CROSS-REFERENCE TO RELATED APPLICATIONS FOR GENETICALLY ENGINEERED CD47 PROTEINS AND USES THEREOF

Abstract

The present disclosure provides engineered CD47 proteins and uses thereof. Also disclosed are polynucleotides encoding the engineered CD47 proteins, vectors comprising the polynucleotides, cells comprising the engineered proteins and / or the vectors, and compositions comprising the engineered CD47 proteins.

Description

[Technical Field]

[0001] This application claims priority to U.S. Provisional Application No. 63 / 311,143, filed February 17, 2022, which is incorporated herein by reference.

[0002] The present disclosure relates generally to engineered CD47 proteins and uses thereof. Also disclosed are polynucleotides encoding the engineered CD47 proteins, vectors containing the polynucleotides, cells containing the engineered proteins and / or vectors, and compositions containing the engineered CD47 proteins.

[0003] International application PCT / US2021 / 065157, and U.S. application Ser. Nos. 63 / 282,961, 63 / 270,956, and 63 / 222,954 are incorporated by reference in their entireties. Summary of the Invention

[0004] CD47 is a transmembrane protein encoded by the CD47 gene in humans (Figure 1). It belongs to the immunoglobulin (Ig) superfamily. CD47 has a molecular weight of approximately 50 kDa. It is glycosylated and ubiquitously expressed by virtually all cells in the human body (Figure 2). It has a single N-terminal IgV-like domain, a highly hydrophobic stretch with five transmembrane segments, and an alternatively spliced ​​C-terminal cytoplasmic tail (Figure 4). In addition, it has two extracellular and two intracellular regions between adjacent transmembrane segments. A signal peptide, if present in CD47 isoforms, is present N-terminally to the IgV-like domain. The human CD47 gene has six naturally occurring transcripts, five of which encode protein isoforms of CD47 (Ensembl, gene:CD47). Thus, five protein isoforms of human CD47 exist, each of which exhibits differential expression among various cell and tissue types.

[0005] CD47 is involved in various cellular processes, including apoptosis, proliferation, adhesion, and migration. CD47 interacts with multiple extracellular ligands, such as TSP-1, integrins, other CD47 proteins, and SIRPα. CD47 / SIRPα interactions regulate numerous cell-cell interactions in numerous body systems, including the immune system. In the immune system, CD47 / SIRPα interactions regulate lymphocyte homeostasis, dendritic cell (DC) maturation and activation, the proper localization of specific DC subsets in secondary lymphoid organs, and cell transmigration. CD47 on cells, including donor cells in the context of transplantation or cell therapy applications, can function as a "marker of self" and regulate phagocytosis by binding to SIRPα on the surface of circulating immune cells and transmitting an inhibitory "don't kill me" signal. CD47-SIRPα binding leads to phosphorylation of immunoreceptor tyrosine-based inhibitory motifs (ITIMs) on SIRPα, which triggers the recruitment of SHP1 and SHP2 (Src homologous phosphatases). These phosphatases then inhibit the accumulation of myosin II at the phagocytic synapse, thereby preventing engulfment (Fujioka et al., 1996). The engulfment of target cells by macrophages is ultimately regulated by the balance of activating signals (e.g., FcγR, CRT, LRP-1) and inhibitory signals (e.g., SIRPα-CD47). Increased CD47 expression can help cells evade immune surveillance and subsequent destruction and killing by innate immune cells. Thus, CD47 can be used as a tolerogenic factor to induce immune tolerance in the presence of pathological or unwanted activation of an otherwise normal immune response. This can occur, for example, when a patient develops an immune response against donor antigens after undergoing allogeneic transplantation or allogeneic cell therapy, or when the body inappropriately responds to self-antigens involved in autoimmune diseases. However, there is a need in the art for improvements regarding such uses of CD47.

[0006] In one aspect, the present disclosure provides engineered CD47 proteins that have fewer amino acids than the wild-type full-length human CD47 protein. Such engineered proteins provide for more efficient cell engineering approaches, including delivery via integrated gene therapy vectors.

[0007] In one aspect, the present disclosure provides an engineered CD47 protein comprising the human CD47 extracellular domain or a portion thereof, at least one human CD47 transmembrane domain or a portion thereof, and a portion of the human CD47 intracellular domain comprising at least one amino acid deletion, wherein the deletion is not an 18 amino acid C-terminal deletion.

[0008] In one aspect, the present disclosure provides an engineered CD47 protein comprising a portion of the human CD47 extracellular domain, at least one human CD47 transmembrane domain or portion thereof, and a portion of the human CD47 intracellular domain comprising an 18 amino acid C-terminal deletion.

[0009] In one aspect, the present disclosure provides an engineered CD47 protein comprising the human CD47 extracellular domain or a portion thereof, at least one and not more than five human CD47 transmembrane domain(s) or a portion(s) thereof, and a portion of the human CD47 intracellular domain comprising an 18 amino acid C-terminal deletion.

[0010] In one aspect, the present disclosure provides an engineered CD47 protein comprising a human CD47 extracellular domain or a portion thereof, at least one human CD47 transmembrane domain or a portion thereof, and a signal peptide, wherein the engineered CD47 protein does not include the intracellular domain.

[0011] In one aspect, the present disclosure provides an engineered CD47 protein comprising a human CD47 extracellular domain and at least one human CD47 transmembrane domain or a portion thereof, wherein the engineered CD47 protein does not include the intracellular domain.

[0012] In one aspect, the present disclosure provides an engineered CD47 protein comprising a human CD47 extracellular domain or portion thereof and at least one and not more than five human CD47 transmembrane domain(s) or portion(s) thereof, wherein the engineered CD47 protein does not include the intracellular domain.

[0013] In one aspect, the present disclosure provides an engineered CD47 protein comprising a human CD47 extracellular domain or a portion thereof, and at least one human CD47 transmembrane domain or a portion thereof, and a human CD47 intracellular domain that does not include the intracellular domain or that contains at least one amino acid deletion, wherein the engineered CD47 protein has an amino acid sequence with up to 99% identity to SEQ ID NO:1 and SEQ ID NO:6.

[0014] In some embodiments, the engineered CD47 proteins disclosed herein contain fewer glycosylation modification sites compared to the wild-type CD47 protein.

[0015] In some embodiments, the engineered CD47 proteins disclosed herein contain fewer glycosylation modifications compared to wild-type human CD47 protein.

[0016] In some embodiments, the engineered CD47 proteins disclosed herein contain fewer than two heparan and / or chondroitin sulfate glycosaminoglycan modification sites.

[0017] In some embodiments, the engineered CD47 proteins disclosed herein comprise fewer than two heparan and / or chondroitin sulfate glycosaminoglycan chains.

[0018] In some embodiments, the engineered CD47 proteins disclosed herein comprise fewer than five N-glycosylation modification sites.

[0019] In some embodiments, the engineered CD47 proteins disclosed herein comprise fewer than four N-glycosylation modified chains.

[0020] In some embodiments, the human CD47 extracellular domain or portion thereof in the engineered CD47 proteins disclosed herein lacks one or more thrombospondin-1 binding site(s) compared to the wild-type human CD47 protein.

[0021] In some embodiments, the human CD47 extracellular domain or portion thereof in the engineered CD47 proteins disclosed herein lacks one or more integrin binding site(s) compared to wild-type human CD47 protein. In some embodiments, the integrin is selected from the group consisting of αvβ3 integrin, αIIbβ3 integrin, α2β1 integrin, α4β1 integrin, α6β1 integrin, and α5 integrin.

[0022] In some embodiments, the human CD47 extracellular domain, or portion thereof, in the engineered CD47 proteins disclosed herein comprises at least one SIRPα-interacting motif.

[0023] In some embodiments, the engineered CD47 proteins disclosed herein comprise a disulfide bond between a cysteine ​​within the human CD47 extracellular domain, or a portion thereof, and a cysteine ​​within or between the human CD47 transmembrane domain(s).

[0024] In some embodiments, the engineered CD47 proteins disclosed herein are immune tolerance inducers.

[0025] In some embodiments, the engineered CD47 proteins disclosed herein are transmembrane proteins.

[0026] In some embodiments, the human CD47 extracellular domain in the engineered CD47 proteins disclosed herein comprises an amino acid sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 19-141 of SEQ ID NO:2.

[0027] In some embodiments, any of the at least one human CD47 transmembrane domain(s) in the engineered CD47 proteins disclosed herein comprises an amino acid sequence selected from the group consisting of: an amino acid sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 142-162 of SEQ ID NO:2, at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 177-197 of SEQ ID NO:2. an amino acid sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 208 to 228 of SEQ ID NO:2; an amino acid sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 236 to 257 of SEQ ID NO:2; and an amino acid sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 269 to 289 of SEQ ID NO:2.

[0028] In some embodiments, the human CD47 intracellular domain in an engineered CD47 protein disclosed herein comprises an amino acid sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the sequence of amino acids 290-323 of SEQ ID NO:2.

[0029] In some embodiments, the engineered CD47 proteins disclosed herein comprise an amino acid sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the amino acid sequence set forth in SEQ ID NO:7.

[0030] In some embodiments, the engineered CD47 proteins disclosed herein comprise an amino acid sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the amino acid sequence set forth in SEQ ID NO:8.

[0031] In some embodiments, the engineered CD47 proteins disclosed herein comprise an amino acid sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the amino acid sequence set forth in SEQ ID NO:9.

[0032] In some embodiments, the engineered CD47 proteins disclosed herein comprise an amino acid sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the amino acid sequence set forth in SEQ ID NO:12.

[0033] In some embodiments, the engineered CD47 proteins disclosed herein comprise an amino acid sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the amino acid sequence set forth in SEQ ID NO:10.

[0034] In some embodiments, the engineered CD47 proteins disclosed herein comprise an amino acid sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the amino acid sequence set forth in SEQ ID NO:11.

[0035] In some embodiments, the engineered CD47 protein is an engineered human CD47 protein, an engineered humanized CD47 protein, or an engineered partially humanized CD47 protein.

[0036] In another aspect, the present disclosure provides a polynucleotide encoding an engineered CD47 protein disclosed herein.

[0037] In another aspect, the present disclosure provides a vector comprising a polynucleotide encoding the engineered CD47 protein disclosed herein. In some embodiments, the vector is a plasmid or a viral vector. In some embodiments, the viral vector is a pseudotyped, self-inactivating lentiviral vector. In some embodiments, the vector is a polycistronic vector. In some embodiments, the polycistronic vector is a bicistronic or tricistronic vector.

[0038] In another aspect, the present disclosure provides a cell comprising a polynucleotide encoding an engineered CD47 protein disclosed herein and / or a vector comprising a polynucleotide encoding an engineered CD47 protein disclosed herein.

[0039] In another aspect, the present disclosure provides a cell comprising the engineered CD47 protein disclosed herein.

[0040] In some embodiments, the cells disclosed herein are stem cells.

[0041] In some embodiments, the cells disclosed herein are pluripotent stem cells. In some embodiments, the pluripotent stem cells are induced pluripotent stem cells (iPSCs) or embryonic stem cells.

[0042] In some embodiments, the cells disclosed herein are pancreatic islet cells.

[0043] In some embodiments, the cells disclosed herein are primary pancreatic islet cells. In some embodiments, the pancreatic islet cells are differentiated from pluripotent stem cells. In some embodiments, the pluripotent stem cells are iPSCs or ESCs.

[0044] In some embodiments, the cells disclosed herein are T cells.

[0045] In some embodiments, the cells disclosed herein are primary T cells. In some embodiments, the primary T cells are T cells comprising a chimeric antigen receptor. In some embodiments, the T cells are CAR-T cells. In some embodiments, the T cells are differentiated from pluripotent stem cells. In some embodiments, the pluripotent stem cells are iPSCs or ESCs.

[0046] In some embodiments, the cells disclosed herein are selected from the group of cells consisting of stem cells, pancreatic islet cells, T cells, CAR-T cells, cardiac cells, cardiac progenitor cells, neuronal cells, glial progenitor cells, endothelial cells, B cells, retinal pigment epithelial cells, hepatocytes, thyroid cells, skin cells, blood cells, plasma cells, platelets, kidney cells, epithelial cells, natural killer cells (NK cells), and CAR-NK cells.

[0047] In some embodiments, the cells are primary cells. In some embodiments, the cells are differentiated cells.

[0048] In some embodiments, the cells are low immunogenic cells.

[0049] In some embodiments, expression of one or more major histocompatibility (MHC) class I proteins and / or one or more MHC class II proteins is reduced compared to wild-type or control cells. In some embodiments, wild-type or control cells are the starting material. In some embodiments, the cells disclosed herein do not express one or more major histocompatibility (MHC) class I proteins and / or one or more MHC class II proteins. In some embodiments, the MHC proteins are HLA proteins.

[0050] In some embodiments, expression of MHC class I proteins is reduced by knocking out or reducing the expression of B2M in the cells described herein.

[0051] In some embodiments, expression of MHC class II proteins is reduced by knocking out or reducing the expression of CIITA in the cells described herein.

[0052] In some embodiments, TRAC and / or TRBC are knocked out or their expression is reduced in the cells described herein.

[0053] In another aspect, the present disclosure provides a composition comprising an engineered CD47 protein disclosed herein.

[0054] In another aspect, the present disclosure provides a composition comprising the cells disclosed herein. [Brief explanation of the drawings]

[0055] [Figure 1] 1 shows a map of the human CD47 gene, showing the protein-coding region of the human CD47 gene. This map is from the Ensembl genome database. [Figure 2A]CD47 isoform expression: ENSG00000196776.14 CD47 molecule (Source: HGNC symbol; Acc: HGNC:1682) showing the expression of each isoform in various human tissues and human cell types. This data is from the Genotype-Tissue Expression (GTEx) project database. [Figure 2B] CD47 isoform expression: ENSG00000196776.14 CD47 molecule (Source: HGNC symbol; Acc: HGNC:1682) showing the expression of each isoform in various human tissues and human cell types. This data is from the Genotype-Tissue Expression (GTEx) project database. [Figure 3] Figure 3 shows the predicted CD47 transmembrane domains and human CD47 protein topology. In particular, Figure 3 shows the predicted locations of various domains in the human CD47 protein. This prediction is from the Universal Protein Resource (UniProt). [Figure 4] The predicted human CD47 tertiary structure from the AlphaFold protein structure database is shown. [Figure 5A] 1 shows a sequence alignment of isoform 201, isoform 202, isoform 203, isoform 205, and isoform 206 of the human CD47 protein. [Figure 5B] 1 shows a sequence alignment of isoform 201, isoform 202, isoform 203, isoform 205, and isoform 206 of the human CD47 protein. [Figure 5C] 1 shows a sequence alignment of isoform 201, isoform 202, isoform 203, isoform 205, and isoform 206 of the human CD47 protein. [Figure 5D]1 shows a sequence alignment of isoform 201, isoform 202, isoform 203, isoform 205, and isoform 206 of the human CD47 protein. [Figure 6] 1 shows an exemplary graph showing viral titers of LVV containing exemplary truncated CD47 variants as assessed by the Ella automated immunoassay system. [Figure 7]

[0033] Figure 1 provides an exemplary graph showing the percentage (%) of CD47KO HEK293T cells expressing CD47 (as assessed by anti-CD47 flow cytometry) after treatment with truncated CD47 LVV. Various CD47 variants were tested, including several containing a GPI anchor. [Figure 8]

[0023] Figure 1 provides an exemplary graph showing the percentage (%) of CD47KO HEK293T cells expressing CD47 (as assessed by anti-CD47 flow cytometry) after treatment with truncated CD47 LVV. Various CD47 variants were tested, including several with truncated intracellular domains and alternative transmembrane domains. [Figure 9]

[0023] Figure 1 provides an exemplary graph showing the percentage (%) of CD47KO HEK293T cells expressing CD47 (as assessed by anti-CD47 flow cytometry) after treatment with truncated CD47 LVV. Various CD47 variants were tested, including those containing truncated intracellular domains and alternative hinge domains. [Figure 10]

[0023] Figure 1 provides an exemplary graph showing the percentage (%) of CD47KO HEK293T cells expressing CD47 (as assessed by anti-CD47 flow cytometry) after treatment with truncated CD47 LVV. Various CD47 variants were tested, including those containing truncated intracellular domains and alternative hinge domains. [Figure 11]

[0023] Figure 1 provides an exemplary graph showing the percentage (%) of CD47KO HEK293T cells expressing CD47 (as assessed by anti-CD47 flow cytometry) after treatment with truncated CD47 LVV. Various CD47 variants were tested, including those containing truncated intracellular domains and alternative hinge domains. [Figure 12A] FIG. 1 shows an exemplary graph depicting the percentage (%) of CD47KO HEK293T cells expressing CD47 (as assessed by anti-CD47 flow cytometry) after treatment with truncated CD47 LVV. [Figure 12B] FIG. 1 shows an exemplary graph depicting the percentage (%) of CD47KO HEK293T cells expressing CD47 (as assessed by anti-CD47 flow cytometry) after treatment with truncated CD47 LVV. [Figure 12C] FIG. 1 shows an exemplary graph depicting the percentage (%) of CD47KO HEK293T cells expressing CD47 (as assessed by anti-CD47 flow cytometry) after treatment with truncated CD47 LVV. [Figure 12D] FIG. 1 shows an exemplary graph depicting the percentage (%) of CD47KO HEK293T cells expressing CD47 (as assessed by anti-CD47 flow cytometry) after treatment with truncated CD47 LVV. [Figure 12E] FIG. 1 shows an exemplary graph depicting the percentage (%) of CD47KO HEK293T cells expressing CD47 (as assessed by anti-CD47 flow cytometry) after treatment with truncated CD47 LVV. [Figure 13] 1 provides an exemplary graph showing the percentage (%) of CD47KO HEK293T cells expressing CD47 (as assessed by anti-CD47 flow cytometry) after treatment with truncated CD47 LVV. [Figure 14] 1 provides an exemplary graph showing the percentage (%) of CD47KO HEK293T cells expressing CD47 (as assessed by anti-CD47 flow cytometry) after treatment with truncated CD47 LVV. [Figure 15]1 provides an exemplary graph showing the percentage (%) of CD47KO HEK293T cells expressing CD47 (as assessed by SIRPα-FC flow cytometry) after treatment with truncated CD47 LVV. [Figure 16] 1 provides an exemplary graph showing the percentage (%) of CD47KO HEK293T cells expressing CD47 (as assessed by SIRPα-FC flow cytometry) after treatment with truncated CD47 LVV. [Figure 17] 1 provides an exemplary graph showing the percentage (%) of CD47KO HEK293T cells expressing CD47 (as assessed by SIRPα-FC flow cytometry) after treatment with truncated CD47 LVV. [Figure 18A] 1 provides an exemplary graph showing the percentage (%) of CD47KO HEK293T cells expressing CD47 (as assessed by anti-CD47 flow cytometry) after treatment with truncated CD47 LVV. [Figure 18B] 1 provides an exemplary graph showing the percentage (%) of CD47KO HEK293T cells expressing CD47 (as assessed by SIRPα-FC flow cytometry) after treatment with truncated CD47 LVV. DETAILED DESCRIPTION OF THE INVENTION

[0056] I. Definition All publications, patents, and patent applications cited in this specification are incorporated by reference in their entirety to the same extent as if each individual publication, patent, and patent application was specifically and individually indicated to be incorporated by reference in its entirety.

[0057] In this disclosure, unless otherwise specified, scientific and technical terms used herein have the meanings that are commonly understood by those of ordinary skill in the art. Although any methods and materials similar or equivalent to those described herein are useful in the practice of this disclosure, the preferred methods and materials are described herein. Accordingly, the terms defined herein are more fully described by reference to the specification in its entirety.

[0058] As used herein, the singular terms "a," "and," and "the" include plural references unless the context clearly dictates otherwise.

[0059] As used herein, "and / or" refers to and includes all possible combinations of one or more of the associated listed items, and when interpreted as the alternative ("or"), the absence of any combination. Furthermore, the present invention contemplates that in some embodiments of the invention, any feature or combination of features described herein may be excluded or omitted.

[0060] As used herein, the term "about," when referring to a measurable value, such as a sequence length, is intended to encompass a variation of 5%, 1%, 0.5%, or even 0.1% of the stated amount.

[0061] Unless the context requires otherwise, the terms "comprise," "comprises," and "comprising," or similar terms, are intended to denote a non-exclusive inclusion, such that an enumerated list of elements or features does not include only the elements expressly or expressly specified, but may also include other elements or features not expressly or explicitly specified.

[0062] Unless otherwise indicated, nucleic acids are written left to right in 5' to 3' orientation; amino acid sequences are written left to right in amino to carboxy orientation, respectively.

[0063] It is to be understood that this disclosure is not limited to the particular methodology, procedures, and reagents described, as these may vary depending on the context in which they are used by those of skill in the art.

[0064] As used herein, "affinity" refers to the strength of the total amount of noncovalent interactions between a single binding site of a molecule (e.g., a receptor) and its binding partner (e.g., a ligand). The affinity of a molecule for its partner is usually measured by the equilibrium dissociation constant (K D ) (or its inverse, the equilibrium association constant, K A Affinity can be measured by common methods known in the art, including those described herein. See, for example, Pope ME, Soste MV, Eyford BA, Anderson NL, Pearson TW, (2009) J. Immunol. Methods. 341(1-2):86-96, and the methods described therein.

[0065] As used herein, the terms "percent identity" and "% identity," as applied to nucleic acid or polynucleotide sequences, refer to the percentage of residue matches between at least two nucleic acid or polynucleotide sequences aligned using a standardized algorithm. Such algorithms may insert gaps in the sequences being compared in a standardized, reproducible manner to optimize the alignment between the two sequences and thereby achieve a more meaningful comparison of the two sequences.

[0066] Percent identity between nucleic acid or polynucleotide sequences can be determined using a commonly used, freely available set of sequence comparison algorithms provided by the National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST) (Altschul, S. F. et al. (1990) J. Mol. Biol. 215:403-410), which is available from several sources, including NCBI, Bethesda, Md., and on the Internet at http: / / www.ncbi.nlm.nih.gov / BLAST / .

[0067] Nucleic acid or polynucleotide sequences that do not show a high degree of identity may nevertheless encode similar amino acid sequences due to the degeneracy of the genetic code. It will be understood that changes in nucleic acid sequences can be made using this degeneracy, resulting in multiple nucleic acid sequences that all encode substantially the same protein. Specifically, degenerate codon substitutions can be achieved by creating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues (Batzer et al. (1991) Nucleic Acid Res 19:5081; Ohtsuka et al. (1985) J Biol Chem 260:2605-2608; Cassol et al. (1992); Rossolini et al. (1994) Mol Cell Probes 8:91-98). The term "nucleic acid" refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. The term nucleic acid is used interchangeably with polynucleotide, and (in appropriate context) gene, cDNA, and mRNA encoded by a gene.

[0068] As used herein, "percent (%) amino acid sequence identity" with respect to a peptide, polypeptide, or protein sequence is defined as the percentage (%) of amino acid residues in a candidate sequence that are identical to the amino acid residues in another peptide or polypeptide sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and does not consider any conservative substitutions as part of the sequence identity. The percent amino acid sequence identity in this disclosure is measured using BLAST software. Those skilled in the art can determine appropriate parameters for assessing alignment, including any algorithms necessary to achieve maximum alignment over the entire length of the sequences being compared.

[0069] Amino acid substitution refers to the replacement of one amino acid with another amino acid in a polypeptide. Exemplary substitutions are shown in Table 1. Amino acid substitutions can be introduced into a protein of interest, and the products can be screened for retention / improvement of the desired activity, e.g., biological activity. [Table 1]

[0070] Amino acids can be classified according to the following common side chain properties: (1) Hydrophobic: Norleucine, Met, Ala, Val, Leu, Ile; (2) Neutral hydrophilic: Cys, Ser, Thr, Asn, Gln; (3) Acidic: Asp, Glu; (4) basic: His, Lys, Arg; (5) residues that influence chain orientation: gly, pro; (6) Aromatic: Trp, Tyr, Phe.

[0071] Non-conservative substitution involves exchanging one member of these classes for another. With respect to the nucleotide or amino acid position of a sequence as described in the sequence listing, the term "corresponding to" refers to the nucleotide or amino acid position identified by alignment with the target sequence based on structural sequence alignment or by using a standard alignment algorithm, such as the GAP algorithm. For example, the corresponding residues of similar sequences (e.g., fragments or species variants) can be determined by alignment with a reference sequence by structural alignment methods. By aligning sequences, those skilled in the art can identify corresponding residues, for example, using conserved and identical amino acid residues as a reference.

[0072] As used herein, an isoform of the human CD47 protein refers to a protein that is translated from the human CD47 gene and processed by alternative splicing.

[0073] As used herein, wild-type human CD47 protein refers to a human CD47 protein that naturally occurs in vivo, e.g., a wild-type human CD47 protein encoded in / by the human genome. Wild-type human CD47 protein can be any of the naturally occurring isoforms of human CD47 protein. The amino acid sequences of the five currently known naturally occurring isoforms of CD47 (isoforms 201, 202, 203, 205, and 206) are set forth in SEQ ID NOs: 1, 2, 4-5. Isoform CD47-202 (SEQ ID NO: 2) is the full-length wild-type human CD47 protein because it contains a signal sequence when translated. The sequence of the mature CD47-202 isoform lacking the signal sequence is set forth in SEQ ID NO: 3. Wild-type human CD47 protein may or may not have a signal peptide when expressed. For example, CD47-206 lacks a signal peptide when translated. Wild-type human CD47 protein may be glycosylated or non-glycosylated. The wild-type human CD47 protein can be a proteoglycan.

[0074] As used herein, an engineered CD47 protein refers to a CD47 protein that does not naturally occur in any species. In other words, an engineered CD47 protein is not a wild-type CD47 protein in any species. In some embodiments, an engineered CD47 protein is an engineered human CD47 protein, meaning that it has been engineered by using a human wild-type CD47 protein as a starting material and making one or more of the modifications described herein. In some embodiments, an engineered CD47 protein is an engineered humanized CD47 protein, meaning that it has been engineered by using a non-human (e.g., mouse) CD47 protein as a starting material and, in addition to humanizing the non-human CD47 sequence, making one or more of the other modifications described herein. In some embodiments, the engineered CD47 protein is an engineered partially humanized CD47 protein, meaning that it has been engineered by using a non-human (e.g., mouse) CD47 protein as the starting material and humanizing a portion of the non-human CD47 sequence, in addition to making one or more of the other modifications described herein.

[0075] As used herein, an engineered CD47 protein refers to a protein that is not the CD47 protein encoded in / by the native genome, e.g., is not a wild-type CD47 protein. Non-limiting examples of genetically engineered CD47 proteins include: (i) a genetically engineered CD47 protein having a human CD47 extracellular domain or a portion thereof, at least one human CD47 transmembrane domain or a portion thereof, and a portion of a human CD47 intracellular domain comprising a deletion of at least one amino acid, wherein the deletion is not an 18 amino acid C-terminal deletion; (ii) a genetically engineered CD47 protein having a portion of a human CD47 extracellular domain, at least one human CD47 transmembrane domain or a portion thereof, and a portion of a human CD47 intracellular domain comprising a C-terminal deletion of 18 amino acids; (iii) a genetically engineered CD47 protein having a human CD47 extracellular domain or a portion thereof, at least one and not more than five human CD47 transmembrane domain(s) or a portion(s) thereof, and a portion of a human CD47 intracellular domain comprising a C-terminal deletion of 18 amino acids; (iv) a genetically engineered CD47 protein having a human CD47 extracellular domain or a portion thereof, at least (v) an engineered CD47 protein having a human CD47 extracellular domain and at least one human CD47 transmembrane domain or a portion thereof, wherein the engineered CD47 protein does not comprise an intracellular domain; (vi) an engineered CD47 protein having a human CD47 extracellular domain or a portion thereof, and at least one and not more than five human CD47 transmembrane domain(s) or a portion thereof, wherein the engineered CD47 protein does not comprise an intracellular domain; (vii) a human CD47 extracellular domain or a portion thereof, and at least one human CD47 transmembrane domain or a portion thereof, wherein the engineered CD47 protein does not comprise an intracellular domain;Included are engineered CD47 proteins having a human CD47 intracellular domain that does not have an intracellular domain or that contains at least one amino acid deletion, wherein the engineered CD47 protein has an amino acid sequence with up to 99% identity to SEQ ID NO: 1 and SEQ ID NO: 6.

[0076] As used herein, in the context of an expressed polynucleotide or polypeptide, the term "exogenous" is intended to mean that the referenced molecule or polypeptide is introduced into a cell of interest. A polypeptide can be introduced, for example, by introducing an encoding nucleic acid into the genetic material of a cell, e.g., by chromosomal integration, or can be introduced as non-chromosomal genetic material, e.g., a plasmid or expression vector. Thus, when used in reference to the expression of an encoding nucleic acid, the term refers to the introduction of the encoding nucleic acid into a cell in an expressible form. An exogenous polynucleotide can be inserted into at least one allele of a cell, for example, using a vector via viral transduction. In some embodiments, the vector is a pseudotyped, self-inactivating lentiviral vector carrying the exogenous polynucleotide. In some embodiments, the vector is a self-inactivating lentiviral vector carrying the exogenous polynucleotide pseudotyped with a vesicular stomatitis VSV-G envelope. In some embodiments, the exogenous polynucleotide is inserted into at least one allele of a cell via viral transduction. In some embodiments, the exogenous polynucleotide is inserted into at least one allele of the cell using a lentivirus-based viral vector. In some embodiments, the exogenous polynucleotide is inserted into a target location of at least one allele of the cell.

[0077] An "exogenous" molecule is a molecule, construct, factor, etc. that is not normally present in a cell but can be introduced into a cell by one or more genetic, biochemical, or other methods. "Normal presence in a cell" is determined with respect to the particular developmental stage and environmental conditions of the cell. Thus, for example, a molecule that is present only during embryonic development of a neuron is exogenous to an adult neuron. Exogenous molecules can include, for example, a functioning version of a dysfunctional endogenous molecule or a dysfunctional version of a normally functioning endogenous molecule.

[0078] The exogenous molecule or factor can be, inter alia, a small molecule such as one produced by combinatorial chemistry processes, or a macromolecule, such as a protein, nucleic acid, carbohydrate, lipid, glycoprotein, lipoprotein, polysaccharide, any modified derivative of the above molecules, or any complex containing one or more of the above molecules. Nucleic acids include DNA and RNA, and can be single- or double-stranded, linear, branched, or circular, and of any length. Nucleic acids include those capable of forming duplexes and triplex-forming nucleic acids. See, e.g., U.S. Patent Nos. 5,176,996 and 5,422,251. Proteins include, but are not limited to, DNA-binding proteins, transcription factors, chromatin remodeling factors, methylated DNA-binding proteins, polymerases, methylases, demethylases, acetylases, deacetylases, kinases, phosphatases, integrases, recombinases, ligases, topoisomerases, gyrases, and helicases.

[0079] The exogenous molecule or construct may be the same type of molecule as the endogenous molecule, such as an exogenous protein or nucleic acid. In such cases, the exogenous molecule is introduced into the cell at a concentration higher than the concentration of the endogenous molecule in the cell. In some cases, the exogenous nucleic acid may include an infectious viral genome, a plasmid or episome introduced into the cell, or a chromosome not normally present in the cell. Methods for introducing exogenous molecules into cells are known to those skilled in the art and include, but are not limited to, lipid-mediated introduction (i.e., liposomes containing neutral and cationic lipids), electroporation, direct injection, cell fusion, particle bombardment, calcium phosphate coprecipitation, DEAE-dextran-mediated introduction, and viral vector-mediated introduction.

[0080] As used herein, the term "genetic modification" and its grammatical equivalents may refer to one or more changes in nucleic acids, for example, nucleic acids in the genome of an organism. For example, genetic modification may refer to the alteration, addition, and / or deletion of a gene or a portion of a gene or other nucleic acid sequence. Genetically modified cells may also refer to cells in which a gene or a portion of a gene has been added, deleted, and / or changed. Genetically modified cells may also refer to cells in which a nucleic acid sequence that is not a gene or a portion of a gene has been added. Genetic modifications include, for example, both transient knock-in or knock-down mechanisms and mechanisms that result in the permanent knock-in, knock-down, or knock-out of a target gene or portion of a gene or nucleic acid sequence. Genetic modifications may also include, for example, both transient knock-in and mechanisms that result in the permanent knock-in of a nucleic acid sequence. Genetic modifications may also include, for example, reduced or increased transcription, reduced or increased mRNA stability, reduced or increased translation, and reduced or increased protein stability.

[0081] As used herein, a portion of a peptide has fewer amino acids than a reference peptide and has at least one amino acid from that peptide.

[0082] As used herein, a composition refers to any mixture of two or more products, substances, or compounds, for example, cells.

[0083] II. CD47 Protein CD47 Protein Overview The present disclosure relates to genetically engineered CD47 proteins and uses thereof.

[0084] CD47, also known as integrin-associated protein (IAP) or MER6, is a transmembrane protein that in humans is encoded by the human CD47 gene (SEQ ID NO: 19) ( FIG. 1 ). CD47 belongs to the immunoglobulin (Ig) superfamily and is involved in a variety of cellular processes, including apoptosis, proliferation, adhesion, and migration.

[0085] Human CD47 is approximately 50 kDa. It is glycosylated and ubiquitously expressed by virtually all cells in the human body (Figure 2). Historical literature suggests that isoform 202 (i.e., CD47-202, SEQ ID NO: 2) is primarily expressed in the brain, but recent GTEx expression data does not support this conclusion (Figure 2). As shown in Example 1 herein, isoform CD47-202 (SEQ ID NO: 2, SEQ ID NO: 14) and isoform CD47-201 (SEQ ID NO: 1, SEQ ID NO: 13) are expressed at relatively equal levels in the Gibco and Rues2 human stem cell lines. Isoforms CD47-206 (SEQ ID NO: 6, SEQ ID NO: 18), 205 (SEQ ID NO: 5, SEQ ID NO: 17), and 204 (SEQ ID NO: 16) also appear to be highly expressed in these stem cell lines. No evidence of isoform CD47-203 (SEQ ID NO: 4, SEQ ID NO: 15) was detected in the stem cell lines.

[0086] Human CD47 has a single N-terminal IgV-like domain, a highly hydrophobic stretch with five transmembrane segments, and an alternatively spliced ​​C-terminal cytoplasmic tail (Figure 4). In addition, it has two extracellular and two intracellular regions between adjacent transmembrane segments. A signal peptide, if present in any CD47 isoform, is present N-terminal to the IgV-like domain.

[0087] As used herein, the human CD47 extracellular domain refers to the N-terminal IgV-like domain of the human CD47 protein. Structurally, the human CD47 extracellular domain is the N-terminal portion of the human CD47 protein that is present extracellularly when the human CD47 protein is anchored to the cell membrane. In some embodiments, the human CD47 extracellular domain has an amino acid sequence corresponding to amino acids 19-141 of SEQ ID NO:2, or at least 80%, 85%, 90%, 91%, 92%, 93%, or 100% identical to amino acids 19-141 of SEQ ID NO:2. In some embodiments, the human CD47 extracellular domain has an amino acid sequence corresponding to amino acids 19-141 of SEQ ID NO:2, or an amino acid sequence having at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to amino acids 19-141 of SEQ ID NO:2.

[0088] As used herein, the human CD47 intracellular domain refers to the C-terminal cytoplasmic tail of the human CD47 protein. Structurally, the human CD47 intracellular domain is the C-terminal portion of the human CD47 protein that is present intracellularly when the human CD47 protein is anchored to the cell membrane. The human CD47 intracellular domain is alternatively spliced ​​in vivo. In some embodiments, the human CD47 intracellular domain has an amino acid sequence corresponding to amino acids 290-323 of SEQ ID NO:2, or an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to amino acids 290-323 of SEQ ID NO:2. In some embodiments, the human CD47 intracellular domain has an amino acid sequence corresponding to amino acids 290-323 of SEQ ID NO:2, or an amino acid sequence having at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to amino acids 290-323 of SEQ ID NO:2.

[0089] As used herein, a human CD47 transmembrane domain refers to one of the transmembrane segments of the human CD47 protein. In some embodiments, the human CD47 transmembrane domain has an amino acid sequence corresponding to, or having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to, amino acids 142-162, 177-197, 208-228, 236-257, or 269-289 of SEQ ID NO:2. In some embodiments, the human CD47 transmembrane domain has an amino acid sequence corresponding to, or having at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to, amino acids 142-162, 177-197, 208-228, 236-257, or 269-289 of SEQ ID NO:2.

[0090] As used herein, a signal peptide refers to a short peptide present at the N-terminus of the CD47 protein when the protein is initially translated. The signal peptide is typically cleaved from the protein by a signal peptidase upon or shortly after insertion into the cell membrane. The signal peptide functions to direct the cell to translocate the protein, typically to the plasma membrane. In some embodiments, the signal peptide of a human CD47 protein has an amino acid sequence corresponding to amino acids 1-18 of SEQ ID NO:2, or an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to amino acids 1-18 of SEQ ID NO:2. In some embodiments, the signal peptide of a human CD47 protein has an amino acid sequence corresponding to amino acids 1-18 of SEQ ID NO:2, or an amino acid sequence having at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to amino acids 1-18 of SEQ ID NO:2. The amino acid sequence has 95%, 96%, 97%, 98%, or 99% identity.

[0091] The human CD47 gene has six transcripts, five of which encode protein isoforms of CD47 (Ensembl, gene:CD47). The six transcripts are designated CD47-201, CD47-202, CD47-203, CD47-204, CD47-205, and CD47-206 (Ensembl, gene:CD47, ENSG00000196776). The coding DNA sequences (CDS) of the six transcripts are shown in SEQ ID NOs: 13 to 18. The amino acid sequences of the five protein isoforms are shown in SEQ ID NOs: 1, 2, 4, 5, and 6, respectively (Table 2).

[0092] The transcript CD47-202 (SEQ ID NO: 14) encodes the 323-amino acid isoform CD47-202 (SEQ ID NO: 2). CD47-202 is the longest transcript of the human CD47 gene. It is designated as the representative transcript in the Ensembl database. In identifying representative transcripts, Ensembl aims to identify transcripts that, overall, have the greatest extent of conserved exons, exhibit the highest expression, have the longest coding sequence, and are represented in other important information sources such as NCBI and UniProt. All splice sites in the CD47-202 transcript are supported by at least one non-suspect mRNA.

[0093] Transcript CD47-201 (SEQ ID NO: 13) encodes isoform CD47-201 (SEQ ID NO: 1), which has 305 amino acids. Isoform CD47-201 represents a C-terminal truncation of 18 amino acids from isoform CD47-202. All splice sites of the CD47-201 transcript are supported by at least one non-suspect mRNA.

[0094] The transcript CD47-203 (SEQ ID NO: 15) encodes the 86 amino acid isoform CD47-203 (SEQ ID NO: 4). The only support for the transcript model comes from a single expressed sequence tag (EST).

[0095] The transcript CD47-204 (SEQ ID NO: 16) does not encode a protein. All splice sites of this transcript are supported by at least one non-suspect mRNA.

[0096] Transcript CD47-205 (SEQ ID NO: 17) encodes isoform CD47-205 (SEQ ID NO: 5), which has 109 amino acids. Isoform 205 contains three transmembrane domains and the truncated intracellular domain from isoform CD47-202 (SEQ ID NO: 2). mRNAs that provide the most support for the transcript model have been flagged as questionable or support is provided by multiple ESTs.

[0097] The transcript CD47-206 (SEQ ID NO: 18) encodes the 183 amino acid isoform CD47-206 (SEQ ID NO: 6). Isoform 206 contains a truncated extracellular domain and the five transmembrane domains from isoform CD47-202 (SEQ ID NO: 2).

[0098] The amino acid sequences of the five isoforms are listed in Table 2. The amino acids corresponding to the various domains in the human CD47 protein are also identified in Table 2 and shown in Figure 5. An "intracellular junction" refers to an intracellular region connecting adjacent transmembrane domains that is located intracellularly (i.e., not located extracellularly and not located within the cell membrane), but is not located at the N- or C-terminus of the engineered CD47 protein. An "extracellular junction" refers to an extracellular region connecting adjacent transmembrane domains that is located extracellularly (i.e., not located intracellularly and not located within the cell membrane). As used herein, the CD47 "intracellular domain" does not include the intracellular junction. Also as used herein, the CD47 "extracellular domain" does not include the extracellular junction. [Table 2]

[0099] Genetically engineered CD47 protein The present disclosure provides engineered CD47 proteins that have fewer amino acids compared to the wild-type, full-length human CD47 protein. Such engineered proteins provide for more efficient cell engineering approaches, including delivery via integrated gene therapy vectors.

[0100] Wild-type full-length human CD47 protein, as used herein, refers to isoform CD47-202, as disclosed in the Ensembl database as of the filing date of this patent application. Wild-type full-length human CD47 protein has the amino acid sequence of SEQ ID NO:2, in which amino acids 1-18 are the signal peptide, amino acids 19-141 are the extracellular domain, amino acids 142-162, 177-197, 208-228, 236-257, and 269-289 are the five transmembrane domains (Figure 3), and amino acids 290-323 are the intracellular domain. Amino acids 163-176 and 229-235 are the two intracellular junctions between the transmembrane domains, and amino acids 198-207 and 257-268 are the two extracellular junctions between the transmembrane domains (Figure 3).

[0101] In some embodiments, the engineered CD47 protein is a C-terminally truncated version of isoform 202 (SEQ ID NO: 2). For example, in some embodiments, the C-terminal truncations are contiguous and include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42 , 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 1, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, The C-terminal truncations are 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, or 161 amino acid(s) in length. Preferably, the C-terminal truncations are 158, 123, 92, 64, 31, or 95 amino acids in length, resulting in engineered CD47 proteins having the amino acid sequences set forth in SEQ ID NOs: 7-12, respectively.In some embodiments, the engineered CD47 protein having a C-terminal truncation of SEQ ID NO:2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114 , 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, or 140 consecutive amino acid(s).

[0102] In some embodiments, the engineered CD47 protein is a C-terminally truncated version of isoform 201 (SEQ ID NO: 1). For example, in some embodiments, the C-terminal truncations are contiguous and include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 20 9, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116 6, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, or 143 amino acid(s) in length. In some embodiments, the engineered CD47 protein having a C-terminal truncation of SEQ ID NO: 1 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46 , 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, or 95 consecutive amino acid(s).

[0103] In some embodiments, the engineered CD47 protein is a C-terminally truncated version of isoform 206 (SEQ ID NO: 6). For example, in some embodiments, the C-terminal truncations are contiguous and are 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, or 66 amino acid(s) in length. In some embodiments, the engineered CD47 protein having a C-terminal truncation of SEQ ID NO: 6 is selected from the group consisting of 1, 2, 3, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, and further having an N-terminal truncation of 14, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, or 140 consecutive amino acid(s).

[0104] In some embodiments, the engineered CD47 protein comprises a minimal intracellular domain. As used herein, a minimal intracellular domain refers to an intracellular domain having the minimum number of amino acids required to retain SIRPα-binding properties of the engineered CD47 protein.

[0105] In some embodiments, the engineered CD47 protein comprises a minimal extracellular domain. As used herein, a minimal extracellular domain refers to an extracellular domain having the minimum number of amino acids required for the engineered CD47 protein to bind to SIRPα.

[0106] In certain aspects, the present disclosure provides engineered CD47 proteins comprising a human CD47 extracellular domain or portion thereof and at least one human CD47 transmembrane domain, wherein the intracellular domain, if present, is a human CD47 intracellular domain having at least one amino acid deletion. In some embodiments, when two or more transmembrane domains are present in the engineered CD47 protein, each of the transmembrane domains is interconnected with intracellular and / or extracellular junction(s).

[0107] In certain aspects, the present disclosure provides engineered CD47 proteins consisting essentially of a human CD47 extracellular domain or portion thereof and at least one human CD47 transmembrane domain. In some embodiments, when more than one transmembrane domain is present in the engineered CD47 protein, each of the transmembrane domains is interconnected with intracellular and / or extracellular junction(s). As used herein, the term "consisting essentially of" includes the specified elements and any additional elements that do not inhibit the SIRPα binding of the engineered CD47 protein.

[0108] In certain aspects, the present disclosure provides engineered CD47 proteins consisting of a human CD47 extracellular domain or portion thereof and at least one human CD47 transmembrane domain. In some embodiments, when more than one transmembrane domain is present in the engineered CD47 protein, each of the transmembrane domains is interconnected with intracellular and / or extracellular junction(s).

[0109] In some embodiments, the engineered CD47 protein comprises the human CD47 extracellular domain or a portion thereof, at least one human CD47 transmembrane domain or a portion thereof, and a portion of the human CD47 intracellular domain comprising at least one amino acid deletion, wherein the deletion is not an 18 amino acid C-terminal deletion.

[0110] In some embodiments, the engineered CD47 protein comprises a portion of the human CD47 extracellular domain, at least one human CD47 transmembrane domain or portion thereof, and a portion of the human CD47 intracellular domain comprising an 18 amino acid C-terminal deletion.

[0111] In some embodiments, the engineered CD47 protein comprises a human CD47 extracellular domain or portion thereof, at least one and not more than five human CD47 transmembrane domain(s) or portion(s) thereof, and a portion of the human CD47 intracellular domain comprising an 18 amino acid C-terminal deletion.

[0112] In some embodiments, the engineered CD47 protein comprises a human CD47 extracellular domain or a portion thereof, at least one human CD47 transmembrane domain or a portion thereof, and a signal peptide, wherein the engineered CD47 protein does not comprise an intracellular domain.

[0113] In some embodiments, the engineered CD47 protein comprises a human CD47 extracellular domain and at least one human CD47 transmembrane domain or a portion thereof, wherein the engineered CD47 protein does not comprise the intracellular domain.

[0114] In some embodiments, the engineered CD47 protein comprises a human CD47 extracellular domain or portion thereof, and at least one and no more than five human CD47 transmembrane domain(s) or portion(s) thereof, wherein the engineered CD47 protein does not comprise the intracellular domain.

[0115] In some embodiments, the engineered CD47 protein comprises a human CD47 extracellular domain, five human CD47 transmembrane domains, and a human CD47 intracellular domain with an 18 amino acid C-terminal deletion, wherein the amino acid sequence of the engineered CD47 protein is not SEQ ID NO:1.

[0116] In some embodiments, the engineered CD47 protein comprises a human CD47 extracellular domain and five human CD47 transmembrane domains, wherein the amino acid sequence of the engineered CD47 protein is not SEQ ID NO:6.

[0117] In some embodiments, the engineered CD47 protein comprises a human CD47 extracellular domain or a portion thereof, at least one human CD47 transmembrane domain or a portion thereof, and a human CD47 intracellular domain that does not include the intracellular domain or that contains at least one amino acid deletion, wherein the amino acid sequence of the engineered CD47 protein has up to 99% identity to SEQ ID NO: 1 and SEQ ID NO: 6. In other words, in some embodiments, the engineered CD47 protein comprises a human CD47 extracellular domain or a portion thereof, at least one human CD47 transmembrane domain or a portion thereof, and a human CD47 intracellular domain that does not include the intracellular domain or that contains at least one amino acid deletion, wherein the amino acid sequence of the engineered CD47 protein has 99% or less identity to SEQ ID NO: 1 and 99% or less identity to SEQ ID NO: 6.

[0118] In some embodiments, the human CD47 extracellular domain in the engineered CD47 protein is a wild-type human CD47 extracellular domain, which in some embodiments has an amino acid sequence corresponding to amino acids 19-141 of SEQ ID NO:1 or amino acids 1-96 of SEQ ID NO:6.

[0119] In some embodiments, the human CD47 extracellular domain in the engineered CD47 protein has an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to amino acids 19-141 of SEQ ID NO: 1 or amino acids 1-96 of SEQ ID NO: 6. In some embodiments, the human CD47 extracellular domain in the engineered CD47 protein has an amino acid sequence that is at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to amino acids 19-141 of SEQ ID NO: 1 or amino acids 1-96 of SEQ ID NO: 6.

[0120] In some embodiments, the human CD47 extracellular domain in the engineered CD47 protein is structurally equivalent to the wild-type human CD47 extracellular domain.

