Adeno-associated variants, formulations and methods for pulmonary delivery

Modified rAAV vectors with a novel capsid protein and CFTR encoding sequence enhance gene therapy efficacy by overcoming antibody neutralization, allowing effective treatment of cystic fibrosis and pulmonary diseases through pulmonary delivery.

JP2026032060APending Publication Date: 2026-02-254D MOLECULAR THERAPEUTICS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025197309
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2020-10-06
Filing Date
2025-11-18
Publication Date
2026-02-25

AI Technical Summary

Technical Problem

The efficacy of adeno-associated virus (AAV) gene therapy is hindered by high prevalence of anti-capsid neutralizing antibodies in the human population, limiting its application to immune-privileged regions due to pre-existing immunity and vector administration.

Method used

Development of recombinant AAV vectors with a modified capsid protein (SEQ ID NO: 12) and a nucleic acid sequence encoding a biologically active CFTR protein, optimized for expression in humans, which are administered via pulmonary delivery to overcome antibody neutralization and achieve sustained therapeutic levels.

Benefits of technology

The modified rAAV vectors demonstrate increased resistance to human AAV neutralizing antibodies, enabling efficient gene delivery and sustained expression of CFTR protein, effectively treating cystic fibrosis and associated pulmonary diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026032060000040
    Figure 2026032060000040
  • Figure 2026032060000041
    Figure 2026032060000041
  • Figure 2026032060000042
    Figure 2026032060000042
Patent Text Reader

Abstract

To provide adeno-associated variants, formulations and methods for pulmonary delivery.SOLUTION: The present disclosure provides variant AAV capsid proteins that confer tropism for lung cells, as well as recombinant adeno-associated viruses comprising the variant AAVs and pharmaceutical compositions comprising the same, and their use in the delivery of heterologous nucleic acids to lung cells for the treatment of lung disorders. (ii) nucleic acids comprising, from 5 ' to 3 ', (a) AAV2 terminal repeats, (b) a promoter, (c) a nucleotide sequence encoding a human cystic fibrosis transmembrane conductance regulator (CFTR) or a biologically active truncated CFTR lacking amino acids 708 to 759 of the human CFTR sequence, (d) a poly-adenylation sequence, and (e) AAV2 terminal repeats.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 63 / 016,246, filed April 27, 2020, and U.S. Provisional Patent Application No. 63 / 088,432, filed October 6, 2020, the entire disclosures of which are incorporated herein by reference.

[0002] Sequence listing submitted via EFS-WEB A computer-readable text file entitled "090400-5013-WO-Sequence-Listing", created on or about April 26, 2021, and having a file size of approximately 186 KB, contains the sequence listing of the present application and is incorporated herein by reference in its entirety. [Background technology]

[0003] Background of the Invention Gene delivery vectors based on adeno-associated virus (AAV) have demonstrated promise in both preclinical disease models and recent human clinical trials for several disease targets. Because wild-type AAV is non-pathogenic and has no known etiological association with any known disease, AAV-based vectors are very safe. Furthermore, AAV offers the potential for highly efficient gene delivery and sustained transgene expression in multiple tissues, including the liver, muscle, lung, retina, and brain.

[0004] AAV is a single-stranded DNA virus containing two open reading frames, rep and cap. The first gene encodes four proteins (Rep78, Rep68, Rep52, and Rep40) required for genome replication, while the second gene expresses three structural proteins (VP1-VP3) that assemble to form the viral capsid. As its name implies, AAV depends on the presence of a helper virus, such as adenovirus or herpesvirus, for active replication. In the absence of a helper, AAV establishes a latent state in which its genome is maintained episomally or integrated into the host chromosome. Several homologous primate AAV serotypes and numerous nonhuman primate serotypes have been identified. AAV2 is best characterized as a gene delivery vehicle.

[0005] As of 2010, 75 clinical trials using AAV as a gene delivery vehicle were underway. However, the efficacy of AAV gene therapy is reduced by the high prevalence of anti-capsid neutralizing antibodies due to widespread exposure to numerous AAV variants and serotypes within the human population. This pre-existing immunity, as well as the subsequent development of immunity due to vector administration, may hinder the wider implementation of AAV gene therapy. For example, to date, AAV has been most successful in clinical studies involving delivery to immune-privileged regions.

[0006] Recent analyses have shown that the prevalence of anti-AAV IgG antibodies in humans is highest for AAV2 (72%) and AAV1 (67%), but AAV9 (47%), AAV6 (46%), AAV5 (40%), and AAV8 (38%) antibodies are also present in a large proportion of study populations. Several studies have found that humoral immunity to AAV capsids during gene therapy can be prevented by reducing the amount of rAAV particles delivered. Unfortunately, administration of low vector doses results in low transduction and therefore low therapeutic gene expression.

[0007] There is a need in the art for the development of new AAV variants that are resistant to neutralization by anti-AAV antibodies. Summary of the Invention [Means for solving the problem]

[0008] Summary of the Invention In some embodiments, provided herein is a recombinant adeno-associated virus (rAAV) vector comprising: (i) a capsid comprising the capsid protein of SEQ ID NO: 12; and (ii) a nucleic acid comprising, from 5' to 3', (a) an AAV2 terminal repeat, (b) a promoter, (c) a nucleotide sequence encoding human cystic fibrosis transmembrane conductance regulator (CFTR) protein or a biologically active truncated CFTR protein lacking amino acids 708-759 of the human CFTR protein sequence, (d) a polyadenylation sequence, and (e) an AAV2 terminal repeat.

[0009] In a related embodiment, the nucleotide sequence encoding human CFTR, or a biologically active portion thereof, encodes the native human CFTR protein and has the following sequence: [ka] [ka] [ka] or having a sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98% or at least 99% identical thereto.

[0010] In a preferred embodiment, the nucleotide sequence encoding human CFTR or a biologically active truncated CFTR protein has the following nucleotide sequence: [ka] [ka] [ka] or comprising a sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98% or at least 99% identical thereto.

[0011] SEQ ID NO:43 is a nucleotide sequence that has been codon-optimized for expression in humans and encodes a biologically active truncated human CFTR protein lacking amino acids 708-759. In some embodiments, provided herein is an isolated nucleic acid comprising the nucleotide sequence of SEQ ID NO:43 or a sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical thereto, optionally operably linked to an expression control sequence. Also provided herein are plasmids and vectors comprising the nucleic acid sequence of SEQ ID NO:43 or a sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical thereto, and host cells comprising such plasmids and vectors. Also provided herein is the use of a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 43, or a sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98% or at least 99% identical thereto, for the treatment of cystic fibrosis or an associated pulmonary disease as described herein, or for use in the manufacture of a medicament for treating cystic fibrosis or an associated pulmonary disease, whereby the nucleotide sequence is optionally operably linked to an expression control sequence.

[0012] In some aspects, the promoter is a constitutive promoter, optionally a truncated cytomegalovirus immediate / early (CMVie) enhancer / promoter, operably linked to a nucleotide sequence encoding human CFTR or a biologically active portion thereof.

[0013] In other embodiments, the promoter is a tissue-specific promoter, preferably wherein the promoter directs preferential expression in lung cells of the nucleic acid operably linked to a nucleotide sequence encoding human CFTR or a biologically active portion thereof.

[0014] In a preferred embodiment, the promoter is a truncated CMVie promoter and is operably linked to a nucleotide sequence encoding human CFTR, or a biologically active portion thereof. In a particularly preferred embodiment, the CMVie promoter has the following sequence: [ka] or CMV173 having a sequence at least 90%, at least 95%, at least 98% or at least 99% identical thereto.

[0015] In a particularly preferred embodiment, the rAAV vector comprises (i) a capsid comprising the capsid protein of SEQ ID NO: 12; and (ii) a nucleic acid comprising, from 5' to 3', (a) an AAV2 terminal repeat, (b) a promoter, (c) a nucleotide sequence encoding human cystic fibrosis transmembrane conductance regulator (CFTR) protein or a biologically active truncated CFTR protein lacking amino acids 708-759 of the human CFTR protein sequence, (d) a polyadenylation sequence, and (e) an AAV2 terminal repeat, wherein, from 5' to 3', the following sequence is present: [ka] [ka] [ka] [ka] or a nucleic acid comprising a sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical thereto. Includes:

[0016] The nucleic acid having the nucleotide sequence of SEQ ID NO: 45 comprises, from 5' to 3', (a) an AAV2 terminal repeat, (b) a CMV173 promoter of SEQ ID NO: 44, (c) a codon-optimized nucleotide sequence encoding a biologically active truncated human CFTR protein lacking amino acids 708-759 of SEQ ID NO: 43, (d) a polyadenylation sequence, and (e) an AAV2 terminal repeat.

[0017] Also provided herein are methods for treating cystic fibrosis in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an infectious rAAV comprising: (i) a capsid comprising the capsid protein of SEQ ID NO: 12; and (ii) a nucleic acid comprising a nucleotide sequence encoding human cystic fibrosis transmembrane conductance regulator (CFTR) protein or a biologically active truncated CFTR protein lacking amino acids 708-759 of the human CFTR protein sequence, operably linked to a promoter. In preferred embodiments, the nucleotide sequence encoding CFTR has the sequence of SEQ ID NO: 43, and / or the promoter has the sequence of SEQ ID NO: 44, and / or the nucleic acid comprises the sequence of SEQ ID NO: 45. In some aspects, the subject is administered an amount of the rAAV effective to ameliorate one or more characteristics of cystic fibrosis, non-limiting examples of which include upper and lower airway inflammation, aberrant epithelial cytokine signaling, and elevated IgE levels.

[0018] In another aspect, provided herein are methods for treating pulmonary diseases associated with cystic fibrosis, including, but not limited to, upper respiratory tract disease, lower respiratory tract disease, nasopharyngeal disease, sinusitis, and / or salivary disease associated with cystic fibrosis, comprising administering to a subject a therapeutically effective amount of an infectious rAAV comprising: (i) a capsid comprising the capsid protein of SEQ ID NO: 12; and (ii) a nucleic acid comprising a nucleotide sequence encoding human cystic fibrosis transmembrane conductance regulator (CFTR) protein or a biologically active truncated CFTR protein lacking amino acids 708-759 of the human CFTR protein sequence, operably linked to a promoter. In preferred embodiments, the nucleotide sequence encoding CFTR has the sequence of SEQ ID NO: 43, and / or the promoter has the sequence of SEQ ID NO: 44, and / or the nucleic acid comprises the sequence of SEQ ID NO: 45.

