Fermentation method using acetate-producing carboxydotrophic bacteria

By employing acetate-producing carboxydotrophic bacteria with thiH, thiS, thiF, and thiG genes, the method addresses the need for vitamin supplementation and contamination in gas conversion processes, achieving cost-effective and efficient production of oxygenated products like ethanol and acetate.

JP2025524757APending Publication Date: 2025-08-01SYNATA BIO INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024547258
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-07-28
Filing Date
2023-01-11
Publication Date
2025-08-01

AI Technical Summary

Technical Problem

Existing methods for converting gases like CO, CO2, and H2 into fuels and chemicals using acetogenic bacteria require expensive vitamin supplementation and are prone to contamination, necessitating a reduction in vitamin supplementation and contamination control.

Method used

A method involving acetate-producing carboxydotrophic bacteria that include genes thiH, thiS, thiF, and thiG, which do not require exogenous thiamine or thiazole-containing thiamine precursors, enabling conversion of CO, CO2, and H2 into oxygenated products within a bioreactor.

Benefits of technology

This approach reduces costs associated with vitamin supplementation and minimizes contamination, achieving efficient conversion of gases into oxygenated products like ethanol and acetate without the need for thiamine, thereby optimizing fermentation processes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025524757000001
    Figure 2025524757000001
  • Figure 2025524757000002
    Figure 2025524757000002
  • Figure 2025524757000003
    Figure 2025524757000003
Patent Text Reader

Abstract

Disclosed is a method for producing at least one oxygenated product from a gaseous substrate containing CO, CO2, and optionally H2. Also provided are methods of using a broth lacking thiamine or a thiamine precursor containing thiazole as a screening tool for suitable ethanol-producing acetate-producing carboxydotrophic bacterial strains, methods of operating syngas fermentation without the addition of thiamine or a thiamine precursor containing thiazole, methods of controlling bacterial contamination in a bioreactor, and methods of preparing animal feed and fertilizers.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Cross - References to Related Applications This patent application claims the benefit of U.S. Provisional Patent Application No. 63 / 369,683, filed Jul. 28, 2022, which is hereby incorporated by reference in its entirety.

[0002] Incorporation by Reference of Electronically Submitted Materials Incorporated by reference in its entirety herein is a computer - readable nucleotide / amino acid sequence listing identified as a 7,154 - byte XML file named "766308.xml", created on Jan. 5, 2023, and submitted simultaneously herewith as follows:

Background Art

[0003] Background of the Invention It is desirable to use bacteria to convert gases containing carbon monoxide (CO), carbon dioxide (CO2), and optionally hydrogen (H2), such as industrial waste gas or synthesis gas, into various products such as fuels and chemicals using fermentation. Acetogenic bacteria that can consume CO, CO2, and H2 have been shown to require vitamin supplementation with pantothenate (vitamin B5), thiamine (vitamin B1), and biotin (vitamin B7) for growth (Annan, et al., Appl. Microbiol. Biotechnol., 103: 4633 - 4648 (2019)). Providing vitamin supplements to bacteria during large - scale batch fermentation can be expensive. Furthermore, the removal of vitamin supplements reduces the opportunity for the growth of contaminating microorganisms.

[0004] Accordingly, there remains a need for methods to reduce the need for vitamin supplementation associated with continuous fermentation. Furthermore, there is a need to reduce contamination in continuous fermentation.

Summary of the Invention

[0005] Brief Summary of the Invention One embodiment of the present invention provides a method for producing at least one oxygenated product from a gaseous substrate comprising CO, CO2, and optionally H2, the method comprising: (a) providing to a bioreactor: (1) a gaseous substrate comprising CO, CO2, and optionally H2, (2) at least one acetate-producing carboxydotrophic bacterium, and (3) a liquid nutrient medium, and (b) providing conditions within the bioreactor for the at least one acetate-producing carboxydotrophic bacterium to convert the gaseous substrate into at least one oxygenated product, wherein the at least one acetate-producing carboxydotrophic bacterium comprises at least one gene selected from thiH, thiS, thiF, and thiG.

[0006] Another embodiment of the present invention provides a method for producing at least one oxygenated product from a gaseous substrate comprising CO, CO2, and optionally H2, the method comprising: (a) providing to a bioreactor: (1) a gaseous substrate comprising CO, CO2, and optionally H2, (2) at least one acetate-producing carboxydotrophic bacterium, and (3) a liquid nutrient medium, and (b) providing conditions within the bioreactor for the at least one acetate-producing carboxydotrophic bacterium to convert the gaseous substrate into at least one oxygenated product, wherein the at least one acetate-producing carboxydotrophic bacterium does not require an exogenously supplied thiamine or a thiamine precursor containing thiazole.

[0007] A further embodiment of the present invention provides a method of operating syngas fermentation without the addition of thiamine or a thiazole-containing thiamine precursor, the method comprising: (a) providing to a bioreactor: (1) a gaseous substrate comprising CO, CO2, and optionally H2, (2) at least one acetate-producing carboxydotrophic bacterium, and (3) a liquid nutrient medium that does not contain thiamine or a thiazole-containing thiamine precursor, and (b) providing within the bioreactor conditions for the at least one acetate-producing carboxydotrophic bacterium to convert the gaseous substrate into at least one oxygenated product, wherein the conditions within the bioreactor create a bioreactor broth and the thiamine or thiazole-containing thiamine precursor is not added to (i) the liquid nutrient medium or (ii) the bioreactor broth before or during syngas fermentation.

[0008] An additional embodiment of the present invention provides a method of producing at least one oxygenated product from a gaseous substrate comprising CO, CO2, and optionally H2, the method comprising: (a) providing to a bioreactor: (1) a gaseous substrate comprising CO, CO2, and optionally H2, (2) at least one acetate-producing carboxydotrophic bacterium, and (3) a liquid nutrient medium, and (b) providing within the bioreactor conditions for the at least one acetate-producing carboxydotrophic bacterium to convert the gaseous substrate into at least one oxygenated product, wherein the at least one acetate-producing carboxydotrophic bacterium comprises at least one gene (e.g., an exogenous gene) selected from thiH, thiS, thiF, and thiG.

[0009] Another aspect of the present invention provides a method of using a broth lacking thiamine or a thiamine precursor containing thiazole as a screening tool for a suitable ethanol-producing acetate-forming carboxydotrophic bacterial strain, the method comprising: (a) in a bioreactor in the absence of thiamine or a thiamine precursor containing thiazole: (1) providing a gaseous substrate comprising CO, CO2, and optionally H2, (2) at least one acetate-forming carboxydotrophic bacterium, and (3) a liquid nutrient medium, and (b) providing conditions within the bioreactor for the at least one acetate-forming carboxydotrophic bacterium to convert the gaseous substrate into at least one oxygenated product, wherein conversion of the gaseous substrate into at least one oxygenated product indicates the presence of a suitable ethanol-producing acetate-forming carboxydotrophic bacterial strain.

[0010] A further aspect of the present invention provides a method of controlling bacterial contamination in a bioreactor, the method comprising: (a) in a bioreactor in the absence of thiamine or a thiamine precursor containing thiazole: (1) providing a gaseous substrate comprising CO, CO2, and optionally H2, (2) at least one acetate-forming carboxydotrophic bacterium, and (3) a liquid nutrient medium, and (b) providing conditions within the bioreactor for the at least one acetate-forming carboxydotrophic bacterium to convert the gaseous substrate into at least one oxygenated product, wherein the absence of exogenously supplied thiamine or a thiamine precursor containing thiazole in the bioreactor prevents unwanted contamination of the bioreactor broth by acetate-forming carboxydotrophic bacteria.

[0011] Additional aspects include a method of preparing animal feed and a method of preparing fertilizer. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Brief description of several viewpoints of the drawing(s)

Figure 1

Figure 2

Figure 3

Figure 4A

Figure 4B

Figure 4C

Figure 4D

Figure 5A

Figure 5B

Figure 6A

Figure 6B

[0013] Detailed Description of the Invention One aspect of the present invention provides a method for producing at least one oxygenated product from a gaseous substrate comprising CO, CO2, and optionally H2, the method comprising: (a) providing to a bioreactor: (1) a gaseous substrate comprising CO, CO2, and optionally H2, (2) at least one acetic acid-producing carboxydotrophic bacterium, and (3) a liquid nutrient medium, and (b) providing conditions within the bioreactor for the at least one acetic acid-producing carboxydotrophic bacterium to convert CO, CO2, and optionally H2 into at least one oxygenated product, wherein the at least one acetic acid-producing carboxydotrophic bacterium comprises at least one gene selected from thiH, thiS, thiF, and thiG, and the conditions within the bioreactor create a bioreactor broth.