[0121] As used herein, "structurally equivalent" refers to two amino acid sequences that have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity. Preferably, the sequence variations do not alter the biological activity of the engineered CD47 protein. In some embodiments, the sequence variations do not prevent the engineered human protein from binding to SIRPα. In some embodiments, the sequence variations do not prevent the engineered human protein from being an immune tolerance inducer. In some embodiments, at least some of the sequence variations may occur by conservative amino acid substitution(s).

[0122] In some embodiments, the engineered proteins of the present disclosure comprise one or more membrane tethers. In some embodiments, the one or more membrane tethers are or comprise a transmembrane domain. In some embodiments, the transmembrane domain comprises a transmembrane domain of a GPCR selected from the group consisting of: 5-hydroxytryptamine (serotonin) receptor 1A (HTR1A), 5-hydroxytryptamine (serotonin) receptor 1B (HTR1B), 5-hydroxytryptamine (serotonin) receptor 1D (HTR1D), 5-hydroxytryptamine (serotonin) receptor 1E (HTR1E), 5-hydroxytryptamine (serotonin) receptor 1F (HTR1F), 5-hydroxytryptamine (serotonin) receptor 2A (HTR2A), 5-hydroxytryptamine (serotonin) receptor 2B (HTR2B), 5-hydroxytryptamine (serotonin) receptor 2C (HTR2C), 5-hydroxytryptamine (serotonin) receptor 4 (HTR4), 5-hydroxytryptamine (serotonin) receptor 5A (HTR5A), 5-hydroxytryptamine (serotonin) receptor 5B (HTR5BP) ), 5-hydroxytryptamine (serotonin) receptor 6 (HTR6), adenylate cyclase-coupled 5-hydroxytryptamine (serotonin) receptor 7 (HTR7), muscarinic cholinergic receptor 1 (CHRM1), muscarinic cholinergic receptor 2 (CHRM2), muscarinic cholinergic receptor 3 (CHRM3), muscarinic cholinergic receptor 4 (CHRM4), muscarinic cholinergic receptor 5 (CHRM5), adenosine A1 receptor (ADORA1), adenosine Adenosine A2a receptor (ADORA2A), adenosine A2b receptor (ADORA2B), adenosine A3 receptor (ADORA3), adhesion G protein-coupled receptor A1 (ADGRA1), adhesion G protein-coupled receptor A2 (ADGRA2), adhesion G protein-coupled receptor A3 (ADGRA3), adhesion G protein-coupled receptor B1 (ADGRB1), adhesion G protein-coupled receptor B2 (ADGRB2), adhesion G protein-coupled receptor B3 (ADGRB3), cadherin EGF LAG7 transmembrane G-type receptor 1 (CELSR1), cadherin EGF LAG7 transmembrane G-type receptor 2 (CELSR2), cadherin EGF LAG7 transmembrane G-type receptor 3 (CELSR3),Adhesion G protein-coupled receptor D1 (ADGRD1), adhesion G protein-coupled receptor D2 (ADGRD2), adhesion G protein-coupled receptor E1 (ADGRE1), adhesion G protein-coupled receptor E2 (ADGRE2), adhesion G protein-coupled receptor E3 (ADGRE3), adhesion G protein-coupled receptor E4 (ADGRE4P), adhesion G protein-coupled receptor E5 (ADGRE5), adhesion G protein-coupled receptor F1 (ADGRF1), adhesion G protein-coupled receptor F2 (ADGRF2), adhesion G protein-coupled receptor F3 (ADGRF3), adhesion G protein Adhesion G protein-coupled receptor F4 (ADGRF4), adhesion G protein-coupled receptor F5 (ADGRF5), adhesion G protein-coupled receptor G1 (ADGRG1), adhesion G protein-coupled receptor G2 (ADGRG2), adhesion G protein-coupled receptor G3 (ADGRG3), adhesion G protein-coupled receptor G4 (ADGRG4), adhesion G protein-coupled receptor G5 (ADGRG5), adhesion G protein-coupled receptor G6 (ADGRG6), adhesion G protein-coupled receptor G7 (ADGRG7), adhesion G protein-coupled receptor L1 (ADGRL1), adhesion G protein-coupled receptor L2 (A DGRL2), adhesion G protein-coupled receptor L3 (ADGRL3), adhesion G protein-coupled receptor L4 (ADGRL4), adhesion G protein-coupled receptor V1 (ADGRV1), adrenoceptor alpha 1A (ADRA1A), adrenoceptor alpha 1B (ADRA1B), adrenoceptor alpha 1D (ADRA1D), adrenoceptor alpha 2A (ADRA2A), adrenoceptor alpha 2B (ADRA2B), adrenoceptor alpha 2C (ADRA2C), adrenoceptor beta 1 (ADRB1), adrenoceptor beta 2 (ADRB2), adrenaline Receptor beta 3 (ADRB3), Angiotensin II receptor type 1 (AGTR1), Angiotensin II receptor type 2 (AGTR2), Apelin receptor (APLNR), G protein-coupled bile acid receptor 1 (GPBAR1), Neuromedin B receptor (NMBR), Gastrin-releasing peptide receptor (GRPR), Bombesin-like receptor 3 (BRS3), Bradykinin receptor B1 (BDKRB1), Bradykinin receptor B2 (BDKRB2), Calcitonin receptor (CALCR), Calcitonin receptor-like receptor (CALCRL), Calcium-sensing receptor (CASR),G protein-coupled receptor class C (GPRC6A), cannabinoid receptor 1 (brain) (CNR1), cannabinoid receptor 2 (CNR2), chemerin chemokine-like receptor 1 (CMKLR1), chemokine (CC motif) receptor 1 (CCR1), chemokine (CC motif) receptor 2 (CCR2), chemokine (CC motif) receptor 3 (CCR3), chemokine (CC motif) receptor 4 (CCR4), chemokine (CC motif) receptor 5 (gene / pseudogene) (CCR5), chemokine (CC motif) receptor 6 (CCR6), Chemokine (C-C motif) receptor 7 (CCR7), chemokine (C-C motif) receptor 8 (CCR8), chemokine (C-C motif) receptor 9 (CCR9), chemokine (C-C motif) receptor 10 (CCR10), chemokine (C-X-C motif) receptor 1 (CXCR1), chemokine (C-X-C motif) receptor 2 (CXCR2), chemokine (C-X-C motif) receptor 3 (CXCR3), chemokine (C-X-C motif) receptor 4 (CXCR4), chemokine (C-X-C motif) receptor 5 (CXCR5), chemokine (C-X-C motif) Chemokine (C-X3-C motif) receptor 6 (CXCR6), chemokine (C-X3-C motif) receptor 1 (CX3CR1), chemokine (C motif) receptor 1 (XCR1), atypical chemokine receptor 1 (Duffy blood group) (ACKR1), atypical chemokine receptor 2 (ACKR2), atypical chemokine receptor 3 (ACKR3), atypical chemokine receptor 4 (ACKR4), chemokine (CC motif) receptor-like 2 (CCRL2), cholecystokinin A receptor (CCKAR), cholecystokinin B receptor (CCKBR), G protein-coupled receptor 1 (GPR1), and bovine serum albumin (BSA) receptor. Brain-like receptor 3 (BRS3), G protein-coupled receptor 3 (GPR3), G protein-coupled receptor 4 (GPR4), G protein-coupled receptor 6 (GPR6), G protein-coupled receptor 12 (GPR12), G protein-coupled receptor 15 (GPR15), G protein-coupled receptor 17 (GPR17), G protein-coupled receptor 18 (GPR18), G protein-coupled receptor 19 (GPR19), G protein-coupled receptor 20 (GPR20), G protein-coupled receptor 21 (GPR21), G protein-coupled receptor 22 (GPR22),G protein-coupled receptor 25 (GPR25), G protein-coupled receptor 26 (GPR26), G protein-coupled receptor 27 (GPR27), G protein-coupled receptor 31 (GPR31), G protein-coupled receptor 32 (GPR32), G protein-coupled receptor 33 (gene / pseudogene) (GPR33), G protein-coupled receptor 34 (GPR34), G protein-coupled receptor 35 (GPR35), G protein-coupled receptor 37 (endothelin receptor type B-like) (GPR37), G protein-coupled receptor 37-like 1 (GPR37L1), G protein-coupled receptor G protein-coupled receptor 39 (GPR39), G protein-coupled receptor 42 (gene / pseudogene) (GPR42), G protein-coupled receptor 45 (GPR45), G protein-coupled receptor 50 (GPR50), G protein-coupled receptor 52 (GPR52), G protein-coupled receptor 55 (GPR55), G protein-coupled receptor 61 (GPR61), G protein-coupled receptor 62 (GPR62), G protein-coupled receptor 63 (GPR63), G protein-coupled receptor 65 (GPR65), G protein-coupled receptor 68 (GPR68), G protein-coupled receptor 75 (GP R75), G protein-coupled receptor 78 (GPR78), G protein-coupled receptor 79 (GPR79), G protein-coupled receptor 82 (GPR82), G protein-coupled receptor 83 (GPR83), G protein-coupled receptor 84 (GPR84), G protein-coupled receptor 85 (GPR85), G protein-coupled receptor 87 (GPR87), G protein-coupled receptor 88 (GPR88), G protein-coupled receptor 101 (GPR101), G protein-coupled receptor 119 (GPR119), G protein-coupled receptor 132 (GPR132), G protein Protein-coupled receptor 135 (GPR135), G protein-coupled receptor 139 (GPR139), G protein-coupled receptor 141 (GPR141), G protein-coupled receptor 142 (GPR142), G protein-coupled receptor 146 (GPR146), G protein-coupled receptor 148 (GPR148), G protein-coupled receptor 149 (GPR149), G protein-coupled receptor 150 (GPR150), G protein-coupled receptor 151 (GPR151), G protein-coupled receptor 152 (GPR152), G protein-coupled receptor 153 (GPR153),G protein-coupled receptor 160 (GPR160), G protein-coupled receptor 161 (GPR161), G protein-coupled receptor 162 (GPR162), G protein-coupled receptor 171 (GPR171), G protein-coupled receptor 173 (GPR173), G protein-coupled receptor 174 (GPR174), G protein-coupled receptor 176 (GPR176), G protein-coupled receptor 182 (GPR182), G protein-coupled receptor 183 (GPR183), leucine-rich repeat-containing G protein-coupled receptor 4 (LGR4), leucine-rich lipid Leucine-rich repeat-containing G protein-coupled receptor 5 (LGR5), leucine-rich repeat-containing G protein-coupled receptor 6 (LGR6), MAS1 proto-oncogene (MAS1), MAS1 proto-oncogene-like (MAS1L), MAS-related GPR family member D (MRGPRD), MAS-related GPR family member E (MRGPRE), MAS-related GPR family member F (MRGPRF), MAS-related GPR family member G (MRGPRG), MAS-related GPR family member X1 (MRGPRX1), MAS-related GPR family member X2 (MRGP PRX2), MAS-related GPR family member X3 (MRGPRX3), MAS-related GPR family member X4 (MRGPRX4), opsin 3 (OPN3), opsin 4 (OPN4), opsin 5 (OPN5), purinergic receptor P2Y (P2RY8), purinergic receptor P2Y (P2RY10), trace amine-associated receptor 2 (TAAR2), trace amine-associated receptor 3 (gene / pseudogene) (TAAR3), trace amine-associated receptor 4 (TAAR4P), trace amine-associated receptor 5 (TAAR5), trace amine-associated receptor 6 (TAAR6), trace amine-associated receptor receptor 8 (TAAR8), trace amine-associated receptor 9 (gene / pseudogene) (TAAR9), G protein-coupled receptor 156 (GPR156), G protein-coupled receptor 158 (GPR158), G protein-coupled receptor 179 (GPR179), G protein-coupled receptor class C (GPRC5A), G protein-coupled receptor class C (GPRC5B), G protein-coupled receptor class C (GPRC5C), G protein-coupled receptor class C (GPRC5D), Frizzled class receptor 1 (FZD1), Frizzled class receptor 2 (FZD2),Frizzled class receptor 3 (FZD3), Frizzled class receptor 4 (FZD4), Frizzled class receptor 5 (FZD5), Frizzled class receptor 6 (FZD6), Frizzled class receptor 7 (FZD7), Frizzled class receptor 8 (FZD8), Frizzled class receptor 9 (FZD9), , Frizzled class receptor 10 (FZD10), Smoothened receptor (SMO) (Frizzled class), complement component 3a receptor 1 (C3AR1), complement component 5a receptor 1 (C5AR1), complement component 5a receptor 2 (C5AR2), corticotropin-releasing hormone receptor 1 (CRHR1), corticotropin-releasing hormone receptor 2 (CRHR2), dopamine receptor D1 (DRD1), dopamine receptor D2 (DRD2), dopamine receptor D3 (DRD3), dopamine receptor D4 (DRD4), dopamine receptor D5 (DRD5) , endothelin receptor type A (EDNRA), endothelin receptor type B (EDNRB), formyl peptide receptor 1 (FPR1), formyl peptide receptor 2 (FPR2), formyl peptide receptor 3 (FPR3), free fatty acid receptor 1 (FFAR1), free fatty acid receptor 2 (FFAR2), free fatty acid receptor 3 (FFAR3), free fatty acid receptor 4 (FFAR4), G protein-coupled receptor 42 (gene / pseudogene) (GPR42), gamma-aminobutyric acid (GABA) B receptor 1 (GABBR1), gamma-aminobutyric acid (GABA) B receptor 2 (GABBR 2), galanin receptor 1 (GALR1), galanin receptor 2 (GALR2), galanin receptor 3 (GALR3), growth hormone secretagogue receptor (GHSR), growth hormone-releasing hormone receptor (GHRHR), gastric inhibitory polypeptide receptor (GIPR), glucagon-like peptide 1 receptor (GLP1R), glucagon-like peptide 2 receptor (GLP2R), glucagon receptor (GCGR), secretin receptor (SCTR), follicle-stimulating hormone receptor (FSHR), luteinizing hormone / chorionic gonadotropin receptor (LHCGR), thyroid-stimulating hormone receptor receptor (TSHR), gonadotropin-releasing hormone receptor (GNRHR), gonadotropin-releasing hormone receptor 2 (pseudogene) (GNRHR2), G protein-coupled receptor 18 (GPR18), G protein-coupled receptor 55 (GPR55), G protein-coupled receptor 119 (GPR119), G protein-coupled estrogen receptor 1 (GPER1), histamine receptor H1 (HRH1), histamine receptor H2 (HRH2), histamine receptor H3 (HRH3), histamine receptor H4 (HRH4), hydroxycarboxylic acid receptor 1 (HCAR1),Hydroxycarboxylic acid receptor 2 (HCAR2), hydroxycarboxylic acid receptor 3 (HCAR3), KISS1 receptor (KISS1R), leukotriene B4 receptor (LTB4R), leukotriene B4 receptor 2 (LTB4R2), cysteinyl leukotriene receptor 1 (CYSLTR1), cysteinyl leukotriene receptor 2 (CYSLTR2), oxoeicosanoid (OXE) receptor 1 (OXER1), formyl peptide receptor 2 (FPR2), lysophosphatidic acid receptor 1 (LPAR1), lysophosphatidic acid receptor 2 (LPAR2), Lysophosphatidic acid receptor 3 (LPAR3), lysophosphatidic acid receptor 4 (LPAR4), lysophosphatidic acid receptor 5 (LPAR5), lysophosphatidic acid receptor 6 (LPAR6), sphingosine-1-phosphate receptor 1 (S1PR1), sphingosine-1-phosphate receptor 2 (S1PR2), sphingosine-1-phosphate receptor 3 (S1PR3), sphingosine-1-phosphate receptor 4 (S1PR4), sphingosine-1-phosphate receptor 5 (S1PR5), melanin-concentrating hormone receptor 1 (MCHR1), melanin-concentrating hormone receptor 2 (MCHR2), melanocortin 1 receptor (α-melanocyte-stimulating hormone receptor) (MC1R), melanocortin 2 receptor (adrenocorticotropic hormone) (MC2R), melanocortin 3 receptor (MC3R), melanocortin 4 receptor (MC4R), melanocortin 5 receptor (MC5R), melatonin receptor 1A (MTNR1A), melatonin receptor 1B (MTNR1B), metabotropic glutamate receptor 1 (GRM1), metabotropic glutamate receptor 2 (GRM2), metabotropic glutamate receptor 3 (GRM3), metabotropic glutamate receptor 4 (GRM4), Metabotropic glutamate receptor 5 (GRM5), metabotropic glutamate receptor 6 (GRM6), metabotropic glutamate receptor 7 (GRM7), metabotropic glutamate receptor 8 (GRM8), motilin receptor (MLNR), neuromedin U receptor 1 (NMUR1), neuromedin U receptor 2 (NMUR2), neuropeptide FF receptor 1 (NPFFR1), neuropeptide FF receptor 2 (NPFFR2), neuropeptide S receptor 1 (NPSR1), neuropeptide B / W receptor 1 (NPBWR1), neuropeptide B / W receptor 2 (NPBWR2),Neuropeptide Y receptor Y1 (NPY1R), neuropeptide Y receptor Y2 (NPY2R), neuropeptide Y receptor Y4 (NPY4R), neuropeptide Y receptor Y5 (NPY5R), neuropeptide Y receptor Y6 (pseudogene) (NPY6R), neurotensin receptor 1 (high affinity) (NTSR1), neurotensin receptor 2 (NTSR2), opioid receptor delta 1 (OPRD1), opioid receptor kappa 1 (OPRK1), opioid receptor μ 1 (OPRM1), opiate receptor-like 1 (OPRL1), hypocretin (orexin) receptor body 1 (HCRTR1), hypocretin (orexin) receptor 2 (HCRTR2), G protein-coupled receptor 107 (GPR107), G protein-coupled receptor 137 (GPR137), olfactory receptor family 51 subfamily E member 1 (OR51E1), transmembrane protein, adipocyte-associated 1 (TPRA1), G protein-coupled receptor 143 (GPR143), G protein-coupled receptor 157 (GPR157), oxoglutarate (α-ketoglutarate) receptor 1 (OXGR1), purinergic receptor P2Y (P2RY1), purinergic receptor P2Y (P2RY2) 2), pyrimidine receptor P2Y (P2RY4), pyrimidine receptor P2Y (P2RY6), purinergic receptor P2Y (P2RY11), purinergic receptor P2Y (P2RY12), purinergic receptor P2Y (P2RY13), purinergic receptor P2Y (P2RY14), parathyroid hormone 1 receptor (PTH1R), parathyroid hormone 2 receptor (PTH2R), platelet-activating factor receptor (PTAFR), prokineticin receptor 1 (PROKR1), prokineticin receptor 2 (PROKR2), prolactin-releasing hormone receptor (PRLHR), prostaglandin D2 receptor (DP) (PTGDR), prostaglandin D2 receptor 2 (PTGDR2), prostaglandin E receptor 1 (PTGER1), prostaglandin E receptor 2 (PTGER2), prostaglandin E receptor 3 (PTGER3), prostaglandin E receptor 4 (PTGER4), prostaglandin F receptor (PTGFR), prostaglandin 12 (prostacyclin) receptor (IP) (PTGIR), thromboxane A2 receptor (TBXA2R), coagulation factor II (thrombin) receptor (F2R), F2R-like trypsin receptor 1 (F2RL1),Coagulation factor II (thrombin) receptor-like 2 (F2RL2), F2R-like thrombin / trypsin receptor 3 (F2RL3), pyroglutamylated RFamide peptide receptor (QRFPR), relaxin / insulin-like family peptide receptor 1 (RXFP1), relaxin / insulin-like family peptide receptor 2 (RXFP2), relaxin / insulin-like family peptide receptor 3 (RXFP3), relaxin / insulin-like family peptide receptor 4 (RXFP4), somatostatin receptor 1 (SSTR1), somatostatin receptor 2 (SSTR2) , somatostatin receptor 3 (SSTR3), somatostatin receptor 4 (SSTR4), somatostatin receptor 5 (SSTR5), succinate receptor 1 (SUCNR1), tachykinin receptor 1 (TACR1), tachykinin receptor 2 (TACR2), tachykinin receptor 3 (TACR3), taste receptor type 1 member 1 (TAS1R1), taste receptor type 1 member 2 (TAS1R2), taste receptor type 1 member 3 (TAS1R3), taste receptor type 2 member 1 (TAS2R1), taste receptor type 2 member 3 (TAS2R3), taste receptor type 2 member 4 (TAS2R4) ), taste receptor type 2 member 5 (TAS2R5), taste receptor type 2 member 7 (TAS2R7), taste receptor type 2 member 8 (TAS2R8), taste receptor type 2 member 9 (TAS2R9), taste receptor type 2 member 10 (TAS2R10), taste receptor type 2 member 13 (TAS2R13), taste receptor type 2 member 14 (TAS2R14), taste receptor type 2 member 16 (TAS2R16), taste receptor type 2 member 19 (TAS2R19), taste receptor type 2 member 20 (TAS2R20), taste receptor type 2 member 30 (TAS2R30), taste receptor Taste receptor type 2 member 31 (TAS2R31), taste receptor type 2 member 38 (TAS2R38), taste receptor type 2 member 39 (TAS2R39), taste receptor type 2 member 40 (TAS2R40), taste receptor type 2 member 41 (TAS2R41), taste receptor type 2 member 42 (TAS2R42), taste receptor type 2 member 43 (TAS2R43), taste receptor type 2 member 45 (TAS2R45), taste receptor type 2 member 46 (TAS2R46), taste receptor type 2 member 50 (TAS2R50), taste receptor type 2 member 60 (TAS2R60),Thyrotropin-releasing hormone receptor (TRHR), trace amine-associated receptor 1 (TAAR1), urotensin 2 receptor (UTS2R), arginine vasopressin receptor 1A (AVPR1A), arginine vasopressin receptor 1B (AVPR1B), arginine vasopressin receptor 2 (AVPR2), oxytocin receptor (OXTR), adenylate cyclase-activating polypeptide 1 (pituitary) receptor type 1 (ADCYAP1R1), vasoactive intestinal peptide receptor 1 (VIPR1), vasoactive intestinal peptide receptor 2 (VIPR2), and any variants thereof. In some embodiments, the transmembrane domain is or comprises the transmembrane domain of CD3zeta, CD8a, CD16a, CD28, CD32a, CD32c, CD40, CD47, CD64, ICOS, Dectin-1, DNGR1, EGFR, GPCR, MyD88, PDGFR, SLAMF7, TRL1, TLR2, TLR3, TRL4, TLR5, TLR6, TLR7, TLR8, TLR9, or VEGFR.

[0123] Plasma membrane proteins may be bound to peripheral membranes or may be integral membrane proteins. See, for example, the review in Komath SS, Fujita M, Hart GW, et al., Glycosylphosphatidylinositol Anchors, editors, Essentials of Glycobiology, 4th edition, Cold Spring Harbor (NY): Cold Spring Harbor Laboratory Press; 2022. Chapter 12. GPI anchoring refers to the attachment of glycosylphosphatidylinositol or GPI to the C-terminus of a protein during post-translational modification. In some embodiments, the heterologous membrane-binding sequence is a GPI anchor-binding sequence. Proteins bound to a GPI anchor via their C-terminus are usually found on the outside of the lipid bilayer. A GPI anchor is an alternative to the single transmembrane domain of type I integral membrane proteins.

[0124] The heterologous GPI anchor attachment sequence can be derived from any known GPI-anchored protein (reviewed in Ferguson MAJ, Kinoshita T, Hart GW. Glycosylphosphatidylinositol Anchors. in Varki A, Cummings RD, Esko JD, et al., editors. Essentials of Glycobiology. 2nd edition. Cold Spring Harbor (NY): Cold Spring Harbor Laboratory Press; 2009. Chapter 11). In some embodiments, the heterologous GPI anchor attachment sequence is derived from CD14, CD16, CD48, DAF / CD55, CD59, CD80, CD87, or TRAIL-R3. In some embodiments, the heterologous GPI anchor attachment sequence is derived from DAF / CD55. In some embodiments, the heterologous GPI anchor attachment sequence is derived from CD59. In some embodiments, the heterologous GPI anchor attachment sequence is derived from TRAIL-R3. In exemplary embodiments, the heterologous GPI anchor attachment sequence is derived from DAF / CD55, CD59, or TRAIL-R3. In some embodiments, one or both of the activation elements includes a heterologous signal sequence that serves to direct expression of the activation element to the cell membrane. Any signal sequence that is active in the packaging cell line may be used. In some embodiments, the signal sequence is the DAF / CD55 signal sequence. In some embodiments, the signal sequence is the CD59 signal sequence. In some embodiments, the signal sequence is the TRAIL-R3 signal sequence.

[0125] In some embodiments, the engineered CD47 protein comprises one or more wild-type human CD47 transmembrane domains, hi some embodiments, the wild-type domains have an amino acid sequence corresponding to amino acids 142-162, 177-197, 208-228, 236-257, or 269-289 of SEQ ID NO:2.

[0126] In some embodiments, the engineered CD47 protein comprises one or more transmembrane domains that are structurally equivalent to the wild-type human CD47 transmembrane domain. In some embodiments, the engineered CD47 protein comprises one or more transmembrane domains having an amino acid sequence that is at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to amino acids 142-162, 177-197, 208-228, 236-257, or 269-289 of SEQ ID NO:2.

[0127] In some embodiments, the human CD47 intracellular domain in the engineered CD47 protein is a wild-type human CD47 intracellular domain, which has an amino acid sequence corresponding to amino acids 290 to 323 of SEQ ID NO:2.

[0128] In some embodiments, the human CD47 intracellular domain in the engineered CD47 protein is structurally equivalent to the wild-type human CD47 intracellular domain, ie, the human CD47 intracellular domain in the engineered CD47 protein has an amino acid sequence that is at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to amino acids 290-323 of SEQ ID NO:2.

[0129] In some embodiments, the engineered CD47 protein comprises an amino acid sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the amino acid sequence set forth in SEQ ID NO:7.

[0130] In some embodiments, the engineered CD47 protein comprises an amino acid sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the amino acid sequence set forth in SEQ ID NO:8.

[0131] In some embodiments, the engineered CD47 protein comprises an amino acid sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the amino acid sequence set forth in SEQ ID NO:9.

[0132] In some embodiments, the engineered CD47 protein comprises an amino acid sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the amino acid sequence set forth in SEQ ID NO:12.

[0133] In some embodiments, the engineered CD47 protein comprises an amino acid sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the amino acid sequence set forth in SEQ ID NO:10.

[0134] In some embodiments, the engineered CD47 protein comprises an amino acid sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the amino acid sequence set forth in SEQ ID NO:11.

[0135] In some embodiments, the engineered CD47 protein is a transmembrane protein. A transmembrane protein is an integral membrane protein that spans the entire cell membrane and has both an intracellular and an extracellular portion. As used herein, the "intracellular portion," if present in the molecule, can include the CD47 intracellular domain and the intracellular junction. As used herein, the "extracellular portion," if present in the molecule, can include the CD47 extracellular domain and the extracellular junction.

[0136] As used herein, wild-type human CD47 extracellular domain refers to any extracellular domain of wild-type human CD47 protein isoform. Wild-type human CD47 transmembrane domain refers to any transmembrane domain of wild-type human CD47 protein isoform. Wild-type human CD47 intracellular domain refers to any intracellular domain of wild-type human CD47 protein isoform.

[0137] In some embodiments, the engineered CD47 protein is an engineered human CD47 protein, an engineered humanized CD47 protein, or an engineered partially humanized CD47 protein.

[0138] As used herein, "humanized" or "humanization" means that the amino acid sequence of an engineered CD47 protein is modified to reduce its immunogenicity in humans. As used herein, "partially humanized" or "partially humanized" means that a portion of the amino acid sequence of an engineered CD47 protein is modified to reduce the immunogenicity of the engineered CD47 protein in humans. For example, in some embodiments, the extracellular domain of an engineered CD47 protein is modified to reduce the immunogenicity of the engineered CD47 protein in humans. Humanization is typically achieved by modifying a protein sequence from a non-human source to increase its similarity to its counterpart protein naturally produced in humans. Two main approaches have been used to humanize proteins: rational design and experimental methods. Rational design methods feature protein structure modeling, which allows several variants of a protein to be generated and their binding or any other properties of interest to be evaluated. In contrast to rational design methods, experimental methods do not require structural information about the protein. They are based on the generation of large combinatorial libraries and the selection of variants of interest by enrichment techniques, such as phage, ribosome, or yeast display, or high-throughput screening techniques. These methods are based on selection rather than estimation of the effect of mutations on protein structure. For example, in some embodiments, humanizing an engineered CD47 protein involves grafting the SIRPα-binding region of the engineered CD47 protein onto a human CD47 protein. In other embodiments, humanizing an engineered CD47 protein involves introducing one or more point mutations into the engineered CD47 protein such that one or more residue(s) in the engineered CD47 protein are substituted with the corresponding residue in the human CD47 protein.

[0139] In some embodiments, the engineered protein of the present disclosure comprises a SIRPα interaction motif, which comprises a SIRPα antibody. In some embodiments, the SIRPα antibody is selected from Table 3. [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5] [Table 3-6] [Table 3-7] [Table 3-8]

[0140] Glycosylation Human CD47 protein is glycosylated. Protein glycosylation involves the covalent attachment of glycans (also called carbohydrates, saccharides, or sugars) to proteins. Based on the amino acid side chain atom to which the glycan is attached, most protein glycosylation falls into two categories: N-linked glycosylation and O-linked glycosylation. In N-linked glycosylation, the glycan is attached to the side chain nitrogen atom of an asparagine residue in the conserved consensus sequence Asn-Xaa-Ser / Thr (Xaa≠Pro), while in O-linked glycosylation, the glycan is attached to the side chain oxygen atom of a hydroxyl amino acid, primarily serine and threonine residues.

[0141] The IgV domain of wild-type human CD47 protein is N-glycosylated and modified with O-linked glycosaminoglycans. Human CD47 protein can be expressed as a proteoglycan with a molecular weight of over 250 kDa, carrying both heparan and chondroitin sulfate glycosaminoglycan (GAG) chains at Ser64 and Ser79 (Kaur et al., J. Biological Chemistry, 2011). Heparan sulfate (HSGAG) and chondroitin sulfate (CSGAG) are synthesized in the Golgi apparatus, where the protein core, produced in the rough endoplasmic reticulum, is post-translationally modified by O-linked glycosylation by glycosyltransferases to form proteoglycans. Additionally, N-linked glycosylation has been identified at four of the five potential modification sites (N16, N32, N55, and N93) in the human CD47 protein (Hatherley et al., Cell, 2008). Amino acid numbering in this paragraph is based on SEQ ID NO: 3 (i.e., mature, full-length wild-type CD47).

[0142] In some embodiments, the engineered CD47 protein contains fewer glycosylation modification sites compared to wild-type human CD47 protein. A glycosylation modification site refers to a sequence of consecutive amino acids in a protein that can function as a glycan attachment site. A glycosylation modification site is also referred to as a sequon. In some embodiments, one or more amino acid(s) within a glycosaminoglycan modification site of the wild-type human CD47 protein are deleted or substituted in the engineered CD47 protein. In some embodiments, the engineered CD47 protein has 0, 1, 2, 3, 4, 5, or 6 glycosylation site(s).

[0143] In some embodiments, the engineered CD47 protein contains fewer glycosylation modifications compared to wild-type human CD47 protein. Glycosylation modifications include, but are not limited to, N-glycosylation, O-glycosylation, phosphoserine glycosylation, and C-glycosylation. In some embodiments, the engineered CD47 protein has 0, 1, 2, 3, 4, or 5 glycosylation modification(s).

[0144] In some embodiments, the engineered CD47 protein contains fewer glycosaminoglycan modification sites compared to wild-type human CD47 protein. A glycosaminoglycan modification site refers to a sequence of consecutive amino acids in a protein that can function as a glycosaminoglycan binding site. In some embodiments, one or more amino acids within a glycosaminoglycan modification site in the wild-type human CD47 protein are deleted or substituted in the engineered CD47 protein. In some embodiments, the engineered CD47 protein has zero or one glycosaminoglycan modification site.

[0145] In some embodiments, the engineered CD47 protein comprises fewer glycosaminoglycan chains compared to wild-type human CD47 protein. Glycosaminoglycan chains include, but are not limited to, heparan sulfate (HSGAG), chondroitin sulfate (CSGAG), keratan sulfate, and hyaluronic acid. In some embodiments, the engineered CD47 protein has zero or one glycosaminoglycan side chain.

[0146] In some embodiments, the engineered CD47 protein comprises fewer than two heparan and / or chondroitin sulfate glycosaminoglycan modification sites. In some embodiments, one or more amino acid(s) within a glycosaminoglycan modification site of a wild-type human CD47 protein are deleted or substituted in the engineered CD47 protein. In some embodiments, the engineered CD47 protein comprises one heparan and / or chondroitin sulfate glycosaminoglycan modification site. In some embodiments, the engineered CD47 protein comprises no heparan and / or chondroitin sulfate glycosaminoglycan modification sites.

[0147] In some embodiments, the engineered CD47 protein comprises fewer than two heparan and / or chondroitin sulfate glycosaminoglycan chains, hi some embodiments, the engineered CD47 protein has zero or one heparan and / or chondroitin sulfate glycosaminoglycan chains.

[0148] In some embodiments, the engineered CD47 protein contains fewer N-linked glycosylation sites compared to wild-type human CD47 protein. An N-linked glycosylation site is a sequence of consecutive amino acids in a protein that can function as an attachment site for saccharides, particularly N-glycans. In some embodiments, the engineered CD47 protein has 0, 1, 2, 3, or 4 N-linked glycosylation site(s).

[0149] In some embodiments, the engineered CD47 protein comprises fewer N-linked glycosylation modifications compared to wild-type human CD47 protein, hi some embodiments, the engineered CD47 protein has 0, 1, 2, or 3 N-linked glycosylation modification(s).

[0150] Biological activity of engineered CD47 proteins In some embodiments, the engineered CD47 protein is functionally equivalent to a wild-type human CD47 protein. As used herein, "functionally equivalent" refers to having at least one type of biological activity of the wild-type human CD47 protein. The type of biological activity of the wild-type human CD47 protein includes, but is not limited to, the ability to interact with TSP-1, integrins, another CD47 protein, or SIRPα. Preferably, the engineered CD47 protein can bind to SIRPα.

[0151] Interaction with TSP-1 The major secreted ligand for CD47 is thrombospondin-1 (TSP-1). TSP-1 is a homotrimeric glycoprotein whose C-terminal domain mediates binding to CD47 (Isenberg et al., 2009). At least two additional members of the thrombospondin family bind to CD47, albeit with lower affinity. TSP-1 is a typical member of the thrombospondin family of extracellular matrix glycoproteins involved in regulating cell motility, proliferation, and differentiation. The extracellular IgV domain of CD47 is the receptor for the C-terminal cell-binding domain (CBD) of TSP-1. Mutagenesis studies have established that heparan sulfate modification of CD47 is required for the high-affinity interaction of TSP-1 with CD47 (Kaur et al., 2011).

[0152] In some embodiments, the engineered CD47 protein lacks one or more thrombospondin-1 binding site(s) compared to wild-type human CD47 protein. In some embodiments, one or more amino acids within the TSP-1 site of wild-type human CD47 protein are deleted or substituted in the engineered CD47 protein. In some embodiments, the engineered CD47 protein lacking one or more TSP-1 binding sites is not glycosylated with one or more heparan sulfates.

[0153] In some embodiments, the engineered CD47 protein binds to TSP-1 with lower affinity compared to wild-type human CD47 protein. In some embodiments, the engineered CD47 protein binds to TSP-1 with a KD greater than about 0.1 μM, 0.2 μM, 0.3 μM, 0.4 μM, 0.5 μM, 0.6 μM, 0.7 μM, 0.8 μM, 0.9 μM, 1 μM, 2 μM, 3 μM, 4 μM, 5 μM, 6 μM, 7 μM, 8 μM, 9 μM, 10 μM, 20 μM, 30 μM, 40 μM, 50 μM, 60 μM, 70 μM, 80 μM, 90 μM, or 100 μM. In some embodiments, the engineered CD47 protein cannot bind to TSP-1.

[0154] Interaction with integrins Early studies of CD47 were based on the use of monoclonal antibodies (mAbs) raised against CD47 protein purified from placenta. These studies demonstrated a role for CD47 in enhancing IgG-mediated phagocytic responses in the presence of RGD-containing ligands, such as fibronectin, fibrinogen, vitronectin, or collagen type IV. The same mAb was also found to inhibit neutrophil transendothelial migration stimulated by interleukin 8 (IL-8) or the bacterial peptide N-formyl-methionyl-leucyl-phenylalanine (f-Met-Leu-Phe), and to inhibit neutrophil migration across endothelial cells stimulated with tumor necrosis factor α (TNFα). These studies revealed the importance of CD47 on both neutrophils and endothelial cells. The generation of other anti-CD47 mAbs raised against epithelial membrane preparations demonstrated that CD47 is present in the basolateral membrane of epithelial cell monolayers, that mAbs blocking CD47 on either neutrophils or epithelial cells delay neutrophil transepithelial migration, and that efficient neutrophil chemotaxis correlates with increased neutrophil cell surface CD47 expression. The basement membrane protein entactin, which contains an RGD sequence, was also found to stimulate neutrophil adhesion and chemotaxis in vitro in a CD47-dependent manner. The generation of CD47-deficient mice further demonstrated the importance of this protein in regulating the neutrophil inflammatory response by showing increased susceptibility to bacterial infection due to delayed neutrophil accumulation during bacterial peritonitis. CD47-deficient neutrophils also exhibit severe impairments in RGD-stimulated neutrophil adhesion, phagocytosis, and respiratory burst. α-antibody binding to vitronectin, an extracellular matrix protein, was also found to be involved in the regulation of neutrophil inflammatory responses. v Regarding β3 integrin-mediated cell responses, CD47 binds α3 to vitronectin-coated beads. v β3-mediated binding to vitronectin-coated surfaces, but not to α v It was found that CD47 is not required for β3-mediated adhesion. v In addition to the original association with β3 integrin, integrins α2β1 and αII on platelets bIt has also been shown to interact with and regulate β3, α2β1 integrin on smooth muscle cells, α4β1 integrin on sickle cells and B lymphocytes, α6β1 integrin on microglia, and α5 integrin on chondrocytes.

[0155] In some embodiments, the engineered CD47 protein lacks one or more integrin binding site(s) compared to the wild-type human CD47 protein, hi some embodiments, one or more amino acid(s) within an integrin binding site of the wild-type human CD47 protein are deleted or substituted in the engineered CD47 protein.

[0156] In some embodiments, the engineered CD47 protein binds to integrins with lower affinity compared to wild-type human CD47 protein. In some embodiments, the engineered CD47 protein binds to integrins with a KD greater than about 0.1 μM, 0.2 μM, 0.3 μM, 0.4 μM, 0.5 μM, 0.6 μM, 0.7 μM, 0.8 μM, 0.9 μM, 1 μM, 2 μM, 3 μM, 4 μM, 5 μM, 6 μM, 7 μM, 8 μM, 9 μM, 10 μM, 20 μM, 30 μM, 40 μM, 50 μM, 60 μM, 70 μM, 80 μM, 90 μM, or 100 μM. In some embodiments, the engineered CD47 protein is unable to bind to integrins.

[0157] In some embodiments, the integrin is α v β3 integrin, αII b The integrin is selected from the group consisting of β3 integrin, α2β1 integrin, α4β1 integrin, α6β1 integrin, and α5 integrin.

[0158] Interaction with SIRP proteins The signal-regulatory protein (SIRP) family includes three members, of which SIRPα and SIRPγ are known CD47 receptors. SIRP proteins belong to the Ig family of cell surface glycoproteins, and the first member to be identified was SIRPα (also known as SHPS-1, CD172a, BIT, MFR, or P84). SIRPα is highly expressed in myeloid and neuronal cells as well as endothelial cells and fibroblasts. It has three extracellular Ig-like domains: one distal IgV-like domain and two juxtamembrane IgC-like domains. In addition, an alternatively spliced ​​form containing only one IgV domain has also been reported. SIRPα contains two immunoreceptor tyrosine-based inhibitory motifs (ITIMs) in its intracellular tail, which, upon phosphorylation, can bind to the Src homology 2 (SH2) domain-containing protein tyrosine phosphatases SHP-1 and SHP-2. Additional cytoplasmic binding partners of SIRPα are the adaptor molecules 55 kDa homolog Src kinase-associated protein / SKAP2 (SKAP55hom / R), Fyn-binding protein / 130 kDa SLP-76-related phosphoprotein (FYB / SLAP-130), and the tyrosine kinase PYK2. SIRPα is also a substrate for the kinase activity of the insulin, EGF, and bPDGF receptors. Overexpression of SIRPα in fibroblasts reduces proliferation and other downstream events in response to insulin, EGF, and bPDGF. Furthermore, because SIRPα constitutively associates with c-fms, the receptor for M-CSF, overexpression of SIRPα partially reverses the v-fms phenotype.

[0159] CD47 is a ligand for SIRPα. Glycosylation of CD47 or SIRPα does not appear to be required for their interaction, but the level of N-glycosylation of SIRPα influences the interaction, such that excessive glycosylation reduces CD47 binding. Cys in the CD47 IgV domain 33 and Cys in the CD47 transmembrane domain 263The long-range disulfide bond between is also important for establishing the configuration of the CD47 IgV domain that enhances binding to SIRPα. Amino acid numbering in this paragraph is based on SEQ ID NO: 3 (i.e., the mature, full-length wild-type CD47 protein).

[0160] The structures of CD47 and the CD47 / SIRPα complex have been elucidated (Hatherley et al., 2008). Two β-strands, corresponding to amino acids 92-100 and 103-113 of SEQ ID NO: 3, were identified as central to the CD47 / SIRPα interaction. Amino acids 97 (Glu), 99 (Thr), 100 (Glu), 103 (Arg), 104 (Glu), and 106 (Glu) of SEQ ID NO: 3 were identified as contact residues in the CD47 / SIRPα interaction, which are involved in the binding affinity of CD47 to SIRPα (Hatherley et al., 2008). In a preferred embodiment, the two β-strands and their six contact residues are retained in the engineered CD47 proteins disclosed herein to maintain SIRPα-binding ability.

[0161] In some embodiments, the engineered CD47 protein comprises at least one SIRPα-interacting motif in its extracellular domain. In some embodiments, amino acids corresponding to amino acids 97, 99, 100, 103, 104, and 106 of SEQ ID NO: 3 are retained in the engineered CD47 protein. In some embodiments, the two beta strands are retained in the engineered CD47 protein.

[0162] In some embodiments, the engineered CD47 protein comprises a disulfide bond between a cysteine ​​within the human CD47 extracellular domain or portion thereof and a cysteine ​​within or between the human CD47 transmembrane domain(s). In some embodiments, the two cysteines are Cys33 in the extracellular domain and Cys263 in the transmembrane domain, where numbering is based on SEQ ID NO:3.

[0163] In some embodiments, the engineered CD47 protein is capable of binding to SIRPα. In some embodiments, the engineered CD47 protein is capable of binding to SIRPα with a binding affinity similar to that of wild-type human CD47 protein. In some embodiments, the engineered CD47 protein binds to SIRPα with a KD of less than about 0.01 μM, 0.02 μM, 0.03 μM, 0.04 μM, 0.05 μM, 0.06 μM, 0.07 μM, 0.08 μM, 0.09 μM, 0.1 μM, 0.2 μM, 0.3 μM, 0.4 μM, 0.5 μM, 0.6 μM, 0.7 μM, 0.8 μM, 0.9 μM, 1 μM, 2 μM, 3 μM, 4 μM, or 5 μM. In some embodiments, the engineered CD47 protein is capable of binding to SIRPα with a higher binding affinity than wild-type human CD47 protein.

[0164] Direct binding studies have shown that TSP-1 inhibits the binding of SIRPα to cells expressing CD47 (Isenberg et al., 2009). This data is consistent with competitive binding of TSP-1 and SIRPα to a single site on CD47, steric inhibition of binding to a distinct but proximal site, or allosteric inhibition. 64 Glycosylation at Ser is required for TSP-1 binding, but not for SIRPα binding (Soto-Pantoja et al., 2015). 64 An engineered CD47 protein lacking glycosylation at SIRPα has enhanced SIRPα-binding ability due to abrogation of TSP-1 binding.

[0165] CD47 / SIRPα interactions regulate numerous cell-cell interactions in numerous body systems, including the immune system. In the immune system, CD47 / SIRPα interactions regulate lymphocyte homeostasis, dendritic cell (DC) maturation and activation, the proper localization of specific DC subsets in secondary lymphoid organs, and cell transmigration. CD47 / SIRPα interactions also regulate cells of the nervous system. The interaction between these two proteins also plays an important role in bone remodeling. Cellular responses regulated by CD47 / SIRPα interactions often depend on bidirectional signaling through both receptors.

[0166] CD47 on host cells can function as a "marker of self" and regulate phagocytosis by binding to SIRPα on the surface of circulating immune cells and transmitting an inhibitory "don't kill me" signal. As disclosed above, SIRPα encodes an Ig superfamily receptor expressed on the surface of macrophages and dendritic cells, and its cytoplasmic region contains an immunoreceptor tyrosine-based inhibitory motif (ITIM), which can trigger a cascade to inhibit phagocytosis. CD47-SIRPα binding results in the phosphorylation of the ITIM on SIRPα, which triggers the recruitment of SHP1 and SHP2 (Src homologous phosphatases). These phosphatases then inhibit the accumulation of myosin II at the phagocytic synapse, thereby preventing engulfment (Fujioka et al., 1996). The engulfment of target cells by macrophages is ultimately regulated by the balance of activating signals (FcγR, CRT, LRP-1) and inhibitory signals (SIRPα-CD47). Increased CD47 expression may help cells avoid immune surveillance and subsequent destruction. Increased CD47 expression may help cells avoid killing by innate immune cells.

[0167] In some embodiments, the engineered CD47 protein is an immune tolerance inducer. As used herein, an immune tolerance inducer is an agent that induces immune tolerance in the presence of pathological or undesired activation of a normal immune response. This can occur, for example, when a patient develops an immune response to donor antigens after undergoing allogeneic transplantation or allogeneic cell therapy, or when the body responds inappropriately to self-antigens involved in autoimmune disease. In some embodiments, "immune tolerance inducers" include hypoimmunity factors, complement inhibitors, and other factors that modulate or affect the ability of cells to be recognized by the host or recipient subject's immune system upon administration, transplantation, or engraftment. In some embodiments, the immune tolerance inducer is genetically modified to provide additional functionality.

[0168] In some embodiments, the engineered CD47 protein can inhibit phagocytosis, release of cytotoxic substances, and / or other mechanisms of cell-mediated killing.

[0169] Interaction between CD47 molecules CD47 has also been shown to mediate cell-cell adhesion interactions in the absence of any known CD47 ligands. This cell-cell adhesion, which requires CD47 but not any of its known ligands, suggests that homotypic binding can also occur between the IgV domains of CD47 on opposing cells (Rebres et al., 2005). This interaction may require an unknown trypsin-sensitive protein (X) to mediate cell-cell adhesion, but it should be considered that this cell-cell interaction and the homotypic binding of proteolytically shed CD47 IgV domains (Maile et al., 2010) or exosomal CD47 (Kaur et al., 2014) to cell-surface CD47 could induce CD47 signaling. However, direct evidence of CD47-CD47 binding and signaling mediated by CD47 homotypic binding is lacking. In some embodiments, the engineered CD47 protein is unable to interact with another CD47 molecule.

[0170] III. Polynucleotides In another aspect, the present disclosure provides a polynucleotide encoding an engineered CD47 protein disclosed herein.

[0171] Polynucleotides encoding the engineered CD47 proteins disclosed herein can be obtained by methods known in the art. For example, polynucleotides can be obtained from cloned DNA (e.g., from a DNA library), by chemical synthesis, by cDNA cloning, or by cloning genomic DNA or fragments thereof purified from a cell of interest. When polynucleotides are produced by recombinant means, any known method for identifying nucleic acids encoding a gene of interest can be used. Any method available in the art can be used to obtain full-length (i.e., containing the entire coding region) cDNA or genomic DNA encoding a human CD47 protein of interest from a cell or tissue source. Modified or variant polynucleotides, including truncated forms of CD47 as provided herein, can be developed from wild-type polynucleotides using standard recombinant DNA methods. Polynucleotides can be cloned or isolated using any available method known in the art for cloning and isolating nucleic acid molecules. Such methods include PCR amplification of nucleic acids and screening of libraries, such as nucleic acid hybridization screening, antibody-based screening, and activity-based screening.

