Reagents and methods

Abstract

To provide novel detection methods and reagents that can find utility in a variety of detection applications, including endpoint and real-time monitoring of isothermal nucleic acid amplification reactions, particularly recombinase polymerase amplification (RPA) reactions.SOLUTION: The present invention relates to novel detection probes and detection methods that are suitable for use in a variety of detection applications, including end-point and real-time monitoring of isothermal nucleic acid amplification reactions, particularly recombinase polymerase amplification (RPA) reactions.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to novel detection probes and detection methods that are suitable for use in a variety of detection applications, including end-point and real-time monitoring of isothermal nucleic acid amplification reactions, particularly recombinase polymerase amplification (RPA) reactions. [Background technology]

[0002] Isothermal nucleic acid amplification methods can amplify target nucleic acids from trace levels to highly detectable levels within minutes without the need for thermal cycling and associated instrumentation. Such isothermal methods include recombinase polymerase amplification (RPA), described in International Publication Nos. 2003 / 072805 and 2021 / 094746. International Publication No. 2021 / 094746 describes a variant RPA method, further referred to herein as "mRPA," that utilizes reaction components tagged with intrinsically disordered regions. RPA methods allow users to detect and quantify minute amounts of specific sequences, facilitating point-of-care testing and increasing accessibility and diagnostic speed.

[0003] Isothermal amplification methods can be monitored by end-point detection (after amplification) or in real time (during amplification).

[0004] The probes used for detection and quantification may vary depending on the application strategy. [Prior art documents] [Patent documents]

[0005] [Patent Document 1] International Publication No. 2003 / 072805 [Patent Document 2] International Publication No. 2021 / 094746 [Patent Document 3] U.S. Patent No. 7,270,981

Patent document 4

Patent document 5

Patent document 6

Patent document 7

Patent document 8

Non-licensed literature

[0006]

Non-licensed literature 1

Non-licensed Document 2

Non-licensed Document 4

Non-licensed Document 5

Non-licensed Document 6

[0007] The present invention relates to novel detection methods and reagents that may find utility in a variety of detection applications, including endpoint and real-time monitoring of isothermal nucleic acid amplification reactions, particularly recombinase polymerase amplification (RPA) reactions.

[0008] A summary of aspects of the present invention is provided below.

[0009] Aspects of the present invention 1. A method for detecting a target nucleic acid sequence of interest in a test solution, comprising: Aa RPA single-stranded DNA binding protein (RPA-SSB) molecule, b. cleavage molecule, c. A detection probe according to any one of embodiments 61 to 108; d. A sample suspected of containing a target nucleic acid sequence of interest providing a test solution comprising: Upon hybridization of one or two oligonucleotides of the Ba probe with the target nucleic acid sequence of interest, and b. When the cleavage molecule cleaves the probe at the cleavage site detecting a detectable signal produced by the signal enhancing molecule of the probe. A method comprising: 2. The test solution is an RPA reaction mixture containing RPA reaction components, and in addition to the RPA-SSB, the RPA reaction components are: 1. Recombinase agents, 2. Recombinase loading protein, 3. Polymerase, and 4. Forward and Reverse Nucleic Acid Primers for Amplification Including, 2. The method of embodiment 1. 3. The method of embodiment 2, further comprising, after providing step (A), performing an RPA reaction comprising one or more amplification cycles, and detecting a detectable signal in real time during one or more amplification cycles or at the end of one or more amplification cycles. 4. The method of any one of aspects 1 to 3, wherein the RPA-SSB is selected from the group consisting of Gp32, E. coli SSB protein, phage T4 Gp32 protein, phage Rb69 Gp32, phage vB_EcoM_NBG1 Gp32, or any functional analog, homolog, or derivative thereof, and any combination thereof, preferably wherein the RPA-SSB is Gp32 or phage vB_EcoM_NBG1 Gp32. 5. The method of embodiment 4, wherein the RPA-SSB is tagged with one or more functional intrinsically disordered regions (IDRs), preferably as an engineered fusion protein comprising an amino acid sequence comprising or consisting of the RPA-SSB and one or more functional IDRs. 6. The recombinase agent is UvsX, T4 UvsX, T6 UvsX, RB18 UvsX, E. coli phage wV7 UvsX, Shigella phage CB8 UvsX, Shigella phage Shfl2 UvsX, E. coli phage AR1 UvsX, phage vB_EcoM_G4507 UvsX, Shigella phage SHFML-11 UvsX, Escherichia phage vB_EcoM_DalCa UvsX, E. coli RecA, E. coli RadA, E. coli RadB, E. coli Rad 51, or any functional analog, homolog, or derivative thereof, and any combination thereof, preferably wherein the recombinase agent is UvsX, more preferably Escherichia phage vB_EcoM_DalCa UvsX. 7. The method of any one of aspects 2 to 6, wherein the recombinase loading protein is selected from the group consisting of UvsY, E. coli RecO, E. coli RecR, or any functional analog, homolog, or derivative thereof, and any combination thereof; preferably, the recombinase loading protein is UvsY, more preferably Escherichia phage STO UvsY. 8. Polymerase A. A eukaryotic polymerase selected from the group consisting of pol-α, pol-β, pol-δ, pol-ε, or any functional analog, homolog, or derivative thereof, and any combination thereof; B. A prokaryotic polymerase selected from the group consisting of Bacillus stearothermophilus polymerase I large fragment, Bacillus subtilis Pol I large fragment (Bsu polymerase), Listeria monocytogenes DNA polymerase I, Staphylococcus aureus DNA polymerase I (Sau polymerase), E. coli DNA polymerase I Klenow fragment, E. coli DNA polymerase I, E. coli DNA polymerase II, E. coli DNA polymerase III, E. coli DNA polymerase IV, E. coli DNA polymerase V, or any functional analog, homolog, or derivative thereof, and any combination thereof; preferably, the polymerase is selected from the group consisting of Bacillus stearothermophilus polymerase I large fragment, Bacillus subtilis Pol I large fragment (Bsu polymerase), Listeria monocytogenes DNA polymerase I, Staphylococcus aureus DNA polymerase I (Sau polymerase), E. coli DNA polymerase I Klenow fragment, E. coli DNA polymerase I, E. coli DNA polymerase II, E. coli DNA polymerase III, E. coli DNA polymerase IV, E. coli DNA polymerase V, or any functional analog, homolog, or derivative thereof, and any combination thereof; aureus DNA polymerase I (Sau polymerase) or Bacillus subtilis Pol I large fragment (Bsu polymerase), a prokaryotic polymerase C. A bacteriophage polymerase selected from the group consisting of bacteriophage T4 gp43 DNA polymerase, T7 DNA polymerase, and Phi-29 DNA polymerase, or any functional analog, homolog, or derivative thereof, and any combination thereof. 8. The method of any one of aspects 2 to 7, wherein 9. The method of any one of aspects 1 to 8, wherein the cleavage molecule is Escherichia coli exonuclease III, preferably having the amino acid sequence set forth in SEQ ID NO: 1; or the cleavage molecule is Neisseria gonorrhoeae exonuclease III, preferably having the amino acid sequence set forth in SEQ ID NO: 2; or the cleavage molecule is tyrosyl-DNA phosphodiesterase 1 (TDP-1), preferably having the amino acid sequence set forth in SEQ ID NO: 3 or SEQ ID NO: 4. 10. Signal promoting molecules are A. Quencher, B. Fluorophores, C. A polypeptide, preferably a. having enzymatic activity; b. a component of an enzyme complex, a domain of an enzyme, a fragment of an enzyme, or an enzyme cofactor; or c. An activator of an enzyme or enzyme complex; D. Small molecules, preferably a. Molecular complexes, e.g., those that promote the formation of protein:protein complexes; b. promotes the activation of an enzyme or enzyme complex; or c. A cofactor for an enzyme or enzyme complex 10. The method of any one of aspects 1 to 9, wherein 11. The method of embodiment 10(A), wherein the probe is a probe according to any one of embodiments 78 to 80, 83, 84, 85, 86(1), and 86(2), and wherein the step of detecting a detectable signal comprises detecting a fluorescent emission produced by a fluorophore of the probe. 12. The method of embodiment 10(B), wherein the probe is a probe according to any one of embodiments 80 to 85, 86(3), and 86(4), and wherein the step of detecting a detectable signal comprises detecting a fluorescent emission produced by a fluorophore of the probe. 13. The method of embodiment 11 or embodiment 12, wherein the cleavage molecule is Escherichia coli exonuclease III, preferably having the amino acid sequence set forth in SEQ ID NO:1. 14. The method of any one of aspects 1 to 9, wherein the signal promoting molecule is a polypeptide, the probe is a probe according to aspect 87, and the detectable signal is produced in a reaction that is dependent on the polypeptide of the probe. 15. The method of embodiment 10(C)(a), wherein the probe is a probe according to embodiment 88, and the detectable signal is produced in a reaction that depends on the enzymatic activity of a polypeptide of the probe. 16. The method of embodiment 15, wherein the probe is the probe of embodiment 89 or 90, the detectable signal is produced in a reaction in solution that depends on the enzymatic activity of HRP in the probe, and the method comprises detecting the activity of the HRP enzyme (HRP holoenzyme) in the solution. 17. The method of embodiment 16, wherein the cleavage molecule is tyrosyl-DNA phosphodiesterase 1 (TDP-1), and optionally, the TDP-1 has the amino acid sequence set forth in SEQ ID NO: 3 or SEQ ID NO: 4. 18. The method of embodiment 10(C)(b), wherein the probe is the probe of embodiment 91, and the detectable signal is produced in a reaction that depends on the enzymatic activity of an enzyme or enzyme complex that comprises a component, the enzymatic activity of an enzyme that comprises a domain, the enzymatic activity of an enzyme that comprises a fragment, or the enzymatic activity of an enzyme that comprises a cofactor. 19. The method of embodiment 18, wherein the probe is the probe of embodiment 92 or 93, and the detectable signal is produced in a reaction dependent on the enzymatic activity of beta-galactosidase mediated by the beta-galactosidase alpha peptide of the probe. 20. The method of embodiment 19, wherein the cleavage molecule is Escherichia coli exonuclease III, preferably having the amino acid sequence set forth in SEQ ID NO:1. 21. The step of detecting a detectable signal comprises: 1) contacting the beta-galactosidase alpha peptide of the probe in solution with a beta-galactosidase omega fragment (omega peptide) to form a beta-galactosidase holoenzyme; and 2) To detect the presence of beta-galactosidase holoenzyme in solution. 21. The method of any one of aspects 18 to 20, comprising: 22. The method of embodiment 10(C)(c), wherein the probe is a probe according to embodiment 34, and the detectable signal is produced in a reaction dependent on activation of an enzyme or enzyme complex by the polypeptide of the probe. 23. The method of embodiment 22, wherein the probe is a probe according to embodiment 95 or 96, and the detectable signal is produced in a reaction dependent on activation of an enzyme or enzyme complex by the M13 polypeptide of the probe. 24. The method of embodiment 23, wherein the detectable signal is produced in a reaction dependent on activation of an enzyme by the M13 polypeptide of the probe, and the enzyme is SUMO1 / sentrino-specific peptidase 1 (SENP1). 25. The detectable signal is A. contacting the probe M13 polypeptide with SUMO1 / sentriin-specific peptidase 1 (SENP1) in the presence of a SUMO-alpha peptide fusion protein, whereby SENP1 catalyzes cleavage of the SUMO-alpha peptide fusion protein to release free beta-galactosidase alpha peptide; and B. Detecting the presence of free beta-galactosidase alpha peptide 73. The method of embodiment 72, wherein the nucleotide sequence is produced in a reaction comprising: 26. The step of detecting the presence of free alpha peptide comprises: 1) contacting the beta-galactosidase alpha peptide of the probe in solution with a beta-galactosidase omega fragment (omega peptide) to form a beta-galactosidase holoenzyme; and 2) To detect the presence of beta-galactosidase holoenzyme in solution. 26. The method of embodiment 25, comprising: 27. The method of embodiment 21 or embodiment 26, wherein the step of detecting the presence of beta-galactosidase holoenzyme in the solution comprises a colorimetric assay, a fluorescent assay, a chemiluminescent assay, a bioluminescent assay, or an electrochemical assay. 28. The step of detecting the presence of beta-galactosidase holoenzyme in the solution comprises: A. Reacting beta-galactosidase holoenzyme with ortho-nitrophenyl-β-D-galactopyranoside (ONPG) in solution, thereby forming the chromophore reaction product ortho-nitrophenol (ONP); and B. Detecting the presence of ortho-nitrophenol (ONP), optionally by measuring the absorbance of the solution at 420 nm. 28. The method of embodiment 27, comprising: 29. The step of detecting the presence of beta-galactosidase holoenzyme in the solution comprises: A. Reacting beta-galactosidase holoenzyme with chlorophenol red-β-D-galactopyranoside (CPRG) in solution, thereby forming the chromophore reaction product chlorophenol red; and B. Detecting the presence of chlorophenol red, optionally by measuring the absorbance of the solution at 570-595 nm, e.g., 575 nm. 28. The method of embodiment 27, comprising: 30. The step of detecting the presence of beta-galactosidase holoenzyme in the solution comprises: A. Reacting beta-galactosidase holoenzyme with 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside in solution, thereby forming the blue precipitated reaction product 5,5'-dibromo-4,4'-dichloro-indigo; and B. Detecting the presence of 5,5'-dibromo-4,4'-dichloro-indigo 28. The method of embodiment 27, comprising: 31. The step of detecting the presence of beta-galactosidase holoenzyme in the solution comprises: A. Reacting beta-galactosidase holoenzyme with 5-bromo-3-indolyl β-D-galactopyranoside in solution, thereby forming the blue precipitated reaction product 5,5'-dibromo-indigo; and B. Detecting the presence of 5,5'-dibromo-indigo 28. The method of embodiment 27, comprising: 32. The step of detecting the presence of beta-galactosidase holoenzyme in the solution comprises: A. Reacting beta-galactosidase holoenzyme with 5-bromo-6-chloro-3-indolyl-β-D-galactopyranoside in solution, thereby forming a magenta precipitated reaction product, 5,5'-dibromo-6,6'-dichloro-indigo; and B. Detecting the presence of 5,5'-dibromo-6,6'-dichloro-indigo, optionally by measuring the absorbance of the solution at 565 nm. 28. The method of embodiment 27, comprising: 33. The step of detecting the presence of beta-galactosidase holoenzyme in the solution comprises: A. Reacting beta-galactosidase holoenzyme with 6-chloro-3-indolyl-beta-D-galactopyranoside in solution, optionally together with nitroblue tetrazolium salt (NBT), thereby forming the precipitated reaction product 6,6'-dichloroindigo; and B. Detecting the presence of 6,6'-dichloroindigo 28. The method of embodiment 27, comprising: 34. The step of detecting the presence of beta-galactosidase holoenzyme in the solution comprises: A. Beta-galactosidase holoenzyme is reacted with Fe3 in solution. + reacting with 3,4-cyclohexenoesculetin β-D-galactopyranoside in the presence of 2,3-dihydroxy-7,8,9,10-tetrahydro-6H-benzo[c]chromen-6-one, thereby producing two 3,4-cyclohexenoesculetin (2,3-dihydroxy-7,8,9,10-tetrahydro-6H-benzo[c]chromen-6-one) molecules and one Fe 3+ forming a black precipitate reaction product which is a complex formed from B. Detecting the presence of a black precipitate reaction product 28. The method of embodiment 27, comprising: 35. The step of detecting the presence of beta-galactosidase holoenzyme in the solution comprises: A. Reacting beta-galactosidase holoenzyme with 5-iodo-3-indolyl-β-D-galactopyranoside in solution, thereby forming the purple precipitated reaction product 5,5'-diiodo-indigo; and B. Detecting the presence of 5,5'-diiodoindigo, optionally by immunoblotting or by measuring the absorbance of the solution at 575 nm. 28. The method of embodiment 27, comprising: 36. The step of detecting the presence of beta-galactosidase holoenzyme in the solution comprises: A. reacting beta-galactosidase holoenzyme with 1-methyl-3-indolyl-β-D-galactopyranoside in solution, thereby forming the green precipitated reaction product 1,1'-dimethylisoindigo; and B. Detecting the presence of 1,1'-dimethylisoindigo 28. The method of embodiment 27, comprising: 37. The step of detecting the presence of beta-galactosidase holoenzyme in the solution comprises: A. Reacting beta-galactosidase holoenzyme with 6-O-β-galactopyranosyl-luciferin in solution in the presence of luciferase, preferably firefly luciferase; and B. Detecting light emission (luminescence), preferably by measuring emission at 560 nm. 28. The method of embodiment 27, comprising: 38. The step of detecting the presence of beta-galactosidase holoenzyme in the solution comprises: A. Reacting beta-galactosidase holoenzyme with 3-chloro-5-chloro-4'-methoxyspiro[adamantan-2,3'-[1,2]dioxetan]-4'-yl)phenoxy-beta-galactopyranoside (Galacton Star) or 2-chloro-5-chloro-4'-methoxyspiro[adamantan-2,3'-[1,2]dioxetan]-4'-yl)phenoxy-beta-galactopyranoside (Galacton plus) in solution; and B. Detecting the production of 3-chloro-5-chloro-4'-methoxyspiro[adamantan-2,3'-[1,2]dioxetan]-4'-yl)phenolate or 2-chloro-5-chloro-4'-methoxyspiro[adamantan-2,3'-[1,2]dioxetan]-4'-yl)phenolate moieties by detecting chemiluminescence. 28. The method of embodiment 27, comprising: 39. The step of detecting the presence of beta-galactosidase holoenzyme in the solution comprises: A. Reacting beta-galactosidase holoenzyme with 7-(β-D-galactopyranosyloxy)-3h-phenoxazin-3-one (resorufin β-D-galactopyranoside) in solution, thereby releasing 7-hydroxy-3H-phenoxazin-3-one (resorufin); and B. Detecting the presence of resorufin, optionally by measuring the fluorescence emission of the solution at 580 nm upon excitation at 570 nm. 28. The method of embodiment 27, comprising: 40. The step of detecting the presence of beta-galactosidase holoenzyme in the solution comprises: A. Reacting beta-galactosidase holoenzyme with 4-methylumbelliferyl-β-D-galactopyranoside (4-methylumbelliferyl-β-D-galactoside, MUG) in solution, thereby releasing 4-methylumbelliferone (4-MU); and B. Detecting the presence of 4-MU, optionally by measuring the fluorescence emission of the solution at 445 nm upon excitation at 372 nm. 28. The method of embodiment 27, comprising: 41. The step of detecting the presence of beta-galactosidase holoenzyme in the solution comprises: A. Reacting beta-galactosidase holoenzyme with fluorescein di(β-D-galactopyranoside) (FDG) in solution, thereby releasing fluorescein; and B. Detecting the presence of fluorescein, optionally by measuring the fluorescence emission of the solution at 517-519 nm upon excitation at 495-498 nm. 28. The method of embodiment 27, comprising: 42. The step of detecting the presence of beta-galactosidase holoenzyme in the solution comprises: A. Reacting beta-galactosidase holoenzyme with 4-aminophenyl-beta-D-galactopyranoside (ANPG) to form 4-aminophenol; B. Oxidizing 4-aminophenol at an electrode comprising or consisting of a conductive material, such as carbon, graphite, graphene, gold, platinum, or a conductive metal oxide, and measuring the current through the electrode; and C. Detecting a change in current, whereby an increase in current correlates with an increase in the rate of formation of 4-aminophenol. 28. The method of embodiment 27, comprising: 43. The step of detecting the presence of beta-galactosidase holoenzyme in the solution comprises: A. Reacting beta-galactosidase holoenzyme with 4-methoxyphenyl-β-d-galactopyranoside (MPGP) to produce 4-methoxyphenol; B. Detecting 4-methoxyphenol by electrochemical detection methods, optionally by voltammetry or amperometry, at an electrode comprising or consisting of a conductive material, such as carbon, graphite, graphene, gold, platinum, or a conductive metal oxide, and measuring the current through the electrode; and C. Detecting a change in voltage or current, whereby an increase in voltage or current correlates with an increase in the rate of formation of 4-methoxyphenol. 28. The method of embodiment 27, comprising: 44. The step of detecting the presence of beta-galactosidase holoenzyme in the solution comprises: A. Reacting beta-galactosidase holoenzyme with 4-methoxyphenyl-β-d-galactopyranoside (MPGP) in the presence of an oxidase, preferably tyrosinase, to form 4-methoxycatechol; B. oxidizing 4-methoxycatechol at an electrode comprising or consisting of a conductive material, such as carbon, graphite, graphene, gold, platinum, or a conductive metal oxide, thereby detecting 4-methoxycatechol at the electrode by an electrochemical detection method, optionally by voltammetry or amperometry, and measuring the current through the electrode; and C. Detecting a change in voltage or current, whereby an increase in voltage or current correlates with an increase in the rate of oxidation of 4-methoxycatechol. 28. The method of embodiment 27, comprising: 45. The method of any one of aspects 1 to 9, wherein the signal-promoting molecule is a small molecule, the probe is a probe according to aspect 97, and the detectable signal is produced in a reaction that is dependent on the small molecule of the probe. 46. ​​The method of embodiment 10(D)(a), wherein the probe is the probe of embodiment 98, and the detectable signal is produced in a reaction that depends on the formation of a molecular complex, e.g., a protein:protein complex, mediated by a small molecule of the probe. 47. A. The probe is a probe according to embodiment 99 or 100, and the detectable signal is produced in a reaction dependent on the formation of a protein:protein complex mediated by the everolimus small molecule of the probe; or B. The probe is a probe according to embodiment 101 or 102, wherein the detectable signal is produced in a reaction dependent on the formation of a protein:protein complex mediated by the rapamycin small molecule of the probe; The method of embodiment 46. 48. The step of detecting a detectable signal comprises: A. Contacting the probe everolimus or rapamycin with FK506 binding protein (FKBP) and the FKBP-rapamycin binding (FRB) domain in solution, whereby everolimus or rapamycin induces dimerization of FKBP and FBR; and B. Detecting the presence of FKBP-FBR dimers in solution; 48. The method of embodiment 47, comprising: 49. The step of detecting the presence of an FKBP-FBR dimer comprises: A. (In order from N-terminus to C-terminus): i. preferably an amino acid sequence

[0010] [ka] FKBP and ii. a first linker, preferably having the amino acid sequence GGSGGSGG (SEQ ID NO: 53), and iii. A C-terminal portion of nano-luc, preferably having the amino acid sequence VTGWRLCERILA (SEQ ID NO: 54), and iv. a second linker, preferably having the amino acid sequence GGSGSGSGSGGSGSGGS (SEQ ID NO: 55), and v. Preferably an amino acid sequence

[0011] [ka] the remaining (N-terminal) portion of nano-luc, and vi. a third linker, preferably having the amino acid sequence SGSGSGG (SEQ ID NO: 57), and vii. Preferably, the amino acid sequence

[0012] [ka] FBR a circularly permuted nano-luc fusion protein comprising: Optionally, the fusion protein has an affinity tag at the N-terminus of the protein before the FKBP sequence, preferably a 6-histidine tag immediately preceding the FKBP sequence; Nano-luc is an ATP-independent, 19.1 kDa catalytically active subunit of luciferase from the giant shrimp Oplophorus gracilirostris. B. Contacting the probe everolimus or rapamycin with the fusion protein in the presence of 2-furanylmethyl-deoxy-coelenterazine (furimazine) or 6-(4-hydroxyphenyl)-2-[(4-hydroxyphenyl)methyl]-8-(phenylmethyl)-7H-imidazo[1,2-a]pyrazin-3-one (coelenterazine); and C. Detecting light emission (luminescence), optionally by measuring emission at 460 nm 49. The method of embodiment 48, comprising: 50. The method of embodiment 10(D)(b), wherein the probe is the probe of embodiment 103, and the detectable signal is produced in a reaction dependent on the activation of an enzyme or enzyme complex mediated by a small molecule of the probe. 51. The method according to embodiment 50, wherein the probe is the probe according to embodiment 104 or 105, and the detectable signal is produced in a reaction dependent on activation of an enzyme or enzyme complex mediated by the methotrexate small molecule of the probe. 52. The step of detecting a detectable signal comprises: A. contacting the probe methotrexate (MTX) with a binding partner to form a protein binding partner:MTX complex; and B. Detecting the presence of the complex 52. The method of embodiment 51, comprising: 53. The step of detecting a detectable signal comprises: A. Contacting the probe MTX with a fusion protein containing glucose dehydrogenase (GDH) and calmodulin domains (CaM-GDH) together with a protein binding partner (CaM-GDH-protein binding partner); B. Measuring GDH activity 53. The method of embodiment 52, comprising: 54. A. The methotrexate:protein binding partner complex comprises a dihydrofolate reductase:MTX complex, and the step of detecting the complex comprises contacting cleaved MTX with a CaM-GDH-dihydrofolate reductase fusion protein and measuring GDH activity; or B. The methotrexate:protein binding partner complex comprises a thymidylate synthase:MTX complex, and detecting the complex comprises contacting cleaved MTX with a CaM-GDH-thymidylate synthase fusion protein and measuring GDH activity; or C. The methotrexate:protein binding partner complex comprises an anti-methotrexate VHH antibody:MTX complex, and detecting the complex comprises contacting cleaved MTX with a CaM-GDH-anti-methotrexate VHH antibody fusion protein and measuring GDH activity. The method of embodiment 53. 55. The method of embodiment 54, wherein the GDH activity is measured by a colorimetric assay or by an electrochemical assay. 56. The method of embodiment 10(D)(c), wherein the probe is the probe of embodiment 106, and the detectable signal is produced in a reaction dependent on conversion of the apoenzyme or apoenzyme complex to a holoenzyme or holoenzyme complex mediated by a small molecule cofactor of the probe. 57. The method of embodiment 56, wherein the probe is the probe of embodiment 107 or 108, and the detectable signal is produced in a reaction dependent on conversion of the apoenzyme or apoenzyme complex to a holoenzyme or holoenzyme complex mediated by the hemin small molecule of the probe. 58. The detectable signal is A. contacting the probe hemin with horseradish peroxidase (HRP) apoenzyme in solution, thereby forming HRP holoenzyme; B. Detecting the activity of HRP holoenzyme in the solution; 58. The method of embodiment 57, wherein the polypeptide is produced in a method comprising: 59. The method of embodiment 58, wherein the step of detecting the activity of the HRP holoenzyme in the solution comprises reacting the HRP holoenzyme with an oxidase and a substrate for the oxidase in the solution, and detecting the presence of a product produced by the reaction. 60. The step of detecting the activity of HRP holoenzyme in the solution comprises: A. (i) HRP holoenzyme in solution a) glucose, e.g., β-d-glucose, glucose oxidase, p-hydroxybenzoic acid, and 4-aminoantipyrine, or b) p-hydroxybenzoic acid, 4-aminoantipyrine, and H2O2 reacting with, thereby forming a chromophore reaction product; and (ii) detecting the presence of the chromophore reaction product, optionally by measuring the absorbance of the solution at 504 nm; or B. (i) HRP holoenzyme in solution a) glucose, e.g., β-d-glucose, glucose oxidase, and 3,3',5,5'-tetramethybenzidine (TMB), or b) 3,3',5,5'-tetramethybenzidine (TMB) and H2O2 reacting with, thereby forming a chromophore reaction product; and (ii) detecting the presence of the chromophore reaction product, optionally by measuring the absorbance of the solution at 450 nm or 650 nm; or C. (i) HRP holoenzyme in solution a) glucose, e.g., β-d-glucose, glucose oxidase, and 2,2'-azino-di-(3-ethylbenzthiazoline sulfonic acid) (ABTS), or b) 2,2'-azino-di-(3-ethylbenzthiazoline sulfonic acid) (ABTS) and H2O2 reacting with, thereby forming a chromophore reaction product; and (ii) detecting the presence of the chromophore reaction product, optionally by measuring the absorbance of the solution at 405 nm; The method of embodiment 16, embodiment 17, embodiment 58, or embodiment 59, comprising: 61. A detection probe for detecting a target nucleic acid sequence of interest in a test solution, wherein the test solution comprises a recombinase polymerase amplification (RPA) single-stranded DNA binding protein (RPA-SSB), a cleavage molecule, and the target nucleic acid sequence of interest, and the probe comprises: A. one or two single-stranded oligonucleotides, each containing a sequence complementary to a target nucleic acid sequence of interest, and B. An inhibitory cleavage-dependent signal transduction system, a. a signal promotion molecule connected to the oligonucleotide via at least one linker, the at least one linker binding to a chemical group on the signal promotion molecule and the oligonucleotide, thereby defining a cleavage site on the oligonucleotide; b. 1. Depends on cleavage at the cleavage site by a cleavage molecule; 2. After hybridization of the oligonucleotide with the target sequence, 1. Cleavage of an oligonucleotide at an apurinic / apyrimidinic site (abasic site) of the oligonucleotide, e.g., at a site containing an abasic furan, 3' to the abasic site and / or 5' to the abasic site, or an abasic furan; or 2. Cleavage of the oligonucleotide at the mismatch site Independent of providing a detectable signal; c. When the probe is present in the test solution, 1. When the oligonucleotide is not hybridized to the target sequence, cleavage at the cleavage site by the cleavage molecule is inhibited, thereby suppressing the production of a detectable signal; 2. Upon hybridization of the oligonucleotide with the target sequence, the cleavage molecule cleaves at the cleavage site, thereby producing a detectable signal. Inhibitory cleavage-dependent signal transduction system a detection probe comprising: 62. The linker: A. an abasic nucleotide or abasic residue of an oligonucleotide, e.g., not attached to the sugar molecule of an abasic nucleotide, and / or B. is not attached to the oligonucleotide at a nucleotide or residue position adjacent to the position in the oligonucleotide occupied by the abasic nucleotide or abasic residue, 62. A detection probe according to embodiment 61. 63. The detection probe of embodiment 61 or embodiment 62, wherein each of the one or two oligonucleotides is about 20 to 70 nucleotide positions in length, preferably between about 30 and 60 nucleotide positions in length. 64. The detection probe of any one of embodiments 61 to 63, further comprising a polymerase extension blocking group attached to the 3' end of the oligonucleotide, optionally wherein the blocking group is a spacer, e.g., a C3-spacer. 65. i. The target nucleic acid sequence of interest is DNA and the detection probe is a detection probe for detecting the target DNA sequence of interest; or ii. the target nucleic acid sequence of interest is RNA and the detection probe is a detection probe for detecting the target RNA sequence of interest; 65. A detection probe according to any one of embodiments 61 to 64. 66. The detection probe of any one of aspects 61 to 65, wherein the recombinase polymerase amplification (RPA) single-stranded DNA binding protein (RPA-SSB), when present in the test solution, is selected from the group consisting of Gp32, Escherichia coli (E. coli) SSB protein, phage T4 Gp32 protein, phage Rb69 Gp32, phage vB_EcoM_NBG1 Gp32, or any functional analog, homolog, or derivative thereof, and any combination thereof, preferably wherein the RPA-SSB is Gp32 or phage vB_EcoM_NBG1 Gp32. 67. A detection probe according to embodiment 66, wherein the RPA-SSB is tagged with one or more functional intrinsically disordered regions (IDRs), preferably as an engineered fusion protein comprising an amino acid sequence comprising or consisting of the RPA-SSB and one or more functional IDRs. 68. A detection probe according to any one of aspects 61 to 67, wherein the cleavage molecule is Escherichia coli exonuclease III, preferably having the amino acid sequence set forth in SEQ ID NO: 1; or Neisseria gonorrhoeae exonuclease III, preferably having the amino acid sequence set forth in SEQ ID NO: 2; or tyrosyl-DNA phosphodiesterase 1 (TDP-1), preferably having the amino acid sequence set forth in SEQ ID NO: 3 or SEQ ID NO: 4. 69. In each of the one or two oligonucleotides, the signal promotion molecule is connected to the oligonucleotide by a linker, and the linker binds to the signal promotion molecule and to a chemical group of the terminal nucleotide at the 3' end of the oligonucleotide, preferably the 3' terminal phosphate group of the oligonucleotide; A. The chemical group to which the linker is attached, preferably the 3' terminal phosphate group, contains a cleavage site; B. When the probe is present in the test solution, upon hybridization of the oligonucleotide with the target sequence in the presence of a cleaving molecule having phosphatase or exonuclease activity, the cleaving molecule cleaves at the cleavage site, thereby generating a detectable signal; 69. A detection probe according to any one of embodiments 61 to 68. 70. In each of the one or two oligonucleotides, the signal promotion molecule is connected to the oligonucleotide by two linkers, (i) a first linker is attached to a chemical group at a first position on the signal promotion molecule and at nucleotide position n of the oligonucleotide, and (ii) a second linker is attached to a chemical group at a second position on the signal promotion molecule and at nucleotide position n+x of the oligonucleotide; A. The chemical group on the oligonucleotide to which the first linker is attached contains a cleavage site, preferably a 3' terminal phosphate group; B. When the probe is present in the test solution, upon hybridization of the oligonucleotide with the target sequence in the presence of a cleaving molecule having phosphatase or exonuclease activity, the cleaving molecule cleaves at the cleavage site, thereby generating a detectable signal; The terminal nucleotide position at the 3' end of the oligonucleotide is defined as position n, and the nucleotide position subsequent to position n in the direction proximal to the 5' end of the oligonucleotide is defined as n+x, where x is an integer greater than or equal to 0. 69. A detection probe according to any one of embodiments 61 to 68. 71. The detection probe of embodiment 70, wherein the chemical group of the oligonucleotide to which the first linker is attached is the 3'-terminal phosphate group at position n of the oligonucleotide. 72. A. A second linker is attached to a chemical group at nucleotide position n of the oligonucleotide, or B. The second linker is attached to a chemical group at nucleotide position n+1 of the oligonucleotide; or C. The second linker is attached to a chemical group at nucleotide position n+x of the oligonucleotide, where x is an integer of 2 or greater; 72. A detection probe according to embodiment 71. 73. The detection probe of embodiment 70, wherein the chemical group of the oligonucleotide to which the first linker is attached is the nucleobase of the nucleotide at position n, preferably a thymine nucleobase. 74. A. The second linker is attached to a chemical group at nucleotide position n+1 of the oligonucleotide, or B. The second linker is attached to a chemical group at nucleotide position n+x of the oligonucleotide, where x is an integer of 2 or greater; 74. A detection probe according to embodiment 73. 75. The detection probe of any one of aspects 72 to 74, wherein the chemical group of the oligonucleotide to which the second linker is attached is a nucleobase of a nucleotide, preferably a thymine nucleobase. 76. The detection probe of embodiment 70, wherein the second linker is attached to a chemical group attached to the terminal nucleotide position at the 5' end of the oligonucleotide, preferably the chemical group is a phosphate group. 77. The probe comprises two oligonucleotides; 1) the signal promotion molecule is connected to the first oligonucleotide by a first linker, the first linker binding to a chemical group of the terminal nucleotide at a first position on the signal promotion molecule and at the 3' end of the first oligonucleotide, preferably the 3' terminal phosphate group of the first oligonucleotide; 2) the signal promotion molecule is connected to the second oligonucleotide by a second linker, which binds to a chemical group of the terminal nucleotide at the second position on the signal promotion molecule and at the 3' end of the second oligonucleotide, preferably the 3' terminal phosphate group of the second oligonucleotide; moreover, A. The chemical group of the first oligonucleotide to which the first linker is attached, preferably the 3' terminal phosphate group, contains a first cleavage site, and the chemical group of the second oligonucleotide to which the second linker is attached, preferably the 3' terminal phosphate group, contains a second cleavage site; B. When the probe is present in the test solution, upon hybridization of the oligonucleotide with the target sequence in the presence of a cleaving molecule having phosphatase or exonuclease activity, the cleaving molecule cleaves at the cleavage site, thereby generating a detectable signal; 69. A detection probe according to any one of embodiments 61 to 68. 78. A. The signal enhancing molecule is a quencher connected to the oligonucleotide by a linker, the linker binding to the quencher and to a chemical group of the terminal nucleotide at the 3' end of the oligonucleotide, preferably the 3' terminal phosphate group at nucleotide position n of the oligonucleotide; B. The probe further comprises a fluorophore connected to the oligonucleotide by an additional linker, the additional linker being attached to a chemical group at nucleotide position n+x of the oligonucleotide, wherein the fluorescence emission from the fluorophore is quenched by a quencher; the terminal nucleotide position at the 3' end of the oligonucleotide is defined as position n, and the nucleotide position subsequent to position n in a direction proximal to the 5' end of the oligonucleotide is defined as n+x, where x is an integer greater than or equal to 0; When the probe is present in the test solution, upon hybridization of the oligonucleotide with the target sequence, the cleavage molecule cleaves at the cleavage site, thereby separating the quencher from the oligonucleotide and a detectable fluorescent emission signal is thereby produced by the fluorophore. 70. A detection probe according to embodiment 69. 79. A. An additional linker is attached to a chemical group at nucleotide position n+0 of the oligonucleotide, or B. An additional linker is attached to the chemical group at nucleotide position n+1 of the oligonucleotide, or C. The additional linker is attached to a chemical group at nucleotide position n+x of the oligonucleotide, where x is 2 or greater; 79. A detection probe according to embodiment 78. 80. The detection probe of embodiment 79, wherein the chemical group of the oligonucleotide to which the further linker is attached is a nucleobase, preferably a thymine nucleobase. 81. A. The signal enhancing molecule is a fluorophore connected to the oligonucleotide by a linker, the linker binding the fluorophore and a chemical group of the terminal nucleotide at the 3' end of the oligonucleotide, preferably the 3' terminal phosphate group at position n of the oligonucleotide; B. The probe further comprises a quencher connected to the oligonucleotide by an additional linker, the additional linker being attached to a chemical group at nucleotide position n+x of the oligonucleotide, wherein the fluorescence emission from the fluorophore is quenched by the quencher; the terminal nucleotide position at the 3' end of the oligonucleotide is defined as position n, and the nucleotide position subsequent to position n in a direction proximal to the 5' end of the oligonucleotide is defined as n+x, where x is an integer greater than or equal to 0; When the probe is present in the test solution, upon hybridization of the oligonucleotide with the target sequence, the cleavage molecule cleaves at the cleavage site, thereby separating the fluorophore from the oligonucleotide, and a detectable fluorescent emission signal is thereby produced by the fluorophore. 70. A detection probe according to embodiment 69. 82. A. An additional linker is attached to a chemical group at nucleotide position n+0 of the oligonucleotide, or B. An additional linker is attached to the chemical group at nucleotide position n+1 of the oligonucleotide, or C. The additional linker is attached to a chemical group at nucleotide position n+x of the oligonucleotide, where x is 2 or greater; 82. A detection probe according to embodiment 81. 83. A detection probe according to any one of aspects 78 to 82, wherein the chemical group of the oligonucleotide to which the further linker is attached is a nucleobase, preferably a thymine nucleobase. 84. A. The quencher is a dark quencher selected from the group consisting of Black Hole Quencher 0 (BHQ0), Black Hole Quencher 1 (BHQ1), Black Hole Quencher 2 (BHQ2), Black Hole Quencher 3 (BHQ3), Black Berry Quencher 650 (BBQ-650), QSY-35, QSY-7, QSY-9, QSY-21, Eclipse Quencher, and DABSYL (dimethylaminoazobenzenesulfonic acid); B. Fluorophores include Alexa 350, Pacific Blue, Marina Blue, acridine, Edans, coumarin, BODIPY 493 / 503, Cy2, BODIPY FL-X, DANSYL, Alexa 488, FAM, Oregon Green, Rhodamine Green-X, NBD-X, TET, Alexa 430, BODIPY R6G-X, JOE, Yakima Yellow, Alexa 532, HEX, R6G, Alexa 555, BODIPY TMR-X, Cy3, Alexa 546, TAMRA, Rhodamine Red-X, BODIPY 581 / 591, Redmond Red, Cy3.5, ROX, Alexa 568, Cal Red, Texas Red, BODIPY TR-X, Alexa 594, BODIPY 630 / 650-X, BODIPY 650 / 665-X, Alexa 647, Cy5, and Cy5.5; 84. A detection probe according to any one of embodiments 78 to 83. 85. A. The fluorophore is 6-carboxyfluorescein (6-FAM) and the quencher is 4'-(2-nitro-4-toluyldiazo)-2'-methoxy-5'-methyl-azobenzene-4-ethylaminoethanol (Black Hole Quencher 1, BHQ1), or B. The fluorophore is tetrachlorofluorescein (TET) and the quencher is 4'-(2-nitro-4-toluyldiazo)-2'-methoxy-5'-methyl-azobenzene-4-ethylaminoethanol (Black Hole Quencher 1, BHQ1); C. The fluorophore is hexachlorofluorescein (HEX) and the quencher is 4'-(2-nitro-4-toluyldiazo)-2'-methoxy-5'-methyl-azobenzene-4-ethylaminoethanol (Black Hole Quencher 1, BHQ1), or D. The fluorophore is carboxy-X-rhodamine (ROX) and the quencher is 4'-(4-nitro-phenyldiazo)-2'-methoxy-5'-methoxy-azobenzene-4-ethylaminoethanol (Black Hole quencher 2, BHQ2); 85. A detection probe according to any one of embodiments 78 to 84. 86. The probe has the structure: 1)