[0014] Thiamine can be produced in bacteria via an 11-step pathway (see Figure 1). Bacteria that convert CO, CO2, and optionally H2 into at least one oxygenated product were previously known to require thiamine to survive and produce the oxygenated product. U.S. Patent No. 10,415,043 discloses transforming Clostridium autoethanogenum with a thiamine biosynthetic protein (ThiC) (EC 4.1.99.17) from Clostridium ragsdalei. This transformation enables Clostridium autoethanogenum to grow without thiamine. In addition to thiC, Clostridia generally lack thiG and thiH, which are required for the synthesis of the thiazole component of thiamine (Annan et al., Applied Microbiology and Biotechnology, 103: 4633-4648 (2019)), and thus the methods claimed herein are unexpected. Annan et al. suggested that these results indicate that "there are unknown genes or unknown pathways that replace thiG and ThiH" (id. at 4646). However, unexpectedly, it has been found that members of the Clostridia that utilize synthesis gas and contain the thiGSH pathway, and when thiC is also present, these microorganisms do not require supplementation with exogenous thiamine or thiazole-containing thiamine precursors for growth.

[0015] This unexpected discovery has several advantages. One advantage is that adding thiamine or thiazole-containing thiamine precursors to fermentation can be expensive, and thus not adding them can result in cost savings. Furthermore, some vitamins are sensitive to chemicals and temperature, which makes their use undesirable for process considerations and requires design changes. Also, the acidic nature of thiamine hydrochloride, which is a common form, can make vitamin solutions less stable depending on the other components of the fermentation.

[0016] In one aspect, at least one acetic acid-producing carboxydotrophic bacterium comprises a sequence having at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 86%, 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identity to any one of SEQ ID NOs: 1-4.

[0017]

[0018] This carrier protein (thiS) is encoded by the thiS gene. In one aspect, at least one acetate-producing carboxydotrophic bacterium comprises a sequence having at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 86%, 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identity to thiS. In one aspect, at least one acetate-producing carboxydotrophic bacterium comprises a sequence having at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 86%, 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identity to SEQ ID NO: 2 (ATGATTGTAAATGGAGAAGAATTAAATTTTGAGAACGATATAACTGTATCTCAATTGCTGAACAAGTTAAATGTAAATGAAGAAACAGTTGTAGTTGAAGTTGACTTAGAAATAGTAGACAGAGATGTCTATAAAACAAAAAAACTTTCAAGCACTTCCAAAGTAGAAGTTATCCGTTATGTTGGAGGTGGC).

[0019] This adenyltransferase (thiF) is encoded by the thiF gene. In one aspect, at least one acetic acid-producing carboxydotrophic bacterium comprises a sequence having at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 86%, 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identity to thiF.In one aspect, at least one acetic acid-producing carboxydotrophic bacterium comprises a sequence having at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 86%, 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identity to SEQ ID NO: 3 (ATGCCATTGACAGATAAAGAGCGTGAAAAGTATGCAAGACACCTAGTATTAAAAGAAATTGGTGCGGCAGGTCAGGAAAAACTTTTAAGCTCCAGGATTTTAATTATAGGCACTGGAGGCCTGGGTTCCCCAGCCTCTGCATATCTTGCTGCAGCAGGTATCGGGACACTAGGACTTGTAGACTTTGATAAAGTAGAACTGTCAAACCTTCAAAGACAAATAATACACATGACAAAAAATATAGGGAAACCAAAACTTTTATCTGCAAAAGAAACTTTAAACAATATAAATCCTGATATGAATGTAATAACTTATAATGAACATCTTGACCACAATAACACAGCTGACATAATAAATGACATGAATTATGATTTCATTTTGGATTGTACAGATAACTTTGAGTCAAAATTTCTTATAAACGATGCTTGTGTTGCCTTAAAAAAACCTTTTTCACATGGAGGTGTTATAAGATTTAGAGGACAAACCATGACTTATATTCCCGGTAAAGGTCCATGTTATAGGTGTGTTTTCGTAAATCCACCCCTGGATGGCGTTGTTCCCACTTCAAAGCAAGTTGGAATAATTGGCACTTCACCAGGAGTTATAGGCACCATTCAGGCTATGGAGGCCATCAAATATATTCTTCATATAGGAAATCTCCTTACAGAACACCTTTTAATATACGATGGACTAAAAATGGATTTCAGAAAAATCAAAATATCCAAGAGAAACGATTGTGCAGCCTGTGGTAAAAAACATCTA).

[0020] Thiazole synthase (thiG) is encoded by the thiG gene. In one aspect, at least one acetic acid-producing carboxydotrophic bacterium comprises a sequence having at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 86%, 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identity to thiG.In one aspect, at least one acetic acid-producing carboxydotrophic bacterium comprises a sequence having at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 86%, 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identity to SEQ ID NO: 4 (ATGGATGAACTTGTAATAGCAAATAAAAAAATAAAAAGCAGATTTTTCATTGGAACAGGGAAATTTTCGTCAAATGAAATAGTTCCAGATATTATTAAAAGCTCTGAAGCACAGGTTATAACAGTAGCCTTAAGACGTATCGACATACATGCTACAGATTCAAGAGATAATATACTGAATTTTATAGATAAAGATTGCATACTTGTGGCAAATACATCCGGTGCAAGAAATGCAGAGGAAGCTATACGACTTGCTCATTTAGCTAAAGCAACAGGATGTGGAAATTGGGTTAAAATTGAGGTTATTTCAGATAGCAAATATCTTCTTCCTGATAACTATGAAACTTTAAAAGCTACTGAAGTACTTGTAAAAGAAGGTTTTATAGCACTTCCATATATAAGTCCAAATTTAATGGACGCAAAAAGACTTGTAGACGCAGGTGCCTCTGCAGTCATGCCCTTAGGTTCTCCTATAGGTACAAATAGAGGTCTTAAAACCAGGGAACTTTTAAAAATTCTAATTGATGAAATAGACATTCCTGTAGTTGTAGATGCAGGTATAGGAAAACCCTCTCACGCCGCAGAAGCCATGGAAATGGGTGCAGATGCAGTACTTGCAAATACTGCTCTTGCAACAGCAAAAGATCCAGTACTCATAGCTGAAGCTTTCAAACTTGCAGTACAAGCAGGAAGAAAAGCCTTTCTTTCAAAACCTGGTATTGAAAGAGAATTGGCCAGTGCTTCATCACCACTCACAGGATTTTTAAGA).

[0021] In one aspect, at least one acetic acid-producing carboxydotrophic bacterium comprises thiH and thiS. In one aspect, at least one acetic acid-producing carboxydotrophic bacterium comprises thiH and thiF. In one aspect, at least one acetic acid-producing carboxydotrophic bacterium comprises thiH and thiG. In one aspect, at least one acetic acid-producing carboxydotrophic bacterium comprises thiS and thiF. In one aspect, at least one acetic acid-producing carboxydotrophic bacterium comprises thiS and thiG. In one aspect, at least one acetic acid-producing carboxydotrophic bacterium comprises thiF and thiG.

[0022] In one aspect, at least one acetic acid-producing carboxydotrophic bacterium comprises thiH, thiS, and thiF. In one aspect, at least one acetic acid-producing carboxydotrophic bacterium comprises thiS, thiF, and thiG. In one aspect, at least one acetic acid-producing carboxydotrophic bacterium comprises thiH, thiS, and thiG. In one aspect, at least one acetic acid-producing carboxydotrophic bacterium comprises thiH, thiF, and thiG. In a further aspect, at least one acetic acid-producing carboxydotrophic bacterium comprises thiH, thiS, thiF, and thiG.

[0023] In one aspect, thiH, thiS, thiF, or thiG is an endogenous gene. In one aspect, at least one acetic acid-producing carboxydotrophic bacterium is engineered to have greater expression of endogenous thiH, thiS, thiF, and / or thiG than an unengineered acetic acid-producing carboxydotrophic bacterium (e.g., by adding a suitable promoter).

[0024] In one aspect, at least one acetate-producing carboxydotrophic bacterium is recombinant. In one aspect, at least one acetate-producing carboxydotrophic bacterium has been engineered to contain at least one gene selected from thiH, thiS, thiF, and thiG. In one aspect, thiH, thiS, thiF, or thiG is an exogenous gene. An "exogenous gene" is a gene that is derived from outside of the acetate-producing carboxydotrophic bacterium into which the gene is introduced. Exogenous genes can be derived from any suitable source, including but not limited to the acetate-producing carboxydotrophic bacterium into which they are to be introduced (e.g., the parental acetate-producing carboxydotrophic bacterium from which the recombinant acetate-producing carboxydotrophic bacterium is derived), a strain or species of acetate-producing carboxydotrophic bacterium different from the acetate-producing carboxydotrophic bacterium into which they are to be introduced, or they can be artificially or recombinantly created. In one aspect, exogenous genes are introduced to increase the expression of a particular gene or overexpress a particular gene (e.g., by increasing the copy number of the gene), or to introduce a strong or constitutive promoter to increase expression). In another aspect, exogenous genes represent genes that are not naturally present within the acetate-producing carboxydotrophic bacterium into which the gene is to be introduced, and enable the expression of products that are not naturally present within the acetate-producing carboxydotrophic bacterium or increased expression of genes that are native to the acetate-producing carboxydotrophic bacterium (e.g., in the case of the introduction of regulatory elements such as promoters). Exogenous genes can be adapted to integrate into the genome of the acetate-producing carboxydotrophic bacterium into which the exogenous gene is to be introduced.