[0172] Polynucleotide amplification methods, including, for example, polymerase chain reaction (PCR), can be used to isolate polynucleotides encoding proteins of interest. PCR can be performed using any method or procedure known in the art. An exemplary method includes the use of a Perkin-Elmer Cetus thermal cycler and Taq polymerase (Gene Amp). Nucleic acids containing a gene of interest can be used as source material, from which nucleic acid molecules encoding polypeptides of interest can be amplified. For example, DNA and mRNA preparations, cell extracts from appropriate sources (e.g., testis, prostate, breast), tissue extracts, liquid samples (e.g., blood, serum, saliva), and samples from healthy and / or diseased subjects can be used in amplification methods. Sources can be from any eukaryotic species, including, but not limited to, vertebrate, mammalian, human, porcine, bovine, feline, avian, equine, canine, and other primate sources. Nucleic acid libraries can also be used as source material. Primers can be designed to amplify polynucleotides of interest. For example, primers can be designed based on the expressed sequence from which the polynucleotide of interest is generated. Primers can be designed based on reverse translation of the polypeptide amino acid sequence. Degenerate primers can be used for amplification, if necessary. Oligonucleotide primers that hybridize to the 3' and 5' terminal sequences of the sequence of interest can be used as primers for amplifying from a nucleic acid sample by PCR. Primers can be used to amplify the entire full-length polynucleotide or a truncated sequence thereof. The nucleic acid molecules generated by amplification can be sequenced to confirm that they encode the polypeptide of interest.

[0173] IV. Vector In another aspect, the present disclosure provides a vector comprising a polynucleotide encoding an engineered CD47 protein disclosed herein.

[0174] Any method known to those skilled in the art for inserting DNA fragments into a vector can be used to construct expression vectors containing the polynucleotides disclosed herein. These methods include in vitro recombinant DNA and synthetic techniques and in vivo (genetic) recombination. The polynucleotides disclosed herein can be operably linked to control sequences in the expression vector(s) to ensure expression of the engineered CD47 protein. Such control sequences include, but are not limited to, a leader or signal sequence, a promoter (e.g., a naturally associated or heterologous promoter), ribosomal binding site, enhancer or activator element, translation initiation and termination sequences, and transcription start and termination sequences; the control sequences are selected to be compatible with the host cell selected for expression of the engineered CD47 protein. Constitutive or inducible promoters known in the art are also contemplated. The promoter can be either a naturally occurring promoter, a hybrid promoter that combines elements of more than one promoter, or a synthetic promoter. The expression construct can be present on an episome, such as a plasmid, within the cell, or the expression construct can be inserted into a chromosome, e.g., a locus. In some embodiments, the expression vector contains a selectable marker gene to allow for selection of transformed host cells. Some embodiments include expression vectors comprising a nucleotide sequence encoding a variant polypeptide operably linked to at least one regulatory control sequence. As used herein, regulatory control sequences include promoters, enhancers, and other expression control elements. In certain embodiments, expression vectors are designed based on the choice of host cell to be transformed, the particular variant polypeptide desired to be expressed, the copy number of the vector, the ability to control that copy number, and / or the expression of any other proteins encoded by the vector, such as antibiotic markers.

[0175] Examples of suitable mammalian promoters include, for example, promoters derived from the following genes: elongation factor 1 alpha (EF1 alpha) promoter, CAG promoter, hamster ubiquitin / S27a promoter (WO97 / 15664), simian vacuolar virus 40 (SV40) early promoter, adenovirus major late promoter, mouse metallothionein-I promoter, Rous sarcoma virus (RSV) long terminal repeat region, mouse mammary tumor virus promoter (MMTV), Moloney murine leukemia virus long terminal repeat region, and human cytomegalovirus (CMV) early promoter. Examples of other heterologous mammalian promoters are actin, immunoglobulin, or heat shock promoter(s). In further embodiments, promoters for use in mammalian host cells can be obtained from the genomes of viruses such as polyoma virus, fowlpox virus (UK 2,211,504 published July 5, 1989), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, retroviruses, hepatitis B virus, and simian virus 40 (SV40). In further embodiments, heterologous mammalian promoters are used. Examples include the actin promoter, immunoglobulin promoters, and heat shock promoters. The early and late promoters of SV40 are conveniently obtained as an SV40 restriction fragment that also contains the SV40 viral origin of replication (Fiers et al., Nature 273:113-120 (1978)). The immediate early promoter of the human cytomegalovirus is conveniently obtained as a HindIII restriction fragment (Greenaway et al., Gene 18:355-360 (1982)). The foregoing references are incorporated by reference in their entireties.

[0176] In some embodiments, the vector is a pseudotyped, self-inactivating lentiviral vector carrying an exogenous polynucleotide. In some embodiments, the vector is a self-inactivating lentiviral vector carrying an exogenous polynucleotide that is pseudotyped with a vesicular stomatitis VSV-G envelope.

[0177] Vectors may include, but are not limited to, viral vectors and plasmid DNA. Viral vectors may include, but are not limited to, adenoviral vectors, lentiviral vectors, retroviral vectors, and adeno-associated viral vectors. Expression vectors usually contain a selectable marker, such as ampicillin resistance, hygromycin resistance, tetracycline resistance, kanamycin resistance, or neomycin resistance, to enable detection of cells transformed with the desired DNA sequence. Suitable vectors, promoters, and enhancer elements are known in the art, and many are commercially available for generating the subject recombinant constructs. In some embodiments, the vector is a polycistronic vector. In some embodiments, the vector is a bicistronic or tricistronic vector. Bicistronic or polycistronic expression vectors can contain (1) multiple promoters fused to each of the open reading frames; (2) the insertion of intergenic splicing signals; (3) fusions of genes whose expression is driven by a single promoter; and (4) the insertion of intergenic proteolytic cleavage sites (self-cleaving peptides) or intergenic internal ribosome entry sites (IRES).

[0178] Polycistronic vectors are used to co-express multiple genes in the same cell. Two strategies are most commonly used to construct polycistronic vectors. First, an internal ribosome entry site (IRES) element is typically used in bicistronic vectors. The IRES element, acting as an additional ribosome recruitment site, allows translation initiation from an internal region of the mRNA. This allows two proteins to be translated from a single mRNA. IRES elements are very large (usually 500-600 bp) (Pelletier et al., 1988; Jang et al., 1988). The engineered CD47 protein disclosed herein has a smaller size than wild-type full-length human CD47 and can therefore be used with IRES elements in polycistronic vectors with limited packaging capacity.

[0179] The second strategy is based on "self-cleaving" 2A peptides. First discovered in picornaviruses, these peptides are short (approximately 20 amino acids) and generate equimolar concentrations of multiple genes from the same mRNA. The term "self-cleaving" is not entirely accurate, as these peptides are thought to function by causing the ribosome to skip peptide bond synthesis at the C-terminus of the 2A element, thereby creating a separation between the end of the 2A sequence and the next peptide downstream (Kim et al., 2011). The "cleavage" occurs between the glycine and proline residues found at the C-terminus. Thus, the upstream cistron has several additional residues added to its end, while the downstream cistron starts with a proline.

[0180] In some embodiments, the polycistronic vector used in the context of the present disclosure is a polycistronic vector described in US Application Nos. 63 / 270,956 and 63 / 222,954.

[0181] In some embodiments, a vector herein refers to a nucleic acid molecule that can introduce or transport another nucleic acid molecule, for example, into a cell or the genome of a cell. The nucleic acid to be introduced is usually linked, e.g., inserted, into the vector nucleic acid molecule. The vector may contain a sequence that induces autonomous replication in the cell, or may contain a sequence sufficient to allow integration into the host cell DNA. Useful vectors include, for example, plasmids (e.g., DNA plasmids or RNA plasmids), transposons, cosmids, bacterial artificial chromosomes, and viral vectors. Useful viral vectors include, for example, replication-defective retroviruses and lentiviruses. Non-viral vectors may require a delivery vehicle to facilitate entry of the nucleic acid molecule into the cell.

[0182] Viral vectors may comprise nucleic acid molecules that typically contain virally derived nucleic acid elements that facilitate the introduction of the nucleic acid molecule or its integration into a cell's genome or into a viral particle that mediates the introduction of the nucleic acid. Viral particles typically contain, in addition to the nucleic acid(s), various viral components and, optionally, host cell components. Viral vectors may, for example, comprise a virus or viral particle capable of introducing a nucleic acid into a cell or transferring the introduced nucleic acid (e.g., as naked DNA). Viral vectors and transfer plasmids may comprise structural and / or functional genetic elements primarily derived from a virus. Retroviral vectors may comprise viral vectors or plasmids that contain structural and functional genetic elements, or portions thereof, primarily derived from a retrovirus.

[0183] In some vectors described herein, at least a portion of one or more protein coding regions that contribute to or are essential for replication may be absent compared to the corresponding wild-type virus, resulting in the viral vector being replication-deficient. In some embodiments, the vector is capable of transducing target non-dividing host cells and / or integrating its genome into the host genome.

[0184] In some embodiments, the retroviral nucleic acid comprises one or more of the following (e.g., all of the following): a 5' promoter (e.g., for controlling expression of all packaged RNAs), a 5' LTR (e.g., comprising a U5 containing R (polyadenylation tail signal) and / or a primer activation signal), a primer binding site, a psi packaging signal, an RRE element for nuclear export, a promoter immediately upstream of the transgene to control expression of the transgene, the transgene (or other exogenous agent element), a polypurine tract, and a 3' LTR (e.g., comprising a mutant U3, R, and U5). In some embodiments, the retroviral nucleic acid further comprises one or more of a cPPT, a WPRE, and / or an insulator element (e.g., as described in Browning et al., "Insulators to Improve the Safety of Retroviral Vectors for HIV Gene Therapy," Biomedicines, 4(1):4 (2016)).

[0185] Retroviruses typically replicate by reverse transcription of their genomic RNA into a linear, double-stranded DNA copy, which then covalently integrates into the host genome. The structure of wild-type retroviral genomes often includes a 5' long terminal repeat (LTR) and a 3' long terminal repeat (LTR), between which or within which reside packaging signals that enable genome packaging, primer binding sites, integration sites that allow integration into the host cell genome, and the gag, pol, and env genes that encode packaging components that promote viral particle assembly. More complex retroviruses possess additional features, such as the HIV rev and RRE sequences that enable efficient export of integrated proviral RNA transcripts from the nucleus to the cytoplasm of infected target cells. In proviruses, viral genes are flanked on both sides by regions called long terminal repeats (LTRs). LTRs are involved in proviral integration and transcription. LTRs also function as enhancer-promoter sequences, controlling viral gene expression. Retroviral RNA encapsidation occurs via the psi sequence present at the 5' end of the viral genome.

[0186] The LTR itself is usually a similar (e.g., identical) sequence that can be divided into three elements designated U3, R, and U5. U3 is derived from a sequence unique to the 3' end of the RNA. R is derived from a sequence repeated at both ends of the RNA, and U5 is derived from a sequence unique to the 5' end of the RNA. The sizes of the three elements can vary greatly between different retroviruses.

[0187] In viral genomes, the transcription initiation site is usually located at the boundary between U3 and R of one LTR, and the poly(A) addition (termination) site is located at the boundary between R and U5 of the other LTR. U3 contains most of the transcriptional regulatory elements of the provirus, including the promoter and multiple enhancer sequences that respond to cellular and sometimes viral transcriptional activator proteins. Some retroviruses contain any one or more of the following genes that encode proteins involved in regulating gene expression: tot, rev, tax, and rex.

[0188] Regarding the structural genes gag, pol, and env, gag encodes the internal structural protein of the virus. The gag protein is proteolytically processed into the mature proteins MA (matrix), CA (capsid), and NC (nucleocapsid). The pol gene encodes reverse transcriptase (RT), including DNA polymerase, associated RNase H, and integrase (IN), which mediate genome replication. The env gene encodes the surface (SU) glycoprotein and transmembrane (TM) protein of the virion, which form a complex that interacts specifically with cellular receptor proteins. This interaction facilitates infection, for example, by fusion of the viral membrane with the cellular membrane.

[0189] In replication-defective retroviral vector genomes, gag, pol, and env may be absent or non-functional. The R regions at both ends of the RNA are usually repetitive sequences. U5 and U3 are unique sequences at the 5' and 3' ends of the RNA genome, respectively. Retroviruses may also contain additional genes encoding proteins other than gag, pol, and env. Examples of additional genes include one or more of vif, vpr, vpx, vpu, tat, rev, and nef (in HIV). EIAV has an additional gene S2 (among others).

[0190] Exemplary retroviruses suitable for use in certain embodiments include, but are not limited to, Moloney murine leukemia virus (M-MuLV), Moloney murine sarcoma virus (MoMSV), Harvey murine sarcoma virus (HaMuSV), mouse mammary tumor virus (MuMTV), gibbon ape leukemia virus (GaLV), feline leukemia virus (FLV), spumavirus, Friend murine leukemia virus, murine stem cell virus (MSCV), and Rous sarcoma virus (RSV), and human immunodeficiency virus (HIV).

[0191] In some embodiments, the retrovirus is a gamma retrovirus. In some embodiments, the retrovirus is an epsilon retrovirus. In some embodiments, the retrovirus is an alpha retrovirus. In some embodiments, the retrovirus is a beta retrovirus. In some embodiments, the retrovirus is a gamma retrovirus. In some embodiments, the retrovirus is a spumaretrovirus. In some embodiments, the retrovirus is an endogenous retrovirus. In some embodiments, the retrovirus is a lentivirus.

[0192] In some embodiments, the retroviral or lentiviral vector further comprises one or more insulator elements, such as those described in Browning et al., "Insulators to Improve the Safety of Retroviral Vectors for HIV Gene Therapy," Biomedicines, 4(1):4 (2016). In various embodiments, the vector comprises a promoter operably linked to a polynucleotide encoding an exogenous agent. The vector can have one or more LTRs, where any LTR comprises one or more modifications, e.g., one or more nucleotide substitutions, additions, or deletions. The vector can further comprise one or more auxiliary elements that increase transduction efficiency (e.g., cPPT / FLAP), viral packaging (e.g., Psi(Y) packaging signal, RRE), and / or other elements that increase exogenous gene expression (e.g., poly(A) sequences), and can optionally include a WPRE or HPRE. In some embodiments, the lentiviral nucleic acid includes, e.g., from 5' to 3', one or more, e.g., all of, the following: a promoter (e.g., CMV), an R sequence (e.g., including TAR), a U5 sequence (e.g., for integration), a PBS sequence (e.g., for reverse transcription), a DIS sequence (e.g., for genome dimerization), a psi packaging signal, a portion of a gag sequence, an RRE sequence (e.g., for nuclear export), a cPPT sequence (e.g., for nuclear import), a promoter for driving expression of an exogenous agent, a gene encoding the exogenous agent, a WPRE sequence (e.g., for efficient transgene expression), a PPT sequence (e.g., for reverse transcription), an R sequence (e.g., for polyadenylation and termination), and a U5 signal (e.g., for integration).

[0193] Exemplary lentiviruses include, but are not limited to, HIV (human immunodeficiency virus; including HIV types 1 and 2); Visna-Maedi virus (VMV); Caprine Arthritis-Encephalitis Virus (CAEV); Equine Infectious Anemia Virus (EIAV); Feline Immunodeficiency Virus (FIV); Bovine Immunodeficiency Virus (BIV); and Simian Immunodeficiency Virus (SIV). In some embodiments, an HIV-based vector backbone (i.e., HIV cis-acting sequence elements) is used. Lentiviral vectors can include viral vectors or plasmids that contain structural and functional genetic elements, or portions thereof, primarily derived from lentiviruses, including the long terminal repeats (LTRs).

[0194] In embodiments, lentiviral vectors (e.g., lentiviral expression vectors) can comprise lentiviral transfer plasmids (e.g., as naked DNA) or infectious lentiviral particles. It should be understood that with respect to elements such as cloning sites, promoters, regulatory elements, heterologous nucleic acids, etc., the sequences of these elements can be present in RNA form in lentiviral particles, or in DNA form in DNA plasmids.

[0195] In embodiments, a lentiviral vector is a vector that carries sufficient retroviral genetic information to enable packaging of an RNA genome into viral particles capable of infecting target cells in the presence of packaging components. Infection of target cells can involve reverse transcription and integration into the target cell genome. Recombinant lentiviral vectors (RLVs) typically carry non-viral coding sequences to be delivered to target cells by the vector. In embodiments, RLVs are incapable of independent replication to generate infectious retroviral particles within target cells. RLVs typically lack functional gag-pol and / or env genes and / or other genes involved in replication. Vectors can be designed as split-intron vectors, for example, as described in PCT Patent Application No. WO 99 / 15683, which is incorporated herein by reference in its entirety.

[0196] In some embodiments, lentiviral vectors comprise a minimal viral genome, e.g., viral vectors that have been genetically engineered to remove non-essential elements and retain essential elements to provide the functions required to infect, transduce, and deliver a nucleotide sequence of interest to a target host cell, e.g., as described in WO98 / 17815, which is incorporated herein by reference in its entirety.

[0197] A minimal lentiviral genome may comprise, for example, (5')R-U5-one or more first nucleotide sequences-U3-R(3'). However, the plasmid vector used to produce the lentiviral genome in the source cell may also comprise transcriptional control regulatory sequences operably linked to the lentiviral genome to direct transcription of the genome in the source cell. These regulatory sequences may include natural sequences associated with the transcribed retroviral sequence, such as the 5' U3 region, or they may comprise a heterologous promoter, such as another viral promoter, for example, the CMV promoter. Some lentiviral genomes contain additional sequences to promote efficient virus production. For example, in the case of HIV, rev and RRE sequences may be included.

[0198] V. Cell In another aspect, the present disclosure provides a cell comprising a polynucleotide encoding an engineered CD47 protein disclosed herein and / or a vector comprising a polynucleotide encoding an engineered CD47 protein disclosed herein.

[0199] In another aspect, the present disclosure provides cells comprising the engineered CD47 protein disclosed herein. In some embodiments, the engineered CD47 protein is introduced into the cell in the form of a nucleic acid molecule encoding the engineered CD47 protein. The process of introducing the nucleic acid molecule into the cell can be accomplished by any suitable technique. Suitable techniques include calcium phosphate or lipid-mediated transfection, electroporation, and transduction or infection using a viral vector. In some embodiments, the nucleic acid molecule comprises DNA. In some embodiments, the nucleic acid molecule comprises modified DNA. In some embodiments, the nucleic acid molecule comprises mRNA. In some embodiments, the nucleic acid molecule comprises modified mRNA.

[0200] In some embodiments, the engineered CD47 protein is delivered using, for example, viral transduction with a vector. In some embodiments, the vector is a pseudotyped, self-inactivating lentiviral vector carrying an exogenous polynucleotide. In some embodiments, the vector is a self-inactivating lentiviral vector carrying an exogenous polynucleotide pseudotyped with a vesicular stomatitis VSV-G envelope.

[0201] In some embodiments, the engineered CD47 protein is delivered using one or more gene editing systems. In some embodiments, the gene editing system is CRISPR / Cas. In some embodiments, the gene editing system is one or more of the CRISPR / Cas systems described herein. In some embodiments, the engineered CD47 protein is delivered using a transcription activator-like effector nuclease (TALEN) method. In some embodiments, the gene editing system is one or more of the TALEN methods described herein.

[0202] In some embodiments, the engineered CD47 protein is delivered using zinc finger nucleases (ZFNs). In some embodiments, the gene editing system is one or more of the ZFN methods described herein.

[0203] In some embodiments, the engineered CD47 protein is delivered using a meganuclease, hi some embodiments, the gene editing system is one or more of the meganuclease methods described herein.

[0204] In some embodiments, the cells are stem cells.

[0205] In some embodiments, the cells are pluripotent stem cells. Pluripotent stem cells are cells that have the ability to self-renew by division and to develop into the three major germ cell layers of the early embryo and therefore into all cells of the adult body, but not into extraembryonic tissues such as the placenta. Embryonic stem cells and induced pluripotent stem cells are pluripotent stem cells.

[0206] In some embodiments, the cells are embryonic stem cells (ESCs), which are pluripotent stem cells derived from the inner cell mass of the blastocyst, an early pre-implantation embryo.

[0207] In some embodiments, the cells are induced pluripotent stem cells (iPSCs), which are derived from adult somatic cells that have been genetically reprogrammed to an embryonic-like pluripotent state, allowing for the development of an unlimited source of any type of cell needed for therapeutic purposes.

[0208] As used herein, "pluripotent stem cells" have the ability to differentiate into any of the following three germ layers: endoderm (e.g., stomach wall, digestive tract, lung, etc.), mesoderm (e.g., muscle, bone, blood, urogenital tissue, etc.), or ectoderm (e.g., epidermal tissue and nervous system tissue). As used herein, the term "pluripotent stem cells" also encompasses induced pluripotent stem cells (iPSCs or iPS cells), or pluripotent stem cell types derived from non-pluripotent cells. In some embodiments, pluripotent stem cells are generated or produced from cells that are not pluripotent. In other words, pluripotent stem cells can be the direct or indirect progeny of non-pluripotent cells. Examples of parent cells include somatic cells that have been reprogrammed to induce a pluripotent, undifferentiated phenotype by various means. Such "iPS" or "iPSC" cells can be generated by inducing the expression of certain regulatory genes or by applying certain exogenous proteins. Methods for deriving iPS cells are known in the art and are further described below. See, e.g., Zhou et al., Stem Cells 27(11):2667-74(2009), Huangfu et al., Nature Biotechnol. 26 (7):795(2008), Woltjen et al., Nature 458(7239):766-770(2009), and Zhou et al., Cell Stem Cell 8:381-384(2009), each of which is incorporated herein by reference in its entirety. In some embodiments, "pluripotent stem cells," as used herein, also encompass mesenchymal stem cells (MSCs) and / or embryonic stem cells (ESCs).

[0209] In some embodiments, the cells are pancreatic islet cells. In some embodiments, the cells are primary pancreatic islet cells.

[0210] In some embodiments, the cells are differentiated from pluripotent stem cells. In some embodiments, the pluripotent stem cells are iPSCs or ESCs.

[0211] In some embodiments, the cell is a T cell. In some embodiments, the cell is a primary T cell. In some embodiments, the cell is a T cell comprising a chimeric antigen receptor (CAR), e.g., a T cell that comprises a polynucleotide encoding a CAR and / or that comprises or otherwise expresses a CAR from a polynucleotide. In some embodiments, the cell is a CAR-T cell. In some embodiments, the T cell is differentiated from a pluripotent stem cell. In some embodiments, the pluripotent stem cell is an iPSC or an ESC.

[0212] T cells are a type of lymphocyte. T cells are one of the white blood cells of the immune system and play a central role in adaptive immune responses. CAR-T cells are T cells genetically engineered to produce an artificial T cell receptor. Chimeric antigen receptors (CARs, also known as chimeric immune receptors, chimeric T cell receptors, or artificial T cell receptors) are receptor proteins genetically engineered to confer the ability to target specific proteins to T cells. These receptors are chimeric because they combine antigen-binding and T cell-activation functions into a single receptor. CAR-T cells can be both CD4+ and CD8+, and a 1:1 ratio of both cell types results in a synergistic antitumor effect. CAR-T cells can be derived from T cells in the patient's own blood (autologous) or from T cells from another healthy donor (allogeneic). T cells can be obtained from a number of sources, including, but not limited to, peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors. In certain embodiments, T cells can be obtained from a unit of blood drawn from a subject using any number of techniques known to those of skill in the art, such as sedimentation, e.g., FICOLL™ separation, antibody-conjugated bead-based methods, e.g., MACS™ separation (Miltenyi).

[0213] In some embodiments, the cells are selected from, but not limited to, cardiac cells, cardiac progenitor cells, neuronal cells, glial progenitor cells, endothelial cells, T cells, B cells, pancreatic islet cells, retinal pigment epithelial cells, hepatocytes, thyroid cells, skin cells, blood cells, plasma cells, platelets, kidney cells, epithelial cells, CAR-T cells, NK cells, and CAR-NK cells.

[0214] In some embodiments, the cells are primary cells. Primary cells are isolated directly from human or animal tissue using enzymatic or mechanical methods. Once isolated, they are placed in an artificial environment in a plastic or glass container supplemented with a special medium containing essential nutrients and growth factors to support growth. Primary cells can be of two types: adherent cells or suspension cells. Adherent cells require attachment to grow and are referred to as anchorage-dependent cells. Adherent cells are usually derived from organ tissues. Suspension cells do not require attachment to grow and are referred to as anchorage-independent cells. Most suspension cells are isolated from the blood system, but cells from some tissues, such as hepatocytes or intestinal cells, can also be used in suspension. While primary cells usually have a limited lifespan, they offer numerous advantages over cell lines. Primary cells allow researchers to study the donor, not just the cells. Several factors, such as age, medical history, race, and gender, can be considered when constructing an experimental model. There is an increasing trend towards personalized medicine, and such donor diversity and tissue complexity can be achieved using primary cells, but is difficult to recapitulate with cell lines, which are more systematic and uniform in nature and do not capture the actual diversity of living tissues.

[0215] In some embodiments, the cells are differentiated cells. Differentiated cells are cells that have undergone differentiation. They are mature cells that perform specialized functions. Some examples of differentiated cells are epithelial cells, skin fibroblasts, endothelial cells that line blood vessels, smooth muscle cells, liver cells, nerve cells, human cardiac muscle cells, etc. Typically, these cells have a unique morphology, metabolic activity, membrane potential, and responsiveness to signals that facilitate their function in a body tissue or organ.

[0216] Low immunogenic cells In some embodiments, the cells described herein are hypoimmunogenic cells. When used herein to characterize cells, the term "hypoimmunogenic" generally means that the cells are less susceptible to innate or adaptive immune rejection by a subject into which the cells are transplanted, e.g., the cells are less susceptible to allogeneic rejection by a subject into which the cells are transplanted. For example, in some embodiments, such hypoimmunogenic cells may be about 2.5%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97.5%, 99%, 100%, or any degree therebetween less susceptible to adaptive immune rejection by a subject into which the cells are transplanted, compared to cells of the same cell type that do not contain the modification. In some embodiments, genome editing techniques are used to regulate the expression of MHC1 and MHCII genes, thereby contributing to the creation of hypoimmunogenic cells. In some embodiments, the hypoimmunogenic cells avoid immune rejection in an MHC-mismatched allogeneic recipient. In some embodiments, differentiated cells generated from the hypoimmunogenic stem cells outlined herein avoid immune rejection when administered (e.g., transplanted or grafted) to an MHC-mismatched allogeneic recipient. In some embodiments, the hypoimmunogenic cells are protected from T cell-mediated adaptive immune rejection and / or innate immune cell-mediated rejection.Detailed descriptions of hypoimmunogenic cells, methods of making such cells, and methods of using such cells can be found in WO2016183041 filed May 9, 2015, WO2018132783 filed January 14, 2018, WO2018176390 filed March 20, 2018, WO2020018615 filed July 17, 2019, WO2020018620 filed July 31, 2020, and WO20200186390 filed July 17, 2020. No. 6,229,999, filed Aug. 1, 2019; US Pat. No. 6,229,999, filed Aug. 23, 2019; US Pat. No. 6,333,660, filed Aug. 27, 2020; and US Pat. No. 6,333,660, filed Jul. 15, 2020, the disclosures of which, including the Examples, sequence listing, and figures, are incorporated by reference herein in their entireties.

[0217] The low immunogenicity of cells can be determined by assessing the immunogenicity of the cells, such as their ability to induce adaptive and innate immune responses or to avoid eliciting such adaptive and innate immune responses. Such immune responses can be measured using assays understood by those skilled in the art. In some embodiments, immune response assays measure the effect of hypoimmunogenic cells on T cell proliferation, T cell activation, T cell killing, donor-specific antibody production, NK cell proliferation, NK cell activation, and macrophage activity. In some examples, hypoimmunogenic cells and their derivatives undergo reduced killing by T cells and / or NK cells when administered to a subject. In some examples, the cells and their derivatives exhibit reduced phagocytosis by macrophages compared to unmodified or wild-type cells. In some embodiments, hypoimmunogenic cells induce a reduced or attenuated immune response in a recipient subject compared to corresponding unmodified wild-type cells. In some embodiments, hypoimmunogenic cells are non-immunogenic or unable to induce an immune response in a recipient subject.

[0218] In some embodiments, expression of major histocompatibility (MHC) class I and MHC class II proteins is disrupted in cells. MHC class I and class II proteins play a role in the adaptive arm of the immune system. Both classes of proteins share the task of presenting peptides on the cell surface for recognition by T cells. Immunogenic peptide-MHC class I (pMHC1) complexes are presented on nucleated cells and recognized by cytotoxic CD8+ T cells. Meanwhile, presentation of peptide-MHC class II (pMHCII) by antigen-presenting cells (e.g., dendritic cells (DCs), macrophages, or B cells) can activate CD4+ T cells, thereby leading to the coordination and regulation of effector cells. In both cases, it is the clonotypic T cell receptor that interacts with a given pMHC complex, potentially resulting in the formation of persistent cell-to-cell contact and T cell activation.

[0219] In some embodiments, the cells described herein express reduced levels of MHC class I proteins compared to wild-type or control cells. In some embodiments, the cells express reduced levels of MHC class II proteins compared to wild-type or control cells. In some embodiments, the cells express reduced levels of both MHC class I and class II proteins compared to wild-type or control cells.

[0220] In some embodiments, the cells do not express any MHC class I proteins. In some embodiments, the cells do not express any MHC class II proteins. In some embodiments, the cells do not express any MHC class I and do not express any MHC class II proteins.

[0221] In some embodiments, the MHC proteins described herein are HLA proteins.

[0222] The "HLA" or "human leukocyte antigen" complex is a complex of genes encoding MHC proteins in humans. The cell surface proteins that make up the HLA complex are responsible for regulating the immune response to antigens. In humans, there are two MHC classes: class I and class II, or "HLA-I" and "HLA-II." HLA-I contains three proteins, HLA-A, HLA-B, and HLA-C, which present peptides from inside cells. Antigens presented by the HLA-I complex attract killer T cells (also known as CD8+ T cells or cytotoxic T cells). The HLA-I protein associates with beta-2 microglobulin (B2M). HLA-II contains five proteins, HLA-DP, HLA-DM, HLA-DOB, HLA-DQ, and HLA-DR, which present antigens from outside cells to T lymphocytes. The HLA-II protein associates with class II transactivator (CIITA). This stimulates CD4+ cells (also known as helper T cells). Although the term "HLA" usually indicates that the gene is of human origin, it should be understood that the use of either "MHC" or "HLA" is not intended to be limiting. Thus, with respect to mammalian cells, these terms may be used interchangeably herein.

[0223] In some embodiments, expression of MHC class II proteins is reduced by knocking out or reducing expression of CIITA. In some embodiments, expression of MHC II genes is regulated (e.g., reduced or eliminated) by targeting and modulating (e.g., reducing or eliminating) expression of class II transactivator (CIITA). In some embodiments, modulation is achieved using a CRISPR / Cas system. CIITA is a member of the LR family of proteins, or nucleotide-binding domain (NBD), leucine-rich repeat (LRR) family, and regulates MHC II transcription by associating with the MHC enhanceosome. In some embodiments, the polynucleotide sequence targeted for modulation is a variant of CIITA, a homolog of CIITA, or an ortholog of CIITA.

[0224] In some embodiments, reducing or eliminating the expression of CIITA reduces or eliminates the expression of one or more of the following MHC class II molecules: HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, and HLA-DR.

[0225] In some embodiments, the cells described herein comprise a genetic modification at a locus encoding a CIITA protein. In other words, the cells comprise a genetic modification at the CIITA locus. In some examples, the nucleotide sequence encoding the CIITA protein is set forth in RefSeq No. NM_000246.4 and NCBI GenBank No. U18259. In some examples, the CIITA locus is set forth in NCBI GenBank No. 4261. In certain examples, the amino acid sequence of CIITA is set forth as NCBI GenBank No. AAA88861.1. Additional descriptions of the CIITA protein and locus can be found in Uniprot No. P33076, HGNC Reference No. 7067, and OMIM Reference No. 600005.

[0226] In some embodiments, the hypoimmunogenic cells outlined herein comprise a genetic modification targeting the CIITA gene. In some embodiments, the genetic modification targeting the CIITA gene is generated by a polynucleotide encoding a rare-cutting endonuclease, including a Cas protein, or a Cas protein, and at least one guide ribonucleic acid sequence for specifically targeting the CIITA gene. In some embodiments, the at least one guide ribonucleic acid sequence for specifically targeting the CIITA gene is selected from the group consisting of SEQ ID NOs: 5184-36352 in Table 12 of WO2016183041 (which is incorporated herein by reference). In some embodiments, the cells have a reduced ability to induce an innate and / or adaptive immune response in a recipient subject. In some embodiments, an exogenous nucleic acid encoding a polypeptide disclosed herein (e.g., a chimeric antigen receptor, CD47, or another immune tolerance inducer disclosed herein) is inserted into the CIITA gene.

[0227] Assays for testing whether the CIITA gene has been inactivated are known and described herein. In some embodiments, the resulting genetic modification of the CIITA gene can be confirmed by PCR, and the reduction in HLA-II expression can be confirmed by FACS analysis. In another embodiment, CIITA protein expression is detected using Western blots of cell lysates probed with an antibody against the CIITA protein. In another embodiment, reverse transcriptase polymerase chain reaction (RT-PCR) is used to confirm the presence of a genetic inactivation modification. In some embodiments, the exogenous polynucleotide is inserted into at least one allele of the cell by viral transduction, for example, using a vector. In some embodiments, the vector is a pseudotyped, self-inactivating lentiviral vector carrying the exogenous polynucleotide. In some embodiments, the vector is a self-inactivating lentiviral vector carrying the exogenous polynucleotide, pseudotyped with the vesicular stomatitis VSV-G envelope. In some embodiments, the exogenous polynucleotide is inserted into at least one allele of the cell using viral transduction. In some embodiments, the exogenous polynucleotide is inserted into at least one allele of the cell using a lentiviral-based viral vector.

[0228] In some embodiments, expression of MHC class I proteins is reduced by knocking out or reducing expression of B2M. In some embodiments, expression of the MHCI gene is modulated (e.g., reduced or eliminated) by targeting and modulating (e.g., reducing or eliminating) expression of the accessory chain B2M. In some embodiments, modulation is achieved using a CRISPR / Cas system. Modulating (e.g., reducing or eliminating) expression of B2M blocks surface trafficking of MHCI molecules, rendering the cells hypoimmunogenic. In some embodiments, the cells have a reduced ability to elicit an innate and / or adaptive immune response in a recipient subject.

[0229] In some embodiments, the polynucleotide sequence targeted for modulation is a variant of B2M, a homolog of B2M, or an ortholog of B2M.

[0230] In some embodiments, reducing or eliminating the expression of B2M reduces or eliminates the expression of one or more of the following MHCI molecules: HLA-A, HLA-B, and HLA-C.

[0231] In some embodiments, the cells described herein comprise a genetic modification at a locus encoding a B2M protein. In other words, the cells comprise a genetic modification at the B2M locus. In some examples, the nucleotide sequence encoding the B2M protein is set forth in RefSeq No. NM_004048.4 and GenBank No. AB021288.1. In some examples, the B2M locus is set forth in NCBI Gene No. 567. In certain examples, the amino acid sequence of B2M is set forth in NCBI GenBank No. BAA35182.1. Additional description of the B2M protein and locus can be found in Uniprot No. P61769, HGNC Reference No. 914, and OMIM Reference No. 109700.

[0232] In some embodiments, the hypoimmunogenic cells outlined herein comprise a genetic modification targeting the B2M gene. In some embodiments, the genetic modification targeting the B2M gene is generated by a polynucleotide encoding a rare-cutting endonuclease, including a Cas protein, or a Cas protein, and at least one guide ribonucleic acid sequence for specifically targeting the B2M gene. In some embodiments, the at least one guide ribonucleic acid sequence for specifically targeting the B2M gene is selected from the group consisting of SEQ ID NOs: 81240-85644 in Table 15 of WO2016 / 183041 (which is incorporated herein by reference). In some embodiments, an exogenous nucleic acid encoding a polypeptide disclosed herein (e.g., a chimeric antigen receptor, CD47, or another immune tolerance-inducing factor disclosed herein) is inserted into the B2M gene. In some embodiments, the exogenous polynucleotide is inserted into at least one allele of the cell using viral transduction, e.g., using a vector. In some embodiments, the vector is a pseudotyped, self-inactivating lentiviral vector carrying an exogenous polynucleotide. In some embodiments, the vector is a self-inactivating lentiviral vector carrying an exogenous polynucleotide, pseudotyped with a vesicular stomatitis VSV-G envelope. In some embodiments, the exogenous polynucleotide is inserted into at least one allele of the cell using viral transduction. In some embodiments, the exogenous polynucleotide is inserted into at least one allele of the cell using a lentiviral-based viral vector.

[0233] Assays for testing whether the B2M gene has been inactivated are known and described herein. In some embodiments, the resulting genetic modification of the B2M gene can be confirmed by PCR, and the reduction in HLA-I expression can be confirmed by FACS analysis. In another embodiment, B2M protein expression is detected using Western blot of cell lysates probed with an antibody against B2M protein. In another embodiment, reverse transcriptase polymerase chain reaction (RT-PCR) is used to confirm the presence of a gene-inactivating modification.

[0234] In some embodiments of the T cells, iPSCs, or ESCs described herein, the cells have knocked out or reduced expression of the T cell receptor alpha chain (TRAC) and / or T cell receptor beta chain (TRBC) genes.

[0235] The T cell receptor (TCR) is a protein complex found on the surface of T cells that is responsible for recognizing antigen fragments as peptides bound to MHC molecules. TCRs are typically disulfide-linked, membrane-anchored heterodimeric proteins composed of highly variable alpha (α) and beta (β) chains (encoded by the TRAC and TRBC genes, respectively) expressed as part of a complex with the invariant CD3 chain molecule. T cells expressing this receptor are called α:β (or αβ) T cells, although a minority of T cells express an alternative receptor formed by variable gamma (γ) and delta (δ) chains and are called γδ T cells. Each chain consists of two extracellular domains: a variable region and a constant region, both of which are immunoglobulin superfamily (IgSF) domains that form an antiparallel β-sheet. The constant region is adjacent to the cell membrane and is followed by a transmembrane region and a short cytoplasmic tail, while the variable region binds to the peptide / MHC complex. It has been reported that knockout of the endogenous TRAC and / or TRBC genes can enhance the expression and function of T cells expressing transgenic T cell receptors. In some embodiments, the cells described herein express reduced levels of MHC class I and / or MHC class II proteins compared to wild-type or control cells.

[0236] In some embodiments, the cells comprise increased expression of wild-type and / or engineered CD47 protein compared to wild-type cells or control cells of the same cell type. In some embodiments, the wild-type or control cells are starting materials. As used herein, starting material refers to a raw material to which one or more of the modifications described herein are made to generate an engineered CD47 protein as described herein, a polynucleotide encoding an engineered CD47 protein as described herein, a vector as described herein, a cell comprising an engineered CD47 protein as described herein, or a composition comprising an engineered CD47 protein or cell as described herein.

[0237] As used herein, "wild-type cell" or "wt cell" refers to any cell found in nature. In some embodiments, wild-type cells include primary cells and T cells found in nature. As used herein, a "control cell" is a cell in which the CD47 gene is unmodified but may have other modifications. In some embodiments, the control cell is a genetically engineered cell that may have a nucleic acid alteration that results in reduced expression of MHC1 protein and / or MHCII protein and / or T cell receptor. In some embodiments, the control cell is a genetically engineered cell in which B2M has been knocked out or contains reduced expression of B2M. In some embodiments, the control cell is a genetically engineered cell in which CIITA has been knocked out or contains reduced expression of CIITA. In some embodiments, the control cell is a genetically engineered cell in which TRAC and / or TRBC have been knocked out or contains reduced expression of TRAC and / or TRBC.

[0238] In some embodiments, the control cell is an iPSC, ESC, or progeny that has a nucleic acid alteration that confers pluripotency. In some embodiments, the control cell is an iPSC, ESC, or progeny that has B2M knocked out or has reduced expression of B2M. In some embodiments, the control cell is an iPSC, ESC, or progeny that has CIITA knocked out or has reduced expression of CIITA. In some embodiments, the control cell is an iPSC, ESC, or progeny that has TRAC and / or TRBC knocked out or has reduced expression of TRAC and / or TRBC.

[0239] In some embodiments, the control cell is a primary T cell or progeny having a nucleic acid alteration that results in reduced expression of an MHC1 protein and / or an MHCII protein and / or a T cell receptor. In some embodiments, the control cell is a primary T cell or progeny in which B2M has been knocked out or has reduced expression of B2M. In some embodiments, the control cell is a primary T cell or progeny in which CIITA has been knocked out or has reduced expression of CIITA. In some embodiments, the control cell is a primary T cell or progeny in which TRAC and / or TRBC have been knocked out or have reduced expression of TRAC and / or TRBC.

[0240] In some embodiments, the starting material is primary cells harvested from a donor. In some embodiments, the starting material is primary blood cells harvested from a donor, e.g., via leukopaque. For example, in some embodiments, the starting material is unmodified T cells harvested from a donor. In some embodiments, the starting material is an iPSC cell line. In some embodiments, the starting material is otherwise modified or engineered to have altered expression of one or more genes other than the human CD47 gene.

[0241] In some embodiments, the described genetically engineered hypoimmunogenic cells are derived from iPSCs or their progeny. As used herein, the term "derived from iPSCs or their progeny" encompasses the initial iPSC produced and any subsequent progeny thereof. As used herein, the term "progeny" encompasses, for example, first generation progeny, i.e., progeny directly derived, obtained, obtainable, or derivable from the initial iPSC, e.g., by conventional propagation methods. The term "progeny" also encompasses subsequent generations, e.g., second, third, fourth, fifth, sixth, seventh, or later generations, i.e., generations of cells derived, obtained, obtainable, or derivable from previous generations, e.g., by conventional propagation methods. The term "progeny" also encompasses modified cells obtained by modification or alteration of the initial iPSC or its progeny.

[0242] In some embodiments, knockdown (e.g., reduction, elimination, or inhibition) of gene expression can be achieved by RNA silencing or RNA interference (RNAi). Useful RNAi methods include those that utilize synthetic RNAi molecules, small interfering RNA (siRNA), PIWI-interacting RNA (piRNA), short hairpin RNA (shRNA), microRNA (miRNA), and other transient knockdown methods recognized by those skilled in the art. Reagents for RNAi, including sequence-specific shRNA, siRNA, miRNA, etc., are commercially available.

[0243] As used herein, the term "genetically engineered cell" refers to a cell that has been altered in at least some way by human intervention, e.g., by genetic change or modification, such that the genetically engineered cell differs from a wild-type cell.

[0244] The terms "reduce," "reduced," "reduction," and "reduce" are all generally used herein to mean a statistically significant decrease. However, for the avoidance of doubt, "reduce," "reduced," "reduction," and "reduce" mean a decrease of at least 10% compared to a reference level, e.g., at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or a decrease of up to 100% (i.e., nonexistent levels compared to a reference sample), or any decrease between 10 and 100%. In some embodiments, cells are genetically engineered to have reduced expression of one or more targets compared to unaltered or unmodified wild-type cells.

[0245] In some embodiments, the provided modified cells are modified so that they can avoid immune recognition and response when administered to a patient (e.g., a recipient subject). The cells can avoid killing by immune cells in vitro and in vivo. In some embodiments, the cells avoid killing by macrophages and NK cells. In some embodiments, the cells are ignored by immune cells or the subject's immune system. In other words, the cells administered by the methods described herein are not detectable by immune cells of the immune system. In some embodiments, the cells are hidden, thereby avoiding immune rejection.

[0246] Methods for determining whether the modified cells provided herein evade immune recognition include, but are not limited to, IFN-γ ELISpot assays, microglial killing assays, cell transplantation animal models, cytokine release assays, ELISA, killing assays using bioluminescence imaging, or chromium release assays, or xCELLigence analysis, mixed lymphocyte reaction, immunofluorescence analysis, and the like.

[0247] In some embodiments, the immunogenicity of cells is assessed in a complement-dependent cytotoxicity (CDC) assay. CDC can be analyzed in vitro by incubating cells with IgG or IgM antibodies targeting HLA-independent antigens expressed on the cell surface in the presence of serum containing complement, and analyzing cell killing. In some embodiments, CDC can be analyzed by incubating cells with ABO-incompatible serum, where the cells contain A or B antigens and the serum contains antibodies against the A and / or B antigens of the cells.

[0248] In some embodiments, once modified cells have been modified or generated as described herein, they can be analyzed for low immunogenicity. Any of a variety of assays can be used to assess whether the cells are low immunogenic or capable of evading the immune system. Exemplary assays include any of those described in WO2016183041 and WO2018132783.

[0249] In some embodiments, the modified cells described herein survive in the host for a week or more (e.g., 1 week, 2 weeks, 1 month, 2 months, 3 months, 6 months, 1 year, 2 years, 3 years, 4 years, 5 years, or more, e.g., the lifetime of the cells and / or their progeny) without stimulating a host immune response. The cells maintain expression of the transgene and / or have deleted or reduced expression of the target gene throughout their survival in the host. In some aspects, the modified cells can be eliminated by the host's immune system when the transgene is no longer expressed and / or when the target gene is expressed. In some embodiments, the persistence or survival of the modified cells can be monitored after their administration to the recipient by further expressing a transgene encoding a protein that allows the cells to be detected in vivo (e.g., a fluorescent protein such as GFP, a truncated receptor or other surrogate marker, or other detectable marker).

[0250] The hypoimmunogenic cells are administered in a manner that allows them to engraft at the intended tissue site and reconstitute or regenerate the functionally deficient area. In some embodiments, the hypoimmunogenic cells are analyzed for engraftment (e.g., successful engraftment). In some embodiments, engraftment of the hypoimmunogenic cells is assessed after a preselected period of time. In some embodiments, the engrafted cells are monitored for cell viability. For example, cell viability may be monitored by bioluminescence imaging (BLI), where the cells are transduced with a luciferase-expressing construct to monitor cell viability. In some embodiments, the engrafted cells are visualized by immunostaining and imaging methods known in the art. In some embodiments, the engrafted cells express known biomarkers that can be detected to confirm successful engraftment. For example, flow cytometry can be used to confirm surface expression of specific biomarkers. In some embodiments, the hypoimmunogenic cells engraft at the intended tissue site as expected (e.g., successful engraftment of the hypoimmunogenic cells). In some embodiments, the hypoimmunogenic cells are engrafted at the intended tissue site as needed, e.g., at the site of a cell deficiency, hi some embodiments, the hypoimmunogenic cells are engrafted at the intended tissue site in the same manner as cells of the same type that do not contain the modification.

[0251] In some embodiments, administration of a population of modified cells (e.g., modified beta islet cells comprising a modification including reduced CD142 expression) or combination (e.g., administration of a population of modified cells in combination with an anticoagulant) improves survival and engraftment by allowing the cells to avoid or reduce IBMIR that occurs as a result of exposure of the cells to blood during transplantation. In some embodiments, reduced IBMIR reduces the amount of cell loss (e.g., loss of transplanted islets) that occurs during transplantation.

[0252] In some embodiments, the hypoimmunogenic cells are analyzed for function. In some embodiments, the hypoimmunogenic cells are analyzed for function prior to their engraftment at the intended tissue site. In some embodiments, the hypoimmunogenic cells are analyzed for function after engraftment at the intended tissue site. In some embodiments, the function of the hypoimmunogenic cells is assessed after a preselected amount. In some embodiments, the function of the engrafted cells is assessed by the cells' ability to produce a detectable phenotype. For example, the function of engrafted beta islet cells can be assessed based on the restoration of glucose control lost due to diabetes. In some embodiments, the function of the hypoimmunogenic cells is as expected (e.g., the hypoimmunogenic cells function well while avoiding antibody-mediated rejection). In some embodiments, the function of the hypoimmunogenic cells is as needed, e.g., they function well at the site of cell deficiency while avoiding antibody-mediated rejection. In some embodiments, the modified cells function similarly to unmodified cells of the same type.