[0019] An rAAV gene therapy vector of the invention comprising a capsid comprising the capsid protein of SEQ ID NO: 12 and a nucleic acid sequence encoding CFTR or a biologically active portion thereof (e.g., comprising a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 43, optionally linked to a promoter of SEQ ID NO: 44, and / or comprising the nucleotide sequence of SEQ ID NO: 45) can be administered to a patient by various means to achieve and maintain therapeutically effective levels of CFTR or a portion thereof for the treatment of cystic fibrosis or a related pulmonary disease.

[0020] In some embodiments, the infectious rAAV is administered to a subject with cystic fibrosis in one or more doses, each dose comprising about 1 x 10 13 ~Approx. 1×10 15 For the vector genome (vg), approximately 1 × 10 13 ~Approx. 1×10 14 vg, approx. 1×10 14 ~Approx. 1×10 15 vg, or approximately 1 × 10 15 ~Approx. 5×10 15 In some preferred embodiments, each dose is between about 1 x 10 14 vg or approximately 1×10 15vg of rAAV.

[0021] In some embodiments, the treatment involves administering only a single dose to the subject and is effective to achieve a durable and sustained therapeutic concentration of CFTR or a biologically active portion thereof. In related embodiments, the treatment involves administering about 1 x 10 rAAV comprising the capsid protein of SEQ ID NO: 12 and the nucleic acid of SEQ ID NO: 45 to a human with cystic fibrosis. 13 ~Approx. 1×10 15 It involves only a single dose administration by inhalation of plaque forming units (pfu), viral particles (vp) or viral genomes (vg). In other embodiments, the administration treatment can be a multiple dose schedule.

[0022] Methods for administering AAV vectors to humans have been previously described by Kay et al. (2000, Nat Genet 24: 257-261), the entire contents of which are incorporated herein by reference. In some preferred embodiments, infectious rAAV is administered to a subject by pulmonary, endobronchial, intranasal, intratracheal, and / or intrabronchial administration. In some preferred embodiments, infectious rAAV is administered using a nebulizer.

[0023] In a related aspect, provided herein is an infectious rAAV comprising (i) a capsid comprising the capsid protein of SEQ ID NO: 12, and (ii) a nucleic acid operably linked to a promoter, the nucleic acid comprising a nucleotide sequence encoding human Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) protein or a biologically active truncated CFTR protein lacking amino acids 708-759 of the human CFTR protein sequence, for use in the treatment of cystic fibrosis or for use in the manufacture of a medicament for the treatment of cystic fibrosis. In some preferred embodiments, the nucleotide sequence encoding the human CFTR protein comprises or consists of the sequence of SEQ ID NO: 43, or a sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical thereto, operably linked to a promoter comprising the sequence of SEQ ID NO: 44, or a sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical thereto. In a particularly preferred embodiment, the rAAV comprises a nucleic acid comprising or consisting of the nucleotide sequence of SEQ ID NO:45.

[0024] In another embodiment, provided herein is a pharmaceutical composition suitable for inhalation, comprising (i) an rAAV infectious rAAV comprising (a) a capsid comprising the capsid protein of SEQ ID NO: 12 and (b) a nucleic acid comprising a nucleotide sequence encoding one or more gene products, in (ii) a buffer containing about 10 mM to about 50 mM citrate, about 70 mM to about 150 mM NaCl, and optionally a surfactant, preferably a non-ionic surfactant, such as Pluronic F-68, more preferably about 0.005% Pluronic F68, and having a pH between 5 and 7, preferably about 6.0. In some preferred aspects, the pharmaceutical composition comprises about 20 mM to about 50 mM citrate, about 85 mM to about 125 mM NaCl, and about 0.005% Pluronic F68, and has a pH of about 6.0. In some particularly preferred aspects, the pharmaceutical composition comprises about 20 mM citrate, about 125 mM NaCl, and about 0.005% Pluronic F68, at a pH of about 6.0. In preferred embodiments, the pharmaceutical composition comprises an rAAV comprising (a) a capsid comprising the capsid protein of SEQ ID NO: 12, and (b) a nucleic acid operably linked to a promoter, the nucleic acid comprising a nucleotide sequence encoding human cystic fibrosis transmembrane conductance regulator (CFTR) protein or a biologically active truncated CFTR protein lacking amino acids 708-759 of the human CFTR protein sequence. In related embodiments, the rAAV comprises a nucleic acid comprising or consisting of the nucleotide sequence of SEQ ID NO: 45.

[0025] In some embodiments, the pharmaceutical composition comprises 10 11 ~10 14 In some preferred embodiments, the pharmaceutical composition comprises between about 1 x 10 13 ~Approx. 9×10 13 vg / ml, preferably about 2×10 13 ~6×10 13 In another preferred embodiment, the pharmaceutical comprises about 1 x 10 13 vg / ml, approx. 2×10 13 vg / ml, approx. 3×10 13vg / ml, approx. 4×10 13 vg / ml, approx. 5×10 13 vg / ml, approximately 6×10 13 vg / ml, approx. 7×10 13 vg / ml, approx. 8×10 13 vg / ml, or approximately 9 × 10 13 In a particularly preferred embodiment, the pharmaceutical composition comprises about 2×10 13 vg / ml ~ approx. 5×10 13 Contains vg / ml.

[0026] In some embodiments, the pharmaceutical composition is formulated as a solution / suspension suitable for aerosolized delivery. In related embodiments, the pharmaceutical composition is formulated as an aerosol and / or is in an inhalable dosage form.

[0027] Also provided herein are methods for delivering heterologous nucleic acid to lung cells, the methods comprising contacting the lung cells with rAAV virions comprising (i) a capsid comprising the capsid protein of SEQ ID NO: 12 and (ii) a heterologous nucleic acid comprising a nucleotide sequence encoding one or more gene products. In some embodiments, the heterologous nucleic acid encodes a protein and / or a small interfering RNA. In some preferred embodiments, the lung cells are any cells of the lung or trachea. In other preferred embodiments, the lung cells are airway epithelial cells, including but not limited to alveolar epithelial cells, bronchial (primary, secondary, or tertiary) epithelial cells, or tracheal epithelial cells. In some preferred aspects, the lung cells are ciliated airway epithelial cells. In some preferred aspects, the lung cells are alveolar epithelial type 1 (AECI) or type 2 (AECII) cells. In other embodiments, the lung cells are smooth muscle cells or endothelial cells. In other embodiments, the lung cells are basal cells, goblet cells, or oocytes. In a particularly preferred embodiment, the rAAV comprises a nucleic acid comprising or consisting of the nucleotide sequence of SEQ ID NO:45.

[0028] Also provided herein is a method of delivering a heterologous nucleic acid to the lungs of a subject (e.g., a human subject), comprising administering to the subject an rAAV virion comprising: (i) a capsid comprising the capsid protein of SEQ ID NO: 12; and (ii) a heterologous nucleic acid comprising a nucleotide sequence encoding one or more gene products. In some embodiments, the heterologous nucleic acid encodes a protein and / or a small interfering RNA. In a related embodiment, a method of delivering a heterologous nucleic acid to the upper respiratory tract, nasopharynx, paranasal sinuses, oral / cheek region, and / or salivary glands of a subject (e.g., a human subject), comprising administering to the subject an rAAV virion comprising: (i) a capsid comprising the capsid protein of SEQ ID NO: 12; and (ii) a heterologous nucleic acid comprising a nucleotide sequence encoding one or more gene products. In a related aspect, the rAAV or a pharmaceutical composition comprising the same is administered to the subject by pulmonary, intrabronchial, intranasal, intratracheal, and / or intrabronchial administration. In a particularly preferred embodiment, the rAAV comprises a nucleic acid comprising or consisting of the nucleotide sequence of SEQ ID NO:45.

[0029] Also provided herein is a method for treating a pulmonary disease, comprising administering to a subject in need thereof a therapeutically effective amount of a recombinant AAV (rAAV) comprising: (i) a capsid comprising the capsid protein of SEQ ID NO: 12; and (ii) a heterologous nucleic acid comprising a nucleotide sequence encoding one or more gene products, wherein the one or more gene products are operably linked to a promoter. In some aspects, the heterologous nucleic acid comprises nucleotide sequences encoding multiple gene products, in which case expression of multiple (e.g., two) gene products can be mediated by multiple (e.g., two) independent promoters, or multiple transgenes can be separated by an internal ribosome entry site (IRES) or 2A peptide sequence and mediated by a single promoter. In preferred embodiments, the heterologous nucleic acid encodes a therapeutic protein and / or a therapeutic small interfering RNA. In related aspects, the gene product(s) delivered by the rAAV reduce the level of an interfering gene product and / or introduce or supplement the level of a supporting gene product. In particularly preferred embodiments, the rAAV comprises a nucleic acid comprising or consisting of the nucleotide sequence of SEQ ID NO: 45. In other preferred embodiments, the rAAV comprises a nucleic acid comprising a nucleotide sequence encoding alpha-1-antitrypsin.

