compound 9-1 (300.0 mg, crude product). (MC20-1234-094). LCMS:Rt:0.693min;MSm / z(ESI):335.1[M+H]+ . Step 2: Synthesis of compound 9 Compound 9-1 (300.0 mg, 0.89 mmol, 1.0 eq.) and compound SM11 (0.62 g, 0.89 mmol, 1.0 eq.) were dissolved in acetonitrile (10.0 mL), and K2CO3 (368.0 mg, 2.67 mmol, 3.0 eq.), Cs2CO3 (86.0 mg, 0.267 mmol, 0.3 eq.) and NaI (13.0 mg, 0.089 mmol, 0.1 eq.) were added at 0°C. The mixture was stirred at 85°C for 16 hours. LCMS showed the reaction was complete, and the mixture was concentrated and purified by high performance liquid chromatography to give yellow oily compound 9 (21.0 mg, 2.5% yield). (MC20-1234-096). 1 HNMR(400MHz,CDCl3)δ:0.86-0.90(m,12H),1.14-1.36(m,63H),1.56-1.65(m,12H),2.28-2.37(m,1 8H),2.90-3.06(m,1H),3.36-3.46(m,1H),3.61-3.69(m,1H),3.95-3.97(m,4H),4.34-4.44(m,1H). LCMS:Rt:1.470min;MSm / z(ESI):948.8[M+H] + . Step 3: Synthesis of compound SM11-1 Compound SM13 (10 g, 21.87 mmol, 1.0 eq.) was dissolved in acetonitrile (50 mL) and K2CO3 (3.02 g, 21.87 mmol, 1.0 eq.), Cs2CO3 (2.38 g, 7.29 mmol, 0.3 eq.), NaI (0.2 g, 1.46 mmol, 0.07 eq.) and PMBNH2 (1 g, 7.29 mmol, 0.3 eq.) were added. The reaction was stirred at 80 °C for 10 h. The reaction mixture was taken up in water (100 mL) and extracted with dichloromethane (3 * 100 mL). The organic phase was washed with saline, dried over anhydrous Na2SO4 and concentrated in vacuum. The crude product was purified by column chromatography (EtOAc:PE = 2:1) to give yellow oily compound SM11-1 (5 g, yield: 84%). (MC19-89-111) LCMS:Rt:1.445min;MSm / z(ESI):814.6[M+H] + . Step 4: Synthesis of compound SM11 Compound SM11-1 (5 g, 6.14 mmol, 1.0 eq.) was dissolved in ethyl acetate (100 mL), Pd / C (1.0 g) was added, and the mixture was stirred at room temperature for 10 hours under a hydrogen gas atmosphere. The reaction mixture was filtered and then concentrated to obtain yellow oily compound SM11 (4.0 g, 94% yield). (MC19-89-112) LCMS:Rt:1.535min;MSm / z(ESI):694.6[M+H] + .