[0253] Immediate blood-borne inflammatory response In some embodiments, modified cells provided herein avoid immediate blood-mediated inflammatory reaction.The main cause of poor clinical outcomes of islet transplantation is the occurrence of harmful immediate blood-mediated inflammatory reaction (IBMIR), which leads to the loss of transplanted tissue when islets encounter the blood of the portal vein (Bennet et al., (1995) Diabetes 48:1907-1914, Moberg et al., (2002) Lancet 360:2039-2045). This response is driven by the combined expression of tissue factor (TF) by endocrine cells of the pancreatic islets and a series of other proinflammatory events, such as expression of MCP-1 (Piemonti et al., (2002) Diabetes 51:55-65), IL-8, and MIF (Waeber et al., (1997) Proc Natl Acad Sci USA 94:4782-4787; Johansson et al., (2006) Am J Transplantation 6(2):305).

[0254] The immediate blood-mediated inflammatory response (IBMIR) is a nonspecific inflammatory and thrombotic response that can occur when cells expressing CD142 come into contact with blood. IBMIR is rapidly initiated by exposure to human blood in the portal vein. It is characterized by activation of complement, platelet, and coagulation pathways, which in turn leads to neutrophil recruitment. IBMIR causes a significant loss of transplanted pancreatic islets. In some embodiments, provided herein are compositions (e.g., modified cells comprising reduced expression of CD142 in combination with one or more other modifications described herein), combinations (e.g., combinations comprising any of the populations of modified cells described herein and a coagulation-reducing anticoagulant), and methods (e.g., methods of treating a patient comprising administering any of the populations of modified cells described herein and a coagulation-reducing anticoagulant) that reduce IBMIR associated with cell transplantation or exposure to blood.

[0255] In some embodiments, IBMIR can be analyzed in vitro, for example, in the in vitro tubing loop model of IBMIR previously described in U.S. Pat. No. 7,045,502, which is incorporated herein by reference in its entirety.

[0256] In some embodiments, IBMIR can be analyzed in vivo (e.g., in a mammal or human patient) by collecting blood samples during the peri-transplant period and assessing plasma levels of thrombin-antithrombin III complex (TAT), C-peptide, factor XIa-antithrombin (FXIa-AT), factor XIIa-antithrombin (FXIIa-AT), thrombin-antithrombin (TAT), plasmin-α2 antiplasmin (PAP), and / or complement C3a. In some embodiments, IBMIR is associated with increased levels of TAT, C-peptide, FXIa-AT, FXIIa-AT, PAP, and / or complement C3a at the time of infusion of the transplanted cells and / or at a period of time after transplantation (e.g., up to 3 hours, 5 hours, 10 hours, or more than 10 hours after transplantation). In some embodiments, IBMIR can be analyzed by monitoring free circulating platelet counts, where a decrease in platelet counts at or after transplantation is associated with IBMIR (e.g., due to platelet consumption resulting from IBMIR).

[0257] Complement-dependent cytotoxicity In some embodiments, the modified cells (e.g., beta islets) provided herein avoid complement-dependent cytotoxicity (CDC). In some embodiments, CDC is caused by the thrombotic response of IBMIR. In some embodiments, CDC occurs independently of IBMIR.

[0258] In some embodiments, the susceptibility of cells to CDC can be analyzed in vitro using standard protocols understood by those of skill in the art. In some embodiments, CDC can be analyzed in vitro by mixing serum (e.g., human serum) containing components of the complement system with target cells bound by antibodies (e.g., IgG or IgM antibodies) and then measuring cell death. In some embodiments, the susceptibility of cells to CDC can be analyzed in vitro by incubating cells in the presence of ABO-incompatible or Rh-incompatible serum containing components of the complement system and antibodies against ABO blood group A antigens, ABO blood group B antigens, and / or cellular Rh-factor antigens.

[0259] A typical CDC assay measures cell death by pre-supplying target cells with a radioactive compound. When cells die, the radioactive compound is released from them. This allows the antibody's ability to mediate cell death to be measured by the level of radioactivity. Unlike radioactive CDC assays, non-radioactive CDC assays often measure the release of abundant cellular components, such as GAPDH, by fluorescence or luminescence measurement. In some embodiments, cell killing by CDC can be analyzed using a label-free platform, such as xCELLigence™ (Agilent).

[0260] VI. Composition In another aspect, the present disclosure provides a composition comprising an engineered CD47 protein disclosed herein.

[0261] In another aspect, the present disclosure provides a composition comprising a cell comprising a polynucleotide encoding an engineered CD47 protein disclosed herein and / or a vector comprising said polynucleotide.

[0262] As used herein, the term "composition" includes, but is not limited to, pharmaceutical compositions. A "pharmaceutical composition" refers to an active pharmaceutical agent formulated in a pharmaceutically or physiologically acceptable solution for administration to a cell or animal, alone or in combination with one or more other therapeutic modalities. It will also be understood that, if desired, the compositions of the present invention may be administered in combination with other agents, such as cytokines, growth factors, hormones, small molecules, chemotherapeutic agents, prodrugs, drugs, antibodies, or various other pharmaceutically active agents. There are virtually no limitations on other components that may be included in the composition, provided that the additional agents do not adversely affect the ability of the composition to deliver its intended therapy. The phrase "pharmaceutically acceptable" is used herein to refer to compounds, substances, compositions, and / or dosage forms that, within the scope of sound medical judgment, are suitable for use in contact with human and animal tissues without undue toxicity, irritation, allergic response, or other problem or complication, and that are commensurate with a reasonable benefit / risk ratio.

[0263] The composition may also comprise a pharmaceutically acceptable carrier, diluent or excipient.As used herein, "pharmaceutically acceptable carrier, diluent or excipient" includes, but is not limited to, any adjuvant, carrier, excipient, glidant, sweetener, diluent, preservative, dye / coloring agent, flavor enhancer, surfactant, wetting agent, dispersant, suspending agent, stabilizer, isotonic agent, solvent, surfactant or emulsifier that is approved by the United States Food and Drug Administration as acceptable for use in humans or domestic animals. Exemplary pharmaceutically acceptable carriers include, but are not limited to, sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethylcellulose, ethyl cellulose, and cellulose acetate; tragacanth; malt; gelatin; talc; cocoa butter; waxes; animal and vegetable fats; paraffin; silicones; bentonite; silicic acid; zinc oxide; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols such as propylene glycol; polyols such as glycerin, sorbitol, mannitol, and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffers such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; phosphate buffer; and any other compatible substance used in pharmaceutical formulations.

[0264] Liquid pharmaceutical compositions, whether in solution, suspension, or other similar form, may contain one or more of the following: sterile diluents, such as water for injection, saline, preferably physiological saline, Ringer's solution, or isotonic saline; fixed oils, such as synthetic monoglycerides or diglycerides, which can serve as solvents or suspending media; polyethylene glycol; glycerin, propylene glycol, or other solvents; antibacterial agents, such as benzyl alcohol or methylparabens; antioxidants, such as ascorbic acid or sodium bisulfite; chelating agents, such as ethylenediaminetetraacetic acid; buffers, such as acetates, citrates, or phosphates; and agents for adjusting tonicity, such as sodium chloride or dextrose. Parenteral preparations may be placed in glass or plastic ampoules, disposable syringes, or multiple-dose vials. Pharmaceutical compositions for injection are preferably sterile.

[0265] Compositions may be suitably developed for intravenous, intratumoral, oral, rectal, intravaginal, parenteral, topical, pulmonary, intranasal, buccal, ocular, or another route of administration.

[0266] VII. Gene Editing Methods In some embodiments, methods for genetically modifying cells to knock out, knock down, or otherwise modify one or more genes include using site-specific nucleases, including, for example, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), meganucleases, transposases, and clustered regularly interspaced short palindromic repeats (CRISPR) / Cas systems, as well as nickase systems, base editing systems, prime editing systems, and any other gene editing systems known in the art.

[0267] ZFNs are fusion proteins containing a series of site-specific DNA-binding domains, adapted from zinc finger-containing transcription factors, linked to the endonuclease domain of the bacterial FokI restriction enzyme. ZFNs can have one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) DNA-binding or zinc finger domains. See, for example, Carroll et al., Genetics Society of America (2011) 188:773-782; Kim et al., Proc. Natl. Acad. Sci. USA (1996) 93:1156-1160. Individual DNA-binding domains are typically referred to as "finger" or "zinc finger." Each zinc finger domain is a small protein structural motif stabilized by one or more zinc ions and typically recognizes a 3- to 4-bp DNA sequence. Thus, tandem domains potentially can bind to extended nucleotide sequences unique within a cell's genome. Each finger binds to 2-4 base pairs of DNA, usually 3 or 4 base pairs. The DNA-binding domain binds to a nucleic acid sequence called a target site or target segment. Each finger usually contains a zinc-chelating DNA-binding subdomain of about 30 amino acids. Studies have demonstrated that this class of single zinc finger consists of an α-helix containing two invariant histidine residues that coordinate zinc with two cysteine ​​residues in a single β-turn (see, e.g., Berg & Shi, Science 271:1081-1085 (1996)).

[0268] Various zinc fingers with known specificities can be combined to create multi-finger polypeptides that recognize sequences of approximately 6, 9, 12, 15, or 18 bp. Various selection and modular assembly techniques are available for creating zinc fingers (and combinations thereof) that recognize specific sequences, including fuzzy display, yeast one-hybrid systems, bacterial one-hybrid and two-hybrid systems, and mammalian cells. Zinc fingers can be engineered to bind to specific nucleic acid sequences. Conditions for engineering zinc fingers to bind to specific nucleic acid sequences are known in the art. See, for example, Sera et al., Biochemistry (2002) 41:7074-7081; Liu et al., Bioinformatics (2008) 24:1850-1857.

[0269] ZFNs containing a FokI nuclease domain or other dimeric nuclease domains function as dimers. Therefore, a pair of ZFNs is required to target non-palindromic DNA sites. Two individual ZFNs must bind to opposite strands of DNA with their nucleases appropriately spaced apart. See Bitinaite et al., Proc. Natl. Acad. Sci. USA (1998) 95:10570-10575. To cleave a specific site in the genome, a pair of ZFNs is designed to recognize two sequences flanking the site, one on the forward strand and the other on the reverse strand. When the ZFNs bind to both sides of the site, the nuclease domains dimerize and cleave the DNA at the site, creating a DSB with a 5' overhang. HDR can then be used to introduce a specific mutation using a repair template containing the desired mutation flanked by homology arms. The repair template is typically an exogenous double-stranded DNA vector introduced into the cell (see Miller et al., Nat. Biotechnol. (2011) 29:143-148; Hockemeyer et al., Nat. Biotechnol. (2011) 29:731-734).

[0270] TALENs are another example of artificial nucleases that can be used to edit target genes. A "TALE nuclease" (TALEN) is a fusion protein consisting of a nucleic acid binding domain, typically derived from a transcription activator-like effector (TALE), and a nuclease catalytic domain for cleaving a nucleic acid target sequence. The catalytic domain is preferably a nuclease domain, more preferably a domain with endonuclease activity, such as I-TevI, ColE7, NucA, and Fok-I. In many embodiments, the TALE domain can be fused to a meganuclease, such as I-CreI and I-OnuI, or functional variants thereof. In a more preferred embodiment, the nuclease is a monomeric TALE nuclease. A monomeric nuclease is a nuclease that does not require dimerization for specific recognition and cleavage, such as a fusion of the catalytic domain of I-TevI ​​with an engineered TAL repeat described in WO2012138927.

[0271] Transcription activator-like effectors (TALEs) are proteins derived from Xanthomonas species of bacteria and contain multiple repeats. Each repeat is 33–35 amino acids long and contains two adjacent amino acids at positions 12 and 13 that are specific for each nucleotide base in the target nucleic acid sequence (termed repeat variable dinucleotides, or RVDs). Binding domains with similar modular base-per-base nucleic acid binding properties (MBBBDs) may be derived from novel modular proteins recently discovered in different bacterial species. These novel modular proteins have the advantage of exhibiting higher sequence variability than TAL repeats. Preferably, the RVDs involved in the recognition of different nucleotides are HD for recognizing C, NG for recognizing T, NI for recognizing A, NN for recognizing G or A, NS for recognizing A, C, G, or T, HG for recognizing T, IG for recognizing T, NK for recognizing G, HA for recognizing C, ND for recognizing C, HI for recognizing C, HN for recognizing G, NA for recognizing G, SN for recognizing G or A, and YG for recognizing T, TL for recognizing A, VT for recognizing A or G, and SW for recognizing A. In another embodiment, the critical amino acids 12 and 13 can be mutated towards other amino acid residues to adjust their specificity towards the nucleotides A, T, C, and G, and in particular to enhance this specificity. TALEN kits are commercially available.

[0272] TALENs are artificially created by fusing one or more TALE DNA binding domains (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) with a nuclease domain, such as a FokI endonuclease domain. See Zhang, Nature Biotech. (2011) 29:149-153. Several mutations to FokI have been created for use in TALENs, which improve, for example, cleavage specificity or activity. See Cermak et al., Nucl. Acids Res. (2011) 39:e82; Miller et al., Nature Biotech. (2011) 29:143-148; Hockemeyer et al., Nature Biotech. (2011) 29:731-734; Wood et al., Science (2011) 333:307; Doyon et al., Nature Methods (2010) 8:74-79; Szczepek et al., Nature Biotech (2007) 25:786-793; Guo et al., J. Mol. Biol. (2010) 200:96. The FokI domain functions as a dimer, requiring two constructs with unique DNA-binding domains properly positioned and spaced to target genomic sites. Both the number of amino acid residues between the TALE DNA binding domain and the FokI nuclease domain and the number of bases between two individual TALEN binding sites appear to be important parameters for achieving high levels of activity. Miller et al., Nature Biotech. (2011) 29:143-148.

[0273] By combining engineered TALE repeats with nuclease domains, site-specific nucleases specific to any desired DNA sequence can be created.Similar to ZFNs, TALENs can be introduced into cells to generate DSBs at desired target sites in the genome, and can therefore be used to knock out genes or knock in mutations in a similar HDR-mediated pathway.Boch, Nature Biotech.(2011) 29:135-136; Boch et al., Science (2009) 326:1509-1512; Moscou et al., See Science (2009) 326:3501.

[0274] Meganucleases are sequence-specific enzymes of the endonuclease family characterized by their ability to recognize and cleave large DNA sequences (14-40 base pairs) (Chevalier, BS and BL Stoddard, Nucleic Acids Res., 2001, 29, 3757-3774). They can cleave specific sites in living cells, thereby enhancing gene targeting near the cleavage site by more than 1000-fold (Puchta et al., Nucleic Acids Res., 1993, 21, 5034-5040; Rouet et al., Mol. Cell. Biol., 1994, 14, 8096-8106; Choulika et al., Mol. Cell. Biol., 1995, 15, 1968-1973; Puchta et al., Proc. Natl. Acad. Sci. USA, 1996, 93, 5055-5060; Sargent et al., Mol. Cell. Biol., 1997, 17, 267-77; Donoho et al. al.,Mol.Cell.Biol,1998,18,4070-4078,Elliott et al., Mol.Cell.Biol.,1998,18,93-101, Cohen-Tannoudji et al.,Mol.Cell.Biol.,1998,18,1444- 1448).

[0275] Meganucleases are classified into families based on their structural motifs that affect nuclease activity and / or DNA recognition. The most widespread and best-known meganucleases are the LAGLIDADG family of proteins, whose name is derived from a conserved amino acid sequence. See Chevalier et al., Nucleic Acids Res. (2001) 29(18):3757-3774. On the other hand, GIY-YIG family members have GIY-YIG modules that are 70-100 residues long and contain four or five conserved sequence motifs with four invariant residues, two of which are required for activity. See Van Roey et al., Nature Struct. Biol. (2002) 9:806-811. His-Cys family meganucleases are characterized by highly conserved histidine and cysteine ​​sequences spanning a region encompassing several hundred amino acid residues. See Chevalier et al., Nucleic Acids Res. (2001) 29(18):3757-3774. Members of the NHN family are defined by a motif containing two pairs of conserved histidines surrounded by asparagine residues. See Chevalier et al., Nucleic Acids Res. (2001) 29(18):3757-3774.

[0276] Because the high specificity required makes it unlikely to identify a natural meganuclease for a particular target DNA sequence, various methods, including mutagenesis and high-throughput screening methods, have been used to generate meganuclease variants that recognize unique sequences. For example, strategies are known in the art for developing meganucleases with altered DNA-binding specificity to bind to predetermined nucleic acid sequences. For example, Chevalier et al., Mol. Cell. (2002) 10:895-905, Epinat et al., Nucleic Acids Res (2003) 31:2952-2962, Silva et al., J Mol. Biol. (2006) 361:744-754, Seligman et al., Nucleic Acids Res(2002) 30:3870-3879, Sussman et al., J Mol Biol (2004) 342:31-41, Doyon et al., J Am Chem Soc(2006) 128:2477-2484, Chen et al., Protein Eng Des Sel(2009) 22:249-256, Arnould et al. al., J Mol See Biol. (2006) 355:443-458; Smith et al., Nucleic Acids Res. (2006) 363(2):283-294.

[0277] Similar to ZFN and TALEN, meganucleases can generate DSBs in genomic DNA, which can cause frameshift mutations when improperly repaired by, for example, NHEJ, thereby resulting in reduced expression of target genes in cells. Alternatively, foreign DNA can be introduced into cells together with meganucleases. Depending on the sequence of foreign DNA and chromosomal sequence, this process can be used to modify target genes. See Silva et al., Current Gene Therapy (2011) 11:11-27.

[0278] Transposase is an enzyme that binds to the end of a transposon and catalyzes its transfer to another part of the genome by a cut-and-paste mechanism or a replicative transposition mechanism. By linking transposase to other systems, such as the CRISPER / Cas system, new gene editing tools can be developed to enable site-specific insertion or manipulation of genomic DNA. There are two known DNA integration methods using transposons: they use catalytically inactive Cas effector proteins and Tn7-like transposons. Transposase-dependent DNA integration does not induce DSBs in the genome, which can ensure safer and more specific DNA integration.

[0279] The CRISPR system was first discovered in prokaryotes (e.g., bacteria and archaea) as a system providing a form of adaptive immunity involved in defense against invading phages and plasmids, and is now being adapted and used as a common gene editing tool in research and clinical applications.

[0280] CRISPR / Cas systems typically include at least two components: one or more guide RNAs (gRNAs) and a Cas protein. The Cas protein is a nuclease that introduces DSBs at target sites. CRISPR-Cas systems are classified into two major classes: Class 1 systems use a complex of multiple Cas proteins to degrade nucleic acids, while Class 2 systems use a single large Cas protein for the same purpose. Class 1 systems are divided into types I, III, and IV, while Class 2 systems are divided into types II, V, and VI. Various Cas proteins suitable for gene editing applications include, but are not limited to, Cas3, Cas4, Cas5, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas12, Cas12a (Cpf1), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12f (C2 Examples of Cas proteins include Cas12c10, Cas12g, Cas12h, Cas12i, Cas12k (C2c5), Cas13, Cas13a (C2c2), Cas13b, Cas13c, Cas13d, C2c4, C2c8, C2c9, Cmr5, Cse1, Cse2, Csf1, Csm2, Csn2, Csx10, Csx11, Csy1, Csy2, Csy3, and Mad7. The most widely used Cas protein, Cas9, is described herein as an example. These Cas proteins can be derived from different source species. For example, Cas9 can be derived from S. pyogenes or S. aureus.

[0281] In the original microbial genome, the type II CRISPR system integrates sequences from the invaded DNA between CRISPR repeat sequences encoded as an array in the host genome. Transcripts from the CRISPR repeat array are processed into CRISPR RNAs (crRNAs), each of which contains a variable sequence known as a "protospacer" sequence transcribed from the invaded DNA and a portion of the CRISPR repeat. Each crRNA hybridizes with a second trans-activating CRISPR RNA (tracrRNA), and these two RNAs form a complex with the Cas9 nuclease. The protospacer-encoded portion of the crRNA guides the Cas9 complex to cleave complementary target DNA sequences, provided the complementary target DNA sequences are flanked by short sequences known as "protospacer adjacent motifs" (PAMs).

[0282] Since its discovery, the CRISPR system has been applied to induce sequence-specific DSBs and targeted genome editing in a wide range of cells and organisms, from bacteria to eukaryotic cells, including human cells. In gene editing applications, an artificially designed synthetic gRNA replaces the native crRNA:tracrRNA complex. For example, the gRNA can be a single guide RNA (sgRNA) composed of a crRNA, a tetraloop, and a tracrRNA. The crRNA typically contains a user-designed complementary region (also called a spacer, typically approximately 20 nucleotides in length) designed to recognize the target DNA of interest. The tracrRNA sequence contains a scaffold region for Cas nuclease binding. The crRNA and tracrRNA sequences are connected by a tetraloop and each contains a short repeat sequence for hybridization with the other, thereby generating a chimeric sgRNA. The genome target of the Cas nuclease can be changed by simply modifying the spacer or complementary region sequence present in the gRNA. The complementary region guides the Cas nuclease to the target DNA site by standard RNA-DNA complementary base-pairing rules.

[0283] For Cas nucleases to function, a PAM must be present immediately downstream of the target sequence in genomic DNA. Recognition of the PAM by the Cas protein is thought to destabilize the adjacent genomic sequence, allowing the gRNA to interrogate the sequence and, if a matching sequence is present, result in gRNA-DNA pairing. The specific sequence of the PAM varies depending on the species of the Cas gene. For example, the most commonly used Cas9 nuclease from S. pyogenes recognizes a PAM sequence of 5'-NGG-3' or, less efficiently, a PAM sequence of 5'-NAG-3', where "N" can be any nucleotide. Other Cas nuclease variants with alternative PAMs have also been characterized and successfully used for genome editing; these are summarized in Table 4 below. [Table 4]

[0284] In some embodiments, Cas nucleases can contain one or more mutations to alter their activity, specificity, recognition, and / or other characteristics. For example, a Cas nuclease can have one or more mutations that alter its fidelity to mitigate off-target effects (e.g., eSpCas9, SpCas9-HF1, HypaSpCas9, HeFSpCas9, and evoSpCas9 high-fidelity variants of SpCas9). In another example, a Cas nuclease can have one or more mutations that alter its PAM specificity.

[0285] The nuclease domain of Cas nuclease, particularly Cas9 nuclease, can be independently mutated to create enzymes called DNA "nickases." Nickases can introduce single-strand breaks with the same specificity as conventional CRISPR / Cas nuclease systems, including CRISPR / Cas9. Nickases can be used to generate double-strand breaks, which can be useful in gene editing systems (Mali et al., Nat Biotech, 31(9):833-838(2013); Mali et al. Nature Methods, 10:957-963(2013); Mali et al., Science, 339(6121):823-826(2013)). In some instances, when two Cas nickases are used, long overhangs are generated at each cut end instead of blunt ends, allowing for precise gene integration and further control of insertion (Mali et al., Nat Biotech, 31(9):833-838 (2013); Mali et al. Nature Methods, 10:957-963 (2013); Mali et al., Science, 339(6121):823-826 (2013)). Because both nicking Cas enzymes must effectively nick their target DNA, paired nickases may exhibit fewer off-target effects compared to Cas-based systems that make double-strand breaks (Ran et al., Cell, 155(2):479-480(2013); Mali et al., Nat Biotech, 31(9):833-838(2013); Mali et al. Nature Methods, 10:957-963(2013); Mali et al., Science, 339(6121):823-826(2013)).

[0286] The molecular machinery of such Cas proteins that enables CRISPR / Cas systems to alter target polynucleotide sequences in cells includes RNA-binding proteins, endonucleases and exonucleases, helicases, and polymerases. In some embodiments, a CRISPR / Cas system includes a Cas protein and at least one or two ribonucleic acids that guide the Cas protein to and hybridize with a target motif in a target polynucleotide sequence. As used herein, "protein" and "polypeptide" are used interchangeably to refer to a series of amino acid residues (i.e., a polymer of amino acids) linked by peptide bonds, including modified amino acids (e.g., phosphorylated, glycosylated, glycosylated, etc.) and amino acid analogs. Exemplary polypeptides or proteins include gene products, naturally occurring proteins, homologs, paralogs, fragments, and other equivalents, variants, and analogs of the above.

[0287] In some embodiments, the Cas protein comprises one or more amino acid substitutions or modifications. In some embodiments, the one or more amino acid substitutions comprise conservative amino acid substitutions. In some instances, the substitutions and / or modifications can prevent or reduce proteolysis of the polypeptide within a cell and / or extend its half-life. In some embodiments, the Cas protein can comprise peptide bond substitutions (e.g., urea, thiourea, carbamate, sulfonylurea, etc.). In some embodiments, the Cas protein can comprise naturally occurring amino acids. In some embodiments, the Cas protein can comprise alternative amino acids (e.g., D-amino acids, β-amino acids, homocysteine, phosphoserine, etc.). In some embodiments, the Cas protein can comprise modifications to include moieties (e.g., PEGylation, glycosylation, lipidation, acetylation, end-capping, etc.).

[0288] In some embodiments, the Cas protein comprises a core Cas protein, an isoform thereof, or any Cas-like protein having a function or activity similar to any Cas protein or isoform thereof. In some embodiments, the Cas protein comprises a core Cas protein. Exemplary Cas core proteins include, but are not limited to, Cas1, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, and Cas9. In some embodiments, the Cas protein comprises a V-type Cas protein. In some embodiments, the Cas protein comprises an E. coli subtype Cas protein (also known as CASS2). Exemplary E. coli subtype Cas proteins include, but are not limited to, Cse1, Cse2, Cse3, Cse4, and Cas5e. In some embodiments, the Cas protein comprises a Ypest subtype Cas protein (also known as CASS3). Exemplary Ypest-subtype Cas proteins include, but are not limited to, Csy1, Csy2, Csy3, and Csy4. In some embodiments, the Cas protein comprises an Nmeni-subtype Cas protein (also known as CASS4). Exemplary Nmeni-subtype Cas proteins include, but are not limited to, Csn1 and Csn2. In some embodiments, the Cas protein comprises a Dvulg-subtype Cas protein (also known as CASS1). Exemplary Dvulg-subtype Cas proteins include Csd1, Csd2, and Cas5d. In some embodiments, the Cas protein comprises a Tneap-subtype Cas protein (also known as CASS7). Exemplary Tneap-subtype Cas proteins include, but are not limited to, Cst1, Cst2, and Cas5t. In some embodiments, the Cas protein comprises an Hmari-subtype Cas protein. Exemplary Cas proteins of the Hmari subtype include, but are not limited to, Csh1, Csh2, and Cas5h.In some embodiments, the Cas protein comprises an Apern subtype Cas protein (also known as CASS5). Exemplary Apern subtype Cas proteins include, but are not limited to, Csa1, Csa2, Csa3, Csa4, Csa5, and Cas5a. In some embodiments, the Cas protein comprises an Mtube subtype Cas protein (also known as CASS6). Exemplary Mtube subtype Cas proteins include, but are not limited to, Csm1, Csm2, Csm3, Csm4, and Csm5. In some embodiments, the Cas protein comprises a RAMP module Cas protein. Exemplary RAMP module Cas proteins include, but are not limited to, Cmr1, Cmr2, Cmr3, Cmr4, Cmr5, and Cmr6. See, e.g., Klompe et al., Nature 571, 219-225 (2019); Strecker et al., Science 365, 48-53 (2019). Examples of Cas proteins include, but are not limited to, Cas3, Cas8a, Cas5, Cas8b, Cas8c, Cas10d, Csel, Csel2, Csyl, Csy2, Csy3, and / or GSU0054. In some embodiments, the Cas protein comprises Cas3, Cas8a, Cas5, Cas8b, Cas8c, Cas10d, Csel, Csel2, Csyl, Csy2, Csy3, and / or GSU0054. Examples of Cas proteins include, but are not limited to, Cas9, Csn2, and / or Cas4. In some embodiments, the Cas protein comprises Cas9, Csn2, and / or Cas4. In some embodiments, example Cas proteins include, but are not limited to, Cas10, Csm2, Cmr5, Cas10, Csx11, and / or Csx10. In some embodiments, the Cas protein comprises, but is not limited to, Cas10, Csm2, Cmr5, Cas10, Csx11, and / or Csx10. In some embodiments, example Cas proteins include, but are not limited to, Csf1.In some embodiments, the Cas protein comprises Csf1. In some embodiments, exemplary Cas proteins include, but are not limited to, Cas12a, Cas12b, Cas12c, C2c4, C2c8, C2c5, C2c10, and C2c9, as well as CasX (Cas12e) and CasY (Cas12d). See also, e.g., Koonin et al., Curr Opin Microbiol. 2017;37:67-78: "Diversity, classification, and evolution of CRISPR-Cas systems." In some embodiments, the Cas protein comprises Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas12d, and / or Cas12e. In some embodiments, the Cas protein comprises Cas13, Cas13a, C2c2, Cas13b, Cas13c, and / or Cas13d. In some embodiments, the CRISPR / Cas system comprises a Cas effector protein selected from the group consisting of: a) Cas3, Cas8a, Cas5, Cas8b, Cas8c, Cas10d, Cse1, Cse2, Csy1, Csy2, Csy3, and GSU0054; b) Cas9, Csn2, and Cas4; c) Cas10, Csn2, and Cas4. sm2, Cmr5, Cas10, Csx11, and Csx10; d) Csf1; e) Cas12a, Cas12b, Cas12c, C2c4, C2c8, C2c5, C2c10, C2c9, CasX (Cas12e), and CasY (Cas12d); and f) Cas13, Cas13a, C2c2, Cas13b, Cas13c, and Cas13d.

[0289] In some embodiments, the Cas protein comprises any of the Cas proteins described herein or functional portions thereof. As used herein, "functional portion" refers to a portion of a peptide that retains the peptide's ability to form a complex with at least one ribonucleic acid (e.g., a guide RNA (gRNA)) and cleave a target polynucleotide sequence. In some embodiments, the functional portion comprises a combination of operably linked Cas9 protein functional domains selected from the group consisting of a DNA-binding domain, at least one RNA-binding domain, a helicase domain, and an endonuclease domain. In some embodiments, the functional portion comprises a combination of operably linked Cas12a (also known as Cpfl) protein functional domains selected from the group consisting of a DNA-binding domain, at least one RNA-binding domain, a helicase domain, and an endonuclease domain. In some embodiments, the functional domains form a complex. In some embodiments, the functional portion of the Cas9 protein comprises a functional portion of a RuvC-like domain. In some embodiments, the functional portion of the Cas9 protein comprises a functional portion of an HNH nuclease domain. In some embodiments, the functional portion of the Cas12a protein comprises a functional portion of a RuvC-like domain.

[0290] In some embodiments, the exogenous Cas protein can be introduced into cells in the form of a polypeptide. In certain embodiments, the Cas protein can be conjugated or fused to a cell-penetrating polypeptide or a cell-penetrating peptide. As used herein, "cell-penetrating polypeptide" and "cell-penetrating peptide" refer to a polypeptide or peptide, respectively, that facilitates the uptake of a molecule into a cell. The cell-penetrating polypeptide can contain a detectable label.

[0291] In many embodiments, the Cas protein can be conjugated or fused to a charged protein (e.g., one with a positive, negative, or overall neutral charge). Such attachment can be covalent. In some embodiments, the Cas protein can be fused to a superpositively charged GFP to significantly enhance the ability of the Cas protein to penetrate cells (Cronican et al. ACS Chem Biol. 2010;5(8):747-52). In certain embodiments, the Cas protein can be fused to a protein transduction domain (PTD) to facilitate entry of the Cas protein into cells. Exemplary PTDs include Tat, oligoarginines, and penetratin. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to a cell-penetrating peptide. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to a PTD. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to a Tat domain. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to an oligoarginine domain. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to a penetratin domain. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to a positively supercharged GFP. In some embodiments, the Cas12a protein comprises a Cas12a polypeptide fused to a cell-penetrating peptide. In some embodiments, the Cas12a protein comprises a Cas12a polypeptide fused to a PTD. In some embodiments, the Cas12a protein comprises a Cas12a polypeptide fused to a tat domain. In some embodiments, the Cas12a protein comprises a Cas12a polypeptide fused to an oligoarginine domain. In some embodiments, the Cas12a protein comprises a Cas12a polypeptide fused to a penetratin domain. In some embodiments, the Cas12a protein comprises a Cas12a polypeptide fused to a positively supercharged GFP.

[0292] In some embodiments, the Cas protein may be introduced into a cell containing a target polynucleotide sequence in the form of a nucleic acid encoding the Cas protein. The process of introducing the nucleic acid into the cell may be accomplished by any suitable technique. Suitable techniques include those described herein.

[0293] In some embodiments, the Cas protein is complexed with one to two ribonucleic acids. In some embodiments, the Cas protein is complexed with two ribonucleic acids. In some embodiments, the Cas protein is complexed with one ribonucleic acid. In some embodiments, the Cas protein is encoded by a modified nucleic acid (e.g., a synthetic, modified mRNA) as described herein.

[0294] The disclosed methods contemplate the use of any ribonucleic acid capable of directing and hybridizing a Cas protein to a target motif in a target polynucleotide sequence. In some embodiments, at least one of the ribonucleic acids comprises a tracrRNA. In some embodiments, at least one of the ribonucleic acids comprises a CRISPR RNA (crRNA). In some embodiments, a single ribonucleic acid comprises a guide RNA that directs and hybridizes a Cas protein to a target motif in a target polynucleotide sequence in a cell. In some embodiments, at least one of the ribonucleic acids comprises a guide RNA that directs and hybridizes a Cas protein to a target motif in a target polynucleotide sequence in a cell. In some embodiments, both of the one or two ribonucleic acids comprise guide RNAs that direct and hybridize a Cas protein to a target motif in a target polynucleotide sequence in a cell. As will be appreciated by one of skill in the art, the ribonucleic acids of the disclosed disclosure can be selected to hybridize to a variety of different target motifs, depending on the particular CRISPR / Cas system and target polynucleotide sequence used. The one or two ribonucleic acids may also be selected to minimize hybridization with nucleic acid sequences other than the target polynucleotide sequence. In some embodiments, the one or two ribonucleic acids hybridize to a target motif that has at least two mismatches when compared to all other genomic nucleotide sequences in the cell. In some embodiments, the one or two ribonucleic acids hybridize to a target motif that has at least one mismatch when compared to all other genomic nucleotide sequences in the cell. In some embodiments, the one or two ribonucleic acids are designed to hybridize to a target motif that is immediately adjacent to a deoxyribonucleic acid motif recognized by a Cas protein. In some embodiments, each of the one or two ribonucleic acids is designed to hybridize to a target motif that is immediately adjacent to a deoxyribonucleic acid motif recognized by a Cas protein, the deoxyribonucleic acid motif adjacent to a mutant allele present between the target motifs.

[0295] In some embodiments, each of the one or two ribonucleic acids comprises a guide RNA that guides a Cas protein to and hybridizes with a target motif in a target polynucleotide sequence within a cell.

[0296] In some embodiments, one or two ribonucleic acids (e.g., guide RNAs) are complementary to and / or hybridize to sequences on the same strand of a target polynucleotide sequence. In some embodiments, one or two ribonucleic acids (e.g., guide RNAs) are complementary to and / or hybridize to sequences on opposite strands of a target polynucleotide sequence. In some embodiments, one or two ribonucleic acids (e.g., guide RNAs) are not complementary to and / or hybridize to sequences on opposite strands of a target polynucleotide sequence. In some embodiments, one or two ribonucleic acids (e.g., guide RNAs) are complementary to and / or hybridize to overlapping target motifs of a target polynucleotide sequence. In some embodiments, one or two ribonucleic acids (e.g., guide RNAs) are complementary to and / or hybridize to offset target motifs of a target polynucleotide sequence.

[0297] VIII. Methods for expressing genetically engineered CD47 proteins The engineered CD47 proteins provided herein can be produced by any method known to those of skill in the art, including in vivo and in vitro methods. The protein of interest can be expressed in any organism suitable for producing the protein in the required amount and form. Expression hosts include prokaryotic and eukaryotic organisms, such as E. coli, yeast, plants, insect cells, mammalian cells, including human cell lines and transgenic animals. Expression hosts can differ in their levels of protein production and the types of post-translational modifications present on the expressed protein. The choice of expression host can be based on these and other factors, such as regulatory and safety considerations, cost of production, and the need for and method of purification.

[0298] In some embodiments, introduction of a polynucleotide encoding an engineered CD47 protein described herein into a cell can be accomplished by any suitable technique. Suitable techniques include calcium phosphate, lipid-mediated transfection, electroporation, fusogens, and transduction or infection using viral vectors, as described herein. In some embodiments, the polynucleotide is introduced into a cell by viral transduction (e.g., AAV transduction, lentiviral transduction) or otherwise delivered with a viral vector (e.g., fusogen-mediated delivery). In some embodiments, the polynucleotide is introduced into a cell by fusogen-mediated delivery or a transposase system selected from the group consisting of a conditional or inducible conditional transposase, a conditional or inducible PiggyBac transposon, a conditional or inducible Sleeping Beauty (SB11) transposon, a conditional or inducible Mos1 transposon, and a conditional or inducible Tol2 transposon.

[0299] Numerous expression vectors are available and known to those skilled in the art and can be used for protein expression. The selection of an expression vector is influenced by the selection of a host expression system. Generally, an expression vector can include a transcription promoter and optionally an enhancer, a translation signal, and transcription and translation termination signals. Expression vectors used for stable transformation usually have a selectable marker that allows the selection and maintenance of transformed cells. In some instances, an origin of replication can be used to amplify the copy number of the vector.

[0300] The expression vector can be introduced into the host cell by, for example, transformation, transfection, transduction, infection, electroporation, and sonoporation. Those skilled in the art can select suitable methods and conditions for introducing the expression vector into the host cell.

[0301] In some embodiments, the engineered CD47 protein is delivered using, for example, viral transduction with a vector. In some embodiments, the vector is a pseudotyped, self-inactivating lentiviral vector carrying an exogenous polynucleotide. In some embodiments, the vector is a self-inactivating lentiviral vector carrying an exogenous polynucleotide pseudotyped with a vesicular stomatitis VSV-G envelope.

[0302] In some embodiments, the engineered CD47 protein is delivered using one or more gene editing systems. In some embodiments, the gene editing system is CRISPR / Cas. In some embodiments, the gene editing system comprises a TALEN. In some embodiments, the gene editing system comprises a zinc finger nuclease. In some embodiments, the gene editing system comprises a meganuclease.

[0303] After introduction of a vector containing a selectable marker, cells may be grown in enriched media for 1-2 days before being transferred to selective media. The purpose of the selectable marker is to confer resistance to selection; its presence allows growth and recovery of cells that normally express the introduced sequences. Resistant clones of stably transformed cells may be propagated using tissue culture techniques appropriate to the cell type. In some embodiments, the engineered CD47 protein is expressed in a mammalian expression system. Expression constructs can be introduced into mammalian cells by viral infection, e.g., adenoviral constructs, or by direct DNA transfer, e.g., liposomes, calcium phosphate, DEAE-dextran, and physical means, e.g., electroporation and microinjection. In some embodiments, the engineered CD47 protein is delivered using viral transduction, e.g., with a vector. In some embodiments, the vector is a pseudotyped, self-inactivating lentiviral vector carrying the exogenous polynucleotide. In some embodiments, the vector is a self-inactivating lentiviral vector pseudotyped with a vesicular stomatitis VSV-G envelope and carrying an exogenous polynucleotide. In some embodiments, the engineered CD47 protein is delivered using one or more gene editing systems. In some embodiments, the gene editing system is CRISPR / Cas. In some embodiments, the gene editing system comprises TALEN. In some embodiments, the gene editing system comprises zinc finger nuclease. In some embodiments, the gene editing system comprises meganuclease.

[0304] In some embodiments, the expression system used in the context of the present disclosure is disclosed in US Application No. 63 / 270,454.

[0305] Expression vectors for mammalian cells typically contain an mRNA cap site, a TATA box, a translation initiation sequence (Kozak consensus sequence), and a polyadenylation element. An IRES element may also be added to allow bicistronic expression with another gene, such as a selectable marker. Such vectors often contain transcriptional promoter-enhancers for high-level expression, such as the SV40 promoter-enhancer, the human cytomegalovirus (CMV) promoter, and the Rous sarcoma virus (RSV) long terminal repeat. These promoter-enhancers are active in many cell types. Tissue and cell type promoter and enhancer regions can also be used for expression. Exemplary promoter / enhancer regions include, but are not limited to, those derived from genes such as elastase I, insulin, immunoglobulin, mouse mammary tumor virus, albumin, alpha-fetoprotein, alpha-1 antitrypsin, beta-globin, myelin basic protein, myosin light chain 2, and gonadotropin-releasing hormone gene control. Selection markers can be used to select and maintain cells carrying the expression construct. Examples of selection marker genes include, but are not limited to, hygromycin B phosphotransferase, adenosine deaminase, xanthine-guanine phosphoribosyltransferase, aminoglycoside phosphotransferase, dihydrofolate reductase (DHFR), and thymidine kinase. For example, expression can be carried out in the presence of methotrexate to select for only cells expressing the DHFR gene.

[0306] Once the vector has been incorporated into a suitable host cell, the host cell is maintained under conditions suitable for expression of the engineered CD47 protein encoded by the incorporated polynucleotide. Those skilled in the art can select suitable conditions for expression of the engineered CD47 protein.

[0307] IX. Other Features It will be understood that certain modifications deemed desirable for a cell therapy product may be introduced into the cells during the process of producing a cell therapy. The cells profiled for donor potential can be edited or unedited. Cell profiling can be performed before or after cell editing. Edited cells contain one or more modifications, such as HIP modifications (hypoimmune gene modifications that enable immune evasion). When transplanted in vivo without immunosuppression, HIP-modified cells have reduced expression of one or more MHC class I and / or MHC class II molecules, which may result in no evidence of a systemic immune response, such as no T cell activation, antibody production, or NK cell activity. Disclosures regarding edited cells are provided herein. Such disclosures are applicable to the methods, uses, and cells described herein. The methods for profiling a cell population for donor potential disclosed herein are advantageous for many of the cell types described herein. In some embodiments, the cells are T cells (e.g., CAR-T cells).

[0308] Genetically engineered cells and methods for genetically engineering cells One potentially desirable modification for a cell therapy product is for the engineered cells and populations thereof to exhibit reduced expression of one or more MHC class I and / or MHC class II molecules. A further potentially desirable modification for a cell therapy product is for the engineered cells and populations thereof to exhibit increased expression of at least one immune tolerance inducer, such as the immune tolerance inducers described herein.

[0309] Provided herein are methods and compositions for reducing and / or avoiding the effects of immune system reactions against allogeneic transplants. To overcome the problem of immune rejection of cell-derived transplants and / or tissue transplants, disclosed herein are genetically engineered immune evasive cells (e.g., genetically engineered primary hypoimmunogenic cells), or populations or pharmaceutical compositions thereof, that provide a viable source of any transplantable cell type. The genetically engineered cells disclosed herein provide reduced recognition by the recipient subject's immune system, regardless of the subject's genetic makeup or any pre-existing response in the subject to one or more previous allogeneic transplants, previous autologous chimeric antigen receptor (CAR) T rejection, and / or other autologous or allogeneic therapies in which the transgene is expressed. Genetically engineered cells may include, but are not limited to, pancreatic beta islet cells, B cells, T cells, NK cells, retinal pigment epithelial cells, glial progenitor cells, endothelial cells, hepatocytes, thyroid cells, skin cells, and blood cells (e.g., plasma cells or platelets).

[0310] In some embodiments, the genetically engineered cells described herein further comprise increased expression and / or overexpression of one or more complement inhibitors. In some embodiments, the one or more complement inhibitors are selected from CD46, CD59, and DAF / CD55. In some embodiments, the genetically engineered cells comprise increased expression of a combination of two or more complement inhibitors, for example, increased expression of CD46 and CD59, or increased expression of CD46, CD59, and CD55.

[0311] The genetically engineered cells provided herein utilize expression of immune tolerance-inducing factors and may also modulate (e.g., reduce or eliminate) the expression (e.g., surface expression) of one or more MHC class I molecules and / or one or more MHC class II molecules. In some embodiments, genome editing techniques utilizing rare-cutting endonucleases (e.g., CRISPR / Cas, TALEN, zinc finger nucleases, meganucleases, and homing endonuclease systems) are also used to reduce or eliminate the expression of important immune genes in human cells (e.g., by deleting the genomic DNA of important immune genes). In certain embodiments, genome editing or other gene regulation techniques are used to insert factors that induce immune tolerance in human cells (immune tolerance-inducing factors) (e.g., CD47), thereby generating genetically engineered cells that can avoid immune recognition upon transplantation into a recipient subject. Thus, the genetically engineered cells provided herein exhibit regulated expression (e.g., reduced or eliminated expression) of one or more genes and factors affecting one or more MHC class I molecules and / or one or more MHC class II molecules, regulated expression (e.g., reduced and / or regulated expression (e.g., overexpression)) of immune tolerance-inducing factors, such as CD47, providing reduced recognition by the recipient subject's immune system. In some embodiments, the genetically engineered cells provided herein exhibit regulated expression (e.g., reduced expression) of CD142. In some embodiments, the genetically engineered cells provided herein exhibit regulated expression (e.g., increased expression) of one or more complement inhibitors selected from CD46, CD59, and DAF / CD55.

[0312] In some aspects, the genetically engineered cells provided herein exhibit reduced innate immune cell rejection and / or adaptive immune cell rejection (e.g., hypoimmunogenic cells). For example, in some embodiments, the genetically engineered cells exhibit reduced susceptibility to NK cell-mediated lysis and / or macrophage phagocytosis. In some embodiments, the genetically engineered cells are useful as a source of universally compatible cells or tissues (e.g., universal donor cells or tissues) that can be transplanted into a recipient subject with little or no need for immunosuppressive agents. Such hypoimmunogenic cells retain cell-specific properties and characteristics upon transplantation.

[0313] Also provided herein are methods of treating disorders comprising administering genetically engineered cells (e.g., genetically engineered primary cells) that circumvent immune rejection in an MHC-mismatched allogeneic recipient. In some embodiments, the genetically engineered cells produced by any of the methods described herein circumvent immune rejection when repeatedly administered (e.g., transplanted or grafted) into an MHC-mismatched allogeneic recipient.

[0314] The practice of the embodiments described herein will employ, unless otherwise specified to the contrary, conventional methods of chemistry, biochemistry, organic chemistry, molecular biology, microbiology, recombinant DNA technology, genetics, immunology, and cell biology, which are within the skill of the art, many of which are described below for illustrative purposes. Such techniques are explained at length in the literature. For example, Sambrook, et al., Molecular Cloning: A Laboratory Manual (3rd Edition, 2001), Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd Edition, 1989), Maniatis et al., Molecular Cloning: A Laboratory Manual (1982), Ausubel et al., Current Protocols in Molecular Biology (John Wiley and Sons, updated July 2008), Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience, Glover, DNA Cloning: A Practical Approach, vol. I & II (IRL Press, Oxford, 1985), Anand, Techniques for the Analysis of Complex Genomes, (Academic Press, New York, 1992), Transcription and Translation(B.Hames & S. Higgins, Eds., 1984), Perbal, A Practical Guide to Molecular Cloning (1984), Harlow and Lane, Antibodies, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1998) Current Protocols in Immunology QE Coligan, A.M. Kruisbeek, D.H. Margulies, E.M. Shevach and W. Strober, eds., 1991), Annual Review of Immunology, and research articles in journals such as Advances in Immunology.

[0315] All publications, including patent documents, scientific articles, and databases, cited in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication were individually incorporated by reference. To the extent that a definition set forth herein contradicts or is inconsistent with a definition set forth in a patent, application, published application, or other publication incorporated herein by reference, the definition set forth in this disclosure shall take precedence over the definition incorporated herein by reference.