[0025] In one aspect, at least one acetic acid-producing carboxydotrophic bacterium is non-naturally occurring. As used herein, "non-naturally occurring" refers to an acetic acid-producing carboxydotrophic bacterium that has been modified by human hand and has at least one genetic modification that is not found in naturally occurring strains of the species being referenced, i.e., not found in wild-type strains of the species being referenced.

[0026] In one aspect, at least one acetic acid-producing carboxydotrophic bacterium is a Clostridium bacterium.

[0027] One aspect of the present invention provides a method for producing at least one oxygenated product from a gaseous substrate comprising CO, CO2, and optionally H2, the method comprising: (a) providing to a bioreactor: (1) a gaseous substrate comprising CO, CO2, and optionally H2, (2) at least one acetic acid-producing carboxydotrophic bacterium, and (3) a liquid nutrient medium, and (b) providing conditions within the bioreactor for the at least one acetic acid-producing carboxydotrophic bacterium to convert the gaseous substrate into at least one oxygenated product, wherein the at least one acetic acid-producing carboxydotrophic bacterium does not require thiamine or a thiamine precursor containing thiazole, and the conditions within the bioreactor create a bioreactor broth.

[0028] As used herein, "thiamine or a thiamine precursor containing thiazole" includes compounds containing a thiazole moiety.

[0029] As used herein, "thiazole-containing thiamine precursor" refers to a thiazole compound that is a precursor in the biosynthesis of thiamine.

[0030] One aspect of the present invention provides a method of operating syngas fermentation without the addition of thiamine or a thiamine precursor containing thiazole, the method comprising: (a) providing to a bioreactor: (1) a gaseous substrate comprising CO, CO2, and optionally H2, (2) at least one acetic acid-producing carboxydotrophic bacterium, and (3) a liquid nutrient medium that does not contain thiamine or a thiamine precursor containing thiazole, and (b) providing conditions within the bioreactor for the at least one acetic acid-producing carboxydotrophic bacterium to convert CO, CO2, and optionally H2 into at least one oxygenated product, wherein the conditions within the bioreactor create a bioreactor broth, and thiamine or a thiamine precursor containing thiazole is not added to (i) the liquid nutrient medium or (ii) the bioreactor broth before or during syngas fermentation.

[0031] As used herein, thiamine includes its salts, including thiamine hydrochloride, thiamine mononitrate, and thiamine nitrate.

[0032] One aspect of the present invention provides a method of producing at least one oxygenated product from a gaseous substrate comprising CO, CO2, and optionally H2, the method comprising: (a) providing to a bioreactor: (1) a gaseous substrate comprising CO, CO2, and optionally H2, (2) at least one acetic acid-producing carboxydotrophic bacterium, and (3) a liquid nutrient medium, and (b) providing conditions within the bioreactor for the at least one acetic acid-producing carboxydotrophic bacterium to convert the gaseous substrate into at least one oxygenated product, wherein the at least one acetic acid-producing carboxydotrophic bacterium comprises at least one gene (e.g., an exogenous gene) selected from thiH, thiS, thiF, and thiG.

[0033] One aspect of the present invention provides a method of using a broth lacking thiamine or a thiamine precursor containing thiazole as a screening tool for a suitable ethanol-producing acetate-forming carboxydotrophic bacterial strain, the method comprising: (a) providing to a bioreactor in the absence of thiamine or a thiamine precursor containing thiazole: (1) a gaseous substrate comprising CO, CO2, and optionally H2, (2) at least one acetate-forming carboxydotrophic bacterium, and (3) a liquid nutrient medium, and (b) providing conditions within the bioreactor for the at least one acetate-forming carboxydotrophic bacterium to convert the gaseous substrate into at least one oxygenated product, wherein conversion of at least one of CO, CO2, and optionally H2 into an oxygenated product indicates the presence of a suitable ethanol-producing acetate-forming carboxydotrophic bacterial strain.

[0034] One aspect of the present invention provides a method of controlling bacterial contamination in a bioreactor, the method comprising: (a) providing to a bioreactor in the absence of thiamine or a thiamine precursor containing thiazole: (1) a gaseous substrate comprising CO, CO2, and optionally H2, (2) at least one acetate-forming carboxydotrophic bacterium, and (3) a liquid nutrient medium, and (b) providing conditions within the bioreactor for the at least one acetate-forming carboxydotrophic bacterium to convert the gaseous substrate into at least one oxygenated product, wherein the absence of exogenously supplied thiamine or a thiamine precursor containing thiazole in the bioreactor prevents unwanted contamination of the bioreactor broth by acetate-forming carboxydotrophic bacteria.

[0035] As used herein, "free of thiamine or a thiamine precursor containing thiazole" and "absence of thiamine or a thiamine precursor containing thiazole" mean that there is less than 0.05 mg of thiamine or a thiamine precursor containing thiazole per 100 L of fermentation broth.

[0036] As used herein, "externally supplied thiamine or thiamine precursor containing thiazole" means not adding thiamine or thiamine precursor containing thiazole to the fermentation broth, bioreactor, or liquid nutrient medium.

[0037] In one embodiment, thiamine or thiamine precursor containing thiazole at 0.05 mg or less is added per 100 L of bioreactor or fermentation broth. In this regard, about 0.05 mg or less, about 0.06 mg, about 0.07 mg, about 0.08 mg, about 0.09 mg, about 0.1 mg, about 0.2 mg, about 0.3 mg, or about 0.4 mg of thiamine is added per 100 L of bioreactor or fermentation broth.

[0038] In one embodiment, thiamine or thiamine precursor containing thiazole at 0.05 mg or less is added per 100 L and is added to the bioreactor or fermentation broth. In this regard, about 0.05 mg or less, about 0.06 mg, about 0.07 mg, about 0.08 mg, about 0.09 mg, about 0.1 mg, about 0.2 mg, about 0.3 mg, or about 0.4 mg of thiazole-containing compound per 100 L is added to the bioreactor or fermentation broth.

[0039] In one embodiment, the oxygenated products are acetic acid ( "acetic acid" and "acetate" are used interchangeably herein), butyrate, butanol, propionate, and propanol. In one embodiment, the oxygenated product is ethanol.

[0040] In one embodiment, the gaseous substrate containing CO, CO2, and optionally H2 is synthesis gas (syngas), such as syngas obtained by gasification of coal or refinery residues, gasification of biomass or lignocellulosic materials, or reforming of natural gas. In another embodiment, the syngas can be obtained from gasification of municipal solid waste or industrial solid waste.

[0041] The gaseous substrate can contain CO, such as at least about 1, about 2, about 5, about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, or about 100 mol% of CO. The gaseous substrate can contain a range of CO, such as from about 20 to about 80, from about 30 to about 70, or from about 40 to about 60 mol% of CO. Preferably, the substrate contains from about 40 to about 70 mol% of CO (e.g., blast furnace gas or converter gas), from about 20 to about 30 mol% of CO (e.g., basic oxygen furnace gas), or from about 15 to about 45 mol% of CO (e.g., synthesis gas). In some embodiments, the gaseous substrate can contain a relatively low amount of CO, such as from about 1 to about 10 or from about 1 to about 20 mol% of CO. In some embodiments, the gaseous substrate contains no or substantially no CO (< about 1 mol%).

[0042] The gaseous substrate can optionally contain H2. For example, the gaseous substrate can contain from about 1, about 2, about 5, about 10, about 15, about 20, or about 30 mol% of H2. In some embodiments, the gaseous substrate can contain a relatively high amount of H2, such as from about 60, about 70, about 80, or about 90 mol% of H2. In another embodiment, the gaseous substrate contains no or substantially no H2 (< about 1 mol%) (e.g., when derived from blast furnace gas). H2 can be derived from or produced by any suitable process, including the formation of H2 using an electrode.

[0043] The gaseous substrate can contain CO2. For example, the gaseous substrate can contain from about 1 to about 80, from about 1 to about 70, from about 1 to about 60, from about 1 to about 50, from about 1 to about 40, from about 1 to about 30, from about 1 to about 25, from about 1 to about 20, from about 1 to about 15, from about 1 to about 10, from about 1 to about 5, from about 1 to about 4, from about 1 to about 3, or from about 2 to about 3 mol% of CO2. In some embodiments, the gaseous substrate can contain less than about 20, about 15, about 10, or about 5 mol% of CO2. In another embodiment, the gaseous substrate contains no or substantially no CO2 (< about 1 mol%).

[0044] In one aspect, at least one acetate-producing carboxydotrophic bacterium is cultured in a bioreactor to produce an acetate-producing carboxydotrophic bacterium culture. In one aspect, the acetate-producing carboxydotrophic bacterium culture continuously produces at least one oxygenated product for more than about 24 hours, about 36 hours, about 48 hours, about 72 hours, about 96 hours, about 120 hours, about 144 hours, about 168 hours, about 192 hours, about 216 hours, about 250 hours, about 300 hours, about 400 hours, about 500 hours, about 600 hours, about 700 hours, about 800 hours, about 900 hours, about 1,000, 1,100 hours, about 1,200 hours, about 1,300 hours, about 1,400 hours, about 1,500 hours, about 1,600 hours, about 1,700 hours, about 1,800 hours, about 1,900 hours, about 2,000 hours, about 2,500 hours, or about 3,000 hours.