[0257] Example 10: Synthesis of Compound 10 [ka] Step 1: Synthesis of compound 10-1 Compound 7-1 (1.0 g, 4.7 mmol, 1.0 eq.) and compound SM12 (11.7 mL, 23.5 mmol, 5.0 eq, 2 M in THF) were dissolved in methanol (10.0 mL) and stirred at room temperature for 16 h. LCMS showed the reaction was complete, and after concentrating the mixture, a yellow oily compound 10-1 (1.2 g, crude product) was obtained. (MC20-1234-106) LCMS:Rt:0.714min;MSm / z(ESI):273.2[M+H] + . Step 2: Synthesis of compound 10-2 Compound 10-1 (1.2 g, 4.4 mmol, 1.0 eq.) was dissolved in dichloromethane (10.0 mL), and hydrochloric acid dioxane (10.0 mL) was added at 0° C. and stirred for 16 h. LCMS showed the reaction was complete, and after concentrating the mixture, brown solid compound 10-2 (1.0 g, crude product) was obtained. (MC20-1234-110) LCMS:Rt:0.329min;MSm / z(ESI):173.2[M+H] + . Step 3: Synthesis of compound 10 Compound 10-2 (100.0 mg, 0.57 mmol, 1.0 eq.) and compound 14-1 (0.43 g, 0.57 mmol, 1.0 eq.) were dissolved in tetrahydrofuran (10.0 mL), and DIEA (220.0 mg, 1.71 mmol, 5.0 eq.) and NaI (8.0 mg, 0.057 mmol, 0.1 eq.) were added at 0° C. The mixture was stirred at 70° C. for 16 h. LCMS showed the reaction was complete, and the mixture was concentrated and purified by high performance liquid chromatography to give yellow oily compound 10 (70.0 mg, 14% yield). (MC20-1234-111). 1 HNMR(400MHz,CDCl3)δ:0.86-0.90(m,12H),1.02-1.05(m,3H),1.26-1.36(m,53H),1.43-1. 46(m,4H),1.56-1.65(m,10H),2.27-2.34(m,9H),2.40-2.69(m,14H),3.96(d,J=5.6Hz,4H). LCMS:Rt:1.247min;MSm / z(ESI):892.8[M+H] + .

[0258] Example 11: Synthesis of Compound 11 [ka] Step 1: Synthesis of compound 11-1 Compound 7-1 (885 mg, 4.56 mmol, 1.1 eq.) and CH3NH2 (1.0 g, 4.15 mmol, 1.0 eq.) were added to methanol (20 mL) and stirred at 60 °C in a sealed container for 16 h. LCMS showed that the reaction was complete. The mixture was concentrated and then purified by silica gel column chromatography (EA:PE = 0% ~ 5%) to give colorless oily compound 11-1 (1.2 g, 63% yield). (MC21-151-067) LCMS:Rt:0.710min;MSm / z(ESI):245.2[M+H] + . Step 2: Synthesis of compound 11-2 Compound 11-1 (500 mg, 2.05 mmol, 1.0 eq.), compound SM13 (1.03 g, 2.46 mmol, 1.1 eq.), K2CO3 (849 mg, 6.15 mmol, 3.0 eq.), Cs2CO3 (202 mg, 0.62 mmol, 0.3 eq.) and NaI (30 mg, 0.21 mmol, 0.1 eq.) were added to acetonitrile (20 mL) and stirred at 85 °C overnight. The mixture was concentrated and then purified by silica gel column chromatography (MeOH:DCM = 0% to 10%) to obtain yellow oily compound 11-2 (1.0 g, yield 83%). (MC21-151-068) LCMS:Rt:0.900min;MSm / z(ESI):583.5[M+H] + . Step 3: Synthesis of compound 11-3 Compound 11-2 (500 mg, 0.86 mmol, 1.0 eq.) was dissolved in dichloromethane (10 mL), TFA (2 mL) was added at room temperature, and the mixture was stirred for 16 h. LCMS showed the reaction was complete, and after concentrating the reaction solution, a yellow oily compound 11-3 (322 mg, 78% yield) was obtained. (MC21-151-072) LCMS:Rt:0.760min;MSm / z(ESI):483.4[M+H] + . Step 4: Synthesis of compound 11 Compound 11-3 (320 mg, 0.66 mmol, 1.0 eq.), compound SM13 (420 mg, 1.00 mmol, 1.5 eq.), K2CO3 (280 mg, 2.00 mmol, 3.0 eq.), Cs2CO3 (65 mg, 0.20 mmol, 0.3 eq.) and NaI (10 mg, 0.07 mmol, 0.1 eq.) were added to acetonitrile (10 mL) and stirred overnight. After purification by high performance liquid chromatography, yellow oily compound 11 (83 mg, 15% yield) was obtained. (MC21-151-073) 1HNMR(400MHz,CDCl3)δ:0.82-0.94(m,12H),1.14-1.39(m,53H),1.40-1.50(m,3H),1.51- 1.72(m,13H),2.22-2.39(m,9H),2.40-2.53(m,5H),2.65-2.84(m,1H),3.99-3.89(m,4H). LCMS:Rt:1.190min;MSm / z(ESI):821.8[M+H] + . Step 5: Synthesis of compound SM13 Compound SM13-1 (20.2 g, 83.3 mmol, 1.0 eq.) and compound SM10 (19.5 g, 100 mol, 1.2 eq.) were dissolved in dichloromethane (300 mL), and EDCI (24.0 g, 125 mmol, 1.5 eq.), DMAP (2.0 g, 16.7 mmol, 0.2 eq.) and DIEA (27.0 g, 208 mmol, 2.5 eq.) were added. The mixture was stirred at room temperature for 16 hours. TLC showed that the reaction was complete. The mixture was concentrated and then purified by silica gel column chromatography (EA / PE=0-1%) to obtain colorless oily compound SM13 (17 g, 49% yield). (MC20-71-001)