[0316] The headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. Those skilled in the art will recognize that several embodiments are possible within the scope and spirit of the present disclosure. The following description illustrates the disclosure and, of course, should not be construed as in any way limiting the scope of the contemplated embodiments described herein.

[0317] Described herein are genetically engineered cells that contain one or more modifications. In some embodiments, the genetically engineered cells provided also contain modifications of one or more target polynucleotide sequences that regulate the expression of one or more MHC class I molecules, one or more MHC class II molecules, or one or more MHC class I molecules and one or more MHC class II molecules.

[0318] In some embodiments, the provided genetically engineered cells also include modifications to increase expression of one or more immune tolerance inducers, hi some embodiments, the immune tolerance inducers are one or more of A20 / TNFAIP3, B2M-HLA-E, CD16, CD16 Fc receptor, CD24, CD27, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD64, CD200, CCL21, CCL22, CTLA4-Ig, C1 inhibitory factor, CR1, DUX4, FASL, HLA-C, HLA-E, HLA-E heavy chain, HLA-F, HLA-G, H2-M3, IDO1, IL-10, IL15-RF, IL-35, IL-39, MANF, Mfge8, PD-L1, Serpinb9, or any combination thereof. In some embodiments, the modification to increase expression of one or more immune tolerance inducers is or comprises increased expression of CD47. In some embodiments, the modification to increase expression of one or more immune tolerance inducers is or comprises increased expression of PD-L1. In some embodiments, the modification to increase expression of one or more immune tolerance inducers is or comprises increased expression of HLA-E. In some embodiments, the modification to increase expression of one or more immune tolerance inducers is or comprises increased expression of HLA-G. In some embodiments, the modification to increase expression of one or more immune tolerance inducers is or comprises increased expression of CCL21, PD-L1, FasL, Serpinb9, H2-M3 (HLA-G), CD47, CD200, and Mfge8.

[0319] In some embodiments, the cells comprise one or more genomic modifications that reduce expression of one or more MHC class I molecules and a modification that increases expression of CD47. In other words, the engineered cells comprise an exogenous CD47 protein and exhibit reduced or silenced surface expression of one or more MHC class I molecules. In some embodiments, the cells comprise one or more genomic modifications that reduce expression of one or more MHC class II molecules and a modification that increases expression of CD47. In some examples, the engineered cells comprise an exogenous CD47 nucleic acid and protein and exhibit reduced or silenced surface expression of one or more MHC class I molecules. In some embodiments, the cells comprise one or more genomic modifications that reduce or eliminate expression of one or more MHC class II molecules, one or more genomic modifications that reduce or eliminate expression of one or more MHC class II molecules, and a modification that increases expression of CD47. In some embodiments, the engineered cells contain exogenous CD47 protein, exhibit reduced or silenced surface expression of one or more MHC class I molecules, and exhibit reduced surface expression of one or more MHC class II molecules or lack surface expression of one or more MHC class II molecules. In many embodiments, the cells are B2M indel / indel, CIITA indel / indel, CD47tg cells.

[0320] In some embodiments, any of the gene editing techniques may be used to reduce the expression of one or more target polynucleotides or target proteins as described. In some embodiments, gene editing techniques may include systems including nucleases, integrases, transposases, and recombinases. In some embodiments, gene editing techniques may be used to knock out or knock down genes. In some embodiments, gene editing techniques may be used to knock in or integrate DNA into a region of the genome. In some embodiments, gene editing techniques result in single-strand breaks (SSBs). In some embodiments, gene editing techniques result in double-strand breaks (DSBs), including those involving non-homologous end joining (NHEJ) or homology-directed repair (HDR). In some embodiments, gene editing techniques may include DNA-based editing or primed editing. In some embodiments, gene editing techniques may include programmable addition of site-specific targeting elements (PASTE).

[0321] In some embodiments, the gene editing technique involves base editing. Base editors (BEs) are typically fusions of a Cas ("CRISPR-associated") domain and a nucleobase-modifying domain (e.g., a naturally occurring or evolved deaminase, such as a cytidine deaminase, including APOBEC1 ("apolipoprotein B mRNA-editing enzyme, catalytic polypeptide 1"), CDA ("cytidine deaminase"), and AID ("activation-induced cytidine deaminase"). In some instances, base editors may also include proteins or domains that alter intracellular DNA repair processes to increase the efficiency and / or stability of the resulting single nucleotide changes.

[0322] In some embodiments, currently available base editors include a cytidine base editor (e.g., BE4) that converts a targeted C·G to a T·A, and an adenine base editor (e.g., ABE7.10) that converts a targeted A·T to a G·C. In some embodiments, Cas9-targeted deamination was first demonstrated with a base editor (BE) system designed to induce base changes without introducing double-stranded DNA breaks. Furthermore, rat deaminase APOBEC1 (rAPOBEC1) fused to inactivated Cas9 (dCas9) was used to successfully convert cytidine to thymidine upstream of the PAM of an sgRNA. In some embodiments, this initial BE system was optimized by altering dCas9 into the "nickase" Cas9 D10A, which nicks the strand opposite the deaminated cytidine. Without being bound by theory, this is predicted to induce long-patch base excision repair (BER) that preferentially uses the deaminated strand to template repair, resulting in a U:A base pair that is then converted to T:A during DNA replication.

[0323] In some embodiments, the base editor is a nucleic acid base editor that contains a first DNA-binding protein domain without catalytic activity, a domain with base-editing activity, and a second DNA-binding protein domain with nickase activity, where the DNA-binding protein domains are expressed in a single fusion protein or are expressed separately (e.g., in separate expression vectors). In some embodiments, the base editor is a fusion protein that includes a domain with base-editing activity (e.g., cytidine deaminase or adenosine deaminase) and two nucleic acid-programmable DNA-binding protein (napDNAbp) domains, where the first domain includes nickase activity and the second domain includes a napDNAbp without catalytic activity, where at least the two napDNAbp are connected by a linker. In some embodiments, the base editor is a fusion protein comprising a CRISPR-Cas (e.g., Cas9) DNA domain with nickase activity (nCas; nCas9), a catalytically inactive domain of a CRISPR-Cas protein (e.g., Cas9) with nucleic acid-programmable DNA-binding activity (dCas; e.g., dCas9), and a deaminase domain, where the dCas is linked to the nCas by a linker, and the dCas is directly adjacent to the deaminase domain. In some embodiments, the base editor is an adenine to thymine or "ATBE" (or thymine to adenine or "TABE") transversion base editor. Exemplary base editors and base editor systems include any of those described in Patent Application Publication Nos. US20220127622, ​​US20210079366, US20200248169, US20210093667, US20210071163, WO2020181202, WO2021158921, WO2019126709, WO2020181178, WO2020181195, WO2020214842, and WO2020181193, which are incorporated herein in their entireties.

[0324] In some embodiments, the gene editing technique is target-primed reverse transcription (TPRT) or "prime editing." In some embodiments, prime editing mediates targeted insertions, deletions, all 12 possible base-base conversions, and combinations thereof in human cells without the need for DSBs or donor DNA templates.

[0325] Prime editing is a genome editing method that uses a nucleic acid-programmable DNA-binding protein ("napDNAbp"), which functions in conjunction with a polymerase (i.e., in the form of a fusion protein or otherwise provided in trans with the napDNAbp), to directly write new genetic information into a designated DNA site. The prime editing system is programmed with a prime editing (PE) guide RNA ("PEgRNA") that specifies the target site and also serves as a template for synthesis of a desired edit in the form of a replacement DNA strand with an extension (either DNA or RNA) engineered onto the guide RNA (e.g., at the 5' or 3' end, or internal to the guide RNA). The replacement strand, containing the desired edit (e.g., a single nucleobase substitution), shares the same sequence as the endogenous strand at the target site to be edited (except that it contains the desired edit). DNA repair and / or replication mechanisms replace the endogenous strand at the target site with the newly synthesized replacement strand containing the desired edit. In some cases, prime editing can be considered a "search and replace" genome editing technique, as the prime editor searches for and detects the desired target site to be edited and simultaneously encodes a replacement strand containing the desired edit that is introduced in place of the endogenous DNA strand at the target site. For example, prime editing can be employed to avoid double-strand breaks in order to perform precise CRISPR / Cas-based genome editing. In some embodiments, the homologous protein is or encodes a Cas protein-reverse transcriptase fusion or related system that targets a specific DNA sequence with a guide RNA, generates a single-strand nick at the target site, and uses the nicked DNA as a primer for reverse transcription of an engineered reverse transcriptase template incorporated by the guide RNA. In some embodiments, the prime editor protein is combined with two prime editing guide RNAs (pegRNAs) that template the synthesis of complementary DNA flaps on opposing strands of genomic DNA, thereby resulting in replacement of the endogenous DNA sequence between the PE-induced nick site and the sequence encoded by the pegRNAs.

[0326] In some embodiments, gene editing technology involves a prime editor, which is a reverse transcriptase or any DNA polymerase known in the art. Thus, in one aspect, the prime editor can include Cas9 (or equivalent napDNAbp) that is programmed to target DNA sequences by associating with a special guide RNA (i.e., PEgRNA) that contains a spacer sequence that anneals to the complementary protospacer of the target DNA. Such methods include those disclosed in Anzalone et al., (doi.org / 10.1038 / s41586-019-1711-4), or PCT Publication Nos. WO2020191248, WO2021226558, or WO2022067130 (which are incorporated herein in their entirety).

[0327] In some embodiments, the gene editing technology is programmable addition of site-specific targeting elements (PASTE). In some aspects, PASTE is a platform in which genome insertion is induced by a CRISPR-Cas9 nickase fused to both a reverse transcriptase and a serine integrase. As described by Ioannidi et al. (doi.org / 10.1101 / 2021.11.01.466786), PASTE does not generate double-strand breaks but allows for the integration of sequences as large as approximately 36 kb. In some embodiments, the serine integrase can be any known in the art. In some embodiments, the serine integrase has sufficient orthogonality so that PASTE can be used for multiplexed gene integration, simultaneously integrating at least two different genes at at least two genomic locations. In some embodiments, PASTE has editing efficiency comparable to or higher than homology-directed repair or non-homologous end joining-based integration methods, is active in non-dividing cells, and has fewer detectable off-target events.

[0328] In some embodiments, the CRISPR system of the present disclosure includes a TnpB polypeptide. In some embodiments, the TnpB polypeptide may include a RuvC-like domain. The RuvC domain may be a split RuvC domain including RuvC-I, RuvC-II, and RuvC-III subdomains. In some embodiments, TnpB may further include one or more of an HTH domain, a bridge helix domain, and a zinc finger domain. The TnpB polypeptide does not include an HNH domain. In some embodiments, the TnpB protein includes, starting from the N-terminus, an HTH domain, a RuvC-I subdomain, a bridge helix domain, a RuvC-II subdomain, a zinc finger domain, and a RuvC-III subdomain. In some embodiments, the RuvC-III subdomain forms the C-terminus of the TnpB polypeptide. In some embodiments, the TnpB polypeptide is derived from a bacterium of the class Epsilonproteobacteria, Actinoplanes lobatus strain DSM 43150, Actinomadura celluolosilytica strain DSM 45823, Actinomadura namibiensis strain DSM 44197, Alicyclobacillus macrosprangiidus strain DSM 17980, Lipingzhangella halophila strain DSM 102030, or Ktedonobacter recemifer. In some embodiments, the TnpB polypeptide is derived from Ktedonobacter racemifer or comprises a conserved RNA region with similarity to the 5' ITR of the TnpB locus of K. racemifer. In some embodiments, TnpB may comprise a Fanzor protein, a TnpB homolog found in eukaryotic genomes. In some embodiments, the CRISPR system comprising TnpB polypeptide binds to the target adjacent motif (TAM) sequence at the 5' side of target polynucleotide.In some embodiments, TAM is a transposon-associated motif.In some embodiments, the TAM sequence comprises TCA.In some embodiments, the TAM sequence comprises TTCAN.In some embodiments, the TAM sequence comprises TTGAT. In some embodiments, the TAM sequence comprises ATAAA.

[0329] In some embodiments, the populations of genetically engineered cells described elicit reduced levels of immune activation or no immune activation when administered to a recipient subject. In some embodiments, the cells elicit reduced levels of systemic TH1 activation or no systemic TH1 activation in a recipient subject. In some embodiments, the cells elicit reduced levels of peripheral blood mononuclear cell (PBMC) immune activation or no PBMC immune activation in a recipient subject. In some embodiments, the cells elicit reduced levels of donor-specific IgG antibodies or no donor-specific IgG antibodies against the cells when administered to a recipient subject. In some embodiments, the cells elicit reduced levels of IgM and IgG antibody production or no IgM and IgG antibody production against the cells in a recipient subject. In some embodiments, the cells elicit reduced levels of cytotoxic T cell killing when administered to a recipient subject.

[0330] In some embodiments, the genetically engineered cells provided herein contain a "suicide gene" or "suicide switch." The suicide gene or suicide switch can be incorporated to function as a "safety switch" that can trigger the death of genetically engineered cells (e.g., genetically engineered primary cells or cells differentiated from genetically engineered pluripotent stem cells) after administration to a subject and in the unlikely event that the cells grow and divide in an undesirable manner. The "suicide gene" ablation approach involves a suicide gene in a gene transfer vector that encodes a protein that results in cell killing only when activated by a specific compound. The suicide gene can encode an enzyme that selectively converts non-toxic compounds into highly toxic metabolites, resulting in the specific ablation of cells expressing the enzyme. In some embodiments, the suicide gene is the herpes virus thymidine kinase (HSV-tk) gene and the trigger is ganciclovir. In other embodiments, the suicide gene is the Escherichia coli cytosine deaminase (EC-CD) gene and the trigger is 5-fluorocytosine (5-FC) (Barese et al, Mol. Therap. 20(10):1932-1943 (2012); Xu et al, Cell Res. 8:73-8 (1998) (both incorporated by reference in their entireties)).

[0331] In other embodiments, the suicide gene is an inducible caspase protein. The inducible caspase protein comprises at least a portion of a caspase protein capable of inducing apoptosis. In some embodiments, the inducible caspase protein is iCasp9, which comprises the sequence of the human FK506-binding protein FKBP12, which has an F36V mutation and is linked to a gene encoding human caspase 9 via a series of amino acids. FKBP12-F36V binds with high affinity to API 903, a small molecule dimerization agent. This allows the suicide function of iCasp9 to be induced by administration of a chemical inducer of dimerization (CID). In some embodiments, the CID is the small molecule drug API 903. Dimerization leads to the rapid induction of apoptosis (see WO2011146862, Stasi et al, N. Engl. J. Med 365;18 (2011), Tey et al, Biol. Blood Marrow Transplant. 13:913-924 (2007), each of which is incorporated by reference in its entirety).

[0332] The inclusion of a safety switch or suicide gene allows for controlled killing of cells if they are cytotoxic or have other adverse effects on the recipient, thereby enhancing the safety of cell therapies, including those that use immune tolerance inducers.

[0333] In some embodiments, a safety switch can be incorporated, e.g., introduced, into the engineered cells provided herein to provide the ability to trigger death or apoptosis of the engineered cells containing the safety switch, e.g., if the cells grow and divide in an undesirable manner or cause excessive toxicity to the host. Thus, the use of a safety switch allows for the conditional elimination of abnormal cells in vivo, which can be an important step in the application of cell therapy in the clinic. Safety switches and their uses are described, for example, in Duzgune §, Origins of Suicide Gene Therapy (2019), Duzgune § (eds), Suicide Gene Therapy. Methods in Molecular Biology, vol. 1895 (Humana Press, New York, NY) (for HSV-tk, cytosine deaminase, nitroreductase, purine nucleoside phosphorylase, and horseradish peroxidase), Zhou and Brenner, Exp Hematol 44(11):1013-1019 (2016) (for iCaspase9), Wang et al., Blood 18(5):1255-1263 (2001) (for huEGFR), U.S. Patent Application Publication No. 20180002397 (for HER1), and Philip et al. al., Blood 124(8):1277-1287 (2014) (for RQR8).

[0334] In some embodiments, the safety switch can cause cell death in a controlled manner, for example, in the presence of a drug or prodrug, or upon activation by a selective exogenous compound. In some embodiments, the safety switch is selected from the group consisting of herpes simplex virus thymidine kinase (HSV-tk), cytosine deaminase (CyD), nitroreductase (NTR), purine nucleoside phosphorylase (PNP), horseradish peroxidase, inducible caspase 9 (iCasp9), rapamycin-activated caspase 9 (rapaCasp9), CCR4, CD16, CD19, CD20, CD30, EGFR, GD2, HER1, HER2, MUC1, PSMA, and RQR8.

[0335] In some embodiments, the safety switch can be a transgene that encodes a product capable of killing cells when activated by a drug or prodrug, for example, by converting a non-toxic prodrug into a toxic metabolite within the cell. In these embodiments, cell killing is activated by contacting the genetically engineered cell with the drug or prodrug. In some examples, the safety switch is HSV-tk, which converts ganciclovir (GCV) to GCV triphosphate, thereby disrupting DNA synthesis and killing dividing cells. In some examples, the safety switch is CyD or a variant thereof, which converts the antifungal drug 5-fluorocytosine (5-FC) to the cytotoxic 5-fluorouracil (5-FU) by catalyzing the hydrolytic deamination of cytosine to uracil. 5-FU is further converted by cellular enzymes to potent antimetabolites (5-FdUMP, 5-FdUTP, 5-FUTP). These compounds inhibit thymidylate synthase and the production of RNA and DNA, resulting in cell death. In some examples, the safety switch is NTR or a variant thereof that can act on the prodrug CB1954 by reduction of the nitro group to a reactive N-hydroxylamine intermediate that is toxic to both proliferating and non-proliferating cells. In some examples, the safety switch is PNP or a variant thereof that can convert the prodrug 6-methylpurine deoxyriboside or fludarabine into a metabolite that is toxic to both proliferating and non-proliferating cells. In some examples, the safety switch is horseradish peroxidase or a variant thereof that can convert indole-3-acetic acid (IAA) into a potent cytotoxin, thereby achieving cell killing.

[0336] In some embodiments, the safety switch can be iCasp9. Caspase 9 is a component of the intrinsic mitochondrial apoptosis pathway that is activated under physiological conditions by the release of cytochrome C from damaged mitochondria. Active caspase 9 then activates caspase 3, which engages terminal effector molecules, resulting in apoptosis. iCasp9 can be generated by fusing a truncated caspase 9 (without its physiological dimerization domain or caspase activation domain) to FKBP12-F36V, an FK506-binding protein (FKBP), via a peptide linker. iCasp9 has low dimer-independent basal activity and can be stably expressed in host cells (e.g., human T cells) without compromising its phenotype, function, or antigen specificity. However, in the presence of chemical inducers of dimerization (CIDs), such as rimiduside (AP1903), AP20187, and rapamycin, iCasp9 can undergo inducible dimerization and activate downstream caspase molecules, resulting in apoptosis of cells expressing iCasp9. See PCT Publication No. WO 2011 / 146862; Stasi et al., N. Engl. J. Med. 365;18 (2011); Tey et al., Biol. Blood Marrow Transplant 13:913-924 (2007). For example, the rapamycin-inducible caspase 9 variant is referred to as rapaCasp9. See Stavrou et al., Mal. Ther. 26(5):1266-1276 (2018). Thus, iCasp9 can be used as a safety switch to achieve controlled killing of host cells.

[0337] In some embodiments, the safety switch can be a membrane-expressed protein that allows cell depletion after administration of a specific antibody against that protein. Safety switches in this category can include one or more transgenes encoding, for example, CCR4, CD16, CD19, CD20, CD30, EGFR, GD2, HER1, HER2, MUC1, PSMA, or RQR8 for their surface expression. These proteins can have surface epitopes that can be targeted by specific antibodies. In some embodiments, the safety switch includes a CCR4 that can be recognized by an anti-CCR4 antibody. Non-limiting examples of suitable anti-CCR4 antibodies include mogamulizumab and its biosimilars. In some embodiments, the safety switch includes a CD16 or CD30 that can be recognized by an anti-CD16 or anti-CD30 antibody. Non-limiting examples of such anti-CD16 or anti-CD30 antibodies include AFM13 and its biosimilars. In some embodiments, the safety switch that can be recognized by an anti-CD19 antibody comprises CD19. Non-limiting examples of such anti-CD19 antibodies include MOR208 and its biosimilars. In some embodiments, the safety switch that can be recognized by an anti-CD20 antibody comprises CD20. Non-limiting examples of such anti-CD20 antibodies include obinutuzumab, ublituximab, ocaratuzumab, rituximab, rituximab-R11b, and their biosimilars. Thus, cells expressing the safety switch are CD20 positive and can be targeted for killing by administration of an anti-CD20 antibody as described. In some embodiments, the safety switch comprises EGFR, which can be recognized by an anti-EGFR antibody. Non-limiting examples of such anti-EGFR antibodies include tomzotuximab, RO5083945 (GA201), cetuximab, and their biosimilars. In some embodiments, the safety switch comprises a GD2 that can be recognized by an anti-GD2 antibody, non-limiting examples of which include Hul4.18K322A, Hul4.18-IL2, Hu3F8, dinituximab, c.60C3-Rllc, and biosimilars thereof.

[0338] In some embodiments, the safety switch can be an exogenously administered drug that recognizes one or more tolerogenic factors on the surface of the genetically engineered cells. In some embodiments, the exogenously administered drug is an antibody directed against or specific for the tolerogenic factor, e.g., an anti-CD47 antibody. By recognizing and blocking the tolerogenic factor on the genetically engineered cells, the exogenously administered antibody can inhibit the immunosuppressive function of the tolerogenic factor, thereby resensitizing the immune system to the genetically engineered cells. For example, in genetically engineered cells that overexpress CD47, an exogenously administered anti-CD47 antibody can be administered to a subject, which results in masking of CD47 on the genetically engineered cells and elicits an immune response against the genetically engineered cells.

[0339] In some embodiments, provided herein are methods for producing genetically engineered cells, the methods comprising: (a) reducing or eliminating expression of one or more MHC class I molecules and / or one or more MHC class II molecules in the cells; and (b) increasing expression of an immune tolerance-inducing factor in the cells. In some embodiments, the one or more immune tolerance inducers are selected from A20 / TNFAIP3, B2M-HLA-E, CD16, CD16 Fc receptor, CD24, CD27, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD64, CD200, CCL21, CCL22, CTLA4-Ig, C1 inhibitory factor, CR1, DUX4, FASL, HLA-C, HLA-E, HLA-E heavy chain, HLA-F, HLA-G, H2-M3, IDO1, IL-10, IL15-RF, IL-35, IL-39, MANF, Mfge8, PD-L1, and Serpinb9. In some embodiments, the one or more immune tolerance inducers is CD47. In some embodiments, the method comprises reducing or eliminating expression of one or more MHC class I molecules and one or more MHC class II molecules. In some embodiments, reducing or eliminating expression comprises performing one or more modifications to the cell using an inducible nuclease (e.g., a CRISPR / Cas system). In some embodiments, the method further comprises introducing into the cell an expression vector comprising an inducible suicide switch.

[0340] In some embodiments, reducing or eliminating expression comprises performing one or more modifications on the cell using an inducible nuclease (e.g., a CRISPR / Cas system). In some embodiments, the method further comprises introducing into the cell an expression vector comprising an inducible suicide switch. In some embodiments, the method further comprises increasing expression of DAF / CD55 in the cell.

[0341] In some embodiments, the immune tolerance inducer is CD47 and the cell comprises an exogenous polynucleotide encoding a CD47 protein, hi some embodiments, the cell expresses the exogenous CD47 polypeptide.

[0342] In some embodiments, the methods disclosed herein comprise administering a CD47-SIRPα blocking agent to a subject in need thereof, wherein the subject has previously received a population of cells genetically engineered to express an exogenous CD47 polypeptide. In some embodiments, the CD47-SIRPα blocking agent comprises a CD47-binding domain. In some embodiments, the CD47-binding domain comprises signal-regulatory protein alpha (SIRPα) or a fragment thereof. In some embodiments, the CD47-SIRPα blocking agent comprises an immunoglobulin G (IgG) Fc domain. In some embodiments, the IgG Fc domain comprises an IgG1 Fc domain. In some embodiments, the IgG1 Fc domain comprises a fragment of a human antibody. In some embodiments, the CD47-SIRPα blocking agent is selected from the group consisting of TTI-621, TTI-622, and ALX148. In some embodiments, the CD47-SIRPα blocking agent is TTI-621, TTI-622, or ALX148. In some embodiments, the CD47-SIRPα blocker is TTI-622. In some embodiments, the CD47-SIRPα blocker is ALX148. In some embodiments, the IgG Fc domain comprises an IgG4 Fc domain. In some embodiments, the CD47-SIRPα blocker is an antibody. In some embodiments, the antibody is selected from the group consisting of MIAP410, B6H12, and magrolimab. In some embodiments, the antibody is MIAP410. In some embodiments, the antibody is B6H12. In some embodiments, the antibody is magrolimab. In some embodiments, the antibody is selected from the group consisting of AO-176, IBI188 (retaplimab), STI-6643, and ZL-1201. In some embodiments, the antibody is AO-176 (Arch). In some embodiments, the antibody is IBI188 (retaplimab) (Innovent). In some embodiments, the antibody is STI-6643 (Sorrento). In some embodiments, the antibody is ZL-1201 (Zai).

[0343] In some embodiments, useful antibodies or fragments thereof that bind to CD47 include magrolimab (Hu5F9-G4) (Forty Seven, Inc., Gilead Sciences, Inc.), urabulelimab, CC-90002 (Celgene, Bristol-Myers Squibb), IBI-188 (Innovent Biologics), IBI-322 (Innovent Biologics), TG-1801 (TG Therapeutics; also known as NI-1701, Novimmune SA), ALX148 (ALX Oncology), TJ011133 (also known as TJC4, I-Mab Biopharma), FA3M3, ZL-1201 (Zai Lab Co., Ltd.), AK117 (Akesbio Australia Pty, Ltd.), AO-176 (Arch Oncology), SRF231 (Surface Oncology), GenSci-059 (GeneScience), C47B157 (Janssen Research and Development), C47B161 (Janssen Research and Development), C47B167 (Janssen Research and Development), C47B222 (Janssen Research and Development), C47B227 (Janssen Research and Development), Vx-1004 (Corvus Pharmaceuticals), HMBD004 (Hummingbird Bioscience Pte Ltd), SHR-1603 (Hengrui), AMMS4-G4 (Beijing Institute of Biotechnology), RTX-CD47 (University of Groningen), and IMC-002 (Samsung Biologics, ImmuneOncia Therapeutics).In some embodiments, the antibody or fragment thereof does not compete for CD47 binding with an antibody selected from the group including magrolimab, urabrelimab, CC-90002, IBI-188, IBI-322, TG-1801 (NI-1701), ALX148, TJ011133, FA3M3, ZL1201, AK117, AO-176, SRF231, GenSci-059, C47B157, C47B161, C47B167, C47B222, C47B227, Vx-1004, HMBD004, SHR-1603, AMMS4-G4, RTX-CD47, and IMC-002. In some embodiments, the antibody or fragment thereof competes for CD47 binding with an antibody selected from magrolimab, urabrelimab, CC-90002, IBI-188, IBI-322, TG-1801 (NI-1701), ALX148, TJ011133, FA3M3, ZL1201, AK117, AO-176, SRF231, GenSci-059, C47B157, C47B161, C47B167, C47B222, C47B227, Vx-1004, HMBD004, SHR-1603, AMMS4-G4, RTX-CD47, and IMC-002. In some embodiments, the antibody or fragment thereof that binds to CD47 is selected from the group comprising a single chain Fv fragment (scFv) against CD47, a Fab against CD47, a VHH nanobody against CD47, a DARPin against CD47, and variants thereof. In some embodiments, the scFv against CD47, Fab against CD47, and variants thereof are based on the antigen-binding domain of any of the antibodies selected from the group including magrolimab, urabrelimab, CC-90002, IBI-188, IBI-322, TG-1801 (NI-1701), ALX148, TJ011133, FA3M3, ZL1201, AK117, AO-176, SRF231, GenSci-059, C47B157, C47B161, C47B167, C47B222, C47B227, Vx-1004, HMBD004, SHR-1603, AMMS4-G4, RTX-CD47, and IMC-002.

[0344] In some embodiments, the CD47 antagonist provides a CD47 blocking agent. Methods and agents for CD47 blockade are described in PCT / US2021 / 054326, which is incorporated herein by reference in its entirety.

[0345] Once modified, the presence or absence of expression of any of the molecules described herein can be analyzed using known techniques, such as Western blot, ELISA assay, FACS assay, and the like.

[0346] In some embodiments, characteristics associated with a particular cell type, such as cellular marker characterization, biomarkers, intracellular markers, extracellular markers, cellular cytokine production, and antibody production, may also be used as information about cell quality. In some embodiments, an intracellular marker may be a change in intracellular protein levels. In some embodiments, an intracellular marker may be a change in intracellular RNA levels. In some embodiments, an intracellular marker may be a change in intracellular DNA levels. In some embodiments, an extracellular marker may be a change in the level of an extracellular peptide (e.g., one or more cytokines, one or more hormones, one or more antibodies, etc.). In some embodiments, an extracellular marker may be a change in the level of an extracellular signaling molecule (e.g., one or more signaling peptides, one or more metabolites, one or more ligands, one or more organic compounds, one or more ions, etc.).

[0347] A. Reduction of target gene expression 1. Target Gene a. MHC class I molecules and / or MHC class II molecules In some embodiments, provided genetically engineered cells comprise modifications (e.g., genetic modifications) of one or more target polynucleotide or protein sequences (interchangeably referred to as target genes) that modulate (e.g., reduce or eliminate) the expression of one or more MHC class I molecules, one or more MHC class II molecules, or one or more MHC class I molecules and one or more MHC class II molecules. In some embodiments, the modified or genetically engineered cells are unmodified or unengineered cells that have not previously been subjected to one or more modifications. In some embodiments, a gene editing system is used to modify one or more target polynucleotide sequences that modulate (e.g., reduce or eliminate) the expression of one or more MHC class I molecules, one or more MHC class II molecules, or one or more MHC class I molecules and one or more MHC class II molecules. In certain embodiments, the genome of the cell has been modified to reduce or eliminate components required for or involved in promoting HLA expression, e.g., cell surface expression of one or more MHC class I molecules and / or one or more MHC class II molecules. For example, in some embodiments, the expression of beta2-microglobulin (B2M), a component of MHC class I molecules, in the cells is reduced or eliminated, thereby reducing or eliminating protein expression (e.g., cell surface expression) of one or more MHC class I molecules by the genetically engineered cells.

[0348] In some embodiments, any of the described modifications in the engineered cells that modulate (e.g., reduce or eliminate) the expression of one or more target polynucleotides or proteins in the engineered cells can be combined with one or more modifications to overexpress a polynucleotide (e.g., an immune tolerance inducer, e.g., CD47) described in Section II.B.

[0349] In some embodiments, reduced expression of one or more MHC class I molecules and / or one or more MHC class II molecules can be achieved, for example, by one or more of the following: (1) direct targeting of polymorphic HLA alleles (HLA-A, HLA-B, HLA-C) and MHC class II genes; (2) ablation of B2M (which reduces surface trafficking of all MHC class I molecules); and / or (3) deletion of one or more components of the MHC enhanceosome that are important for HLA expression, such as LRC5, RFX-5, RFXANK, RFXAP, IRF1, NF-Y (including NFY-A, NFY-B, NFY-C), and CIITA.

[0350] In certain embodiments, HLA expression is disrupted. In some embodiments, HLA expression is disrupted by targeting individual HLAs (e.g., knocking out expression of HLA-A, HLA-B, and / or HLA-C), targeting transcriptional regulators of HLA expression (e.g., knocking out expression of NLRC5, CIITA, RFX5, RFXAP, RFXANK, NFY-A, NFY-B, NFY-C, and / or IRF-1), inhibiting surface transport of MHC class I molecules (e.g., knocking out expression of B2M and / or TAP1), and / or targeting with HLA-Razor (see, e.g., WO2016183041).

[0351] The human leukocyte antigen (HLA) complex is synonymous with human MHC. In some embodiments, the genetically engineered cells disclosed herein are human cells. In certain aspects, the genetically engineered cells disclosed herein do not express one or more human leukocyte antigens (e.g., HLA-A, HLA-B, and / or HLA-C) corresponding to one or more MHC class I molecules and / or one or more MHC class II molecules, and are therefore characterized by low immunogenicity. For example, in certain aspects, the genetically engineered cells disclosed herein include any stem cells or differentiated stem cells prepared therefrom, which have been modified to not express or exhibit reduced expression of one or more of the following MHC class I molecules: HLA-A, HLA-B, and HLA-C. In some embodiments, one or more of HLA-A, HLA-B, and HLA-C may be "knocked out" from the cell. Cells in which the HLA-A gene, the HLA-B gene, and / or the HLA-C gene have been knocked out can exhibit reduced or eliminated expression of each of the knocked-out genes.

[0352] In certain embodiments, expression of one or more MHC class I molecules and / or one or more MHC class II molecules is modulated by targeting and deleting a contiguous stretch of genomic DNA, thereby reducing or eliminating expression of a target gene selected from the group consisting of B2M, CIITA, and NLRC5.

[0353] In some embodiments, the provided genetically engineered cells comprise modifications of one or more target polynucleotide sequences that regulate one or more MHC class I molecules. Exemplary methods for reducing the expression of one or more MHC class I molecules are described in the following sections. In some embodiments, the targeted polynucleotide sequences are one or both of B2M and NLRC5. In some embodiments, the cells comprise modifications (e.g., indels) made by gene editing in the B2M gene. In some embodiments, the cells comprise modifications (e.g., indels) made by gene editing in the NLRC5 gene. In some embodiments, the cells comprise modifications (e.g., indels) made by gene editing in the B2M and CIITA genes.

[0354] In some embodiments, the modification that reduces expression of one or more MHC class I molecules is a modification that reduces expression of B2M. In some embodiments, the modification that reduces B2M expression reduces B2M mRNA expression. In some embodiments, the reduction in B2M mRNA expression is compared to unmodified or wild-type cells of the same cell type that do not contain the modification. In some embodiments, B2M mRNA expression is reduced by more than about 5%, e.g., more than about 10%, more than about 20%, more than about 30%, more than about 40%, more than about 50%, more than about 60%, more than about 70%, more than about 80%, more than about 90%, or more. In some embodiments, B2M mRNA expression is reduced by up to about 100%, e.g., by up to about 90%, by up to about 80%, by up to about 70%, by up to about 60%, by up to about 50%, by up to about 40%, by up to about 30%, by up to about 20%, by up to about 10%, by up to about 5%, or less. In some embodiments, B2M mRNA expression is reduced by about 5%, by about 10%, by about 20%, by about 30%, by about 40%, by about 50%, by about 60%, by about 70%, by about 80%, by about 90%, or by about 100%. In some embodiments, B2M mRNA expression is eliminated (e.g., 0% expression of B2M mRNA). In some embodiments, the modification that reduces B2M mRNA expression eliminates B2M gene activity.

[0355] In some embodiments, the modification that reduces B2M expression reduces B2M protein expression. In some embodiments, the reduction in B2M protein expression is compared to unmodified or wild-type cells of the same cell type that do not contain the modification. In some embodiments, B2M protein expression is reduced by more than about 5%, e.g., more than about 10%, more than about 20%, more than about 30%, more than about 40%, more than about 50%, more than about 60%, more than about 70%, more than about 80%, more than about 90%, or more. In some embodiments, protein expression of B2M is reduced by up to about 100%, e.g., by up to about 90%, by up to about 80%, by up to about 70%, by up to about 60%, by up to about 50%, by up to about 40%, by up to about 30%, by up to about 20%, by up to about 10%, by up to about 5%, or less. In some embodiments, protein expression of B2M is reduced by about 5%, by about 10%, by about 20%, by about 30%, by about 40%, by about 50%, by about 60%, by about 70%, by about 80%, by about 90%, or by about 100%. In some embodiments, protein expression of B2M is eliminated (e.g., 0% expression of B2M protein). In some embodiments, the modification that reduces B2M protein expression eliminates B2M gene activity.

[0356] In some embodiments, the modification that reduces B2M expression comprises inactivation or disruption of the B2M gene. In some embodiments, the modification that reduces B2M expression comprises inactivation or disruption of one allele of the B2M gene. In some embodiments, the modification that reduces B2M expression comprises inactivation or disruption of both alleles of the B2M gene.

[0357] In some embodiments, the modification comprises inactivation or disruption of one or more B2M coding sequences in the cell. In some embodiments, the modification comprises inactivation or disruption of all B2M coding sequences in the cell. In some embodiments, the modification, inactivation or disruption comprises an indel in the B2M gene. In some embodiments, the modification is a frameshift mutation in the genomic DNA of the B2M gene. In some embodiments, the modification is a deletion in the genomic DNA of the B2M gene. In some embodiments, the modification is a deletion of a contiguous section of the genomic DNA of the B2M gene. In some embodiments, the B2M gene is knocked out.

[0358] In some embodiments, the provided genetically engineered cells comprise one or more target polynucleotide sequence modifications that regulate one or more MHC class II molecules. Exemplary methods for reducing the expression of one or more MHC class II molecules are described in the following sections. In some embodiments, the cells comprise gene editing modifications of the CIITA gene.

[0359] In some embodiments, the modification that reduces the expression of one or more MHC class II molecules is a modification that reduces the expression of CIITA. In some embodiments, the modification that reduces CIITA expression reduces CIITA mRNA expression. In some embodiments, the reduction in CIITA mRNA expression is compared to unmodified or wild-type cells of the same cell type that do not contain the modification. In some embodiments, CIITA mRNA expression is reduced by more than about 5%, for example, by more than about 10%, by more than about 20%, by more than about 30%, by more than about 40%, by more than about 50%, by more than about 60%, by more than about 70%, by more than about 80%, by more than about 90%, or even more. In some embodiments, CIITA mRNA expression is reduced by up to about 100%, for example, by up to about 90%, up to about 80%, up to about 70%, up to about 60%, up to about 50%, up to about 40%, up to about 30%, up to about 20%, up to about 10%, up to about 5%, or less. In some embodiments, CIITA mRNA expression is reduced by about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100%. In some embodiments, CIITA mRNA expression is eliminated (eg, 0% expression of CIITA mRNA). In some embodiments, the modification that reduces CIITA mRNA expression eliminates CIITA gene activity.

[0360] In some embodiments, the modification that reduces CIITA expression reduces CIITA protein expression. In some embodiments, the reduction in CIITA protein expression is compared to unmodified or wild-type cells of the same cell type that do not contain the modification. In some embodiments, the CIITA protein expression is reduced by more than about 5%, for example, by more than about 10%, by more than about 20%, by more than about 30%, by more than about 40%, by more than about 50%, by more than about 60%, by more than about 70%, by more than about 80%, by more than about 90%, or even more. In some embodiments, the protein expression of CIITA is reduced by up to about 100%, for example, by up to about 90%, up to about 80%, up to about 70%, up to about 60%, up to about 50%, up to about 40%, up to about 30%, up to about 20%, up to about 10%, up to about 5%, or less. In some embodiments, the protein expression of CIITA is reduced by about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100%. In some embodiments, protein expression of CIITA is eliminated (eg, 0% expression of CIITA protein). In some embodiments, the modification that reduces CIITA protein expression eliminates CIITA gene activity.

[0361] In some embodiments, the modification that reduces B2M expression comprises inactivation or disruption of the CIITA gene. In some embodiments, the modification that reduces CIITA expression comprises inactivation or disruption of one allele of the CIITA gene. In some embodiments, the modification that reduces CIITA expression comprises inactivation or disruption of both alleles of the CIITA gene.

[0362] In some embodiments, the modification comprises inactivation or disruption of one or more B2M coding sequences in the cell. In some embodiments, the modification comprises inactivation or disruption of all B2M coding sequences in the cell. In some embodiments, the modification, inactivation or disruption comprises an indel in the B2M gene. In some embodiments, the modification is a frameshift mutation in the genomic DNA of the B2M gene. In some embodiments, the modification is a deletion in the genomic DNA of the B2M gene. In some embodiments, the modification is a deletion of a contiguous section of the genomic DNA of the B2M gene. In some embodiments, the CIITA gene is knocked out.

[0363] In some embodiments, the provided genetically engineered cells comprise modifications of one or more target polynucleotide sequences that regulate one or more MHC class I molecules and / or one or more MHC class II molecules. Exemplary methods for reducing expression of one or more MHC class I molecules and / or one or more MHC class II molecules are described in the sections below. In some embodiments, the cells comprise modifications by gene editing of the B2M and NLRC5 genes. In some embodiments, the cells comprise modifications by gene editing of the CIITA and NLRC5 genes. In embodiments, the cells comprise modifications by gene editing of the B2M, CIITA, and NLRC5 genes.

[0364] 2. Methods for reducing expression In some embodiments, the cells provided herein are modified (e.g., genetically modified) to reduce expression of one or more target polynucleotides or proteins as described. In some embodiments, the cells that have been genetically engineered with one or more modifications to reduce (e.g., eliminate) expression of a polynucleotide or protein are any of the source cells described herein. In some embodiments, the source cells are any of the cells described in Section II.C. In certain embodiments, the cells disclosed herein (e.g., stem cells, induced pluripotent stem cells, differentiated cells such as beta pancreatic islet cells or hepatocytes, or primary cells) contain one or more modifications to reduce expression of one or more target polynucleotides. Non-limiting examples of one or more target polynucleotides include any of those described above, such as one or more of CIITA, B2M, NLRC5, HLA-A, HLA-B, HLA-C, LRC5, RFX-ANK, RFX5, RFX-AP, NFY-A, NFY-B, NFY-C, IRF1, and TAP1. In some embodiments, modifications to reduce expression of one or more target polynucleotides are combined with one or more modifications to increase expression of a transgene of interest, e.g., any of those described in Section II.B. In some embodiments, the modifications create engineered cells that are immune privileged or hypoimmunogenic. By modulating (e.g., reducing or eliminating) the expression of one or more target polynucleotides, such cells exhibit reduced immune activation when transplanted into a recipient subject. In some embodiments, the cells are considered hypoimmunogenic when administered, e.g., in a recipient subject or patient.

[0365] Any method for reducing expression of a target polynucleotide may be used. In some embodiments, the modification results in permanent elimination or reduction of expression of the target polynucleotide. For example, in some embodiments, the target polynucleotide or gene is destroyed by introducing a DNA break in the target polynucleotide, e.g., by using a targeting endonuclease. In other embodiments, the modification results in a transient reduction in expression of the target polynucleotide. For example, in some embodiments, gene suppression is achieved using an inhibitory nucleic acid complementary to the target polynucleotide to selectively inhibit or suppress expression of the gene, e.g., using antisense technology, e.g., RNA interference (RNAi), small interfering RNA (siRNA), short hairpin (shRNA), and / or ribozymes.

[0366] In some embodiments, the target polynucleotide sequence is a genomic sequence. In some embodiments, the target polynucleotide sequence is a human genomic sequence. In some embodiments, the target polynucleotide sequence is a mammalian genomic sequence. In some embodiments, the target polynucleotide sequence is a vertebrate genomic sequence.

[0367] In some embodiments, gene disruption is typically carried out by introducing one or more double-strand breaks and / or one or more single-strand breaks in a gene in a targeted manner. In some embodiments, the double-strand or single-strand breaks are created by a nuclease, e.g., an endonuclease, e.g., a gene-targeting nuclease. In some embodiments, the targeting nuclease is selected from zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and RNA-guided nucleases, e.g., CRISPR-associated nucleases (Cas), which are specifically designed to target the sequence of a gene or a portion thereof. In some embodiments, the targeting nuclease generates double-strand or single-strand breaks, which are then repaired by error-prone non-homologous end joining (NHEJ) or, in some cases, template-based precise homology-directed repair (HDR). In some embodiments, the targeting nuclease generates a DNA double-strand break (DSB). In some embodiments, the process of creating and repairing the break is usually error-prone, resulting in the insertion and deletion of DNA bases (indels) due to NHEJ repair. In some embodiments, the modification can induce deletion, insertion, or mutation of the nucleotide sequence of the target gene. In some instances, the modification can result in a frameshift mutation, which can result in a premature stop codon. In the example of nuclease-mediated gene editing, targeted editing occurs in both alleles of the gene, thereby resulting in the disruption or editing of both alleles of the gene. In some embodiments, all alleles of the gene are targeted by gene editing. In some embodiments, modification by targeted nucleases, for example, using the CRISPR / Cas system, results in the complete knockout of the gene.

[0368] In some embodiments, a nuclease, such as a rare-cutting endonuclease, is introduced into a cell containing a target polynucleotide sequence. The nuclease may be introduced into the cell in the form of a nucleic acid encoding the nuclease. The process of introducing the nucleic acid into the cell may be achieved by any suitable technique. Suitable techniques include calcium phosphate or lipid-mediated transfection, electroporation, and transduction or infection using a viral vector. In some embodiments, the nucleic acid introduced into the cell is DNA. In some embodiments, the nuclease is introduced into the cell in the form of a protein. For example, in the case of the CRISPR / Cas system, a ribonucleoprotein (RNP) may be introduced into the cell.

[0369] In some embodiments, the modification is carried out using a CRISPR / Cas system. Any CRISPR / Cas system capable of altering a target polynucleotide sequence in a cell may be used. Such CRISPR-Cas systems may use a variety of Cas proteins (Haft et al. PLoS Comput Biol. 2005;1(6)e60). The molecular machinery of such Cas proteins that enables CRISPR / Cas systems to alter a target polynucleotide sequence in a cell includes an RNA-binding protein, an endonuclease and exonuclease, a helicase, and a polymerase. In some embodiments, the CRISPR / Cas system is a type I CRISPR system. In some embodiments, the CRISPR / Cas system is a type II CRISPR system. In some embodiments, the CRISPR / Cas system is a type V CRISPR system.

[0370] CRISPR / Cas systems include targeting systems that can be used to alter any target polynucleotide sequence within a cell. In some embodiments, the CRISPR / Cas systems provided herein include a Cas protein and one or more, e.g., at least one or two, ribonucleic acids (e.g., guide RNAs (gRNAs)) that guide the Cas protein to and hybridize with a target motif in a target polynucleotide sequence.

[0371] In some embodiments, the Cas protein comprises one or more amino acid substitutions or modifications. In some embodiments, the one or more amino acid substitutions comprise conservative amino acid substitutions. In some instances, the substitutions and / or modifications can prevent or reduce proteolysis of the polypeptide within a cell and / or extend its half-life. In some embodiments, the Cas protein can comprise peptide bond substitutions (e.g., urea, thiourea, carbamate, sulfonylurea, etc.). In some embodiments, the Cas protein can comprise naturally occurring amino acids. In some embodiments, the Cas protein can comprise alternative amino acids (e.g., D-amino acids, β-amino acids, homocysteine, phosphoserine, etc.). In some embodiments, the Cas protein can comprise modifications to include moieties (e.g., PEGylation, glycosylation, lipidation, acetylation, end-capping, etc.).

[0372] In some embodiments, the Cas protein comprises a core Cas protein. Exemplary Cas core proteins include, but are not limited to, Cas1, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, and Cas9. In some embodiments, the Cas protein comprises an E. coli subtype Cas protein (also known as CASS2). Exemplary E. coli subtype Cas proteins include, but are not limited to, Cse1, Cse2, Cse3, Cse4, and Cas5e. In some embodiments, the Cas protein comprises a Ypest subtype Cas protein (also known as CASS3). Exemplary Ypest subtype Cas proteins include, but are not limited to, Csy1, Csy2, Csy3, and Csy4. In some embodiments, the Cas protein comprises a Nmeni subtype Cas protein (also known as CASS4). Exemplary Nmeni-subtype Cas proteins include, but are not limited to, Csn1 and Csn2. In some embodiments, the Cas protein comprises a Dvulg-subtype Cas protein (also known as CASS1). Exemplary Dvulg-subtype Cas proteins include Csd1, Csd2, and Cas5d. In some embodiments, the Cas protein comprises a Tneap-subtype Cas protein (also known as CASS7). Exemplary Tneap-subtype Cas proteins include, but are not limited to, Cst1, Cst2, and Cas5t. In some embodiments, the Cas protein comprises an Hmari-subtype Cas protein. Exemplary Hmari-subtype Cas proteins include, but are not limited to, Csh1, Csh2, and Cas5h. In some embodiments, the Cas protein comprises an Apern-subtype Cas protein (also known as CASS5). Exemplary Apern subtype Cas proteins include, but are not limited to, Csa1, Csa2, Csa3, Csa4, Csa5, and Cas5a.In some embodiments, the Cas protein comprises an Mtube subtype Cas protein (also known as CASS6). Exemplary Mtube subtype Cas proteins include, but are not limited to, Csm1, Csm2, Csm3, Csm4, and Csm5. In some embodiments, the Cas protein comprises a RAMP module Cas protein. Exemplary RAMP module Cas proteins include, but are not limited to, Cmr1, Cmr2, Cmr3, Cmr4, Cmr5, and Cmr6. See, e.g., Klompe et al., Nature 571, 219-225 (2019); Strecker et al., Science 365, 48-53 (2019).