[0013] [ka] where * is the terminal phosphate group at the 3' end of the oligonucleotide, L1 is a first linker, L2 is a second linker, and BHQ1 is 4'-(2-nitro-4-toluyldiazo)-2'-methoxy-5'-methyl-azobenzene-4-ethylaminoethanol (Black Hole Quencher 1), 2)

[0014] [ka] where * is the terminal phosphate group at the 3' end of the oligonucleotide, n=2, n is the number of nucleotide positions relative to the 3' end of the probe, L1 is a first linker, L2 is a second linker attached to the nucleobase at the third nucleotide position relative to the 3' end of the probe, and BHQ1 is 4'-(2-nitro-4-toluyldiazo)-2'-methoxy-5'-methyl-azobenzene-4-ethylaminoethanol (Black Hole Quencher 1), or 3)

[0015] [ka] where * is the terminal phosphate group at the 3' end of the oligonucleotide, L1 is a first linker, L2 is a second linker, and BHQ1 is 4'-(2-nitro-4-toluyldiazo)-2'-methoxy-5'-methyl-azobenzene-4-ethylaminoethanol (Black Hole Quencher 1), or 4)

[0016] [ka] (where * is the terminal phosphate group at the 3' end of the oligonucleotide, n=2, n is the number of nucleotide positions relative to the 3' end of the probe, L1 is a first linker, L2 is a second linker attached to the nucleobase at the third nucleotide position relative to the 3' end of the probe, and BHQ1 is 4'-(2-nitro-4-toluyldiazo)-2'-methoxy-5'-methyl-azobenzene-4-ethylaminoethanol (Black Hole Quencher 1)). 70. The detection probe of embodiment 69, having 87. A detection probe according to any one of aspects 69 to 77, wherein the signal promoting molecule is a polypeptide, and when the probe is present in a test solution, upon hybridization of the oligonucleotide with the target sequence, the cleavage molecule cleaves at the cleavage site, thereby producing a detectable signal in a reaction dependent on the polypeptide. 88. The detection probe of embodiment 87, wherein the polypeptide has enzymatic activity and the detectable signal is produced in a reaction that depends on the enzymatic activity of the polypeptide. 89. The detection probe of embodiment 88, wherein the polypeptide is a horseradish peroxidase (HRP) enzyme, preferably, the HRP enzyme has the amino acid sequence set forth in SEQ ID NO:5. 90. The probe has the structure:

[0017] [ka] (where * is the terminal phosphate group at the 3' end of the oligonucleotide, L is a linker, and HRP is the HRP enzyme, preferably having the amino acid sequence set forth in SEQ ID NO: 5). 90. The detection probe of embodiment 89, having 91. The detection probe of embodiment 87, wherein the polypeptide is a component of an enzyme complex, a domain of an enzyme, a fragment of an enzyme, or an enzyme cofactor, and the detectable signal is produced in a reaction that is dependent on the polypeptide. 92. The detection probe according to embodiment 91, wherein the polypeptide is a beta-galactosidase alpha peptide, preferably having an amino acid sequence set forth in SEQ ID NOs: 6-56. 93. The probe has the structure:

[0018] [ka] where * is the terminal phosphate group at the 3' end of the oligonucleotide, L1 is the first linker, and L2 is the second linker. 93. The detection probe of embodiment 92, having 94. The detection probe of embodiment 87, wherein the polypeptide is an activator or cofactor of an enzyme or enzyme complex, and the detectable signal is produced in a reaction that is dependent on the polypeptide. 95. The detection probe of embodiment 94, wherein the polypeptide is an M13 polypeptide, preferably having any one of the amino acid sequences set forth in SEQ ID NOs: 57, 58, and 59. 96. The probe has the structure:

[0019] [ka] where * is the terminal phosphate group at the 3' end of the oligonucleotide and L is a linker. 96. The detection probe of embodiment 95, having 97. When the signal promoting molecule is a small molecule and the probe is present in the test solution, upon hybridization of the oligonucleotide with the target sequence, the cleavage molecule cleaves at the cleavage site, thereby allowing a detectable signal to be produced in a reaction dependent on the small molecule; A. Aspect 69, or B. Aspects 70 to 77 The detection probe according to claim 1. 98. The detection probe of embodiment 97, wherein the small molecule promotes the formation of a molecular complex, for example, a protein:protein complex, and the detectable signal is produced in a reaction dependent on the formation of the molecular complex or protein:protein complex. 99. A small molecule has the structure:

[0020] [ka] 99. The detection probe of embodiment 98, wherein the detection probe is everolimus having the formula: 100. The probe has the following structure:

[0021] [ka] where * is the terminal phosphate group at the 3' end of the oligonucleotide and L is a linker. 100. The detection probe of embodiment 99, having: 101. A small molecule has the structure:

[0022] [ka] 99. The detection probe of embodiment 98, which is rapamycin having the formula: 102. The probe has the structure:

[0023] [ka] where * is the terminal phosphate group at the 3' end of the oligonucleotide and L is a linker. 102. The detection probe of embodiment 101, having the following structure: 103. The detection probe of embodiment 97, wherein the small molecule promotes the activation of an enzyme or enzyme complex, and the detectable signal is produced in a reaction that depends on the activation of the enzyme or enzyme complex. 104. A signal enhancing molecule has the structure:

[0024] [ka] 104. The detection probe of embodiment 103, wherein the detection probe is methotrexate having the formula: 105. The probe has the structure:

[0025] [ka] where * is the terminal phosphate group at the 3' end of the oligonucleotide and L is a linker. 105. The detection probe of embodiment 104, having the following structure: 106. The detection probe of embodiment 97, wherein the small molecule is a cofactor for an enzyme or enzyme complex, and the detectable signal is produced in a reaction that depends on activation of the enzyme or enzyme complex. 107. A signal enhancing molecule has the structure:

[0026] [ka] 107. The detection probe of embodiment 106, wherein the detection probe is a hemin having the formula: 108. The probe has the structure:

[0027] [ka] where * is the terminal phosphate group at the 3' end of the oligonucleotide and L is a linker. 108. The detection probe of embodiment 107, having the following structure: 109. Composition ingredients: A. RPA single-stranded DNA binding protein (RPA-SSB) molecule, B. cleavage molecules, and C. A detection probe according to any one of embodiments 61 to 108. A composition comprising: 110. A recombinase polymerase amplification (RPA) reaction composition, comprising: A. RPA reaction components, including the RPA single-stranded DNA binding protein (RPA-SSB) molecule; B. cleavage molecules, and C. A detection probe according to any one of embodiments 61 to 108. 1. A recombinase polymerase amplification (RPA) reaction composition comprising: 111. Kit Components: A. RPA single-stranded DNA binding protein (RPA-SSB) molecule, B. cleavage molecules, and C. A detection probe according to any one of embodiments 61 to 108. Includes a kit. 112. A recombinase polymerase amplification (RPA) reaction kit comprising: A. RPA reaction components, including the RPA single-stranded DNA binding protein (RPA-SSB) molecule; B. cleavage molecules, and C. A detection probe according to any one of embodiments 61 to 108. A recombinase polymerase amplification (RPA) reaction kit comprising: 113. The composition according to embodiment 109 or embodiment 110, or the kit according to embodiment 111 or embodiment 112, wherein the composition or kit components are provided in dried form, optionally air-dried, dried using a vacuum concentrator system, or dried under an inert gas, or wherein the composition or kit components are provided in lyophilized (freeze-dried) form. 114. The composition according to embodiment 109, the RPA reaction composition according to embodiment 110, or the kit according to embodiment 111, 112, or 113, wherein the single-stranded DNA binding protein (RPA-SSB) molecule is selected from the group consisting of Gp32, Escherichia coli (E. coli) SSB protein, phage T4 Gp32 protein, phage Rb69 Gp32, phage vB_EcoM_NBG1 Gp32, or any functional analogue, homologue, or derivative thereof, and any combination thereof, preferably the SSB molecule is Gp32 or phage vB_EcoM_NBG1 Gp32. 115. The RPA reaction composition of embodiment 110, or the RPA reaction kit of embodiment 112 or 113, wherein, in addition to the RPA-SSB, the RPA reaction components comprise a recombinase, a recombinase loading protein, and a polymerase. 116. A. Recombinases include UvsX, T4 UvsX, T6 UvsX, RB18 UvsX, E. coli phage wV7 UvsX, Shigella phage CB8 UvsX, Shigella phage Shfl2 UvsX, E. coli phage AR1 UvsX, phage vB_EcoM_G4507 UvsX, Shigella phage SHFML-11 UvsX, Escherichia phage vB_EcoM_DalCa UvsX, E. coli RecA, E. coli RadA, E. coli RadB, and E. coli Rad 51, or any functional analog, homolog, or derivative thereof, and any combination thereof, preferably wherein the recombinase agent is UvsX, more preferably Escherichia phage vB_EcoM_DalCa UvsX; B. the recombinase loading protein is selected from the group consisting of UvsY, E. coli RecO, E. coli RecR, or any functional analog, homolog, or derivative thereof, and any combination thereof; preferably, the recombinase loading protein is UvsY, more preferably Escherichia phage STO UvsY; C. The polymerase is a eukaryotic polymerase selected from the group consisting of pol-α, pol-β, pol-δ, pol-ε, or any functional analog, homolog, or derivative thereof, and any combination thereof, or the polymerase is selected from the group consisting of Bacillus stearothermophilus polymerase I large fragment, Bacillus subtilis Pol I large fragment (Bsu polymerase), Listeria monocytogenes DNA polymerase I, Staphylococcus aureus DNA polymerase I (Sau polymerase), Escherichia coli (E. coli) DNA polymerase I Klenow fragment, E. coli (E. coli) DNA polymerase I, E. coli (E. coli) DNA polymerase II, E. coli (E. coli) DNA polymerase III, E. coli (E. coli) DNA polymerase IV, E. coli (E. a prokaryotic polymerase selected from the group consisting of Staphylococcus aureus (S. aureus) DNA polymerase I (Sau polymerase) or Bacillus subtilis (Bsu polymerase) Pol I large fragment, or a bacteriophage polymerase selected from the group consisting of bacteriophage T4 gp43 DNA polymerase, T7 DNA polymerase, and Phi-29 DNA polymerase, or any functional analog, homolog, or derivative thereof, and any combination thereof; An RPA reaction composition or an RPA reaction kit according to embodiment 115. 117. The composition according to embodiment 109, 112, or 113, the RPA reaction composition according to embodiment 110, 114, 115, or 116, or the kit according to any one of embodiments 111 to 116, wherein the cleavage molecule is Escherichia coli exonuclease III, preferably having the amino acid sequence set forth in SEQ ID NO: 1, or Neisseria gonorrhoeae exonuclease III, preferably having the amino acid sequence set forth in SEQ ID NO: 2, or tyrosyl-DNA phosphodiesterase 1 (TDP-1), preferably having the amino acid sequence set forth in SEQ ID NO: 3 or SEQ ID NO: 4. 118. A portable reaction device for performing a recombinase polymerase amplification (RPA) reaction, comprising: A. at least one sample application compartment; B. at least one reagent compartment downstream of and in fluid communication with the at least one sample application compartment, the reagent compartment comprising an RPA reaction composition according to any one of aspects 110 or 114 to 117, wherein the composition components of the RPA reaction composition are provided in a dried form, optionally air-dried, dried using a vacuum concentrator system, or dried under an inert gas, or the composition components are provided in a lyophilized (freeze-dried) form; A device comprising: [Brief explanation of the drawings]

[0028] [Figure 1] FIG. 1 is a schematic overview illustrating how the probes described herein are unable to produce a signal in the presence of single-stranded binding proteins (i.e., are "cloaked") and therefore, after amplification and incorporation into double-stranded DNA, are processed (i.e., are "uncloaked") so that they are able to produce a detectable signal. [Figure 2-1]Figure 2 relates to a dual-modified probe containing a 3' fluorophore and a 3' quencher. (A) The structure and mechanism of the probe are shown. (B) The sequences of the probe, target sequence, and forward and reverse primers are provided. [Figure 2-2] Figure 2 relates to a dual-modified probe containing a 3' fluorophore and a 3' quencher. (A) The structure and mechanism of the probe are shown. (B) The sequences of the probe, target sequence, and forward and reverse primers are provided. (C) The results of an amplification assay are provided. [Figure 3-1] Figure 3 relates to a dual-modified probe containing a 3' fluorophore and a nearby quencher. (A) The structure and mechanism of the probe are shown. (B) The sequences of the probe, target sequence, and forward and reverse primers are provided. (C) The results of an amplification assay are provided. [Figure 3-2] Figure 3 relates to a dual-modified probe containing a 3' fluorophore and a nearby quencher. (A) The structure and mechanism of the probe are shown. (B) The sequences of the probe, target sequence, and forward and reverse primers are provided. (C) The results of an amplification assay are provided. [Figure 4-1] Figure 4 shows the structure and mechanism of the bead-oligo-HRP probe and its processing by yeast TDP-1 (A). The sequences of the probe, target sequence, and forward and reverse primers are provided (B). The experimental setup is shown (C, lower panel), and the results of the amplification assay and TDP-1-mediated processing are provided (C, upper panel). [Figure 4-2] Figure 4 shows the structure and mechanism of the bead-oligo-HRP probe and its processing by yeast TDP-1 (A). The sequences of the probe, target sequence, and forward and reverse primers are provided (B). The experimental setup is shown (C, lower panel), and the results of the amplification assay and TDP-1-mediated processing are provided (C, upper panel). [Figure 4-3]Figure 4 shows the structure and mechanism of the bead-oligo-HRP probe and its processing by yeast TDP-1 (A). The sequences of the probe, target sequence, and forward and reverse primers are provided (B). The experimental setup is shown (C, lower panel), and the results of the amplification assay and TDP-1-mediated processing are provided (C, upper panel). [Figure 5-1] Figure 5 shows the results of the reconstitution reaction between apo-HRP and hemin-oligo probe with and without nuclease (A). Wells included a negative control (1), a positive control (2), no nuclease (7-9), and nuclease (10-12). Figure 5 also shows the results of the reconstitution reaction between apo-HRP and hemin-oligo probe with and without nuclease and Gp32 protection of the oligo-hemin probe (B and C). (Nexo = nuclease.) [Figure 5-2] Figure 5 shows the results of the reconstitution reaction between apo-HRP and hemin-oligo probe with and without nuclease (A). Wells included a negative control (1), a positive control (2), no nuclease (7-9), and nuclease (10-12). Figure 5 also shows the results of the reconstitution reaction between apo-HRP and hemin-oligo probe with and without nuclease and Gp32 protection of the oligo-hemin probe (B and C). (Nexo = nuclease.) [Figure 5-3] Figure 5 shows the results of the reconstitution reaction between apo-HRP and hemin-oligo probe with and without nuclease (A). Wells included a negative control (1), a positive control (2), no nuclease (7-9), and nuclease (10-12). Figure 5 also shows the results of the reconstitution reaction between apo-HRP and hemin-oligo probe with and without nuclease and Gp32 protection of the oligo-hemin probe (B and C). (Nexo = nuclease.) [Figure 6]Figure 6 shows the results of a control experiment to confirm that Gp32 does not affect the color change reaction of functional horseradish peroxidase. Addition of functional horseradish peroxidase to a solution containing Gp32 induces a color change. [Figure 7] Figure 7 shows the results of a two-pot RPA reaction (FluANS, ntc = no template control, + = 3 x 104 c / uL FluA DNA) using an oligo-hemin / apo-HRP detection system. The reaction was first performed in 30 uL with 180 nM hemin-oligoFluANS probe at 42°C. After 20 minutes, the entire volume of each tube was transferred to a new tube containing all components of the colorimetric reaction. A strong color difference is observed between the ntc and positive results. [Figure 8-1] FIG. 8 shows the structures of linear (A-C) and cyclic (D and E) oligo-alpha-peptide probes synthesized and characterized by the inventors. [Figure 8-2] FIG. 8 shows the structures of linear (A-C) and cyclic (D and E) oligo-alpha-peptide probes synthesized and characterized by the inventors. [Figure 8-3] FIG. 8 shows the structures of linear (A-C) and cyclic (D and E) oligo-alpha-peptide probes synthesized and characterized by the inventors. [Figure 8-4] FIG. 8 shows the structures of linear (A-C) and cyclic (D and E) oligo-alpha-peptide probes synthesized and characterized by the inventors. [Figure 8-5] FIG. 8 shows the structures of linear (A-C) and cyclic (D and E) oligo-alpha-peptide probes synthesized and characterized by the inventors. [Figure 9] FIG. 9 shows the results of an alpha complementation assay using a 5′-oligo-3′-N-alpha-peptide-C-terminal probe conjugate (the “N-terminal conjugate” probe shown in FIG. 8A). [Figure 10-1]Figure 10 shows the results of an alpha complementation assay using a 5'-oligo-3'-C-alpha peptide-N-terminal conjugate (the "C-terminal conjugate" probe shown in Figure 8B) and a 5'-oligo-3'-N-alpha-peptide-C-3'-oligo-5' conjugate (the "sandwich" probe shown in Figure 8C). (A) Results of alpha complementation using a C-terminal conjugate (left panel) and a sandwich probe (right panel). Left panel: Tube 1: omega fragment, Tube 2: omega fragment + probe, Tube 3: omega fragment + probe + exo, Tube 4: omega fragment + probe + exo + Gp32. Right panel: Tube 1: omega fragment + probe, Tube 2: omega fragment + probe + exo, Tube 3: omega fragment + probe + gp32, Tube 4: omega fragment + probe + exo + Gp32. (B) Results of alpha complementation using a C-terminal conjugate (right panel) and a sandwich probe (left panel). In each panel, the first labeled tube (Tube 2) is without Gp32, and the second labeled tube (Tube 4) is with Gp32 after 2 hours. Sandwich probes result in a more optimized protection profile of the probe. See Example 5, Materials and Methods, for conditions. [Figure 10-2]Figure 10 shows the results of an alpha complementation assay using a 5'-oligo-3'-C-alpha peptide-N-terminal conjugate (the "C-terminal conjugate" probe shown in Figure 8B) and a 5'-oligo-3'-N-alpha-peptide-C-3'-oligo-5' conjugate (the "sandwich" probe shown in Figure 8C). (A) Results of alpha complementation using a C-terminal conjugate (left panel) and a sandwich probe (right panel). Left panel: Tube 1: omega fragment, Tube 2: omega fragment + probe, Tube 3: omega fragment + probe + exo, Tube 4: omega fragment + probe + exo + Gp32. Right panel: Tube 1: omega fragment + probe, Tube 2: omega fragment + probe + exo, Tube 3: omega fragment + probe + gp32, Tube 4: omega fragment + probe + exo + Gp32. (B) Results of alpha complementation using a C-terminal conjugate (right panel) and a sandwich probe (left panel). In each panel, the first labeled tube (Tube 2) is without Gp32, and the second labeled tube (Tube 4) is with Gp32 after 2 hours. Sandwich probes result in a more optimized protection profile of the probe. See Example 5, Materials and Methods, for conditions. [Figure 11-1]Figure 11 shows the results of a chronoamperometric assay using the sandwich probe shown in Figure 8C. (A) An experiment showing that nuclease-activated release of alpha-peptide causes an increase in electrochemical signal due to alpha-complementation, followed by beta-galactosidase-catalyzed hydrolysis of ANPG, which results in the release of 4-aminophenol, which is oxidized at the electrode. The orange trace indicates that in the presence of Gp32, no signal is observed because Gp32 protects the probe from nuclease processing. The experiment was performed in 25 mM Tris, 7.5 mM potassium acetate, 28 mM MgCl, 1.8 μM omega fragment, and 20 nM alpha-peptide oligonucleotide probe. (B) A control experiment showing that the electrochemical signal observed in (A) is due to beta-galactosidase. In the absence of omega fragment, no signal is observed. In the presence of omega fragment, a significant increase in signal is observed upon addition of the probe. [Figure 11-2] Figure 11 shows the results of a chronoamperometric assay using the sandwich probe shown in Figure 8C. (A) An experiment showing that nuclease-activated release of alpha-peptide causes an increase in electrochemical signal due to alpha-complementation, followed by beta-galactosidase-catalyzed hydrolysis of ANPG, which results in the release of 4-aminophenol, which is oxidized at the electrode. The orange trace indicates that in the presence of Gp32, no signal is observed because Gp32 protects the probe from nuclease processing. The experiment was performed in 25 mM Tris, 7.5 mM potassium acetate, 28 mM MgCl, 1.8 μM omega fragment, and 20 nM alpha-peptide oligonucleotide probe. (B) A control experiment showing that the electrochemical signal observed in (A) is due to beta-galactosidase. In the absence of omega fragment, no signal is observed. In the presence of omega fragment, a significant increase in signal is observed upon addition of the probe. [Figure 12-1] Figure 12 shows the results of an RPA experiment targeting FluA amplification from DNA. "-" represents a no-template control (ntc) and "+" represents 3 x 104 c / uL. (A) The sandwich probe (shown in Figure 8C) was used at a concentration of 8.3 nM. The left and right panels correspond to two different replicates under the same conditions, but with readings taken at slightly different times. (B) The sandwich probe was used at a concentration of 50 nM. Higher probe concentrations result in stronger background. [Figure 12-2] Figure 12 shows the results of an RPA experiment targeting FluA amplification from DNA. "-" represents a no-template control (ntc) and "+" represents 3 x 104 c / uL. (A) The sandwich probe (shown in Figure 8C) was used at a concentration of 8.3 nM. The left and right panels correspond to two different replicates under the same conditions, but with readings taken at slightly different times. (B) The sandwich probe was used at a concentration of 50 nM. Higher probe concentrations result in stronger background. [Figure 13] Figure 13 shows the results of RPA amplification performed in the presence of a 3'-3' cyclic (circular) probe. The fluorescent substrate FAM digalactopyranoside was added to a final concentration of 15 uM, and omega fragment was added to 1.8 uM. The oligo-alpha-peptide conjugate was used at a concentration of 40 nM. [Figure 14] Figure 14 shows the results of RPA amplification of Flu A from DNA in the presence of a 3'-3' oligo-alpha-peptide probe. Reactions were performed under the following conditions: 5.5% 35K PEG, 1.8 uM omega fragment:180 nM 3'-3' oligo-alpha-peptide probe, 1 mM CPRG, and 28 mM MgOAc. [Figure 15-1]Figure 15 shows the results of an experiment to determine the limit of detection for using 3'-3' oligo-alpha peptide probes in RPA amplification reactions. (A) RPA was performed in the presence of PEG with various copies / uL of FluB(NS) RNA: 100-5 c / uL (left panel) and 1-0.1 c / uL (right panel). (B) mRPA was performed using FluA H1N1 target under acidic conditions (65 mM Tricine pH 8.8 + 25 mM HCl) with 20 mM MgCl. Template concentrations were varied from 10 c / uL to 1 c / uL. [Figure 15-2] Figure 15 shows the results of an experiment to determine the limit of detection for using 3'-3' oligo-alpha peptide probes in RPA amplification reactions. (A) RPA was performed in the presence of PEG with various copies / uL of FluB(NS) RNA: 100-5 c / uL (left panel) and 1-0.1 c / uL (right panel). (B) mRPA was performed using FluA H1N1 target under acidic conditions (65 mM Tricine pH 8.8 + 25 mM HCl) with 20 mM MgCl. Template concentrations were varied from 10 c / uL to 1 c / uL. [Figure 16-1] Figure 16 shows the results of a chronoamperometry assay to evaluate electrochemical detection of RPA amplification using a 3'-3' oligo-alpha-peptide probe. Chronoamperometry (+0.2 V vs. Ag / AgCl) at 40°C. (A) mRPA of FluB template RNA via alpha-complement-dependent ANPG oxidation was performed under the following conditions: 1.8 μM omega fragment, 120 nM probe, 20 mM MgOAc, 1% γ-cyclodextrin, 25 mM Tris-acetate, 25 mM ANPG, 2.5 mM ATP (neutral conditions). (B) mRPA of FluAH1N1 template RNA by alpha-complement-dependent ANPG oxidation was performed under the following conditions: 1.8 μM omega fragment, 120 nM probe, 20 mM MgOAc, 1% γ-cyclodextrin, 25 mM Tris-acetate, 25 mM ANPG, and 2.5 mM ATP (neutral conditions). [Figure 16-2]Figure 16 shows the results of a chronoamperometry assay to evaluate electrochemical detection of RPA amplification using a 3'-3' oligo-alpha-peptide probe. Chronoamperometry (+0.2 V vs. Ag / AgCl) at 40°C. (A) mRPA of FluB template RNA via alpha-complement-dependent ANPG oxidation was performed under the following conditions: 1.8 μM omega fragment, 120 nM probe, 20 mM MgOAc, 1% γ-cyclodextrin, 25 mM Tris-acetate, 25 mM ANPG, 2.5 mM ATP (neutral conditions). (B) mRPA of FluAH1N1 template RNA by alpha-complement-dependent ANPG oxidation was performed under the following conditions: 1.8 μM omega fragment, 120 nM probe, 20 mM MgOAc, 1% γ-cyclodextrin, 25 mM Tris-acetate, 25 mM ANPG, and 2.5 mM ATP (neutral conditions). DETAILED DESCRIPTION OF THE INVENTION

[0029] Mechanism of action of the probe Disclosed herein is a novel detection probe suitable for use in detecting a target nucleic acid sequence of interest in a test solution, the test solution comprising a recombinase polymerase amplification (RPA) single-stranded DNA binding protein (RPA-SSB), a cleavage molecule, and a target nucleic acid sequence of interest, preferably a DNA sequence of interest. The detection probe of the present invention is further suitable for use in detecting a target nucleic acid sequence of interest, preferably a DNA sequence of interest, in a recombinase polymerase amplification (RPA) reaction mixture.

[0030] As outlined above, detection probes that are not suitable for detecting a target nucleic acid sequence of interest in a test solution or that are not suitable for detecting a target nucleic acid sequence of interest in an RPA reaction process are not included within the scope of the present invention.

[0031] The present invention also relates to a method for detecting a target nucleic acid sequence of interest in a test solution, as further described and defined herein.

[0032] Previous RPA detection probes have exploited the ability of certain nucleases to cleave the phosphodiester backbone of the oligonucleotide portion of the probe when the probe hybridizes to its target sequence, producing a detectable signal, for example, by separating closely spaced quenchers and fluorophores that are involved in a FRET interaction on the probe prior to cleavage.

[0033] Previously described RPA Fpg probes utilize the action of Escherichia coli formamidopyrimidine DNA glycosylase (Fpg). This enzyme catalyzes the sequential cleavage of phosphodiester bonds in oligonucleotides, first 3' and then 5' to the apurinic / apyrimidinic site (abasic site or AP site), to generate 5'- and 3'-phosphate termini, respectively, thereby excising the abasic residue or abasic nucleotide from the oligonucleotide (Bhagwat et al., 1996, Biochemistry, 35(2), pp. 659-665). In Fpg probes, a signal-enhancing molecule, e.g., a fluorophore, is typically linked to the abasic residue or nucleotide of the probe, e.g., the sugar molecule of the abasic nucleotide. The fluorophore is positioned adjacent to a quencher, which is linked to a residue or nucleotide that is neither an abasic residue nor an abasic nucleotide. When the probe hybridizes to its target sequence, Fpg cleaves the phosphodiester backbone of the oligonucleotide at the 3' and then 5' ends of the abasic residue or nucleotide. This causes the abasic residue or nucleotide to be linked to the oligonucleotide to be removed, thereby generating a detectable signal. The linker itself is not cleaved. In Fpg probes, the quencher is typically linked to the oligonucleotide near its 5' end, and the fluorophore linked to the abasic residue or nucleotide is positioned 3' to the oligonucleotide relative to the quencher.

[0034] Previously described RPA Exo probes utilize the action of Escherichia coli exonuclease III (Exo III), specifically the apurinic / apyrimidinic (AP) endonuclease activity of this enzyme rather than its phosphatase / exonuclease activity. The AP endonuclease activity of this enzyme catalyzes the cleavage of the phosphodiester bond of an oligonucleotide 5' to the abasic site, thereby generating a single internal break in the phosphodiester backbone (Shida et al., 1996, Nucleic Acids Res., 24(22), pp. 4572-4576). In Exo probes, a signal-enhancing molecule, e.g., a fluorophore, is typically linked to a residue or nucleotide of the oligonucleotide that is neither an abasic residue nor an abasic nucleotide. The fluorophore is positioned adjacent to a quencher, which is also linked to a residue or nucleotide that is neither an abasic residue nor an abasic nucleotide. The probe is structured so that the oligonucleotide has an abasic residue or abasic nucleotide between the positions occupied by the residues or nucleotides to which the fluorophore and quencher are linked. In Exo probes, the abasic residue, typically a tetrahydrofuran (THF) base analog, is used. Typically, the fluorophore is linked to the oligonucleotide via a residue or nucleotide adjacent to the 5' end of the oligonucleotide, and the quencher is positioned 3' to the oligonucleotide relative to the fluorophore, with the abasic residue located between them. When the probe hybridizes to its target sequence, exonuclease III cleaves the phosphodiester backbone 5' to the abasic residue, i.e., by the apurinic / apyrimidinic (AP) endonuclease activity of the enzyme. Typically, the portion of the oligonucleotide to which the quencher is linked can be dissociated from the target nucleic acid strand, while the portion to which the fluorophore is linked remains hybridized to the target nucleic acid strand. Separation of the fluorophore and quencher results in the production of a detectable signal.The linker that attaches the fluorophore and quencher to the oligonucleotide is not itself cleavable.

[0035] In contrast to probes such as Fpg and Exo probes, in the detection probe of the present invention, the signal promoting molecule is connected to the oligonucleotide by one or more linkers.In the probe of the present invention, the linker is not connected to the abasic nucleotide or abasic residue.The linker is not connected to the chemical group of the abasic nucleotide or abasic residue.The linker is not connected to the oligonucleotide at the nucleotide or residue position adjacent to the position of the oligonucleotide occupied by the abasic nucleotide or abasic residue.Adjacent means within 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides or residue positions of the position of the oligonucleotide occupied by the abasic nucleotide or abasic residue.

[0036] In the probes of the present invention, the signal promoting molecule is connected to the oligonucleotide via at least one linker, which is bound to a chemical group on the oligonucleotide, thereby defining a cleavage site on the oligonucleotide, where the cleavage site is susceptible to cleavage mediated by phosphatase or exonuclease activity when contacted with a cleavage molecule having phosphatase or exonuclease activity.