[0259] Example 12: Synthesis of Compound 12 [ka] Step 1: Synthesis of compound 12-1 Compound 3-2 (690 mg, 0.9 mmol, 1.0 eq.) was dissolved in methanol (10 mL), and compound SM14 (400 mg, 3.6 mmol, 1.2 eq.) and Ti(OPr)4 (1.2 g, 4.5 mmol, 1.5 eq.) were added. The mixture was stirred at room temperature for 5 hours. Then, NaCNBH3 (408 mg, 6.0 mmol, 2.0 eq.) was added. The mixture was stirred at room temperature for 10 hours. Thin layer chromatography showed that the reaction was complete. The mixture was poured into water, extracted with ethyl acetate, and the organic phase was separated and dried over Na2SO4. After concentration, the mixture was purified by high performance liquid chromatography to obtain yellow oily compound 12-1 (700 mg, 78% yield). (MC21-151-064) Step 2: Synthesis of compound 12-2 Compound 12-1 (300 mg, 1.00 mmol, 1.0 eq.), compound SM13 (420 mg, 1.00 mmol, 1.0 eq.), K2CO3 (414 mg, 3.00 mmol, 3.0 eq.), Cs2CO3 (98 mg, 0.30 mmol, 0.3 eq.) and NaI (14 mg, 0.10 mmol, 0.1 eq.) were added to acetonitrile (10 mL) and stirred at 85°C overnight. The mixture was concentrated and then purified by silica gel column chromatography (MeOH:DCM = 0% to 10%) to obtain yellow oily compound 12-2 (290 mg, yield 83%). (MC21-151-066) LCMS:Rt:0.890min;MSm / z(ESI):637.5[M+H]+. Step 3: Synthesis of compound 12-3 Compound 12-2 (290 mg, 0.46 mmol, 1.0 eq.) was dissolved in dichloromethane (10 mL), TFA (2 mL) was added at room temperature, and the mixture was stirred for 16 h. LCMS showed the reaction was complete, and after concentrating the reaction solution, a yellow oily compound 12-3 (290 mg, 80% yield) was obtained. (MC21-151-072) LCMS:Rt:0.760min;MSm / z(ESI):537.4[M+H]+. Step 4: Synthesis of compound 12 Compound 12-3 (290 mg, 0.54 mmol, 1.0 eq.), SM13 (273 mg, 0.65 mmol, 1.2 eq.), K2CO3 (222 mg, 1.59 mmol, 3.0 eq.), Cs2CO3 (52 mg, 0.16 mmol, 0.3 eq.) and NaI (7 mg, 0.05 mmol, 0.1 eq.) were added to acetonitrile (10 mL) and stirred at 85° C. overnight. The mixture was purified by high performance liquid chromatography to obtain yellow oily compound 12 (96 mg, 20% yield). (MC21-151-071) 1 HNMR(400MHz,CDCl3)δ:0.78-0.93(m,12H),1.17-1.40(m,54H),1.41-1.81(m,22H),2.22 -2.45(m,9H),2.46-2.58(m,2H),2.59-2.77(m,2H),3.08-3.28(m,1H),3.90-4.03(m,4H). LCMS:Rt:1.240min;MSm / z(ESI):875.8[M+H] + .