[0373] In some embodiments, the CRISPR system of the present disclosure includes a TnpB polypeptide. In some embodiments, the TnpB polypeptide may include a RuvC-like domain. The RuvC domain may be a split RuvC domain including RuvC-I, RuvC-II, and RuvC-III subdomains. In some embodiments, TnpB may further include one or more of an HTH domain, a bridge helix domain, and a zinc finger domain. The TnpB polypeptide does not include an HNH domain. In some embodiments, the TnpB protein includes, starting from the N-terminus, an HTH domain, a RuvC-I subdomain, a bridge helix domain, a RuvC-II subdomain, a zinc finger domain, and a RuvC-III subdomain. In some embodiments, the RuvC-III subdomain forms the C-terminus of the TnpB polypeptide. In some embodiments, the TnpB polypeptide is derived from a bacterium of the class Epsilonproteobacteria, Actinoplanes lobatus strain DSM 43150, Actinomadura celluolosilytica strain DSM 45823, Actinomadura namibiensis strain DSM 44197, Alicyclobacillus macrosprangiidus strain DSM 17980, Lipingzhangella halophila strain DSM 102030, or Ktedonobacter recemifer. In some embodiments, the TnpB polypeptide is derived from Ktedonobacter racemifer or comprises a conserved RNA region with similarity to the 5' ITR of the TnpB locus of K. racemifer. In some embodiments, TnpB may comprise a Fanzor protein, a TnpB homolog found in eukaryotic genomes. In some embodiments, the CRISPR system comprising TnpB polypeptide binds to the target adjacent motif (TAM) sequence at the 5' side of target polynucleotide.In some embodiments, TAM is a transposon-associated motif.In some embodiments, the TAM sequence comprises TCA.In some embodiments, the TAM sequence comprises TTCAN.In some embodiments, the TAM sequence comprises TTGAT. In some embodiments, the TAM sequence comprises ATAAA.

[0374] In some embodiments, methods for genetically modifying cells to knock out, knock down, or otherwise modify one or more genes include using site-specific nucleases, including, for example, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), meganucleases, transposases, and clustered regularly interspaced short palindromic repeats (CRISPR) / Cas systems.

[0375] ZFNs are fusion proteins containing a series of site-specific DNA-binding domains, adapted from zinc finger-containing transcription factors, linked to the endonuclease domain of the bacterial FokI restriction enzyme. ZFNs can have one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) DNA-binding or zinc finger domains. See, for example, Carroll et al., Genetics Society of America (2011) 188:773-782; Kim et al., Proc. Natl. Acad. Sci. USA (1996) 93:1156-1160. Each zinc finger domain is a small protein structural motif stabilized by one or more zinc ions and typically recognizes a 3-4 bp DNA sequence. Thus, tandem domains can potentially bind to extended nucleotide sequences unique within a cell's genome.

[0376] Various zinc fingers with known specificities can be combined to create multi-finger polypeptides that recognize sequences of approximately 6, 9, 12, 15, or 18 bp. Various selection and modular assembly techniques are available for creating zinc fingers (and combinations thereof) that recognize specific sequences, including fuzzy display, yeast one-hybrid systems, bacterial one-hybrid and two-hybrid systems, and mammalian cells. Zinc fingers can be engineered to bind to specific nucleic acid sequences. Conditions for engineering zinc fingers to bind to specific nucleic acid sequences are known in the art. See, for example, Sera et al., Biochemistry (2002) 41:7074-7081; Liu et al., Bioinformatics (2008) 24:1850-1857.

[0377] ZFNs containing a FokI nuclease domain or other dimeric nuclease domains function as dimers. Therefore, a pair of ZFNs is required to target non-palindromic DNA sites. Two individual ZFNs must bind to opposite strands of DNA with their nucleases appropriately spaced apart. See Bitinaite et al., Proc. Natl. Acad. Sci. USA (1998) 95:10570-10575. To cleave a specific site in the genome, a pair of ZFNs is designed to recognize two sequences flanking the site, one on the forward strand and the other on the reverse strand. When the ZFNs bind to both sides of the site, the nuclease domains dimerize and cleave the DNA at the site, creating a DSB with a 5' overhang. HDR can then be used to introduce a specific mutation using a repair template containing the desired mutation flanked by homology arms. The repair template is typically an exogenous double-stranded DNA vector introduced into cells. Miller et al., Nat. Biotechnol. (2011) 29:143-148; Hockemeyer et al., Nat. Biotechnol. (2011) 29:731- See 734.

[0378] TALENs are another example of artificial nucleases that can be used to edit target genes. TALENs are derived from a DNA-binding domain called a TALE repeat, which typically contains tandem arrays of 10-30 repeats that bind to and recognize extended DNA sequences. Each repeat is 33-35 amino acids long and contains two adjacent amino acids (called a repeating variable dinucleotide, or RVD) that confer specificity for one of four DNA base pairs. Thus, there is a one-to-one correspondence between the repeat and the base pairs of the target DNA sequence.

[0379] TALENs are artificially created by fusing one or more TALE DNA binding domains (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) with a nuclease domain, such as a FokI endonuclease domain. See Zhang, Nature Biotech. (2011) 29:149-153. Several mutations to FokI have been created for use in TALENs, which improve, for example, cleavage specificity or activity. See Cermak et al., Nucl. Acids Res. (2011) 39:e82; Miller et al., Nature Biotech. (2011) 29:143-148; Hockemeyer et al., Nature Biotech. (2011) 29:731-734; Wood et al., Science (2011) 333:307; Doyon et al., Nature Methods (2010) 8:74-79; Szczepek et al., Nature Biotech (2007) 25:786-793; Guo et al., J. Mol. Biol. (2010) 200:96. The FokI domain functions as a dimer, requiring two constructs with unique DNA-binding domains properly positioned and spaced to target genomic sites. Both the number of amino acid residues between the TALE DNA binding domain and the FokI nuclease domain and the number of bases between two individual TALEN binding sites appear to be important parameters for achieving high levels of activity. Miller et al., Nature Biotech. (2011) 29:143-148.

[0380] By combining engineered TALE repeats with nuclease domains, site-specific nucleases specific to any desired DNA sequence can be created.Similar to ZFNs, TALENs can be introduced into cells to generate DSBs at desired target sites in the genome, and can therefore be used to knock out genes or knock in mutations in a similar HDR-mediated pathway.Boch, Nature Biotech.(2011) 29:135-136; Boch et al., Science (2009) 326:1509-1512; Moscou et al., See Science (2009) 326:3501.

[0381] Meganucleases are enzymes of the endonuclease family characterized by their ability to recognize and cleave large DNA sequences (14-40 base pairs). Meganucleases are classified into families based on their structural motifs that affect nuclease activity and / or DNA recognition. The most widespread and best-known meganucleases are the LAGLIDADG family of proteins, whose names are derived from conserved amino acid sequences. See Chevalier et al., Nucleic Acids Res. (2001) 29(18):3757-3774. On the other hand, GIY-YIG family members have GIY-YIG modules that are 70-100 residues long and contain four or five conserved sequence motifs with four invariant residues, two of which are required for activity. See Van Roey et al., Nature Struct. Biol. (2002) 9:806-811. His-Cys family meganucleases are characterized by highly conserved sequences of histidine and cysteine ​​over a region encompassing several hundred amino acid residues. See Chevalier et al., Nucleic Acids Res. (2001) 29(18):3757-3774. Members of the NHN family are defined by a motif containing two pairs of conserved histidines surrounded by asparagine residues. See Chevalier et al., Nucleic Acids Res. (2001) 29(18):3757-3774.

[0382] Because the high specificity required makes it unlikely to identify a natural meganuclease for a particular target DNA sequence, various methods, including mutagenesis and high-throughput screening methods, have been used to generate meganuclease variants that recognize unique sequences. For example, strategies are known in the art for developing meganucleases with altered DNA-binding specificity to bind to predetermined nucleic acid sequences. For example, Chevalier et al., Mol. Cell. (2002) 10:895-905, Epinat et al., Nucleic Acids Res (2003) 31:2952-2962, Silva et al., J Mol. Biol. (2006) 361:744-754, Seligman et al., Nucleic Acids Res(2002) 30:3870-3879, Sussman et al., J Mol Biol (2004) 342:31-41, Doyon et al., J Am Chem Soc(2006) 128:2477-2484, Chen et al., Protein Eng Des Sel(2009) 22:249-256, Arnould et al. al., J Mol See Biol. (2006) 355:443-458; Smith et al., Nucleic Acids Res. (2006) 363(2):283-294.

[0383] Similar to ZFN and TALEN, meganucleases can generate DSBs in genomic DNA, which can cause frameshift mutations when improperly repaired, for example, by NHEJ, thereby reducing the expression of target genes in cells. Alternatively, foreign DNA can be introduced into cells together with meganucleases. Depending on the sequence of foreign DNA and chromosomal sequence, this process can be used to modify target genes. See Silva et al., Current Gene Therapy (2011) 11:11-27.

[0384] Transposase is an enzyme that binds to the end of a transposon and catalyzes its transfer to another part of the genome by a cut-and-paste mechanism or a replicative transposition mechanism. By linking transposase to other systems, such as the CRISPER / Cas system, new gene editing tools can be developed to enable site-specific insertion or manipulation of genomic DNA. There are two known DNA integration methods using transposons: they use catalytically inactive Cas effector proteins and Tn7-like transposons. Transposase-dependent DNA integration does not induce DSBs in the genome, which can ensure safer and more specific DNA integration.

[0385] The CRISPR system was first discovered in prokaryotes (e.g., bacteria and archaea) as a system providing a form of adaptive immunity involved in defense against invading phages and plasmids, and is now being adapted and used as a common gene editing tool in research and clinical applications.

[0386] CRISPR / Cas systems typically include at least two components: one or more guide RNAs (gRNAs) and a Cas protein. The Cas protein is a nuclease that introduces DSBs at target sites. CRISPR-Cas systems are classified into two major classes: Class 1 systems use a complex of multiple Cas proteins to degrade nucleic acids, while Class 2 systems use a single large Cas protein for the same purpose. Class 1 systems are divided into types I, III, and IV, while Class 2 systems are divided into types II, V, and VI. Various Cas proteins suitable for gene editing applications include, but are not limited to, Cas3, Cas4, Cas5, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas12, Cas12a (Cpf1), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12f (C2 Cas12c10), Cas12g, Cas12h, Cas12i, Cas12k (C2c5), Cas13, Cas13a (C2c2), Cas13b, Cas13c, Cas13d, C2c4, C2c8, C2c9, Cmr5, Cse1, Cse2, Csf1, Csm2, Csn2, Csx10, Csx11, Csy1, Csy2, Csy3, and Mad7. The most widely used Cas protein is Type II Cas9, and is described herein as an example. These Cas proteins can be derived from different source species. For example, Cas9 can be derived from S. pyogenes or S. aureus.

[0387] In the original microbial genome, the type II CRISPR system integrates sequences from the invaded DNA between CRISPR repeat sequences encoded as an array in the host genome. Transcripts from the CRISPR repeat array are processed into CRISPR RNAs (crRNAs), each of which contains a variable sequence known as a "protospacer" sequence transcribed from the invaded DNA and a portion of the CRISPR repeat. Each crRNA hybridizes with a second trans-activating CRISPR RNA (tracrRNA), and these two RNAs form a complex with the Cas9 nuclease. The protospacer-encoded portion of the crRNA guides the Cas9 complex to cleave complementary target DNA sequences, provided the complementary target DNA sequences are flanked by short sequences known as "protospacer adjacent motifs" (PAMs).

[0388] Since its discovery, the CRISPR system has been applied to induce sequence-specific DSBs and targeted genome editing in a wide range of cells and organisms, from bacteria to eukaryotic cells, including human cells. In gene editing applications, an artificially designed synthetic gRNA replaces the native crRNA:tracrRNA complex. For example, the gRNA can be a single guide RNA (sgRNA) composed of a crRNA, a tetraloop, and a tracrRNA. The crRNA typically contains a user-designed complementary region (also called a spacer, typically approximately 20 nucleotides in length) designed to recognize the target DNA of interest. The tracrRNA sequence contains a scaffold region for Cas nuclease binding. The crRNA and tracrRNA sequences are connected by a tetraloop and each contains a short repeat sequence for hybridization with the other, thereby generating a chimeric sgRNA. The genome target of the Cas nuclease can be changed by simply modifying the spacer or complementary region sequence present in the gRNA. The complementary region guides the Cas nuclease to the target DNA site by standard RNA-DNA complementary base-pairing rules.

[0389] For Cas nucleases to function, a PAM must be present immediately downstream of the target sequence in genomic DNA. Recognition of the PAM by the Cas protein is thought to destabilize the adjacent genomic sequence, allowing the gRNA to interrogate the sequence and, if a matching sequence is present, result in gRNA-DNA pairing. The specific sequence of the PAM varies depending on the species of the Cas gene. For example, the most commonly used Cas9 nuclease from S. pyogenes recognizes a PAM sequence of 5'-NGG-3' or, less efficiently, a PAM sequence of 5'-NAG-3', where "N" can be any nucleotide. Other Cas nuclease variants with alternative PAMs have also been characterized and successfully used for genome editing; these are summarized in Table 1a below. Table 5. Exemplary Cas nuclease variants and their PAM sequences. [Table 5]

[0390] In some embodiments, Cas nucleases can contain one or more mutations to alter their activity, specificity, recognition, and / or other characteristics. For example, a Cas nuclease can have one or more mutations that alter its fidelity to mitigate off-target effects (e.g., eSpCas9, SpCas9-HF1, HypaSpCas9, HeFSpCas9, and evoSpCas9 high-fidelity variants of SpCas9). In another example, a Cas nuclease can have one or more mutations that alter its PAM specificity.

[0391] In some embodiments, the Cas protein comprises any of the Cas proteins described herein or functional portions thereof. As used herein, "functional portion" refers to a portion of a peptide that retains the peptide's ability to form a complex with at least one ribonucleic acid (e.g., a guide RNA (gRNA)) and cleave a target polynucleotide sequence. In some embodiments, the functional portion comprises a combination of operably linked Cas9 protein functional domains selected from the group consisting of a DNA-binding domain, at least one RNA-binding domain, a helicase domain, and an endonuclease domain. In some embodiments, the functional portion comprises a combination of operably linked Cas12a (also known as Cpfl) protein functional domains selected from the group consisting of a DNA-binding domain, at least one RNA-binding domain, a helicase domain, and an endonuclease domain. In some embodiments, the functional domains form a complex. In some embodiments, the functional portion of the Cas9 protein comprises a functional portion of a RuvC-like domain. In some embodiments, the functional portion of the Cas9 protein comprises a functional portion of an HNH nuclease domain. In some embodiments, the functional portion of the Cas12a protein comprises a functional portion of a RuvC-like domain.

[0392] In some embodiments, suitable Cas proteins include, but are not limited to, Cas0, Cas12a (i.e., Cpf1), Cas12b, Cas12i, CasX, and Mad7.

[0393] In some embodiments, the exogenous Cas protein can be introduced into cells in the form of a polypeptide. In certain embodiments, the Cas protein can be conjugated or fused to a cell-penetrating polypeptide or a cell-penetrating peptide. As used herein, "cell-penetrating polypeptide" and "cell-penetrating peptide" refer to a polypeptide or peptide, respectively, that facilitates the uptake of a molecule into a cell. The cell-penetrating polypeptide can contain a detectable label.

[0394] In certain embodiments, the Cas protein may be conjugated or fused to a charged protein (e.g., one with a positive, negative, or overall neutral charge). Such attachment may be covalent. In some embodiments, the Cas protein may be fused to a superpositively charged GFP to significantly enhance the ability of the Cas protein to penetrate cells (Cronican et al. ACS Chem Biol. 2010;5(8):747-52). In certain embodiments, the Cas protein may be fused to a protein transduction domain (PTD) to facilitate entry of the Cas protein into cells. Exemplary PTDs include Tat, oligoarginines, and penetratin. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to a cell-penetrating peptide. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to a PTD. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to a Tat domain. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to an oligoarginine domain. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to a penetratin domain. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to a positively supercharged GFP. In some embodiments, the Cas12a protein comprises a Cas12a polypeptide fused to a cell-penetrating peptide. In some embodiments, the Cas12a protein comprises a Cas12a polypeptide fused to a PTD. In some embodiments, the Cas12a protein comprises a Cas12a polypeptide fused to a tat domain. In some embodiments, the Cas12a protein comprises a Cas12a polypeptide fused to an oligoarginine domain. In some embodiments, the Cas12a protein comprises a Cas12a polypeptide fused to a penetratin domain. In some embodiments, the Cas12a protein comprises a Cas12a polypeptide fused to a positively supercharged GFP.

[0395] In some embodiments, the Cas protein may be introduced into a cell containing a target polynucleotide sequence in the form of a nucleic acid encoding the Cas protein. The process of introducing the nucleic acid into the cell may be accomplished by any suitable technique. Suitable techniques include calcium phosphate or lipid-mediated transfection, electroporation, and transduction or infection using a viral vector. In some embodiments, the nucleic acid comprises DNA. In some embodiments, the nucleic acid comprises modified DNA as described herein. In some embodiments, the nucleic acid comprises mRNA. In some embodiments, the nucleic acid comprises modified mRNA (e.g., synthetic modified mRNA) as described herein.

[0396] In provided embodiments, a CRISPR / Cas system typically includes two components: one or more guide RNAs (gRNAs) and a Cas protein. In some embodiments, the Cas protein is complexed with one or more, e.g., one to two, ribonucleic acids (e.g., guide RNAs (gRNAs)). In some embodiments, the Cas protein is complexed with two ribonucleic acids. In some embodiments, the Cas protein is complexed with one ribonucleic acid. In some embodiments, the Cas protein is encoded by a modified nucleic acid (e.g., a synthetic, modified mRNA) as described herein.

[0397] In some embodiments, the gRNA is a synthetic short RNA consisting of a scaffold sequence for Cas binding and a user-designed spacer or complementary portion called the crRNA. The cRNA consists of a crRNA targeting sequence (hereinafter also referred to as the gRNA targeting sequence; typically about 20 nucleotides in length) that defines the genomic target to be modified and a region of crRNA repeats (e.g., GUUUUAGAGCUA; SEQ ID NO: 19). The genomic target of the Cas protein can be changed by simply changing the sequence of the complementary portion present in the gRNA (e.g., the gRNA targeting sequence). In some embodiments, the scaffold sequence for Cas binding is composed of the tracrRNA sequence (e.g., UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU; SEQ ID NO: 20), and the tracrRNA hybridizes to the crRNA via its anti-repeat sequence. The crRNA:tracrRNA complex recruits a Cas nuclease (e.g., Cas9) that cleaves upstream of a protospacer adjacent motif (PAM). For the Cas protein to function, a PAM must be present immediately downstream of the target sequence in genomic DNA. Recognition of the PAM by the Cas protein is thought to destabilize the adjacent genomic sequence, allowing the gRNA to interrogate the sequence and, if a matching sequence is present, result in gRNA-DNA pairing. The specific sequence of the PAM varies depending on the species of the Cas gene. For example, the most commonly used Cas9 nuclease from S. pyogenes recognizes the NGG PAM sequence. Other Cas9 variants and other nucleases with alternative PAMs have also been characterized and successfully used in genome editing. Thus, the CRISPR / Cas system can be used to generate targeted DSBs at specific genomic locations complementary to a gRNA designed for that location. The crRNA and tracrRNA can be linked together by a loop sequence (e.g., a tetraloop; GAAA) to create a gRNA that is a chimeric single-stranded guide RNA (sgRNA; Hsu et al. 2013).

[0398] In some embodiments, the sequence of the complementary portion of the gRNA (e.g., gRNA targeting sequence) varies depending on the target site of interest. In some embodiments, the gRNA comprises a complementary portion specific to the sequence of a gene listed in Table 1a. In some embodiments, the genomic locus targeted by the gRNA is within 4000 bp, within 3500 bp, within 3000 bp, within 2500 bp, within 2000 bp, within 1500 bp, within 1000 bp, or within 500 bp of any of the listed loci.

[0399] The methods disclosed herein contemplate the use of any ribonucleic acid that can guide and hybridize a Cas protein to a target motif in a target polynucleotide sequence. In some embodiments, at least one of the ribonucleic acids comprises:

[0400] In some embodiments, the Cas protein is complexed with one to two ribonucleic acids (e.g., guide RNAs (gRNAs)). In some embodiments, the Cas protein is complexed with two ribonucleic acids. In some embodiments, the Cas protein is complexed with one ribonucleic acid. In some embodiments, the Cas protein is encoded by a modified nucleic acid (e.g., a synthetic, modified mRNA) as described herein.

[0401] The methods disclosed herein contemplate the use of any ribonucleic acid capable of directing and hybridizing a Cas...

Claims

1. (a) one or more extracellular domains; (b) one or more membrane tethers; and a nucleic acid construct comprising one or more nucleic acid sequences encoding an engineered protein comprising: the one or more extracellular domains comprise a signal-regulatory protein alpha (SIRPα)-interacting motif; The nucleic acid construct does not contain a nucleic acid sequence encoding one or more full-length CD47 intracellular domains.

2. 2. The nucleic acid construct of claim 1, wherein the SIRPα interaction motif is or comprises the CD47 extracellular domain or a portion thereof.

3. The nucleic acid construct of claim 2, wherein the CD47 extracellular domain is or comprises a CD47 immunoglobulin variable (IgV)-like domain.

4. The nucleic acid construct of claim 1 or 2, wherein the CD47 extracellular domain is a human CD47 extracellular domain.

5. The nucleic acid construct of any one of claims 2 to 4, wherein the CD47 extracellular domain is encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

52.

6. The nucleic acid construct of any one of claims 2 to 4, wherein the CD47 extracellular domain is encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

53.

7. The nucleic acid construct of any one of claims 2 to 4, wherein the CD47 extracellular domain is encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

57.

8. The nucleic acid construct of any one of claims 2 to 4, wherein the CD47 extracellular domain is encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

59.

9. 2. The nucleic acid construct of claim 1, wherein the SIRPα interaction motif is or comprises a SIRPα antibody or a portion thereof.

10. 10. The nucleic acid construct of claim 1, wherein the one or more membrane tethers are or comprise a transmembrane domain.

11. 11. The nucleic acid construct of claim 10, wherein the transmembrane domain is or comprises the transmembrane domain of CD3ζ, CD8a, CD16a, CD28, CD32a, CD32c, CD40, CD47, CD64, ICOS, Dectin 1, DNGR1, EGFR, GPCR, MyD88, PDGFR, SLAMF7, TRL1, TLR2, TLR3, TRL4, TLR5, TLR6, TLR7, TLR8, TLR9, or VEGFR.

12. 12. The nucleic acid construct of claim 10 or 11, wherein the transmembrane domain is or comprises a CD47 transmembrane domain.

13. The nucleic acid construct of any one of claims 10 to 12, wherein the transmembrane domain is encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

54.

14. The nucleic acid construct of any one of claims 10 to 12, wherein the transmembrane domain is encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

56.

15. The nucleic acid construct of any one of claims 10 to 12, wherein the transmembrane domain is encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

58.

16. The nucleic acid construct of any one of claims 10 to 12, wherein the transmembrane domain is encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

60.

17. The nucleic acid construct of any one of claims 10 to 12, wherein the transmembrane domain is encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

62.

18. 12. The nucleic acid construct of claim 10 or 11, wherein the transmembrane domain is or comprises a CD8a transmembrane domain.

19. 19. The nucleic acid construct of claim 10, 11, or 18, wherein the transmembrane domain is encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

69.

20. 12. The nucleic acid construct of claim 10 or 11, wherein the transmembrane domain is or comprises a CD28 transmembrane domain.

21. 21. The nucleic acid construct of claim 10, 11, or 20, wherein the transmembrane domain is encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

71.

22. 12. The nucleic acid construct of claim 10 or 11, wherein the transmembrane domain is or comprises a PDGFR transmembrane domain.

23. 23. The nucleic acid construct of claim 10, 11, or 22, wherein the transmembrane domain is encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

73.

24. 10. The nucleic acid construct of claim 1, wherein the one or more membrane tethers is or comprises a glycosylphosphatidylinositol (GPI) anchor.

25. 25. The nucleic acid construct of claim 24, wherein the GPI anchor is or comprises a DAF / CD55 GPI anchor, a TRAILR3 GPI anchor, or a CD59 GPI anchor.

26. 26. The nucleic acid construct of claim 24 or 25, wherein the GPI anchor is or comprises a DAF / CD55 GPI anchor.

27. The nucleic acid construct of any one of claims 24 to 26, wherein the DAF / CD55 GPI anchor is encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

65.

28. 26. The nucleic acid construct of claim 24 or 25, wherein the GPI anchor is or comprises a TRAILR3 GPI anchor.

29. 29. The nucleic acid construct of any one of claims 24, 25, or 28, wherein the TRAILR3 GPI anchor is encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

66.

30. 29. The nucleic acid construct of any one of claims 24, 25, or 28, wherein the TRAILR3 GPI anchor is encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

67.

31. 26. The nucleic acid construct of claim 24 or 25, wherein the GPI anchor is or comprises a CD59 GPI anchor.

32. 32. The nucleic acid construct of any one of claims 24, 25, or 31, wherein the CD59 GPI anchor is encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

68.

33. 25. The nucleic acid construct of any one of claims 1 to 24, further comprising one or more regulatory sequences.

34. 34. The nucleic acid construct of claim 33, wherein the one or more regulatory sequences encode an extracellular signal peptide.

35. 35. The nucleic acid construct of claim 33 or 34, wherein the extracellular signal peptide is encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

51.

36. 34. The nucleic acid construct of claim 33, wherein the one or more control sequences comprises a promoter.

37. 37. The nucleic acid construct of claim 36, wherein the promoter is a constitutive promoter or an inducible promoter.

38. 38. The nucleic acid construct of claim 36 or 37, wherein the promoter is a naturally occurring promoter, a hybrid promoter, or a synthetic promoter.

39. The promoter may be an EF1α promoter, an EF1α short promoter, a CAG promoter, a ubiquitin / S27a promoter, an SV40 early promoter, an adenovirus major late promoter, a mouse metallothionein-I promoter, an RSV promoter, an MMTV promoter, a Moloney murine leukemia virus, a long terminal repeat region, a CMV promoter, an actin promoter, an immunoglobulin promoter, a heat shock promoter, a polyomavirus promoter, a fowlpox virus promoter, a bovine papilloma virus promoter, an avian sarcoma virus promoter, or a ribosomal protein promoter.

39. The nucleic acid construct of any one of claims 36 to 38, which is or comprises a motor, a retrovirus promoter, a hepatitis B virus promoter, a PGK promoter, an adenovirus late promoter, a vaccinia virus 7.5K promoter, an SV40 promoter, an HSV tk promoter, a mouse mammary tumor virus (MMTV) promoter, an HIV LTR promoter, a Moloney virus promoter, an Epstein-Barr virus (EBV) promoter, a Rous sarcoma virus (RSV) promoter, a U6 promoter, or a UBC promoter.

40. 40. The nucleic acid construct of any one of claims 36 to 39, wherein the promoter is or comprises a CAG promoter.

41. 41. The nucleic acid construct of any one of claims 36 to 40, wherein the promoter comprises a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

49.

42. 40. The nucleic acid construct of any one of claims 36 to 39, wherein the promoter is or comprises an EF1α promoter.

43. 43. The nucleic acid construct of any one of claims 36 to 40 or 42, wherein the promoter comprises a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

50.

44. 34. The nucleic acid construct of claim 33, wherein the one or more control sequences comprise a ribosome binding site, an enhancer element, an activator element, a translation initiation sequence, a translation termination sequence, a transcription initiation sequence, a transcription termination sequence, a polyadenylation signal sequence, a replication element, an RNA processing and transport element, a transposon sequence, a transposase sequence, an insulator sequence, an internal ribosome entry site (IRES), a 5' UTR, a 3' UTR, an mRNA 3' end processing sequence, a boundary element, a locus control region (LCR), a matrix attachment region (MAR), a sequence for recombination or cassette exchange, a linker sequence, a secretion signal, a resistance marker, an anchor peptide, a localization signal, a fusion tag, an affinity tag, a chaperonin, a protease, or a combination thereof.

45. 45. The nucleic acid construct of any one of claims 1 to 44, wherein the one or more extracellular domains further comprise an extracellular hinge domain.

46. 46. ​​The nucleic acid construct of claim 45, wherein the extracellular hinge domain is or comprises a CD47 hinge, a CD8a hinge, a CD28 hinge, a PDGFR hinge, or an IgG4 hinge.

47. 47. The nucleic acid construct of claim 45 or 46, wherein the extracellular hinge domain is or comprises a CD47 hinge.

48. 48. The nucleic acid construct of any one of claims 45 to 47, wherein the extracellular hinge domain is encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

75.

49. 47. The nucleic acid construct of claim 45 or 46, wherein the extracellular hinge domain is or comprises a CD8a hinge.

50. 50. The nucleic acid construct of claim 45, 46, or 49, wherein the extracellular hinge domain is encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

76.

51. 47. The nucleic acid construct of claim 45 or 46, wherein the extracellular hinge domain is or comprises a CD28 hinge.

52. 4. The nucleic acid construct of claim 45, 46, or 7f51, wherein the extracellular hinge domain is encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

77.

53. 47. The nucleic acid construct of claim 45 or 46, wherein the extracellular hinge domain is or comprises a PDGFR hinge.

54. 54. The nucleic acid construct of claim 45, 46, or 53, wherein the extracellular hinge domain is encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

78.

55. 47. The nucleic acid construct of claim 45 or 46, wherein the extracellular hinge domain is or comprises an IgG4 hinge.

56. 56. The nucleic acid construct of claim 45, 46, or 55, wherein the extracellular hinge domain is encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

79.

57. 10. The nucleic acid construct of any one of the preceding claims, further comprising one or more nucleic acid sequences encoding an intracellular domain.

58. 58. The nucleic acid construct of claim 57, wherein the intracellular domain is or comprises a CD47 intracellular domain or a portion thereof.

59. 59. The nucleic acid construct of claim 57 or 58, wherein the intracellular domain is encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

55.

60. 59. The nucleic acid construct of claim 57 or 58, wherein the intracellular domain is encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

59.

61. 59. The nucleic acid construct of claim 57 or 58, wherein the intracellular domain is encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

63.

62. 59. The nucleic acid construct of claim 57 or 58, wherein the intracellular domain is encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

64.

63. 58. The nucleic acid construct of claim 57, wherein the intracellular domain is or comprises a CD8a intracellular domain or a portion thereof.

64. 64. The nucleic acid construct of claim 57 or 63, wherein the intracellular domain is encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

70.

65. 58. The nucleic acid construct of claim 57, wherein the intracellular domain is or comprises the CD28 intracellular domain or a portion thereof.

66. 59. The nucleic acid construct of claim 57 or 58, wherein the intracellular domain is encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

72.

67. 58. The nucleic acid construct of claim 57, wherein the intracellular domain is or comprises a PDGFR intracellular domain or a portion thereof.

68. 68. The nucleic acid construct of claim 57 or 67, wherein the intracellular domain is encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

74.

69. 69. The nucleic acid construct of any one of claims 57 to 68, wherein the intracellular domain comprises one or more modifications compared to the wild-type CD47 intracellular domain.

70. 70. The nucleic acid construct of any one of claims 57 to 69, wherein the intracellular domain comprises one or more deletions compared to the wild-type CD47 intracellular domain.

71. 70. The nucleic acid construct of any one of claims 57 to 69, wherein the intracellular domain comprises one or more insertions compared to the wild-type CD47 intracellular domain.

72. 72. The nucleic acid construct of any one of claims 57 to 71, wherein the intracellular domain comprises an altered function compared to the wild-type CD47 intracellular domain.

73. 73. The nucleic acid construct of any one of claims 57 to 72, wherein the intracellular domain comprises a reduced function compared to a wild-type CD47 intracellular domain.

74. 74. The nucleic acid construct of any one of claims 57 to 73, wherein the intracellular domain comprises a reduced level of CD47 intracellular signaling compared to a wild-type CD47 intracellular domain.

75. The nucleic acid construct of any one of claims 57 to 74, wherein the intracellular domain comprises a non-functional intracellular domain.

76. 31. A nucleic acid construct according to any one of the preceding claims, comprising a nucleic acid sequence that is at least 80% identical to a sequence selected from Table 31.

77. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

13.

78. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

14.

79. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

18.

80. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

133.

81. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

134.

82. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

135.

83. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

136.

84. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

137.

85. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

138.

86. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

139.

87. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

140.

88. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

141.

89. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

142.

90. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

143.

91. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

144.

92. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

145.

93. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

146.

94. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

147.

95. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

148.

96. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

149.

97. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

150.

98. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

151.

99. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

152.

100. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

153.

101. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

154.

102. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

155.

103. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

156.

104. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

157.

105. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

158.

106. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

159.

107. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

160.

108. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

161.

109. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

162.

110. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

163.

111. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

164.

112. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

165.

113. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

166.

114. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

167.

115. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

168.

116. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

169.

117. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

170.

118. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

171.

119. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

172.

120. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

173.

121. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

174.

122. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

175.

123. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

176.

124. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

177.

125. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

178.

126. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

179.

127. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

180.

128. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

181.

129. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

182.

130. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

183.

131. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

184.

132. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

185.

133. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

341.

134. 77. The nucleic acid construct of any one of claims 1 to 76, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

342.

135. 69. The nucleic acid construct of any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to one or more sequences selected from Table 33.

136. 10. A nucleic acid construct according to any one of the preceding claims, comprising one or more nucleic acid sequences that are at least 80% identical to one or more sequences selected from Table 33 and / or Table 31.

137. 69. A nucleic acid construct according to any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NO:49 and SEQ ID NO:

14.

138. 69. The nucleic acid construct of any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NO:

14.

139. 69. A nucleic acid construct according to any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NO:49 and SEQ ID NO:

13.

140. 69. The nucleic acid construct of any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NO:

13.

141. 69. A nucleic acid construct according to any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NO:49 and SEQ ID NO:

18.

142. 69. The nucleic acid construct of any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NO:

18.

143. 69. The nucleic acid construct of any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NOs: 51, 52, 54, 55, 56, and 57.

144. 69. The nucleic acid construct of any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NOs: 51, 52, 54, 55, and 56.

145. 69. The nucleic acid construct of any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NOs: 51, 52, 54, and 55.

146. 69. The nucleic acid construct of any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NOs: 51, 52, 54, 55, 56, 57, 58, 59, 60, 61, and 62.

147. 69. The nucleic acid construct of any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NOs: 51, 52, 54, 55, 56, 57, 58, 59, 60, and 61.

148. 69. The nucleic acid construct of any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NOs: 51, 52, 54, 55, 56, 57, 58, 59, and 60.

149. 69. The nucleic acid construct of any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NOs: 51, 52, 54, 55, 56, 57, 58, and 59.

150. 69. The nucleic acid construct of any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NOs: 49, 53, and 65.

151. 69. A nucleic acid construct according to any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NOs: 53 and 65.

152. 69. The nucleic acid construct of any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NOs: 49, 53, and 66.

153. 69. A nucleic acid construct according to any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NOs: 53 and 66.

154. 69. The nucleic acid construct of any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NOs: 49, 53, and 67.

155. 69. A nucleic acid construct according to any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NOs: 53 and 67.

156. 69. The nucleic acid construct of any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NOs: 49, 53, 69, and 70.

157. 69. The nucleic acid construct of any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NOs: 53, 69, and 70.

158. 10. The nucleic acid construct of any one of claims 1 to 8k, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NOs: 49, 53, 71, and 72.

159. 69. The nucleic acid construct of any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NOs: 53, 71, and 72.

160. 69. The nucleic acid construct of any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NOs: 49, 53, 73, and 74.

161. 69. The nucleic acid construct of any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NOs: 53, 73, and 74.

162. 69. The nucleic acid construct of any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NOs: 49, 52, 78, 73, and 74.

163. 69. The nucleic acid construct of any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NOs: 52, 78, 73, and 74.

164. 69. The nucleic acid construct of any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NOs: 49, 52, 79, 71, and 72.

165. 69. The nucleic acid construct of any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NOs: 52, 79, 71, and 72.

166. 69. The nucleic acid construct of any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NOs: 49, 52, 79, 69, and 70.

167. 69. The nucleic acid construct of any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NOs: 52, 79, 69, and 70.

168. 69. The nucleic acid construct of any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NOs: 49, 52, 77, 71, and 72.

169. 69. The nucleic acid construct of any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NOs: 52, 77, 71, and 72.

170. 69. The nucleic acid construct of any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NOs: 49, 52, 77, 69, and 70.

171. 69. The nucleic acid construct of any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NOs: 52, 77, 69, and 70.

172. 69. The nucleic acid construct of any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NOs: 49, 52, 76, 71, and 72.

173. 69. The nucleic acid construct of any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NOs: 52, 76, 71, and 72.

174. 69. The nucleic acid construct of any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NOs: 49, 52, 76, 69, and 70.

175. 69. The nucleic acid construct of any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NOs: 52, 76, 69, and 70.

176. 69. The nucleic acid construct of any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NOs: 49 and 200.

177. 69. The nucleic acid construct of any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NOs: 50 and 200.

178. 69. The nucleic acid construct of any one of claims 1 to 68, comprising one or more nucleic acid sequences that are at least 80% identical to SEQ ID NO:

200.

179. A vector comprising the nucleic acid construct of any one of claims 1 to 178.

180. 180. The vector of claim 179, wherein the vector is a polycistronic vector.

181. 181. The vector of claim 180, wherein the polycistronic vector is a bicistronic or tricistronic vector.

182. The vector of any one of claims 179 to 181, wherein the vector is a plasmid or a viral vector.

183. The vector of claim 182, wherein the viral vector is a pseudotyped, self-inactivating lentiviral vector.

184. 179. A genetically engineered protein encoded by the nucleic acid construct of any one of claims 1 to 178.

185. (a) one or more extracellular domains; (b) one or more membrane tethers; the one or more extracellular domains comprise a signal-regulatory protein alpha (SIRPα)-interacting motif; The genetically engineered protein does not comprise one or more full-length CD47 intracellular domains.

186. 186. The engineered protein of claim 185, wherein said SIRPα interaction motif is or comprises the CD47 extracellular domain or a portion thereof.

187. 187. The genetically engineered protein of claim 186, wherein the CD47 extracellular domain is a CD47 immunoglobulin variable (IgV)-like domain.

188. 187. The genetically engineered protein of claim 185 or 186, wherein the CD47 extracellular domain is a human CD47 extracellular domain.

189. 189. The engineered protein of any one of claims 186-188, wherein the CD47 extracellular domain comprises an amino acid sequence at least 80% identical to SEQ ID NO:

21.

190. 189. The engineered protein of any one of claims 186-188, wherein the CD47 extracellular domain comprises an amino acid sequence at least 80% identical to SEQ ID NO:

22.

191. 189. The engineered protein of any one of claims 186-188, wherein the CD47 extracellular domain comprises an amino acid sequence at least 80% identical to SEQ ID NO:

26.

192. 189. The engineered protein of any one of claims 186-188, wherein the CD47 extracellular domain comprises an amino acid sequence at least 80% identical to SEQ ID NO:

30.

193. 186. The engineered protein of claim 185, wherein said SIRPα interaction motif is or comprises a SIRPα antibody or portion thereof.

194. 194. The engineered protein of claim 193, wherein the SIRPα antibody or portion thereof comprises an amino acid sequence at least 80% identical to SEQ ID NO:

186.

195. 194. The engineered protein of claim 193, wherein the SIRPα antibody or portion thereof comprises an amino acid sequence at least 80% identical to SEQ ID NO:

187.

196. 194. The engineered protein of claim 193, wherein the SIRPα antibody or portion thereof comprises an amino acid sequence at least 80% identical to SEQ ID NO:

188.

197. 194. The engineered protein of claim 193, wherein the SIRPα antibody or portion thereof comprises an amino acid sequence at least 80% identical to SEQ ID NO:

189.

198. 194. The engineered protein of claim 193, wherein the SIRPα antibody or portion thereof comprises an amino acid sequence at least 80% identical to SEQ ID NO:

190.

199. 194. The engineered protein of claim 193, wherein the SIRPα antibody or portion thereof comprises an amino acid sequence at least 80% identical to SEQ ID NO:

191.

200. 194. The engineered protein of claim 193, wherein the SIRPα antibody or portion thereof comprises an amino acid sequence at least 80% identical to SEQ ID NO:

192.

201. 194. The engineered protein of claim 193, wherein the SIRPα antibody or portion thereof comprises an amino acid sequence at least 80% identical to SEQ ID NO:

193.

202. 194. The engineered protein of claim 193, wherein the SIRPα antibody or portion thereof comprises an amino acid sequence at least 80% identical to SEQ ID NO:

194.

203. 194. The engineered protein of claim 193, wherein the SIRPα antibody or portion thereof comprises an amino acid sequence at least 80% identical to SEQ ID NO:

195.

204. 194. The engineered protein of claim 193, wherein the SIRPα antibody or portion thereof comprises an amino acid sequence at least 80% identical to SEQ ID NO:

196.

205. 194. The engineered protein of claim 193, wherein the SIRPα antibody or portion thereof comprises an amino acid sequence at least 80% identical to SEQ ID NO:

197.

206. 194. The engineered protein of claim 193, wherein the SIRPα antibody or portion thereof comprises an amino acid sequence at least 80% identical to SEQ ID NO:

198.

207. 194. The engineered protein of any one of claims 185-193, wherein said one or more membrane tethers is or comprises a transmembrane domain.

208. 208. The engineered protein of claim 207, wherein said transmembrane domain is or comprises the transmembrane domain of CD3ζ, CD8a, CD16a, CD28, CD32a, CD32c, CD40, CD47, CD64, ICOS, Dectin 1, DNGR1, EGFR, GPCR, MyD88, PDGFR, SLAMF7, TRL1, TLR2, TLR3, TRL4, TLR5, TLR6, TLR7, TLR8, TLR9, or VEGFR.

209. 209. The genetically engineered protein of claim 207 or 208, wherein the transmembrane domain is or comprises a CD47 transmembrane domain.

210. 210. The engineered protein of any one of claims 207-209, wherein the transmembrane domain comprises an amino acid sequence at least 80% identical to SEQ ID NO:

23.

211. 210. The engineered protein of any one of claims 207-209, wherein the transmembrane domain comprises an amino acid sequence that is at least 80% identical to SEQ ID NO:

25.

212. 210. The engineered protein of any one of claims 207-209, wherein the transmembrane domain comprises an amino acid sequence at least 80% identical to SEQ ID NO:

27.

213. 210. The engineered protein of any one of claims 207 to 209, wherein the transmembrane domain comprises an amino acid sequence at least 80% identical to SEQ ID NO:

29.

214. 210. The engineered protein of any one of claims 207-209, wherein the transmembrane domain comprises an amino acid sequence at least 80% identical to SEQ ID NO:

31.

215. 209. The genetically engineered protein of claim 207 or 208, wherein the transmembrane domain is or comprises a CD8a transmembrane domain.

216. 216. The engineered protein of claim 207, 208, or 215, wherein the transmembrane domain comprises an amino acid sequence at least 80% identical to SEQ ID NO:

38.

217. 209. The genetically engineered protein of claim 207 or 208, wherein the transmembrane domain is or comprises a CD28 transmembrane domain.

218. 218. The engineered protein of claim 207, 208, or 217, wherein the transmembrane domain comprises an amino acid sequence at least 80% identical to SEQ ID NO:

40.

219. 209. The genetically engineered protein of claim 207 or 208, wherein the transmembrane domain is or comprises a PDGFR transmembrane domain.

220. 220. The engineered protein of claim 207, 208, or 219, wherein the transmembrane domain comprises an amino acid sequence at least 80% identical to SEQ ID NO:

42.

221. 194. The engineered protein of any one of claims 85-193, wherein the one or more membrane tethers is or comprises a glycosylphosphatidylinositol (GPI) anchor.

222. 222. The engineered protein of claim 221, wherein the GPI anchor is or comprises a DAF / CD55 GPI anchor, a TRAILR3 GPI anchor, or a CD59 GPI anchor.

223. 223. The genetically engineered protein of claim 221 or 222, wherein the GPI anchor is or comprises a DAF / CD55 GPI anchor.

224. 224. The engineered protein of any one of claims 221-223, wherein the DAF / CD55 GPI anchor comprises an amino acid sequence at least 80% identical to SEQ ID NO:

34.

225. 223. The engineered protein of claim 221 or 222, wherein the GPI anchor is or comprises a TRAILR3 GPI anchor.

226. 226. The engineered protein of any one of claims 221, 222, or 225, wherein the TRAILR3 GPI anchor comprises an amino acid sequence at least 80% identical to SEQ ID NO:

35.

227. 226. The engineered protein of any one of claims 221, 222, or 225, wherein the TRAILR3 GPI anchor comprises an amino acid sequence at least 80% identical to SEQ ID NO:

36.

228. 223. The genetically engineered protein of claim 221 or 222, wherein the GPI anchor is or comprises a CD59 GPI anchor.

229. 229. The engineered protein of any one of claims 221, 222, or 228, wherein the CD59 GPI anchor comprises an amino acid sequence at least 80% identical to SEQ ID NO:

37.

230. 222. The engineered protein of any one of claims 185 to 221, further comprising an extracellular signal peptide.

231. 231. The genetically engineered protein of claim 230, wherein the extracellular signal peptide is encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

20.

232. 232. The engineered protein of any one of claims 185-231, wherein the one or more extracellular domains further comprise an extracellular hinge domain.

233. 233. The genetically engineered protein of claim 232, wherein the extracellular hinge domain is or comprises a CD47 hinge, a CD8a hinge, a CD28 hinge, a PDGFR hinge, or an IgG4 hinge.

234. 232 or 17a, wherein the extracellular hinge domain is or comprises a CD47 hinge.

235. 235. The engineered protein of any one of claims 232-234, wherein the extracellular hinge domain comprises an amino acid sequence at least 80% identical to SEQ ID NO:

44.

236. 234. The engineered protein of claim 232 or 233, wherein the extracellular hinge domain is or comprises a CD8a hinge.

237. 237. The engineered protein of claim 232, 233, or 236, wherein the extracellular hinge domain comprises a nucleic acid sequence at least 80% identical to SEQ ID NO:

45.

238. 234. The genetically engineered protein of claim 232 or 233, wherein the extracellular hinge domain is or comprises a CD28 hinge.

239. 239. The engineered protein of claim 232, 233, or 238, wherein the extracellular hinge domain comprises an amino acid sequence at least 80% identical to SEQ ID NO:

46.

240. 234. The genetically engineered protein of claim 232 or 233, wherein the extracellular hinge domain is or comprises a PDGFR hinge.

241. 241. The engineered protein of claim 232, 233, or 240, wherein the extracellular hinge domain comprises an amino acid sequence at least 80% identical to SEQ ID NO:

47.

242. 234. The engineered protein of claim 232 or 233, wherein the extracellular hinge domain is or comprises an IgG4 hinge.

243. 243. The engineered protein of claim 232, 233, or 242, wherein the extracellular hinge domain comprises an amino acid sequence at least 80% identical to SEQ ID NO:

48.

244. 10. The engineered protein of any one of the preceding claims, further comprising an intracellular domain.

245. 245. The genetically engineered protein of claim 244, wherein the intracellular domain is or comprises the CD47 intracellular domain or a portion thereof.