[0030] In some embodiments, the pulmonary disease is selected from the group consisting of pulmonary arterial hypertension, pulmonary hypertension, lung cancer (primary, secondary, and metastatic), surfactant deficiency, viral and / or bacterial infections, cystic fibrosis, acute bronchitis, pneumonia (including viral, bacterial, and fungal pneumonia), respiratory tract infections (including pharyngitis, croup, aspergillus, coccidiomycosis, hantavirus pulmonary syndrome, and histoplasmosis), chemical and hypersensitivity pneumonitis, tuberculosis and other mycobacterial infections (including, but not limited to, mycobacterium avium), sarcoidosis, respiratory syncytial virus, pulmonary edema, acute respiratory distress syndrome (ARDS), pneumoconiosis (including anthraxosis, asbestosis, and silicosis), interstitial lung disease (including sarcoidosis and autoimmune diseases), pulmonary embolism, pleural effusion, and the like. effusion, pleuritis, mesothelioma, pneumothorax, acute bronchitis, bronchiolitis (including bronchiolitis obliterans), sudden infant death syndrome, sleep apnea, bronchiectasis, bronchopulmonary dysplasia, idiopathic organizing pneumonia, e-cigarette or vaping use associated lung injury (EVALI), Middle East Respiratory Syndrome (MERS), primary ciliary dyskinesia, severe acute respiratory syndrome (SARS), alpha-1-antitrypsin deficiency, asthma, interstitial lung disease, and COVID-19 (novel coronavirus disease 2019). In other embodiments, the pulmonary disease is chronic obstructive pulmonary disease (COPD) or idiopathic pulmonary fibrosis (IPF). In a related aspect, a method of treating COVID-19 is provided, comprising administering to a subject in need thereof a therapeutically effective amount of a recombinant AAV (rAAV) or a pharmaceutical composition comprising the rAAV, the rAAV comprising: (i) a capsid comprising the capsid protein of SEQ ID NO: 12; and (ii) a heterologous nucleic acid comprising a nucleotide sequence encoding one or more gene products operably linked to one or more promoters, wherein the gene product(s) knockdown, modify, and / or overexpress viral gene products or host cell genes to reduce or eliminate viral pathogenesis or replication in either the lungs or nasopharyx, and / or result in the expression of neutralizing antibodies against viral epitopes.

[0031] In some embodiments, genes that can be targeted for the treatment of IPF include, but are not limited to, SFTPA1 (surfactant A1) and caveolin-1. Genes that can be targeted for the treatment of COPD include, but are not limited to, alpha-1-antitrypsin, alpha-1-antichymotrypsin, alpha-1-macroglobulin, matrix metalloproteinase 1 (MMP1), matrix metalloproteinase 12 (MMP12), microsomal epoxide hydrolyase, CYP1A1, glutathione S-transferase, heme oxygenase-1, TGF-beta-1, TNF-alpha, IL-1 complex, IL-8, IL-13, human leukocyte antigen (HLA-B7 and Bw16), vitamin D binding protein, and beta-2-adrenergic receptor.

[0032] In related aspects, to treat a pulmonary disease in a subject in need thereof, the rAAV or pharmaceutical composition is administered by pulmonary, intrabronchial, intranasal, intratracheal, and / or intrabronchial administration. In some preferred embodiments, the infectious rAAV is administered using a nebulizer.

[0033] In other embodiments, about 10% of rAAV is administered to treat a pulmonary disease. 12 ~10 14 At least one dose of vector genomes (vg) / kg is administered to the subject. In a related embodiment, the subject is administered about 1 x 10 11 ~Approx. 1×10 14 vg / kg, approximately 1×10 12 ~Approx. 9×10 13 vg / kg, approximately 1×10 12 vg / kg ~ approx. 9×10 12 vg / kg, preferably about 2×10 12 vg / kg ~ approx. 3×10 12 vg / kg, more preferably about 2.6×10 12 vg / kg, approx. 2.7×10 12 vg / kg, approx. 2.8×10 12vg / kg, approximately 2.9×10 12 vg / kg approx. 3.0×10 12 vg / kg or approximately 3.1 × 10 12 In a preferred embodiment, subjects are administered one or more doses in one or more doses, each dose being about 1 x 10 vg / kg. 13 ~Approx. 1×10 15 For the vector genome (vg), approximately 1 × 10 13 ~Approx. 1×10 14 vg, approx. 1×10 14 ~Approx. 1×10 15 vg, or approximately 1 × 10 15 ~Approx. 5×10 15 In some preferred embodiments, each dose contains between about 1 x 10 vg of rAAV. 14 vg or approximately 1×10 15 vg of rAAV.

[0034] The present disclosure further provides infectious recombinant adeno-associated virus (rAAV) virions comprising a variant capsid protein and a heterologous nucleic acid. The present disclosure further provides variant adeno-associated virus (AAV) capsid proteins (and / or nucleic acids encoding the variant AAV capsid proteins) that confer increased resistance to human AAV neutralizing antibodies on infectious rAAV virions. The present disclosure further provides host cells comprising infectious rAAV virions and / or nucleic acids encoding the subject variant AAV capsid proteins. The present disclosure further provides libraries of the above-described virions, capsid proteins, nucleic acids, and / or host cells, wherein the variant AAV capsid protein of at least one member of the library comprises an amino acid sequence having at least one amino acid substitution compared to the amino acid sequence set forth in one of SEQ ID NOs: 10-13 and 26-33.

[0035] The present disclosure further provides methods for delivering heterologous nucleic acids to target cells, contacting the target cells with a subject infectious rAAV virion. The present disclosure also provides methods for delivering gene products to an individual, generally involving administering to an individual in need thereof an effective amount of a subject rAAV virion. Compositions and kits for carrying out the subject methods are also provided herein.

[0036] Features of the present disclosure include infectious recombinant adeno-associated virus (rAAV) virions comprising: (a) a variant adeno-associated virus (AAV) capsid protein comprising an amino acid sequence having at least about 90% amino acid sequence identity to the amino acid sequence set forth in one of SEQ ID NOs: 11-13 and 26-33; and (b) a heterologous nucleic acid. In some cases, the variant AAV capsid protein comprises an amino acid sequence having at least about 95% amino acid sequence identity to the amino acid sequence set forth in one of SEQ ID NOs: 11-13 and 26-33. In some cases, the variant AAV capsid protein comprises an amino acid sequence set forth in one of SEQ ID NOs: 11-13 and 26-33.

[0037] Features of the present disclosure include: (a) a variant adeno-associated virus (AAV) capsid protein comprising an amino acid sequence having at least about 95% amino acid sequence identity to the amino acid sequence set forth in SEQ ID NO: 10, and including the amino acid substitutions N312K, N449D, D472N, N551S, 1698V, and L735Q relative to SEQ ID NO: 2; and (b) an infectious recombinant adeno-associated virus (rAAV) virion comprising a heterologous nucleic acid. In some cases, the variant AAV capsid protein comprises the amino acid sequence set forth in SEQ ID NO: 10. In some cases, the rAAV exhibits increased resistance to human AAV neutralizing antibodies compared to the resistance exhibited by AAV2 (wild-type AAV serotype 2). In some cases, the rAAV exhibits resistance to human AAV neutralizing antibodies that is at least about 1.5-fold (e.g., at least about 3-fold, at least about 5-fold, at least about 10-fold, at least about 30-fold, etc.) greater than the resistance exhibited by AAV2. In some cases, rAAV exhibits increased mammalian cell transduction in the presence of human AAV neutralizing antibodies compared to the mammalian cell transduction exhibited by wild-type AAV serotype 2 (AAV2). In some cases, the mammalian cell is a hepatocyte, a pancreatic cell, a skeletal muscle cell, a cardiac muscle cell, a fibroblast, a retinal cell, a synovial joint cell, a lung cell, a T cell, a neuron, a glial cell, a stem cell (e.g., a hematopoietic stem cell, a hematopoietic progenitor cell, a neural stem cell, a neural progenitor cell, a neural crest stem cell, an embryonic stem cell, an induced pluripotent stem cell (iPS cell), a mesenchymal stem cell, a mesodermal stem cell, a hepatic stem cell, a pancreatic stem cell, a pancreatic progenitor cell, a muscle stem cell, a retinal stem cell, etc.), an endothelial cell, or a cancer cell. In some cases, the heterologous nucleic acid comprises an RNA interference agent. In some cases, the heterologous nucleic acid comprises a nucleotide sequence encoding a polypeptide.

[0038] The present disclosure features an isolated nucleic acid comprising a nucleotide sequence encoding a variant adeno-associated virus (AAV) capsid protein comprising an amino acid sequence having at least about 90% amino acid sequence identity to the amino acid sequence set forth in one of SEQ ID NOs: 11-13 and 26-33. In some cases, the encoded variant AAV capsid protein comprises an amino acid sequence having at least about 95% amino acid sequence identity to the amino acid sequence set forth in one of SEQ ID NOs: 11-13 and 26-33. In some cases, the encoded variant AAV capsid protein comprises an amino acid sequence having at least about 95% amino acid sequence identity to the amino acid sequence set forth in one of SEQ ID NOs: 11-13 and 26-33.

[0039] The present disclosure features an isolated nucleic acid comprising a nucleotide sequence encoding a variant adeno-associated virus (AAV) capsid protein comprising an amino acid sequence having at least about 95% amino acid sequence identity to the amino acid sequence set forth in SEQ ID NO:10, and comprising the amino acid substitutions N312K, N449D, D472N, N551S, I698V, and L735Q relative to SEQ ID NO:2.

[0040] In some cases, the encoded variant AAV capsid protein (encoded by the isolated nucleic acid) confers on infectious recombinant adeno-associated virus (rAAV) virions increased resistance to human AAV neutralizing antibodies compared to the resistance exhibited by AAV2 (wild-type AAV serotype 2). In some cases, the increased resistance is at least about 1.5-fold (e.g., at least about 3-fold, at least about 5-fold, at least about 10-fold, at least about 30-fold, etc.) greater than the resistance exhibited by AAV2. In some cases, the encoded variant AAV capsid protein (encoded by the isolated nucleic acid) confers on infectious recombinant adeno-associated virus (rAAV) virions increased transduction of mammalian cells in the presence of human AAV neutralizing antibodies compared to the transduction exhibited by AAV2.

[0041] The present disclosure features an isolated host cell comprising the subject nucleic acid.In some cases, the host cell is stably transfected with the nucleic acid.In some cases, the host cell further comprises a nucleic acid comprising a nucleotide sequence encoding an AAV rep protein.In some cases, the host cell further comprises a recombinant AAV vector.