[0037] In contrast, in the probes of the present invention, the signal-promoting molecule is connected to the oligonucleotide via at least one linker, which is bound to a chemical group on the oligonucleotide, thereby defining a cleavage site on the oligonucleotide, where the cleavage site is not susceptible to cleavage mediated by apurinic / apyrimidinic (AP) endonuclease activity when contacted with a cleavage molecule having apurinic / apyrimidinic (AP) endonuclease activity.

[0038] In the probes of the present invention, the linker defining the cleavage site can be attached to a nucleotide or residue of the oligonucleotide at the phosphate group of the nucleotide or residue, provided that the cleavage site is susceptible to cleavage mediated by phosphatase or exonuclease activity and not susceptible to cleavage mediated by apurinic / apyrimidinic (AP) endonuclease activity. The linker can also be attached to the sugar of the nucleotide or residue of the oligonucleotide. The linker can also be attached to the base of the nucleotide or residue of the oligonucleotide.

[0039] When the probe is present in a test solution containing a recombinase polymerase amplification (RPA) single-stranded DNA binding protein (RPA-SSB), a cleavage molecule, and a target nucleic acid sequence of interest, 1. When the oligonucleotide is not hybridized to the target sequence, cleavage at the cleavage site by the cleavage molecule is inhibited, thereby suppressing the production of a detectable signal; 2. Upon hybridization of the oligonucleotide with the target sequence, the cleavage molecule cleaves at the cleavage site, thereby producing a detectable signal.

[0040] Importantly, in contrast to probes such as the Fpg and Exo probes, the provision of a detectable signal in the probes of the invention following hybridization of the oligonucleotide to a target sequence does not depend on a cleavage mechanism that is dependent on the presence of apurinic / apyrimidinic nucleotides or residues (also referred to as abasic sites or apurinic / apyrimidinic (AP) sites), nor on the presence of mismatches in the oligonucleotide, e.g. 1. Relying on cleavage of the oligonucleotide at apurinic / apyrimidinic sites (abasic sites) of the oligonucleotide, e.g., 3' to the abasic site and / or 5' to the abasic site, e.g., at a position in the oligonucleotide occupied by an abasic residue or abasic nucleotide, 2. Relying on cleavage of the oligonucleotide at the site of the mismatch 3. It also does not rely on cleavage of the oligonucleotide at sites containing abasic furans, such as tetrahydrofuran (THF).

[0041] Thus, the probes of the present invention are incompatible with the action of formamidopyrimidine DNA glycosylase or the apurinic / apyrimidinic (AP) endonuclease activity of exonuclease III.

[0042] The probes of the present invention can be configured to achieve these functional attributes. For example, the linker that attaches the signal-promoting molecule, e.g., a fluorophore or quencher, to the oligonucleotide and defines the cleavage site is not attached to the abasic residue or abasic nucleotide of the oligonucleotide, e.g., the sugar molecule of the abasic nucleotide. The linker that attaches the signal-promoting molecule, e.g., a fluorophore or quencher, to the oligonucleotide and defines the cleavage site does not have to be attached to the oligonucleotide at a position adjacent to the position in the oligonucleotide occupied by the abasic residue or abasic nucleotide.

[0043] The probes of the present invention are suitable for use in RPA reactions because they cannot provide a detectable signal when the oligonucleotide is not hybridized to a target sequence, but a detectable signal can be produced when the oligonucleotide hybridizes to a target sequence, for example, during an RPA cycle.

[0044] The RPA reaction requires the use of an RPA single-stranded DNA-binding protein (RPA-SSB) molecule, typically Gp32. Because the probes of the present invention contain a single-stranded portion that includes a sequence complementary to the target nucleic acid sequence of interest, the RPA-SSB will bind to the probe's oligonucleotide. The RPA-SSB will dissociate from the probe's oligonucleotide when the single-stranded portion of the probe hybridizes to the target sequence of interest to form a double-stranded structure. The signal-promoting molecule is attached to the probe's oligonucleotide via at least one linker that includes a cleavage site. Without being bound by theory, and consistent with the data described herein (see Example 3), the inventors believe that when the oligonucleotide is not hybridized to the target sequence, binding of the RPA-SSB to the oligonucleotide prevents the cleavage molecule from gaining access to the cleavage site. As a result, no detectable signal is produced. However, when the oligonucleotide hybridizes to the target sequence, the RPA-SSB dissociates from the oligonucleotide, thereby allowing the cleavage molecule to gain access to the cleavage site. As a result, a detectable signal is produced.

[0045] The cleavage molecule that initially performs cleavage at the cleavage site is an enzyme with phosphatase and / or exonuclease activity, as further described and defined herein. Cleavage at the cleavage site can occur by hydrolysis of a phosphate group, preferably a phosphomonoester bond, that connects the terminal phosphate group at the 3' end of the oligonucleotide to the remainder of the oligonucleotide.

[0046] Without wishing to be bound by theory, cleavage at the cleavage site provides a detectable signal, depending on the nature of the signal enhancement molecule and how the signal enhancement molecule is linked to the oligonucleotide.

[0047] For example, the signal promoting molecule can be a fluorophore that is attached to the terminal phosphate group of the oligonucleotide, for example, at the 3' end, by a single linker, where a quencher is also attached to the oligonucleotide by a separate linker, and functions to quench the fluorescence emission of the fluorophore through FRET interaction. Cleavage of the terminal phosphate group causes the FRET interaction to be disrupted, and the quencher can no longer quench the fluorescence emission of the fluorophore. In such a situation, cleavage at the cleavage site by a cleavage molecule (phosphatase / exonuclease) will separate the signal promoting molecule (fluorophore) from the oligonucleotide.

[0048] In an alternative embodiment, the signal promoting molecule may be a polypeptide comprising or consisting of a beta-galactosidase alpha peptide and attached to the oligonucleotide by one or two linkers. When two linkers are used, the first linker may be attached to the polypeptide at a first amino acid position of the polypeptide, and the second linker may be attached to the polypeptide at a second amino acid position of the polypeptide. The first linker may be attached to the terminal phosphate group of the oligonucleotide, e.g., at the 3' end, and the second linker may be attached to the oligonucleotide at a different position, e.g., to the nucleobase of the 3'-terminal nucleotide. As shown in the examples herein, such a probe does not provide a detectable signal when not hybridized to a target nucleic acid sequence of interest. This is because the RPA-SSB prevents cleavage molecules from gaining access to the cleavage site. However, once the probe hybridizes to a target nucleic acid sequence of interest, the probe will provide a detectable signal. This is because the RPA-SSB no longer prevents cleavage molecules from gaining access to the cleavage site. In such a situation, cleavage at the cleavage site by the cleavage molecule (phosphatase / exonuclease) would separate the first linker from the oligonucleotide. This would allow the signal enhancing molecule (beta-galactosidase alpha peptide) to come into contact with the beta-galactosidase omega fragment (omega peptide) in solution, forming a detectable beta-galactosidase holoenzyme. Without wishing to be bound by theory, the inventors believe that only a single cleavage reaction separating the first linker from the oligonucleotide is necessary to allow the beta-galactosidase alpha peptide to come into contact with the beta-galactosidase omega fragment, forming a detectable beta-galactosidase holoenzyme.In such a situation, the signal promoter molecule (beta-galactosidase alpha peptide) can remain connected to the oligonucleotide (via the second linker), i.e., it becomes released relative to the oligonucleotide and can still produce a detectable signal. A second cleavage reaction by the same cleavage molecule can occur to separate the second linker from the oligonucleotide. In such a situation, the signal promoter molecule (beta-galactosidase alpha peptide) can be separated from the oligonucleotide and produce a detectable signal.

[0049] Based on knowledge of the present invention and the exemplary probe structures described and defined herein, a user may determine that in a test solution containing RPA-SSB molecules: i. when the oligonucleotide is not hybridized to the target sequence, cleavage at the cleavage site is inhibited and production of a detectable signal is thereby suppressed; ii. upon hybridization of the oligonucleotide with the target sequence, the cleavage molecule cleaves at the cleavage site, thereby producing a detectable signal; A detection probe could be constructed.

[0050] In the probes of the present invention, at least one linker, which defines a cleavage site and connects the signal promotion molecule to the oligonucleotide of the probe, is preferably attached to the terminal phosphate group at the 3' end of the signal promotion molecule and the oligonucleotide, and thus the terminal phosphate group at the 3' end of the probe comprises the cleavage site.

[0051] Alternatively, in other probes of the present invention, at least one linker that defines a cleavage site and connects the signal promoter molecule to the oligonucleotide of the probe is attached to the signal promoter molecule and the oligonucleotide at a position other than the terminal phosphate group at the 3' end of the probe. Thus, the terminal phosphate group at the 3' end of the probe does not comprise the cleavage site. In such an alternative probe structure, the terminal phosphate group at the 3' end of the probe is susceptible to initial cleavage by the cleavage molecule due to the phosphatase activity of the cleavage molecule. Subsequently, the cleavage molecule cleaves at the cleavage site due to the exonuclease activity of the cleavage molecule.

[0052] Oligonucleotides The detection probes of the present invention comprise one or two oligonucleotides.

[0053] As used herein, the term "oligonucleotide" refers to a single-stranded multimer of nucleotide residues, optionally including non-nucleotide residues.

[0054] An oligonucleotide can be defined as comprising a sequence of residues, where a residue is a chemical entity that occupies a given position in the oligonucleotide sequence.

[0055] The oligonucleotide portion of the probe will comprise a sequence of deoxyribonucleotide residues.

[0056] However, it is not a requirement that every position in the oligonucleotide portion of the probe be occupied by a deoxyribonucleotide residue, and it may be possible to tolerate residues that are not deoxyribonucleotide residues, provided that the probe is capable of hybridizing to the target DNA sequence of interest and contains a functional inhibitory cleavage-dependent signaling system as further described and defined herein.

[0057] Thus, one or more positions in the oligonucleotide may be occupied by an abasic residue, provided that cleavage at the cleavage site does not depend on the presence of any such abasic residue, as further discussed herein.

[0058] One or more positions in the oligonucleotide may be occupied by a locked or bridging nucleic acid residue.

[0059] One or more positions in the oligonucleotide may be occupied by unlocked nucleic acid residues.

[0060] One or more positions in the oligonucleotide may be occupied by a peptide nucleic acid residue.

[0061] In any oligonucleotide of any one of the probes described and defined herein, 90% of the oligonucleotide residue positions can be deoxyribonucleotide residues. In any oligonucleotide of any one of the probes described and defined herein, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the oligonucleotide residue positions can be deoxyribonucleotide residues.

[0062] Optionally, any oligonucleotide of any one of the probes described and defined herein may include one or more abasic / apurinic residues along its length, provided that cleavage at the cleavage site is independent of the presence of any such abasic / apurinic residues, as further discussed herein.

[0063] Alternatively, any oligonucleotide of any one of the probes described and defined herein may contain no abasic / apurinic residues along its length.

[0064] Preferably, any oligonucleotide of any one of the probes described and defined herein comprises a deoxyribonucleotide residue at each position along its length.

[0065] single stranded part The detection probes of the present invention comprise one or two oligonucleotides.

[0066] The oligonucleotide of the probe comprises a single-stranded portion that comprises a sequence that is complementary to the target nucleic acid sequence of interest, preferably the DNA sequence of interest. The oligonucleotide of the probe preferably consists of a single-stranded portion, i.e., in the probe of the present invention, the oligonucleotide is preferably single-stranded as a whole.

[0067] Complementarity and binding characteristics The oligonucleotides contain a single-stranded portion that contains a sequence that is complementary to a target nucleic acid sequence of interest, and the probes are structured so that they can hybridize to the target nucleic acid sequence of interest by standard Watson-Crick base pairing under appropriate conditions.

[0068] The portion of the oligonucleotide that is complementary to the target nucleic acid sequence of interest may extend along the entire length of the oligonucleotide. Thus, a probe oligonucleotide may comprise or consist of a single-stranded portion that consists of a sequence that is complementary to the target nucleic acid sequence of interest.

[0069] Alternatively, the part of oligonucleotide that is complementary to the target DNA sequence of interest does not necessarily extend along the entire length of oligonucleotide.Probe oligonucleotide can comprise or consist of a single-stranded part that comprises the sequence that is complementary to the target nucleic acid sequence of interest.The single-stranded part of such oligonucleotide can comprise other sequences that are not complementary to the target DNA sequence of interest, and this can be included in oligonucleotide for purposes other than target DNA sequence recognition.

[0070] It is not necessary that the sequence (target recognition sequence) that is complementary to the target DNA sequence of interest hybridizes with the target sequence in such a manner that all positions along the length of the target recognition sequence must be occupied by the nucleotide that participates in Watson-Crick base pairing with the complementary nucleotide in the target chain.The only requirement is that the target recognition sequence can hybridize with the target DNA sequence of interest under appropriate conditions.Therefore, the mismatch between the nucleotide in the target chain and the corresponding position in the single-stranded part of the probe can be tolerated, provided that the target recognition sequence can hybridize with the target nucleic acid sequence of interest under appropriate conditions, and furthermore, as further discussed herein, the cleavage at the cleavage site does not depend on the existence of any such mismatch.

[0071] length Detection probes according to the present invention may be of any suitable length, provided they are capable of providing the described functional attributes, specifically, provided that the probe comprises an inhibitory cleavage-dependent signaling system as detailed herein, which relies on the recombinase polymerase amplification (RPA) single-stranded DNA binding protein (RPA-SSB).

[0072] The length of each of the one or two oligonucleotides can be selected by the user to suit the specific operating conditions, and is therefore not critical. The length of each of the one or two oligonucleotides can be about 20 to 70 nucleotide positions, about 25 to 65 nucleotide positions, and preferably about 30 to 60 nucleotide positions.

[0073] Linker A variety of different chemistries are available to the user for attaching signal enhancing molecules to oligonucleotides.

[0074] One very common and frequently used method is the "click chemistry." Several types of click chemistry are available. For example, a free amino group can be provided on a signal-promoting molecule and a terminal azide group can be provided on an oligonucleotide. Alternatively, a free amino group can be provided on an oligonucleotide and a terminal azide group can be provided on a signal-promoting molecule. The free amino group can be reacted with, for example, an N-hydroxysuccinimide (NHS)-functionalized bicyclononyne (BCN) via an amidation reaction to create a BCN-functionalized site. An azide group can then be covalently attached to the BCN-functionalized site via, for example, a copper-free click chemistry reaction. DBCO (dibenzocyclooctyne) click chemistry offers an alternative method. In these methods, a DBCO compound can be used to activate (functionalize) one molecule, which is then reacted with another molecule that has been activated / functionalized with an azide group. The reaction results in the conjugation of two molecules that become linked via a triazole linker. Click chemistry is widely used to conjugate molecules for a wide range of biological applications and has broad and diverse applicability (for comprehensive reviews, see Chio et al. "Click Chemistry Conjugations", Methods Mol. Biol. 2020; 2078: 83-97; Fantoni et al. "A Hitchhiker's Guide to Click-Chemistry with Nucleic Acids", Chem. Rev. 2021, 121(12), 7122-7154).

[0075] Numerous other chemical reactions are available for conjugation of molecules after introduction of a reactive group, e.g., a reactive primary amine group or a reactive thiol group (for a comprehensive review, see Spicer et al. "Achieving Controlled Biomolecule-Biomaterial Conjugation", Chem. Rev. 2018, 118, pp. 7702-7743).

[0076] The chemistry of the linker can therefore be selected by the user depending on the particular signal-enhancing molecule to be attached to the probe oligonucleotide and on the particular oligonucleotide attachment location desired. Some non-limiting examples are provided below.

[0077] Linker for binding to the 3'-terminal phosphate In any of the probes of the invention described and defined herein, when a linker is attached to the 3' terminal phosphate group of the probe's oligonucleotide, the linker may optionally have any one of the structures set forth in Table L1 below.

[0078] [Table 1-1]

[0079] [Table 1-2]

[0080] [Table 1-3]

[0081] [Table 1-4]

[0082] In any of the probes of the invention described and defined herein, when a linker is attached to a chemical group at a nucleotide position of the oligonucleotide other than a phosphate group, for example, when attached to a nucleobase of the nucleotide, the linker may optionally have any one of the structures set forth in Table L2 below.

[0083] [Table 2-1]

[0084] [Table 2-2]

[0085] [Table 2-3]

[0086] [Table 2-4]

[0087] [Table 2-5]

[0088] [Table 2-6]

[0089] In any of the probes of the invention described and defined herein, when a linker is attached to the 5' end of the oligonucleotide of the probe, the linker may optionally have any one of the structures set out in Table L3 below.

[0090] [Table 3-1]

[0091] [Table 3-2]

[0092] In any of the probes of the invention described and defined herein, when a linker is attached to a primary amine of a chemical group at a nucleotide position of the oligonucleotide of the probe, the linker may optionally be achieved by any one of the activated esters set forth in Table L4 below.

[0093] [Table 4-1]

[0094] [Table 4-2]

[0095] [Table 4-3]

[0096] In any of the probes of the invention described and defined herein, the linker may optionally have any one of the structures set out in Table L5 below, made up of peptide bonds.

[0097] [Table 5-1]

[0098] [Table 5-2]

[0099] [Table 5-3]

[0100] In any of the specific probe structures described, defined, and exemplified herein, where a peptide-triazole linkage is shown, the linkage may be varied in alternative embodiments in which different linker chemistries are utilized to conjugate (connect) the signal enhancing molecule to the oligonucleotide. Thus, the peptide-triazole linkages shown may be varied in alternative embodiments in which different linker chemistries are utilized to conjugate (connect) the signal enhancing molecule to the oligonucleotide.

[0101] [ka] Depending on the linker, any of the linkers described above and herein may be substituted.

[0102] cutting molecule The cleavage molecule is any molecule that has phosphatase / exonuclease activity and is suitable for effecting cleavage at the cleavage site by the action of the phosphatase and / or exonuclease activity of the molecule. Such molecules may also naturally possess apurinic / apyrimidinic (AP) endonuclease activity; however, the present probe is structured such that the apurinic / apyrimidinic (AP) endonuclease activity cannot mediate cleavage at the cleavage site.

[0103] Preferably, the cleavage molecule may be Escherichia coli exonuclease III, preferably having the amino acid sequence set forth in SEQ ID NO: 1, Neisseria gonorrhoeae exonuclease III, preferably having the amino acid sequence set forth in SEQ ID NO: 2, or tyrosyl-DNA phosphodiesterase 1 (TDP-1), preferably having the amino acid sequence set forth in SEQ ID NO: 3 or SEQ ID NO: 4.

[0104] The amino acid sequence of Escherichia coli exonuclease III as defined by SEQ ID NO: 1 is set forth below:

[0105] [ka]

[0106] The amino acid sequence of tyrosyl-DNA phosphodiesterase 1 (TDP-1) as defined by SEQ ID NO:2 is set forth below:

[0107] [ka]

[0108] The amino acid sequence of tyrosyl-DNA phosphodiesterase 1 (TDP-1) (Saccharomyces cerevisiae TDP-1, yTDP-1) defined by SEQ ID NO:3 is set forth below:

[0109] [ka]

[0110] The amino acid sequence of tyrosyl-DNA phosphodiesterase 1 (TDP-1) (yTDP-1-maltose binding protein (MBP) domain fusion protein) defined by SEQ ID NO:4 is set forth below:

[0111] [ka] Test solution

[0112] The detection probes of the present invention are suitable for use in detecting a target nucleic acid sequence of interest in a test solution comprising at least a recombinase polymerase amplification (RPA) single-stranded DNA binding protein (RPA-SSB), a cleavage molecule, and the target nucleic acid sequence of interest.

[0113] As shown in Example 3, the inventors have determined that the presence of RPA-SSB in a test solution, together with the probe, cleavage molecule, and target sequence, is sufficient to provide the inhibitory cleavage-dependent signaling system characteristic of the probes of the present invention. Thus, it is not necessary for the test solution to actually contain an RPA reaction mixture that contains all of the RPA reaction components required to support the RPA reaction. In any event, the probes of the present invention find particular use in detecting target nucleic acid sequences of interest in an RPA reaction, and as a result, a suitable test solution is a. RPA single-stranded DNA binding protein (SSB) molecule, b. cleavage molecule, c. Any one of the detection probes of the invention as described and defined herein; d. a target nucleic acid sequence of interest, and e. An RPA reaction mixture comprising RPA reaction components, wherein in addition to the RPA-SSB, the RPA reaction components include: i. recombinase agents, ii. optionally, a recombinase loading protein; iii. a polymerase, and iv. Forward and reverse nucleic acid primers for amplification an RPA reaction mixture comprising Includes.

[0114] Inhibitory cleavage-dependent signal transduction pathway All detection probes described and defined herein involve inhibitory cleavage-dependent signal transduction systems.

[0115] The signal transduction system is inhibitory, as described in more detail herein in connection with the mechanism of action of the probe. Therefore, the probe of the present invention will not be able to provide a detectable signal if the oligonucleotide is not hybridized to the target sequence. This is because a recombinase polymerase amplification (RPA) single-stranded DNA binding protein (RPA-SSB) molecule, typically Gp32, present in the test solution will bind to the probe's oligonucleotide and prevent the cleavage molecule from gaining access to the cleavage site. However, when the oligonucleotide hybridizes to the target sequence, the RPA-SSB dissociates from the oligonucleotide, thereby allowing the cleavage molecule to gain access to the cleavage site and cause cleavage. Therefore, the signal transduction system is suppressed or inhibited in the test solution if the oligonucleotide is not hybridized to the target sequence.

[0116] The signal transduction system is de-inhibited or activated when the oligonucleotide hybridizes to the target sequence in the test solution. The inhibitory / agonistic nature of the probe, through the association and dissociation of the RPA-SSB and the access of the cleavage molecule to the cleavage site, characterizes the mechanism of action of the probe.

[0117] The use of signal enhancing molecules that bind to probes described elsewhere herein is essential for the inhibitory cleavage-dependent signal transduction system.

[0118] Upon accessing the cleavage site, the cleavage molecule performs cleavage not through the action of apurinic / apyrimidinic (AP) endonuclease activity, but through the action of a phosphatase / exonuclease activity. The probe is therefore structured so that phosphatase / exonuclease cleavage triggers the action of a signal facilitator molecule, and conversely, so that apurinic / apyrimidinic (AP) endonuclease activity does not trigger the action of a signal facilitator molecule. Given the description herein, a user will be readily able to structure probes to provide these effects.

[0119] A wide range of signal enhancing molecules, including a variety of different inhibitory cleavage-dependent signal transduction system components, have been designed, implemented and demonstrated by the inventors.

[0120] signal-promoting molecules The signal promoting molecules that form the inhibitory cleavage-dependent signal transduction system are any molecules that can generate a detectable signal through the probes of the present invention based on the mechanisms of action described herein. As will become clear with respect to the exemplary systems described herein, the signal promoting molecules may be capable of generating a detectable signal either directly or indirectly.

[0121] The signal promoting molecule may have the ability to naturally generate a detectable signal. An example of such a signal promoting molecule is a fluorophore, where the inhibitory cleavage-dependent signal transduction system further comprises a quencher. The fluorophore may be separated from the oligonucleotide after cleavage at the cleavage site by the cleavage molecule. The separation of the fluorophore from the oligonucleotide prevents the quencher from quenching the signal of the fluorophore, so that the fluorophore can generate a detectable signal.

[0122] Alternatively, the signal promoting molecule may lack the ability to naturally generate a detectable signal itself, but in any case, be capable of indirectly generating a detectable signal. Examples of such signal promoting molecules are quenchers, components of an enzyme complex, domains of an enzyme, fragments of an enzyme, or enzyme cofactors. For example, the enzyme component may be separated from or released relative to the oligonucleotide after cleavage at the cleavage site by the cleavage molecule. The separation or release of the enzyme component from the oligonucleotide allows the enzyme component to associate with other components of the enzyme to form a holoenzyme, which is then capable of generating a detectable signal, for example, a colorimetric signal.

[0123] A variety of different signal enhancing molecules are described below as components of the cleavage-dependent signal transduction system.

[0124] Signal enhancing molecules - fluorophores / quenchers The signal enhancing molecule can be a fluorophore or a quencher.

[0125] Fluorophores As described above, the signal-promoting molecule can be a fluorophore, and the inhibitory cleavage-dependent signaling system further includes a quencher attached to the oligonucleotide. The quencher is positioned adjacent to the fluorophore on the oligonucleotide such that the fluorophore and quencher are involved in a FRET interaction. In this configuration, the quencher prevents the fluorophore from generating a detectable fluorescent signal when the probe is in a single-stranded form and is not hybridized to the target sequence of interest in a reaction mixture containing RPA-SSB. The fluorophore is attached to the oligonucleotide via at least one linker containing a cleavage site. When the probe is in a double-stranded form and hybridizes to the target sequence of interest in a reaction mixture containing RPA-SSB, the fluorophore is separated from the oligonucleotide after cleavage at the cleavage site by the cleavage molecule.

[0126] The method for detecting a target nucleic acid sequence of interest in a reaction mixture described and defined herein includes detecting the target sequence of interest by detecting a detectable signal produced by a signal-promoting molecule. Separation of the fluorophore from the oligonucleotide prevents the quencher from quenching the fluorescent signal produced by the fluorophore, thus allowing a detectable signal to be generated.

[0127] In this system, quencher can be connected to oligonucleotide through at least one linker that comprises cleavage site.Alternatively, quencher can be connected to oligonucleotide through at least one linker that does not comprise cleavage site.It does not matter whether quencher is connected to cleavage site on oligonucleotide, because cleavage of the linker that connects to fluorophore will separate fluorophore from quencher, regardless of whether quencher remains connected to oligonucleotide.

[0128] Quencher The signal-promoting molecule can be a quencher, where the inhibitory cleavage-dependent signaling system further includes a fluorophore connected to the oligonucleotide by a linker that does not include a cleavage site. The quencher is positioned adjacent to the fluorophore on the oligonucleotide so that the fluorophore and quencher are involved in a FRET interaction. In this configuration, the quencher prevents the fluorophore from generating a detectable signal by fluorescence when the probe is in single-stranded form and not hybridized to the target sequence of interest in a reaction mixture containing RPA-SSB. In such a system, the quencher is separated from the oligonucleotide after cleavage at the cleavage site by the cleavage molecule when the probe is in double-stranded form and hybridized to the target sequence of interest in a reaction mixture containing RPA-SSB. Separation of the quencher from the oligonucleotide prevents the quencher from quenching the fluorescent signal generated by the fluorophore, thus allowing a detectable signal to be generated.

[0129] Fluorophore / quencher placement In such inhibitory cleavage-dependent signaling systems, the nucleotide positions on the oligonucleotide to which the quencher and fluorophore are attached are not critical, provided that at least one linker binding the signal-facilitating molecule, whether fluorophore or quencher, contains a cleavage site, and the probe is capable of operating by the RPA-SSB-mediated inhibitory / agonistic mechanism described herein and is suitable for use in an RPA reaction.

[0130] A user can easily structure a probe to place the fluorophore and quencher in close proximity in a FRET interaction, thereby allowing the quencher to quench the fluorescent signal from the fluorophore when the probe is in single-stranded form and not hybridized to a target sequence of interest in a test solution containing RPA-SSB. These criteria can be easily tested empirically according to the methods described herein.

[0131] A user can readily construct a probe such that at least one linker connecting a signal-promoting molecule, whether a fluorophore or a quencher, to the oligonucleotide contains a cleavage site that is cleaved by the action of a cleavage molecule having phosphatase / exonuclease activity when the probe is in double-stranded form and hybridized to a target sequence of interest in a test solution containing RPA-SSB, and, in contrast, such that cleavage by the cleavage molecule does not occur when the probe is in single-stranded form and not hybridized to a target sequence of interest in a test solution containing RPA-SSB. These criteria can be readily tested empirically according to the methods described herein.

[0132] Preferably, the signal-promoting molecule, whether a fluorophore or a quencher, is connected to the oligonucleotide via at least one linker that is bonded to the terminal phosphate group at the 3' end of the probe. Thus, this linker comprises a cleavage site that includes a terminal phosphate group, whereby cleavage is effected by the action of a cleavage molecule, which may be any molecule with phosphatase / exonuclease activity. Alternatively, the signal-promoting molecule may be connected to the oligonucleotide via at least one linker that is bonded to another chemical group and / or at another nucleotide position of the oligonucleotide, provided that the probe is structurally arranged so that cleavage at the cleavage site is effected by the action of a cleavage molecule, which may be any molecule with phosphatase / exonuclease activity, and the probe is suitable for use in an RPA reaction.

[0133] In any of the probes described and defined herein, when the signal enhancing molecule is a fluorophore or a quencher, the cleavage molecule is any molecule with phosphatase / exonuclease activity, preferably Escherichia coli exonuclease III, preferably having the amino acid sequence set forth in SEQ ID NO: 1, Neisseria gonorrhoeae exonuclease III, preferably having the amino acid sequence set forth in SEQ ID NO: 2, or tyrosyl-DNA phosphodiesterase 1 (TDP-1), preferably having the amino acid sequence set forth in SEQ ID NO: 3 or SEQ ID NO: 4. The probe is structured such that cleavage at the cleavage site depends on cleavage by the action of the phosphatase / exonuclease activity of the cleavage molecule and not on any apurinic / apyrimidinic (AP) endonuclease activity of the cleavage molecule.

[0134] Fluorophores, quenchers, and pairs The following table provides a list of exemplary quenchers that can be used in the probes of the present invention.

[0135] [Table 6]

[0136] The following table provides a list of exemplary fluorophores that can be used in the probes of the present invention.

[0137] [Table 7-1]

[0138] [Table 7-2]

[0139] [Table 7-3]

[0140] [Table 7-4]

[0141] The following table provides a list of exemplary fluorophore / quencher pairs that can be used in the probes of the invention. The symbol "x" indicates a particular combination of a fluorophore from the left column and a quencher from the top row.

[0142] [Table 8-1]

[0143] [Table 8-2]

[0144] [Table 8-3]

[0145] [Table 8-4]

[0146] Non-Limiting Exemplary Probe Embodiments The detection probe can be a probe in which the signal enhancing molecule is a fluorophore or in which the signal enhancing molecule is a quencher.

[0147] The detection probe is A. The fluorophore is 6-carboxyfluorescein (6-FAM) and the quencher is 4'-(2-nitro-4-toluyldiazo)-2'-methoxy-5'-methyl-azobenzene-4-ethylaminoethanol (Black Hole Quencher 1, BHQ1), or B. The fluorophore is tetrachlorofluorescein (TET) and the quencher is 4'-(2-nitro-4-toluyldiazo)-2'-methoxy-5'-methyl-azobenzene-4-ethylaminoethanol (Black Hole Quencher 1, BHQ1); C. The fluorophore is hexachlorofluorescein (HEX) and the quencher is 4'-(2-nitro-4-toluyldiazo)-2'-methoxy-5'-methyl-azobenzene-4-ethylaminoethanol (Black Hole Quencher 1, BHQ1); D. The fluorophore is carboxy-X-rhodamine (ROX) and the quencher is 4'-(4-nitro-phenyldiazo)-2'-methoxy-5'-methoxy-azobenzene-4-ethylaminoethanol (Black Hole quencher 2, BHQ2), or E. The fluorophore and quencher pair is any other pair identified in the table of exemplary fluorophore / quencher pairs above that may be used in the probes of the invention; It may be a probe.

[0148] The detection probe has the structure: 1)

[0149] [ka] where * is the terminal phosphate group at the 3' end of the oligonucleotide, L1 is a first linker, L2 is a second linker, and BHQ1 is 4'-(2-nitro-4-toluyldiazo)-2'-methoxy-5'-methyl-azobenzene-4-ethylaminoethanol (Black Hole Quencher 1), 2)

[0150] [ka] where * is the terminal phosphate group at the 3' end of the oligonucleotide, n=2, n is the number of nucleotide positions relative to the 3' end of the probe, L1 is a first linker, L2 is a second linker attached to the nucleobase at the third nucleotide position relative to the 3' end of the probe, and BHQ1 is 4'-(2-nitro-4-toluyldiazo)-2'-methoxy-5'-methyl-azobenzene-4-ethylaminoethanol (Black Hole Quencher 1), or 3)

[0151] [ka] where * is the terminal phosphate group at the 3' end of the oligonucleotide, L1 is a first linker, L2 is a second linker, BHQ1 is 4'-(2-nitro-4-toluyldiazo)-2'-methoxy-5'-methyl-azobenzene-4-ethylaminoethanol (Black Hole Quencher 1), and FAM is fluorescein, or 4)

[0152] [ka] (where * is the terminal phosphate group at the 3' end of the oligonucleotide, n=2, n is the number of nucleotide positions relative to the 3' end of the probe, L1 is a first linker, L2 is a second linker attached to the nucleobase at the third nucleotide position relative to the 3' end of the probe, and BHQ1 is 4'-(2-nitro-4-toluyldiazo)-2'-methoxy-5'-methyl-azobenzene-4-ethylaminoethanol (Black Hole Quencher 1)). The probe may have the following structure:

[0153] Non-Limiting Exemplary Detection Embodiments The method for detecting a target nucleic acid sequence of interest in a test solution comprises: Aa RPA single-stranded DNA binding protein (SSB) molecule, b. cleavage molecule, c. Any one of the detection probes described in the "Non-Limiting Exemplary Probe Embodiments" section immediately above; and d. A sample suspected of containing a target nucleic acid sequence of interest providing a test solution comprising: B. c. Upon hybridization of one or two oligonucleotides of the probe with the target nucleic acid sequence of interest, and d. When the cleavage molecule cleaves the probe at the cleavage site detecting a detectable signal produced by the signal enhancing molecule of the probe. The method may include:

[0154] The method includes the step of: the test solution is an RPA reaction mixture comprising RPA reaction components, in addition to the RPA-SSB, the RPA reaction components comprising: 1. Recombinase agents, 2. Recombinase loading protein, 3. Polymerase, and 4. Forward and Reverse Nucleic Acid Primers for Amplification It may include:

[0155] The method may be further defined by the present disclosure and description herein.

[0156] In methods in which the probe comprises a signal enhancing molecule that is a fluorophore or a quencher, the method of detection is one in which the step of detecting a detectable signal comprises detecting fluorescent emission produced by the fluorophore of the probe.

[0157] Signal promoter molecules - polypeptides with enzymatic activity The signal enhancing molecule can be a polypeptide with enzymatic activity.

[0158] A non-limiting exemplary embodiment of such a polypeptide is horseradish peroxidase (HRP), described below. Any other suitable alternative polypeptide having enzymatic activity can also be used by simply adapting the principles of the probe structure described herein, and it will be understood that the following discussion regarding HRP applies mutatis mutandis to any other suitable alternative polypeptide.

[0159] Horseradish peroxidase (HRP) Horseradish peroxidase (HRP) is a glycoprotein enzyme of approximately 44 kDa that is widely used as a labeling and detection molecule in biochemistry, molecular biology, and immunochemistry. HRP catalyzes the oxidation of several organic substrates by hydrogen peroxide.

[0160] The HRP enzyme may have the following amino acid sequence (SEQ ID NO:5):

[0161] [ka] HRP placement

[0162] In such inhibitory cleavage-dependent signaling systems, the nucleotide position on the oligonucleotide to which the HRP is attached is not important, provided that at least one linker attached to the HRP contains a cleavage site and the probe is capable of operating by the RPA-SSB-mediated inhibitory / agonistic mechanism described herein and is suitable for use in an RPA reaction.

[0163] A user can easily construct a probe such that at least one linker connecting the HRP to the oligonucleotide contains a cleavage site that is cleaved by the action of a cleavage molecule having phosphatase / exonuclease activity when the probe is in double-stranded form and hybridized to a target sequence of interest in a test solution containing RPA-SSB, and, in contrast, such that cleavage by the cleavage molecule does not occur when the probe is in single-stranded form and not hybridized to a target sequence of interest in a test solution containing RPA-SSB. These criteria can be easily tested empirically according to the methods described herein.