[0045] In one aspect, the acetate-producing carboxydotrophic bacterium culture continuously produces at least one oxygenated product at a rate of at least about 0.1 g / L / day (e.g., at least about 0.1 g / L / day, at least about 0.2 g / L / day, at least about 0.3 g / L / day, at least about 0.4 g / L / day, at least about 0.5 g / L / day, at least about 0.6 g / L / day, at least about 0.7 g / L / day, at least about 0.8 g / L / day, at least about 0.9 g / L / day, at least about 1 g / L / day, at least about 1.1 g / L / day, at least about 1.2 g / L / day, at least about 1.3 g / L / day, at least about 1.4 g / L / day, at least about 1.5 g / L / day, at least about 1.6 g / L / day, at least about 1.7 g / L / day, at least about 1.8 g / L / day, at least about 1.9 g / L / day, or at least about 2.0 g / L / day).

[0046] In one aspect, the method of the invention further includes the case where the conditions within the bioreactor create a bioreactor broth.

[0047] In one aspect, the method of the invention further includes removing the bioreactor broth from the bioreactor to produce a removed broth.

[0048] In one aspect, the method of the present invention further comprises removing at least one oxygenated product from the withdrawal broth to produce a withdrawal broth depleted of the oxygenated product. The oxygenated product can be separated or purified from the fermentation broth using any method or combination of methods known in the art, such as fractional distillation, evaporation, pervaporation, gas stripping, phase separation, and extraction fermentation, including, for example, liquid-liquid extraction. In certain aspects, the target product is recovered from the fermentation broth by continuously removing a portion of the broth from the bioreactor, recovering one or more oxygenated products from the fermentation broth, and separating the cells (and their components) from the broth (e.g., by filtration). Alcohol can be recovered, for example, by distillation.

[0049] In one aspect, the method of the present invention further comprises removing the cells (and their components) of the culture from the withdrawal broth and / or the withdrawal broth depleted of the oxygenated product. The removal of the cells (and their components) can be carried out by any suitable means, such as by cyclone, filtration, or centrifugation. In one aspect, most (i.e., more than 50%) of the cells (and their components) of the non-naturally occurring acetate-producing carboxydotrophic bacterial culture are removed. In one aspect, the removed cells (and their components) of the acetate-producing carboxydotrophic bacterial culture are removed from the withdrawal broth before recovering one or more oxygenated products from the fermentation broth. In one aspect, the removed cells (and their components) of the acetate-producing carboxydotrophic bacterial culture are removed from the withdrawal broth after recovering one or more oxygenated products from the fermentation broth.

[0050] In one aspect, the method of the present invention further comprises providing the withdrawal broth depleted of the oxygenated product to the bioreactor. Additional nutrients (e.g., non-thiamine B vitamins and metals) can be added to the withdrawal broth depleted of the oxygenated product to replenish the withdrawal broth depleted of the oxygenated product before returning the withdrawal broth depleted of the oxygenated product to the bioreactor.

[0051] In one aspect, at least about 1 gram, at least about 2 grams, at least about 3 grams, at least about 4 grams, at least about 5 grams, at least about 6 grams, at least about 7 grams, at least about 8 grams, at least about 9 grams, at least about 10 grams, at least about 11 grams, at least about 12 grams, at least about 13 grams, at least about 14 grams, at least about 15 grams, or at least about 20 grams, or at least about 25 grams, or at least about 30 grams, or at least about 35 grams, or at least about 40 grams, or at least about 45 grams, or at least about 50 grams, or at least about 55 grams, or at least about 60 grams, or at least about 65 grams, or at least about 70 grams, or at least about 75 grams, or at least about 80 grams, or at least about 85 grams, or at least about 90 grams, or at least about 95 grams, or at least about 100 grams, or from about 1 to about 100 grams, or from about 16 to about 20 grams of at least one oxygenated product is produced per liter of the withdrawal broth.

[0052] In one aspect, a withdrawal broth depleted of oxygenated product of greater than about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% is provided back to the bioreactor. In this regard, a withdrawal broth depleted of oxygenated product of from about 1% to about a 100% is provided back to the bioreactor, e.g., a withdrawal broth depleted of oxygenated product of from about 1% to about 30%, from about 1% to about 35%, from about 1% to about 40%, from about 1% to about 45%, from about 1% to about 50%, from about 1% to about 55%, from about 1% to about 60%, from about 1% to about 65%, from about 1% to about 70%, from about 1% to about 75%, or from about 1% to about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% is provided back to the bioreactor. In an alternative aspect, a withdrawal broth depleted of oxygenated product of from about 50% to about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% is provided back to the bioreactor.

[0053] In one aspect, the fermentation is a co-culture and includes at least one acetic acid-producing carboxydotrophic bacterium and an additional bacterium. In one aspect, the additional bacterium is an acetic acid-producing carboxydotrophic bacterium. In another aspect, the additional bacterium is not an acetic acid-producing carboxydotrophic bacterium. In one aspect, the additional bacterium is a butyrate-producing bacterium (see, e.g., U.S. Patent No. 9,469,860 B2, which is incorporated herein by reference). In one aspect, the additional bacterium is a propionate-producing bacterium (see, e.g., U.S. Patent Application Publication No. 2014 / 0273123 A1, which is incorporated herein by reference).

[0054] Typically, the culture is carried out in a bioreactor. The term "bioreactor" includes a culture / fermentation device consisting of one or more vessels, towers, or piping arrangements, such as a continuous stirred tank reactor (CSTR), an immobilized cell reactor (ICR), a trickle bed reactor (TBR), a bubble column, a gas lift fermenter, a static mixer, or other containers or other devices suitable for gas-liquid contact. In certain embodiments, the bioreactor may include a first growth reactor and a second culture / fermentation reactor. The substrate can be provided to one or both of these reactors. As used herein, the terms "culture" and "fermentation" are used interchangeably. These terms encompass both the growth phase and the product biosynthesis phase of the culture / fermentation process.

[0055] As used herein, "bioreactor" refers to a bioreactor assembly. A bioreactor assembly is a group of one or more vessels suitable for containing an aqueous broth and carboxydotrophic bacteria for acetic acid production. The bioreactor assembly may contain associated devices such as an injector, a recycle loop, and a stirrer.

[0056] Any suitable bioreactor assembly can be used in the method of the present invention. The bioreactor assembly used in the method of the present invention can be a bioreactor assembly used for the bioconversion of syngas, or the bioreactor assembly used in the method of the present invention can be separate from the bioreactor assembly used for the bioconversion of syngas. The bioreactor assembly for use in the method of the present invention includes, but is not limited to, a column reactor, a bubble column, a jet loop reactor, a stirred tank reactor, a fluidized bed reactor, a trickle bed reactor, a membrane bioreactor, a biofilm reactor including, but not limited to, and a pipe reactor including, but not limited to, a static mixer reactor. One or more bioreactors can be used, and when two or more bioreactors are used, they can be in parallel operation or continuous operation. The bioreactor assembly can include, but is not necessarily required, a heat exchanger; solid separation unit operations such as a centrifuge, a sedimentation pond, and a filter; gas / liquid separation unit operations; pumps; and devices useful for the monitoring and control of the bioreactor assembly.

[0057] A separate bioreactor assembly can optionally be integrated into the facility for the bioconversion of syngas to oxygenated organic compounds. For example, if the facility contains a distillation assembly, the distillation assembly can be used to remove at least a portion of the oxygenated product and to denature the aqueous fermentation broth.

[0058] As used herein, "biomass" refers to biological materials including living or previously (e.g., recently) living plants and animals, and containing at least hydrogen, oxygen, and carbon. Biomass typically also contains nitrogen, phosphorus, sulfur, sodium, potassium, and trace metals. The chemical composition of biomass can vary from source to source and even within a source. Sources of biomass include, but are not limited to, harvested plants such as wood, grass clippings, and yard waste, switchgrass, corn (including corn stover), hemp, sorghum, sugarcane (including bagasse), and waste such as garbage and municipal solid waste. Biomass does not include fossil fuels such as coal, natural gas, and petroleum.

[0059] Fossil carbonaceous materials, or fossil fuels, include, but are not limited to, natural gas; petroleum, including carbonaceous streams from the refining or other processing of petroleum, including petroleum coke; lignite; and coal.

[0060] As used herein, "aqueous broth" or "aqueous fermentation broth" refers to the liquid aqueous phase that may contain dissolved compounds including, but not limited to, hydrogen, carbon monoxide, and carbon dioxide.

[0061] Intermittently means sometimes and can be at regular time intervals or at irregular time intervals.

[0062] Syngas means a gas that contains at least one of hydrogen and carbon monoxide and may and usually does contain carbon dioxide, regardless of its source.