246. 246. The genetically engineered protein of claim 244 or 245, wherein the intracellular domain comprises an amino acid sequence at least 80% identical to SEQ ID NO:

24.

247. 246. The genetically engineered protein of claim 244 or 245, wherein the intracellular domain comprises an amino acid sequence at least 80% identical to SEQ ID NO:

28.

248. 246. The genetically engineered protein of claim 244 or 245, wherein the intracellular domain comprises an amino acid sequence at least 80% identical to SEQ ID NO:

32.

249. 246. The genetically engineered protein of claim 244 or 245, wherein the intracellular domain comprises an amino acid sequence at least 80% identical to SEQ ID NO:

33.

250. 245. The engineered protein of claim 244, wherein the intracellular domain is or comprises the CD8a intracellular domain or a portion thereof.

251. 251. The genetically engineered protein of claim 244 or 250, wherein the intracellular domain comprises an amino acid sequence at least 80% identical to SEQ ID NO:

39.

252. 245. The genetically engineered protein of claim 244, wherein the intracellular domain is or comprises the CD28 intracellular domain or a portion thereof.

253. 246. The genetically engineered protein construct of claim 244 or 245, wherein the intracellular domain comprises an amino acid sequence at least 80% identical to SEQ ID NO:

41.

254. 245. The genetically engineered protein of claim 244, wherein the intracellular domain is or comprises a PDGFR intracellular domain or a portion thereof.

255. 255. The engineered protein of claim 244 or 254, wherein the intracellular domain comprises an amino acid sequence at least 80% identical to SEQ ID NO:

43.

256. 256. The engineered protein of any one of claims 244-255, wherein said intracellular domain comprises one or more modifications compared to the wild-type CD47 intracellular domain.

257. 257. The engineered protein of any one of claims 244-256, wherein said intracellular domain comprises one or more deletions compared to the wild-type CD47 intracellular domain.

258. 257. The engineered protein of any one of claims 244-256, wherein said intracellular domain comprises one or more insertions compared to the wild-type CD47 intracellular domain.

259. 259. The engineered protein of any one of claims 244-258, wherein the intracellular domain comprises an altered function compared to a wild-type CD47 intracellular domain.

260. 260. The engineered protein of any one of claims 244-259, wherein the intracellular domain comprises a reduced function compared to a wild-type CD47 intracellular domain.

261. 261. The engineered protein of any one of claims 244-260, wherein said intracellular domain comprises a reduced level of CD47 intracellular signaling compared to a wild-type CD47 intracellular domain.

262. 262. The engineered protein of any one of claims 244-261, wherein the intracellular domain comprises a non-functional intracellular domain.

263. 263. The engineered protein of any one of claims 185-262, comprising an amino acid sequence at least 80% identical to a sequence selected from Table 30.

264. 264. The engineered protein of any one of claims 185 to 263, comprising an amino acid sequence at least 80% identical to SEQ ID NO:

1.

265. 264. The engineered protein of any one of claims 185 to 263, comprising an amino acid sequence at least 80% identical to SEQ ID NO:

2.

266. 264. The engineered protein of any one of claims 185 to 263, comprising an amino acid sequence at least 80% identical to SEQ ID NO:

6.

267. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

80.

268. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

81.

269. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

82.

270. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

83.

271. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

84.

272. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

85.

273. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

86.

274. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

87.

275. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

88.

276. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

89.

277. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

90.

278. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

91.

279. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

92.

280. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

93.

281. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

94.

282. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

95.

283. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

96.

284. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

97.

285. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

98.

286. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

99.

287. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

100.

288. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

101.

289. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

102.

290. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

103.

291. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

104.

292. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

105.

293. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

106.

294. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

107.

295. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

108.

296. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

109.

297. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

110.

298. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

111.

299. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

112.

300. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

113.

301. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

114.

302. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

115.

303. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

116.

304. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

117.

305. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

118.

306. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

119.

307. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

120.

308. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

121.

309. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

122.

310. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

123.

311. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

124.

312. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

125.

313. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

126.

314. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

127.

315. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

128.

316. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

129.

317. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

130.

318. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

131.

319. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

132.

320. 264. The nucleic acid construct of any one of claims 185 to 263, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

340.

321. 256. The engineered protein of any one of claims 185-255, comprising one or more amino acid sequences that are at least 80% identical to one or more sequences selected from Table 32.

322. 10. The engineered protein of any one of the preceding claims, comprising one or more nucleic acid sequences that are at least 80% identical to one or more sequences selected from Table 32 and / or Table 30.

323. 256. The engineered protein of any one of claims 185-255, comprising one or more amino acid sequences at least 80% identical to SEQ ID NOs: 20, 21, 23, 24, 25, and 26.

324. 256. The engineered protein of any one of claims 185-255, comprising one or more amino acid sequences at least 80% identical to SEQ ID NOs: 20, 21, 23, 24, and 25.

325. 256. The engineered protein of any one of claims 185-255, comprising one or more amino acid sequences at least 80% identical to SEQ ID NOs: 20, 21, 23, and 24.

326. 256. The engineered protein of any one of claims 185-255, comprising one or more amino acid sequences at least 80% identical to SEQ ID NOs: 20, 21, 23, 24, 25, 26, 27, 28, 29, 30, and 31.

327. 256. The engineered protein of any one of claims 185-255, comprising one or more amino acid sequences at least 80% identical to SEQ ID NOs: 20, 21, 23, 24, 25, 26, 27, 28, 29, and 30.

328. 256. The engineered protein of any one of claims 185-255, comprising one or more amino acid sequences at least 80% identical to SEQ ID NOs: 20, 21, 23, 24, 25, 26, 27, 28, and 29.

329. 256. The engineered protein of any one of claims 185-255, comprising one or more amino acid sequences at least 80% identical to SEQ ID NOs: 20, 21, 23, 24, 25, 26, 27, and 28.

330. 256. The engineered protein of any one of claims 185-255, comprising one or more amino acid sequences that are at least 80% identical to SEQ ID NOs: 22 and 34.

331. 256. The engineered protein of any one of claims 185-255, comprising one or more amino acid sequences that are at least 80% identical to SEQ ID NOs: 22 and 35.

332. 256. The engineered protein of any one of claims 185-255, comprising one or more amino acid sequences that are at least 80% identical to SEQ ID NOs: 22 and 36.

333. 256. The engineered protein of any one of claims 185-255, comprising one or more amino acid sequences at least 80% identical to SEQ ID NOs: 22, 38, and 39.

334. 256. The engineered protein of any one of claims 185-255, comprising one or more amino acid sequences at least 80% identical to SEQ ID NOs: 22, 40, and 41.

335. 256. The engineered protein of any one of claims 185-255, comprising one or more amino acid sequences at least 80% identical to SEQ ID NOs: 22, 42, and 43.

336. 256. The engineered protein of any one of claims 185-255, comprising one or more amino acid sequences at least 80% identical to SEQ ID NOs: 21, 47, 42, and 43.

337. 256. The engineered protein of any one of claims 185-255, comprising one or more amino acid sequences at least 80% identical to SEQ ID NOs: 21, 48, 40, and 41.

338. 256. The engineered protein of any one of claims 185-255, comprising one or more amino acid sequences at least 80% identical to SEQ ID NOs: 21, 48, 38, and 39.

339. 256. The engineered protein of any one of claims 185-255, comprising one or more amino acid sequences at least 80% identical to SEQ ID NOs: 21, 46, 40, and 41.

340. 256. The engineered protein of any one of claims 185-255, comprising one or more amino acid sequences at least 80% identical to SEQ ID NOs: 21, 46, 38, and 39.

341. 256. The engineered protein of any one of claims 185-255, comprising one or more amino acid sequences at least 80% identical to SEQ ID NOs: 21, 45, 40, and 41.

342. 256. The engineered protein of any one of claims 185-255, comprising one or more amino acid sequences at least 80% identical to SEQ ID NOs: 21, 45, 38, and 39.

343. 343. The engineered protein of any one of claims 185-342, comprising fewer glycosylation modification sites compared to wild-type human CD47 protein.

344. The genetically engineered protein of claim 343, wherein the genetically engineered protein does not contain the N206 glycosylation site.

345. A genetically engineered cell comprising the genetically engineered protein of any one of claims 185-344.

346. 1. A genetically engineered cell comprising a first transgene encoding an engineered protein, the engineered protein is (a) one or more extracellular domains; (b) one or more membrane tethers; the one or more extracellular domains comprise a signal-regulatory protein alpha (SIRPα)-interacting motif; The genetically engineered cell, wherein the genetically engineered protein does not comprise one or more full-length CD47 intracellular domains.

347. 347. The genetically engineered cell of claim 346, wherein said SIRPα interaction motif is or comprises the CD47 extracellular domain or a portion thereof.

348. The genetically engineered cell of claim 347, wherein the CD47 extracellular domain is a CD47 immunoglobulin variable (IgV)-like domain.

349. The genetically engineered cell of claim 23 or 347, wherein the CD47 extracellular domain is a human CD47 extracellular domain.

350. 350. The genetically engineered cell of any one of claims 347-349, wherein said CD47 extracellular domain is encoded by said first transgene, said first transgene comprising a nucleic acid sequence at least 80% identical to SEQ ID NO:

52.

351. 350. The genetically engineered cell of any one of claims 347-349, wherein said CD47 extracellular domain is encoded by said first transgene, said first transgene comprising a nucleic acid sequence at least 80% identical to SEQ ID NO:

53.

352. 350. The genetically engineered cell of any one of claims 347-349, wherein the CD47 extracellular domain is encoded by a nucleic acid sequence at least 80% identical to SEQ ID NO:

57.

353. 350. The genetically engineered cell of any one of claims 347-349, wherein the CD47 extracellular domain is encoded by a nucleic acid sequence at least 80% identical to SEQ ID NO:

59.

354. 347. The genetically engineered cell of claim 346, wherein said SIRPα interaction motif is or comprises a SIRPα antibody or portion thereof.

355. 355. The genetically engineered cell of any one of claims 346-354, wherein said one or more membrane tethers is or comprises a transmembrane domain.

356. 356. The genetically engineered cell of claim 355, wherein said transmembrane domain is or comprises a transmembrane domain of CD3ζ, CD8a, CD16a, CD28, CD32a, CD32c, CD40, CD47, CD64, ICOS, Dectin 1, DNGR1, EGFR, GPCR, MyD88, PDGFR, SLAMF7, TRL1, TLR2, TLR3, TRL4, TLR5, TLR6, TLR7, TLR8, TLR9, or VEGFR.

357. 357. The genetically engineered cell of claim 355 or 356, wherein the transmembrane domain is or comprises a CD47 transmembrane domain.

358. 358. The genetically engineered cell of any one of claims 355-357, wherein said transmembrane domain is encoded by said first transgene, said first transgene comprising a nucleic acid sequence at least 80% identical to SEQ ID NO:

54.

359. 358. The genetically engineered cell of any one of claims 355-357, wherein said transmembrane domain is encoded by said first transgene, said first transgene comprising a nucleic acid sequence at least 80% identical to SEQ ID NO:

56.

360. 358. The genetically engineered cell of any one of claims 355-357, wherein said transmembrane domain is encoded by said first transgene, said first transgene comprising a nucleic acid sequence at least 80% identical to SEQ ID NO:

58.

361. 358. The genetically engineered cell of any one of claims 355-357, wherein said transmembrane domain is encoded by said first transgene, and said first transgene comprises a nucleic acid sequence at least 80% identical to SEQ ID NO:

60.

362. 358. The genetically engineered cell of any one of claims 355-357, wherein said transmembrane domain is encoded by said first transgene, said first transgene comprising a nucleic acid sequence at least 80% identical to SEQ ID NO:

62.

363. 357. The genetically engineered cell of claim 355 or 356, wherein the transmembrane domain is or comprises a CD8a transmembrane domain.

364. The genetically engineered cell of claim 355, 356, or 363, wherein the transmembrane domain is encoded by the first transgene, and the first transgene comprises a nucleic acid sequence at least 80% identical to SEQ ID NO:

69.

365. The genetically engineered cell of claim 355 or 356, wherein the transmembrane domain is or comprises a CD28 transmembrane domain.

366. The genetically engineered cell of claim 355, 356, or 365, wherein the transmembrane domain is encoded by the first transgene, and the first transgene comprises a nucleic acid sequence at least 80% identical to SEQ ID NO:

71.

367. 357. The genetically engineered cell of claim 355 or 356, wherein the transmembrane domain is or comprises a PDGFR transmembrane domain.

368. The genetically engineered cell of claim 355, 356, or 367, wherein the transmembrane domain is encoded by the first transgene, and the first transgene comprises a nucleic acid sequence at least 80% identical to SEQ ID NO:

73.

369. 355. The genetically engineered cell of any one of claims 346-354, wherein said one or more membrane tethers is or comprises a glycosylphosphatidylinositol (GPI) anchor.

370. 370. The genetically engineered cell of claim 369, wherein the GPI anchor is or comprises a DAF / CD55 GPI anchor, a TRAILR3 GPI anchor, or a CD59 GPI anchor.

371. 371. The genetically engineered cell of claim 369 or 370, wherein the GPI anchor is or comprises a DAF / CD55 GPI anchor.

372. 372. The genetically engineered cell of any one of claims 369-371, wherein the DAF / CD55 GPI anchor is encoded by the first transgene, and the first transgene comprises a nucleic acid sequence at least 80% identical to SEQ ID NO:

65.

373. 371. The genetically engineered cell of claim 369 or 370, wherein the GPI anchor is or comprises a TRAILR3 GPI anchor.

374. The genetically engineered cell of any one of claims 369, 370, or 373, wherein the TRAILR3 GPI anchor is encoded by the first transgene, and the first transgene comprises a nucleic acid sequence at least 80% identical to SEQ ID NO:

66.

375. The genetically engineered cell of any one of claims 369, 370, or 373, wherein the TRAILR3 GPI anchor is encoded by the first transgene, and the first transgene comprises a nucleic acid sequence at least 80% identical to SEQ ID NO:

67.

376. 371. The genetically engineered cell of claim 369 or 370, wherein the GPI anchor is or comprises a CD59 GPI anchor.

377. 377. The genetically engineered cell of any one of claims 369, 370, or 376, wherein the CD59 GPI anchor is encoded by the first transgene, and the first transgene comprises a nucleic acid sequence at least 80% identical to SEQ ID NO:

68.

378. 370. The genetically engineered cell of any one of claims 346-369, further comprising one or more regulatory sequences.

379. 379. The genetically engineered cell of claim 378, wherein said one or more regulatory sequences encode an extracellular signal peptide.

380. The genetically engineered cell of claim 378 or 379, wherein the extracellular signal peptide is encoded by the first transgene, and the first transgene comprises a nucleic acid sequence at least 80% identical to SEQ ID NO:

51.

381. The genetically engineered cell of claim 378, wherein the one or more regulatory sequences comprise a promoter.

382. 382. The genetically engineered cell of claim 381, wherein the promoter is a constitutive promoter or an inducible promoter.

383. 383. The genetically engineered cell of claim 381 or 382, ​​wherein the promoter is a naturally occurring promoter, a hybrid promoter, or a synthetic promoter.

384. The promoter may be an EF1α promoter, an EF1α short promoter, a CAG promoter, a ubiquitin / S27a promoter, an SV40 early promoter, an adenovirus major late promoter, a mouse metallothionein-I promoter, an RSV promoter, an MMTV promoter, a Moloney murine leukemia virus, a long terminal repeat region, a CMV promoter, an actin promoter, an immunoglobulin promoter, a heat shock promoter, a polyomavirus promoter, a fowlpox virus promoter, a bovine papilloma virus promoter, an avian sarcoma virus promoter, or a virion.

384. The genetically engineered cell of any one of claims 381-383, wherein the promoter is or comprises a promoter selected from the group consisting of a nucleotide sequence ...

385. 385. The genetically engineered cell of any one of claims 381-384, wherein the promoter is or comprises a CAG promoter.

386. 386. The genetically engineered cell of any one of claims 381-385, wherein said first transgene comprises said promoter, and said promoter comprises a nucleic acid sequence at least 80% identical to SEQ ID NO:

49.

387. 385. The genetically engineered cell of any one of claims 381-384, wherein the promoter is or comprises an EF1α promoter.

388. 388. The genetically engineered cell of any one of Claims 381-385 or 387, wherein said first transgene comprises said promoter, and said promoter comprises a nucleic acid sequence at least 80% identical to SEQ ID NO:

50.

389. 379. The genetically engineered cell of claim 378, wherein the one or more control sequences comprise a ribosome binding site, an enhancer element, an activator element, a translation initiation sequence, a translation termination sequence, a transcription initiation sequence, a transcription termination sequence, a polyadenylation signal sequence, a replication element, an RNA processing and transport element, a transposon sequence, a transposase sequence, an insulator sequence, an internal ribosome entry site (IRES), a 5' UTR, a 3' UTR, an mRNA 3' end processing sequence, a boundary element, a locus control region (LCR), a matrix attachment region (MAR), a sequence for recombination or cassette exchange, a linker sequence, a secretion signal, a resistance marker, an anchor peptide, a localization signal, a fusion tag, an affinity tag, a chaperonin, a protease, or a combination thereof.

390. 390. The genetically engineered cell of any one of claims 346-389, wherein said one or more extracellular domains further comprise an extracellular hinge domain.

391. 391. The genetically engineered cell of claim 390, wherein the extracellular hinge domain is or comprises a CD47 hinge, a CD8a hinge, a CD28 hinge, a PDGFR hinge, or an IgG4 hinge.

392. 392. The genetically engineered cell of claim 390 or 391, wherein the extracellular hinge domain is or comprises a CD47 hinge.

393. 393. The genetically engineered cell of any one of Claims 390-392, wherein said extracellular hinge domain is encoded by said first transgene, said first transgene comprising a nucleic acid sequence at least 80% identical to SEQ ID NO:

75.

394. 392. The genetically engineered cell of claim 390 or 391, wherein the extracellular hinge domain is or comprises a CD8a hinge.

395. The genetically engineered cell of claim 390, 391, or 394, wherein the extracellular hinge domain is encoded by the first transgene, and the first transgene comprises a nucleic acid sequence at least 80% identical to SEQ ID NO:

76.

396. 392. The genetically engineered cell of claim 390 or 391, wherein the extracellular hinge domain is or comprises a CD28 hinge.

397. The genetically engineered cell of claim 390, 391, or 396, wherein the extracellular hinge domain is encoded by the first transgene, and the first transgene comprises a nucleic acid sequence at least 80% identical to SEQ ID NO:

77.

398. 392. The genetically engineered cell of claim 390 or 391, wherein the extracellular hinge domain is or comprises a PDGFR hinge.

399. The genetically engineered cell of claim 390, 391, or 398, wherein the extracellular hinge domain is encoded by the first transgene, and the first transgene comprises a nucleic acid sequence at least 80% identical to SEQ ID NO:

78.

400. 392. The genetically engineered cell of claim 390 or 391, wherein the extracellular hinge domain is or comprises an IgG4 hinge.

401. The genetically engineered cell of claim 390, 391, or 400, wherein the extracellular hinge domain is encoded by the first transgene, and the first transgene comprises a nucleic acid sequence at least 80% identical to SEQ ID NO:

79.

402. 402. The genetically engineered cell of any one of claims 346-401, wherein said first transgene further comprises one or more nucleic acid sequences encoding an intracellular domain.

403. 403. The genetically engineered cell of claim 402, wherein the intracellular domain is or comprises a CD47 intracellular domain or a portion thereof.

404. The genetically engineered cell of claim 402 or 403, wherein the intracellular domain is encoded by the first transgene, and the first transgene comprises a nucleic acid sequence at least 80% identical to SEQ ID NO:

55.

405. The genetically engineered cell of claim 402 or 403, wherein the intracellular domain is encoded by the first transgene, and the first transgene comprises a nucleic acid sequence at least 80% identical to SEQ ID NO:

59.

406. The genetically engineered cell of claim 402 or 403, wherein the intracellular domain is encoded by the first transgene, and the first transgene comprises a nucleic acid sequence at least 80% identical to SEQ ID NO:

63.

407. The genetically engineered cell of claim 402 or 403, wherein the intracellular domain is encoded by the first transgene, and the first transgene comprises a nucleic acid sequence at least 80% identical to SEQ ID NO:

64.

408. 403. The genetically engineered cell of claim 402, wherein the intracellular domain is or comprises a CD8a intracellular domain or a portion thereof.

409. The genetically engineered cell of claim 402 or 408, wherein the intracellular domain is encoded by the first transgene, and the first transgene comprises a nucleic acid sequence at least 80% identical to SEQ ID NO:

70.

410. The genetically engineered cell of claim 402, wherein the intracellular domain is or comprises a CD28 intracellular domain or a portion thereof.

411. The genetically engineered cell of claim 402 or 403, wherein the intracellular domain is encoded by the first transgene, and the first transgene comprises a nucleic acid sequence at least 80% identical to SEQ ID NO:

72.

412. 403. The genetically engineered cell of claim 402, wherein the intracellular domain is or comprises a PDGFR intracellular domain or a portion thereof.

413. The genetically engineered cell of claim 402 or 412, wherein the intracellular domain is encoded by the first transgene, and the first transgene comprises a nucleic acid sequence at least 80% identical to SEQ ID NO:

74.

414. 414. The genetically engineered cell of any one of claims 402-413, wherein said intracellular domain comprises one or more modifications compared to a wild-type CD47 intracellular domain.

415. 415. The genetically engineered cell of any one of claims 402-414, wherein said intracellular domain comprises one or more deletions compared to a wild-type CD47 intracellular domain.

416. 415. The genetically engineered cell of any one of claims 402-414, wherein said intracellular domain comprises one or more insertions compared to a wild-type CD47 intracellular domain.

417. 417. The genetically engineered cell of any one of claims 402-416, wherein the intracellular domain comprises an altered function compared to a wild-type CD47 intracellular domain.

418. 418. The genetically engineered cell of any one of claims 402-417, wherein the intracellular domain comprises a reduced function compared to a wild-type CD47 intracellular domain.

419. 419. The genetically engineered cell of any one of claims 402-418, wherein said intracellular domain comprises a reduced level of CD47 intracellular signaling compared to a wild-type CD47 intracellular domain.

420. 420. The genetically engineered cell of any one of claims 402-419, wherein the intracellular domain comprises a non-functional intracellular domain.

421. 421. The genetically engineered cell of any one of Claims 346-420, wherein said first transgene comprises an amino acid sequence at least 80% identical to a sequence selected from Table 31.

422. 422. The genetically engineered cell of any one of claims 346-421, wherein said first transgene comprises a nucleic acid sequence at least 80% identical to SEQ ID NO:

13.

423. 422. The genetically engineered cell of any one of claims 346-421, wherein said first transgene comprises a nucleic acid sequence at least 80% identical to SEQ ID NO:

14.

424. 422. The genetically engineered cell of any one of claims 346-421, wherein said first transgene comprises a nucleic acid sequence at least 80% identical to SEQ ID NO:

18.

425. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

133.

426. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

134.

427. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

135.

428. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

136.

429. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

137.

430. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

138.

431. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

139.

432. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

140.

433. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

141.

434. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

142.

435. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

143.

436. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

144.

437. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

145.

438. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

146.

439. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

147.

440. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

148.

441. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

149.

442. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

150.

443. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

151.

444. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

152.

445. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

153.

446. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

154.

447. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

155.

448. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

156.

449. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

157.

450. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

158.

451. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

159.

452. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

160.

453. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

161.

454. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

162.

455. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

163.

456. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

164.

457. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

165.

458. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

166.

459. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

167.

460. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

168.

461. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

169.

462. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

170.

463. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

171.

464. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

172.

465. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

173.

466. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

174.

467. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

175.

468. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

176.

469. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

177.

470. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

178.

471. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

179.

472. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

180.

473. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

181.

474. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

182.

475. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

183.

476. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

184.

477. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

185.

478. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

341.

479. 422. The genetically engineered cell of any one of claims 346-421, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO:

342.

480. 414. The genetically engineered cell of any one of Claims 346-413, wherein said first transgene comprises one or more nucleic acid sequences that are at least 80% identical to one or more sequences selected from Table 33.

481. 347. The genetically engineered cell of any one of Claims 346, wherein said first transgene comprises one or more nucleic acid sequences at least 80% identical to one or more sequences selected from Table 33 and / or Table 31.

482. 414. The genetically engineered cell of any one of claims 346-413, wherein said first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NO:49 and SEQ ID NO:

14.

483. 414. The genetically engineered cell of any one of claims 346-413, wherein said first transgene comprises one or more nucleic acid sequences that are at least 80% identical to SEQ ID NO:

14.

484. 414. The genetically engineered cell of any one of claims 346-413, wherein said first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NO:49 and SEQ ID NO:

13.

485. 414. The genetically engineered cell of any one of claims 346-413, wherein said first transgene comprises one or more nucleic acid sequences that are at least 80% identical to SEQ ID NO:

13.

486. 414. The genetically engineered cell of any one of claims 346-413, wherein said first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NO:49 and SEQ ID NO:

18.

487. 414. The genetically engineered cell of any one of claims 346-413, wherein said first transgene comprises one or more nucleic acid sequences that are at least 80% identical to SEQ ID NO:

18.

488. 414. The genetically engineered cell of any one of claims 346-413, wherein the first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NOs: 51, 52, 54, 55, 56, and 57.

489. 414. The genetically engineered cell of any one of claims 346-413, wherein the first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NOs: 51, 52, 54, 55, and 56.

490. 414. The genetically engineered cell of any one of claims 346-413, wherein the first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NOs: 51, 52, 54, and 55.

491. 414. The genetically engineered cell of any one of claims 346-413, wherein said first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NOs: 51, 52, 54, 55, 56, 57, 58, 59, 60, 61, and 62.

492. 414. The genetically engineered cell of any one of claims 346-413, wherein the first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NOs: 51, 52, 54, 55, 56, 57, 58, 59, 60, and 61.

493. 414. The genetically engineered cell of any one of claims 346-413, wherein the first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NOs: 51, 52, 54, 55, 56, 57, 58, 59, and 60.

494. 414. The genetically engineered cell of any one of claims 346-413, wherein the first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NOs: 51, 52, 54, 55, 56, 57, 58, and 59.

495. 414. The genetically engineered cell of any one of claims 346-413, wherein the first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NOs: 49, 53, and 65.

496. 414. The genetically engineered cell of any one of claims 346-413, wherein said first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NOs: 53 and 65.

497. 414. The genetically engineered cell of any one of claims 346-413, wherein the first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NOs: 49, 53, and 66.

498. 414. The genetically engineered cell of any one of claims 346-413, wherein said first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NOs: 53 and 66.

499. 414. The genetically engineered cell of any one of claims 346-413, wherein the first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NOs: 49, 53, and 67.

500. 414. The genetically engineered cell of any one of claims 346-413, wherein said first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NOs: 53 and 67.

501. 414. The genetically engineered cell of any one of claims 346-413, wherein the first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NOs: 49, 53, 69, and 70.

502. 414. The genetically engineered cell of any one of claims 346-413, wherein the first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NOs: 53, 69, and 70.

503. 414. The genetically engineered cell of any one of claims 346-413, wherein the first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NOs: 49, 53, 71, and 72.

504. 414. The genetically engineered cell of any one of claims 346-413, wherein the first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NOs: 53, 71, and 72.

505. 414. The genetically engineered cell of any one of claims 346-413, wherein the first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NOs: 49, 53, 73, and 74.

506. 414. The genetically engineered cell of any one of claims 346-413, wherein the first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NOs: 53, 73, and 74.

507. 414. The genetically engineered cell of any one of claims 346-413, wherein the first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NOs: 49, 52, 78, 73, and 74.

508. 414. The genetically engineered cell of any one of claims 346-413, wherein the first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NOs: 52, 78, 73, and 74.

509. 414. The genetically engineered cell of any one of claims 346-413, wherein the first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NOs: 49, 52, 79, 71, and 72.

510. 414. The genetically engineered cell of any one of claims 346-413, wherein the first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NOs: 52, 79, 71, and 72.

511. 414. The genetically engineered cell of any one of claims 346-413, wherein the first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NOs: 49, 52, 79, 69, and 70.

512. 414. The genetically engineered cell of any one of claims 346-413, wherein the first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NOs: 52, 79, 69, and 70.

513. 414. The genetically engineered cell of any one of claims 346-413, wherein the first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NOs: 49, 52, 77, 71, and 72.

514. 414. The genetically engineered cell of any one of claims 346-413, wherein the first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NOs: 52, 77, 71, and 72.

515. 414. The genetically engineered cell of any one of claims 346-413, wherein the first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NOs: 49, 52, 77, 69, and 70.

516. 414. The genetically engineered cell of any one of claims 346-413, wherein the first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NOs: 52, 77, 69, and 70.

517. 414. The genetically engineered cell of any one of claims 346-413, wherein the first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NOs: 49, 52, 76, 71, and 72.

518. 414. The genetically engineered cell of any one of claims 346-413, wherein the first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NOs: 52, 76, 71, and 72.

519. 414. The genetically engineered cell of any one of claims 346-413, wherein the first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NOs: 49, 52, 76, 69, and 70.

520. 414. The genetically engineered cell of any one of claims 346-413, wherein the first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NOs: 52, 76, 69, and 70.

521. 414. The genetically engineered cell of any one of claims 346-413, wherein said first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NOs: 49 and 200.

522. 414. The genetically engineered cell of any one of claims 346-413, wherein said first transgene comprises one or more nucleic acid sequences at least 80% identical to SEQ ID NOs: 50 and 200.

523. 414. The genetically engineered cell of any one of claims 346-413, wherein said first transgene comprises one or more nucleic acid sequences that are at least 80% identical to SEQ ID NO:

200.

524. 524. The genetically engineered cell of any one of claims 346-523, comprising said first transgene at a first insertion site in the genome.

525. 525. The genetically engineered cell of claim 524, wherein the first insertion site is a T cell receptor (TCR) locus.

526. 526. The genetically engineered cell of claim 525, wherein said TCR locus is or comprises a TRAC locus, a TRBC1 locus, or a TRBC2 locus.

527. The genetically engineered cell of claim 525, wherein the first insertion site is the beta2 microglobulin (B2M) locus.

528. 526. The genetically engineered cell of claim 525, wherein the first insertion site is the class II transactivator (CIITA) locus.

529. 526. The genetically engineered cell of claim 525, wherein the first insertion site is a safe harbor locus.

530. The genetically engineered cell of claim 529, wherein the safe harbor locus is the AAVS1, ABO, CCR5, CLYBL, CXCR4, F3, FUT1, HMGB1, KDM5D, LRP1, MICA, MICB, RHD, ROSA26, or SHS231 locus.

531. 531. The genetically engineered cell of any one of claims 525-530, wherein said first insertion site is an exon.

532. 531. The genetically engineered cell of any one of claims 525-530, wherein said first insertion site is an intron.

533. 531. The genetically engineered cell of any one of claims 525-530, wherein said first insertion site is between an intron and an exon.

534. 531. The genetically engineered cell of any one of claims 525-530, wherein said first insertion site is in a control region.

535. 535. The genetically engineered cell of any one of claims 346-534, wherein said genetically engineered cell has cell surface expression of said genetically engineered protein.

536. 536. The genetically engineered cell of any one of claims 346-535, wherein said genetically engineered cell has reduced cell surface expression of TCR compared to a comparable cell that has not been genetically engineered.

537. 537. The genetically engineered cell of any one of claims 346-536, wherein the genetically engineered cell has reduced cell surface expression of B2M compared to a comparable cell that has not been genetically engineered.

538. 8. The genetically engineered cell of any one of claims 346-537, wherein the genetically engineered cell has reduced expression of CIITA compared to a comparable cell that has not been genetically engineered.

539. 539. The genetically engineered cell of any one of claims 346-538, wherein said genetically engineered cell comprises a modification at a TCR locus, a B2M locus, a TAP I locus, a NLRC5 locus, a CIITA locus, an HLA-A locus, an HLA-B locus, an HLA-C locus, an HLA-DP locus, an HLA-DM locus, an HLA-DOA locus, an HLA-DOB locus, an HLA-DQ locus, an HLA-DR locus, an RFX5 locus, an RFXANK locus, an RFXAP locus, an NFY-A locus, an NFY-B locus, an NFY-C locus, or a combination thereof.

540. 540. The genetically engineered cell of any one of claims 346-539, wherein said genetically engineered cell is genetically engineered to knock out an HLA-A locus, an HLA-B locus, an HLA-C locus, or a combination thereof.

541. 540. The genetically engineered cell of any one of claims 346-539, wherein said genetically engineered cell is genetically engineered to knock out an HLA-DM locus, an HLA-DO locus, an HLA-DP locus, an HLA-DQ locus, an HLA-DR locus, or a combination thereof.

542. The genetically engineered cell of any one of claims 346-541, wherein said genetically engineered cell is genetically engineered to knock out a TCR locus.

543. 543. The genetically engineered cell of any one of claims 346-542, wherein said genetically engineered cell is genetically engineered to knock out the B2M locus.

544. 544. The genetically engineered cell of any one of claims 346-543, wherein said genetically engineered cell is genetically engineered to knock out the CIITA locus.

545. The cells (a) one or more major histocompatibility complex (MHC) class I molecules, or one or more molecules that modulate the expression of said one or more MHC class I molecules; and / or (b) one or more MHC class II molecules, or one or more molecules that modulate the expression of said one or more MHC class II molecules; 545. The genetically engineered cell of any one of claims 346-544, comprising one or more modifications that inactivate or disrupt one or more alleles of

546. 546. The genetically engineered cell of any one of claims 346-545, wherein the cell comprises one or more modifications that inactivate or disrupt one or more alleles of one or more MHC class I molecules or one or more molecules that regulate expression of said one or more MHC class I molecules.

547. 547. The genetically engineered cell of any one of claims 346-546, wherein said cell comprises one or more modifications that inactivate or disrupt one or more alleles of one or more MHC class II molecules or one or more molecules that regulate expression of said one or more MHC class II molecules.

548. The cells (a) one or more MHC class I molecules, or one or more molecules that modulate the expression of said one or more MHC class I molecules; and (b) one or more MHC class II molecules, or one or more molecules that modulate the expression of said one or more MHC class II molecules; 548. The genetically engineered cell of any one of claims 346-547, comprising one or more modifications that inactivate or disrupt one or more alleles of

549. The genetically engineered cell of any one of claims 346-548, wherein said one or more modifications reduce cell surface protein expression of said one or more MHC class I molecules.

550. 550. The genetically engineered cell of any one of claims 346-549, wherein said one or more modifications reduce cell surface transport of said one or more MHC class I molecules.

551. 551. The genetically engineered cell of any one of claims 346-550, wherein said one or more modifications reduce a function of said one or more MHC class I molecules, optionally wherein said function is antigen presentation.

552. 552. The genetically engineered cell of any one of claims 346-551, wherein the one or more MHC class I molecules are one or more human leukocyte antigen (HLA) class I molecules.

553. The genetically engineered cell of claim 552, wherein said one or more HLA class I molecules are selected from the group consisting of HLA-A, HLA-B, and HLA-C.

554. The genetically engineered cell of any one of claims 346-551, wherein the one or more molecules that regulate the expression of the one or more MHC class I molecules are selected from the group consisting of B2M, NLRC5, and TAP1.

555. 555. The genetically engineered cell of any one of claims 346-554, wherein said one or more modifications reduce cell surface protein expression of said one or more MHC class II molecules.

556. 556. The genetically engineered cell of any one of claims 346-555, wherein said one or more modifications reduce cell surface trafficking of said one or more MHC class II molecules.

557. 557. The genetically engineered cell of any one of claims 346-556, wherein said one or more modifications reduce a function of said one or more MHC class II molecules, optionally wherein said function is antigen presentation.

558. 558. The genetically engineered cell of any one of claims 346-557, wherein the one or more MHC class II molecules are one or more human leukocyte antigen (HLA) class II molecules.

559. The genetically engineered cell of claim 558, wherein said one or more HLA class II molecules are selected from the group consisting of HLA-DP, HLA-DQ, and / or HLA-DR.

560. 558. The genetically engineered cell of any one of claims 346-557, wherein the one or more molecules that regulate the expression of the one or more MHC class II molecules are selected from the group consisting of CIITA and CD74.

561. 548. The genetically engineered cell of any one of claims 346-547, further comprising a second transgene encoding an immune tolerance inducer.

562. 562. The genetically engineered cell of claim 561, wherein the immune tolerance inducer is or comprises A20 / TNFAIP3, B2M-HLA-E, CD16, CD16 Fc receptor, CD24, CD27, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD64, CD200, CCL21, CCL22, CTLA4-Ig, C1 inhibitory factor, CR1, DUX4, FASL, HLA-C, HLA-E, HLA-E heavy chain, HLA-F, HLA-G, H2-M3, IDO1, IL-10, IL15-RF, IL-35, IL-39, MANF, Mfge8, PD-L1, or Serpinb9.

563. The genetically engineered cell of claim 561 or 562, wherein the second transgene encoding the immune tolerance inducer is inserted at an insertion site in the TCR locus.

564. The genetically engineered cell of claim 561 or 562, wherein the second transgene encoding the immune tolerance inducer is inserted at an insertion site in the B2M locus.

565. 563. The genetically engineered cell of claim 561 or 562, wherein the second transgene encoding the immune tolerance inducer is inserted at an insertion site in the CIITA locus.

566. The genetically engineered cell of claim 561 or 562, wherein the second transgene encoding the immune tolerance inducer is inserted at an insertion site in a safe harbor locus.

567. The genetically engineered cell of claim 566, wherein the safe harbor locus is the AAVS1, ABO, CCR5, CLYBL, CXCR4, F3, FUT1, HMGB1, KDM5D, LRP1, MICA, MICB, RHD, ROSA26, or SHS231 locus.

568. 566. The genetically engineered cell of any one of claims 561 to 565, wherein the genetically engineered cell has cell surface expression of the immune tolerance-inducing factor.

569. 569. The genetically engineered cell of any one of claims 346-568, further comprising a third transgene encoding a chimeric antigen receptor (CAR).

570. The CAR is selected from the group consisting of CD5-specific CAR, CD19-specific CAR, CD20-specific CAR, CD22-specific CAR, CD23-specific CAR, CD30-specific CAR, CD33-specific CAR, CD38-specific CAR, CD70-specific CAR, CD123-specific CAR, CD138-specific CAR, kappa-specific CAR, lambda-specific CAR, B-cell maturation substance (BCMA)-specific CAR, G protein-coupled receptor family C group 5 member D (G PRC5D) specific CAR, CD123-specific CAR, LeY-specific CAR, NKG2D ligand-specific CAR, WT1-specific CAR, GD2-specific CAR, HER2-specific CAR, EGFR-specific CA R, EGFRvIII-specific CAR, B7H3-specific CAR, PSMA-specific CAR, PSCA-specific CAR, CAIX-specific CAR, CD171-specific CAR, CEA-specific CAR, CSPG4-specific CAR, EPHA2-specific CAR, FAP-specific CAR, FRα-specific CAR, IL-13Rα-specific CAR, mesothelin-specific CAR, MUC1-specific CAR, MUC16-specific CAR, ROR1-specific CAR, C-Met-specific CAR, CD133-specific CAR, Ep-CAM-specific CAR, GPC3-specific CAR, HPV16-E6-specific CAR, IL13Ra2-specific CAR, MAGEA3-specific CAR, MAGEA4-specific CAR, MART1-specific CAR, NY-ESO-1-specific CAR, VEGFR2-specific CAR, α-folate receptor-specific CAR, CD24-specific CAR, CD44v7 / 8-specific CAR, EGP-2-specific CAR, EGP-40-specific CAR, erb-B2-specific CAR, erb-B2,3,4-specific CAR, FBP-specific CAR, fetal acetylcholine receptor-specific CAR, G Ｄ２ Specific CAR, G Ｄ３ 570. The genetically engineered cell of claim 569, which is or comprises a CD19 / CD22 bispecific CAR, a CD19 / CD22 specific CAR, a CD19 / CD22 specific CAR, a CD19 / CD22 IgG1 ...

571. The genetically engineered cell of claim 569 or 570, wherein the CAR is or comprises a CD19-specific CAR, a CD20-specific CAR, a CD22-specific CAR, a CD38-specific CAR, a CD123-specific CAR, a CD138-specific CAR, a BCMA-specific CAR, or a CD19 / CD22 bispecific CAR.

572. 572. The genetically engineered cell of any one of claims 569-571, wherein said genetically engineered cell has cell surface expression of said CAR.

573. 568. The genetically engineered cell of any one of claims 346-567, further comprising a third transgene encoding a chimeric autoantigen receptor (CAAR).

574. 574. The genetically engineered cell of claim 573, wherein the CAAR comprises an antigen selected from the group consisting of pancreatic beta cell antigen, synovial joint antigen, myelin basic protein, proteolipid protein, myelin oligodendrocyte glycoprotein, MuSK, keratinocyte adhesion protein desmoglein 3 (Dsg3), Ro-RNP complex, La antigen, myeloperoxidase, proteinase 3, cardiolipin, citrullinated proteins, carbamylated proteins, and the alpha 3 chain of basement membrane collagen.

575. The genetically engineered cell of claim 573 or 574, wherein the genetically engineered cell has cell surface expression of the CAAR.

576. 568. The genetically engineered cell of any one of claims 346-567, further comprising a third transgene encoding a B-cell autoantibody receptor (BAR).

577. 577. The genetically engineered cell of claim 576, wherein the genetically engineered cell has cell surface expression of the BAR.

578. 578. The genetically engineered cell of any one of claims 569-577, wherein said third transgene is inserted into a safe harbor locus.

579. 579. The genetically engineered cell of any one of claims 569-578, wherein said third transgene is inserted at the TRAC locus, TRBC1 locus, TRBC2 locus, B2M locus, CIITA locus, MICA locus, MICB locus, or safe harbor locus.

580. 579. The genetically engineered cell of any one of claims 569-579, wherein the third transgene is inserted at the AAVS1 locus, ABO locus, CCR5 locus, CLYBL locus, CXCR4 locus, F3 locus, FUT1 locus, HMGB1 locus, KDM5D locus, LRP1 locus, RHD locus, ROSA26 locus, or SHS231 locus.

581. 567. The genetically engineered cell of any one of claims 346-566, wherein said first transgene and said second transgene are inserted into the same insertion site.

582. 581. The genetically engineered cell of any one of claims 346-566 or 576-580, wherein said first transgene and said third transgene are inserted into the same insertion site.

583. 581. The genetically engineered cell of any one of claims 561-580, wherein the second transgene and the third transgene are inserted into the same insertion site.

584. 581. The genetically engineered cell of any one of claims 346-580, wherein the first transgene, the second transgene, and the third transgene are inserted into the same insertion site.

585. 585. The genetically engineered cell of any one of claims 346-584, wherein said first transgene, said second transgene, and said third transgene are encoded by three separate constructs.

586. 585. The genetically engineered cell of any one of claims 346-584, wherein said first transgene, said second transgene, and said third transgene are encoded by two separate constructs.

587. 585. The genetically engineered cell of any one of claims 346-584, wherein said first transgene, said second transgene, and said third transgene are encoded by a polycistronic construct.

588. The genetically engineered cell of any one of claims 346 to 587, wherein the first transgene and / or the second transgene and / or the third transgene encodes a genome editing complex.

589. The genetically engineered cell of claim 588, wherein the genome editing complex comprises a genome targeting material and a genome modifying material.

590. The genetically engineered cell of claim 589, wherein the genome targeting agent is a nucleic acid-derived targeting agent.

591. 591. The genetically engineered cell of claim 589 or 590, wherein said genome targeting agent is selected from the group consisting of a sequence-specific nuclease, a nucleic acid-programmable DNA binding protein, an RNA-guided nuclease, an RNA-guided nuclease comprising a Cas nuclease and a guide RNA (CRISPR-Cas combination), a ribonucleoprotein (RNP) complex comprising a gRNA and a Cas nuclease, a homing endonuclease, a zinc finger nuclease (ZF) nucleic acid binding agent, a transcription activator-like effector (TALE) nucleic acid binding agent, a meganuclease, a Cas nuclease, a core Cas protein, a homing endonuclease, an endonuclease-deficient Cas protein, an enzymatically inactive Cas protein, a CRISPR-associated transposase (CAST), a type II or type V Cas protein, or a functional portion thereof.

592. The genome targeting substance is selected from the group consisting of Cas1, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas12, Cas12a (Cpf1), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12 f (C2c10), Cas12g, Cas12h, Cas12i, Cas12k (C2c5), Cas13, Cas13a (C2c2), Cas13b, Cas13c, Cas13d, C2c4, C2c8, C2c9, Cmr1, Cmr2, Cmr3, Cmr4, Cmr5, Cmr6, Csd1, Csd2, Cas5d, Cse1, Cse 2, Cse3, Cse4, Cas5e, Csf1, Csm1, Csm2, Csm3, Csm4, Csm5, Csn1, Csn2, Cst1, Cst2, Cas5t, Cs h1, Csh2, Cas5h, Csa1, Csa2, Csa3, Csa4, Csa5, Cas5a, Csx10, Csx11, Csy1, Csy2, Csy3, Csy4 , Mad7, SpCas9, eSpCas9 of SpCas9, SpCas9-HF1, HypaSpCas9, HeFSpCas9, and evoSpCas9 high fidelity variants, SaCas9, NmeCas9, CjCas9, StCas9, TdCas9, LbCas12a, AsCas12a, AacCas12b, BhCas12b v4, TnpB, dCas(D10A), dCas(H840A), dCas13a, dCas13b, or a functional portion thereof.

593. 593. The genetically engineered cell of any one of claims 589-592, wherein said genome modifying agent cleaves, deaminates, nicks, polymerizes, interrogates, fuses, cuts, unwinds, destroys, alters, methylates, demethylates, or otherwise destabilizes a target locus.

594. 594. The genetically engineered cell of any one of claims 589-593, wherein the genome-modifying agent comprises a recombinase, integrase, transposase, endonuclease, exonuclease, nickase, helicase, DNA polymerase, RNA polymerase, reverse transcriptase, deaminase, flippase, methylase, demethylase, acetylase, nucleic acid-modifying protein, RNA-modifying protein, DNA-modifying protein, Argonaute protein, epigenetic-modifying protein, histone-modifying protein, or a functional portion thereof.

595. 595. The genetically engineered cell of any one of claims 589-594, wherein the genome modifying agent is selected from the group consisting of a sequence-specific nuclease, a nucleic acid-programmable DNA binding protein, an RNA-guided nuclease, an RNA-guided nuclease comprising a Cas nuclease and a guide RNA (CRISPR-Cas combination), a ribonucleoprotein (RNP) complex comprising the gRNA and the Cas nuclease, a homing endonuclease, a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), a meganuclease, a Cas nuclease, a core Cas protein, a TnpB nuclease, an endonuclease-deficient Cas protein, an enzymatically inactive Cas protein, a CRISPR-associated transposase (CAST), a type II or type V Cas protein, base editing, prime editing, programmable addition of site-specific targeting elements (PASTE), or a functional portion thereof.

596. The genome modifying substance is selected from the group consisting of Cas1, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas12, Cas12a (Cpf1), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), and Cas12f. (C2c10), Cas12g, Cas12h, Cas12i, Cas12k (C2c5), Cas13, Cas13a (C2c2), Cas13b, Cas13c, C as13d, C2c4, C2c8, C2c9, Cmr1, Cmr2, Cmr3, Cmr4, Cmr5, Cmr6, Csd1, Csd2, Cas5d, Cse1, Cse2 , Cse3, Cse4, Cas5e, Csf1, Csm1, Csm2, Csm3, Csm4, Csm5, Csn1, Csn2, Cst1, Cst2, Cas5t, Csh 1, Csh2, Cas5h, Csa1, Csa2, Csa3, Csa4, Csa5, Cas5a, Csx10, Csx11, Csy1, Csy2, Csy3, Csy4, Mad7, SpCas9, eSpCas9 of SpCas9, SpCas9-HF1, HypaSpCas9, HeFSpCas9, and evoSpCas9 high-fidelity variants, SaCas9, NmeCas9, CjCas9, StCas9, TdCas9, LbCas12a, AsCas12a, AacCas12b, BhCas12bv4, TnpB, FokI, dCas(D10A), dCas(H840A), dCas13a, dCas13b, base editor, prime editor, target primed reverse transcription (TPRT) editor, APOBEC1, cytidine deaminase, adenosine deaminase, uracil glycosylase inhibitor (UGI), adenine base editor (ABE), cytosine base editor (CBE), reverse transcriptase, serine integrase, recombinase, transposase, polymerase, adenine to thymine or "ATBE" 596. The genetically engineered cell of any one of Claims 589-595, wherein the target gene is selected from the group consisting of: THX (or thymine to adenine or "TABE") transversion base editor, 10-11 translocation methylcytosine dioxygenase (TET), TET1, TET3, TET1CD, histone acetyltransferase p300, histone methyltransferase SMYD3, histone methyltransferase PRDM9, H3K79 methyltransferase DOT1L, a transcriptional repressor, or a functional portion thereof.