[0042] The present disclosure features methods for delivering heterologous nucleic acids to target cells, the methods comprising contacting the target cells with a subject virion (described above). In some cases, the target cells are hepatocytes, pancreatic cells, skeletal muscle cells, cardiac muscle cells, fibroblasts, retinal cells, synovial joint cells, lung cells, T cells, neurons, glial cells, stem cells (e.g., hematopoietic stem cells, hematopoietic progenitor cells, neural stem cells, neural progenitor cells, neural crest stem cells, embryonic stem cells, induced pluripotent stem cells (iPS cells), mesenchymal stem cells, mesodermal stem cells, hepatic stem cells, pancreatic stem cells, pancreatic progenitor cells, muscle stem cells, or retinal stem cells), endothelial cells, or cancer cells. In some cases, the target cells are in vitro. In some cases, the target cells are in vivo.

[0043] The present disclosure features methods for delivering a gene product to an individual in need thereof, comprising administering to the individual an effective amount of a subject infectious recombinant adeno-associated virus (rAAV) virion (described above). In some cases, the heterologous nucleic acid of the rAAV virion comprises an RNA interference agent. In some cases, the heterologous nucleic acid of the rAAV virion comprises a nucleotide sequence encoding a polypeptide. In some cases, the administering step comprises indirect delivery of the infectious rAAV virion. In some cases, the administering step comprises direct delivery of the infectious rAAV virion.

[0044] Features of the present disclosure include variant adeno-associated virus (AAV) capsid proteins comprising an amino acid sequence having at least about 90% amino acid sequence identity to the amino acid sequence set forth in one of SEQ ID NOs: 11-13 and 26-33. In some cases, the AAV capsid protein comprises an amino acid sequence having at least about 95% amino acid sequence identity to the amino acid sequence set forth in one of SEQ ID NOs: 11-13 and 26-33. In some cases, the AAV capsid protein comprises an amino acid sequence set forth in one of SEQ ID NOs: 11-13 and 26-33.

[0045] Features of the present disclosure include a variant adeno-associated virus (AAV) capsid protein comprising an amino acid sequence having at least about 95% amino acid sequence identity to the amino acid sequence set forth in SEQ ID NO: 10, and comprising the amino acid substitutions N312K, N449D, D472N, N551S, 1698V, and L735Q relative to SEQ ID NO: 2. In some cases, the variant AAV capsid protein comprises the amino acid sequence set forth in SEQ ID NO: 10. In some cases, the variant AAV capsid protein confers on infectious recombinant adeno-associated virus (rAAV) virions increased resistance to human AAV neutralizing antibodies compared to the resistance exhibited by AAV2. In some cases, the increased resistance is at least about 1.5-fold (e.g., at least about 3-fold, at least about 5-fold, at least about 10-fold, at least about 30-fold, etc.) greater than the resistance exhibited by AAV2. In some cases, variant AAV capsid proteins confer infectious recombinant adeno-associated virus (rAAV) virions increased transduction of mammalian cells in the presence of human AAV neutralizing antibodies compared to the transduction exhibited by AAV2.

[0046] Features of the present disclosure include: (i) two or more infectious rAAV virions, each comprising a variant adeno-associated virus (AAV) capsid protein and a heterologous nucleic acid; (ii) two or more isolated nucleic acids, each comprising a nucleotide sequence encoding a variant AAV capsid protein; (iii) two or more host cells, each comprising a nucleic acid comprising a nucleotide sequence encoding a variant AAV capsid protein; and (iv) a library comprising at least one of the two or more variant AAV capsid proteins, wherein the variant AAV capsid protein of at least one member of the library comprises an amino acid sequence having at least one amino acid substitution compared to the amino acid sequence set forth in one of SEQ ID NOs: 10-13 and 26-33.

[0047] The disclosure features methods for generating and identifying modified infectious rAAV virions that exhibit altered infectious properties relative to a starter (parent) virion comprising a starter capsid protein, the method comprising: (a) generating variant adeno-associated virus (AAV) capsid proteins from a starter capsid protein, wherein the starter capsid proteins comprise an amino acid sequence set forth in one of SEQ ID NOs: 10-13 and 26-33, and each variant AAV capsid protein comprises at least one amino acid substitution relative to the starter capsid protein; (b) generating variant AAV virions, each comprising the variant capsid AAV protein generated in step (a); and (c) assaying the variant AAV virions generated in step (b) for altered infectious properties to identify modified infectious rAAV virions. In some cases, generating the library of variant AAV capsid proteins comprises a mutagenesis method selected from the group consisting of polymerase chain reaction mutagenesis, oligonucleotide-directed mutagenesis, saturation mutagenesis, loop-swapping mutagenesis, fragment-shuffling mutagenesis, and combinations thereof. In some cases, the altered infection characteristic is increased resistance to human AAV neutralizing antibodies compared to the resistance exhibited by the starter virion. In some cases, the altered infection characteristic is increased transduction of mammalian cells in the presence of human AAV neutralizing antibodies compared to the transduction exhibited by the starter virion. In some cases, the modified infectious rAAV virions comprise modified AAV capsid proteins comprising an amino acid sequence having at least about 90% amino acid sequence identity to a starter capsid protein.