[0063] Synthesis gas can be produced from many carbonaceous raw materials. These include natural gas, biogas, biomass, especially lignocellulosic biomass, gas produced by reforming hydrocarbon-containing materials, peat, petroleum coke, coal, waste such as debris from construction and demolition, municipal solid waste, and landfill gas, including hydrocarbon sources. Synthesis gas is typically produced by a gasifier or reformer (steam, autothermal, or partial oxidation). Any of the aforementioned biomass sources are suitable for producing synthesis gas. The synthesis gas produced thereby will typically contain from about 10 to about 60 mole % CO, at least about 1 mole % CO2, and preferably from about 35 to about 65 mole % H2. Synthesis gas may also contain N2 and CH4 as well as trace components such as H2S, COS, NH3, and HCN. Other sources of gas substrates include gas produced during petroleum and petrochemical processing and gas produced from industrial processes. These gases may have a composition substantially different from typical synthesis gas and may be essentially pure hydrogen or essentially pure carbon monoxide. The gas substrate can be obtained directly from gasification or from petroleum and petrochemical processing or industrial processes or by blending two or more streams. Also, the gas substrate can be treated to remove or alter the composition, including, but not limited to, removing components by chemical or physical sorption, membrane separation, and selective reaction.

[0064] The product oxygen-containing organic compounds produced in the process of this invention will depend on the acetic acid-forming carboxydotrophic bacteria or combination of acetic acid-forming carboxydotrophic bacteria used for fermentation and the conditions of fermentation.

[0065] The aqueous broth is maintained under anaerobic fermentation conditions at a suitable temperature, for example, in the range of about 25°C to about 60°C, or from about 30°C to about 40°C. The conditions of fermentation, including the density of the acetic acid-forming carboxydotrophic bacteria and the aqueous fermentation broth composition, are preferably sufficient to achieve the desired conversion efficiency of hydrogen and carbon monoxide. The pH of the aqueous broth is acidic, for example, between about 4 and about 6.5.

[0066] The rate of supply of synthesis gas to the bioreactor under steady-state conditions is preferably such that the rate of transfer of carbon monoxide and hydrogen into the liquid phase matches the rate at which carbon monoxide and hydrogen are bioconverted. The rate at which carbon monoxide and hydrogen can be consumed will be affected by the properties of the acetate-producing carboxydotrophic bacteria, the concentration of acetate-producing carboxydotrophic bacteria in the aqueous fermentation broth, and the fermentation conditions. Since the rate of transfer of carbon monoxide and hydrogen into the aqueous fermentation broth is a parameter of the operation, conditions that affect the rate of transfer, such as the interfacial surface area and the driving force between the gas phase and the liquid phase, are important. Preferably, the feed gas is introduced into the bioreactor in the form of microbubbles. Often, microbubbles have a diameter in the range of about 0.01 to about 0.5 millimeters, or about 0.02 to about 0.3 millimeters.

[0067] In another aspect, the present disclosure provides a method of preparing animal feed. As used herein, animal feed can be any suitable type of animal feed, such as, for example, aquaculture (fish feed), poultry feed, cattle feed, swine feed, bird feed, and the like. In one aspect, at least one acetic acid-producing carboxydotrophic bacterium and / or an acetic acid-producing carboxydotrophic bacterium culture is effective for use as animal feed. In a further aspect, the present disclosure provides a method of preparing animal feed, the method comprising: providing to a bioreactor: (1) a gaseous substrate comprising CO, CO2, and optionally H2, (2) at least one acetic acid-producing carboxydotrophic bacterium comprising at least one gene selected from thiH, thiS, thiF, and thiG, and (3) a liquid nutrient medium; providing conditions within the bioreactor for the at least one acetic acid-producing carboxydotrophic bacterium to convert the gaseous substrate into at least one oxygenated product; and removing the at least one acetic acid-producing carboxydotrophic bacterium from the bioreactor, wherein the at least one acetic acid-producing carboxydotrophic bacterium is effective for use as animal feed. In another aspect, the present disclosure provides a method of preparing animal feed, the method comprising: providing to a bioreactor in the absence of thiamine or a thiamine precursor containing thiazole: (1) a gaseous substrate comprising CO, CO2, and optionally H2, (2) at least one acetic acid-producing carboxydotrophic bacterium, and (3) a liquid nutrient medium; providing conditions within the bioreactor for the at least one acetic acid-producing carboxydotrophic bacterium to convert the gaseous substrate into at least one oxygenated product; and removing the at least one acetic acid-producing carboxydotrophic bacterium from the bioreactor, wherein the at least one acetic acid-producing carboxydotrophic bacterium is effective for use as animal feed.

[0068] In some embodiments, the method of preparing animal feed is useful for producing an aqueous culture containing relatively low amounts of one or more toxic metals, such as mercury, iron, nickel, and the like.

[0069] In another aspect, the present disclosure provides a method for preparing a fertilizer. In one aspect, at least one acetic acid-producing carboxydotrophic bacterium and / or an acetic acid-producing carboxydotrophic bacterium culture is effective for use as a fertilizer. In a further aspect, the present disclosure provides a method for preparing a fertilizer, the method comprising: providing to a bioreactor: (1) a gaseous substrate comprising CO, CO2, and optionally H2, (2) at least one acetic acid-producing carboxydotrophic bacterium comprising at least one gene selected from thiH, thiS, thiF, and thiG, and (3) a liquid nutrient medium; (b) providing conditions within the bioreactor for the at least one acetic acid-producing carboxydotrophic bacterium to convert the gaseous substrate into at least one oxygenated product; and (c) removing the at least one acetic acid-producing carboxydotrophic bacterium from the bioreactor, wherein the at least one acetic acid-producing carboxydotrophic bacterium is effective for use as a fertilizer. In another aspect, the present disclosure provides a method for preparing a fertilizer, the method comprising: providing to a bioreactor in the absence of thiamine or a thiamine precursor containing thiazole: (1) a gaseous substrate comprising CO, CO2, and optionally H2, (2) at least one acetic acid-producing carboxydotrophic bacterium, and (3) a liquid nutrient medium; providing conditions within the bioreactor for the at least one acetic acid-producing carboxydotrophic bacterium to convert the gaseous substrate into at least one oxygenated product; and removing the at least one acetic acid-producing carboxydotrophic bacterium from the bioreactor, wherein the at least one acetic acid-producing carboxydotrophic bacterium is effective for use as a fertilizer.

[0070] In one aspect, at least one acetic acid-producing carboxydotrophic bacterium and / or an acetic acid-producing carboxydotrophic bacterium culture is effective for landfill application or land application as a fertilizer or animal feed. In one aspect, at least one acetic acid-producing carboxydotrophic bacterium and / or an acetic acid-producing carboxydotrophic bacterium culture is useful for fertilizers, animal feeds, landfill applications, and / or land applications, and contains proteins, fats, carbohydrates, and / or minerals, for example, 86% protein, 2% fat, 2% minerals, 10% carbohydrates. At least one acetic acid-producing carboxydotrophic bacterium and / or an acetic acid-producing carboxydotrophic bacterium culture can be effective for landfill application (e.g., for Class A solids), land application as a fertilizer, or as an animal feed such as aquaculture (fish feed), poultry feed, cattle feed, swine feed, etc. In the case of fish feed, advantageously, in some embodiments, the fish feed contains less total toxic metals compared to conventional fish meal.

[0071] In some aspects, at least one acetic acid-producing carboxydotrophic bacterium and / or an acetic acid-producing carboxydotrophic bacterium culture contains from about 25 to about 50 weight percent solids, such as from about 25 to about 40 weight percent solids. The amount of recovered solids is advantageous because it contains proteins, carbohydrates, minerals, and potentially vitamins that are highly nutritious for plants and animals.

[0072] At least one acetic acid-producing carboxydotrophic bacterium and / or an acetic acid-producing carboxydotrophic bacterium culture can be used in a wet state or a dry state. For example, in some embodiments, at least one acetic acid-producing carboxydotrophic bacterium and / or an acetic acid-producing carboxydotrophic bacterium culture is effective for use as a wet fertilizer. In some embodiments, the method further includes drying at least one acetic acid-producing carboxydotrophic bacterium and / or an acetic acid-producing carboxydotrophic bacterium culture to form a "dry cake", and the resulting dry cake is effective for use as a dry fertilizer, animal feed or fish feed, or any combination thereof. Drying of at least one acetic acid-producing carboxydotrophic bacterium and / or an acetic acid-producing carboxydotrophic bacterium culture can also be used as a means of concentrating the at least one acetic acid-producing carboxydotrophic bacterium and / or the acetic acid-producing carboxydotrophic bacterium culture. However, the at least one acetic acid-producing carboxydotrophic bacterium and / or an acetic acid-producing carboxydotrophic bacterium culture removed can be dried using any suitable means.