[0260] Example 13: Synthesis of Compound 13 [ka] Step 1: Synthesis of compound 13-1 Compound 3-2 (690.0 mg, 3.0 mmol, 1.0 eq.) and compound SM15 (353.0 mg, 3.6 mmol, 1.2 eq.) were dissolved in methanol (10.0 mL), tetrapropyl titanate (1.2 g, 4.5 mmol, 1.5 eq.) was added at room temperature, the mixture was stirred at 50° C. for 2 hours, then NaCNBH3 (408.0 mg, 6.0 mmol, 2.0 eq.) was added, and the mixture was stirred at 50° C. for 16 hours. LCMS showed that the reaction was complete, H2O (20.0 mL) was added, and the mixture was concentrated and then purified by silica gel column chromatography (DCM / MeOH=1 / 0-10 / 1) to obtain yellow oily compound 13-1 (0.9 g, crude product). (MC20-1234-081) LCMS:Rt:0.720min;MSm / z(ESI):313.2[M+H]+. Step 2: Synthesis of compound 13-2 Compound 13-1 (0.9 g, 2.88 mmol, 1.0 eq.) and compound SM13 (1.2 g, 2.88 mmol, 1.0 eq.) were added to THF (10.0 mL), and DIEA (1.8 g, 14.4 mmol, 5.0 eq.) and NaI (42.0 mg, 0.29 mmol, 0.1 eq.) were added at 0° C. The mixture was stirred at 70° C. for 16 h. LCMS showed that the reaction was complete, and the mixture was concentrated and then purified by silica gel column chromatography (DCM / MeOH=1 / 0-20 / 1) to give yellow oily compound 13-2 (0.6 g, 32% yield). (MC20-1234-086) Step 3: Synthesis of compound 13-3 Compound 13-2 (0.48 g, 0.74 mmol, 1.0 eq.) was dissolved in dichloromethane (10.0 mL) and TFA (2.0 mL) was added at 0° C. The mixture was stirred at room temperature for 16 h, and LCMS showed the reaction was complete, giving brown oily compound 13-3 (0.42 g, crude product) after concentration. (MC20-1234-088) LCMS:Rt:0.794min;MSm / z(ESI):551.5[M+H] + . Step 4: Synthesis of compound 13 Compound 13-3 (200.0 mg, 0.36 mmol, 1.0 eq.) and compound SM13 (228.0 mg, 0.54 mmol, 1.5 eq.) were dissolved in acetonitrile (15.0 mL), and K2CO3 (149 mg, 1.08 mmol, 3.0 eq.), Cs2CO3 (35.0 mg, 0.11 mmol, 0.3 eq.) and NaI (5.0 mg, 0.036 mmol, 0.1 eq.) were added at room temperature. The mixture was stirred at 80 °C for 16 h. LCMS showed the reaction was complete, and the reaction solution was concentrated and purified by high performance liquid chromatography to give colorless oily compound 13 (27.0 mg, 8% yield). (MC20-30-090). 1HNMR(400MHz,CDCl3)δ:0.86-0.90(m,12H),1.14-1.36(m,59H),1.45-1.70(m,22H),2.21-2.41(m,11H),3.89-3.90(m,4H). LCMS:Rt:1.550min;MSm / z(ESI):889.8[M+H] + .