[0048] The disclosure features a method of generating a variant AAV capsid protein from a starter capsid protein, comprising subjecting a nucleic acid comprising a nucleotide sequence encoding the starter capsid protein to a type of mutagenesis selected from the group consisting of polymerase chain reaction mutagenesis, oligonucleotide-directed mutagenesis, saturation mutagenesis, loop-swapping mutagenesis, fragment-shuffling mutagenesis, and combinations thereof, wherein the starter capsid protein comprises an amino acid sequence set forth in one of SEQ ID NOs: 10-13 and 26-33. In an embodiment of the present invention, for example, the following items are provided: (Item 1) A recombinant adeno-associated virus (rAAV) vector comprising: (i) a capsid comprising the capsid protein of SEQ ID NO: 12; and (ii) a nucleic acid comprising, from 5' to 3', (a) an AAV2 terminal repeat, (b) a promoter, (c) a nucleotide sequence encoding human cystic fibrosis transmembrane conductance regulator (CFTR) protein or a biologically active truncated CFTR protein lacking amino acids 708 to 759 of the human CFTR protein sequence, (d) a polyadenylation sequence, and (e) an AAV2 terminal repeat. (Item 2) 2. The rAAV virus of item 1, wherein the nucleotide sequence encoding human CFTR has the nucleotide sequence of SEQ ID NO: 43 or a sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical thereto. (Item 3) 3. The rAAV virus of item 1 or 2, wherein the promoter is a constitutive promoter, optionally a shortened version of the CMV immediate-early / enhancer / promoter. (Item 4) 3. The rAAV virus of item 1 or 2, wherein the promoter is a tissue-specific promoter, preferably wherein the promoter directs preferential expression of the nucleic acid in lung cells. (Item 5) 3. The rAAV virus of item 1 or 2, wherein the promoter is a CMV173 promoter and is operably linked to the nucleotide sequence encoding human CFTR. (Item 6) 6. The rAAV virus of item 5, wherein the CMV173 promoter has the sequence of SEQ ID NO: 44. (Item 7) The rAAV virus of item 1, wherein the nucleic acid comprises the nucleotide sequence of SEQ ID NO: 45. (Item 8) A method for treating cystic fibrosis or a lung disease associated therewith in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an infectious rAAV described in any one of items 1 to 7, preferably in an amount effective to ameliorate one or more characteristics of cystic fibrosis, optionally selected from upper airway inflammation, aberrant epithelial cytokine signaling, and elevated IgE levels. (Item 9) 9. The method of claim 8, wherein the rAAV is administered to the subject by pulmonary (bronchial) and / or nasal administration, preferably by inhalation, and preferably in a single dose. (Item 10) The rAAV is administered to the subject at a dose of 1×10 13 ~5×10 15 For vector genomes (vg), more preferably 1 × 10 14 ~1×10 15 10. The method of claim 8 or 9, wherein the administration is in one or more doses between vg. (Item 11) 8. The rAAV of any one of items 1 to 7 for use in treating cystic fibrosis or a lung disease related thereto. (Item 12) 8. The rAAV of any one of items 1 to 7 for use in the manufacture of a medicament for the treatment of cystic fibrosis or a lung disease related thereto. (Item 13) 8. A pharmaceutical composition suitable for inhalation comprising the rAAV of any one of items 1 to 7, and a buffer solution containing about 10 mM to about 50 mM citrate, about 70 mM to about 150 mM NaCl, and optionally a surfactant, preferably a non-ionic surfactant, such as Pluronic F-68, more preferably about 0.005% Pluronic F68, wherein the buffer solution has a pH of about 6.0. (Item 14) Item 14. The pharmaceutical composition according to item 13, comprising about 20 mM to about 50 mM citrate, about 85 mM to about 125 mM NaCl, and about 0.005% Pluronic F68, and having a pH of about 6.0. (Item 15) 15. The pharmaceutical composition of item 14, comprising about 20 mM citrate, about 125 mM NaCl, and about 0.005% Pluronic F68, and having a pH of about 6.0. (Item 16) 10 per ml 11 ~10 14 16. The pharmaceutical composition according to any one of items 13 to 15, comprising a vector genome (vg). (Item 17) Approximately 1×10 13 ~Approx. 9×10 13 vg / ml, preferably about 2×10 13 ~6×10 13 vg / ml, more preferably about 2×10 13 17. The pharmaceutical composition according to item 16, comprising 100 mg of 10 ... (Item 18) 18. The pharmaceutical composition according to any one of items 13 to 17, which is in the form of a solution / suspension suitable for aerosolized delivery or formulated as an aerosol and / or in an inhalable dosage form. (Item 19) 19. A method for treating cystic fibrosis or a lung disease associated therewith in a subject in need thereof, comprising administering to the subject a pharmaceutical composition according to any one of items 13 to 18. (Item 20) A method for delivering a heterologous nucleic acid to a lung cell, comprising contacting the lung cell with an rAAV virion comprising: (i) a capsid comprising the capsid protein of SEQ ID NO: 12; and (ii) a heterologous nucleic acid comprising a nucleotide sequence encoding a gene product, thereby expressing the gene product in the lung cell. (Item 21) 21. The method of claim 20, wherein the heterologous nucleic acid comprises a nucleotide sequence encoding a human cystic fibrosis transmembrane conductance regulator (CFTR) protein or a biologically active truncated CFTR protein lacking amino acids 708 to 759 of the human CFTR protein sequence. (Item 22) 22. The method of claim 21, wherein the heterologous nucleic acid comprises the sequence of SEQ ID NO: 45 or a sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical thereto. (Item 23) 24. The method of any one of items 20 to 22, wherein the lung cells are airway epithelial cells. 24. The method of item 23, wherein the epithelial cells are alveolar epithelial cells, bronchial (primary, secondary or tertiary) epithelial cells or tracheal epithelial cells. (Item 25) 25. The method of claim 24, wherein the lung cells are alveolar epithelial type 1 (AECI) or type 2 (AECII) cells. (Item 26) 23. The method of any one of items 20 to 22, wherein the lung cells are smooth muscle cells or endothelial cells. (Item 27) A method for treating a pulmonary disease, comprising administering to a subject in need thereof a therapeutically effective amount of a recombinant AAV (rAAV) comprising: (i) a capsid comprising a capsid protein comprising the amino acid sequence set forth as SEQ ID NO: 12; and (ii) a heterologous nucleic acid comprising a nucleotide sequence encoding one or more gene products operably linked to one or more promoters; or administering to the subject a pharmaceutical composition comprising the rAAV. (Item 28) The pulmonary disease may be chronic obstructive pulmonary disease (COPD), idiopathic pulmonary fibrosis (IPF), pulmonary arterial hypertension, pulmonary hypertension, lung cancer (primary, secondary and metastatic), surfactant deficiency, viral and / or bacterial infections, cystic fibrosis, acute bronchitis, pneumonia (including viral, bacterial and fungal pneumonia), respiratory tract infections (including pharyngitis, croup, aspergillosis, coccidioidomycosis, hantavirus pulmonary syndrome, and histoplasmosis), chemical and hypersensitivity pneumonitis, tuberculosis and other mycobacterial infections (including, but not limited to, mycobacterium avium), sarcoidosis, respiratory syncytial virus, pulmonary edema, acute respiratory distress syndrome (ARDS), pneumoconiosis (including anthrax, asbestosis, and silicosis), interstitial lung disease (including sarcoidosis and autoimmune diseases), pulmonary embolism, pleural effusion, pleuritis, mesothelioma, pneumothorax, acute bronchitis, bronchiolitis (including bronchiolitis obliterans), sudden infant death syndrome, sleep apnea, bronchiectasis, bronchopulmonary dysplasia, idiopathic organizing pneumonia, e-cigarette or vaping use associated lung injury (EVALI), Middle East respiratory syndrome (MERS), primary ciliary dyskinesia, severe acute respiratory syndrome (SARS), alpha-1-antitrypsin deficiency, asthma, interstitial lung disease, and COVID-19 (novel coronavirus disease 2019). (Item 29) 29. The method of claim 28, wherein the pulmonary disease is chronic obstructive pulmonary disease (COPD) or idiopathic pulmonary fibrosis (IPF). (Item 30) 30. The method of claim 29, wherein the pulmonary disease is COPD, and the rAAV optionally comprises a heterologous nucleic acid encoding a gene product targeting one or more genes selected from alpha-1-antitrypsin, alpha-1-antichymotrypsin, alpha-1-macroglobulin, matrix metalloproteinase 1 (MMP1), matrix metalloproteinase 12 (MMP12), microsomal epoxide hydrolyase, CYP1A1, glutathione S-transferase, heme oxygenase-1, TGF-beta-1, TNF-alpha, IL-1 complex, IL-8, IL-13, human leukocyte antigens (HLA-B7 and Bw16), vitamin D binding protein, and beta-2-adrenergic receptor. (Item 31) 30. The method of claim 29, wherein the lung disease is IPF, and the rAAV optionally comprises a heterologous nucleic acid encoding a gene product that targets one or more genes selected from SFTPA1 (surfactant A1) and caveolin-1. (Item 32) 29. The method of claim 28, wherein the lung disease is alpha-1-antitrypsin deficiency and the rAAV comprises a heterologous nucleic acid encoding a functional alpha-1-antitrypsin. (Item 33) 33. The method of any one of items 27 to 32, wherein the rAAV or pharmaceutical composition is administered by pulmonary, intrabronchial, intranasal, intratracheal, and / or intrabronchial administration. (Item 34) Approximately 10% of the rAAV 12 ~10 15 34. The method of any one of items 27 to 33, wherein at least one dose of vector genome (vg) is administered to the subject. (Item 35) The subject is about 1×10 13 ~Approx. 5×10 15 vg, preferably about 1 × 10 14 vg~approx. 1×10 15 35. The method of claim 34, wherein the patient is administered 20 mg of ribozyme. (Item 36) A nucleic acid encoding a biologically active human CFTR protein lacking amino acids 708-759 and that is codon-optimized for expression in humans, the nucleic acid comprising the nucleotide sequence set forth as SEQ ID NO:43, or a sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical thereto. (Item 37) 37. The nucleic acid according to item 36, comprising or consisting of the nucleotide sequence set forth as SEQ ID NO: 43. (Item 38) 38. An expression cassette comprising the nucleic acid of item 36 or 37 and an expression control sequence operably linked to and heterologous to the nucleic acid sequence. (Item 39) 39. The expression cassette of item 38, wherein the expression control sequence comprises a CMV173 promoter having the nucleotide sequence set forth as SEQ ID NO: 44. (Item 40) 40. The expression cassette of claim 38 or 39, comprising, from 5' to 3', (a) AAV2 terminal repeats, (b) a CMV173 promoter, (c) a codon-optimized gene of SEQ ID NO: 43, and (d) an AAV2 terminal repeat. (Item 41) 41. The expression cassette of item 40, further comprising an SV40 polyadenylation sequence between (c) and (d). [Brief explanation of the drawings]

[0049] [Figure 1] 1A-B show directed evolution of AAV for enhanced antibody evasion.

[0050] [Figure 2-1] Figures 2A-B show the neutralization profiles of antibody escape variants using human IVIG. [Figure 2-2] Figures 2A-B show the neutralization profiles of antibody escape variants using human IVIG.

[0051] [Figure 3-1] Figures 3A-C show the neutralization profiles of antibody escape variants using human sera obtained from individuals who were excluded from hemophilia B clinical trials due to the presence of high neutralizing antibody titers against AAV. [Figure 3-2] Figures 3A-C show the neutralization profiles of antibody escape variants using human sera obtained from individuals who were excluded from hemophilia B clinical trials due to the presence of high neutralizing antibody titers against AAV.

[0052] [Figure 4] Figure 4A-B shows the amino acid sequences of the loop-swap / shuffle and saturation mutagenesis clones.

[0053] [Figure 5] FIG. 5 shows the in vitro tropism of AAV variants.

[0054] [Figure 6] 6A-B show the in vivo localization and neutralization of novel AAV variants.

[0055] [Figure 7] 7A-D show the generation of human antibody escapees.

[0056] [Figure 8-1] Figures 8A-I show the capsid protein sequence of Shuffle100-1 (SEQ ID NO: 11) aligned with the wild-type capsid protein sequences of AAV1-9 (SEQ ID NOs: 1-9). [Figure 8-2] Figures 8A-I show the capsid protein sequence of Shuffle100-1 (SEQ ID NO: 11) aligned with the wild-type capsid protein sequences of AAV1-9 (SEQ ID NOs: 1-9). [Figure 8-3] Figures 8A-I show the capsid protein sequence of Shuffle100-1 (SEQ ID NO: 11) aligned with the wild-type capsid protein sequences of AAV1-9 (SEQ ID NOs: 1-9). [Figure 8-4] Figures 8A-I show the capsid protein sequence of Shuffle100-1 (SEQ ID NO: 11) aligned with the wild-type capsid protein sequences of AAV1-9 (SEQ ID NOs: 1-9). [Figure 8-5] Figures 8A-I show the capsid protein sequence of Shuffle100-1 (SEQ ID NO: 11) aligned with the wild-type capsid protein sequences of AAV1-9 (SEQ ID NOs: 1-9). [Figure 8-6] Figures 8A-I show the capsid protein sequence of Shuffle100-1 (SEQ ID NO: 11) aligned with the wild-type capsid protein sequences of AAV1-9 (SEQ ID NOs: 1-9). [Figure 8-7] Figures 8A-I show the capsid protein sequence of Shuffle100-1 (SEQ ID NO: 11) aligned with the wild-type capsid protein sequences of AAV1-9 (SEQ ID NOs: 1-9). [Figure 8-8] Figures 8A-I show the capsid protein sequence of Shuffle100-1 (SEQ ID NO: 11) aligned with the wild-type capsid protein sequences of AAV1-9 (SEQ ID NOs: 1-9). [Figure 8-9] Figures 8A-I show the capsid protein sequence of Shuffle100-1 (SEQ ID NO: 11) aligned with the wild-type capsid protein sequences of AAV1-9 (SEQ ID NOs: 1-9).

[0057] [Figure 9-1] Figures 9A-I show the capsid protein sequence of Shuffle100-3 (SEQ ID NO: 12) aligned with the wild-type capsid protein sequences of AAV1-9 (SEQ ID NOs: 1-9). [Figure 9-2] Figures 9A-I show the capsid protein sequence of Shuffle100-3 (SEQ ID NO: 12) aligned with the wild-type capsid protein sequences of AAV1-9 (SEQ ID NOs: 1-9). [Figure 9-3]Figures 9A-I show the capsid protein sequence of Shuffle100-3 (SEQ ID NO: 12) aligned with the wild-type capsid protein sequences of AAV1-9 (SEQ ID NOs: 1-9). [Figure 9-4] Figures 9A-I show the capsid protein sequence of Shuffle100-3 (SEQ ID NO: 12) aligned with the wild-type capsid protein sequences of AAV1-9 (SEQ ID NOs: 1-9). [Figure 9-5] Figures 9A-I show the capsid protein sequence of Shuffle100-3 (SEQ ID NO: 12) aligned with the wild-type capsid protein sequences of AAV1-9 (SEQ ID NOs: 1-9). [Figure 9-6] Figures 9A-I show the capsid protein sequence of Shuffle100-3 (SEQ ID NO: 12) aligned with the wild-type capsid protein sequences of AAV1-9 (SEQ ID NOs: 1-9). [Figure 9-7] Figures 9A-I show the capsid protein sequence of Shuffle100-3 (SEQ ID NO: 12) aligned with the wild-type capsid protein sequences of AAV1-9 (SEQ ID NOs: 1-9). [Figure 9-8] Figures 9A-I show the capsid protein sequence of Shuffle100-3 (SEQ ID NO: 12) aligned with the wild-type capsid protein sequences of AAV1-9 (SEQ ID NOs: 1-9). [Figure 9-9] Figures 9A-I show the capsid protein sequence of Shuffle100-3 (SEQ ID NO: 12) aligned with the wild-type capsid protein sequences of AAV1-9 (SEQ ID NOs: 1-9).