[0164] Preferably, HRP is connected to oligonucleotide through at least one linker that is bonded to the terminal phosphate group at the 3' end of probe.Therefore, this linker comprises a cleavage site that comprises a terminal phosphate group, and cleavage is thereby caused by the action of a cleavage molecule that is any molecule that has phosphatase / exonuclease activity.Alternatively, HRP can be connected to oligonucleotide through at least one linker that is bonded to another chemical group and / or at another nucleotide position of oligonucleotide, provided that the probe is structurally arranged so that cleavage at cleavage site is caused by the action of a cleavage molecule that is any molecule that has phosphatase / exonuclease activity, and the probe is suitable for use in RPA reaction.

[0165] In any of the probes described and defined herein, when the signal enhancing molecule is HRP, the cleavage molecule is any molecule with phosphatase / exonuclease activity, preferably Escherichia coli exonuclease III, preferably having the amino acid sequence set forth in SEQ ID NO: 1, Neisseria gonorrhoeae exonuclease III, preferably having the amino acid sequence set forth in SEQ ID NO: 2, or tyrosyl-DNA phosphodiesterase 1 (TDP-1), preferably having the amino acid sequence set forth in SEQ ID NO: 3 or SEQ ID NO: 4. The probe is structured such that cleavage at the cleavage site depends on cleavage by the action of the phosphatase / exonuclease activity of the cleavage molecule and not on any apurinic / apyrimidinic (AP) endonuclease activity of the cleavage molecule.

[0166] Non-Limiting Exemplary Probe Embodiments The detection probe of the present invention may be a probe in which the signal promoting molecule is a polypeptide, and when the probe is present in a test solution, upon hybridization of the oligonucleotide with the target sequence, the cleavage molecule cleaves at the cleavage site, thereby producing a detectable signal in a reaction dependent on the polypeptide.

[0167] A detection probe of the present invention can be a probe in which the polypeptide has enzymatic activity and a detectable signal is produced in a reaction that depends on the enzymatic activity of the polypeptide.

[0168] The detection probe of the present invention can be a probe in which the polypeptide is a horseradish peroxidase (HRP) enzyme.

[0169] The detection probe of the present invention can be a probe in which the polypeptide is a horseradish peroxidase (HRP) enzyme having the following amino acid sequence (SEQ ID NO:5).

[0170] [ka]

[0171] The detection probe has the structure:

[0172] [ka] (where * is the terminal phosphate group at the 3' end of the oligonucleotide, L is a linker, and HRP is the HRP enzyme having the following amino acid sequence (SEQ ID NO: 5, from N-terminus to C-terminus):

[0173] [ka] The probe may have the following structure:

[0174] In such probes, L can be attached to HRP at any suitable amino acid position of HRP, for example, at the terminal amino acid position at the N-terminus of HRP, at the terminal amino acid position at the C-terminus of HRP, or at any other amino acid position including any one or more K residues and any one or more C residues.

[0175] Non-Limiting Exemplary Detection Embodiments The method for detecting a target nucleic acid sequence of interest in a test solution comprises: Aa RPA single-stranded DNA binding protein (SSB) molecule, b. cleavage molecule, c. Any one of the detection probes described in the "Non-Limiting Exemplary Probe Embodiments" section immediately above; and d. A sample suspected of containing a target nucleic acid sequence of interest providing a test solution comprising: Upon hybridization of one or two oligonucleotides of the Ba probe with the target nucleic acid sequence of interest, and b. When the cleavage molecule cleaves the probe at the cleavage site detecting a detectable signal produced by the signal enhancing molecule of the probe. The method may include:

[0176] The method includes the step of: the test solution is an RPA reaction mixture comprising RPA reaction components, in addition to the RPA-SSB, the RPA reaction components comprising: 1. Recombinase agents, 2. Recombinase loading protein, 3. Polymerase, and 4. Forward and Reverse Nucleic Acid Primers for Amplification It may include:

[0177] The method may be further defined by the present disclosure and description herein.

[0178] The method involves detecting the activity of the HRP enzyme (HRP holoenzyme) in solution, where a detectable signal is produced in a reaction in solution that is dependent on the enzymatic activity of the HRP in the probe.

[0179] The method may be one in which the step of detecting the activity of the HRP holoenzyme in the solution comprises reacting the HRP holoenzyme in the solution with an oxidase and a substrate for the oxidase, and detecting the presence of a product produced by the reaction.

[0180] The method comprises detecting the activity of HRP holoenzyme in the solution, A. (i) HRP holoenzyme in solution a) glucose, e.g., β-d-glucose, glucose oxidase, p-hydroxybenzoic acid, and 4-aminoantipyrine, or b) p-hydroxybenzoic acid, 4-aminoantipyrine, and H2O2 reacting with, thereby forming a chromophore reaction product; and (ii) detecting the presence of the chromophore reaction product, optionally by measuring the absorbance of the solution at 504 nm; or B. (i) HRP holoenzyme in solution a) glucose, e.g., β-d-glucose, glucose oxidase, and 3,3',5,5'-tetramethybenzidine (TMB), or b) 3,3',5,5'-tetramethybenzidine (TMB) and H2O2 reacting with, thereby forming a chromophore reaction product; and (ii) detecting the presence of the chromophore reaction product, optionally by measuring the absorbance of the solution at 450 nm or 650 nm; or C. (i) HRP holoenzyme in solution a) glucose, e.g., β-d-glucose, glucose oxidase, and 2,2'-azino-di-(3-ethylbenzthiazoline sulfonic acid) (ABTS), or b) 2,2'-azino-di-(3-ethylbenzthiazoline sulfonic acid) (ABTS) and H2O2 reacting with, thereby forming a chromophore reaction product; and (ii) detecting the presence of the chromophore reaction product, optionally by measuring the absorbance of the solution at 405 nm; The method may include:

[0181] Components of signal enhancer-enzyme complexes, domains of enzymes, fragments of enzymes, or enzyme cofactors The signal enhancing molecule can be a polypeptide that is a component of an enzyme complex, a domain of an enzyme, a fragment of an enzyme, or an enzyme cofactor.

[0182] A non-limiting exemplary embodiment of such a polypeptide is beta-galactosidase alpha peptide (alpha peptide), described below. Any other suitable alternative polypeptide that is a component of an enzyme complex, a domain of an enzyme, a fragment of an enzyme, or an enzyme cofactor can also be used, simply by adapting the principles of the probe structures described herein, and it will be understood that the following discussion regarding alpha peptide applies mutatis mutandis to any other suitable alternative polypeptide.

[0183] Alpha Peptide The enzyme beta-galactosidase can be separated into two inactive fragments of different sizes, which themselves cannot hydrolyze the beta-galactosidase substrate. The smaller fragment is referred to as the alpha peptide, alpha fragment, alpha domain, or enzyme donor, and these terms are used interchangeably herein. The alpha peptide is approximately 100 amino acid residues long. The larger fragment is referred to as the omega peptide, omega fragment, omega domain, or enzyme acceptor, and these terms are used interchangeably herein. The omega fragment is approximately 900 amino acid residues long. When the alpha and omega fragments are combined, the beta-galactosidase enzyme is reconstituted and becomes active. Active beta-galactosidase can then be detected.

[0184] Alpha peptide configuration In such inhibitory cleavage-dependent signaling systems, the nucleotide position on the oligonucleotide to which the alpha peptide is attached is not important, provided that at least one linker attached to the alpha peptide contains a cleavage site and the probe is capable of operating by the RPA-SSB-mediated inhibitory / agonistic mechanism described herein and is suitable for use in an RPA reaction.

[0185] A user can easily construct a probe such that at least one linker connecting the alpha peptide to the oligonucleotide contains a cleavage site that is cleaved by the action of a cleavage molecule having phosphatase / exonuclease activity when the probe is in double-stranded form and hybridized to a target sequence of interest in a test solution containing RPA-SSB, and, in contrast, such that cleavage by the cleavage molecule does not occur when the probe is in single-stranded form and not hybridized to a target sequence of interest in a test solution containing RPA-SSB. These criteria can be easily tested empirically according to the methods described herein.

[0186] Preferably, the alpha peptide is connected to the oligonucleotide via at least one linker that is bonded to the terminal phosphate group at the 3' end of the probe. Thus, the linker comprises a cleavage site that includes a terminal phosphate group, whereby cleavage is effected by the action of a cleavage molecule, which may be any molecule with phosphatase / exonuclease activity. Alternatively, the alpha peptide may be connected to the oligonucleotide via at least one linker that is bonded to another chemical group and / or at another nucleotide position of the oligonucleotide, provided that the probe is structurally arranged so that cleavage at the cleavage site is effected by the action of a cleavage molecule, which may be any molecule with phosphatase / exonuclease activity, and the probe is suitable for use in an RPA reaction.

[0187] In any of the probes described and defined herein, when the signal enhancing molecule is an alpha peptide, the cleavage molecule is any molecule with phosphatase / exonuclease activity, preferably Escherichia coli exonuclease III, preferably having the amino acid sequence set forth in SEQ ID NO: 1, Neisseria gonorrhoeae exonuclease III, preferably having the amino acid sequence set forth in SEQ ID NO: 2, or tyrosyl-DNA phosphodiesterase 1 (TDP-1), preferably having the amino acid sequence set forth in SEQ ID NO: 3 or SEQ ID NO: 4. The probe is structured such that cleavage at the cleavage site depends on cleavage by the action of the phosphatase / exonuclease activity of the cleavage molecule and not on any apurinic / apyrimidinic (AP) endonuclease activity of the cleavage molecule.

[0188] Non-Limiting Exemplary Probe Embodiments The detection probe may be a probe as further described and defined herein in which the signal-promoting molecule is a polypeptide that is a component of an enzyme complex, a domain of an enzyme, a fragment of an enzyme, or an enzyme cofactor, and in which the detectable signal is produced in a reaction that is dependent on the polypeptide.

[0189] The detection probe can be a probe in which the polypeptide is a beta-galactosidase alpha peptide.

[0190] The detection probe may be a probe in which the polypeptide is a beta-galactosidase alpha peptide having an amino acid sequence set forth in any one of SEQ ID NOs: 6-56 listed in the table below.

[0191] The table provides a list of beta-galactosidase alpha peptide amino acid sequences that can be used as signal promoting molecules. Preferably, a first linker is attached to the first amino acid residue of the sequence at the N-terminus of the polypeptide (underlined, typically (but not exclusively) through the addition of an azide to the N-terminus, i.e., azidoacetic acid coupling), and a second linker is attached to the second (underlined) amino acid residue of the sequence, in a C-terminally proximal orientation.

[0192] Preferably, the N-terminal amine of the peptide is reacted with azidoacetic acid to add an azide to the N-terminus. Alternative methods may include the reaction of a longer carbon chain or a PEG-based linker. A further alternative method may include the reaction of the N-terminus with bromo / iodoacetic acid to conjugate the peptide with oligo-SH.

[0193] [Table 9-1]

[0194] [Table 9-2]

[0195] [Table 9-3]

[0196] [Table 9-4]

[0197] The detection probe has the structure:

[0198] [ka] (wherein * is the terminal phosphate group at the 3' end of the oligonucleotide, L1 is a first linker, L2 is a second linker, and SEQ ID NO: X is any one of SEQ ID NOs: 6 to 56, and in each sequence, an underlined K residue or an underlined C residue is bound to L1 and another underlined residue is bound to L2, or in each sequence, an underlined K residue or an underlined C residue is bound to L2 and another underlined residue is bound to L1) The probe may have the following structure:

[0199] The detection probe has the structure:

[0200] [ka] (wherein * is the terminal phosphate group at the 3' end of the oligonucleotide, L1 is a first linker, L2 is a second linker, n is the number of nucleotide positions relative to the 3' end of the probe, and SEQ ID NO: X is any one of SEQ ID NOs: 6 to 56, in which in each sequence, an underlined K residue or an underlined C residue is bound to L1 and another underlined residue is bound to L2, or in each sequence, an underlined K residue or an underlined C residue is bound to L2 and another underlined residue is bound to L1) The probe may have the following structure:

[0201] The detection probe has the structure:

[0202] [ka] (wherein * is the terminal phosphate group at the 3' end of the oligonucleotide, L1 is a first linker, L2 is a second linker, n is the number of nucleotide positions relative to the 3' end of the probe, and SEQ ID NO: X is any one of SEQ ID NOs: 6 to 56, in which in each sequence, an underlined K residue or an underlined C residue is bound to L1 and another underlined residue is bound to L2, or in each sequence, an underlined K residue or an underlined C residue is bound to L2 and another underlined residue is bound to L1) The probe may have the following structure:

[0203] The detection probe has the structure:

[0204] [ka] (wherein * is the terminal phosphate group at the 5' end of the oligonucleotide, ** is the terminal phosphate group at the 3' end of the oligonucleotide, L1 is a first linker, L2 is a second linker, SEQ ID NO: X is any one of SEQ ID NOs: 6 to 56, and in each sequence, an underlined K residue or an underlined C residue is bound to L1 and another underlined residue is bound to L2, or in each sequence, an underlined K residue or an underlined C residue is bound to L2 and another underlined residue is bound to L1) The probe may have the following structure:

[0205] The detection probe has the structure:

[0206] [ka] (wherein * is the terminal phosphate group at the 3' end of the first oligonucleotide, ** is the terminal phosphate group at the 3' end of the second oligonucleotide, L1 is a first linker, L2 is a second linker, SEQ ID NO: X is any one of SEQ ID NOs: 6 to 56, and in each sequence, an underlined K residue or an underlined C residue is bound to L1 and another underlined residue is bound to L2, or in each sequence, an underlined K residue or an underlined C residue is bound to L2 and another underlined residue is bound to L1) The probe may have the following structure:

[0207] The detection probe may have any one of the following 32 structures (in each structure, * is the terminal phosphate group at the 3' end of the oligonucleotide, L1 is the first linker, and L2 is the second linker): Structure 1:

[0208] [ka] Structure 2:

[0209] [ka] Structure 3:

[0210] [ka] Structure 4:

[0211] [ka] Structure 5:

[0212] [ka] Structure 6:

[0213]

change

[0214]

change

[0215]

change

[0216]

change

[0217]

change

[0218]

change

[0219]

change

[0220]

change

[0221]

change

[0222]

change

[0223]

change

[0224]

change

[0225]

change

[0226]

change

[0227]

change

[0228]

change

[0229]

change

[0230]

change

[0231]

change

[0232]

change

[0233]

change

[0234] [ka] Structure 28:

[0235] [ka] Structure 29:

[0236] [ka] Structure 30:

[0237] [ka] Structure 31:

[0238] [ka] or Structure 32:

[0239] [ka]

[0240] Non-Limiting Exemplary Detection Embodiments The method for detecting a target nucleic acid sequence of interest in a test solution comprises: Aa RPA single-stranded DNA binding protein (SSB) molecule, b. cleavage molecule, c. Any one of the detection probes described in the "Non-Limiting Exemplary Probe Embodiments" section immediately above; and d. A sample suspected of containing a target nucleic acid sequence of interest providing a test solution comprising: Upon hybridization of one or two oligonucleotides of the Ba probe with the target nucleic acid sequence of interest, and b. When the cleavage molecule cleaves the probe at the cleavage site detecting a detectable signal produced by the signal enhancing molecule of the probe. The method may include:

[0241] The method includes the step of: the test solution is an RPA reaction mixture comprising RPA reaction components, in addition to the RPA-SSB, the RPA reaction components comprising: 1. Recombinase agents, 2. Recombinase loading protein, 3. Polymerase, and 4. Forward and Reverse Nucleic Acid Primers for Amplification It may include:

[0242] The method may be further defined by the present disclosure and description herein.

[0243] The method is one in which a detectable signal is produced in a reaction that depends on the enzymatic activity of an enzyme or enzyme complex containing component, an enzyme containing domain, an enzyme containing fragment, or an enzyme containing cofactor.

[0244] The method can be one in which a detectable signal is produced in a reaction that depends on the enzymatic activity of beta-galactosidase mediated by the beta-galactosidase alpha peptide of the probe.

[0245] The method comprises detecting a detectable signal, 1) contacting the beta-galactosidase alpha peptide of the probe in solution with a beta-galactosidase omega fragment (omega peptide) to form a beta-galactosidase holoenzyme; and 2) To detect the presence of beta-galactosidase holoenzyme in solution. It may include:

[0246] The method can be one in which the step of detecting the presence of beta-galactosidase holoenzyme in the solution comprises a colorimetric assay, a fluorescent assay, a chemiluminescent assay, a bioluminescent assay, or an electrochemical assay.

[0247] The method comprises detecting the presence of beta-galactosidase holoenzyme in the solution, A. Reacting beta-galactosidase holoenzyme with ortho-nitrophenyl-β-D-galactopyranoside (ONPG) in solution, thereby forming the chromophore reaction product ortho-nitrophenol (ONP); and B. Detecting the presence of ortho-nitrophenol (ONP), optionally by measuring the absorbance of the solution at 420 nm. It may include:

[0248] The method comprises detecting the presence of beta-galactosidase holoenzyme in the solution, A. Reacting beta-galactosidase holoenzyme with chlorophenol red-β-D-galactopyranoside (CPRG) in solution, thereby forming the chromophore reaction product chlorophenol red; and B. Detecting the presence of chlorophenol red, optionally by measuring the absorbance of the solution at 570-595 nm, e.g., 575 nm. It may include:

[0249] The method comprises detecting the presence of beta-galactosidase holoenzyme in the solution, A. Reacting beta-galactosidase holoenzyme with 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside in solution, thereby forming the blue precipitated reaction product 5,5'-dibromo-4,4'-dichloro-indigo; and B. Detecting the presence of 5,5'-dibromo-4,4'-dichloro-indigo It may include:

[0250] The method comprises detecting the presence of beta-galactosidase holoenzyme in the solution, A. Reacting beta-galactosidase holoenzyme with 5-bromo-3-indolyl β-D-galactopyranoside in solution, thereby forming the blue precipitated reaction product 5,5'-dibromo-indigo; and B. Detecting the presence of 5,5'-dibromo-indigo It may include:

[0251] The method comprises detecting the presence of beta-galactosidase holoenzyme in the solution, A. Reacting beta-galactosidase holoenzyme with 5-bromo-6-chloro-3-indolyl-β-D-galactopyranoside in solution, thereby forming a magenta precipitated reaction product, 5,5'-dibromo-6,6'-dichloro-indigo; and B. Detecting the presence of 5,5'-dibromo-6,6'-dichloro-indigo, optionally by measuring the absorbance of the solution at 565 nm. It may include:

[0252] The method comprises detecting the presence of beta-galactosidase holoenzyme in the solution, A. Reacting beta-galactosidase holoenzyme with 6-chloro-3-indolyl-beta-D-galactopyranoside in solution, optionally together with nitroblue tetrazolium salt (NBT), thereby forming the precipitated reaction product 6,6'-dichloroindigo; and B. Detecting the presence of 6,6'-dichloroindigo It may include:

[0253] The method comprises detecting the presence of beta-galactosidase holoenzyme in the solution, A. Beta-galactosidase holoenzyme is reacted with Fe3 in solution. +reacting with 3,4-cyclohexenoesculetin β-D-galactopyranoside in the presence of 2,3-dihydroxy-7,8,9,10-tetrahydro-6H-benzo[c]chromen-6-one, thereby producing two 3,4-cyclohexenoesculetin (2,3-dihydroxy-7,8,9,10-tetrahydro-6H-benzo[c]chromen-6-one) molecules and one Fe 3+ forming a black precipitate reaction product which is a complex formed from B. Detecting the presence of a black precipitate reaction product It may include:

[0254] The method comprises detecting the presence of beta-galactosidase holoenzyme in the solution, A. Reacting beta-galactosidase holoenzyme with 5-iodo-3-indolyl-β-D-galactopyranoside in solution, thereby forming the purple precipitated reaction product 5,5'-diiodo-indigo; and B. Detecting the presence of 5,5'-diiodoindigo, optionally by immunoblotting or by measuring the absorbance of the solution at 575 nm It may include:

[0255] The method comprises detecting the presence of beta-galactosidase holoenzyme in the solution, A. reacting beta-galactosidase holoenzyme with 1-methyl-3-indolyl-β-D-galactopyranoside in solution, thereby forming the green precipitated reaction product 1,1'-dimethylisoindigo; and B. Detecting the presence of 1,1'-dimethylisoindigo It may include:

[0256] The method comprises detecting the presence of beta-galactosidase holoenzyme in the solution, A. Reacting beta-galactosidase holoenzyme with 6-O-β-galactopyranosyl-luciferin in solution in the presence of luciferase, preferably firefly luciferase; and B. Detecting light emission (luminescence), preferably by measuring emission at 560 nm. It may include:

[0257] The method comprises detecting the presence of beta-galactosidase holoenzyme in the solution, A. Reacting beta-galactosidase holoenzyme with 3-chloro-5-chloro-4'-methoxyspiro[adamantan-2,3'-[1,2]dioxetan]-4'-yl)phenoxy-beta-galactopyranoside (Galacton Star) or 2-chloro-5-chloro-4'-methoxyspiro[adamantan-2,3'-[1,2]dioxetan]-4'-yl)phenoxy-beta-galactopyranoside (Galacton plus) in solution; and B. Detecting the production of 3-chloro-5-chloro-4'-methoxyspiro[adamantan-2,3'-[1,2]dioxetan]-4'-yl)phenolate or 2-chloro-5-chloro-4'-methoxyspiro[adamantan-2,3'-[1,2]dioxetan]-4'-yl)phenolate moieties by detecting chemiluminescence. It may include:

[0258] The method comprises detecting the presence of beta-galactosidase holoenzyme in the solution, A. Reacting beta-galactosidase holoenzyme with 7-(β-D-galactopyranosyloxy)-3h-phenoxazin-3-one (resorufin β-D-galactopyranoside) in solution, thereby releasing 7-hydroxy-3H-phenoxazin-3-one (resorufin); and B. Detecting the presence of resorufin, optionally by measuring the fluorescence emission of the solution at 580 nm upon excitation at 570 nm. It may include:

[0259] The method comprises detecting the presence of beta-galactosidase holoenzyme in the solution, A. Reacting beta-galactosidase holoenzyme with 4-methylumbelliferyl-β-D-galactopyranoside (4-methylumbelliferyl-β-D-galactoside, MUG) in solution, thereby releasing 4-methylumbelliferone (4-MU); and B. Detecting the presence of 4-MU, optionally by measuring the fluorescence emission of the solution at 445 nm upon excitation at 372 nm. It may include:

[0260] The method comprises detecting the presence of beta-galactosidase holoenzyme in the solution, A. Reacting beta-galactosidase holoenzyme with fluorescein di(β-D-galactopyranoside) (FDG) in solution, thereby releasing fluorescein; and B. Detecting the presence of fluorescein, optionally by measuring the fluorescence emission of the solution at 517-519 nm upon excitation at 495-498 nm. It may include:

[0261] The method comprises detecting the presence of beta-galactosidase holoenzyme in the solution, A. Reacting beta-galactosidase holoenzyme with 4-aminophenyl-beta-D-galactopyranoside (ANPG) to form 4-aminophenol; B. Oxidizing 4-aminophenol at an electrode comprising or consisting of a conductive material, such as carbon, graphite, graphene, gold, platinum, or a conductive metal oxide, and measuring the current through the electrode; and C. Detecting a change in current, whereby an increase in current correlates with an increase in the rate of formation of 4-aminophenol. It may include:

[0262] The method comprises detecting the presence of beta-galactosidase holoenzyme in the solution, A. Reacting beta-galactosidase holoenzyme with 4-methoxyphenyl-β-d-galactopyranoside (MPGP) to produce 4-methoxyphenol; B. Detecting 4-methoxyphenol by electrochemical detection methods, optionally by voltammetry or amperometry, at an electrode comprising or consisting of a conductive material, such as carbon, graphite, graphene, gold, platinum, or a conductive metal oxide, and measuring the current through the electrode; and C. Detecting a change in voltage or current, whereby an increase in voltage or current correlates with an increase in the rate of formation of 4-methoxyphenol. It may include:

[0263] The method comprises detecting the presence of beta-galactosidase holoenzyme in the solution, A. Reacting beta-galactosidase holoenzyme with 4-methoxyphenyl-β-d-galactopyranoside (MPGP) in the presence of an oxidase, preferably tyrosinase, to form 4-methoxycatechol; B. oxidizing 4-methoxycatechol at an electrode comprising or consisting of a conductive material, such as carbon, graphite, graphene, gold, platinum, or a conductive metal oxide, thereby detecting 4-methoxycatechol at the electrode by an electrochemical detection method, optionally by voltammetry or amperometry, and measuring the current through the electrode; and C. Detecting a change in voltage or current, whereby an increase in voltage or current correlates with an increase in the rate of oxidation of 4-methoxycatechol. It may include:

[0264] Signal enhancer molecules - activators of enzymes or enzyme complexes The signal enhancing molecule can be a polypeptide that is an activator of an enzyme or an activator of an enzyme complex.

[0265] Such polypeptides have the ability to stimulate the activity of another molecule, for example, an enzyme or enzyme complex.

[0266] A non-limiting exemplary embodiment of such a polypeptide is the M13 polypeptide described below. Any other suitable alternative polypeptide that is an activator of an enzyme or an activator of an enzyme complex can also be used, simply by adapting the principles of the probe structure described herein, and it will be understood that the following discussion regarding the M13 peptide applies mutatis mutandis to any other suitable alternative polypeptide.

[0267] M13 polypeptide M13 is Ca 2+ This peptide corresponds to the CaM-binding domain of the calmodulin (CaM) binding protein. The CaM-binding domain binds calmodulin and small conductance Ca 2+ activation K + It mediates the interaction between the SK channel and the SK receptor.

[0268] M13 polypeptide is also referred to as M13 peptide, and these terms are used interchangeably herein.

[0269] Arrangement of M13 polypeptide In such an inhibitory cleavage-dependent signaling system, the nucleotide position on the oligonucleotide to which the M13 polypeptide is attached is not important, provided that at least one linker attached to the M13 polypeptide contains a cleavage site and the probe is capable of operating by the RPA-SSB-mediated inhibitory / agonistic mechanism described herein and is suitable for use in an RPA reaction.

[0270] A user can readily construct a probe such that at least one linker connecting the M13 polypeptide to the oligonucleotide contains a cleavage site that is cleaved by the action of a cleavage molecule having phosphatase / exonuclease activity when the probe is in double-stranded form and hybridized to a target sequence of interest in a test solution containing RPA-SSB, and, in contrast, such that cleavage by the cleavage molecule does not occur when the probe is in single-stranded form and not hybridized to a target sequence of interest in a test solution containing RPA-SSB. These criteria can be readily tested empirically according to the methods described herein.

[0271] Preferably, the M13 polypeptide is connected to the oligonucleotide via at least one linker that is bonded to the terminal phosphate group at the 3' end of the probe.Accordingly, this linker comprises a cleavage site that includes a terminal phosphate group, and cleavage is thereby caused by the action of a cleavage molecule, which is any molecule with phosphatase / exonuclease activity.Alternatively, the M13 polypeptide may be connected to the oligonucleotide via at least one linker that is bonded to another chemical group and / or at another nucleotide position of the oligonucleotide, provided that the probe is structurally arranged so that cleavage at the cleavage site is caused by the action of a cleavage molecule, which is any molecule with phosphatase / exonuclease activity, and the probe is suitable for use in RPA reactions.

[0272] In any of the probes described and defined herein, when the signal enhancing molecule is an M13 polypeptide, the cleavage molecule is any molecule with phosphatase / exonuclease activity, preferably Escherichia coli exonuclease III, preferably having the amino acid sequence set forth in SEQ ID NO: 1, Neisseria gonorrhoeae exonuclease III, preferably having the amino acid sequence set forth in SEQ ID NO: 2, or tyrosyl-DNA phosphodiesterase 1 (TDP-1), preferably having the amino acid sequences set forth in SEQ ID NO: 3 and SEQ ID NO: 4. The probe is structured such that cleavage at the cleavage site depends on cleavage by the action of the phosphatase / exonuclease activity of the cleavage molecule and not on any apurinic / apyrimidinic (AP) endonuclease activity of the cleavage molecule.

[0273] Non-Limiting Exemplary Probe Embodiments The detection probe may be a probe as further described and defined herein, in which the polypeptide is an activator of an enzyme or an activator of an enzyme complex, and the detectable signal is produced in a reaction that is dependent on the polypeptide.

[0274] The detection probe may be a probe in which the polypeptide is an M13 polypeptide.

[0275] The detection probe can be a probe in which the polypeptide is an M13 polypeptide having any one of the amino acid sequences set forth in the table below.

[0276] [Table 10]

[0277] The table provides a list of M13 peptide amino acid sequences that can be used as signal promoting molecules. Preferably, a first linker is attached to the first amino acid residue of the sequence at the N-terminus of the polypeptide (underlined, typically (but not exclusively) through the addition of an azide to the N-terminus, i.e., azidoacetic acid coupling). If a second linker is used, the second linker is preferably attached to the second (underlined) amino acid residue of the sequence, in a C-terminally proximal orientation.

[0278] Preferably, the N-terminal amine of the peptide is reacted with azidoacetic acid to add an azide to the N-terminus. Alternative methods may include the reaction of a longer carbon chain or a PEG-based linker. A further alternative method may include the reaction of the N-terminus with bromo / iodoacetic acid to conjugate the peptide with oligo-SH.

[0279] The detection probe has the structure:

[0280] [ka] where * is the terminal phosphate group at the 3' end of the oligonucleotide and L is a linker. The probe may have the following structure:

[0281] Non-Limiting Exemplary Detection Embodiments The method for detecting a target nucleic acid sequence of interest in a test solution comprises: Aa RPA single-stranded DNA binding protein (SSB) molecule, b. cleavage molecule, c. Any one of the detection probes described in the "Non-Limiting Exemplary Probe Embodiments" section immediately above; and d. A sample suspected of containing a target nucleic acid sequence of interest providing a test solution comprising: Upon hybridization of one or two oligonucleotides of the Ba probe with the target nucleic acid sequence of interest, and b. When the cleavage molecule cleaves the probe at the cleavage site detecting a detectable signal produced by the signal enhancing molecule of the probe. The method may include:

[0282] The method includes the step of: the test solution is an RPA reaction mixture comprising RPA reaction components, in addition to the RPA-SSB, the RPA reaction components comprising: 1. Recombinase agents, 2. Recombinase loading protein, 3. Polymerase, and 4. Forward and Reverse Nucleic Acid Primers for Amplification It may include:

[0283] The method may be further defined by the present disclosure and description herein.

[0284] The method is one in which a detectable signal is produced in a reaction that depends on the activation of an enzyme or enzyme or enzyme complex by the probe polypeptide.

[0285] The method may be one in which a detectable signal is produced in a reaction that depends on the activation of an enzyme or enzyme complex by the M13 polypeptide of the probe.

[0286] The method comprises detecting a signal comprising: A. contacting the probe M13 polypeptide with SUMO1 / sentriin-specific peptidase 1 (SENP1) in the presence of a SUMO-alpha peptide fusion protein, whereby SENP1 catalyzes cleavage of the SUMO-alpha peptide fusion protein to release free beta-galactosidase alpha peptide; and B. Detecting the presence of free beta-galactosidase alpha peptide It may be produced in a reaction comprising:

[0287] In such methods, the step of detecting the presence of free alpha peptide comprises: 1) contacting the beta-galactosidase alpha peptide of the probe in solution with a beta-galactosidase omega fragment (omega peptide) to form a beta-galactosidase holoenzyme; and 2) To detect the presence of beta-galactosidase holoenzyme in solution. may include:

[0288] In any of these methods, the step of detecting the presence of beta-galactosidase holoenzyme in the solution may include a colorimetric assay, a fluorescent assay, a chemiluminescent assay, a bioluminescent assay, or an electrochemical assay.

[0289] In any of these methods, the step of detecting the presence of beta-galactosidase holoenzyme in solution may include any one of the colorimetric, fluorescent, chemiluminescent, bioluminescent, or electrochemical assays described above in the "Non-Limiting Exemplary Detection Embodiments" subsection of the "Components of Signal Promoter-Enzyme Complexes, Enzyme Domains, Enzyme Fragments, or Enzyme Cofactors" section.

[0290] Signal promoting molecules - small molecules that can promote the formation of molecular complexes, e.g., protein:protein complexes A signal enhancing molecule can be a small molecule that can enhance the formation of a complex between two or more additional molecules, for example, the formation of a protein:protein complex, including a dimeric protein:protein complex.

[0291] Non-limiting exemplary embodiments of such small molecules are everolimus and rapamycin, described below. Any other suitable alternative small molecule capable of promoting the formation of a complex between two or more additional molecules, for example, the formation of a protein:protein complex, including a dimeric protein:protein complex, can also be used simply by adapting the principles of the probe structures described herein, and it will be understood that the following discussion regarding everolimus and rapamycin applies mutatis mutandis to any other suitable alternative small molecule.

[0292] Everolimus and rapamycin Everolimus and rapamycin are inhibitors of mammalian target of rapamycin (mTOR) kinase. Everolimus is a derivative of rapamycin. Rapamycin and everolimus bind to FKBP12 (a 12 kDa FK 506-binding protein) and prevent mTOR from activating mTORC1.

[0293] Everolimus and rapamycin placement In such an inhibitory cleavage-dependent signaling system, the nucleotide position on the oligonucleotide to which everolimus and rapamycin are connected is not important, provided that at least one linker binding everolimus and rapamycin contains a cleavage site and the probe is capable of operating by the RPA-SSB-mediated inhibitory / agonistic mechanism described herein and is suitable for use in an RPA reaction.

[0294] A user can easily construct a probe such that at least one linker connecting everolimus and rapamycin to the oligonucleotide contains a cleavage site that is cleaved by the action of a cleavage molecule having phosphatase / exonuclease activity when the probe is in double-stranded form and hybridized to a target sequence of interest in a test solution containing RPA-SSB, and, in contrast, such that cleavage by the cleavage molecule does not occur when the probe is in single-stranded form and not hybridized to a target sequence of interest in a test solution containing RPA-SSB. These criteria can be easily tested empirically according to the methods described herein.

[0295] Preferably, everolimus and rapamycin are connected to oligonucleotide through at least one linker that is bonded to the terminal phosphate group at the 3' end of probe.Therefore, this linker comprises a cleavage site that comprises a terminal phosphate group, and cleavage is thereby caused by the action of a cleavage molecule that is any molecule that has phosphatase / exonuclease activity.Alternatively, everolimus and rapamycin can be connected to oligonucleotide through at least one linker that is bonded to another chemical group and / or at another nucleotide position of oligonucleotide, provided that the probe is structurally arranged so that cleavage at cleavage site is caused by the action of a cleavage molecule that is any molecule that has phosphatase / exonuclease activity, and the probe is suitable for use in RPA reaction.

[0296] In any of the probes described and defined herein, when the signal enhancing molecule is everolimus and rapamycin, the cleavage molecule is any molecule with phosphatase / exonuclease activity, preferably Escherichia coli exonuclease III, preferably having the amino acid sequence set forth in SEQ ID NO: 1, Neisseria gonorrhoeae exonuclease III, preferably having the amino acid sequence set forth in SEQ ID NO: 2, or tyrosyl-DNA phosphodiesterase 1 (TDP-1), preferably having the amino acid sequences set forth in SEQ ID NO: 3 and SEQ ID NO: 4. The probe is structured such that cleavage at the cleavage site depends on cleavage by the action of the phosphatase / exonuclease activity of the cleavage molecule and not on any apurinic / apyrimidinic (AP) endonuclease activity of the cleavage molecule.