[0261] Example 14: Synthesis of Compound 14 [ka] Synthesis of compound 14 Compound 14-1 (0.75 g, 1.0 mmol, 1.0 eq.) and compound 7-3 (0.2 g, 1.0 mmol, 1.0 eq.) were added to THF (10.0 mL), and DIEA (0.64 g, 5.0 mmol, 5.0 eq.) and NaI (14.6 mg, 0.1 mmol, 0.1 eq.) were added at 0° C. The mixture was stirred at 70° C. for 16 h. LCMS showed the reaction was complete, and the reaction solution was concentrated and purified by high performance liquid chromatography to give brown oily compound 14 (57.0 mg, 6% yield). (MC20-1234-102) 1 HNMR(400MHz,CDCl3)δ:0.86-0.90(m,12H),1.26-1.32(m,53H),1.43-1.45(m,4H),1.5 9-1.65(m,10H),2.28-2.32(m,6H),2.36(s,6H),2.41-2.61(m,12H),3.96-3.97(m,4H). LCMS:Rt:1.580min;MSm / z(ESI):878.8[M+H] + .

[0262] Example 15: Synthesis of Compound 15 [ka] Step 1: Synthesis of compound 15-2 Compound 15-1 (200 mg, 0.27 mmol, 1.0 eq.), MsCl (38 mg, 0.33 mmol, 1.2 eq.), and DIEA (106 mg, 0.82 mmol, 3.0 eq.) were added to dichloromethane (5 mL) and stirred for 1 h. The mixture was quenched with water and extracted with ethyl acetate. After drying and concentrating the organic phase, a yellow oily compound 15-2 (306 mg, crude product) was obtained. (MC20-364-028) Step 2: Synthesis of compound 15 Compound 15-2 (137 mg, 0.19 mmol, 1.0 eq.), compound 7-3 (36 mg, 0.22 mmol, 1.2 eq.), and DIEA (73 mg, 0.56 mmol, 3.0 eq.) were added to DMF (5 mL) and stirred at 80° C. overnight. The mixture was diluted with water, extracted with ethyl acetate, washed with saline, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated and then purified by high performance liquid chromatography to obtain colorless oily compound 15 (19 mg, 12.8% yield). (MC21-364-033) 1 HNMR(400MHz,CDCl3)δ:0.82-0.92(m,12H),1.19-1.32(m,56H),1.33-1.38(m,3H),1.76-1.87(m,2 H),1.93-2.07(m,2H),2.18-2.29(m,6H),2.30-2.38(m,9H),2.58-2.68(m,2H),3.97-4.11(m,4H). LCMS:Rt:0.080min;MSm / z(ESI):793.6[M+H] + .

[0263] Example 16: Preparation and characterization of lipid nanoparticles That is, the cationic lipids, DSPC, cholesterol and PEG-lipids provided by the present invention were dissolved in ethanol in a molar ratio of 50:10:38.5:1.5, and the mRNA was diluted with 10-50 mM citrate buffer to pH=4. Using a microfluidic device, the ethanol lipid solution and the mRNA aqueous solution were mixed in a volume ratio of 1:3 at a flow rate of 9-30 mL / min to prepare LNPs with a total lipid to mRNA weight ratio of about 10:1-30:1. Ethanol was removed by using dialysis PBS instead of ethanol. Finally, the lipid nanoparticles were filtered through a 0.2 μm sterile filter. The size of lipid nanoparticles was determined by dynamic light scattering using a Malvern Zetasizer Nano ZS (Malvern UK) in 173° backscattering detection mode. The encapsulation efficiency of lipid nanoparticles was determined using the Quant-it Ribogreen RNA quantification assay kit (Thermo Fisher Scientific, UK) according to the manufacturer's instructions. As reported in the literature, the apparent pKa of an LNP formulation is related to the delivery efficiency of the LNP for nucleic acids in vivo. The apparent pKa of each formulation was determined using a fluorescent assay based on 2-(p-toluidino)-6-naphthalenesulfonic acid (TNS). LNP formulations containing cationic lipid / DSPC / cholesterol / DMG-PEG (50 / 10 / 38.5 / 1.5 mol%) were prepared as described above. TNS was prepared as a 300 uM stock solution in distilled water. The LNP formulations were diluted to 0.1 mg / ml total lipid in 3 mL buffer solution containing 50 mM sodium citrate, 50 mM sodium phosphate, 50 mM sodium boronate, and 30 mM sodium chloride, pH 3-9. TNS solution was added to a final concentration of 0.1 mg / ml, and after vortex mixing, the fluorescence intensity was measured at room temperature using excitation wavelengths of 325 nm and 435 nm in a Molecular Devices Spectramax iD3 spectrometer. A sigmoidal best-fitting analysis was applied to the fluorescence data to determine the pKa value at which the pH reached half the maximum fluorescence intensity.