[0058] [Figure 10-1] Figures 10A-I show the capsid protein sequence of Shuffle100-7 (SEQ ID NO: 13) aligned with the wild-type capsid protein sequences of AAV1-9 (SEQ ID NOs: 1-9). [Figure 10-2] Figures 10A-I show the capsid protein sequence of Shuffle100-7 (SEQ ID NO: 13) aligned with the wild-type capsid protein sequences of AAV1-9 (SEQ ID NOs: 1-9). [Figure 10-3] Figures 10A-I show the capsid protein sequence of Shuffle100-7 (SEQ ID NO: 13) aligned with the wild-type capsid protein sequences of AAV1-9 (SEQ ID NOs: 1-9). [Figure 10-4] Figures 10A-I show the capsid protein sequence of Shuffle100-7 (SEQ ID NO: 13) aligned with the wild-type capsid protein sequences of AAV1-9 (SEQ ID NOs: 1-9). [Figure 10-5] Figures 10A-I show the capsid protein sequence of Shuffle100-7 (SEQ ID NO: 13) aligned with the wild-type capsid protein sequences of AAV1-9 (SEQ ID NOs: 1-9). [Figure 10-6] Figures 10A-I show the capsid protein sequence of Shuffle100-7 (SEQ ID NO: 13) aligned with the wild-type capsid protein sequences of AAV1-9 (SEQ ID NOs: 1-9). [Figure 10-7] Figures 10A-I show the capsid protein sequence of Shuffle100-7 (SEQ ID NO: 13) aligned with the wild-type capsid protein sequences of AAV1-9 (SEQ ID NOs: 1-9). [Figure 10-8] Figures 10A-I show the capsid protein sequence of Shuffle100-7 (SEQ ID NO: 13) aligned with the wild-type capsid protein sequences of AAV1-9 (SEQ ID NOs: 1-9). [Figure 10-9] Figures 10A-I show the capsid protein sequence of Shuffle100-7 (SEQ ID NO: 13) aligned with the wild-type capsid protein sequences of AAV1-9 (SEQ ID NOs: 1-9).

[0059] [Figure 11] FIG. 11 shows neutralizing antibody titers of library clones and parental serotypes in immunized mouse sera.

[0060] [Figure 12]FIG. 12 illustrates the directed evolution process utilized to identify capsid variant "A101" (comprising the capsid protein of SEQ ID NO: 12) that has enhanced gene delivery to the lung in the presence of human neutralizing antibodies.

[0061] [Figure 13] Figure 13A illustrates the estimated genetic diversity of the capsid library used in the directed evolution process. The total diversity of the library is >1 billion gene variants. Figure 13B illustrates the productivity of the capsid library. All capsid libraries were produced at levels sufficient to generate material for in vivo therapeutic vector evolution program studies. The administered viral genomes (vg) represent the target dose and do not account for attenuation associated with the delivery device and route of administration.

[0062] [Figure 14] Figure 14A illustrates external PCR amplification of viral genomes from isolated AT II cells after a) administration by AeroProbe® or b) administration by nebulizer from the first round of selection. The bands in the blue boxes represent successful amplification of viral genomes. The temperature gradient represents the annealing temperature used during PCR corresponding to each lane of the gel. Figure 14B illustrates internal PCR amplification of viral genomes from isolated AT II cells after a) administration by AeroProbe® or b) administration by nebulizer from the first round of selection. The bands in the blue boxes represent successful amplification of viral genomes.

[0063] [Figure 15] Figure 15A illustrates the frequency of chimeric motifs within the sequencing analysis of the study. The sequencing analysis is based on the total frequency within the sequenced population for both AeroProbe and nebulizer delivery devices. Figure 15B illustrates the frequency of A101 variants within the chimeric motifs within the study. The sequencing analysis is based on the total frequency within the sequenced population for both AeroProbe and nebulizer delivery devices.

[0064] [Figure 16] Schematic of lung sampling (Examples 3 and 7). Schematic of tracheal and lung sampling. Circles in the right lung represent adjacent samples obtained for DNA and protein isolation. Samples oriented along the major and minor axes for tissue sectioning are represented by squares.

[0065] [Figure 17] Transduction with variant capsids (containing the capsid protein of SEQ ID NO: 12) using NHP serum samples at a serum dilution of 1:10. Serum samples from NHPs eligible for inclusion in the study were analyzed for the presence of anti-AAV neutralizing antibodies. Transduction in the presence of a serum dilution of 1:10 (compared to transduction in the absence of serum) is reported for all NHPs. NHPs selected for inclusion in the study are indicated by yellow bars. Error bars = standard deviation, n = 3 (internal replicates).

[0066] [Figure 18] Biodistribution of variant capsid-mediated genomes. Quantification of viral genomes in lungs and additional systemic organs by qPCR using primers and probes for the EGFP transgene. Viral genomes were detected in all 48 samples (n = 16 samples per NHP; n = 3 NHPs). All tested samples from skeletal muscle (triceps brachii, vastus lateralis), diaphragm, kidney, spleen, brain, and spinal cord were below the lower limit of quantification. Mean ± standard error; n = 3 NHPs (n = 16 biopsy sites per lung per NHP, n = 10 biopsy sites per liver per NHP, n = 15 biopsy sites per heart per NHP, n = 9 biopsy sites per skeletal muscle per NHP, n = 2 samples per kidney per NHP, n = 1 sample per spleen per NHP, n = 8 biopsy sites per brain per NHP, n = 3 biopsy sites per spinal cord per NHP).

[0067] [Figure 19]Variant capsid-mediated protein expression in lungs. Quantification of EGFP protein expression in lungs by ELISA for EGFP protein. EGFP expression was observed in all 48 lung samples (n = 16 samples per NHP; n = 3 NHPs). EGFP expression was observed in 10 liver samples that were positive for viral genomes (n = 10 samples per NHP; n = 3 NHPs). Mean ± standard error.

[0068] [Figure 20] Localization of variant capsid-mediated proteins in the lung. Representative images of EGFP expression in the trachea (a-b), bronchi (c, e, g), and alveoli (d, f, h) of NHP V002969. Sections marked with white boxes in the trachea (b), alveoli (d), and bronchi (e) are presented as enlarged images in i, j, and k, respectively. The approximate locations of the images are indicated by magenta boxes in the schematic diagram. EGFP expression is detected by an anti-GFP antibody (red) in all images. Nuclei were counterstained with DAPI (blue).

[0069] [Figure 21-1] Characterization of alveolar epithelial type 2 non-human primate cells. More than 90% of NHP AECII cells were LysoTracker positive, as shown by fluorescence microscopy (FIG. 17A) and quantified by flow cytometry (FIG. 21B). Surfactant protein C, a maturation marker for AECII cells, was evident at days 1 and 5 after seeding (FIG. 21C). The proliferation rate of AECII cells declined over time in culture, as shown by EdU incorporation (FIG. 21D). EdU = 5-ethynyl-2'-deoxyuridine, error bars = standard deviation, n = 3 internal replicates. [Figure 21-2]Characterization of alveolar epithelial type 2 non-human primate cells. More than 90% of NHP AECII cells were LysoTracker positive, as shown by fluorescence microscopy (FIG. 17A) and quantified by flow cytometry (FIG. 21B). Surfactant protein C, a maturation marker for AECII cells, was evident at days 1 and 5 after seeding (FIG. 21C). The proliferation rate of AECII cells declined over time in culture, as shown by EdU incorporation (FIG. 21D). EdU = 5-ethynyl-2'-deoxyuridine, error bars = standard deviation, n = 3 internal replicates.

[0070] [Figure 22] Characterization of non-human primate alveolar epithelial type 2 cell vectors. In ALI cultures of AECII NHP cells, rAAV(4D-A101) capsids containing the capsid protein of SEQ ID NO: 12 exhibited higher transduction rates than AAV5 capsids, where both rAAV and AAV5 contained CAG-eGFP. Quantification of eGFP-positive cells by flow cytometry (Figure 22A). Representative ICC images of eGFP-positive cells (Figure 22B). Time post-infection was 3 days, for a total of 5 days of culture. Error bars = standard deviation, n = 3 internal replicates. Student's t-test, p < 0.05 compared to AAV5.

[0071] [Figure 23-1] Characterization of alveolar epithelial type 2 human cells. Human AECII cells were approximately 80% LysoTracker positive by day 11 in culture, decreasing to 50% at day 11, as shown by fluorescence microscopy (Figure 23A) and quantified by flow cytometry (Figure 23B). Surfactant protein C, a maturation marker for AECII cells, was evident at days 5 and 11 after seeding (Figure 23C). The proliferation rate of AECII cells decreased over time in culture, as shown by EdU incorporation (Figure 23D). EdU = 5-ethynyl-2'-deoxyuridine, error bars = standard deviation, n = 3 internal replicates. [Figure 23-2]Characterization of alveolar epithelial type 2 human cells. Human AECII cells were approximately 80% LysoTracker positive by day 11 in culture, decreasing to 50% at day 11, as shown by fluorescence microscopy (Figure 23A) and quantified by flow cytometry (Figure 23B). Surfactant protein C, a maturation marker for AECII cells, was evident at days 5 and 11 after seeding (Figure 23C). The proliferation rate of AECII cells decreased over time in culture, as shown by EdU incorporation (Figure 23D). EdU = 5-ethynyl-2'-deoxyuridine, error bars = standard deviation, n = 3 internal replicates.