[0297] Non-Limiting Exemplary Probe Embodiments The detection probe may be a probe as further described and defined herein in which the small molecule promotes the formation of a molecular complex, e.g., a protein:protein complex, and the detectable signal is produced in a reaction dependent on the formation of the molecular complex or protein:protein complex.

[0298] The detection probe is a small molecule having the structure:

[0299] [ka] The probe may be everolimus having the formula:

[0300] The detection probe has the structure:

[0301] [ka] where * is the terminal phosphate group at the 3' end of the oligonucleotide and L is a linker. The probe may have the following structure:

[0302] The detection probe is a small molecule having the structure:

[0303] [ka] The probe may be rapamycin having the formula:

[0304] The detection probe has the structure:

[0305] [ka] where * is the terminal phosphate group at the 3' end of the oligonucleotide and L is a linker. The probe may have the following structure:

[0306] Non-Limiting Exemplary Detection Embodiments The method for detecting a target nucleic acid sequence of interest in a test solution comprises: Aa RPA single-stranded DNA binding protein (SSB) molecule, b. cleavage molecule, c. Any one of the detection probes described in the "Non-Limiting Exemplary Probe Embodiments" section immediately above; and d. A sample suspected of containing a target nucleic acid sequence of interest providing a test solution comprising: Upon hybridization of one or two oligonucleotides of the Ba probe with the target nucleic acid sequence of interest, and b. When the cleavage molecule cleaves the probe at the cleavage site detecting a detectable signal produced by the signal enhancing molecule of the probe. The method may include:

[0307] The method includes the step of: the test solution is an RPA reaction mixture comprising RPA reaction components, in addition to the RPA-SSB, the RPA reaction components comprising: 1. Recombinase agents, 2. Recombinase loading protein, 3. Polymerase, and 4. Forward and Reverse Nucleic Acid Primers for Amplification It may include:

[0308] The method may be further defined by the present disclosure and description herein.

[0309] The method is one in which a detectable signal is produced in a reaction that depends on the formation of a molecular complex, eg, a protein:protein complex, mediated by the small molecule of the probe.

[0310] The method comprises: A. The probe is any one of the probes described above, the signal enhancing molecule is everolimus, and the detectable signal is produced in a reaction dependent on the formation of a protein:protein complex mediated by the everolimus small molecule of the probe; or B. The probe is any one of the probes described above, the signal enhancing molecule is rapamycin, and the detectable signal is produced in a reaction dependent on the formation of a protein:protein complex mediated by the rapamycin small molecule of the probe. It could be.

[0311] The method comprises detecting a detectable signal, A. Contacting the probe everolimus or rapamycin with FK506 binding protein (FKBP) and the FKBP-rapamycin binding (FRB) domain in solution, whereby everolimus or rapamycin induces dimerization of FKBP and FBR; and B. Detecting the presence of FKBP-FBR dimers in solution It may include:

[0312] The method further comprises detecting the presence of an FKBP-FBR dimer by: C. (in order from N-terminus to C-terminus): i. preferably an amino acid sequence

[0313] [ka] FKBP and ii. a first linker, preferably having the amino acid sequence GGSGGSGG (SEQ ID NO: 61), and iii. A C-terminal portion of nano-luc, preferably having the amino acid sequence VTGWRLCERILA (SEQ ID NO: 62), and iv. a second linker, preferably having the amino acid sequence GGSGSGSGSGGSGSGGS (SEQ ID NO: 63), and v. Preferably an amino acid sequence

[0314] [ka] the remaining (N-terminal) portion of nano-luc, and vi. a third linker, preferably having the amino acid sequence SGSGSGG (SEQ ID NO: 65), and vii. Preferably, the amino acid sequence

[0315] [ka] FBR a circularly permuted nano-luc fusion protein comprising: Optionally, the fusion protein has an affinity tag at the N-terminus of the protein before the FKBP sequence, preferably a 6-histidine tag immediately preceding the FKBP sequence; Nano-luc is an ATP-independent, 19.1 kDa catalytically active subunit of luciferase from the giant shrimp Oplophorus gracilirostris. D. Contacting the probe everolimus or rapamycin with the fusion protein in the presence of 2-furanylmethyl-deoxy-coelenterazine (furimazine) or 6-(4-hydroxyphenyl)-2-[(4-hydroxyphenyl)methyl]-8-(phenylmethyl)-7H-imidazo[1,2-a]pyrazin-3-one (coelenterazine); and E. Detecting light emission (luminescence), optionally by measuring emission at 460 nm It may include:

[0316] The amino acid sequence of an exemplary full-length circularly permuted nano-luc fusion protein is shown below (SEQ ID NO: 67).

[0317] [ka] Signal enhancer molecules - small molecules that enhance the activation of an enzyme or enzyme complex A signal enhancing molecule can be a small molecule that enhances the activation of an enzyme or enzyme complex.

[0318] A non-limiting exemplary embodiment of such a small molecule is methotrexate, described below. Any other suitable alternative small molecule that promotes the activation of an enzyme or enzyme complex can also be used, simply by adapting the principles of the probe structures described herein, and it will be understood that the following discussion of methotrexate applies mutatis mutandis to any other suitable alternative small molecule.

[0319] Methotrexate Methotrexate is a small molecule drug commonly used in chemotherapy and as an immune system suppressant.

[0320] Methotrexate placement In such an inhibitory cleavage-dependent signaling system, the nucleotide position on the oligonucleotide to which methotrexate is attached is not important, provided that at least one linker attached to methotrexate contains a cleavage site and the probe is capable of operating by the RPA-SSB-mediated inhibitory / agonistic mechanism described herein and is suitable for use in an RPA reaction.

[0321] A user can easily construct a probe such that at least one linker connecting methotrexate to the oligonucleotide contains a cleavage site that is cleaved by the action of a cleavage molecule having phosphatase / exonuclease activity when the probe is in double-stranded form and hybridized to a target sequence of interest in a test solution containing RPA-SSB, and, in contrast, such that cleavage by the cleavage molecule does not occur when the probe is in single-stranded form and not hybridized to a target sequence of interest in a test solution containing RPA-SSB. These criteria can be easily tested empirically according to the methods described herein.

[0322] Preferably, methotrexate is connected to oligonucleotide through at least one linker that is bonded to the terminal phosphate group at the 3' end of probe.Therefore, this linker comprises a cleavage site that comprises a terminal phosphate group, and cleavage is thereby caused by the action of the cleavage molecule, which is any molecule that has phosphatase / exonuclease activity.Alternatively, methotrexate can be connected to oligonucleotide through at least one linker that is bonded to another chemical group and / or at another nucleotide position of oligonucleotide, provided that the probe is structurally arranged so that the cleavage at cleavage site is caused by the action of the cleavage molecule, which is any molecule that has phosphatase / exonuclease activity, and the probe is suitable for use in RPA reaction.

[0323] In any of the probes described and defined herein, when the signal enhancing molecule is methotrexate, the cleavage molecule is any molecule with phosphatase / exonuclease activity, preferably Escherichia coli exonuclease III, preferably having the amino acid sequence set forth in SEQ ID NO: 1, Neisseria gonorrhoeae exonuclease III, preferably having the amino acid sequence set forth in SEQ ID NO: 2, or tyrosyl-DNA phosphodiesterase 1 (TDP-1), preferably having the amino acid sequences set forth in SEQ ID NO: 3 and SEQ ID NO: 4. The probe is structured such that cleavage at the cleavage site depends on cleavage by the action of the phosphatase / exonuclease activity of the cleavage molecule and not on any apurinic / apyrimidinic (AP) endonuclease activity of the cleavage molecule.

[0324] Non-Limiting Exemplary Probe Embodiments The detection probe can be any one of the probes further described and defined herein in which a small molecule promotes the activation of an enzyme or enzyme complex and a detectable signal is produced in a reaction that is dependent on the activation of the enzyme or enzyme complex.

[0325] The detection probe is a signal enhancing molecule having the structure:

[0326] [ka] The probe may be any one of the probes further described and defined herein, wherein the probe is methotrexate having the formula:

[0327] The detection probe has the structure:

[0328] [ka] where * is the terminal phosphate group at the 3' end of the oligonucleotide and L is a linker. The probe may have the following structure:

[0329] Non-Limiting Exemplary Detection Embodiments The method for detecting a target nucleic acid sequence of interest in a test solution comprises: Aa RPA single-stranded DNA binding protein (SSB) molecule, b. cleavage molecule, c. Any one of the detection probes described in the "Non-Limiting Exemplary Probe Embodiments" section immediately above; and d. A sample suspected of containing a target nucleic acid sequence of interest providing a test solution comprising: Upon hybridization of one or two oligonucleotides of the Ba probe with the target nucleic acid sequence of interest, and b. When the cleavage molecule cleaves the probe at the cleavage site detecting a detectable signal produced by the signal enhancing molecule of the probe. The method may include:

[0330] The method includes the step of: the test solution is an RPA reaction mixture comprising RPA reaction components, in addition to the RPA-SSB, the RPA reaction components comprising: 1. Recombinase agents, 2. Recombinase loading protein, 3. Polymerase, and 4. Forward and Reverse Nucleic Acid Primers for Amplification It may include:

[0331] The method may be further defined by the present disclosure and description herein.

[0332] The method is one in which a detectable signal is produced in a reaction that depends on the activation of an enzyme or enzyme complex mediated by the small molecule of the probe.

[0333] The method is one in which a detectable signal is produced in a reaction that depends on the activation of an enzyme or enzyme complex mediated by the probe methotrexate small molecule.

[0334] The method comprises detecting a detectable signal, A. contacting the probe methotrexate (MTX) with a binding partner to form a protein binding partner:MTX complex; and B. Detecting the presence of the complex It may include:

[0335] The method comprises detecting a detectable signal, C. Contacting the probe MTX with a fusion protein containing glucose dehydrogenase (GDH) and a calmodulin domain (CaM-GDH) together with a protein binding partner (CaM-GDH-protein binding partner); D. Measuring GDH activity It may include:

[0336] Such a method is A. The methotrexate:protein binding partner complex comprises a dihydrofolate reductase:MTX complex, and the step of detecting the complex comprises contacting cleaved MTX with a CaM-GDH-dihydrofolate reductase fusion protein and measuring GDH activity; B. The methotrexate:protein binding partner complex comprises a thymidylate synthase:MTX complex, and detecting the complex comprises contacting cleaved MTX with a CaM-GDH-thymidylate synthase fusion protein and measuring GDH activity; or C. The methotrexate:protein binding partner complex comprises an anti-methotrexate VHH antibody:MTX complex, and detecting the complex comprises contacting cleaved MTX with a CaM-GDH-anti-methotrexate VHH antibody fusion protein and measuring GDH activity, optionally wherein GDH activity is measured by a colorimetric or electrochemical assay. It could be.

[0337] Signal enhancer molecules - small molecules that are cofactors for enzymes or enzyme complexes The signal enhancing molecule can be a small molecule that is a cofactor for an enzyme or enzyme complex.

[0338] A non-limiting exemplary embodiment of such a small molecule is hemin, described below. Any other suitable alternative small molecule that is a cofactor for an enzyme or enzyme complex, including any suitable substituted hemin, can also be used by simply adapting the principles of the probe structures described herein, and it will be understood that the following discussion regarding hemin applies mutatis mutandis to any other suitable alternative small molecule.

[0339] Hyemin Hemin is a cofactor for horseradish peroxidase (HRP). When hemin forms a complex with the HRP apoenzyme, an HRP holoenzyme is produced. The HRP holoenzyme is the active form of the HRP enzyme. The HRP apoenzyme is inactive. Substituted hemins that act as cofactors for HRP have also been described.

[0340] Hemin placement In such inhibitory cleavage-dependent signaling systems, the nucleotide position on the oligonucleotide to which hemin is attached is not important, provided that at least one linker that binds to hemin contains a cleavage site and the probe is capable of operating by the RPA-SSB-mediated inhibitory / agonistic mechanism described herein and is suitable for use in an RPA reaction.

[0341] A user can readily construct a probe such that at least one linker connecting hemin to the oligonucleotide contains a cleavage site that is cleaved by the action of a cleavage molecule having phosphatase / exonuclease activity when the probe is in double-stranded form and hybridized to a target sequence of interest in a test solution containing RPA-SSB, and, in contrast, such that cleavage by the cleavage molecule does not occur when the probe is in single-stranded form and not hybridized to a target sequence of interest in a test solution containing RPA-SSB. These criteria can be readily tested empirically according to the methods described herein.

[0342] Preferably, hemin is connected to the oligonucleotide via at least one linker bound to the terminal phosphate group at the 3' end of the probe. Thus, the linker comprises a cleavage site containing a terminal phosphate group, whereby cleavage is effected by the action of a cleavage molecule, which may be any molecule with phosphatase / exonuclease activity. Alternatively, hemin may be connected to the oligonucleotide via at least one linker bound to another chemical group and / or at another nucleotide position of the oligonucleotide, provided that the probe is structurally arranged so that cleavage at the cleavage site is effected by the action of a cleavage molecule, which may be any molecule with phosphatase / exonuclease activity, and the probe is suitable for use in an RPA reaction.

[0343] In any of the probes described and defined herein, when the signal enhancing molecule is hemin, the cleavage molecule is any molecule with phosphatase / exonuclease activity, preferably Escherichia coli exonuclease III, preferably having the amino acid sequence set forth in SEQ ID NO: 1, Neisseria gonorrhoeae exonuclease III, preferably having the amino acid sequence set forth in SEQ ID NO: 2, or tyrosyl-DNA phosphodiesterase 1 (TDP-1), preferably having the amino acid sequences set forth in SEQ ID NO: 3 and SEQ ID NO: 4. The probe is structured such that cleavage at the cleavage site depends on cleavage by the action of the phosphatase / exonuclease activity of the cleavage molecule and not on any apurinic / apyrimidinic (AP) endonuclease activity of the cleavage molecule.

[0344] Non-Limiting Exemplary Probe Embodiments The detection probe can be any one of the probes further described and defined herein in which the small molecule is a cofactor for an enzyme or enzyme complex and the detectable signal is produced in a reaction that depends on the activation of the enzyme or enzyme complex.

[0345] Such detection probes may be used where the signal enhancing molecule has the structure:

[0346] [ka] The probe may be hemin having the formula:

[0347] Such a detection probe has the structure:

[0348] [ka] where * is the terminal phosphate group at the 3' end of the oligonucleotide and L is a linker. The probe may have the following structure:

[0349] Non-Limiting Exemplary Detection Embodiments The method for detecting a target nucleic acid sequence of interest in a test solution comprises: Aa RPA single-stranded DNA binding protein (SSB) molecule, b. cleavage molecule, c. Any one of the detection probes described in the "Non-Limiting Exemplary Probe Embodiments" section immediately above; and d. A sample suspected of containing a target nucleic acid sequence of interest providing a test solution comprising: Upon hybridization of one or two oligonucleotides of the Ba probe with the target nucleic acid sequence of interest, and b. When the cleavage molecule cleaves the probe at the cleavage site detecting a detectable signal produced by the signal enhancing molecule of the probe. The method may include:

[0350] The method includes the step of: the test solution is an RPA reaction mixture comprising RPA reaction components, in addition to the RPA-SSB, the RPA reaction components comprising: 1. Recombinase agents, 2. Recombinase loading protein, 3. Polymerase, and 4. Forward and Reverse Nucleic Acid Primers for Amplification It may include:

[0351] The method may be further defined by the present disclosure and description herein.

[0352] The method can be one in which the detectable signal is produced in a reaction that depends on conversion of an apoenzyme or apoenzyme complex to a holoenzyme or holoenzyme complex mediated by a small molecule cofactor of the probe.

[0353] Such methods may be those in which a detectable signal is produced in a reaction that depends on the conversion of an apoenzyme or apoenzyme complex to a holoenzyme or holoenzyme complex mediated by the hemin small molecule of the probe.

[0354] In any such method, the detectable signal is A. contacting the probe hemin with horseradish peroxidase (HRP) apoenzyme in solution, thereby forming HRP holoenzyme; B. Detecting the activity of HRP holoenzyme in the solution; It can be produced in a method comprising:

[0355] In any such method, the step of detecting the activity of the HRP holoenzyme in the solution may include reacting the HRP holoenzyme in the solution with an oxidase and a substrate for the oxidase, and detecting the presence of a product produced by the reaction.

[0356] In any such method, the step of detecting the activity of HRP holoenzyme in the solution comprises: A. (i) HRP holoenzyme in solution a) glucose, e.g., β-d-glucose, glucose oxidase, p-hydroxybenzoic acid, and 4-aminoantipyrine, or b) p-hydroxybenzoic acid, 4-aminoantipyrine, and H2O2 reacting with, thereby forming a chromophore reaction product; and (ii) detecting the presence of the chromophore reaction product, optionally by measuring the absorbance of the solution at 504 nm; or B. (i) HRP holoenzyme in solution a) glucose, e.g., β-d-glucose, glucose oxidase, and 3,3',5,5'-tetramethybenzidine (TMB), or b) 3,3',5,5'-tetramethybenzidine (TMB) and H2O2 reacting with, thereby forming a chromophore reaction product; and (ii) detecting the presence of the chromophore reaction product, optionally by measuring the absorbance of the solution at 450 nm or 650 nm; or C. (i) HRP holoenzyme in solution a) glucose, e.g., β-d-glucose, glucose oxidase, and 2,2'-azino-di-(3-ethylbenzthiazoline sulfonic acid) (ABTS), or b) 2,2'-azino-di-(3-ethylbenzthiazoline sulfonic acid) (ABTS) and H2O2 reacting with, thereby forming a chromophore reaction product; and (ii) detecting the presence of the chromophore reaction product, optionally by measuring the absorbance of the solution at 405 nm; may include:

[0357] Arrangement of signal-promoting molecules As noted elsewhere herein, in any of the inhibitory cleavage-dependent signaling systems described and defined herein, the nucleotide position on the oligonucleotide to which the signal facilitator molecule is attached is not important, provided that at least one linker attached to the signal facilitator molecule contains a cleavage site and the probe is capable of operating by the RPA-SSB-mediated inhibitory / agonistic mechanism of action described herein and is suitable for use in an RPA reaction.

[0358] Thus, in the probes of the present invention, the signal-promoting molecule is connected to the oligonucleotide via at least one linker, which is attached to a chemical group on the oligonucleotide, thereby defining a cleavage site on the oligonucleotide that is susceptible to cleavage mediated by phosphatase or exonuclease activity when contacted with a cleavage molecule having phosphatase or exonuclease activity. In contrast, in the probes of the present invention, the signal-promoting molecule is connected to the oligonucleotide via at least one linker, which is attached to a chemical group on the oligonucleotide, thereby defining a cleavage site on the oligonucleotide that is not susceptible to cleavage mediated by apurinic / apyrimidinic (AP) endonuclease activity when contacted with a cleavage molecule having apurinic / apyrimidinic (AP) endonuclease activity.

[0359] Preferably, at least one linker defining a cleavage site and connecting the signal promotion molecule to the oligonucleotide of the probe is attached to the terminal phosphate group at the 3' end of the signal promotion molecule and the oligonucleotide, such that the terminal phosphate group at the 3' end of the probe comprises the cleavage site, and this terminal phosphate group is cleaved by the cleavage molecule due to the phosphatase activity of the cleavage molecule.

[0360] Alternatively, at least one linker that defines a cleavage site and connects the signal promoter molecule to the oligonucleotide of the probe is attached to the oligonucleotide at a position other than the terminal phosphate group at the 3' end of the signal promoter molecule and the probe. Thus, the terminal phosphate group at the 3' end of the probe does not include the cleavage site containing the linker. In such an alternative probe structure, the terminal phosphate group at the 3' end of the probe is susceptible to initial cleavage by the cleavage molecule due to the phosphatase activity of the cleavage molecule. Subsequently, the cleavage molecule cleaves at the cleavage site containing the linker due to the exonuclease activity of the cleavage molecule.

[0361] In probes in which the signal promotion molecule is connected to the oligonucleotide by only a single linker, the linker can be attached to any nucleotide position on the oligonucleotide, provided that the probe is structured to operate in the manner described above. Preferably, the linker connecting the signal promotion molecule to the oligonucleotide of the probe is attached to the terminal phosphate group at the 3' end of the signal promotion molecule and the oligonucleotide.

[0362] In probes in which the signal enhancing molecule is connected to the oligonucleotide by two linkers, the probe can be structured as described below.

[0363] The probe comprises: (i) a first linker attached to a chemical group at a first position on the signal promotion molecule and at nucleotide position n of the oligonucleotide; (ii) a second linker attached to a chemical group at a second position on the signal promotion molecule and at nucleotide position n+x of the oligonucleotide; A. The chemical group on the oligonucleotide to which the first linker is attached contains a cleavage site, preferably a phosphate group; B. When the probe is present in the test solution, upon hybridization of the oligonucleotide with the target sequence in the presence of a cleaving molecule having phosphatase or exonuclease activity, the cleaving molecule cleaves at the cleavage site, thereby generating a detectable signal; The terminal nucleotide position at the 3' end of the oligonucleotide is defined as position n, and the nucleotide position subsequent to position n in the direction proximal to the 5' end of the oligonucleotide is defined as n+x, where x is an integer greater than or equal to 0. It could be.

[0364] The probe comprises: (i) a first linker attached to a chemical group at a first position on the signal promotion molecule and at nucleotide position n+x of the oligonucleotide; (ii) a second linker attached to a chemical group at a second position on the signal promotion molecule and at nucleotide position n+x+y of the oligonucleotide; A. The chemical group to which the first linker is attached comprises a cleavage site; B. When the probe is present in the test solution, upon hybridization of the oligonucleotide with the target sequence in the presence of a cleaving molecule having phosphatase activity, the cleaving molecule cleaves at the cleavage site, thereby generating a detectable signal; The terminal nucleotide position at the 3' end of the oligonucleotide is defined as position n, and subsequent nucleotide positions relative to position n in the direction proximal to the 5' end of the oligonucleotide are defined as n+x and n+x+y, where x is an integer of 1 or greater and y is an integer of 0 or greater. It could be.

[0365] In probes in which the signal enhancing molecule is connected to the oligonucleotide by two linkers, the probe can alternatively be structured as described below.

[0366] The probe comprises: (i) a first linker attached to a chemical group at a first position on the signal promotion molecule and at nucleotide position n of the oligonucleotide; (ii) a second linker attached to a chemical group at a second position on the signal promotion molecule and at nucleotide position n+x of the oligonucleotide; A. The chemical group on the oligonucleotide to which L1 is attached contains a cleavage site, optionally a phosphate group; B. When the probe is present in the test solution, upon hybridization of the oligonucleotide with the target sequence in the presence of a cleaving molecule having phosphatase or exonuclease activity, the cleaving molecule cleaves at the cleavage site, thereby generating a detectable signal; The terminal nucleotide position at the 5' end of the oligonucleotide is defined as position n, and the nucleotide position subsequent to position n in the direction proximal to the 3' end of the oligonucleotide is defined as n+x, where x is an integer greater than or equal to 0. It could be.

[0367] The probe comprises: (i) a first linker (L1) attached to a chemical group at a first position on the signal promotion molecule and at nucleotide position n+x of the oligonucleotide; (ii) a second linker (L2) attached to a chemical group at a second position on the signal promotion molecule and at nucleotide position n+x+y of the oligonucleotide; A. The chemical group to which L1 is attached contains a cleavage site; B. When the probe is present in the test solution, upon hybridization of the oligonucleotide with the target sequence in the presence of a cleaving molecule having phosphatase activity, the cleaving molecule cleaves at the cleavage site, thereby generating a detectable signal; The terminal nucleotide position at the 5' end of the oligonucleotide is defined as position n, and the nucleotide positions subsequent to position n in the direction proximal to the 3' end of the oligonucleotide are defined as n+x and n+x+y, where x is an integer of 1 or greater and y is an integer of 0 or greater. It could be.

[0368] Recombinase polymerase amplification (RPA) Recombinase polymerase amplification (RPA) is a method for isothermal amplification of nucleic acids. Generally, in the first step of RPA, a recombinase agent is contacted with a first and second nucleic acid primer and a recombinase loading protein to form a first and second nucleoprotein primer. Generally, in the second step, the first and second nucleoprotein primers are contacted with a double-stranded template nucleic acid so that the 3' ends of the first and second nucleic acid primers are oriented toward each other on a given nucleic acid molecule, forming a first double-stranded structure in a first portion of the first strand of the template nucleic acid and a second double-stranded structure in a second portion of the second strand of the template nucleic acid. Generally, in the third step, the 3' ends of the first and second nucleoprotein primers are extended by a polymerase to generate a first and second double-stranded nucleic acid and a first and second displaced single strand of the nucleic acid. A single-strand stabilizing agent is utilized to stabilize the first and second displaced single strands of the nucleic acid. Generally, the second and third steps can be repeated until the desired degree of amplification is reached.

[0369] RPA methods are widely disclosed in, for example, U.S. Patent No. 7,270,981, U.S. Patent No. 7,399,590, U.S. Patent No. 7,666,598, U.S. Patent No. 7,435,561, and International Patent Application Publication No. 2010 / 141940. In addition, for a comprehensive recent discussion, see: Review: a comprehensive summary of a decade development of the recombinase polymerase amplification, Li, J. et al., 2019, Analyst, 144, pp. 31-67).

[0370] As described below, certain RPA components can be linked / tagged to one or more IDR-polypeptides. The IDR-polypeptides contain intrinsically disordered regions. Suitable IDR-polypeptides for use in RPA reactions are broadly described in International Patent Application Publication No. WO 2021 / 094746.

[0371] Recombinase agents The RPA method uses a recombinase agent.

[0372] Any IDR-polypeptide can be bound / linked / tagged to any recombinase agent.

[0373] Recombinase agents are molecules, typically enzymes, that can coat single-stranded nucleic acids, typically DNA (ssDNA), to form nucleoprotein filaments. Such filaments can then "scan" double-stranded nucleic acid molecules, typically DNA (dsDNA), for regions of sequence homology / complementarity. When a complementary sequence is located, the strand of the nucleoprotein filament (including the recombinase agent) invades the double-stranded nucleic acid molecule, creating a short hybrid and a displaced strand bubble known as a D-loop.

[0374] Any suitable recombinase agent can be used in the RPA methods described herein and can be tagged with any suitable IDR amino acid sequence.

[0375] The recombinase agent may originate from a prokaryotic, eukaryotic, or viral organism.

[0376] The recombinase agent can be RecA, UvsX, RadA, RadB, Rad 51, or any functional variant, analog, homolog, or derivative of any of these proteins.

[0377] Any combination of these proteins may be used.

[0378] Suitable recombinase agents include the E. coli RecA protein, the T4 UvsX protein, or any homologous protein or protein complex from any phylum.

[0379] Eukaryotic RecA homologs are generally referred to as Rad51, after the first member of this group to be identified. Other heterologous recombinase agents, such as RecT or RecO, may be utilized in place of RecA.

[0380] Exemplary recombinase agents include RecA and UvsX, as well as fragments or mutants thereof, and combinations thereof.RecA and UvsX proteins can be obtained from any species.RecA and UvsX fragment or mutant proteins can also be produced using available RecA and UvsS proteins and nucleic acid sequences and molecular biology techniques. Exemplary UvsX proteins include those from myoviridae phages, such as T4, T2, T6, Rb69, Aeh1, KVP40, Acinetobacter phage 133, Aeromonas phage 65, cyanophage P-SSM2, cyanophage PSSM4, cyanophage S-PM2, Rb14, Rb32, Aeromonas phage 25, Vibrio phage nt-1, phi-1, Rb16, Rb43, phage 31, phage 44RR2.81, Rb49, phage Rb3, and phage LZ2. Additional exemplary recombinase agents include archaeal RADA and RADB proteins, and eukaryotic (e.g., plant, mammalian, and fungal) Rad51 proteins (e.g., RAD51, RAD51B, RAD51C, RAD51D, DMC1, XRCC2, XRCC3, and recA).

[0381] The recombinase agent is preferably UvsX, T4 UvsX, T6 UvsX, RB18 UvsX, E. coli phage wV7 UvsX, Shigella phage CB8 UvsX, Shigella phage Shfl2 UvsX, E. coli phage AR1 UvsX, phage vB_EcoM_G4507 UvsX, Shigella phage SHFML-11 UvsX, Escherichia phage vB_EcoM_DalCa UvsX, E. coli RecA, E. coli RadA, E. coli RadB, E. coli Rad 51, or any functional variant, analog, homolog, or derivative thereof, or any combination thereof. A particularly preferred recombinase agent is Escherichia phage vB_EcoM_DalCa UvsX.

[0382] The recombinase agent may also include a C-terminal deletion of acidic residues to improve its activity.

[0383] Any functional variants, analogs, homologs, or derivatives of the above recombinase agents may also function as recombinases themselves, and these functional variants, analogs, homologs, or derivatives are also contemplated as recombinase agents to be used in the processes described and defined herein.

[0384] For example, a small peptide derived from RecA has been shown to retain some aspects of the recombination properties of RecA: this peptide, which contains residues 193-212 of E. coli RecA, can mediate the pairing of single-stranded oligonucleotides.

[0385] The recombinase agent (e.g., UvsX) can be a mutant or hybrid recombinase agent. Mutant forms of UvsX are described in U.S. Patent No. 8,071,308. The mutant UvsX can be an Rb69 UvsX containing at least one mutation in the Rb69 UvsX amino acid sequence, where the mutation is selected from the group consisting of: (a) an amino acid other than histidine at position 64, a serine at position 64, the addition of one or more glutamic acid residues at the C-terminus, the addition of one or more aspartic acid residues at the C-terminus, and any combination thereof.

[0386] The mutant UvsX can be a T6 UvsX having at least one mutation in the T6 UvsX amino acid sequence, where the mutation is selected from the group consisting of: (a) an amino acid other than histidine at position 66, (b) a serine at position 66, (c) the addition of one or more glutamic acid residues at the C-terminus, (d) the addition of one or more aspartic acid residues at the C-terminus, and (e) any combination thereof. When a hybrid recombinase agent is used, the hybrid protein can be, for example, a UvsX protein containing at least one region comprising an amino acid sequence from a different UvsX species. The region can be, for example, the DNA-binding loop-2 region of UvsX.

[0387] If desired, the recombinase agent can be a temperature-sensitive (herein referred to as "ts") recombinase agent. When a ts recombinase agent is used, the RPA reaction can be initiated at one temperature (the permissive temperature) and terminated at another temperature (the non-permissive temperature). Permissive temperature combinations can be, for example, 25°C / 30°C, 30°C / 37°C, 37°C / 42°C, etc. The ts protein can be reversible. The activity of a reversible ts protein is restored upon a shift from the non-permissive temperature to the permissive temperature.

[0388] Any recombinase agent concentration can be used, but preferred recombinase concentrations can be, for example, within the ranges of 0.2 to 12 μM, 6 to 12 μM, 4 to 12 μM, and 4 to 6 μM, preferably about 5 μM, and more preferably about 4.8 μM.

[0389] Recombinase agents generally require the presence of ATP, ATPγS, or other nucleoside triphosphates or their analogs. Recombinase agents are preferably used in a reaction environment in which regeneration of the targeting site can occur immediately after a single round of synthesis stimulated by the D-loop. Completion of the recombination event, including recombinase disassembly, would avoid amplification stalls or highly inefficient linear amplification of ssDNA caused by alternating unidirectional synthesis from one end to the other.

[0390] Exemplary UvsX recombinase agents tagged with amino acid tag sequences containing intrinsically disordered regions (IDRs) are set forth in the table below.

[0391] [Table 11-1]

[0392] [Table 11-2]

[0393] [Table 11-3]

[0394] [Table 11-4]

[0395] [Table 11-5]

[0396] [Table 11-6]

[0397] [Table 11-7]

[0398] Recombinase Loading Protein The RPA method may further comprise / use a recombinase loading protein.

[0399] Any suitable recombinase loading protein can be used in the RPA methods described herein.

[0400] Recombinase loading proteins can be of prokaryotic, viral, or eukaryotic origin. Exemplary recombinase loading proteins include E. coli RecO, E. coli RecR, UvsY, and mutants or fragments thereof, or combinations thereof. Exemplary UvsY proteins include those from myoviridae phages, such as T4, T2, T6, Rb69, Aeh1, KVP40, Acinetobacter phage 133, Aeromonas phage 65, cyanophage P-SSM2, cyanophage PSSM4, cyanophage S-PM2, Rb14, Rb32, Aeromonas phage 25, Vibrio phage nt-1, phi-1, Rb16, Rb43, phage 31, phage 44RR2.8t, Rb49, phage Rb3, and phage LZ2.

[0401] A preferred recombinase loading protein is UvsY, E. coli RecO, E. coli RecR, or any functional variant, analog, homolog, or derivative of any of these proteins. A particularly preferred UvsY recombinase loading protein is Escherichia phage STO UvsY.

[0402] Any combination of any of these proteins can be used.

[0403] Preferred concentrations of these proteins are between 0.1-24 μM, 6-24 μM, 4-24 μM, and 4-12 μM, preferably about 10 μM, more preferably about 8.6 μM. The recombinase loading protein may be present at between about 0.5 and about 2 times the micromolar concentration of the recombinase agent.

[0404] Exemplary UvsY recombinase loading proteins tagged with amino acid tag sequences containing intrinsically disordered regions are listed in the table below.

[0405] [Table 12]

[0406] Single-stranded stabilizers The RPA method uses single-stranded stabilizing agents.

[0407] Any suitable single-stranded stabilizing agent (single-stranded DNA binding protein) can be used.

[0408] Optionally, any suitable IDR-polypeptide may be bound / linked / tagged to any single-stranded stabilizer.

[0409] Single-stranded stabilizing agents are used to stabilize nucleic acids during the various exchange reactions that occur during the RPA reaction. Specifically, single-stranded stabilizing agents are used to stabilize the recombinase / ssDNA nucleoprotein filament.

[0410] Single-stranded stabilizers can be derived or obtained from any species, eg, prokaryotic, viral, or eukaryotic species.

[0411] Single-stranded stabilizers include single-stranded DNA binding proteins from E. coli and those derived from myoviridae phages, such as T4, T2, T6, Rb69, Aeh1, KVP40, Acinetobacter phage 133, Aeromonas phage 65, cyanophage P-SSM2, cyanophage PSSM4, cyanophage S-PM2, Rb14, Rb32, Aeromonas phage 25, Vibrio phage nt-1, phi-1, Rb16, Rb43, phage 31, phage 44RR2.81, Rb49, phage Rb3, and phage LZ2. Additional examples of single-stranded stabilizers include A. denitrificans Alide_2047, Burkholderia thailandensis BthaB_33951, Prevotella pollens HMPREF9144_0124, and the eukaryotic single-stranded DNA binding protein replication protein A.

[0412] Preferred single-stranded stabilizers are selected from the group consisting of Gp32, E. coli SSB protein, phage T4 Gp32 protein, phage Rb69 Gp32, phage vB_EcoM_NBG1 Gp32, and derivatives thereof and any combination thereof. A particularly preferred single-stranded stabilizer is Gp32, and in particular phage vB_EcoM_NBG1 Gp32.

[0413] Any combination of any of these proteins can be used.

[0414] One preferred concentration of the single-stranded stabilizer is between about 5 and 30 μM, for example, about 8.6 μM, preferably between about 15 and 25 μM, more preferably about 20 μM.

[0415] Exemplary Gp32 single-stranded stabilizers tagged with amino acid tag sequences containing intrinsically disordered regions are listed in the table below.

[0416] [Table 13-1]

[0417] [Table 13-2]

[0418] [Table 13-3]

[0419] [Table 13-4]

[0420] [Table 13-5]

[0421] [Table 13-6]

[0422] [Table 13-7]

[0423] [Table 13-8]

[0424] [Table 13-9]

[0425] [Table 13-10]

[0426] polymerase The RPA method uses a polymerase.