[0073] The compositions of animal feed and fertilizer are generally similar because they are mainly composed of microbial proteins and / or carbohydrates. In some embodiments, the animal feed and / or fertilizer comprises proteins (e.g., from about 30 wt% to about 90 wt%, such as from about 60 wt% to about 90 wt%), fats (e.g., from about 1 wt% to about 12 wt%, such as from about 1 wt% to about 3 wt%), carbohydrates (e.g., from about 5 wt% to about 60 wt%, such as from about 15 wt% to about 60 wt% or from about 5 wt% to about 15 wt%) and / or minerals such as sodium, potassium, copper (e.g., from about 1 wt% to about 20 wt%, such as from about 1 wt% to about 3 wt%). For example, the animal feed and / or fertilizer may contain about 86% protein, about 2% fat, about 2% minerals, and about 10% carbohydrates. Aspects of the subject matter described herein, including embodiments, may be beneficial alone or in combination with one or more other aspects or embodiments. Without limiting the foregoing description, specific non-limiting aspects of the present disclosure numbered 1-24 are provided below. As will be apparent to those skilled in the art upon reading this disclosure, each of the individually numbered aspects may be used or combined with any of the preceding or following individually numbered aspects. This is intended to provide support for all such combinations of aspects and is not limited to the combinations of aspects explicitly provided below:

[0074] (1) A method for producing at least one oxygenated product from a gaseous substrate comprising CO, CO2, and optionally H2, the method comprising: providing to a bioreactor: (1) a gaseous substrate comprising CO, CO2, and optionally H2, (2) at least one acetate-producing carboxydotrophic bacterium, and (3) a liquid nutrient medium, and providing conditions within the bioreactor for the at least one acetate-producing carboxydotrophic bacterium to convert the gaseous substrate into at least one oxygenated product comprising, Here, the method wherein the at least one acetate-producing carboxydotrophic bacterium comprises at least one gene selected from thiH, thiS, thiF, and thiG.

[0075] (2) The method according to embodiment 1, wherein the at least one acetate-producing carboxydotrophic bacterium comprises a sequence having at least 90% identity with SEQ ID NO: 1 (thiH).

[0076] (3) The method according to embodiment 1, wherein the at least one acetate-producing carboxydotrophic bacterium comprises a sequence having at least 90% identity with SEQ ID NO: 2 (thiS).

[0077] (4) The method according to embodiment 1, wherein the at least one acetate-producing carboxydotrophic bacterium comprises a sequence having at least 90% identity with SEQ ID NO: 3 (thiF).

[0078] (5) The method according to embodiment 1, wherein the at least one acetate-producing carboxydotrophic bacterium comprises a sequence having at least 90% identity with SEQ ID NO: 4 (thiG).

[0079] (6) The method according to embodiment 1, wherein the at least one acetate-producing carboxydotrophic bacterium comprises thiH, thiS, thiF, and thiG.

[0080] (7) A method for producing at least one oxygenated product from a gaseous substrate comprising CO, CO2, and optionally H2, the method comprising: providing to a bioreactor: (1) a gaseous substrate comprising CO, CO2, and optionally H2, (2) at least one acetate-producing carboxydotrophic bacterium, and (3) a liquid nutrient medium, and providing conditions in the bioreactor for the at least one acetate-producing carboxydotrophic bacterium to convert the gaseous substrate into at least one oxygenated product comprising, wherein the at least one acetate-producing carboxydotrophic bacterium does not require an exogenously supplied thiazole-containing thiamine precursor.

[0081] (8) A method according to any one of aspects 1 to 7, wherein a thiamine or a thiamine precursor containing thiazole at 0.05 mg or less per 100 L is provided to the bioreactor.

[0082] (9) A method of operating a synthesis gas fermentation without the addition of thiamine or a thiamine precursor containing thiazole, the method comprising: providing to the bioreactor: (1) a gaseous substrate containing CO, CO2, and optionally H2, (2) at least one acetic acid-producing carboxydotrophic bacterium, and (3) a liquid nutrient medium not containing thiamine or a thiamine precursor containing thiazole, and providing conditions in the bioreactor for the at least one acetic acid-producing carboxydotrophic bacterium to convert the gaseous substrate into at least one oxygenated product comprising, wherein the conditions in the bioreactor create a bioreactor broth, and thiamine or a thiamine precursor containing thiazole is not added to (i) the liquid nutrient medium or (ii) the bioreactor broth before or during the synthesis gas fermentation.

[0083] (10) A method according to any one of aspects 1 to 9, wherein at least one acetic acid-producing carboxydotrophic bacterium is cultured in a bioreactor to produce an acetic acid-producing carboxydotrophic bacterium culture.

[0084] (11) The method of aspect 10, wherein the acetic acid-producing carboxydotrophic bacterium culture continuously produces at least one oxygenated product for more than about 24 hours.

[0085] (12) A method according to any one of aspects 1 to 11, wherein the conditions in the bioreactor create a bioreactor broth, and at least one oxygenated product is extracted from the bioreactor broth.

[0086] (13) A method according to any one of aspects 1 to 12, wherein at least one oxygenated product is ethanol.

[0087] (14) A method according to any one of aspects 1 to 13, wherein at least one acetate-producing carboxydotrophic bacterium is a recombinant.

[0088] (15) A method according to aspect 14, wherein at least one acetate-producing carboxydotrophic bacterium is engineered to contain at least one gene selected from thiH, thiS, thiF, and thiG.

[0089] (16) A method for producing at least one oxygenated product from a gaseous substrate comprising CO, CO2, and optionally H2, the method comprising: (a) providing to a bioreactor: (1) a gaseous substrate comprising CO, CO2, and optionally H2, (2) at least one acetate-producing carboxydotrophic bacterium, and (3) a liquid nutrient medium, and (b) providing conditions within the bioreactor for the at least one acetate-producing carboxydotrophic bacterium to convert the gaseous substrate into at least one oxygenated product comprising, wherein the at least one acetate-producing carboxydotrophic bacterium comprises at least one exogenous gene selected from thiH, thiS, thiF, and thiG.

[0090] (17) A method of using a broth lacking thiamine or a thiamine precursor containing thiazole as a screening tool for a suitable ethanol-producing acetate-producing carboxydotrophic bacterial strain, the method comprising: (a) providing to a bioreactor in the absence of thiamine or a thiamine precursor containing thiazole: (1) a gaseous substrate comprising CO, CO2, and optionally H2, (2) at least one acetate-producing carboxydotrophic bacterium, and (3) a liquid nutrient medium, and (b) providing conditions within the bioreactor for the at least one acetate-producing carboxydotrophic bacterium to convert the gaseous substrate into at least one oxygenated product comprising, Here, the conversion of at least one oxygenated product of the gaseous substrate is a method that indicates the presence of a suitable ethanol-producing acetate-forming carboxydotrophic bacterial strain.

[0091] (18) A method for controlling bacterial contamination in a bioreactor, the method comprising: (a) Providing to a bioreactor in the absence of thiamine or a thiamine precursor containing thiazole: (1) a gaseous substrate comprising CO, CO2, and optionally H2, (2) at least one acetate-forming carboxydotrophic bacterium, and (3) a liquid nutrient medium, and (b) Providing conditions within the bioreactor for the at least one acetate-forming carboxydotrophic bacterium to convert the gaseous substrate into at least one oxygenated product comprising, wherein the absence of exogenously supplied thiamine or a thiamine precursor containing thiazole in the bioreactor prevents unwanted contamination of the bioreactor broth by acetate-forming carboxydotrophic bacteria.

[0092] (19) The method according to any one of claims 1 to 18, wherein at least one acetate-forming carboxydotrophic bacterium is effective for use as animal feed.

[0093] (20) The method according to any one of claims 1 to 18, wherein at least one acetate-forming carboxydotrophic bacterium is effective for use as fertilizer.

[0094] (21) A method for preparing animal feed, the method comprising: (a) Providing to a bioreactor: (1) a gaseous substrate comprising CO, CO2, and optionally H2, (2) at least one acetate-forming carboxydotrophic bacterium comprising at least one gene selected from thiH, thiS, thiF, and thiG, and (3) a liquid nutrient medium, (b) Providing conditions within the bioreactor for the at least one acetate-forming carboxydotrophic bacterium to convert the gaseous substrate into at least one oxygenated product, and (c) removing the at least one acetate-producing carboxydotrophic bacterium from the bioreactor comprising wherein the at least one acetate-producing carboxydotrophic bacterium is effective for use as an animal feed, a method.

[0095] (22) A method for preparing a fertilizer, the method comprising: (a) providing to a bioreactor: (1) a gaseous substrate comprising CO, CO2, and optionally H2, (2) at least one acetate-producing carboxydotrophic bacterium comprising at least one gene selected from thiH, thiS, thiF, and thiG, and (3) a liquid nutrient medium (b) providing conditions in the bioreactor for the at least one acetate-producing carboxydotrophic bacterium to convert the gaseous substrate into at least one oxygenated product, and (c) removing the at least one acetate-producing carboxydotrophic bacterium from the bioreactor comprising wherein the at least one acetate-producing carboxydotrophic bacterium is effective for use as a fertilizer, a method.