[0072] [Figure 24] Characterization of human alveolar epithelial type 2 cell vectors. In ALI cultures of AECII human cells, capsids containing the capsid protein of SEQ ID NO: 12 (4D-A101) showed higher transduction rates than AAV5 capsids, where both 4D-A101 and AAV5 capsids carried CAG-eGFP. Representative ICC images of eGFP-positive cells at 6 and 10 days post-infection, for a total of 7 and 11 days of culture.

[0073] [Figure 25] In vitro neutralization profiles of wild-type AAV1, AAV2, AAV5, AAV8, AAV9, and rAAV (4D-A101) containing capsids containing the capsid protein of SEQ ID NO: 12. Compared to wild-type AAV, rAAV containing capsids containing the capsid protein of SEQ ID NO: 12 demonstrated superior ability to evade AAV neutralizing antibodies in human IVIG. The AAV.CAG.luciferase vector was incubated with dilutions of IVIG and then infected into 2V6.11 cells at an MOI of 1,000. Cells were transduced with vectors capable of evading antibodies, and luciferase activity was measured 48 hours postinfection. IVIG = intravenous immunoglobulin; error bars = standard deviation; n = 3 internal replicates. *p < 0.05 for 4D-A101 vs. AAV1, AAV2, AAV8, and AAV9; †p < 0.05 for 4D-A101 vs. AAV5.

[0074] [Figure 26] A101 Graph of net charge versus pH for VP1 and VP3 capsid proteins.

[0075] [Figure 27] A101-GFP pH solubility graph after 1 day of storage at room temperature.

[0076] [Figure 28] Transduction results in robust protein expression and membrane localization in HEK2v6.11 cells. HEK2v6.11 were transduced with 4D-710 and probed by Western blot using anti-CFTR antibody (Figure 28A). Representative images (Figure 28B) show cells analyzed by immunocytochemistry: anti-CFTR (red), F-actin (green), DAPI, and nuclei (blue). Scale bars are 100 μM (Figure 28B) and 25 μM (Figure 28C).

[0077] [Figure 29] Transduction of 16HBE14o-G542X cells with 4D-710. Reverse transcription-ddPCR (RT-ddPCR) digital droplet PCR (ddPCR) was performed on RNA extracted from HBE cultures after transduction with increasing MOIs of 4D-710 (Figure 29A). Exogenous CFTRΔR transcript levels were determined, quantified as copies / μL above a set threshold, and plotted on a linear scale. BLQ, below the limit of quantification. NT, not transduced. Immunocytochemistry of HBE cultures after transduction at MOIs of 35,000 and 50,000 (Figure 29B). Blue is DAPI, and red is CFTR protein. Scale bar is 100 μm.

[0078] [Figure 30]Transduction of healthy ex vivo ALI lung cultures with 4D-710. ddPCR was performed on cDNA prepared from RNA extracted from cultures after transduction with 4D-710. Two primer / probe sets were designed to clearly distinguish the codon-optimized human CFTRΔR transgene from the endogenous human CFTR gene. The number of droplets above a set threshold containing transcripts for the investigated primer / probe set was quantified. BLQ, below the limit of quantification. NT, not transduced.

[0079] [Figure 31] Transduction of NHP serum samples with 4D-A101 using a serum dilution of 1:10. Serum samples from NHPs eligible for inclusion in the study were analyzed for the presence of anti-AAV neutralizing antibodies against the 4D-710 capsid (4D-A101, containing the capsid protein of SEQ ID NO: 12). Transduction in the presence of a serum dilution of 1:10 (compared to transduction in the absence of serum) is reported for all NHPs. Error bars = standard deviation, n = 3 (internal replicates).

[0080] [Figure 32] Viral genome quantification by qPCR using primers and probes for the CFTRΔR transgene. Figure 32A: Viral genomes were robustly detected in lung samples distributed throughout the right lung. Figure 32B: Individual animal lung samples are shown by approximate area and lobe: alveoli (green), primary / secondary bronchi (blue), tertiary / lower bronchi (red), cranial lobe (circle), intermediate lobe (square), caudal lobe (triangle), and accessory lobe (diaphragm). Figure 32C: Viral genome quantification in animals receiving 3 x 10 vg demonstrates that all tested samples from the heart, liver, brain, skeletal muscle (triceps brachii, vastus lateralis, diaphragm), spinal cord, pancreas, kidney, and testis were below the lower limit of quantification. All three animals had detectable viral genomes in the tracheobronchial (TB) lymph nodes, and one animal had detectable viral genomes in the spleen. Mean ± SD.

[0081] [Figure 33] Transgene transcript expression in the lungs by 4D-710. Quantification of CFTRΔR transcripts by RT-qPCR using primers and probes for the 4D-710 transgene. Figure 33A. Transcripts were detected in right lung samples distributed throughout the lobe in animals receiving 3x10 vg. All were BLQ for vehicle animals. Figure 33B. Lung samples from individual animals receiving 3x10 vg are shown by approximate area and lobe: alveoli (green), primary / secondary bronchi (blue), tertiary / inferior bronchi (red), cranial lobe (circle), middle lobe (square), caudal lobe (triangle), accessory lobe (diamond). Mean ± SD.

[0082] [Figure 34] Protein expression by 4D-710 in the lung. CFTR protein expression in the lung by immunohistochemical staining. Figure 34A: CFTR expression in tracheal epithelium, bronchial epithelium, and alveolar sections from each treatment group, representative images. Figure 34B: CFTR protein expression in tracheal epithelium, bronchial epithelium, and alveolar sections from animals treated with 3x1013vg (shown for individual animals), representative images.

[0083] [Figure 35] A101-Luc solubility vs. pH DETAILED DESCRIPTION OF THE INVENTION

[0084] Detailed Description of the Invention definition

[0085] Adeno-associated virus (AAV) is a nonpathogenic parvovirus composed of a 4.7 kb single-stranded DNA genome within a nonenveloped icosahedral capsid. "AAV" is an abbreviation for adeno-associated virus and can be used to refer to the virus itself or its derivatives. The genome contains three open reading frames (ORFs) flanked by inverted terminal repeats (ITRs), which function as viral origins of replication and packaging signals. The rep ORF encodes four nonstructural proteins that play roles in viral replication, transcriptional regulation, site-specific integration, and virion assembly. The cap ORF encodes three structural proteins (VP1-VP3) that assemble to form the 60-mer viral capsid. Finally, an ORF present in an alternative reading frame within the cap gene localizes AAV capsid proteins to the nucleolus and also produces the assembly-activating protein (AAP), a viral protein that functions in the capsid assembly process.

[0086] There are several naturally occurring serotypes and over 100 variants of AAV, each of which differs in amino acid sequence, particularly within the hypervariable regions of the capsid protein, and therefore in their gene delivery properties. No AAV has been associated with any human disease, making recombinant AAV attractive for clinical applications.

[0087] The term "AAV," as used herein, encompasses all subtypes and both naturally occurring and recombinant forms, unless otherwise required. The term "AAV" includes AAV type 1 (AAV-1 or AAV1), AAV type 2 (AAV-2 or AAV2), AAV type 3 (AAV-3 or AAV3), AAV type 4 (AAV-4 or AAV4), AAV type 5 (AAV-5 or AAV5), AAV type 6 (AAV-6 or AAV6), AAV type 7 (AAV-7 or AAV7), AAV type 8 (AAV-8 or AAV8), AAV type 9 (AAV-9 or AAV9), avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, and ovine AAV. "Primate AAV" refers to AAV that infects primates, "non-primate AAV" refers to AAV that infects non-primate mammals, "bovine AAV" refers to AAV that infects bovine mammals, and so on.

[0088] The term "4D-A101" or "A101" as used herein refers to an AAV capsid comprising the capsid protein of SEQ ID NO:12.

[0089] The term "4D-710," as used herein, refers to a recombinant AAV comprising (i) a capsid comprising the capsid protein of SEQ ID NO: 12 and (ii) a heterologous nucleic acid comprising the nucleotide sequence of SEQ ID NO: 45.

[0090] The genome sequences of various serotypes of AAV, as well as the sequences of native terminal repeats (TRs), Rep proteins and capsid subunits, are known in the art.Such sequences can be found in literature or public databases such as GenBank.For example, GenBank accession numbers NC_002077.1 (AAV-1), AF063497.1 (AAV-1), NC_001401.2 (AAV-2), AF043303.1 (AAV-2), J01901.1 (AAV-2), U48704.1 (AAV-3), NC_001729 ... See NC_001829.1 (AAV-4), U89790.1 (AAV-4), NC_006152.1 (AAV-5), AF085716.1 (AAV-5), AF028704.1 (AAV-6), NC_006260.1 (AAV-7), AF513851.1 (AAV-7), AF513852.1 (AAV-8) NC_006261.1 (AAV-8), and AY530579.1 (AAV-9); the disclosures of which are incorporated herein by reference for their teaching of AAV nucleic acid and amino acid sequences. For example, Srivistava et al. (1983) J. Virology 45: 555;Chiorini et al. (1998) J. Virology 71: 6823;Chiorini et al. (1999) J. Virology 73: 1309;Bantel-Schaal et al. (1999) J. Virology 73: 939;Xiao et al. (1999) J. Virology 73: 3994;Muramatsu et al. (1996) Virology 221: 208;Shade et al., (1986) J. Virol. 58: 921;Gao et al. (2002) Proc. Nat. Acad. Sci. USA 99: 11854;Moris et al. (2004) Virology 33: See also International Patent Publications WO 00 / 28061, WO 99 / 61601, WO 98 / 11244; and U.S. Patent No. 6,156,303.