[0427] Any suitable polymerase can be used.

[0428] Optionally, any suitable IDR-polypeptide may be bound / linked / tagged to any suitable polymerase.

[0429] For DNA synthesis or amplification, a DNA polymerase is preferably used.

[0430] One advantage of RPA reactions is that there are no limitations on the type of polymerase that can be used: eukaryotic, prokaryotic, and bacteriophage polymerases can be used.

[0431] The DNA polymerase may be a eukaryotic polymerase. Examples of eukaryotic polymerases that can be used include pol-α, pol-β, pol-δ, pol-ε, or any functional variant, analog, homolog, or derivative thereof, and any combination thereof.

[0432] The DNA polymerase may be a prokaryotic polymerase. Examples of prokaryotic polymerases that can be used include E. coli DNA polymerase I Klenow fragment, E. coli DNA polymerase I, E. coli DNA polymerase II, E. coli DNA polymerase III, E. coli DNA polymerase IV, E. coli DNA polymerase V, Bacillus stearothennophilus polymerase I large fragment, Bacillus subtilis Pol I large fragment (Bsu polymerase), Listeria monocytogenes DNA polymerase I, Staphylococcus aureus DNA polymerase 1 (Sau), or any functional variant, analog, homolog, or derivative thereof, and any combination thereof.

[0433] The DNA polymerase may be a bacteriophage polymerase. Examples of bacteriophage polymerases that can be used in the methods described herein include Phi-29 DNA polymerase, T7 DNA polymerase, bacteriophage T4 gp43 DNA polymerase, or any functional variant, analog, homolog, or derivative thereof, and any combination thereof.

[0434] DNA polymerases typically contain strand-displacing properties.

[0435] DNA polymerases can use the free 3'-hydroxyl of the invading strand to catalyze DNA synthesis by incorporating new nucleotides. Some polymerases can use the 3'-hydroxyl of the invading strand to catalyze synthesis, simultaneously displacing the other strand as synthesis occurs. For example, E. coli polymerase II or III can be used to extend the invaded D-loop. In addition, E. coli polymerase V, which is commonly used in SOS-lesion-targeted mutagenesis in E. coli, can be used. All of these polymerases can be highly processive through their interaction with the β-dimer clamp and the coordinated action of single-stranded DNA binding proteins (SSBs) and other components. Other polymerases from prokaryotes, viruses, and eukaryotes can also be used to extend the invading strand.

[0436] Many DNA polymerases have 3'-5' exonuclease activity, and some also have 5'-3' exonuclease activity, which is undesirable in RPA reactions because it results in processive digestion rather than displacement of one DNA strand as the polymerase proceeds in the forward direction.

[0437] 3'-5' exonucleases have potential advantages as well as obvious disadvantages. On the one hand, 3'-5' exonuclease activity can increase the fidelity of the replication reaction and prevent polymerase stalling at misincorporation points. High-fidelity amplification is desirable in many DNA applications. 3'-5' exonuclease activity may also be suitable for amplifying larger DNA fragments, where stalling due to misincorporation can inhibit effective amplification.

[0438] Despite these clear advantages of 3'-5' exonuclease activity, some drawbacks exist: Free oligonucleotides can be subject to end-dependent degradation when polymerases with 3'-5' exonuclease activity are utilized.

[0439] Reaction noise can be reduced by using a polymerase lacking 3'-5' exonuclease activity. This suggests that oligonucleotides shortened by the 3'-5' exonuclease activity of the polymerase may be generated by mispriming. As a result, 3'-5' exonuclease editing activity, pyrophosphorylysis, or any other similar editing activity may be a source of noise. This can be suppressed to a large extent by using saturating amounts of the relatively cooperative Gp32 protein with some polymerases, such as the Klenow fragment. In any case, polymerases lacking 3'-5' exonuclease activity may be provided for use in the methods described herein.

[0440] The DNA polymerase may be present at a concentration between 10,000 units / ml and 10 units / ml, for example, between 5000 units / ml and 500 units / ml.

[0441] adjuvants The RPA reaction may further utilize auxiliary agents.

[0442] Optionally, any IDR-polypeptide may be bound / linked / tagged to any auxiliary agent.

[0443] These auxiliary agents include single-stranded binding proteins, helicases, topoisomerases, resolvases, and any combination thereof. Such agents can have unwinding, relaxing, and resolving activities, respectively, on nucleic acids.

[0444] The auxiliary components can also include RuvA, RuvB, RuvC, RecG, PriA, PriB, PriC, DnaT, DnaB, DnaC, DnaG, DnaX clamp loader, polymerase core complex, DNA ligase, and sliding clamp, as well as any combination thereof. The sliding clamp can be an E. coli β-dimer sliding clamp, a eukaryotic PCNA sliding clamp, or a T4 sliding clamp gp45, or a combination thereof. The auxiliary components can further include a DNA polymerase III holoenzyme complex consisting of a β-clamp, a DnaX clamp loader, and a polymerase core complex. These latter auxiliary components will enable the execution of leading and lagging RPA.

[0445] The RPA reaction can be carried out with one or more additional enzymes that can promote efficient disassembly of the recombinase agent / dsDNA complex after the initiation of DNA synthesis, including those that can stimulate 3' to 5' disassembly and those that can assist 5' to 3' disassembly.

[0446] Such additional enzymes include several polymerases that can displace RecA in the 3' to 5' direction and stimulate 3' to 5' disassembly of the recombinase agent / dsDNA complex. These DNA polymerases include Escherichia coli (E. coli) PolV and homologous polymerases from other species. Inclusion of E. coli PolV or any functional variant, analog, homolog, or derivative thereof can improve amplification efficiency.

[0447] Other enzymes include a class of enzymes called helicases that can be used to promote the disassembly of RecA from dsDNA. These promote disassembly in both the 5' to 3' and 3' to 5' directions. An ideal helicase complex for stimulating the disassembly of RecA from intermediates consists of the E. coli proteins RuvA and RuvB. The RuvAB complex promotes branch migration, dissociating the RecA protein and allowing RecA to be recycled. Incorporating RuvAB into the RPA mixture can promote the dissociation of RecA from dsDNA after strand exchange and displacement, allowing de novo synthesis of replication templates from the same site. In addition, the RuvAB complex can act in concert with RuvC, ultimately cleaving and resolving Holliday junctions. Adding RuvC to the RPA reaction mixture can resolve complex structures, such as Holliday junctions, that form at the invasion site.

[0448] Yet other enzymes include the E. coli RecG protein, which can stimulate the disassembly of branched structures.

[0449] Other enzymes useful in RPA reaction mixtures are those that allow the continuous generation of RecA nucleoprotein filaments in the presence of ATP and single-stranded stabilizers. Thus, RecO and RecR, and optionally RecF proteins, can be used.

[0450] Primer RPA methods utilize a polymerase to generate copies of a template nucleic acid molecule. RPA methods, including those of the present invention, therefore use primers to initiate extension by the polymerase.

[0451] It is a prerequisite for most nucleic acid polymerases that incorporation requires a free 3'-hydroxyl moiety on the terminal sugar of a short stretch of double-stranded nucleic acid adjacent to the site of new synthesis. This stretch of double-stranded nucleic acid is typically templated by a short oligonucleotide, called a primer, which typically has a complementary sequence and serves as the initiation site for the polymerase synthesis reaction. In some cases, a 3' modification, such as a sulfhydryl, may be used to prime the synthesis reaction. The primer nucleic acid, which base pairs with the template and is extended by the polymerase, can be RNA or DNA. Typically, for in vitro reactions, the primer is provided as a short, often chemically synthesized, single-stranded DNA (or modified DNA or RNA) and is commonly referred to as an oligonucleotide primer. Primers are often of a specific sequence, although random primers can also be used. The primer is targeted to the complementary sequence using its specific base-pairing ability. Hybrid formation between an oligonucleotide primer and a target nucleic acid is typically formed by incubating the two in solution under salt, pH, and temperature conditions that allow spontaneous annealing.

[0452] The primer used in RPA can have a single-stranded region for hybridization to target DNA in the presence of recombinase agent.The single-stranded region can be, for example, about 10 bases, about 15 bases, about 20 bases, about 25 bases, about 30 bases, about 40 bases, and about 50 bases.Theoretically, even longer regions, such as about 75 bases, about 100 bases, about 150 bases, or more, can be used.The selection of the single-stranded region will depend on the complexity of the starting nucleic acid, so for example, human genome may require longer primers, while plasmid may require much shorter primers.

[0453] Preferred primer lengths are between about 30 and about 50 bases, for example, between 30 and 45 bases, between 30 and 40 bases, between 30 and 35 bases, between 35 and 40 bases, between 40 and 45 bases, and between 45 and 50 bases. While the primer lengths referenced above are given, recombinases and / or single-stranded binding proteins with optimal primer lengths of less than 30 bases are also possible and contemplated.

[0454] The primers used in RPA are preferably DNA, although PNA and RNA are also suitable for use as primers. Note that in natural DNA replication, DNA polymerase actually extends genomic DNA by extension from an RNA primer.

[0455] Primers can be synthesized according to standard techniques. Modified bases and / or linker backbone chemistries may be desirable and functional in some cases. In addition, oligonucleotides may be modified at their 5' or 3' ends with groups that serve various purposes, such as fluorescent groups, quenchers, protecting (blocking) groups (reversible or irreversible), magnetic tags, proteins, etc. In some cases, single-stranded oligonucleotides can be used for strand invasion, while in other cases, only partially single-stranded nucleic acids can be used, in which a 5' stretch of the invading nucleic acid's sequence is already hybridized to the oligonucleotide.

[0456] The primer may contain a 5' region that is not homologous to the target nucleic acid. Note that amplification can be achieved even if the primer is not completely complementary to the target nucleic acid. The primer may be non-complementary by having an additional sequence at the 5' end. These additional sequences may be, for example, a restriction endonuclease recognition site sequence or a sequence complementary to a sequencing primer. The restriction endonuclease recognition site may be useful for subsequent cleavage of the amplified sequence. The use of a restriction endonuclease that cleaves the nucleic acid outside the restriction endonuclease recognition site is also contemplated. The sequence complementary to the sequencing primer may enable high-speed DNA sequencing of the amplified product using commercially available primers or commercially available sequencing equipment.

[0457] The software for designing the oligonucleotide for use in in vitro DNA synthesis reaction has been well established, especially for use in PCR.The considerations of RPA method are similar, including optimizing the melting temperature of oligonucleotide, avoiding hairpin formation within oligonucleotide, and selecting for complementarity with other oligonucleotides present in a given reaction.Therefore, it is important to design oligonucleotide primer pairs to avoid undesired side reactions.

[0458] In addition to optimizing oligonucleotide sequence design, there are additional approaches to reducing or eliminating primer-dimer formation. As shown elsewhere herein, reaction noise can be reduced by using a polymerase lacking 3'-5' exonuclease activity. This suggests that oligonucleotides shortened by the 3'-5' exonuclease activity of the polymerase may result from mispriming. As a result, 3'-5' exonuclease editing activity, pyrophosphorolysis, or any other similar editing activity can be a source of noise. In addition to using a polymerase lacking exonuclease activity and removing pyrophosphate with pyrophosphatase, the use of synthetic oligonucleotides with non-hydrolyzable backbones at the final and / or penultimate linkages can be beneficial in reducing reaction noise. Alternative backbones can be selected from a wide range of available chemistries, such as phosphorothioates, morpholinos, locked nucleic acids, or peptide nucleic acids.

[0459] Reagents for use in RPA reactions Reagents for use in the RPA method are outlined below.

[0460] dNTP dNTP, such as dATP, dGTP, dCTP and dTTP, and their derivatives and analogs, can be added to RPA reaction.In leading and lagging strand RPA, ATP, GTP, CTP and UTP can also be included in the synthesis of RNA primer.In addition, ddNTP (ddATP, ddTTP, ddGTP and ddGTP, and their derivatives and analogs) can be used to generate fragment ladder.

[0461] dNTPs may be used at a concentration of between 1 mM and 200 mM of each NTP species.

[0462] The mixture of dNTPs and ddNTPs can be used at a ddNTP concentration of 1 / 100 to 1 / 1000 of that of dNTPs (1 mM to 200 mM).

[0463] RPA can be performed in the presence of ATP, a hydrolyzable ATP analog, or other nucleoside triphosphate, such as dATP, ddATP, or other nucleoside triphosphate analogs, such as UTP.

[0464] reducing agent An example of a reducing agent that can be used in the RPA reaction is DTT, whose concentration can be between 1 mM and 10 mM, preferably 1 mM.

[0465] ATP ATP or an ATP analogue can be used in the RPA reaction.

[0466] The ATP or ATP analog may be any of ATP, ATP-γ-S, ATP-β-S, ddATP, or a combination thereof. The preferred concentration of ATP or ATP analog is between 1 mM and 10 mM, preferably 2.5 mM.

[0467] A system for ATP regeneration Other components of the RPA reaction can include a system for ATP regeneration (i.e., a system for converting ADP to ATP). Such a system can be, for example, phosphocreatine and creatine kinase.

[0468] Because recombinases have an extremely high ATP hydrolysis rate when bound to nucleic acids, an ATP regeneration system enables sustained recombination reactions. Specifically, the UvsX protein has a hydrolysis rate 10-20 times higher than RecA, consuming 200 ATP molecules per minute per monomer. Several systems are available. The creatine kinase / phosphocreatine system is preferred. When UvsX is used, the AMP produced can be converted to ATP. Additionally, chicken myokinase can be used, which converts one AMP molecule and one ATP molecule into two ADP molecules. ADP can then be converted to ATP using the creatine kinase / phosphocreatine system. Poor ATP regeneration can reduce the reaction rate.

[0469] In the RPA methods described herein, phosphocreatine is preferably used at a concentration between 15 and 25 mM, more preferably 20 mM, and creatine kinase is preferably used at a concentration between about 0.25 and 5.0 μM, more preferably 1 μM.

[0470] Polyvalent metal cations The buffer solution in the RPA reaction preferably contains a polyvalent metal cation. The buffer may contain a functional equivalent of the polyvalent metal cation.

[0471] The buffer solution in the RPA reaction more preferably contains a divalent metal cation. The buffer may contain a functional equivalent of a divalent metal cation.

[0472] Any suitable polyvalent or divalent metal cation or their functional equivalents can be used, either as a single agent or in a combination of agents.

[0473] The specific polyvalent or divalent metal cation or its functional equivalent that achieves optimal results in promoting / enhancing IDR-mediated phase separation in an RPA reaction, as well as the specific concentration of the polyvalent / divalent metal cation used, may depend on the specific IDR polypeptide used. The optimal polyvalent / divalent metal cation or its functional equivalent, as well as its optimal concentration, can be established empirically using routine testing, including the RPA reaction itself and / or the phase separation assays further described herein.

[0474] The divalent metal cation is Mg 2+ , Mn 2+ , Ca 2+ , Co 2+ , Ni 2+ , or Cu 2+ Any of these cations may be used as a single agent, or any combination of cations may be used. Preferably, they are used as a single agent. A preferred divalent metal cation is Mg 2+ , Mn 2+ , and Ca 2+ A particularly preferred divalent metal cation is Mg 2+ is.

[0475] The preferred concentration range is 30 to 40 mM, more preferably 33 to 39 mM.

[0476] The buffer solution contains Mg 2+ ions, preferably at the concentrations shown. More preferably, the buffer contains MgOAc at the concentrations shown.

[0477] The buffer solution contains Ca 2+ ions, preferably at the concentrations indicated. More preferably, the buffer contains CaCl2 at the concentrations indicated.

[0478] The buffer solution contains Mn 2+ ions, preferably at the concentrations shown. More preferably, the buffer contains MnCl2 at the concentrations shown.

[0479] buffer solution The buffer solution in the RPA reaction can be Tris-HCl buffer, Tris-acetate buffer, or a combination thereof. The buffer can be present at a concentration between about 10 mM and about 100 mM. A preferred buffer is Tris-HCl buffer used at a concentration between about 20 mM and about 30 mM, most preferably 25 mM. The buffered pH can be 6.5 to 9.0, preferably pH 8.3.

[0480] The buffer may contain between about 5 mM and about 50 mM, preferably between about 10 mM and about 40 mM, of potassium acetate.

[0481] Reaction components A preferred, but non-limiting set of reaction components for an RPA reaction is as follows: Tris HCl pH 8.3, 25 mM KOAc, 7.5 mM DTT, 1 mM ATP, 2.5 mM Phosphocreatine, 20 mM Creatine kinase, 1 μM dNTPs, 1 mM Gp32, 20 μM UvsX, 4.8 μM UvsY, 8.6 μM Staphylococcus aureus (S. aureus) DNA polymerase 1 (Sau), 0.135 μM or B. subtilis DNA polymerase 1 (Bsu) MgOAc, 33 mM Forward primer, 0.4 μM Reverse primer, 0.4 μM

[0482] RPA reaction conditions The RPA reaction can be incubated for any suitable length of time.

[0483] Any of the RPA reactions can be incubated for between 5 minutes and 16 hours or longer, for example, between 15 minutes and 3 hours, or between 30 minutes and 2 hours.

[0484] Incubation can be carried out until the desired degree of amplification is achieved, which can be 10-fold, 100-fold, 1000-fold, 10,000-fold, 100,000-fold, or 1,000,000-fold amplification.

[0485] One advantage of RPA is that the reaction can be performed at a reduced concentration compared to techniques that require thermal cycling, such as PCR. A further advantage of RPA is that temperature is not critical, and strict control, while preferred, is not absolutely necessary. For example, in a field environment, it is sufficient to incubate the RPA reaction at room temperature or near body temperature (35°C to 38°C), for example, by placing the sample between the body surfaces. Furthermore, the RPA reaction can be performed without temperature-induced melting of the template nucleic acid.

[0486] Thus, any of the RPA reactions can be carried out at any suitable temperature.

[0487] The RPA reaction can be carried out at less than 45°C. The RPA reaction can be carried out at less than 40°C. The RPA reaction can be carried out at less than 35°C. The RPA reaction can be carried out at less than 30°C.

[0488] The RPA reaction can be carried out at a temperature between 20°C and 50°C, between 20°C and 40°C, for example, between 20°C and 30°C.

[0489] Lyophilization of RPA reaction components One advantage of the RPA reaction is that reagents, with the possible exception of crowding agents (if used) and buffers, can be lyophilized (i.e., freeze-dried) prior to use. Lyophilized reagents offer the advantage of not requiring refrigerated storage to maintain activity. For example, RPA reagent tubes can be stored at room temperature. This advantage is particularly useful in field conditions where access to refrigerated storage is limited.

[0490] The RPA reagents can be lyophilized at the bottom of a tube, or on beads or any other suitable type of solid support. To perform the RPA reaction, the lyophilized reagents are reconstituted in a buffer solution with a crowding agent (if used), or simply with a buffered solution or water, depending on the composition of the lyophilized reagent. The target nucleic acid or a sample suspected of containing the target nucleic acid is then added. The reconstitution solution may also contain sample nucleic acid. The reconstituted reaction is incubated for a period of time, and amplified nucleic acid, if present, is detected.

[0491] In any one of the RPA methods described herein, the reagents that can be lyophilized prior to use include at least a recombinase agent, a recombinase loading protein, a single-strand stabilizing agent, a DNA polymerase, dNTPs or a mixture of dNTPs and ddNTPs, a reducing agent, ATP or an ATP analog, a primer, and a probe.

[0492] To improve lyophilization performance and shelf life, a stabilizer, such as trehalose sugar, can be included in the lyophilization mixture, e.g., at 20 mM to 200 mM and most optimally 40 mM to 80 mM in the reconstituted reactants. If desired, the lyophilized reagents can be stored for 1 day, 1 week, 1 month, or 1 year or longer before use.

[0493] Biochemical reaction reagents, such as RPA reagents, may be lyophilized together with crowding agents. However, complex interrelated issues may exist that may justify the omission of crowding agents from the lyophilized mixture. For example, users may experience problems effectively rehydrating the lyophilized crowding agents, or users may experience other adverse events, including the need for larger lyophilized pellets. Therefore, there may be advantages to being able to omit some or all of the crowding agents from the lyophilized material, including reduced pellet size, shorter cycle times, and easier rehydration, among others. However, this has the disadvantage that, if a crowding agent is used, it must be added fresh before use, after the biochemical reaction mixture is rehydrated and ready for use. This may be problematic in certain situations, such as point-of-care or field use. An advantage of the IDR-based reagents of the present invention is that they are not expected to exhibit the same disadvantages as crowding agents in a lyophilization environment and therefore can be easily lyophilized together with other biochemical reaction components, thus avoiding the need to add additional reagents fresh before use.

[0494] Kit containing RPA reaction components Kits for performing RPA reactions are also provided.

[0495] The kits may include any of the reagents described herein for RPA, including the detection probes described herein, in any one of the concentrations described above.

[0496] The kit may include any of the IDR-tagged macromolecules and / or IDR-tagged polypeptides described and defined herein. Preferably, the kit includes an RPA recombinase agent, an RPA recombinase loading protein, a polymerase, a first and second nucleic acid primers, a buffer, and / or a polyvalent metal ion, preferably a divalent metal cation, such as Mg. 2+ , Mn 2+ , Ca 2+ , Co 2+ , or Ni 2+ The composition may further comprise an additional RPA component selected from the following sources:

[0497] The reagents of the kit may be lyophilized, in which case they may be provided in any suitable amount such that appropriate reagent concentrations are achieved upon reconstitution.

[0498] Other common definitions DNA As used herein, the term "DNA" refers to deoxyribonucleic acid and its derivatives, molecules that carry most of the genetic instructions used in the development, function, and reproduction of all known organisms and many viruses. Most DNA molecules consist of two biopolymer strands wrapped around each other to form a double-stranded helix. The two DNA strands, known as polynucleotides, are composed of simpler units called deoxynucleotides. Each deoxynucleotide consists of a nitrogenous nucleobase—cytosine (C), guanine (G), adenine (A), or thymine (T)—as well as a monosaccharide called deoxyribose and a phosphate group. Deoxyribonucleotides are linked to each other within the chain by covalent (phosphodiester) bonds between the sugar of one deoxyribonucleotide and the phosphate of the next, resulting in an alternating sugar-phosphate backbone. Hydrogen bonds join the nitrogenous bases of two separate polynucleotide strands according to base-pairing rules (A to T and C to G) to create double-stranded DNA. The specific order of the monomers, ie, the order in which the deoxyribonucleotide bases are linked to the sugar / phosphate backbone, is called the DNA sequence.

[0499] RNA As used herein, the term "RNA" refers to ribonucleic acid and its derivatives.

[0500] RNA is typically a single-stranded nucleic acid molecule, a polynucleotide composed of simpler units called ribonucleotides. Each ribonucleotide consists of a nitrogenous nucleobase—cytosine (C), guanine (G), adenine (A), or thymine (T)—and a monosaccharide called deoxyribose and a phosphate group. Ribonucleotides are linked to each other in a chain by covalent (phosphodiester) bonds between the sugar of one ribonucleotide and the phosphate group of the next. The specific order of the monomers, i.e., the order in which the ribonucleotide bases are linked to the sugar / phosphate backbone, is referred to as the RNA sequence.

[0501] amino acid As used herein, the term "amino acid" refers to any natural or synthetic amino acid, i.e., an organic compound containing carbon, hydrogen, oxygen, and nitrogen atoms and containing both amino (-NH2) and carboxylic acid (-COOH) functional groups. Typically, amino acids are α-, β-, γ-, or δ-amino acids. The amino acid may be one of the 22 naturally occurring proteinogenic α-amino acids.Alternatively, the amino acid may be α-amino-n-butyric acid, norvaline, norleucine, alloisoleucine, t-leucine, α-amino-n-heptanoic acid, pipecolic acid, α,β-diaminopropionic acid, α,γ-diaminobutyric acid, ornithine, allothreonine, homocysteine, homoserine, β-alanine, β-amino-n-butyric acid, β-aminoisobutyric acid, γ-aminobutyric acid, α-aminoisobutyric acid, isovaline, sarcosine, N-ethylglycine, N-propylglycine, N-Isopropylglycine, N-Methylalanine, N-Ethylalanine, N-Methyl-β-alanine, N-Ethyl-β-alanine, Isoserine, α-Hydroxy-γ-aminobutyric acid, Homonorleucine, O-Methyl-homoserine, O-Ethyl-homoserine, Selenohomocysteine, Selenomethionine, Selenoethionine, Carboxyglutamic acid, Hydroxyproline, Hypusine, Pyroglutamic acid, Aminoisobutyric acid, Dehydroalanine, β-alanine, γ-amino Butyric acid, δ-aminolevulinic acid, 4-aminobenzoic acid, citrulline, 2,3-diaminopropanoic acid, 3-aminopropanoic acid, hydroxytryptophan, selenohomocysteine, α-aminoglycine, and diaminoacetic acid, 2,3-diaminopropionic acid, α,γ-diaminobutyric acid, amino-2-keto-butyric acid, 4-acetylphenylalanine and formylglycine, azidolidine, azidoornithine, azidonorleucine, azidoalanine, azidohomoalanine The amino acid may be a synthetic amino acid selected from 4-azidophenylalanine, 4-azidomethylphenylalanine, homoallylglycine, 4-ethylphenylalanine, 4-propargyloxyphenylalanine, propargylglycine, 4-(2-propynyl)proline, 2-amino-6-({[(1R,8S)-bicyclo[6.1.0]non-4-yn-9-ylmethoxy]carbonyl}amino)hexanoic acid, and homopropargylglycine. Amino acids having a stereocenter can exist as a single enantiomer or as a mixture of enantiomers (e.g., a racemic mixture).

[0502] The conventional one-letter or three-letter codes for amino acid residues are used herein.

[0503] Peptides and Polypeptides As used herein, the terms "peptide" and "polypeptide" are used interchangeably and refer to a biological molecule comprising a polymer of amino acid monomers.

[0504] protein Proteins consist of one or more polypeptides arranged in a biologically functional manner, often bound to ligands, e.g., coenzymes and cofactors, or other proteins or other macromolecules (DNA, RNA, etc.), or complex macromolecular assemblies.

[0505] enzyme The term "enzyme" refers to a protein or polypeptide that has catalytic activity and is capable of catalyzing a chemical reaction.

[0506] small molecule As used herein, the term "small molecule" refers to a low-molecular-weight chemical compound with a known biological or pharmacological effect. Typically, small molecules have a molecular weight of about 5 kDa or less. Optionally, small molecules have a molecular weight of about 1.5 kDa or less or about 1.0 kDa or less. Preferably, small molecules have a molecular weight of about 900 Da or less. Small molecules account for the majority of pharmaceuticals and include biological molecules such as fatty acids, glucose, amino acids, cholesterol, and secondary metabolites such as lipids, glycosides, alkaloids, and natural phenols. In contrast, small molecules do not include, for example, polysaccharides, proteins, and nucleic acids.

[0507] Fluorophores The term "fluorophore" refers to a chromophore or dye capable of fluorescence, i.e., a functional group and / or a molecule containing such a functional group, that absorbs energy of a particular wavelength and re-emits the energy at a different wavelength.

[0508] Quencher The term "quencher," as used herein, generally refers to a dye that is capable of reducing the fluorescent emission of another dye, i.e., that can do so by absorbing the energy emitted by the other dye.

[0509] connection The term "connection," as used herein, typically refers to the association between a signal promotion molecule and an oligonucleotide of a probe. In all of the specific detection probe embodiments, the signal promotion molecule is associated with the oligonucleotide of the probe by a linker, and therefore the association between the signal promotion molecule and the oligonucleotide is indirect; the signal promotion molecule is not itself directly chemically bound to the oligonucleotide.

[0510] join The terms "link" or "linked," as used herein, typically refer to the association between a linker and an oligonucleotide of a probe, or between a linker and a signal promotion molecule. The association between the linker and the oligonucleotide and the linker and the signal promotion molecule is direct, with the linker being chemically bound directly to the oligonucleotide or the signal promotion molecule.

[0511] others It is understood that the specific detection probes and detection methods described and defined herein are exemplary and non-limiting and can be adapted or tailored to the specific needs of the user. It is also understood that the terminology used herein is for the purpose of describing particular embodiments of the invention only and is not intended to be limiting.

[0512] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Thus, for example, a reference to one entity, such as "a molecule," "a polypeptide," etc., includes two or more such entities.

[0513] Terms such as "about" and "approximately" shall be understood to encompass a referenced numerical value plus or minus 10% of that numerical value, or plus or minus 5% of that numerical value, unless the context clearly indicates otherwise.

[0514] When a numerical range is presented as "between" a lower and an upper value, the range is to be interpreted as including both the upper and lower values. For example, a range between 22 mM and 50 mM, or between about 22 mM and about 50 mM, is to be interpreted as including the values ​​22 mM and 50 mM, or about 22 mM and about 50 mM. [Example]

[0515] The following examples are offered to illustrate, but not to limit, the present invention.

[0516] [Example 1] Detection of RPA products using dual modified probes—fluorescence detection. Experimental objectives and overview This experiment was performed to demonstrate the shielding by Gp32 of a probe doubly modified with a fluorophore and a quencher at the 3' end. In one mode, the fluorophore remains attached to the 3' end of the probe, while the quencher is released (see Figure 2A). In another mode, the fluorophore is released, while the quencher remains attached to the 3' end of the probe (see Figure 3A).

[0517] This example demonstrates that in the absence of mRPA-based DNA amplification, the fluorophore or quencher is protected from phosphodiesterase attack by exonuclease III (Exo III), and therefore the fluorophore remains quenched.

[0518] After adding the template to the reaction, DNA amplification began. During the reaction, the probe was incorporated into double-stranded DNA as the amount of synthesized DNA increased. Once the probe hybridized to its target, forming a double-stranded structure, Gp32, a primarily single-stranded DNA-binding protein, lost its affinity for the probe and separated. Removal of Gp32 from the probe rendered the probe "deshielded," i.e., exposing the 3' end of the probe to Exo III attack. The phosphodiesterase activity of Exo III separated the fluorophore from the quencher. In either format, increased double-stranded DNA amplification could be detected by an increase in fluorescent signal.

[0519] material and method RNA detection reactions specific for Sars-CoV-2 (Wuhan-Hu-1 strain-MN908947.3) (COVID ORF1 AB, Figure 2) or E gene (Figure 3) were set up by mixing 25 mM Tris-HCl pH 8.3, 7.5 mM KOAc, 1 mM DTT, 2.5 mM ATP, 20 mM phosphocreatine, 1 μM creatine kinase, 1 mM dNTPs, 0.4 μM forward primer, 0.4 μM reverse primer, 0.12 μM probe, 20 μM Gp32 fusion, 4.8 μM UvsX, 8.6 μM UvsY, 0.135 μM S. aureus DNA polymerase, 0.326 μM RNA polymerase, and 0.27 μM exonuclease III. Reactions were initiated by the addition of template at a given concentration and with 28 mM MgOAc.

[0520] The relevant primers and probes are shown below. ORF1 AB (Figure 2B): Forward primer: 5'-ACCGTAGCTGGTGTCTCTATCTGTAGTACTATGAC-3' (SEQ ID NO: 113) Reverse primer: 5'-TGCCAACCACCATAGAATTTGCTTGTTCCAATTAC-3' (SEQ ID NO: 114) probe: 5'-CCGTAGCTGGTGTCTCTATCTGTAGTACTATGACCAATAGACAGTTTCATCAAAAATTA[dT-BHQ1]-3'[FAM-C7] (SEQ ID NO: 115) FAM is 6-fluorescein and BHQ1 is Black Hole Quencher 1.

[0521] The target locus to which the probe binds is shown in Figure 2B (SEQ ID NO: 116). E gene (Figure 3B): Forward primer: 5'-GGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGC-3' (SEQ ID NO: 117) Reverse primer: 5'-CGCACACAATCGAAGCGCAGTAAGGATGGCTAGTG-3' (SEQ ID NO: 118) probe: 5'-GGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGC[dT-BHQ1]TT-3'[FAM-C7] (SEQ ID NO: 119) FAM is 6-fluorescein and BHQ1 is Black Hole Quencher 1.

[0522] The target locus to which the probe binds is shown in Figure 3B (SEQ ID NO: 120).

[0523] The reaction was then incubated at 39°C, placed in a fluorometer, and magnetically mixed using a stirring bowl.

[0524] Results and Conclusions Two different dual-modified probe configurations were tested. The results indicate that the single-stranded binding protein Gp32 sterically blocks exonuclease III access to the 3' end of the probe, i.e., Gp32 "shields" the probe. As amplification proceeds and the probe is incorporated into double-stranded DNA, Gp32 is released from the probe (i.e., the probe is "deshielded"), allowing exonuclease III to access and process the 3' end of the probe. In this example, the fluorophore is separated from the quencher, allowing rapid detection of amplification of two example targets. In one format, the fluorophore remains attached to the probe while the quencher is released (see Figures 2A-C), while in the other format, the fluorophore is released while the quencher remains attached to the probe (see Figures 3A-C).

[0525] [Example 2] Detection of RPA products using oligo-HRP probes mediated by TDP-1 processing—colorimetric detection. Experimental objectives and overview This experiment was designed to test whether tyrosyl-DNA phosphodiesterase 1 (TDP-1) nucleosidase can hydrolyze the 3'-phosphate of a probe oligonucleotide, specifically in the presence of a target amplicon derived from mRPA, and to demonstrate colorimetric detection.

[0526] TDP-1 processes the 3' end from the aberrant adduct. The natural substrate of this enzyme is primarily a phosphotyrosine linkage left by the aberrant topoisomerase activity. The amino acid sequence of yeast (Saccharomyces cerevisiae) TDP-1 (yTDP-1) is provided below:

[0527] [ka]

[0528] The yTDP-1 enzyme used in this example was expressed as a fusion protein containing a maltose-binding protein (MBP) domain and an N-terminal histidine tag to facilitate purification. The amino acid sequence of this fusion construct is provided below (yTDP-1 residues are underlined):

[0529] [ka]

[0530] The 3'-phosphate of the oligonucleotide probe was conjugated to horseradish peroxidase (HRP) using a thiol-maleimide linkage. The 5'-end was immobilized on poly(methyl methacrylate) (PMMA) beads using strain-promoted azide-alkyne cycloaddition (SPAAC) so that hydrolysis of the 3'-phosphate would release the HRP from the solid support (see Figure 4A). A cellulose wick was then used to separate the bead-immobilized (i.e., unprocessed) HRP from the free HRP, which was then mixed with a 3,3',5,5'-tetramethylbenzidine (TMB) substrate solution to generate a blue reaction product. Thus, mRPA reactions containing the target amplicon should produce a blue color on the wick, while the no-template control (NTC) should be colorless.

[0531] material and method HRP-labeled probe oligonucleotides immobilized on beads Lyophilized DBCO-labeled oligos with the following sequences and modifications were purchased from ATDBio Ltd (UK) (see Figures 4A and B): 5'_[DBCO(TEG)]-CGCCTGCAAGTCCTAAGACGCCAATCGAAAAGAAACACGCGGATGAAA-HEG-C6SS_3' (SEQ ID NO: 121); Here, DBCO(TEG) represents a dibenzocyclooctyne attached through a tetra(ethylene glycol) linker, HEG represents a hexa(ethylene glycol) linker, C6SS represents a dithiol modifier, and "-" represents a phosphate linkage between modifiers.

[0532] Click buffer = 12 mM sodium phosphate pH 8.5, 137 mM NaCl, 510 mM MgCl2, 0.1% w / v SDS.