[0096] (23) A method for preparing an animal feed, the method comprising: (a) providing to a bioreactor in the absence of thiamine or a thiamine precursor containing thiazole: (1) a gaseous substrate comprising CO, CO2, and optionally H2, (2) at least one acetate-producing carboxydotrophic bacterium, and (3) a liquid nutrient medium (b) providing conditions in the bioreactor for the at least one acetate-producing carboxydotrophic bacterium to convert the gaseous substrate into at least one oxygenated product, and (c) removing the at least one acetate-producing carboxydotrophic bacterium from the bioreactor comprising Here, a method in which the at least one acetate-producing carboxydotrophic bacterium is effective for use as an animal feed.

[0097] (24) A method for preparing a fertilizer, the method comprising: (a) In a bioreactor in the absence of thiamine or a thiamine precursor containing thiazole: (1) providing a gaseous substrate containing CO, CO2, and optionally H2, (2) at least one acetate-producing carboxydotrophic bacterium, and (3) a liquid nutrient medium; (b) providing conditions in the bioreactor for the at least one acetate-producing carboxydotrophic bacterium to convert the gaseous substrate into at least one oxygenated product; and (c) removing the at least one acetate-producing carboxydotrophic bacterium from the bioreactor. comprising, wherein the at least one acetate-producing carboxydotrophic bacterium is effective for use as a fertilizer.

Examples

[0098] Example 1 This example demonstrates that the acetate-producing carboxydotrophic bacterium strain SB1 produces acetate and ethanol during fermentation in a growth medium without thiamine or a thiamine precursor containing thiazole.

[0099] Fermentation was carried out using the acetate-producing carboxydotrophic bacterium strain SB1 in the presence of synthesis gas (59% H2, 25% CO, 2.7% CO2, and 12.5% CH4). At the 473-hour time point, thiamine was removed from the growth medium. Growth continued for an additional 327 hours with no change in the uptake of H2, CO, CO2 (Figure 2), and no decrease in the production of ethanol or acetate (Figure 3). The black arrows in Figures 2 and 3 indicate the 473-hour time point (when thiamine was removed). These results demonstrate that strain SB1 can undergo synthesis gas growth without the addition of thiamine or a thiamine precursor.

[0100] Example 2 This example demonstrates that the gene sequences SEQ ID NO: 1 (thiH), SEQ ID NO: 2 (thiS), SEQ ID NO: 3 (thiF), and SEQ ID NO: 4 (thiG) are required for thiamine prototrophy of the SB1 strain. Mutants were constructed via single crossover predicted to disrupt the functions of SEQ ID NO: 1 (thiH), SEQ ID NO: 2 (thiS), SEQ ID NO: 3 (thiF), and SEQ ID NO: 4 (thiG). A 3,508 bp fragment spanning the region from nucleotide 3 of SEQ ID NO: 2 (thiS) to nucleotide 562 of SEQ ID NO: 3 (thiF) was amplified via PCR. The fragment was cloned into a derivative of plasmid pMTL84151 (Heap, et al., Journal of Microbiological Methods, 78(1): 79-85(2009)) to form plasmid pKO31 (Figure 4A). Upon single crossover recombination between the plasmid and the corresponding gene on the chromosome, the plasmid was expected to integrate into the chromosome, leading to the disruption of the predicted thiHSFG thiazole biosynthetic genes.

[0101] Plasmid pKO31 was introduced via conjugation and single crossover integration was selected using 2 μg / ml thiamphenicol to select for plasmid pKO31 and 10 μg / ml trimethoprim to counterselect against the E. coli donor strain. After conjugation, multiple antibiotic-resistant colonies were isolated (Figure 4B). The colonies were then screened for plasmid integration (Figure 4C) and to demonstrate that the resulting colonies did not arise from tandem duplications of the entire region (data not shown).

[0102] Cells containing pKO31 integrated within the predicted thiamine gene region were then grown in a flask in fructose medium (Mock, et al., J. Bacteriol., 197(18): 2965-2980(2015)), and the cells were washed to remove any thiamine in the medium. The cells were then cultured in the same medium in the presence or absence of thiamine. Robust growth was observed only in the presence of thiamine for the SB1 strain harboring pKO31 integration (Figure 4D; designated as SB1::pKO31). The SB1 strain lacking the pKO31 insertion grew well in the absence of thiamine (Figures 2 and 3). The results demonstrate that the disruption of the predicted thiazole biosynthetic genes leads to growth inability in thiamine-free medium.

[0103] Example 3 This example demonstrates that the gene sequences SEQ ID NO: 1 (thiH), SEQ ID NO: 2 (thiS), SEQ ID NO: 3 (thiF), and SEQ ID NO: 4 (thiG) are required for the thiamine prototrophy of the SB1 strain. A mutant (SB1::pKO31) was constructed via single crossover predicted to disrupt the functions of SEQ ID NO: 1 (thiH), SEQ ID NO: 2 (thiS), SEQ ID NO: 3 (thiF), and SEQ ID NO: 4 (thiG) described in Example 2.

[0104] SB::pKO31 cells were then grown in a bottle in fructose medium (Mock, et al., J. Bacteriol., 197(18): 2965-2980(2015)), and the cells were washed to remove any thiamine in the medium. The cells were then cultured in the same medium containing syngas in the presence or absence of thiamine (Figures 5A and 5B). Growth for SB1::pKO31 in syngas and thiamine was better than growth in syngas medium lacking thiamine. The SB1 strain showed robust growth in the presence and absence of thiamine in syngas medium. These results demonstrate that the disruption of the predicted thiazole biosynthetic genes leads to growth inability in thiamine-free medium when using syngas as a carbon source.

[0105] Example 4 This example demonstrates that the gene sequences SEQ ID NO: 1 (thiH), SEQ ID NO: 2 (thiS), SEQ ID NO: 3 (thiF), and SEQ ID NO: 4 (thiG) are required for thiamine prototrophy in strain SB1. The mutant SB1::pKO31 was constructed via single crossover predicted to disrupt the functions of SEQ ID NO: 1 (thiH), SEQ ID NO: 2 (thiS), SEQ ID NO: 3 (thiF), and SEQ ID NO: 4 (thiG) as described in Example 2.

[0106] Cells containing SB1::pKO31 were then grown in fructose medium (Mock, et al., J. Bacteriol., 197(18): 2965-2980(2015)) and used to inoculate a syngas reactor. The reactor was then brought to steady state with the addition of 5 μg / ml thiamphenicol (to select for maintenance of the integrated plasmid) as described in Example 1. At the 185-hour time point (arrow), thiamine was removed from the medium. Removal of thiamine from the medium supply resulted in a small decrease in optical density (OD600) (Figure 6A), as well as a small decrease in ethanol production (Figure 6B). The results demonstrate that disruption of the predicted thiazole biosynthetic genes leads to a reduced growth ability in medium lacking thiamine during steady-state continuous fermentation in syngas. Removal of thiamine had no effect on either the growth or productivity of the SB1 strain lacking the integrated plasmid in the predicted thiazole biosynthetic genes (see Examples 1 and 2).

[0107] Reductions in growth and ethanol productivity were observed after removal of thiamine from the medium, but the effects were less pronounced than those observed in tube / bottle experiments having either fructose or syngas as the carbon source. The reason for this is unclear but may be related to the nature of the constructed mutants (which may retain low levels of thiFGSH function), as well as the slow growth associated with steady-state growth in the bioreactor (e.g., in fructose, the bacteria grow faster and thus changes in growth rate are observed earlier).

[0108] All references, including publications, patent applications, and patents cited herein, are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated as being incorporated by reference and were set forth in its entirety herein.

[0109] In the context of describing the present invention (particularly in the context of the following claims), the use of the terms "a", "an", "the", "at least one", and similar indicative references should be construed to cover both the singular and the plural forms, unless otherwise indicated herein or clearly contradicted by the context. The use of the term "at least one" followed by a list of one or more items (e.g., "at least one of A and B") should be construed to mean one item selected from the listed items (A or B) or any combination of two or more of the listed items (A and B), unless otherwise indicated herein or clearly contradicted by the context. The terms "comprising", "having", "including", and "containing" should be construed as open-ended terms (i.e., meaning "including but not limited to") unless otherwise noted. The recitation of a range of values herein is merely intended to serve as a convenient method of referring individually to each separate value falling within the range, and each separate value is incorporated herein as if it were individually recited herein. All methods described herein can be performed in any suitable order, unless otherwise indicated herein or otherwise clearly contradicted by the context. The use of any example, or exemplary language (e.g., "such as") provided herein is merely intended to clarify the invention better and does not impose a limitation on the scope of the invention unless otherwise claimed. None of the terms in this specification should be construed as indicating that any element not recited in the claims is essential for the practice of the invention.