[0264] Example 17: Animal Studies Lipid nanoparticles containing the compounds in the following table encapsulating human erythropoietin (hEPO) mRNA were administered to 6-8 week old female ICR mice (Xipuer-Bikai, Shanghai) via tail vein at a dose of 0.5 mg / kg. Blood samples were taken from the mice at specific time points (e.g. 6 hours) after administration. In addition to the above test groups, lipid nanoparticles containing melinoylmethyl-4-dimethylaminobutanoate (DLin-MC3-DMA, commonly abbreviated as MC3) encapsulating hEPO mRNA were administered to mice of similar age and sex at the same dose as a positive control. After the last sampling time point, mice were euthanized by CO2 overdose. Serum was separated from whole blood by centrifugation at 5000g for 10 min at 4°C, flash frozen and stored at -80°C for analysis. ELSA assays were performed using a commercial kit (DEP00, R&D Systems) according to the manufacturer's instructions. The table below provides characteristics of the lipid nanoparticles tested, including expression levels above MC3 measured from the test groups.

[0265] [Table 1]

Claims

1. Formula (I): 【Chemistry 1】 or a pharma- ceutically acceptable salt or stereoisomer thereof, wherein G is N or CH; L １ , L ２ and L ３ each independently represents a bond or C １ -C ８ Selected from alkylenes, R １ -C(O)OR ４ or -OC(O)R ９ Selected from R ２ -C(O)OR ５ , C ３ -C ８ Cycloalkyl, C １ -C ８ Alkyl, -OC(O)R １０ , -C(O)NHC １０ -C ２０ Alkyl or -NHC(O)C １０ -C ２０ Selected from alkyl, R ３ but 【Chemistry 2】 Selected from R ４ C １０ -C ２０ is alkyl, R ５ C １０ -C ２０ is alkyl, R ６ -C(O)(CH ２ ) １－８ N (C １ -C ８ Alkyl)C １ -C ８ Alkyl, C １ -C ８ Alkyl or -(CH ２ ) １－８ C(O)OR １１ Selected from R ７ - (CH ２ ) １－８ N (C １ -C ８ Alkyl)C １ -C ８ is alkyl, R ８ - (CH ２ ) １－８ N (C １ -C ８ Alkyl)C １ -C ８ is alkyl, R ９ C １０ -C ２０ is alkyl, R １０ C １０ -C ２０ is alkyl, R １１ C １０ -C ２０ is alkyl, A compound, or a pharma- ceutically acceptable salt or stereoisomer thereof, characterized in that * represents a linking site.

2. During the ceremony, G is N; L １ , L ２ and L ３ However, each independently C １ -C ８ is alkylene, R １ -C(O)OR ４ and R ２ -C(O)OR ５ and R ３ but 【Chemistry 3】 and R ４ C １０ -C ２０ is alkyl, R ５ C １０ -C ２０ is alkyl, R ６ -C(O)(CH ２ ) １－８ N (C １ -C ８ Alkyl)C １ -C ８ Alkyl or C １ -C ８ alkyl, and 2. The compound according to claim 1, or a pharma- ceutically acceptable salt or stereoisomer thereof, wherein * represents a linking site.