[0533] 5 mm azide-functionalized PMMA beads (210 mL of 1% w / v stock obtained from PolyAn GmbH, Germany), click buffer (350 mL), and DBCO-labeled oligos (50 mL of a 100 mM solution in click buffer) were reacted overnight in the dark at room temperature. The reaction mixture was then centrifuged at 4,000 g for 1 minute, the supernatant removed, and the labeled beads washed three times with 500 mL of 0.2 M sodium phosphate pH 8.5, 0.1% v / v NP40 by centrifugation (4,000 g for 1 minute). The beads were resuspended in 200 mL of 0.2 M sodium phosphate pH 8.5, 0.1% v / v NP40 to yield approximately 1% w / v of oligo-labeled beads.

[0534] Maleimide conjugation buffer = 0.1 M sodium phosphate pH 7.2, 5 mM EDTA, 0.1% v / v NP40.

[0535] Storage buffer = 25 mM TrisOAc pH 8.3, 7.5 mM KOAc, 0.0125% v / v NP40.

[0536] To conjugate maleimide-HRP to the thiolated oligos on PMMA beads, a 500 mL suspension of 80 mM DTT and 0.2% w / v oligo-labeled beads (with 3'-dithiol) was rotated at room temperature for 30 minutes. The reaction mixture was then centrifuged at 4,000 g for 1 minute, the supernatant removed, and the beads were washed four times with 400 mL of maleimide conjugation buffer by centrifugation (4,000 g for 1 minute). They were then resuspended in 160 mL of maleimide conjugation buffer containing 2 mg of EZ-link maleimide-HRP and rotated at room temperature for 3.5 hours. (Note: Thermo EZ-Link maleimide-HRP #3148 has a 5 mg pack size, but the total solids content is 25 mg; the weights in the above protocol refer to this total solids.)

[0537] The reaction mixture was then centrifuged at 4,000 g for 1 minute, the supernatant removed, and the beads washed five times with storage buffer by centrifugation (4,000 g for 1 minute) and then resuspended in 100 mL of storage buffer to obtain approximately 1% w / v beads labeled with HRP-oligo. To check HRP labeling, 1 mL of the bead suspension (or the supernatant to check for leaching or washing) was mixed with 100 mL of TMB substrate solution (Abcam No. 171522, warmed to room temperature), followed by the addition of 900 mL of 1 M aqueous HCl, and the A450 was measured. A blue color was produced in the presence of HRP, and the reaction was stopped by the addition of HCl to yield a yellow solution.

[0538] The target locus to which the probe binds is shown in Figure 4B (SEQ ID NO: 122).

[0539] HRP release by yeast TDP-1 Five mm PMMA beads functionalized with HRP-labeled probe oligonucleotides were washed four times by centrifugation (4,000 g for 1 minute) in 25 mM Tris-acetate pH 8.3, 7.5 mM KOAc, 0.0025% v / v Triton X-100 (400 μL) and then resuspended to approximately 1% w / v in 25 mM Tris-acetate pH 8.3, 7.5 mM KOAc, 0.0025% v / v Triton X-100. mRPA reactions were performed at 42°C for 20 minutes using standard mRPA protein and buffer concentrations and 0.02% w / v of freshly washed oligo-HRP-labeled PMMA beads. 4 The reactions were carried out with or without the copy hly template and with or without 22.3 pmol of yTDP1 enzyme.

[0540] Reactions contained 0.8 mM of each of the following primers: Forward primer sequence: 5'-AAATTTAATTTCATCCATGGCACCACCAGCATCTC-3' (SEQ ID NO: 123) Reverse primer sequence: 5'-CTGCATCTCCGTGGTATACTAATACATTGTTTTTA-3' (SEQ ID NO: 124)

[0541] The reaction contained 33.6 mM magnesium acetate. At the end of the RPA reaction, a lined wick (Ahlstrom 222) was inserted into the reaction tube for 3 min, then inverted and inserted into TMB substrate solution (100 mL) for 10 min; a blue color indicated HRP release.

[0542] result The blue color of HRP is yeast TDP1 dependent and positive (i.e., 10 4 The (copy) reaction was more potent than that of the NTC (see Figure 4C).

[0543] conclusion The results of this experiment were consistent with target-specific probe processing and release of HRP by yTDP1.

[0544] [Example 3] Development and characterization of an oligo-hemin probe-enzyme / cofactor system - colorimetric detection. Experimental objectives and overview Horseradish peroxidase (HRP) is an enzyme widely used in diagnostic applications due to its ability to generate a colorimetric signal after oxidation of a commercially available substrate. This enzyme contains a hemin cofactor center that is essential for catalysis. Acid treatment of the enzyme allows for the removal of the cofactor (in this manner, the apoenzyme is generated). The apoenzyme alone is incapable of any catalytic activity.

[0545] We generated oligo-hemin conjugates that could be tested for their ability to reconstitute the apoenzyme. The experimental objectives were to first demonstrate that (i) apo-horseradish peroxidase does not generate any activity, (ii) whether a nuclease is required for reconstitution, and (iii) that Gp32 blocks reconstitution by binding to and "shielding" the probe. Nuclease activity would release the hemin cofactor from the probe. However, Gp32 binds to single-stranded DNA and, by doing so, can sterically hinder certain processes, such as nuclease processing.

[0546] We tested HRP activity by following the oxidative coupling of p-hydroxybenzoic acid with 4-aminoantipyrine in the presence of hydrogen peroxide, which leads to the formation of a quinone imine dye (red). To avoid the addition of hydrogen peroxide, this compound was generated in situ by adding glucose oxidase and glucose.

[0547] material and method Synthesis of oligonucleotide hemin conjugates 3'-NH2 probe oligonucleotides with sequences specific to the COVID E gene and FluA NS region were generated: COVID E Gene: 5'-GGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTATTCTTG-3'(NH2) (SEQ ID NO: 125) FluA NS region: 5'-TACAGAGATTCGCTTGGAGAAACTGTGATGAGAATGGGAGACCTTCACTACCT-3'(NH2) (SEQ ID NO: 126)

[0548] Synthesis was performed on a 1 mmol scale on a K&A H2 oligo synthesizer using standard automated phosphoramidite chemistry, and amino modifications were introduced using 3'-PT-amino-modifier C3 CPG (Glen Research, USA). Cleavage and deprotection were performed using AMA (i.e., 1:1 v / v concentrated aqueous NH3 / concentrated aqueous MeNH2) at 65 °C for 15 min. Purification was performed by RP-cartridge (Glen Research, USA) followed by IP-RP-HPLC on a Waters OST C18 column using an acetonitrile gradient in 50 mM aqueous TEAA, pH 7. Desalting was performed using a NAP-10 SE column (Cytiva, USA). Oligos were characterized by LCMS in negative ionization mode on a Waters BioAccord instrument, and LC separation was performed by HILIC using a Waters BEH amide column with a gradient of water in 10 mM ammonium acetate and acetonitrile.

[0549] A mixture of hemin (0.1 M) and O-(benzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (HBTU, 0.1 M) in DMF was reacted briefly (5 min), and then 40 mL of the mixture was added to 125 nmol of amino-modified oligo in 60 mL of 0.5 M pH 9 aqueous NaHCO3 solution and reacted overnight (16 h) at room temperature. The crude target was desalted into 1.5 mL of Milli-Q HO using a NAP-10 SE column, lyophilized overnight, and redissolved in 1 mL of Milli-Q water. The insoluble brown precipitate was removed by centrifugal filtration (Corning (USA) Costar 0.22 mm CA filter), concentrated using an Amicon Ultra 0.5 10 kDa MWCO filter, and centrifuged and washed with additional Milli-Q water to remove free hemin. The remaining volume (approximately 145 mL) was purified by IP-RP-HPLC on a Waters OST C18 column using an acetonitrile gradient in 50 mM aqueous TEAA, pH 7. The target fraction was lyophilized, then redissolved in Milli-Q water and desalted with NAP-10 SE. The target hemin-labeled oligo was characterized by LCMS as described above.

[0550] Preparation of apo-HRP and biochemical assays Horseradish peroxidase, glucose oxidase, and catalase were purchased from Sigma. Gp32 and nuclease (NExo, an ExoIII family AP endonuclease from Neisseria meningitidis) were recombinantly produced in E. coli.

[0551] Apo-HRP was prepared using the following protocol. Horseradish peroxidase (10 mg / mL in HO, 2 mL) was kept cold by keeping it on ice. Concentrated acid (HCl) was then added to the protein mix to reach a pH of at least 2. An equal volume (2 mL) of 2-butanone was used to separate the hemin from the protein; upon mixing, the hemin (brown) entered the organic phase, while the lower aqueous layer contained the protein. The organic phase was then discarded. This procedure was repeated 10 more times until the lower aqueous layer was colorless. Finally, the aqueous layer was dialyzed overnight against a buffer containing 20 mM Tris, 10% glycerol, pH 8. The enzyme was then stored at -20°C.

[0552] Unless otherwise specified, all colorimetric assays were performed using the following protocol. A 5x stock solution (Solution B) of a buffer containing 50 mM Tris, glucose oxidase (Sigma, 1 mg / mL), 10 mM p-hydroxybenzoic acid (Fisher Scientific), and 0.5 mM 4-aminoantipyrine (Sigma) was prepared. The colorimetric reaction was assembled in a buffer containing 50 mM Tris (pH 8), 28 mM MgCl, Solution B 1x, 1% DMSO, and 20 mM glucose (Solution C). Depending on the reaction conditions, oligo-hemin and / or Gp32 and NExo were supplemented to final concentrations of typically 25 nM, 0.7 mg / mL, and 0.07 mg / mL, respectively. The reaction was initiated by the addition of apo-HRP (up to 25 μg / mL) and then incubated at 37°C for 5–15 min according to the following reaction scheme for the in situ generation of hydrogen peroxide and the oxidative coupling of p-hydroxybenzoic acid with 4-aminoantipyrine catalyzed by horseradish peroxidase (HRP):

[0553] [ka]

[0554] result We attempted to determine whether an oligo-hemin probe could reconstitute apo-HRP and whether Gp32 could halt the reconstitution through binding to the probe. Figure 5A shows the initial results of reconstitution of apo-HRP using the synthesized hemin-oligo probe (reaction conditions—Solution C: 50 mM Tris, 28 mM MgCl, 20 mM glucose, 50 μg / mL glucose oxidase, 2 mM 4-hydroxybenzoic acid, and 100 μM 4-aminoantipyrine—see Materials and Methods).

[0555] After setting up the reaction, the plate was incubated at 37°C for 10 minutes. Well 1 (numbered from left to right) contained buffer only; the solution remained colorless; therefore, as expected, no catalysis occurred without the addition of horseradish peroxidase. Well 2 was a positive control; the addition of functional horseradish peroxidase (HRP, up to 25 μg / mL) resulted in a color change. In wells 3-5, a hemin-oligo probe was added to solution C. Figure 5A shows that adding the oligo probe to a final concentration of 25 nM resulted in no color change. Well 6 shows the addition of apo-horseradish peroxidase to solution C; almost no background activity was observed with the apo-enzyme (the solution remained clear). Wells 7-9 show that combining apo-HRP and oligo-hemin probe produced a different result: a strong red color was observed. The same red color was observed in the presence of nuclease (NExo). These results demonstrate that no single component of the reaction can produce a color change, but that oligo-hemin can reconstitute the apo-enzyme independently of nuclease processing.

[0556] The experiment was repeated using the same experimental conditions as described above (Figure 5B). Tubes 1 and 2 (numbered from left to right) are controls, and as expected, no color change is observed in the presence of oligo-hemin alone (Tube 2), while apo-HRP alone shows only a slight color change (Tube 1). The combination of apo-HRP and hemin-oligo probe produces a color change regardless of the presence of nuclease (NExo) (Tube 3 without NExo and Tube 4 with NExo).

[0557] A very significant result is shown in tubes 5 and 6 (Figure 5B), which demonstrate the effect of Gp32 in the presence of apo-HRP and oligo-hemin, with and without NExo. In both cases, no color change is observed as long as Gp32 stops enzyme reconstitution.

[0558] Further repeats (same reaction conditions) are shown in Figure 5C, where the reaction was monitored after 5 and 15 minutes. The controls (wells 1-3) remain clear, but when apo-HRP and oligo-hemin probes are present in the same mixture, a color change is observed even after 5 minutes, regardless of nuclease activity (wells 4-6 without NExo and wells 10-12 with NExo). Again, the presence of Gp32 inhibits the reconstitution reaction (wells 7-9).

[0559] We also investigated whether the effect of Gp32 was due to binding to the probe, i.e., steric hindrance, rather than any effect on the colorimetric reaction. This was tested by adding Gp32 to a solution containing functional holo-horseradish peroxidase. Given that the oligonucleotide probe does not participate in the reaction of horseradish peroxidase with hemin, we predict that a color change will be observed in the presence of Gp32. Addition of holo-HRP (containing hemin) to the reaction buffer (solution C; see Methods and Results for concentrations) induced a color change with and without Gp32 (Figure 6). This observation confirms that the Gp32 effect observed in Figure 5 is to stop the reconstitution of apo-horseradish peroxidase via protection of the oligo-hemin probe. Together with the results above, this indicates that Gp32 prevents the reconstitution of apo-HRP by the oligo-hemin probe.

[0560] conclusion We successfully demonstrated that an oligo-hemin probe can reconstitute apo-horseradish peroxidase and that the reconstitution is impaired by the presence of Gp32. The Gp32-mediated inhibition is shown to occur as a result of Gp32 binding to the single-stranded DNA portion of the probe, thereby sterically hindering the reconstitution of hemin and apo-HRP.

[0561] [Example 4] Detection of RPA products using an oligo-hemin probe-enzyme / cofactor system with colorimetric detection. Experimental objectives and overview Following the successful characterization of the oligo-hemin probe described in Example 3, we investigated whether reconstitution of apo-HRP could be used to monitor recombinase polymerase amplification (RPA).

[0562] A two-pot reaction system was investigated to assess whether RPA amplification could be monitored using an oligo-hemin / apo-HRP detection system. In this experiment, a hemin-oligo probe was supplemented to the RPA mix. After 20 minutes, the volume was transferred to a new tube containing the components required for the color change.

[0563] material and method RPA amplification was set up using in-house recombinant enzymes (18.23 ng / uL Epi polymerase, 110 ng / uL creatine kinase, 58.36 ng / uL UvsX, 14.99 ng / uL UvsY, and 13.12 ng / uL ExoIII) and a buffer containing (25 mM Tris-acetate pH 8.3, 1% DMSO). Primers (forward and reverse) were used up to 0.8 uM, and Gp32 HRP was used up to 0.7 mg / mL. Other components included in the standard RPA mix are potassium acetate (7.5 mM), ATP (2.5 mM), phosphocreatine (20 mM), and dNTPs (1 mM).

[0564] Hemin-Flu-probe was added to 180 nM. The reaction was initiated by adding a solution of MgOAc containing either water or FluA DNA to 28 mM. The reaction was then incubated at 42°C for 20 minutes. A separate tube was prepared with 180 uL of buffer containing (50 mM Tris-acetate (pH 8.3), 28 mM MgCl, Solution B 1x, 1% DMSO, 20 mM glucose); Solution B is a 5x stock solution containing 50 mM Tris-acetate (pH 8.3), glucose oxidase (Sigma, 1 mg / mL), 10 mM p-hydroxybenzoic acid (Fisher Scientific), 0.5 mM 4-aminoantipyrine (Sigma), and apo-HRP to 25 μg / mL. A volume of 25 uL of RPA mix was then transferred to 180 uL of colorimetric mix and further incubated for 10 minutes.

[0565] result We evaluated apo-HRP RPA reactions in a two-pot system (Figure 7, three negative (i.e., no template) controls (ntc) and three positive reactions—3 × 10 4 The no-template control remained light pink in color, while the positive samples displayed a strong red color (Figure 7).

[0566] conclusion Detection of successful amplification was observed through reconstitution of apo-HRP with an oligo-hemin probe.

[0567] [Example 5] Development and characterization of a linear oligo-alpha-peptide probe-peptide activator system - Colorimetric detection. Experimental objectives and overview Beta-galactosidase enzyme fragment complementation assays can be combined with mRPA for readout by binding an alpha peptide fragment to an oligonucleotide probe in such a way that the peptide is constrained and blocked from complementing the target amplicon in the presence of the omega fragment until it is released from the oligo or otherwise released to the oligo by, for example, a nuclease such as Exo III. Thus, beta-galactosidase is activated by mRPA in a target-specific manner. Although a colorimetric detection system is shown in this example, the choice of beta-galactosidase enzyme substrate allows the same system to be used for multiple detection methods (e.g., colorimetric, fluorescent, chemiluminescent, bioluminescent, and electrochemical detection).

[0568] Multiple binding sites and modes of attachment are possible for the alpha peptide-oligo conjugates. SPAAC was used to attach the N- and C-termini of the alpha-peptide to the oligo. We have used the following linear probe configurations: (i) conjugation of the N-terminus of the alpha-peptide to the 3'-terminus of the oligonucleotide (Figure 8A); (ii) conjugation of the C-terminus of the alpha-peptide to the 3′-terminus of the oligonucleotide ( FIG. 8B ), and (iii) A sandwich construct containing an alpha-peptide conjugated (at their 3' ends) to two oligonucleotides, one oligo conjugated to the N-terminus of the alpha-peptide and the other oligo conjugated to the C-terminus of the alpha-peptide (Figure 8C). was synthesized and characterized.

[0569] material and method A 3'-NH2 probe oligonucleotide with a sequence specific for a given target, e.g., RSVB, was generated: 5'-TCTTGATCTGTCGCTTTCAGAGAACTTCAACTTTTCAT(NH2)-3'(NH2) (SEQ ID NO: 127)

[0570] Synthesis was performed on a 1 μmol scale using standard automated phosphoramidite chemistry on a K&A H2 oligo synthesizer. dT-amino modifications were introduced using phosphoramidites from Glen Research (CAS 198080-39-6), and 3'-amino modifications were introduced using 3'-PT-amino-modifier C3 CPG (Glen Research, USA). Cleavage and deprotection were performed using AMA (i.e., 1:1 volume / volume concentrated aqueous NH3 / concentrated aqueous MeNH2) at 65 °C for 15 min. Purification was performed using an RP-cartridge (Glen Research, USA) followed by IP-RP-HPLC on a Waters OST C18 column using an acetonitrile gradient in 50 mM aqueous TEAA, pH 7. Desalting was performed using a NAP-10 SE column (Cytiva, USA). Oligos were characterized by LCMS in negative ionization mode on a Waters BioAccord instrument, and LC separation was performed by HILIC using a Waters BEH amide column with a gradient of water in 10 mM ammonium acetate and acetonitrile.

[0571] The amino-modified oligo was subsequently labeled with DBCO-NHS ester (Merck, CAS 1353016-71-3) by adding 80 μL of 25 mM DBCO-NHS ester in DMSO to 124 nmol of bis-amino-modified oligo in 120 μL of 0.5 M pH 8.8 aqueous NaHCO solution and reacting for 1 h at 40° C. An additional 25 μL of 25 mM DBCO-NHS ester in DMSO was added and the reaction continued for an additional 1 h at 40° C. The crude target was desalted into Milli-Q HO (1.5 mL) using a NAP-10 SE column and then concentrated to dryness overnight in a Speedvac. The sample was then redissolved in 0.1 mL of 0.1 M aqueous TEAA, pH 7, and purified by IP-RP-HPLC on a Waters OST C18 column using a gradient of acetonitrile in 50 nM aqueous TEAA, pH 7. The target fraction was concentrated to dryness overnight in a Speedvac, then redissolved in Milli-Q water, desalted with NAP-10 SE, and lyophilized overnight before being characterized by LCMS as described above.

[0572] The bis-DBCO labeled oligonucleotide was reacted with a bis-azidoacetyl functionalized peptide from CPC (China), the sequence of which is shown below. Azidoacetyl-MTMITDSLAVVLQRRDWENPGVTQLNRLAAHPPFASWRNSEK(Azidoacetyl)-NH2 (SEQ ID NO: 128)

[0573] Bis-DBCO-oligo (70 nmol) and bis-azido-peptide (70 nmol) were mixed in 350 μL of 0.1 M TEAA pH 7 aqueous solution containing 4% v / v DMSO, and 70 μL of formamide was then added to dissolve the precipitate. After leaving the reaction mixture at room temperature for 6 hours, 14 nmol of peptide was added in DMSO (2.8 μL), and the reaction was continued over the weekend (64 hours) at approximately 4°C. 47 μL of 3 M K-acetate buffer (pH 5.5) was added, and the conjugate was precipitated with 1.18 ml of ethanol (absolute) at -20°C for 1 hour. The conjugate was pelleted at 17,000 g for 20 minutes, the supernatant was discarded, and the pellet was first dissolved in 380 μL of water, followed by the addition of 20 μL of 3 M K-acetate buffer (pH 5.5). Precipitation with 1 mL of ethanol (absolute) at -20°C for 1 hour, pelleting was repeated as above, and the pellet was then briefly dried (5 min) in a Speedvac and redissolved in 100 μL of 0.1 M TEAA aqueous solution, pH 7. The conjugate was then redissolved in 0.1 mL of 0.1 M TEAA aqueous solution, pH 7, and purified by IP-RP-HPLC on a Waters OST C18 column using a gradient of acetonitrile in 50 mM TEAA aqueous solution, pH 7. The target fraction was concentrated to dryness overnight in a Speedvac, then redissolved in 0.1 mL of 20 mM Tris.HCl aqueous solution, pH 8.0, and purified by IEX-HPLC on a Thermo DNAPac PA200 column using a gradient of NaCl in 20 mM Tris.HCl aqueous solution, pH 8.0. The conjugate-containing fractions were desalted using an Amicon ultra 0.5 10 kDa MWCO filtration unit by exchanging the elution buffer with Milli-Q water three times. The final desalted conjugate was recovered from the filter in a volume of approximately 60 μL and characterized by LCMS as described above.

[0574] The sequence of the oligonucleotide shown in Figure 8A is set forth in SEQ ID NO: 129. The sequence of the alpha peptide shown in Figure 8A is set forth in SEQ ID NO: 130.

[0575] The sequence of the oligonucleotide shown in Figure 8B is set forth in SEQ ID NO: 131. The sequence of the alpha peptide shown in Figure 8B is set forth in SEQ ID NO: 132.

[0576] The sequence of the oligonucleotide shown in Figure 8C is set forth in SEQ ID NO: 133. The sequence of the alpha peptide shown in Figure 8C is set forth in SEQ ID NO: 134.

[0577] The sequence of the alpha peptide shown in Figure 8E is set forth in SEQ ID NO:135.

[0578] Alpha Complement Experiment Alpha complementation experiments were performed in the following conditions: 25 mM Tris-acetate, 28 mM Mg-acetate, 7.5 mM K-acetate (pH 8.3). Unless otherwise specified, the buffer was supplemented with 20 nM oligonucleotide-alpha peptide conjugate, the colorimetric substrate CPRG (chlorophenol-red β-d-galactopyranoside) to 1 mM, ExoIII to 0.07 mg / mL, and gp32 to 0.7 mg / mL. Unless otherwise indicated, reactions were initiated by the addition of omega fragment (purchased from Molecular Depot, final concentration: 1.8 μM).

[0579] Electrochemical alpha complementation was performed under the following conditions: 25 mM Tris-acetate (pH 8.3), 28 mM MgCl, 12.5 mM ANPG, unless otherwise specified. Proteins Exo III, Gp32, and omega were injected to reach final concentrations of 0.07 mg / mL, 0.7 mg / mL, and 1.8 μM, respectively. Commercially available screen-printed carbon electrodes (WE: Carbon-0.5 cm) were used. 2 , CE: carbon, RE: Ag / AgCl) were purchased from Flexmedical (UK). Chronoamperometry conditions: +0.3 V vs. Ag / AgCl, 42°C.

[0580] RPA colorimetric experiments were performed under the following conditions: Table 1 - List of ingredients included in colorimetric mRPA experiments LacZ-free protein mix: Staphylococcus epidermidis polymerase (Pol, 37ng / uL) Creatine kinase (CK, 110ng / uL) UVB (343ng / uL) UvsY (88ng / uL) Exonuclease III (ExoIII, 57ng / uL) Omega Fragment (1.8uM) Other ingredients 25mM Tris Acetate (unless otherwise specified) Triton X-100 (0.0125%) dNTP (1 mM) ATP (2.5 mM, unless otherwise specified) Phosphocreatine (20mM) Potassium acetate (7.5 mM) Forward primer (0.8uM) Reverse primer (0.8uM) Alpha-peptide probe Gp32 or Gp32HRP1 (0.65 mg / mL) Magnesium acetate (28 mM) Template viral DNA ·35K 5.5% PEG (unless otherwise specified) CPRG (1 mM)

[0581] The reaction was assembled by first combining all reagents except for magnesium and template, the addition of which initiated the reaction, which was then left on a 42°C heating block.

[0582] result 1. Structure: Result of a linear probe with a 5'-oligo-3'-N-alpha peptide-C terminus ("N-terminal conjugate") We sought to determine whether the N-terminal conjugated probe (shown in Figure 8A) complemented the omega fragment and whether nuclease (ExoIII) processing was required for that process to occur. Additionally, we investigated Gp32 protection of the oligonucleotide probe from ExoIII processing. The objectives of the study were: (i) whether the oligo-alpha-peptide probe can itself complement the omega fragment; (ii) whether ExoIII processing of the probe causes acceleration of alpha-complementation; (iii) whether Gp32 protects the probe from alpha-complementation; and (iv) Whether Gp32 protects the probe from ExoIII processing and therefore from alpha-complementation The purpose was to determine the following.

[0583] Experimental conditions: Experiments were carried out in a buffer (30 uL) containing 25 mM Tris-acetate, 20 mM Mg-acetate, 7.5 mM K-acetate (pH 8.3). The buffer was supplemented with colorimetric substrate (CPRG) to 1 mM.

[0584] Processing of the substrate causes the release of chlorophenol red, turning the solution from yellow to red (lambda max: 575 nm). Initial results were performed using an N-terminal alpha peptide oligo probe and are shown in Figure 9. PCR tubes contained different combinations of components:

[0585] Tubes 1-3: In tubes 1 through 3, the buffer was supplemented with buffer only, omega fragment, and +alpha-probe. These control experiments show that omega and probe do not cause any color change by themselves (omega injected up to 1.8 uM, probe injected up to 20 nM).

[0586] Tube No. 4: Buffer supplemented with both omega and probe. Tube No. 5: Buffer supplemented with omega, probe, and Exo III. We observed a slight color change after 15 minutes in the tubes containing the omega and alpha-peptide probes, but there was a strong increase in alpha-complementation in the presence of Exo III. These data suggest that the released alpha-peptide (release catalyzed by Exo III) complements better than the unprocessed oligoconjugate.

[0587] Tube 6: Buffer supplemented with omega and alpha peptides, probe, and Gp32. Tube 7: Buffer supplemented with omega and alpha peptides, probe, Gp32, and Exo. III We observed alpha-complementation in both tubes 6 and 7. A visible color difference was observed between tube 5 and tubes 6-7, suggesting that Gp32 protects the probe from alpha-complementation (Figure 9).

[0588] conclusion Nuclease (Exo III) processing of the N-terminal conjugated probe leads to alpha complementation after the release of Gp32. A color change was observed in all conditions tested.

[0589] 2. Structure: (a) 5'-oligo-3'-C-alpha peptide-N-terminus ("C-terminal conjugate"), and (b) 5'-oligo-3'-N-alpha-peptide-C-terminus-3'-oligo-5' ("sandwich probe") Results for a linear probe with We sought to determine whether the C-terminal conjugate and sandwich probes (shown in Figures 8B and 8C, respectively) complemented the omega fragment and whether nuclease (Exo III) processing was required for this process to occur. Furthermore, we investigated Gp32 protection of the oligonucleotide probes from nuclease (Exo III) processing. We aimed to determine the ability of the two new probe configurations to drive alpha complementation by themselves, the enhancement of alpha-complementation kinetics after nuclease processing, and, crucially, the ability of Gp32 to protect the probes from processing and from complementation.

[0590] The results using the C-terminal conjugates (tubes 1 to 4, left panel) and sandwich probes (tubes 5 to 8, right panel) are shown in Figure 10. Figure 10 shows the fast complementation kinetics of both the C-terminal conjugates and sandwich probes (see the Figure Brief Description above, i.e., figure legends, for further details).

[0591] [Example 6] Oligo-alpha-peptide sandwich probe-peptide activator system - electrochemical detection. Experimental objectives and overview Alpha-complementation offers the possibility of detecting signals by other means, such as fluorescence and electrochemical reactions. Regarding electrochemical reactions, CPRG can be replaced by 4-aminophenyl-beta-D-galactopyranoside (ANPG), and hydrolysis of the glycosidic bond leads to the release of 4-aminophenol, which can be oxidized at a carbon electrode. Compared to other redox mediators, this molecule allows redox reactions to occur at relatively low potentials. Unmodified, commercially available screen-printed electrodes were used in the following experiments.

[0592] We attempted to determine whether the sandwich probe (shown in Figure 8C) would generate an electrochemical signal and whether Gp32 would terminate signal generation as observed in experiments based on color change (see Example 5 above).

[0593] material and method Experiments were performed in 80 μL of buffer containing 25 mM Tris-acetate, 20 mM Mg-acetate, and 7.5 mM K-acetate (pH 8.3). The buffer was supplemented with electrochemical substrate (ANPG) to 12.5 mM, 1.8 μM omega fragment, and 0.07 mg / mL Exo III. The oligo-alpha-peptide probe was injected to a final concentration of 20 nM. The results of this addition are shown in Figure 11A as the blue trace (without Gp32). To test the Gp32 protection profile, experiments were performed in the same buffer as above, but supplemented with electrochemical substrate (ANPG) to 12.5 mM, 20 nM probe, and 0.7 mg / mL Gp32. The reaction was initiated by adding Exo III and omega to final concentrations of 0.7 mg / mL and 1.8 μM, respectively. The results of this addition are shown in Figure 11A as the orange trace (with Gp32). Note that the current in the electrochemical reaction corresponds to the reaction rate. The graph shows strong protection of the probe by Gp32-HRP (flat line), while in the absence of Gp32-HRP, there is an increase in the electrochemical signal due to 4-aminophenol oxidation.

[0594] Control experiments were also performed to confirm that the signal found in the previous experiments was indeed generated by the beta-galactosidase-catalyzed release of 4-aminophenol and therefore the oxidation of 4-aminohenol.

[0595] The experiment was performed in 80 μL of buffer containing 25 mM Tris-acetate, 20 mM Mg-acetate, and 7.5 mM K-acetate (pH 8.3). The buffer was supplemented with the electrochemical substrate (ANPG) to 12.5 mM and 0.07 mg / mL Exo III. The alpha-peptide probe was injected to a final concentration of 20 nM. The result of this addition is shown by the blue trace in the "without omega" panel. The same experiment was then repeated, except that the omega fragment was included in the reaction mix ("with omega" trace). The results are shown in Figure 11B. In the absence of the omega fragment, no signal is observed. This confirms that the observed current is specific to the activity of the omega fragment and, as expected, depends on the presence of the probe.

[0596] conclusion Upon nuclease processing of the alpha-peptide oligo probe, a strong electrochemical signal can be generated.

[0597] [Example 7] Detection of RPA products using oligo-alpha-peptide sandwich probes—colorimetric detection. Experimental objectives and overview A series of experiments were performed to test the ability of the sandwich probe (shown in Figure 8C) to detect RPA amplification by alpha-complementation.

[0598] result Very high copy number (3 × 10 4RPA experiments targeting FluA detection from DNA at 1000 kJ / µL were performed using the following conditions: 1 mM CPRG, 28 mM MgOAc, 8.3 nM sandwich probe, 0.7 mg / mL Gp32, 0.14 mg / mL omega fragment, 5.5% PEG. (For a complete list of reagents and their relative concentrations included in the RPA reaction, see the Materials and Methods section of Example 5 above.) After 18 minutes, a strong signal was observed in the positive sample (containing FluA DNA), while the negative sample (ntc) remained yellow (Figure 12A). Over time, ntc changed slightly; however, the two samples were easily distinguishable visually.

[0599] Further experiments were performed under the same conditions but using a sandwich probe at a concentration of 50 nM (FIG. 12B).

[0600] conclusion We successfully demonstrated detection of RPA amplification by an oligo-alpha-peptide complementation system. We generated three oligonucleotide-alpha-peptide conjugates. Of the three probes synthesized and characterized, the sandwich probe performed optimally in terms of performance and protection from Gp32.

[0601] We have also successfully performed colorimetric one-pot RPA amplification using sandwich probes. The same assay can be used for any other category of probes.

[0602] [Example 8] Development and characterization of cyclic oligo-alpha-peptide probes Experimental objectives and overview As discussed in Example 5 above, multiple attachment sites and modes are possible for alpha-peptide-oligo conjugates, including the use of SPAAC to attach the N- and C-termini of the peptide to the oligo. We have created several cyclic architectures of alpha-peptide-oligonucleotide conjugates. In one case, the alpha-peptide is conjugated to both the 5' and 3' ends of the oligonucleotide (5'3' alpha-peptide oligoconjugate) (Figure 8D). In another case, we attached the alpha-peptide to the 3'-terminal nucleotide of the oligonucleotide probe as well as to internal positions, such as positions 6 and 25 (counting from the 3'-terminal nucleotide of the probe). In another case, we attached the 3'-end of the oligo (or 3'-dT) to an internal amino acid of the peptide by introducing azido-lysine at different positions in the alpha-peptide. The list of introduced mutations and full peptide sequences is provided above (SEQ ID NOS: 6-56).

[0603] The optimized construct was a circular construct in which the peptide was attached to the thymine nucleobase at the 3' end of the oligo and at the 3'-most nucleotide (3'3' oligo-alpha-peptide conjugate). This design has been shown to provide a useful signal-to-noise ratio. The 3'3' circularized product is isolated as a mixture of positional isomers, as shown in Figure 8E, which shows the general structure of these probes.

[0604] material and method Synthesis of oligo-alpha-peptide conjugates The probe was synthesized as described in Example 5 above.

[0605] Alpha Complement Experiment For colorimetric, electrochemical, and fluorescence-based detection, RPA and mRPA (molten RPA) were performed using the following conditions unless otherwise specified: Table 2. RPA recipes: LacZ-free protein mix: Staphylococcus epidermidis-polymerase (37ng / uL) Creatine kinase (110ng / uL) UVB (343ng / uL) UvsY (88ng / uL) Exonuclease III (57ng / uL) Omega Fragment (1.8uM) · Reverse transcriptase (unless the added template is DNA). Other ingredients 25mM Tris Acetate (unless otherwise specified) Triton X-100 (0.0125%) dNTP (1 mM) ATP (2.5 mM, unless otherwise specified) Phosphocreatine (20mM) Potassium acetate (7.5 mM) Forward primer (0.8uM) Reverse primer (0.8uM) Alpha-peptide probe Gp32 or Gp32HRP1 (0.65 mg / mL) Magnesium acetate (28 mM) Template viral DNA ·35K 5.5% PEG (unless otherwise specified) · FAM-di-galactopyranoside (15 uM) or CPRG (1 mM) depending on whether the assay is fluorescence-based or colorimetric-based, respectively. Table 3. mRPA recipe - electrochemical settings: LacZ-free protein mix: Staphylococcus epidermidis polymerase (Pol, 33ng / uL) Creatine kinase (CK, 100ng / uL) S64V UVB (360ng / uL) UvsY (72ng / uL) Exonuclease III (Exo, 26.4ng / uL) Reverse transcriptase (RT, 60ng / uL) RNase inhibitor (RI, 100ng / uL) Omega Fragment (1.8uM) Other Ingredients: 25mM Tris Acetate (unless otherwise specified) Triton X-100 (0.0125%) dNTP (1 mM) ATP (2.5 mM, unless otherwise specified) Phosphocreatine (20mM) Potassium acetate (7.5 mM) Forward primer (0.8uM) Reverse primer (0.8uM) 3'3' alpha-peptide probe Gp32HRP (0.65 mg / mL) Magnesium acetate (20 mM) Template viral RNA Y-cyclodextrin (up to 1% unless otherwise specified) Chronoamperometry conditions: +0.2 V vs. Ag / AgCl Screen-printed carbon electrodes (Flexmedical, 0.5 cm) 2 a carbon working electrode, a carbon counter electrode, and an Ag / AgCl reference electrode) ANPG (25 mM) ·MultiPalmsens 4 (commercially available potentiostatic electrolysis device). Table 4. mRPA recipe - colorimetric settings: LacZ-free protein mix: Staphylococcus epidermidis polymerase (33ng / uL) Creatine kinase (100ng / uL) S64V UVB (360ng / uL) UvsY (72ng / uL) Exonuclease III (26.4ng / uL) Reverse transcriptase (60ng / uL) RNase inhibitor (100ng / uL) Omega Fragment (1.8uM) Other Ingredients: 25mM Tris Acetate (unless otherwise specified) Triton X-100 (0.0125%) dNTP (1 mM) ATP (2.5 mM, unless otherwise specified) Phosphocreatine (20mM) Potassium acetate (7.5 mM) Forward primer (0.8uM) Reverse primer (0.8uM) 3'3' alpha-peptide probe Gp32HRP (0.65 mg / mL) Magnesium acetate or magnesium chloride (20 mM) Template viral RNA · y-cyclodextrin (up to 1% unless otherwise specified) or 6-hydroxyl-propyl-gamma-cyclodextrin (6%). Where specified, 25 mM HCl was used to mimic lysis conditions for viral action. Beta-galactosidase substrate: CPRG (1 mM for coloring).