[0110] Preferred embodiments and aspects of the invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those preferred embodiments may become apparent to those skilled in the art upon reading the foregoing description. The inventors expect those skilled in the art to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all alterations and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Further, any combination of the above-described elements in all possible variations thereof is included in the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

Claims

1. CO, CO 2 , and optionally H 2 A method for producing at least one oxygenated product from a gaseous substrate containing, the method comprising: (a) To a bioreactor: (1) a gaseous substrate containing CO, CO 2 , and optionally H 2 , (2) at least one acetic acid-producing carboxydotrophic bacterium, and (3) a liquid nutrient medium, and (b) providing, within the bioreactor, conditions for the at least one acetate-producing carboxydotrophic bacterium to convert the gaseous substrate into at least one oxygenated product comprising wherein the at least one acetate-producing carboxydotrophic bacterium comprises at least one gene selected from thiH, thiS, thiF, and thiG, a method.

2. The method of claim 1, wherein the at least one acetate-producing carboxydotrophic bacterium comprises a sequence having at least 90% identity with SEQ ID NO: 1 (thiH).

3. The method of claim 1, wherein the at least one acetate-producing carboxydotrophic bacterium comprises a sequence having at least 90% identity with SEQ ID NO: 2 (thiS).

4. The method of claim 1, wherein the at least one acetate-producing carboxydotrophic bacterium comprises a sequence having at least 90% identity with SEQ ID NO: 3 (thiF).

5. The method of claim 1, wherein the at least one acetate-producing carboxydotrophic bacterium comprises a sequence having at least 90% identity with SEQ ID NO: 4 (thiG).

6. The method of claim 1, wherein the at least one acetate-producing carboxydotrophic bacterium comprises thiH, thiS, thiF, and thiG.

7. CO, CO 2 , and optionally H 2 A method for producing at least one oxygenated product from a gaseous substrate containing, the method comprising: (a) To a bioreactor: (1) a gaseous substrate containing CO, CO 2 , and optionally H 2 , (2) at least one acetic acid-producing carboxydotrophic bacterium, and (3) a liquid nutrient medium are provided, and (b) providing, within the bioreactor, conditions for the at least one acetate-producing carboxydotrophic bacterium to convert the gaseous substrate into at least one oxygenated product comprising wherein the at least one acetate-producing carboxydotrophic bacterium does not require an exogenously supplied thiamine or thiazole-containing thiamine precursor, a method.

8. The method according to any one of claims 1 to 7, wherein a thiamine or thiazole-containing thiamine precursor of 0.05 mg or less per 100 L is provided to the bioreactor.

9. A method of operating a syngas fermentation without the addition of thiamine or a thiazole-containing thiamine precursor, the method comprising: (a) To a bioreactor: (1) providing a gaseous substrate containing CO, CO 2 , and optionally H 2 , (2) at least one acetic acid-producing carboxydotrophic bacterium, and (3) a liquid nutrient medium that does not contain thiamine or a thiamine precursor containing thiazole, and (b) providing, within the bioreactor, conditions for the at least one acetate-producing carboxydotrophic bacterium to convert the gaseous substrate into at least one oxygenated product comprising Here, the conditions in the bioreactor are such that a bioreactor broth is created, and thiamine or a thiamine precursor containing thiazole is not added to (i) the liquid nutrient medium or (ii) the bioreactor broth before or during the synthesis gas fermentation, method.

10. The method according to any one of claims 1 to 9, wherein at least one acetate-producing carboxydotrophic bacterium is cultured in a bioreactor to produce an acetate-producing carboxydotrophic bacterium culture.

11. The method of claim 10, wherein the acetate-producing carboxydotrophic bacterium culture continuously produces at least one oxygenated product for more than about 24 hours.

12. The method according to any one of claims 1 to 11, wherein the conditions in the bioreactor create a bioreactor broth, and at least one oxygenated product is extracted from the bioreactor broth.

13. The method according to any one of claims 1 to 12, wherein at least one oxygenated product is ethanol.

14. The method according to any one of claims 1 to 13, wherein at least one acetate-producing carboxydotrophic bacterium is a recombinant.

15. The method of claim 14, wherein at least one acetate-producing carboxydotrophic bacterium is engineered to contain at least one gene selected from thiH, thiS, thiF, and thiG.

16. CO, CO 2 , and optionally H 2 A method for producing at least one oxygenated product from a gaseous substrate containing, the method comprising: (a) In a bioreactor: (1) a gaseous substrate containing CO, CO 2 , and optionally H 2 , (2) at least one acetic acid-producing carboxydotrophic bacterium, and (3) a liquid nutrient medium are provided, and (b) providing conditions in the bioreactor for the at least one acetate-producing carboxydotrophic bacterium to convert the gaseous substrate into at least one oxygenated product comprising wherein the at least one acetate-producing carboxydotrophic bacterium contains at least one exogenous gene selected from thiH, thiS, thiF, and thiG, method.

17. A method of using a broth lacking thiamine or a thiamine precursor containing thiazole as a screening tool for a suitable ethanol-producing acetate-producing carboxydotrophic bacterial strain, the method comprising: (a) To a bioreactor in the absence of thiamine or a thiamine precursor containing thiazole: (1) a gaseous substrate containing CO, CO 2 , and optionally H 2 , (2) at least one acetic acid-producing carboxydotrophic bacterium, and (3) a liquid nutrient medium, and (b) providing conditions in the bioreactor for the at least one acetate-producing carboxydotrophic bacterium to convert the gaseous substrate into at least one oxygenated product comprising wherein the conversion of the gaseous substrate into at least one oxygenated product indicates the presence of a suitable ethanol-producing acetate-producing carboxydotrophic bacterial strain, method.

18. A method for controlling bacterial contamination in a bioreactor, the method comprising: (a) To a bioreactor in the absence of thiamine or a thiamine precursor containing thiazole: (1) a gaseous substrate containing CO, CO 2 , and optionally H 2 , (2) at least one acetic acid-producing carboxydotrophic bacterium, and (3) a liquid nutrient medium, and (b) providing conditions within the bioreactor for the at least one acetic acid-producing carboxydotrophic bacterium to convert the gaseous substrate into at least one oxygenated product comprising wherein the absence of exogenously supplied thiamine or thiamine-containing thiamine precursors in the bioreactor prevents contamination of the bioreactor broth with undesirable acetic acid-producing carboxydotrophic bacteria.

19. The method according to any one of claims 1 to 18, wherein the at least one acetic acid-producing carboxydotrophic bacterium is effective for use as an animal feed.

20. The method according to any one of claims 1 to 18, wherein the at least one acetic acid-producing carboxydotrophic bacterium is effective for use as a fertilizer.

21. A method for preparing an animal feed, the method comprising: (a) To a bioreactor: (1) a gaseous substrate containing CO, CO 2 , and optionally H 2 , (2) at least one acetic acid-producing carboxydotrophic bacterium containing at least one gene selected from thiH, thiS, thiF, and thiG, and (3) providing a liquid nutrient medium. (b) providing conditions within the bioreactor for the at least one acetic acid-producing carboxydotrophic bacterium to convert the gaseous substrate into at least one oxygenated product, and (c) removing the at least one acetic acid-producing carboxydotrophic bacterium from the bioreactor comprising wherein the at least one acetic acid-producing carboxydotrophic bacterium is effective for use as an animal feed.

22. A method for preparing a fertilizer, the method comprising: (a) To a bioreactor: (1) a gaseous substrate containing CO, CO 2 , and optionally H 2 , (2) at least one acetic acid-producing carboxydotrophic bacterium containing at least one gene selected from thiH, thiS, thiF, and thiG, and (3) providing a liquid nutrient medium. (b) providing conditions within the bioreactor for the at least one acetic acid-producing carboxydotrophic bacterium to convert the gaseous substrate into at least one oxygenated product, and (c) removing the at least one acetic acid-producing carboxydotrophic bacterium from the bioreactor comprising wherein the at least one acetic acid-producing carboxydotrophic bacterium is effective for use as a fertilizer.

23. A method for preparing an animal feed, the method comprising: (a) To a bioreactor in the absence of thiamine or a thiamine precursor containing thiazole: (1) a gaseous substrate containing CO, CO 2 , and optionally H 2 , (2) at least one acetic acid-producing carboxydotrophic bacterium, and (3) a liquid nutrient medium are provided. (b) providing conditions within the bioreactor for the at least one acetic acid-producing carboxydotrophic bacterium to convert the gaseous substrate into at least one oxygenated product, and (c) removing the at least one acetic acid-producing carboxydotrophic bacterium from the bioreactor comprising wherein the at least one acetic acid-producing carboxydotrophic bacterium is effective for use as an animal feed.

24. A method for preparing a fertilizer, the method comprising: (a) To a bioreactor in the absence of thiamine or a thiamine precursor containing thiazole: (1) a gaseous substrate containing CO, CO 2 , and optionally H 2 , (2) at least one acetic acid-producing carboxydotrophic bacterium, and (3) a liquid nutrient medium are provided. (b) providing conditions in the bioreactor for the at least one acetate-producing carboxydotrophic bacterium to convert the gaseous substrate into at least one oxygenated product; and (c) removing the at least one acetate-producing carboxydotrophic bacterium from the bioreactor comprising: wherein the at least one acetate-producing carboxydotrophic bacterium is effective for use as a fertilizer.