3. During the ceremony, G is N; L １ , L ２ and L ３ However, each independently C １ -C ８ is alkylene, R １ -C(O)OR ４ and R ２ -C(O)OR ５ and R ３ but 【Chemistry 4】 Selected from R ４ C １０ -C ２０ is alkyl, R ５ C １０ -C ２０ is alkyl, R ７ - (CH ２ ) １－８ N (C １ -C ８ Alkyl)C １ -C ８ is alkyl, R ８ - (CH ２ ) １－８ N (C １ -C ８ Alkyl)C １ -C ８ is alkyl, 2. The compound according to claim 1, or a pharma- ceutically acceptable salt or stereoisomer thereof, wherein * represents a linking site.

4. During the ceremony, G is N; L １ and L ３ However, each independently C １ -C ８ is alkylene, L ２ is a bond, R １ -C(O)OR ４ and R ２ C ３ -C ８ Cycloalkyl or C １ -C ８ Selected from alkyl, R ３ but 【Chemistry 5】 and R ４ C １０ -C ２０ is alkyl, R ６ - (CH ２ ) １－８ C(O)OR １１ and R １１ C １０ -C ２０ is alkyl, 2. The compound according to claim 1, or a pharma- ceutically acceptable salt or stereoisomer thereof, wherein * represents a linking site.

5. During the ceremony, G is CH; L １ , L ２ and L ３ However, each independently C １ -C ８ is alkylene, R １ Ga-OC(O)R ９ and R ２ Ga-OC(O)R １０ and R ３ but 【Chemistry 6】 and R ８ - (CH ２ ) １－８ N (C １ -C ８ Alkyl)C １ -C ８ is alkyl, R ９ C １０ -C ２０ is alkyl, R １０ C １０ -C ２０ is alkyl, 2. The compound according to claim 1, or a pharma- ceutically acceptable salt or stereoisomer thereof, wherein * represents a linking site.

6. In the formula, R ４ , R ５ , R ９ , R １０ and R １１ Each independently represents -(CH ２ ) １－３ -CH(C ５ -C １０ Alkyl) (C ５ -C １０ 6. The compound according to claim 1, or a pharma- ceutically acceptable salt or stereoisomer thereof, wherein the compound is selected from the group consisting of aryl, ...

7. The compound is 【Chemistry 7】 【Chemistry 8】 2. The compound according to claim 1, or a pharma- ceutically acceptable salt or stereoisomer thereof, selected from:

8. A composition comprising a compound according to any one of claims 1 to 7 and a therapeutic or prophylactic agent, preferably the composition also comprises one or more structured lipids, preferably the one or more structured lipids are DSPC, more preferably the molar ratio of the compound to the structured lipid is within the range of about 2:1 to about 8:1, preferably the composition also comprises a steroid, preferably the steroid is cholesterol, more preferably the molar ratio of the compound to the steroid is within the range of about 5:1 to about 1:1, preferably the composition also comprises one or more polymer-conjugated lipids, preferably the polymer-conjugated lipids are DMG-PEG2000 or DMPE-PEG200. 0, and more preferably the molar ratio of said compound to said polymer-conjugated lipid is in the range of about 100:1 to about 20:1, preferably said therapeutic or prophylactic agent comprises an mRNA encoding at least one antigen, or a fragment or epitope thereof, preferably said mRNA is a monocistronic or multicistronic mRNA, preferably said antigen is a pathogenic antigen, preferably said antigen is a tumor associated antigen, preferably said mRNA comprises one or more functional nucleotide analogues, preferably said functional nucleotide analogues are one or more selected from pseudouridine, 1-methyl-pseudouridine and 5-methylcytosine.

9. A lipid nanoparticle comprising a compound according to any one of claims 1 to 7 or a composition according to claim 8.

10. A pharmaceutical composition comprising a compound according to any one of claims 1 to 7, a composition according to claim 8, or a lipid nanoparticle according to claim 9, and a pharma- ceutically acceptable excipient or diluent.

Images