[0606] The reaction is first assembled in a PCR tube without magnesium and template. The reaction is initiated by the addition of these two components (by pipetting into the lid and quick centrifugation). The PCR tube is then incubated at 41°C. In the case of an electrochemical setup, after addition of magnesium and template, the volume is transferred to a screen-printed electrode.

[0607] result The new circular probes (oligo-alpha-peptide probe and 5'-3' oligo-alpha-peptide probe) were compared with linear sandwich probes (described above in Examples 5-7). As previously described, in the linear sandwich probe design, the alpha-peptide is attached to two oligo probes from the N- and C-termini via 3'-phosphate-DBCO. Comparison of the three designs was first performed using fluorescence spectroscopy: by replacing CPRG with a fluorescent substrate, e.g., FAM digalactopyranoside, a fluorescent signal was observed from the alpha complementation.

[0608] FluA amplification was detected by RPA set up according to Table 2 above. In positive samples, the DNA template (Flu A) was added at 3 × 10 4 The fluorescent substrate (fluorescein (FAM) di-beta-D-galactopyranoside) and probe conjugate were used at 15 μM and 40 nM, respectively. The reaction was incubated at 42° C. in a T8 fluorimeter (axxin, T8), and FAM excitation was monitored over a 20-minute period.

[0609] Representative results obtained with the 3'3' circular probe are shown in Figure 13, where a clear amplification curve is visible starting at 7.5 minutes (under non-optimized conditions). This fluorescence analysis shows a good signal-to-noise ratio for the 3'3' circular probe in the Flu A amplification assay.

[0610] Positive results were also observed with a circular probe in which alpha-peptide was conjugated to both the 5' and 3' ends of the oligonucleotide (5'3' alpha-peptide oligoconjugate, shown in Figure 89D) (data not shown).

[0611] We also tested the 3'-3' oligo-alpha-peptide probe in colorimetric RPA to monitor background generation. FluA RPA amplification reactions using CPRG as the colorimetric substrate (1 mM) were performed under the same conditions as those described in Table 1, except that the concentration of the 3'3' oligo-alpha-peptide probe was 180 nM. A much higher probe concentration (180 nM instead of 40 nM) was used to potentially amplify the background problem in the system. Figure 14 shows that the no-template control (ntc) reactions (i.e., the first two tubes labeled "-" in each panel) remained very clean over the course of 1 hour. In contrast, a very strong amplification signal was obtained in the tubes containing the reaction template (i.e., the next two tubes labeled "+" in each panel) at approximately 15 minutes. This confirmed that the 3'3' circular probe exhibited a good signal-to-noise ratio.

[0612] We further tested the detection limit of colorimetric RPA for analyzing FluB from RNA. RPA amplification reactions for FluB used CPRG (1 mM) as the colorimetric substrate. Other components included in the RPA reaction mix were 50 mM Tris-acetate pH 8.1, 5 mM DTT, 100 ng / uL CK, 0.6 uM of each primer, 0.65 mg / mL Gp32, 350 ng / uL S64V UvsX, 80 ng / uL UvsY, 110 ng / uL Exo, 20 ng / uL polymerase, 20 ng / uL reverse transcriptase, 180 nM omega fragment, 2.5 mM ATP, 50 mM phosphocreatine, 1.8 mM dNTPs, 100 mM potassium acetate, and 5.5% PEG. A 3'3' circular alpha peptide probe was used at 50 nM, while template RNA concentrations were varied from 100 c / uL to 0.1 c / uL. The results of this experiment are shown in Figure 15A, which demonstrates that the colorimetric-alpha complemented RPA allows detection of 1 c / uL in 20-25 minutes, while the NTC remains stable.

[0613] Similar results were observed for RPA amplification reactions performed using the SARS-Cov2 target sequence (Figure 15B). In this case, mRPA reactions were performed to detect SARS-CoV-2 from RNA using the following mRPA conditions: polymerase 33 ng / uL, creatine kinase 100 ng / uL, S64V UvsX 360 ng / uL, UsvY 72 ng / uL, Exo 26.4 ng / uL, reverse transcriptase 60 ng / uL, RNAase inhibitor 100 ng / uL, 65 mM Tricine (pH 8.8), 25 mM HCl, 20 mM MgCl2, 6% 4-OH-propyl-γ-cyclodextrin, 0.8 uM of each primer, 20 nM 3'3' oligo-alpha-peptide probe, 0.65 mg / mL Gp32 HRP, 1.8 uM omega fragment, 0.5 mM CPRG, 1% 35K PEG. The template RNA varied from 1 to 10 c / uL.

[0614] Finally, we tested the detection limit of electrochemical mRPA analyzing FluB and FluA using 3'3' oligo-alpha-peptides. The mRPA experiment was set up under the conditions described in Table 3 above. The results are presented in Figure 16. It was observed that electrochemical detection of FluB and FluA H1N1 by beta-galactosidase alpha-complemented mRPA using ANPG as a substrate allowed a strong amplified signal to become visible in 15-20 minutes (1 c / uL). The no-template control (ntc) remained stable (i.e., did not produce an increase in current) over the course of the experiment.

[0615] conclusion Tethering an alpha peptide 3' to the probe was found to provide tight protection of the probe from Gp32, providing proof of principle for performing mRPA and RPA in one pot using beta-galactosidase alpha complementation.

[0616] While the present invention has been described in connection with particular embodiments thereof, it is to be understood that the scope of the claims is not limited by the preferred embodiments set forth in the examples, but is to be accorded the broadest interpretation consistent with the description as a whole.

[0617] All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety.

Claims

1. 1. A method for detecting a target nucleic acid sequence of interest in a test solution, comprising: A. a. RPA single-stranded DNA binding protein (RPA-SSB) molecule; b. cutting molecule, c. a detection probe according to any one of claims 25 to 60, and d. A sample suspected of containing a target nucleic acid sequence of interest providing a test solution comprising: B. a. upon hybridization of one or two oligonucleotides of said probe with said target nucleic acid sequence of interest, and b. When the cleavage molecule cleaves the probe at the cleavage site. detecting a detectable signal produced by the signal enhancing molecule of said probe; A method comprising:

2. The test solution is an RPA reaction mixture comprising RPA reaction components, and in addition to the RPA-SSB, the RPA reaction components comprise:

1. Recombinase agents, 2. Recombinase loading protein, 3. Polymerase, and 4. Forward and reverse nucleic acid primers for amplification The method of claim 1 , comprising:

3. 3. The method of claim 2, further comprising, after said providing step (A), performing an RPA reaction comprising one or more amplification cycles, and detecting said detectable signal in real time during said one or more amplification cycles or at the end of said one or more amplification cycles.

4. 4. The method of any one of claims 1 to 3, wherein the RPA-SSB is selected from the group consisting of Gp32, E. coli SSB protein, phage T4 Gp32 protein, phage Rb69 Gp32, phage vB_EcoM_NBG1 Gp32, or any functional analog, homolog, or derivative thereof, and any combination thereof, preferably wherein the RPA-SSB is Gp32 or phage vB_EcoM_NBG1 Gp32, and optionally wherein the RPA-SSB is tagged with one or more functional intrinsically disordered regions (IDRs), preferably as an engineered fusion protein comprising an amino acid sequence comprising or consisting of the RPA-SSB and the one or more functional IDRs.

5. The recombinase agent is selected from the group consisting of UvsX, T4 UvsX, T6 UvsX, RB18 UvsX, E. coli phage wV7 UvsX, Shigella phage CB8 UvsX, Shigella phage Shfl2 UvsX, E. coli phage AR1 UvsX, phage vB_EcoM_G4507 UvsX, Shigella phage SHFML-11 UvsX, Escherichia phage vB_EcoM_DalCa UvsX, E. coli RecA, E. coli RadA, E. coli RadB, E. coli Rad 51, or any functional analog, homolog, or derivative thereof, and any combination thereof, preferably wherein the recombinase agent is UvsX, more preferably Escherichia phage vB_EcoM_DalCa UvsX.

6. 6. The method of any one of claims 2 to 5, wherein the recombinase loading protein is selected from the group consisting of UvsY, E. coli RecO, E. coli RecR, or any functional analog, homolog, or derivative thereof, and any combination thereof, preferably wherein the recombinase loading protein is UvsY, more preferably Escherichia phage STO UvsY.

7. The polymerase A. A eukaryotic polymerase selected from the group consisting of pol-α, pol-β, pol-δ, pol-ε, or any functional analog, homolog, or derivative thereof, and any combination thereof; B. A prokaryotic polymerase selected from the group consisting of Bacillus stearothermophilus polymerase I large fragment, Bacillus subtilis Pol I large fragment (Bsu polymerase), Listeria monocytogenes DNA polymerase I, Staphylococcus aureus DNA polymerase I (Sau polymerase), E. coli DNA polymerase I Klenow fragment, E. coli DNA polymerase I, E. coli DNA polymerase II, E. coli DNA polymerase III, E. coli DNA polymerase IV, E. coli DNA polymerase V, or any functional analog, homolog, or derivative thereof, and any combination thereof, preferably wherein said polymerase is selected from the group consisting of Bacillus stearothermophilus polymerase I large fragment, Bacillus subtilis Pol I large fragment (Bsu polymerase), Listeria monocytogenes DNA polymerase I, Staphylococcus aureus DNA polymerase I (Sau polymerase), E. coli DNA polymerase I Klenow fragment, E. coli DNA polymerase I, E. coli DNA polymerase II, E. coli DNA polymerase III, E. coli DNA polymerase IV, E. coli DNA polymerase V, or any functional analog, homolog, or derivative thereof, and any combination thereof; aureus DNA polymerase I (Sau polymerase) or Bacillus subtilis Pol I large fragment (Bsu polymerase), C. A bacteriophage polymerase selected from the group consisting of bacteriophage T4 gp43 DNA polymerase, T7 DNA polymerase, and Phi-29 DNA polymerase, or any functional analog, homolog, or derivative thereof, and any combination thereof.

7. The method according to claim 2, wherein

8. 8. The method of any one of claims 1 to 7, wherein the cleavage molecule is Escherichia coli exonuclease III, preferably having the amino acid sequence set forth in SEQ ID NO: 1, or Neisseria gonorrhoeae exonuclease III, preferably having the amino acid sequence set forth in SEQ ID NO: 2, or tyrosyl-DNA phosphodiesterase 1 (TDP-1), preferably having the amino acid sequence set forth in SEQ ID NO: 3 or SEQ ID NO:

4.

9. the signal facilitating molecule A. Quencher, B. fluorophores, C. A polypeptide, preferably a. having enzymatic activity; b. a component of an enzyme complex, a domain of an enzyme, a fragment of an enzyme, or an enzyme cofactor; or c. an activator of an enzyme or enzyme complex; D. Small molecules, preferably a. Promoting the formation of molecular complexes, e.g., protein:protein complexes; b. promotes the activation of an enzyme or enzyme complex; or c. A cofactor for an enzyme or enzyme complex 9. The method according to claim 1, wherein

10. 9. The method of claim 9(A), wherein the probe is a probe described in any one of claims 42 to 44, 47, 48, 49, 50(1), and 50(2), and wherein the step of detecting the detectable signal comprises detecting a fluorescent emission produced by the fluorophore of the probe.

11. 9. The method of claim 9(B), wherein the probe is a probe described in any one of claims 44 to 49, 50(3), and 50(4), and wherein the step of detecting the detectable signal comprises detecting a fluorescent emission produced by the fluorophore of the probe.

12. 12. The method of claim 10 or claim 11, wherein the cleavage molecule is Escherichia coli exonuclease III, preferably having the amino acid sequence set forth in SEQ ID NO:

1.

13. 52. The method of claim 1, wherein the signal promoting molecule is a polypeptide, the probe is a probe according to claim 51, and the detectable signal is produced in a reaction dependent on the polypeptide of the probe.

14. 53. The method of claim 9(C)(a), wherein the probe is the probe of claim 52, and the detectable signal is produced in a reaction dependent on the enzymatic activity of the polypeptide of the probe.

15. 55. The method of claim 14, wherein the probe is the probe of claim 53 or 54, the detectable signal is produced in a reaction in solution that depends on the enzymatic activity of HRP of the probe, the method comprising detecting the activity of the HRP enzyme (HRP holoenzyme) in the solution, and optionally, the cleavage molecule is tyrosyl-DNA phosphodiesterase 1 (TDP-1), and optionally, TDP-1 has the amino acid sequence set forth in SEQ ID NO:3 or SEQ ID NO:

4.

16. The method of claim 9(C)(b), wherein the probe is the probe described in claim 55, and the detectable signal is produced in a reaction dependent on the enzymatic activity of the enzyme or enzyme complex containing the component, the enzymatic activity of the enzyme containing the domain, the enzymatic activity of the enzyme containing the fragment, or the enzymatic activity of the enzyme containing the cofactor.

17. 17. The method of claim 16, wherein the probe is a probe according to claim 56 or 57, and the detectable signal is produced in a reaction dependent on the enzymatic activity of beta-galactosidase mediated by the beta-galactosidase alpha peptide of the probe, and optionally the cleavage molecule is Escherichia coli exonuclease III, preferably having the amino acid sequence set forth in SEQ ID NO:

1.

18. detecting the detectable signal, 1) contacting the beta-galactosidase alpha peptide of the probe in solution with a beta-galactosidase omega fragment (omega peptide) to form a beta-galactosidase holoenzyme; and 2) Detecting the presence of beta-galactosidase holoenzyme in solution 18. The method of claim 16 or 17, comprising:

19. 20. The method of claim 18, wherein the step of detecting the presence of beta-galactosidase holoenzyme in solution comprises a colorimetric assay, a fluorescent assay, a chemiluminescent assay, a bioluminescent assay, or an electrochemical assay.

20. detecting the presence of beta-galactosidase holoenzyme in the solution; A. Reacting beta-galactosidase holoenzyme with ortho-nitrophenyl-β-D-galactopyranoside (ONPG) in solution, thereby forming the chromophore reaction product ortho-nitrophenol (ONP); B. Detecting the presence of ortho-nitrophenol (ONP), optionally by measuring the absorbance of the solution at 420 nm.

20. The method of claim 19, comprising:

21. The method of claim 9(D)(c), wherein the probe is the probe of claim 59 and the detectable signal is produced in a reaction dependent on conversion of an apoenzyme or apoenzyme complex to a holoenzyme or holoenzyme complex mediated by a small molecule cofactor of the probe.

22. 61. The method of claim 21, wherein the probe is the probe of claim 60, and the detectable signal is produced in a reaction dependent on conversion of an apoenzyme or apoenzyme complex to a holoenzyme or holoenzyme complex mediated by the hemin small molecule of the probe.

23. the detectable signal is A. contacting the hemin of the probe with horseradish peroxidase (HRP) apoenzyme in solution, thereby forming HRP holoenzyme; B. Detecting the activity of HRP holoenzyme in said solution; produced in a method comprising:

23. The method of claim 22, wherein optionally, the step of detecting the activity of HRP holoenzyme in the solution comprises contacting HRP holoenzyme in the solution with an oxidase and a substrate for the oxidase, and detecting the presence of a product produced by the reaction.

24. detecting the activity of HRP holoenzyme in the solution; A. (i) adding the HRP holoenzyme in said solution to a) glucose, e.g., β-d-glucose, glucose oxidase, p-hydroxybenzoic acid, and 4-aminoantipyrine, or b) p-hydroxybenzoic acid, 4-aminoantipyrine, and H ２ O ２ reacting with, thereby forming a chromophore reaction product; and (ii) detecting the presence of said chromophore reaction product, optionally by measuring the absorbance of said solution at 504 nm; or B. (i) adding the HRP holoenzyme in said solution to a) glucose, e.g., β-d-glucose, glucose oxidase, and 3,3',5,5'-tetramethybenzidine (TMB), or b) 3,3',5,5'-tetramethybenzidine (TMB) and H ２ O ２ reacting with, thereby forming a chromophore reaction product; and (ii) detecting the presence of said chromophore reaction product, optionally by measuring the absorbance of said solution at 450 nm or 650 nm; or C. (i) adding the HRP holoenzyme in said solution to a) glucose, e.g., β-d-glucose, glucose oxidase, and 2,2′-azino-di-(3-ethylbenzthiazoline sulfonic acid) (ABTS), or b) 2,2'-azino-di-(3-ethylbenzthiazoline sulfonic acid) (ABTS) and H ２ O ２ reacting with, thereby forming a chromophore reaction product; and (ii) detecting the presence of said chromophore reaction product, optionally by measuring the absorbance of said solution at 405 nm.

24. The method of claim 15 or 23, comprising:

25. 1. A detection probe for detecting a target nucleic acid sequence of interest in a test solution, the test solution comprising a recombinase polymerase amplification (RPA) single-stranded DNA binding protein (RPA-SSB), a cleavage molecule, and the target nucleic acid sequence of interest, the probe comprising: A. one or two single-stranded oligonucleotides, each containing a sequence complementary to a target nucleic acid sequence of interest, and B. An inhibitory cleavage-dependent signaling system comprising: a. a signal promotion molecule connected to said oligonucleotide via at least one linker, said at least one linker binding to a chemical group on said signal promotion molecule and said oligonucleotide, thereby defining a cleavage site on said oligonucleotide; b. i. depends on cleavage at the cleavage site by the cleavage molecule; ii. After hybridization of the oligonucleotide with the target sequence, 1. Cleavage of the oligonucleotide at an apurinic / apyrimidinic site (abasic site) of the oligonucleotide, e.g., at a site that includes an abasic furan and / or on the 3' side of the abasic site and / or on the 5' side of the abasic site, or an abasic furan; or 2. Cleavage of the oligonucleotide at the site of the mismatch; provides a detectable signal that is independent of c. when the probe is present in the test solution, i. when the oligonucleotide is not hybridized to the target sequence, cleavage at the cleavage site by the cleavage molecule is inhibited and production of a detectable signal is thereby suppressed; ii. Upon hybridization of the oligonucleotide with the target sequence, the cleavage molecule cleaves at the cleavage site, thereby producing a detectable signal. Inhibitory cleavage-dependent signal transduction system a detection probe comprising:

26. The linker is A. the abasic nucleotide or abasic residue of the oligonucleotide, e.g., is not attached to the sugar molecule of the abasic nucleotide, and / or B. The detection probe of claim 25, which is not bound to the oligonucleotide at a nucleotide or residue position adjacent to a position in the oligonucleotide occupied by an abasic nucleotide or abasic residue.

27. A detection probe according to claim 25 or claim 26, wherein each of said one or two oligonucleotides is about 20 to 70 nucleotide positions in length, preferably between about 30 and 60 nucleotide positions in length.

28. 28. The detection probe of any one of claims 25 to 27, further comprising a polymerase extension blocking group attached to the 3' end of the oligonucleotide, optionally wherein the blocking group is a spacer, for example a C3-spacer.

29. i. the target nucleic acid sequence of interest is DNA and the detection probe is a detection probe for detecting the target DNA sequence of interest; or ii. The detection probe of any one of claims 25 to 28, wherein the target nucleic acid sequence of interest is RNA and the detection probe is a detection probe for detecting the target RNA sequence of interest.

30. 30. The detection probe of any one of claims 25 to 29, wherein the recombinase polymerase amplification (RPA) single-stranded DNA binding protein (RPA-SSB), when present in the test solution, is selected from the group consisting of Gp32, Escherichia coli (E. coli) SSB protein, phage T4 Gp32 protein, phage Rb69 Gp32, phage vB_EcoM_NBG1 Gp32, or any functional analog, homolog, or derivative thereof, and any combination thereof, preferably wherein the RPA-SSB is Gp32 or phage vB_EcoM_NBG1 Gp32.

31. 31. The detection probe of claim 30, wherein the RPA-SSB is tagged with one or more functional intrinsically disordered regions (IDRs), preferably as an engineered fusion protein comprising the RPA-SSB and an amino acid sequence comprising or consisting of the one or more functional IDRs.

32. 32. A detection probe according to any one of claims 25 to 31, wherein the cleavage molecule is Escherichia coli exonuclease III, preferably having the amino acid sequence set out in SEQ ID NO: 1, or Neisseria gonorrhoeae exonuclease III, preferably having the amino acid sequence set out in SEQ ID NO: 2, or tyrosyl-DNA phosphodiesterase 1 (TDP-1), preferably having the amino acid sequence set out in SEQ ID NO: 3 or SEQ ID NO:

4.

33. In each of the one or two oligonucleotides, the signal promotion molecule is connected to the oligonucleotide by a linker, the linker binding to the signal promotion molecule and to a chemical group of the terminal nucleotide at the 3' end of the oligonucleotide, preferably the 3' terminal phosphate group of the oligonucleotide; A. The chemical group to which the linker is attached, preferably the 3' terminal phosphate group, comprises the cleavage site; B. The detection probe of any one of claims 25 to 32, wherein, when the probe is present in the test solution, upon hybridization of the oligonucleotide to the target sequence in the presence of a cleaving molecule having phosphatase or exonuclease activity, the cleaving molecule cleaves at the cleavage site, thereby generating a detectable signal.

34. In each of the one or two oligonucleotides, the signal promotion molecule is connected to the oligonucleotide by two linkers, (i) a first linker is attached to a chemical group at a first position on the signal promotion molecule and at nucleotide position n of the oligonucleotide, and (ii) a second linker is attached to a chemical group at a second position on the signal promotion molecule and at nucleotide position n+x of the oligonucleotide; A. the chemical group on the oligonucleotide to which the first linker is attached comprises the cleavage site, preferably the 3' terminal phosphate group; B. When the probe is present in the test solution, upon hybridization of the oligonucleotide with the target sequence in the presence of a cleaving molecule having phosphatase or exonuclease activity, the cleaving molecule cleaves at the cleavage site, thereby producing a detectable signal; 33. A detection probe according to any one of claims 25 to 32, wherein the terminal nucleotide position at the 3' end of the oligonucleotide is defined as position n, and the nucleotide position subsequent to position n in the direction proximal to the 5' end of the oligonucleotide is defined as n+x, where x is an integer of 0 or greater.

35. 35. The detection probe of claim 34, wherein the chemical group of the oligonucleotide to which the first linker is attached is the 3' terminal phosphate group at position n of the oligonucleotide.

36. A. the second linker is attached to a chemical group at nucleotide position n of the oligonucleotide, or B. the second linker is attached to a chemical group at nucleotide position n+1 of the oligonucleotide; or C. The detection probe of claim 35, wherein the second linker is attached to a chemical group at nucleotide position n+x of the oligonucleotide, where x is an integer of 2 or greater.

37. 35. A detection probe according to claim 34, wherein the chemical group of the oligonucleotide to which the first linker is attached is the nucleobase of the nucleotide at position n, preferably a thymine nucleobase.

38. A. the second linker is attached to a chemical group at nucleotide position n+1 of the oligonucleotide; or B. The detection probe of claim 37, wherein the second linker is attached to a chemical group at nucleotide position n+x of the oligonucleotide, where x is an integer of 2 or greater.

39. 39. A detection probe according to any one of claims 36 to 38, wherein the chemical group of the oligonucleotide to which the second linker is attached is a nucleobase of a nucleotide, preferably a thymine nucleobase.

40. 35. The detection probe of claim 34, wherein the second linker is linked to a chemical group attached to the terminal nucleotide position at the 5' end of the oligonucleotide, preferably the chemical group is a phosphate group.

41. the probe comprises two oligonucleotides; 1) the signal promotion molecule is connected to a first oligonucleotide by a first linker, the first linker binding to a chemical group of a terminal nucleotide at a first position on the signal promotion molecule and at the 3' end of the first oligonucleotide, preferably the 3' terminal phosphate group of the first oligonucleotide; 2) the signal promotion molecule is connected to a second oligonucleotide by a second linker, the second linker binding to a chemical group of the terminal nucleotide at a second position on the signal promotion molecule and at the 3' end of the second oligonucleotide, preferably the 3' terminal phosphate group of the second oligonucleotide; moreover, A. The chemical group of the first oligonucleotide to which the first linker is attached, preferably the 3'-terminal phosphate group, comprises a first cleavage site, and the chemical group of the second oligonucleotide to which the second linker is attached, preferably the 3'-terminal phosphate group, comprises a second cleavage site; B. The detection probe of any one of claims 25 to 32, wherein, when the probe is present in the test solution, upon hybridization of the oligonucleotide to the target sequence in the presence of a cleaving molecule having phosphatase or exonuclease activity, the cleaving molecule cleaves at the cleavage site, thereby generating a detectable signal.

42. A. the signal enhancement molecule is a quencher connected to the oligonucleotide by a linker, the linker binding to the quencher and to a chemical group of the terminal nucleotide at the 3' end of the oligonucleotide, preferably the 3' terminal phosphate group at nucleotide position n of the oligonucleotide; B. The probe further comprises a fluorophore connected to the oligonucleotide by an additional linker, the additional linker being attached to a chemical group at nucleotide position n+x of the oligonucleotide, wherein the fluorescence emission from the fluorophore is quenched by the quencher; the terminal nucleotide position at the 3' end of the oligonucleotide is defined as position n, and the nucleotide position subsequent to position n in a direction proximate the 5' end of the oligonucleotide is defined as n+x, where x is an integer of 0 or greater; 34. The detection probe of claim 33, wherein, when the probe is present in the test solution, upon hybridization of the oligonucleotide with the target sequence, the cleavage molecule cleaves at the cleavage site, thereby separating the quencher from the oligonucleotide and a detectable fluorescent emission signal is thereby produced by the fluorophore.

43. A. the further linker is attached to a chemical group at nucleotide position n+0 of the oligonucleotide, or B. The additional linker is attached to a chemical group at nucleotide position n+1 of the oligonucleotide, or C. The detection probe of claim 42, wherein the additional linker is attached to a chemical group at nucleotide position n+x of the oligonucleotide, where x is 2 or greater.

44. 44. A detection probe according to claim 43, wherein the chemical group of the oligonucleotide to which the further linker is attached is a nucleobase, preferably a thymine nucleobase.

45. A. the signal enhancing molecule is a fluorophore connected to the oligonucleotide by a linker, the linker binding the fluorophore and a chemical group of the terminal nucleotide at the 3' end of the oligonucleotide, preferably the 3' terminal phosphate group at position n of the oligonucleotide; B. The probe further comprises a quencher connected to the oligonucleotide by an additional linker, the additional linker binding to a chemical group at nucleotide position n+x of the oligonucleotide, wherein the fluorescence emission from the fluorophore is quenched by the quencher; the terminal nucleotide position at the 3' end of the oligonucleotide is defined as position n, and the nucleotide position subsequent to position n in a direction proximate the 5' end of the oligonucleotide is defined as n+x, where x is an integer of 0 or greater; 34. The detection probe of claim 33, wherein, when the probe is present in the test solution, upon hybridization of the oligonucleotide with the target sequence, the cleavage molecule cleaves at the cleavage site, thereby separating the fluorophore from the oligonucleotide and a detectable fluorescent emission signal is thereby produced by the fluorophore.

46. A. the further linker is attached to a chemical group at nucleotide position n+0 of the oligonucleotide, or B. The additional linker is attached to a chemical group at nucleotide position n+1 of the oligonucleotide, or C. The detection probe of claim 45, wherein the additional linker is attached to a chemical group at nucleotide position n+x of the oligonucleotide, where x is 2 or greater.

47. 47. A detection probe according to any one of claims 42 to 46, wherein the chemical group of the oligonucleotide to which the further linker is attached is a nucleobase, preferably a thymine nucleobase.

48. A. the quencher is a dark quencher selected from the group consisting of Black Hole Quencher 0 (BHQ0), Black Hole Quencher 1 (BHQ1), Black Hole Quencher 2 (BHQ2), Black Hole Quencher 3 (BHQ3), Black Berry Quencher 650 (BBQ-650), QSY-35, QSY-7, QSY-9, QSY-21, Eclipse Quencher, and DABSYL (dimethylaminoazobenzenesulfonic acid); B. The fluorophore is selected from the group consisting of Alexa 350, Pacific Blue, Marina Blue, acridine, Edans, coumarin, BODIPY 493 / 503, Cy2, BODIPY FL-X, DANSYL, Alexa 488, FAM, Oregon Green, rhodamine Green-X, NBD-X, TET, Alexa 430, BODIPY R6G-X, JOE, Yakima Yellow, Alexa 532, HEX, R6G, Alexa 555, BODIPY TMR-X, Cy3, Alexa 546, TAMRA, rhodamine Red-X, BODIPY 581 / 591, Redmond Red, Cy3.5, ROX, Alexa 568, Cal Red, Texas Red, BODIPY TR-X, Alexa 594, BODIPY 630 / 650-X, BODIPY 650 / 665-X, Alexa 647, Cy5, and Cy5.

5.

49. A. The fluorophore is 6-carboxyfluorescein (6-FAM) and the quencher is 4'-(2-nitro-4-toluyldiazo)-2'-methoxy-5'-methyl-azobenzene-4-ethylaminoethanol (Black Hole Quencher 1, BHQ1); B. The fluorophore is tetrachlorofluorescein (TET) and the quencher is 4'-(2-nitro-4-toluyldiazo)-2'-methoxy-5'-methyl-azobenzene-4-ethylaminoethanol (Black Hole Quencher 1, BHQ1); C. The fluorophore is hexachlorofluorescein (HEX) and the quencher is 4'-(2-nitro-4-toluyldiazo)-2'-methoxy-5'-methyl-azobenzene-4-ethylaminoethanol (Black Hole Quencher 1, BHQ1), or D. The detection probe of any one of claims 42 to 48, wherein the fluorophore is carboxy-X-rhodamine (ROX) and the quencher is 4'-(4-nitro-phenyldiazo)-2'-methoxy-5'-methoxy-azobenzene-4-ethylaminoethanol (Black Hole Quencher 2, BHQ2).

50. The probe has the structure: １） 【Chemistry 1】 (wherein * is the terminal phosphate group at the 3' end of the oligonucleotide, L1 is the first linker, L2 is the second linker, and BHQ1 is 4'-(2-nitro-4-toluyldiazo)-2'-methoxy-5'-methyl-azobenzene-4-ethylaminoethanol (Black Hole Quencher 1)). ２） 【Chemistry 2】 wherein * is the terminal phosphate group at the 3' end of the oligonucleotide, n=2, n is the number of nucleotide positions relative to the 3' end of the probe, L1 is the first linker, L2 is the second linker attached to the nucleobase at the third nucleotide position relative to the 3' end of the probe, and BHQ1 is 4'-(2-nitro-4-toluyldiazo)-2'-methoxy-5'-methyl-azobenzene-4-ethylaminoethanol (Black Hole Quencher 1), or ３） 【Transformation 3】 (wherein * is the terminal phosphate group at the 3' end of the oligonucleotide, L1 is the first linker, L2 is the second linker, and BHQ1 is 4'-(2-nitro-4-toluyldiazo)-2'-methoxy-5'-methyl-azobenzene-4-ethylaminoethanol (Black Hole Quencher 1)), or ４） 【Chemistry 4】 (wherein * is the terminal phosphate group at the 3' end of the oligonucleotide, n=2, n is the number of nucleotide positions relative to the 3' end of the probe, L1 is the first linker, L2 is the second linker attached to the nucleobase at the third nucleotide position relative to the 3' end of the probe, and BHQ1 is 4'-(2-nitro-4-toluyldiazo)-2'-methoxy-5'-methyl-azobenzene-4-ethylaminoethanol (Black Hole Quencher 1)) 34. The detection probe of claim 33, having:

51. 42. A detection probe according to any one of claims 33 to 41, wherein the signal promoting molecule is a polypeptide, and when the probe is present in the test solution, upon hybridization of the oligonucleotide with the target sequence, the cleavage molecule cleaves at the cleavage site, thereby producing a detectable signal in a reaction dependent on the polypeptide.

52. 52. The detection probe of claim 51, wherein the polypeptide has enzymatic activity and the detectable signal is produced in a reaction that is dependent on the enzymatic activity of the polypeptide.

53. 53. The detection probe of claim 52, wherein the polypeptide is a horseradish peroxidase (HRP) enzyme, preferably the HRP enzyme has the amino acid sequence set forth in SEQ ID NO:

5.

54. The probe has the structure: 【Transformation 5】 (wherein * is the terminal phosphate group at the 3' end of the oligonucleotide, L is the linker, and HRP is the HRP enzyme, preferably having the amino acid sequence set forth in SEQ ID NO: 5).

54. The detection probe of claim 53, having:

55. 52. The detection probe of claim 51, wherein the polypeptide is a component of an enzyme complex, a domain of an enzyme, a fragment of an enzyme, or an enzyme cofactor, and the detectable signal is produced in a reaction dependent on the polypeptide.

56. 56. A detection probe according to claim 55, wherein said polypeptide is a beta-galactosidase alpha peptide, preferably having an amino acid sequence set out in SEQ ID NOs: 6-56.

57. The probe has the structure: 【Transformation 6】 (wherein * is the terminal phosphate group at the 3' end of the oligonucleotide, L1 is the first linker, and L2 is the second linker).

57. The detection probe of claim 56, having:

58. the signal promoting molecule is a small molecule, and when the probe is present in the test solution, upon hybridization of the oligonucleotide with the target sequence, the cleavage molecule cleaves at the cleavage site, thereby producing a detectable signal in a reaction dependent on the small molecule; A. A detection probe according to claim 33, or B. A detection probe according to claims 34 to 41.

59. 59. The detection probe of claim 58, wherein the small molecule is a cofactor for an enzyme or enzyme complex and the detectable signal is produced in a reaction dependent on activation of the enzyme or enzyme complex.

60. The signal enhancing molecule has the structure: 【Transformation 7】 and hemin having the formula Optionally, the probe has the structure: 【Transformation 8】 (where * is the terminal phosphate group at the 3' end of the oligonucleotide, and L is the linker).

60. The detection probe of claim 59, having

61. Composition ingredients: A. RPA single-stranded DNA binding protein (RPA-SSB) molecule; B. a cleavage molecule, and C. A detection probe according to any one of claims 25 to 60. A composition comprising:

62. 1. A recombinase polymerase amplification (RPA) reaction composition comprising: A. RPA reaction components, including the RPA single-stranded DNA binding protein (RPA-SSB) molecule; B. a cleavage molecule, and C. A detection probe according to any one of claims 25 to 60.

1. A recombinase polymerase amplification (RPA) reaction composition comprising:

Images