597. 597. The genetically engineered cell of any one of claims 589-596, wherein the genome targeting agent and the genome modifying agent are different domains of a single polypeptide.

598. 600. The genetically engineered cell of any one of claims 589-597, wherein the genome targeting agent and the genome modifying agent are two different polypeptides that are operably linked to each other.

599. 600. The genetically engineered cell of any one of claims 589-597, wherein the genome targeting agent and the genome modifying agent are two different polypeptides that are not linked to each other.

600. 600. The genetically engineered cell of any one of claims 589-599, wherein the genome editing complex comprises a guide nucleic acid having a targeting domain complementary to at least one target locus, and optionally the guide nucleic acid is a guide RNA (gRNA).

601. The genetically engineered cell of any one of claims 588-598, wherein the genome editing complex comprises an RNA-guided nuclease.

602. The genetically engineered cell of claim 601, wherein the RNA-guided nuclease comprises a Cas nuclease.

603. The genetically engineered cell of claim 602, wherein the genome editing complex comprises a ribonucleoprotein (RNP) complex comprising the Cas nuclease and the gRNA.

604. The genetically engineered cell of claim 602 or 603, wherein the Cas nuclease is a type II or type V Cas protein.

605. The Cas nuclease is Cas3, Cas4, Cas5, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas12, Cas12a (Cpf1), Cas12b (C 2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12f (C2c10), Cas12g, Cas12h, Cas12i, Cas12k (C2c5), Cas13, Cas13a (C2c2), Cas13b, Cas13c, Cas13d, C2c4, C2c8, C2c9, Cmr5, Cse1, Cse2, Csf1, Csm2, Csn2, Csx10, Csx11, Csy1, Csy2, Csy3, and Mad7.

606. The genetically engineered cell of any one of claims 346 to 587, wherein the genetically engineered cell is a human cell or a non-human animal cell.

607. The genetically engineered cell of claim 606, wherein the non-human animal cell is a porcine, bovine, or ovine cell.

608. The genetically engineered cell of claim 606, wherein the genetically engineered cell is a human cell.

609. 609. The genetically engineered cell of any one of claims 346-608, wherein said genetically engineered cell is a differentiated cell derived from a stem or progenitor cell.

610. The genetically engineered cell of claim 609, wherein the stem cell is a pluripotent stem cell.

611. The genetically engineered cell of claim 610, wherein the pluripotent stem cell is an induced pluripotent stem cell (iPSC).

612. The genetically engineered cell of claim 610, wherein the pluripotent stem cell is an embryonic stem cell (ESC).

613. 613. The genetically engineered cell of any one of claims 346-612, wherein the cell is a primary cell isolated from a donor.

614. The genetically engineered cell of claim 613, wherein the donor is healthy and / or not suspected of having a disease or condition at the time the primary cells are taken from the donor.

615. 615. The genetically engineered cell of any one of claims 346-614, wherein said genetically engineered cell is part of a population of primary cells isolated from multiple donors.

616. 616. The genetically engineered cell of any one of claims 346-615, wherein said plurality of donors are healthy and / or not suspected of having a disease or condition at the time said primary cells are obtained from said donors.

617. 617. The genetically engineered cell of any one of claims 346-616, wherein the cell is an islet cell, a beta islet cell, a pancreatic islet cell, an immune cell, a B cell, a T cell, a natural killer (NK) cell, a natural killer T (NKT) cell, a macrophage cell, an endothelial cell, a muscle cell, a cardiomyocyte, a smooth muscle cell, a skeletal muscle cell, a dopaminergic neuron, a retinal pigment epithelial cell, a photoreceptor cell, a liver parenchymal cell, a thyroid cell, a skin cell, a glial progenitor cell, a neuron, a cardiac cell, a stem cell, a hematopoietic stem cell, an induced pluripotent stem cell (iPSC), a mesenchymal stem cell (MSC), an embryonic stem cell (ESC), a pluripotent stem cell (PSC), a blood cell, or a combination thereof.

618. The genetically engineered cell of any one of claims 346-617, wherein the cell is a T cell.

619. 619. The genetically engineered cell of claim 618, wherein the T cell is a CD3+ T cell, CD4+ T cell, CDS+ T cell, naive T cell, regulatory T (Treg) cell, non-regulatory T cell, Th1 cell, Th2 cell, Th9 cell, Th17 cell, follicular helper T (Tfh) cell, cytotoxic T lymphocyte (CTL), effector T (Teff) cell, central memory T cell, effector memory T cell, effector memory T cell expressing CD45RA (TEMRA cell), tissue-resident memory (Trm) cell, virtual memory T cell, innate immune memory T cell, memory stem cell (Tsc), γδ T cell, or a combination thereof.

620. The genetically engineered cell of claim 618 or 619, wherein the T cells are cytotoxic T cells, helper T cells, memory T cells, regulatory T cells, tumor-infiltrating lymphocytes, or a combination thereof.

621. 621. The genetically engineered cell of any one of claims 618-620, wherein the cell is a human T cell.

622. 622. The genetically engineered cell of any one of claims 618-621, wherein the cell is an autologous T cell.

623. 622. The genetically engineered cell of any one of claims 618-621, wherein the cell is an allogeneic T cell.

624. The genetically engineered cell of claim 623, wherein the allogeneic T cells are primary T cells.

625. The genetically engineered cell of claim 623 or 624, wherein the allogeneic T cell is differentiated from an embryonic stem cell (ESC) or an induced pluripotent stem cell (iPSC).

626. 626. The genetically engineered cell of any one of claims 346-625, wherein the engineered protein is expressed in the genetically engineered cell at a level greater than at least about 1 fold, 2 fold, 3 fold, 4 fold, 5 fold, 10 fold, 20 fold, 25 fold, 30 fold, 40 fold, 50 fold, 60 fold, 70 fold, 80 fold, 90 fold, 100 fold, 150 fold, 200 fold, 300 fold, 400 fold, 500 fold, 600 fold, 700 fold, 800 fold, 900 fold, 1000 fold, 1100 fold, 1200 fold, 1300 fold, 1400 fold, 1500 fold, 2000 fold, 2500 fold, 3000 fold, 3500 fold, 4000 fold, 4500 fold, or 5000 fold greater than endogenous CD47 protein in a control cell of the same cell type as the genetically engineered cell.

627. 626. The genetically engineered cell of any one of claims 346-625, wherein said genetically engineered protein is expressed in said genetically engineered cell at a level that is at least about 1-fold to at least about 15-fold greater than endogenous CD47 protein in a control cell of the same cell type as said genetically engineered cell.

628. 626. The genetically engineered cell of any one of claims 346-625, wherein said genetically engineered protein is expressed in said genetically engineered cell at a level that is at least about 1-fold to at least about 10-fold greater than endogenous CD47 protein in a control cell of the same cell type as said genetically engineered cell.

629. 626. The genetically engineered cell of any one of claims 346-625, wherein said genetically engineered protein is expressed in said genetically engineered cell at a level that is at least about 1-fold to at least about 5-fold greater than endogenous CD47 protein in a control cell of the same cell type as said genetically engineered cell.

630. 626. The genetically engineered cell of any one of claims 346-625, wherein said genetically engineered protein is expressed in said genetically engineered cell at a level that is at least about 3-fold to at least about 4-fold greater than endogenous CD47 protein in a control cell of the same cell type as said genetically engineered cell.

631. 626. The genetically engineered cell of any one of claims 346-625, wherein said genetically engineered protein is expressed in said genetically engineered cell at a level that is at least about 3-fold to at least about 10-fold greater than endogenous CD47 protein in a control cell of the same cell type as said genetically engineered cell.

632. 626. The genetically engineered cell of any one of claims 346-625, wherein said genetically engineered protein is expressed in said genetically engineered cell at a level that is at least about 4-fold to at least about 10-fold greater than endogenous CD47 protein in a control cell of the same cell type as said genetically engineered cell.

633. 626. The genetically engineered cell of any one of claims 346-625, wherein said genetically engineered protein is expressed in said genetically engineered cell at a level that is at least about 500-fold to at least about 2000-fold greater than endogenous CD47 protein in a control cell of the same cell type as said genetically engineered cell.

634. 626. The genetically engineered cell of any one of claims 346-625, wherein said genetically engineered protein is expressed in said genetically engineered cell at a level that is at least about 500-fold to at least about 1500-fold greater than endogenous CD47 protein in a control cell of the same cell type as said genetically engineered cell.

635. 626. The genetically engineered cell of any one of claims 346-625, wherein said genetically engineered protein is expressed in said genetically engineered cell at a level that is at least about 900-fold to at least about 1000-fold greater than endogenous CD47 protein in a control cell of the same cell type as said genetically engineered cell.

636. 626. The genetically engineered cell of any one of claims 346-625, wherein said genetically engineered protein is expressed in said genetically engineered cell at a level that is at least about 1000-fold greater than endogenous CD47 protein in a control cell of the same cell type as said genetically engineered cell.

637. A composition comprising the genetically engineered cell of any one of claims 345-636.

638. 10. A pharmaceutical composition comprising: (i) the genetically engineered cell of any one of claims 345-636; and (ii) a pharmaceutically acceptable excipient.

639. 638. A method comprising administering to a subject the genetically engineered cell of any one of claims 345-636, the composition of claim 637, or the pharmaceutical composition of claim 638.

640. The method of claim 639, wherein the method is a method for treating a disease in a subject.

641. 10. A cell population comprising the genetically engineered cells of any one of claims 345-636 for use in treating a disease in a subject.

642. The composition described in claim 637, which is used to treat a disease in a subject.

643. The pharmaceutical composition described in claim 638, which is used to treat a disease in a subject.

644. 10. Use of a genetically modified cell according to any one of claims 345 to 636, a cell population according to claim 56, a composition according to claim 54 or 56a, or a pharmaceutical composition according to claim 54a or 54b for use in treating a disease in a subject.

645. 10. Use of a genetically modified cell according to any one of claims 345 to 636, a cell population according to claim 56, a composition according to claim 54 or 56a, or a pharmaceutical composition according to claim 54a or 54b in the manufacture of a medicament for the treatment of a disease.

646. 10. The genetically modified cell, cell population, composition, pharmaceutical composition or use of any one of the preceding claims, wherein the disease is cancer.

647. The cancer is characterized by the presence of CD5, CD19, CD20, CD22, CD23, CD30, CD33, CD70, kappa, lambda, B-cell maturation substance (BCMA), G protein-coupled receptor family C group 5 member D (GPRC5D), CD123, LeY, NKG2D ligand, WT1, GD2, HER2, EGFR, EGFRvIII, B7H3, PSMA, PSCA, CAIX, CD171, CEA, CSPG4, EPHA2 , FAP, FRα, IL-13Rα, mesothelin, MUC1, MUC16, ROR1, c-Met, CD133, Ep-CAM, GPC3, HPV16-E6, IL13Ra2, MAGEA3, MAGEA4, MART1, NY-ESO-1, VEGFR2, alpha-folate receptor, CD24, CD44v7 / 8, EGP-2, EGP-40, erb-B2, erb-B2,3,4, FBP, fetal acetylcholine receptor, G Ｄ２ , G Ｄ３ , HMW-MAA, IL-11Rα, KDR, Lewis Y, L1 cell adhesion molecule, MAGE-A1, carcinoembryonic antigen (h5T4), and / or TAG-72.

648. 10. The genetically modified cell, cell population, composition, pharmaceutical composition or use of any one of the preceding claims, wherein the cancer is a hematological malignancy.

649. 10. The genetically modified cell, cell population, composition, pharmaceutical composition, or use of any one of the preceding claims, wherein the hematological malignancy is selected from the group consisting of myeloid neoplasms, myelodysplastic syndromes (MDS), myeloproliferative / myelodysplastic syndromes, acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL), acute myeloid leukemia (AML), chronic myelogenous leukemia (CML), blast crisis chronic myeloid leukemia (bcCML), B-cell acute lymphoblastic leukemia (B-ALL), T-cell acute lymphoblastic leukemia (T-ALL), T-cell lymphoma, and B-cell lymphoma.

650. 10. The genetically modified cell, cell population, composition, pharmaceutical composition or use of any one of the preceding claims, wherein the cancer is a solid malignant tumor.

651. 10. The genetically modified cell, cell population, composition, pharmaceutical composition, or use of any one of the preceding claims, wherein the solid malignant tumor is selected from breast cancer, ovarian cancer, colon cancer, prostate cancer, epithelial carcinoma, renal cell carcinoma, pancreatic adenocarcinoma, cervical cancer, colorectal carcinoma, glioblastoma, rhabdomyosarcoma, neuroblastoma, melanoma, Ewing's sarcoma, osteosarcoma, mesothelioma, and adenocarcinoma.

652. 10. The genetically modified cell, cell population, composition, pharmaceutical composition or use of any one of the preceding claims, wherein the disease is an autoimmune disease.

653. 10. The genetically modified cell, cell population, composition, pharmaceutical composition, or use of any one of the preceding claims, wherein the autoimmune disease is selected from the group consisting of lupus, systemic lupus erythematosus, rheumatoid arthritis, psoriasis, psoriatic arthritis, multiple sclerosis, Crohn's disease, ulcerative colitis, Addison's disease, Graves' disease, Sjogren's syndrome, Hashimoto's thyroiditis, and celiac disease.

654. 10. The genetically modified cell of any one of the preceding claims, the cell population of any one of the preceding claims, the composition of any one of the preceding claims, the pharmaceutical composition of any one of the preceding claims, or the use of any one of the preceding claims, wherein the disease is diabetes.

655. 10. The genetically modified cell, cell population, composition, pharmaceutical composition, or use of any one of the preceding claims, wherein the diabetes is selected from the group consisting of type I diabetes, type II diabetes, prediabetes, and gestational diabetes.

656. 10. The genetically modified cell, cell population, composition, pharmaceutical composition or use of any one of the preceding claims, wherein the disease is a nervous system disease.

657. 10. The genetically modified cell, cell population, composition, pharmaceutical composition or use of any one of the preceding claims, wherein the nervous system disease is selected from the group consisting of catalepsy, epilepsy, encephalitis, meningitis, migraine, Huntington's disease, Alzheimer's disease, Parkinson's disease, Pelizaeus-Merzbacher disease, and multiple sclerosis.

658. 1. A method of producing a genetically engineered cell comprising a nucleic acid construct, the method comprising:

185. A method comprising delivering a nucleic acid construct according to any one of claims 1 to 184 to a cell, thereby producing a genetically engineered cell.

659. 659. The method of claim 658, wherein the nucleic acid construct comprises a first transgene encoding the engineered protein.

660. 660. The method of claim 658 or 659, wherein said method comprises inserting a first transgene encoding said engineered protein into a first insertion site in the genome of said cell.

661. 661. The method of claim 660, wherein the first insertion site is a T cell receptor (TCR) locus.

662. 662. The method of claim 661, wherein the TCR locus is or comprises a TRAC locus, a TRBC1 locus, or a TRBC2 locus.

663. The method of claim 661, wherein the first insertion site is the beta2 microglobulin (B2M) locus.

664. 662. The method of claim 661, wherein the first insertion site is the class II transactivator (CIITA) locus.

665. 662. The method of claim 661, wherein the first insertion site is a safe harbor locus.

666. The method of claim 665, wherein the safe harbor locus is the AAVS1, ABO, CCR5, CLYBL, CXCR4, F3, FUT1, HMGB1, KDM5D, LRP1, MICA, MICB, RHD, ROSA26, or SHS231 locus.

667. 665. The method of any one of claims 660 to 664, wherein the first insertion site is an exon.

668. 665. The method of any one of claims 660 to 664, wherein the first insertion site is an intron.

669. 665. The method of any one of claims 660 to 664, wherein the first insertion site is between an intron and an exon.

670. 665. The method of any one of claims 660-664, wherein the first insertion site is in a control region.

671. 671. The method of any one of claims 660-670, wherein the inserting step comprises insertion using a gene therapy vector, a transposase, a lentiviral vector, a retrovirus, a fusosome, a PiggyBac transposon, a Sleeping Beauty (SB11) transposon, a Mos1 transposon, or a Tol2 transposon.

672. 672. The method of any one of claims 660 to 671, wherein the inserting step comprises inserting using a lentiviral vector.

673. 671. The method of any one of claims 660-670, wherein the inserting step comprises homology directed repair (HDR)-mediated insertion using genome modification proteins.

674. The method of any one of claims 658 to 673, further comprising introducing a genome editing complex into the cell.

675. The method of claim 674, wherein the genome editing complex comprises a genome targeting substance and a genome modifying substance.

676. The method of claim 675, wherein the genome targeting agent localizes the genome editing complex to a safe harbor site, and optionally, the genome targeting agent is a nucleic acid-guided targeting agent.

677. The method of claim 675 or 676, wherein the genome targeting agent is selected from the group consisting of a sequence-specific nuclease, a nucleic acid-programmable DNA binding protein, an RNA-guided nuclease, an RNA-guided nuclease comprising a Cas nuclease and a guide RNA (CRISPR-Cas combination), a ribonucleoprotein (RNP) complex comprising a gRNA and a Cas nuclease, a homing endonuclease, a zinc finger nuclease (ZF) nucleic acid binding agent, a transcription activator-like effector (TALE) nucleic acid binding agent, a meganuclease, a Cas nuclease, a core Cas protein, a homing endonuclease, an endonuclease-deficient Cas protein, an enzymatically inactive Cas protein, a CRISPR-associated transposase (CAST), a type II or type V Cas protein, or a functional portion thereof.

678. The genome targeting substance is selected from the group consisting of Cas1, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas12, Cas12a (Cpf1), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12 f (C2c10), Cas12g, Cas12h, Cas12i, Cas12k (C2c5), Cas13, Cas13a (C2c2), Cas13b, Cas13c, Cas13d, C2c4, C2c8, C2c9, Cmr1, Cmr2, Cmr3, Cmr4, Cmr5, Cmr6, Csd1, Csd2, Cas5d, Cse1, Cse 2, Cse3, Cse4, Cas5e, Csf1, Csm1, Csm2, Csm3, Csm4, Csm5, Csn1, Csn2, Cst1, Cst2, Cas5t, Cs h1, Csh2, Cas5h, Csa1, Csa2, Csa3, Csa4, Csa5, Cas5a, Csx10, Csx11, Csy1, Csy2, Csy3, Csy4 , Mad7, SpCas9, eSpCas9 of SpCas9, SpCas9-HF1, HypaSpCas9, HeFSpCas9, and evoSpCas9 high fidelity variants, SaCas9, NmeCas9, CjCas9, StCas9, TdCas9, LbCas12a, AsCas12a, AacCas12b, BhCas12b v4, TnpB, dCas(D10A), dCas(H840A), dCas13a, dCas13b, or a functional portion thereof.

679. The method of any one of claims 675-678, wherein said genome modifying agent cleaves, deaminates, nicks, polymerizes, interrogates, fuses, cuts, unwinds, disrupts, alters, methylates, demethylates, or otherwise destabilizes a target locus.

680. The method of any one of claims 675 to 679, wherein the genome-modifying substance comprises a recombinase, integrase, transposase, endonuclease, exonuclease, nickase, helicase, DNA polymerase, RNA polymerase, reverse transcriptase, deaminase, flippase, methylase, demethylase, acetylase, nucleic acid-modifying protein, RNA-modifying protein, DNA-modifying protein, Argonaute protein, epigenetic-modifying protein, histone-modifying protein, or a functional portion thereof.

681. The method of any one of claims 675 to 680, wherein the genome modifying agent is selected from the group consisting of a sequence-specific nuclease, a nucleic acid-programmable DNA-binding protein, an RNA-guided nuclease, an RNA-guided nuclease comprising a Cas nuclease and a guide RNA (CRISPR-Cas combination), a ribonucleoprotein (RNP) complex comprising the gRNA and the Cas nuclease, a homing endonuclease, a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), a meganuclease, a Cas nuclease, a core Cas protein, a TnpB nuclease, an endonuclease-deficient Cas protein, an enzymatically inactive Cas protein, a CRISPR-associated transposase (CAST), a type II or type V Cas protein, base editing, prime editing, programmable addition of site-specific targeting elements (PASTE), or a functional portion thereof.

682. The genome modifying substance is selected from the group consisting of Cas1, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas12, Cas12a (Cpf1), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), and Cas12f. (C2c10), Cas12g, Cas12h, Cas12i, Cas12k (C2c5), Cas13, Cas13a (C2c2), Cas13b, Cas13c, C as13d, C2c4, C2c8, C2c9, Cmr1, Cmr2, Cmr3, Cmr4, Cmr5, Cmr6, Csd1, Csd2, Cas5d, Cse1, Cse2 , Cse3, Cse4, Cas5e, Csf1, Csm1, Csm2, Csm3, Csm4, Csm5, Csn1, Csn2, Cst1, Cst2, Cas5t, Csh 1, Csh2, Cas5h, Csa1, Csa2, Csa3, Csa4, Csa5, Cas5a, Csx10, Csx11, Csy1, Csy2, Csy3, Csy4, Mad7, SpCas9, eSpCas9 of SpCas9, SpCas9-HF1, HypaSpCas9, HeFSpCas9, and evoSpCas9 high-fidelity variants, SaCas9, NmeCas9, CjCas9, StCas9, TdCas9, LbCas12a, AsCas12a, AacCas12b, BhCas12bv4, TnpB, FokI, dCas(D10A), dCas(H840A), dCas13a, dCas13b, base editor, prime editor, target primed reverse transcription (TPRT) editor, APOBEC1, cytidine deaminase, adenosine deaminase, uracil glycosylase inhibitor (UGI), adenine base editor (ABE), cytosine base editor (CBE), reverse transcriptase, serine integrase, recombinase, transposase, polymerase, adenine to thymine or " 682. The method of any one of claims 675-681, wherein the base is selected from the group consisting of: ATBE (or thymine to adenine or "TABE") transversion base editor, 10-11 translocation methylcytosine dioxygenase (TET), TET1, TET3, TET1CD, histone acetyltransferase p300, histone methyltransferase SMYD3, histone methyltransferase PRDM9, H3K79 methyltransferase DOT1L, a transcriptional repressor, or a functional portion thereof.

683. The method of any one of claims 675-682, wherein the genome targeting agent and the genome modifying agent are different domains of a single polypeptide.

684. 684. The method of any one of claims 675-683, wherein the genome targeting agent and the genome modifying agent are two different polypeptides that are operably linked to each other.

685. 684. The method of any one of claims 675-683, wherein the genome targeting agent and the genome modifying agent are two different polypeptides that are not linked to each other.

686. 686. The method of any one of claims 674-685, wherein the genome editing complex comprises a guide nucleic acid having a targeting domain complementary to at least one sequence within a safe harbor site of the genome, and optionally the guide nucleic acid is a guide RNA (gRNA).

687. The method of any one of claims 674 to 686, wherein the genome editing complex comprises an RNA-guided nuclease.

688. The method of claim 687, wherein the RNA-guided nuclease comprises a Cas nuclease.

689. The method of claim 688, wherein the genome editing complex comprises a ribonucleoprotein (RNP) complex comprising the Cas nuclease and the gRNA.

690. The method of claim 688 or 689, wherein the Cas nuclease is a type II or type V Cas protein.

691. The Cas nuclease is Cas3, Cas4, Cas5, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas12, Cas12a (Cpf1), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12f (C2c10), Cas12g, Cas12h, Cas12i, Ca s12k (C2c5), Cas13, Cas13a (C2c2), Cas13b, Cas13c, Cas13d, C2c4, C2c8, C2c9, Cmr5, Cse1, Cse2, Csf1, Csm2, Csn2, Csx10, Csx11, Csy1, Csy2, Csy3, and Mad7.

692. The method of Claim 678, wherein the gRNA comprises a complementary region, the complementary region comprising a nucleic acid sequence complementary to a target nucleic acid sequence within a locus, and the target nucleic acid sequence comprises the insertion site.

693. The method of claim 692, wherein the locus is a TCR locus.

694. 693. The method of claim 692, wherein the locus is the B2M locus.

695. 693. The method of claim 692, wherein the locus is the CIITA locus.

696. the first insertion site is no more than 25 nucleotides from a protospacer adjacent motif (PAM) sequence, and the PAM sequence is ngg, nag, ngrrt, ngrrn, nnnngatt, nnnnryac, nnagaaw, naaaac, tttv, ttn, attn, tttn, gttn, or yttn; (i) r=a or g; (ii) y=c or t; (iii) w=a or t; (iv) v=a or c or g; (v) The method of any one of claims 660 to 695, wherein n=a, c, t, or g.

697. 697. The method of any one of claims 660-696, wherein the inserting step comprises homology-directed repair (HDR)-mediated insertion using SpCas9, and the PAM is ngg or nag, where n=a, c, t, or g.

698. the inserting step comprises homology-directed repair (HDR)-mediated insertion using SaCas9, and the PAM is ngrrt or ngrrn; (i) r=a or g; (ii) The method of any one of claims 660 to 696, wherein n=a, c, t, or g.

699. 697. The method of any one of claims 660-696, wherein the inserting step comprises homology-directed repair (HDR)-mediated insertion using NmeCas9, and the PAM is nnnnngatt, where n=a, c, t, or g.

700. the inserting step comprises homology-directed repair (HDR)-mediated insertion using CjCas9, and the PAM is nnnnryac; (i) r=a or g; (ii) y=c or t; (iii) The method of any one of claims 660 to 696, wherein n=a, c, t, or g.

701. the inserting step comprises homology-directed repair (HDR)-mediated insertion using StCas9, and the PAM is nnagaaw; (i) w=a or t; (ii) The method of any one of claims 660 to 696, wherein n=a, c, t, or g.

702. 697. The method of any one of claims 660-696, wherein the inserting step comprises homology-directed repair (HDR)-mediated insertion using TdCas9, and the PAM is naaaac, where n=a, c, t, or g.

703. 697. The method of any one of claims 660-696, wherein the inserting step comprises homology-directed repair (HDR)-mediated insertion using LbCasl2a, and the PAM is tttv, where v=a or c or g.

704. 697. The method of any one of claims 660-696, wherein the inserting step comprises homology-directed repair (HDR)-mediated insertion using AsCasl2a, and the PAM is tttv, where v=a or c or g.

705. 697. The method of any one of claims 660-696, wherein the inserting step comprises homology-directed repair (HDR)-mediated insertion using AacCasl2b, and the PAM is ttn, where n=a, c, t, or g.

706. 697. The method of any one of claims 660 to 696, wherein the inserting step comprises homology-directed repair (HDR)-mediated insertion using BhCasl2b, and wherein the PAM is attn, tttn, or gttn, and n=a, c, t, or g.

707. the inserting step comprises insertion mediated by homology-directed repair (HDR) using MAD7 (ErCasl2a), and the PAM is yttn; (i) y=c or t; (ii) The method of any one of claims 660 to 696, wherein n=a, c, t, or g.

708. 708. The method of any one of claims 660, 678, or 697-707, wherein site-specific nuclease-based homology directed repair (HDR)-mediated insertion is performed with an HDR efficiency equal to or greater than lentiviral-based HDR insertion.

709. 678. The method of any one of Claims 660-673, 675, 676, or 677, wherein the inserting step comprises ZFN-mediated homology directed repair (HDR)-mediated insertion.

710. 709. The method of any one of claims 660-673, 675, 676, 677, or 709, wherein said first insertion site is no more than 25 nucleotides from a zinc finger binding sequence.

711. 678. The method of any one of claims 660-673, 675, 676, or 677, wherein the inserting step comprises TALEN-based homology directed repair (HDR)-mediated insertion.

712. 712. The method of any one of claims 660-673, 675, 676, 677, or 711, wherein the first insertion site is 25 nucleotides or less from a transcription activator-like effector (TALE) binding sequence.

713. 678. The method of any one of Claims 660-675 or 677, wherein the inserting step comprises homology directed repair (HDR)-mediated insertion using a guide RNA (gRNA) and a TnpB polypeptide.

714. 714. The method of Claim 713, wherein said gRNA comprises a complementary region, said complementary region comprising a nucleic acid sequence complementary to a target nucleic acid sequence within a locus, said target nucleic acid sequence comprising said insertion site.

715. The method of claim 714, wherein the locus is a TCR locus.

716. The method of claim 714, wherein the locus is the B2M locus.

717. The method of claim 714, wherein the locus is the CIITA locus.

718. The method of claim 714, wherein the locus is a safe harbor locus.

719. 719. The method of claim 718, wherein the safe harbor locus is the AAVS1, ABO, CCR5, CLYBL, CXCR4, F3, FUT1, HMGB1, KDM5D, LRP1, MICA, MICB, RHD, ROSA26, or SHS231 locus.

720. the insertion site is 25 nucleotides or less from a target adjacent motif (TAM) sequence, and the TAM sequence is tca, tcac, tcag, tcat, tcaa, ttcan, ttcaa, ttcag, or ttgat; (i) The method of any one of claims 713 to 719, wherein n=a, c, t, or g.

721. 721. The method of any one of claims 713-720, wherein the inserting step comprises homology-directed repair (HDR)-mediated insertion using a TnpB polypeptide, and the TAM is tca.

722. 721. The method of any one of claims 713-720, wherein the inserting step comprises homology-directed repair (HDR)-mediated insertion using a TnpB polypeptide, and the TAM is tcac.

723. 721. The method of any one of claims 713-720, wherein the inserting step comprises homology directed repair (HDR)-mediated insertion using a TnpB polypeptide, and the TAM is tcag.

724. 721. The method of any one of claims 713-720, wherein the inserting step comprises homology directed repair (HDR)-mediated insertion using a TnpB polypeptide, and wherein the TAM is tcat.

725. 721. The method of any one of claims 713-720, wherein the inserting step comprises homology-directed repair (HDR)-mediated insertion using a TnpB polypeptide, and the TAM is tcaa.

726. 721. The method of any one of claims 713-720, wherein the inserting step comprises homology-directed repair (HDR)-mediated insertion using a TnpB polypeptide, and wherein the TAM is ttcan and n=a, c, t, or g.

727. 721. The method of any one of claims 713-720, wherein the inserting step comprises homology-directed repair (HDR)-mediated insertion using a TnpB polypeptide, and the TAM is ttcaa.

728. 721. The method of any one of claims 713-720, wherein the inserting step comprises homology directed repair (HDR)-mediated insertion using a TnpB polypeptide, and the TAM is ttcag.

729. 721. The method of any one of claims 713-720, wherein the inserting step comprises homology-directed repair (HDR)-mediated insertion using a TnpB polypeptide, and the TAM is ttgat.

730. The method of claim 658 or 659, wherein the step of delivering the nucleic acid construct to the cell comprises viral transduction with a retroviral or adeno-associated viral (AAV) vector.

731. 731. The method of claim 730, wherein said retrovirus is or comprises Moloney murine leukemia virus (M-MuLV), Moloney murine sarcoma virus (MoMSV), Harvey murine sarcoma virus (HaMuSV), mouse mammary tumor virus (MuMTV), gibbon ape leukemia virus (GaLV), feline leukemia virus (FLV), spumavirus, Friend murine leukemia virus, murine stem cell virus (MSCV), Rous sarcoma virus (RSV), lentivirus, gammaretrovirus, epsilonretrovirus, alpharetrovirus, betaretrovirus, deltaretrovirus, or spumaretrovirus.

732. 731. The method of claim 730, wherein the AAV vector is an AAV6 vector or an AAV9 vector.

733. 6. The method of any one of claims 660, 661, 662, 673-693, 696-715, or 720-732, wherein said first transgene encoding said engineered protein at said insertion site of a TCR locus reduces expression of a functional TCR.

734. 664. The method of any one of claims 660, 661, 662, 673-693, 696-715, or 720-733, wherein said first transgene encoding said engineered protein at said insertion site of a TCR locus disrupts expression of a functional TCR.

735. 6. The method of any one of claims 660, 661, 662, 673-693, 696-715, or 720-732, wherein the first transgene encoding the engineered protein at the insertion site of the B2M locus reduces expression of functional B2M.

736. 735. The method of any one of claims 660, 661, 662, 673-693, 696-715, or 720-732, or 735, wherein the first transgene encoding the engineered protein at the insertion site of the B2M locus reduces expression of a functional MHC I molecule.

737. 66. The method of any one of claims 660, 661, 662, 673-693, 696-715, or 720-732, or 735-736, wherein the first transgene encoding the engineered protein at the insertion site of the B2M locus disrupts expression of functional B2M.

738. 6. The method of any one of claims 660, 661, 662, 673-693, 696-715, or 720-732, or 735-737, wherein said first transgene encoding said engineered protein at said insertion site in the B2M locus disrupts expression of a functional MHC I molecule.

739. 6. The method of any one of claims 660, 661, 662, 673-693, 696-715, or 720-732, wherein the first transgene encoding the engineered protein at the insertion site of the CIITA locus reduces expression of functional CIITA.

740. 739. The method of any one of claims 660, 661, 662, 673-693, 696-715, or 720-732, or 739, wherein the first transgene encoding the engineered protein at the insertion site of the CIITA locus reduces expression of a functional MHCII molecule.

741. 6. The method of any one of claims 660, 661, 662, 673-693, 696-715, or 720-732, or 739-740, wherein the first transgene encoding the engineered protein at the insertion site of the CIITA locus disrupts expression of functional CIITA.

742. 6. The method of any one of claims 660, 661, 662, 673-693, 696-715, or 720-732, or 739-741, wherein the first transgene encoding the engineered protein at the insertion site of the CIITA locus disrupts expression of a functional MHCII molecule.

743. The cells (a) one or more major histocompatibility complex (MHC) class I molecules, or one or more molecules that modulate the expression of said one or more MHC class I molecules; and / or (b) one or more MHC class II molecules, or one or more molecules that modulate the expression of said one or more MHC class II molecules; 743. The method of any one of claims 658-742, comprising one or more modifications that inactivate or disrupt one or more alleles of

744. 744. The method of any one of claims 658-743, wherein the cells comprise one or more modifications that inactivate or disrupt one or more alleles of one or more MHC class I molecules or one or more molecules that regulate expression of said one or more MHC class I molecules.

745. 745. The method of any one of claims 658-744, wherein the cells comprise one or more modifications that inactivate or disrupt one or more alleles of one or more MHC class II molecules or one or more molecules that regulate expression of said one or more MHC class II molecules.

746. The cells (a) one or more MHC class I molecules, or one or more molecules that modulate the expression of said one or more MHC class I molecules; and (b) one or more MHC class II molecules, or one or more molecules that modulate the expression of said one or more MHC class II molecules; 746. The method of any one of claims 658-745, comprising one or more modifications that inactivate or disrupt one or more alleles of

747. The method of any one of claims 743 to 746, wherein said one or more modifications reduce cell surface protein expression of said one or more MHC class I molecules.

748. The method of any one of claims 743-747, wherein said one or more modifications reduce cell surface transport of said one or more MHC class I molecules.

749. 749. The method of any one of claims 743 to 748, wherein said one or more modifications reduce a function of said one or more MHC class I molecules, optionally wherein said function is antigen presentation.

750. The method of any one of claims 743 to 749, wherein the one or more MHC class I molecules are one or more human leukocyte antigen (HLA) class I molecules.

751. The method of claim 750, wherein said one or more HLA class I molecules are selected from the group consisting of HLA-A, HLA-B, and HLA-C.

752. The method of any one of claims 743 to 751, wherein the one or more molecules that regulate the expression of the one or more MHC class I molecules are selected from the group consisting of B2M, NLRC5, and TAP1.

753. The method of any one of claims 743-752, wherein said one or more modifications reduce cell surface protein expression of said one or more MHC class II molecules.

754. The method of any one of claims 743-753, wherein said one or more modifications reduce cell surface transport of said one or more MHC class II molecules.

755. 755. The method of any one of claims 743-754, wherein said one or more modifications reduce a function of said one or more MHC class II molecules, optionally wherein said function is antigen presentation.

756. The method of any one of claims 743 to 755, wherein the one or more MHC class II molecules are one or more human leukocyte antigen (HLA) class II molecules.

757. The method of claim 756, wherein said one or more HLA class II molecules are selected from the group consisting of HLA-DP, HLA-DQ, and / or HLA-DR.

758. The method of any one of claims 743 to 757, wherein the one or more molecules that modulate the expression of the one or more MHC class II molecules are selected from the group consisting of CIITA and CD74.

759. 759. The method of any one of claims 660-758, wherein the first transgene encoding the engineered protein at an insertion site of a safe harbor locus disrupts expression of functional AAVS1, ABO, CCR5, CLYBL, CXCR4, F3, FUT1, HMGB1, KDM5D, LRP1, MICA, MICB, RHD, ROSA26, or SHS231.

760. 759. The method of any one of claims 660-758, wherein the first transgene encoding the engineered protein at the insertion site of a safe harbor locus disrupts expression of a functional AAVS1, ABO, CCR5, CLYBL, CXCR4, F3, FUT1, HMGB1, KDM5D, LRP1, MICA, MICB, RHD, ROSA26, or SHS231 molecule.

761. 761. The method of any one of claims 658-760, wherein said genetically engineered cells have cell surface expression of said genetically engineered protein.

762. The method of any one of claims 658 to 761, wherein the nucleic acid construct further comprises a second transgene encoding an immune tolerance-inducing factor.

763. 763. The method of claim 762, wherein said method further comprises inserting said second transgene into a second insertion site in the genome of said cell.

764. The method of claim 762, wherein the immune tolerance inducer is or comprises A20 / TNFAIP3, B2M-HLA-E, CD16, CD16 Fc receptor, CD24, CD27, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD64, CD200, CCL21, CCL22, CTLA4-Ig, C1 inhibitory factor, CR1, DUX4, FASL, HLA-C, HLA-E, HLA-E heavy chain, HLA-F, HLA-G, H2-M3, IDO1, IL-10, IL15-RF, IL-35, IL-39, MANF, Mfge8, PD-L1, or Serpinb9.

765. 765. The method of any one of claims 762-764, wherein the second transgene encoding the immune tolerance inducer is inserted at the second insertion site of the TCR locus.

766. 765. The method of any one of claims 762 to 764, wherein the second transgene encoding the immune tolerance inducer is inserted at the second insertion site of the B2M locus.

767. The method of any one of claims 762 to 121b764, wherein the second transgene encoding the immune tolerance inducer is inserted at the second insertion site of the CIITA locus.

768. 765. The method of any one of claims 762-764, wherein the second transgene encoding the immune tolerance inducer is inserted at the second insertion site of a safe harbor locus.

769. The method of claim 768, wherein the safe harbor locus is the AAVS1, ABO, CCR5, CLYBL, CXCR4, F3, FUT1, HMGB1, KDM5D, LRP1, MICA, MICB, RHD, ROSA26, or SHS231 locus.

770. The method of any one of claims 762 to 769, wherein the genetically engineered cells have cell surface expression of the immune tolerance-inducing factor.

771. 771. The method of any one of claims 658-770, wherein said nucleic acid construct further comprises a third transgene encoding a chimeric antigen receptor (CAR).

772. 772. The method of claim 771, wherein the method further comprises inserting the third transgene into a third insertion site in the genome of the cell.

773. Preface CAR, CD5-specific CAR, CD19-specific CAR, CD20-specific CAR, CD22-specific CAR, CD23-specific CAR, CD30-specific CAR, CD33-specific CAR, CD38-specific CAR, CD70-specific CAR, CD123-specific CAR, CD138-specific CAR, kappa, lambda, B cell maturation substance (BCMA)-specific CAR, GPCR5D-specific CAR, CD123-specific CAR, LeY-specific CAR, NKG2D-specific CAR CAR, WT1-specific CAR, GD2-specific CAR, HER2-specific CAR, EGFR-specific CAR, EGFRvIII-specific CAR, B7H3-specific CAR, PSMAA-specific CAR, PSCAA-specific CAR, CAIX-specific CAR, CD171-specific CAR, CEA-specific CAR, CSPG4-specific CAR, EPHA2-specific CAR, FAP-specific CAR, FRα-specific CAR, IL-13Rα-specific CAR, mesoterin-specific CAR, MUC1-specific CAR, MUC16-specific CAR, ROR 1-specific CAR, C-Met-specific CAR, CD133-specific CAR, Epi-CAM-specific CAR, GPC3-specific CAR, HPV16-E6-specific CAR, IL13Ra2-specific CAR, MAGEA3-specific CAR, MAGEA4-specific CAR, MART1-specific CAR, NY-ESO-1-specific CAR, VEGFR2-specific CAR, α-folate receptor-specific CAR, CD24-specific CAR, CD44v7 / 8-specific CAR, EGP-2-specific CAR, EGP-40-specific CAR, erb-B2-specific CAR R, erb-B2,3,4-specific CAR, FBP-specific CAR, fetal acetylcorine receptor-specific CAR, GD2-specific CAR, GD3-specific CAR, HMW-MAA-specific CAR, IL-11Rα-specific CAR, KDR-specific CAR, LuisY-specific CAR, L1 cells followed by molecular-specific CAR, MAGE-A1-specific CAR, oncofetal specific antigen (h5T4)-specific CAR, TAG -72 specific CAR, またはCD19 / CD22 dual specific CARであるか, またはそれをincluding む, method described in request item 771. Request 774 The method of any one of claims 771-773, wherein the CAR is or comprises a CD19-specific CAR, a CD20-specific CAR, a CD22-specific CAR, a CD38-specific CAR, a CD123-specific CAR, a CD138-specific CAR, a BCMA-specific CAR, or a CD19 / CD22 bispecific CAR.

775. The method of any one of claims 771-774, wherein the genetically engineered cell has cell surface expression of the CAR.

776. 771. The method of any one of claims 658-770, wherein the nucleic acid construct further comprises a third transgene encoding a chimeric autoantigen receptor (CAAR).

777. 777. The method of claim 776, wherein the method further comprises inserting the third transgene into a third insertion site in the genome of the cell.

778. The method of claim 776, wherein the CAAR comprises an antigen selected from the group consisting of pancreatic beta cell antigen, synovial joint antigen, myelin basic protein, proteolipid protein, myelin oligodendrocyte glycoprotein, MuSK, keratinocyte adhesion protein desmoglein 3 (Dsg3), Ro-RNP complex, La antigen, myeloperoxidase, proteinase 3, cardiolipin, citrullinated proteins, carbamylated proteins, and the alpha 3 chain of basement membrane collagen.

779. The method of any one of claims 776 to 778, wherein the genetically engineered cell has cell surface expression of the CAAR.

780. 771. The method of any one of claims 658 to 770, wherein the nucleic acid construct further comprises a third transgene encoding a B-cell autoantibody receptor (BAR).

781. 781. The method of claim 780, wherein the method further comprises inserting the third transgene into a third insertion site in the genome of the cell.

782. 781. The method of claim 780, wherein the genetically engineered cell has cell surface expression of the BAR.

783. 783. The method of any one of claims 771-782, wherein said third transgene is inserted into a safe harbor locus.

784. 784. The method of any one of claims 771-783, wherein the third transgene is inserted at the TRAC locus, TRBC1 locus, TRBC2 locus, B2M locus, CIITA locus, MICA locus, MICB locus, or safe harbor locus.

785. 785. The method of any one of claims 771-784, wherein the third transgene is inserted into the AAVS1 locus, ABO locus, CCR5 locus, CLYBL locus, CXCR4 locus, F3 locus, FUT1 locus, HMGB1 locus, KDM5D locus, LRP1 locus, RHD locus, ROSA26 locus, or SHS231 locus.

786. 786. The method of any one of claims 658-785, wherein the first transgene and the second transgene are inserted into the same insertion site.

787. 786. The method of any one of claims 658-768 or 780-785, wherein the first transgene and the third transgene are inserted into the same insertion site.

788. 786. The method of any one of claims 762-785, wherein the second transgene and the third transgene are inserted into the same insertion site.

789. 786. The method of any one of claims 658-785, wherein the first transgene, the second transgene, and the third transgene are inserted into the same insertion site.

790. 790. The method of any one of claims 658-789, wherein the first transgene, the second transgene, and the third transgene are encoded by three separate constructs.

791. 790. The method of any one of claims 658-789, wherein the first transgene, the second transgene, and the third transgene are encoded by two separate constructs.

792. 790. The method of any one of claims 658-789, wherein the first transgene, the second transgene, and the third transgene are encoded by a polycistronic construct.

793. 793. The method of any one of claims 658 to 792, wherein the genetically engineered cell is a human cell or a non-human animal cell.

794. 794. The method of claim 793, wherein the non-human animal cells are porcine, bovine, or ovine cells.

795. The method of claim 793, wherein the genetically engineered cells are human cells.

796. 8. The method of any one of claims 658 to 795, wherein the genetically engineered cells are differentiated cells derived from stem or progenitor cells.

797. 797. The method of any one of claims 658 to 796, wherein the cells are stem or progenitor cells.

798. 797. The method of any one of claims 658 to 796, wherein the cell is a differentiated cell derived from a stem or progenitor cell.

799. The method of claim 796, wherein the stem cells are pluripotent stem cells.

800. 799. The method of claim 799, wherein the pluripotent stem cells are induced pluripotent stem cells (iPSCs).

801. 799. The method of claim 799, wherein the pluripotent stem cells are embryonic stem cells (ESCs).

802. The method of any one of claims 658 to 801, wherein the cells are primary cells isolated from a donor.

803. The method of claim 802, wherein the donor is healthy and / or not suspected of having a disease or condition at the time the primary cells are taken from the donor.

804. 803. The method of any one of claims 658-803, wherein the cell is an islet cell, a beta islet cell, a pancreatic islet cell, an immune cell, a B cell, a T cell, a natural killer (NK) cell, a natural killer T (NKT) cell, a macrophage cell, an endothelial cell, a muscle cell, a cardiac muscle cell, a smooth muscle cell, a skeletal muscle cell, a dopaminergic neuron, a retinal pigment epithelial cell, a photoreceptor cell, a hepatocyte cell, a thyroid cell, a skin cell, a glial progenitor cell, a neuron, a cardiac cell, a stem cell, a hematopoietic stem cell, an induced pluripotent stem cell (iPSC), a mesenchymal stem cell (MSC), an embryonic stem cell (ESC), a pluripotent stem cell (PSC), a blood cell, or a combination thereof.

805. The method of any one of claims 658 to 804, wherein the cell is a T cell.

806. The method of claim 805, wherein the T cells are CD3+ T cells, CD4+ T cells, CDS+ T cells, naive T cells, regulatory T (Treg) cells, non-regulatory T cells, Th1 cells, Th2 cells, Th9 cells, Th17 cells, follicular helper T (Tfh) cells, cytotoxic T lymphocytes (CTLs), effector T (Teff) cells, central memory T cells, effector memory T cells, effector memory T cells expressing CD45RA (TEMRA cells), tissue-resident memory (Trm) cells, virtual memory T cells, innate immune memory T cells, memory stem cells (Tsc), γδ T cells, or a combination thereof.

807. The method of claim 805 or 806, wherein the T cells are cytotoxic T cells, helper T cells, memory T cells, regulatory T cells, tumor infiltrating lymphocytes, or a combination thereof.

808. The method of any one of claims 805 to 807, wherein the cell is a human T cell.

809. The method of any one of claims 805 to 808, wherein the cells are autologous T cells.

810. The method of any one of claims 805-808, wherein the cell is an allogeneic T cell.

811. The method of claim 810, wherein the allogeneic T cells are primary T cells.

812. 812. The method of claim 810 or 811, wherein the allogeneic T cells are differentiated from embryonic stem cells (ESCs) or induced pluripotent stem cells (iPSCs).

Images