[0091] The sequences of naturally occurring cap (capsid) proteins associated with AAV serotypes are known in the art and include AAV1 (SEQ ID NO: 1), AAV2 (SEQ ID NO: 2), AAV3 (SEQ ID NO: 3), AAV4 (SEQ ID NO: 4), AAV5 (SEQ ID NO: 5), AAV6 (SEQ ID NO: 6), AAV7 (SEQ ID NO: 7), AAV8 (SEQ ID NO: 8), and AAV9 (SEQ ID NO: 9). The term "variant AAV capsid protein" is an AAV capsid protein comprising an amino acid sequence that contains at least one substitution (including deletion, insertion, etc.) compared to one of the naturally occurring AAV capsid protein sequences set forth in SEQ ID NOs: 1-9.

[0092] An "AAV virion" or "AAV viral particle" refers to a viral particle composed of at least one AAV capsid protein and an encapsidated AAV polynucleotide.

[0093] "Recombinant," when applied to a polynucleotide, means that the polynucleotide is the product of various combinations of cloning, restriction, or ligation steps, and other procedures that result in a construct that is distinct from polynucleotides found in nature. A recombinant virus is a viral particle that contains a recombinant polynucleotide. The terms include replicas of the original polynucleotide construct and progeny of the original viral construct, respectively.

[0094] When an AAV virion contains a heterologous polynucleotide (i.e., a polynucleotide other than the wild-type AAV genome, such as a transgene delivered to a target cell, an RNAi agent or a CRISPR agent delivered to a target cell, etc.), it is generally referred to as a "recombinant AAV (rAAV) virion" or "rAAV virus particle." Generally, the heterologous polynucleotide is flanked by at least one, and generally two, AAV inverted terminal repeats (ITRs).

[0095] The term "rAAV vector" by definition encompasses rAAV virions (i.e., rAAV virus particles) that contain rAAV polynucleotides (e.g., infectious rAAV virions), and also encompasses polynucleotides that encode rAAV (e.g., single-stranded polynucleotides encoding AAV (ss-rAAV); double-stranded polynucleotides encoding rAAV (ds-rAAV), e.g., plasmids encoding rAAV; etc.).

[0096] "Packaging" refers to the series of intracellular events that lead to the assembly and encapsidation of AAV particles.

[0097] AAV "rep" and "cap" genes refer to polynucleotide sequences that encode the replication and encapsidation proteins of adeno-associated virus. AAV rep and cap are referred to herein as AAV "packaging genes."

[0098] AAV "helper virus" refers to a virus that enables AAV (e.g., wild-type AAV) to be replicated and packaged by mammalian cells. A variety of such helper viruses for AAV are known in the art, including adenoviruses, herpesviruses, and poxviruses such as vaccinia. Adenoviruses encompass several different subgroups, with adenovirus type 5 of subgroup C being the most commonly used. Numerous adenoviruses of human, nonhuman mammalian, and avian origin are known and available from depositories such as the American Type Culture Collection (ATCC). Examples of viruses from the herpes family include herpes simplex virus (HSV) and Epstein-Barr virus (EBV), as well as cytomegalovirus (CMV) and pseudorabies virus (PRV), which are also available from depositories such as the American Type Culture Collection (ATCC).

[0099] "Helper virus functions" refer to functions encoded in the helper virus genome that enable AAV replication and packaging (in conjunction with other requirements for replication and packaging as described herein). As described herein, "helper virus functions" can be provided in several ways, including by providing a helper virus or, for example, by providing a polynucleotide sequence encoding the required function(s) in trans to a producer cell. For example, a plasmid or other expression vector containing a nucleotide sequence encoding one or more adenoviral proteins is transfected into a producer cell along with the rAAV vector.

[0100] An "infectious" virus or virus particle is one that contains a competently assembled viral capsid and is capable of delivering polynucleotide components to cells for which the viral species is tropic. The term does not necessarily imply any replicative ability of the virus. Assays for counting infectious virus particles are described elsewhere in this disclosure and in the art. Viral infectivity can be expressed as the ratio of infectious virus particles to total virus particles. Methods for determining the ratio of infectious virus particles to total virus particles are known in the art. See, for example, Grainger et al. (2005) Mol. Ther. 11: S337 (where a TCID50 infectious titer assay is described); and Zolotukhin et al. (1999) Gene Ther. 6: 973. See also the Examples.

[0101] The term "tropism," as used herein, refers to a virus (e.g., AAV) preferentially targeting a particular host species or a particular cell type within a host species. For example, a virus capable of infecting heart, lung, liver, and muscle cells has broader (i.e., increased) tropism than a virus capable of infecting only lung and muscle cells. Tropism can also include a virus's dependence on specific types of host cell surface molecules. For example, some viruses can only infect cells with surface glycosaminoglycans, while others can only infect cells with sialic acid (such dependence can be tested by using various cell lines lacking specific classes of molecules as potential host cells for viral infection). In some cases, viral tropism describes the relative preferences of the virus. For example, a first virus may be able to infect all cell types but is much more successful at infecting cells with surface glycosaminoglycans. If a second virus also prefers the same characteristics (e.g., the second virus is also more successful at infecting cells with surface glycosaminoglycans), the second virus can be considered to have similar (or identical) tropism as the first virus, even if the absolute transduction efficiency is not similar. For example, a second virus may be more efficient than the first virus at infecting any given cell type tested, but still be considered to have similar (or identical) tropism as the first virus if the relative preferences are similar (or identical). In some embodiments, the tropism of virions comprising a subject variant AAV capsid protein is unchanged compared to naturally occurring virions. In some embodiments, the tropism of virions comprising a subject variant AAV capsid protein is expanded (i.e., broadened) compared to naturally occurring virions. In some embodiments, the tropism of virions comprising a subject variant AAV capsid protein is reduced compared to naturally occurring virions.

[0102] A "replication-competent" virus (e.g., replication-competent AAV) refers to a phenotypically wild-type virus that is both infectious and capable of replicating in infected cells (i.e., in the presence of a helper virus or helper virus functions). In the case of AAV, replication competence generally requires the presence of functional AAV packaging genes. Generally, the rAAV vectors described herein are replication-incompetent in mammalian cells (particularly human cells) due to the lack of one or more AAV packaging genes. Generally, such rAAV vectors lack any AAV packaging gene sequences to minimize the possibility of generating replication-competent AAV by recombination between the AAV packaging genes and the incoming rAAV vector. In many embodiments, the rAAV vector preparations described herein contain little, if any, replication-competent AAV (rcAAV, also referred to as RCA) (e.g., 10 2 Approximately 1 rcAAV per rAAV particle, less than 10 4 Approximately 1 rcAAV per rAAV particle, less than 10 8 Approximately 1 rcAAV per rAAV particle, less than 10 12 (less than about 1 rcAAV per rAAV particle, or containing no rcAAV).

[0103] The term "polynucleotide" refers to a polymeric form of nucleotides of any length, including deoxyribonucleotides or ribonucleotides, or analogs thereof. A polynucleotide may contain modified nucleotides, such as methylated nucleotides and nucleotide analogs, and may be interrupted by non-nucleotide components. If present, modifications to the nucleotide structure may be made before or after assembly of the polymer. As used herein, the term polynucleotide refers interchangeably to double-stranded and single-stranded molecules. Unless otherwise specified or required, any embodiment herein that includes a polynucleotide encompasses both the double-stranded form and each of the two complementary single-stranded forms known or predicted to constitute the double-stranded form.

[0104] A polynucleotide or polypeptide has a certain percent "sequence identity" with another polynucleotide or polypeptide, that is, the percentage of bases or amino acids that are the same when the two sequences are compared when aligned. Sequence similarity can be determined in several different ways. To determine sequence identity, sequences can be aligned using methods and computer programs, including BLAST, available on the World Wide Web at ncbi.nlm.nih.gov / BLAST / . Another alignment algorithm is FASTA, which is available as the Genetics Computing Group (GCG) package from Oxford Molecular Group, Inc., a wholly owned subsidiary of Madison, Wis., USA. Other techniques for alignment are described in Methods in Enzymology, vol. 266: Computer Methods for Macromolecular Sequence Analysis (1996), ed. Doolittle, Academic Press, Inc., a division of Harcourt Brace & Co., San Diego, Calif., USA. Of particular interest are alignment programs that allow gaps in sequences. Smith-Waterman is one type of algorithm that allows gaps in sequence alignment. See Meth. Mol. Biol. 70: 173-187 (1997). Sequences can also be aligned using the GAP program, which uses the Needleman and Wunsch alignment method. See J. Mol. Biol. 48: 443-453 (1970).

[0105] " Gene " refers to a polynucleotide that performs a certain function in cells. For example, a gene may contain an open reading frame that can encode a specific protein after being transcribed and translated. On the other hand, a gene may code for a functional RNA product that is not translated (for example, aptamer, interfering RNA, ribosomal RNA (rRNA), transfer RNA (tRNA) etc.).

[0106] A "gene expression product" or "gene product" is a molecule resulting from the expression of a particular gene as defined above. Gene expression products include, for example, polypeptides, aptamers, interfering RNA, messenger RNA (mRNA), rRNA, tRNA, non-coding RNA (ncRNA), etc.

[0107] "RNA interference agent" or "RNAi agent" encompasses any agent (or polynucleotide encoding such an agent) that can be used to change the expression of a gene (as defined above). Examples of RNAi agents known to those skilled in the art include, but are not limited to: (i) siRNA agents; (ii) antisense RNA; (iii) CRISPR agents; (iv) zinc finger nuclease agents, and (v) transcription activator-like effector nuclease (TALEN) agents.

[0108] (i) siRNA agents (“small interfering” or “short interfering RNA” (or siRNA)) are RNA duplex nucleotides targeted to a gene of interest (“target gene”). An “RNA duplex” refers to the structure formed by complementary pairing between two regions of an RNA molecule that form a region of double-stranded RNA (dsRNA). An siRNA is “targeted” to a gene because the nucleotide sequence of the duplex portion of the siRNA is complementary to the nucleotide sequence of the targeted gene. In some embodiments, the length of the siRNA duplex is less than 30 nucleotides. In some embodiments, the duplex can be 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, or 10 nucleotides in length. In some embodiments, the length of the duplex is 19-25 nucleotides in length. The RNA duplex portion of the siRNA can be part of a hairpin structure. An siRNA agent containing a hairpin may also be referred to as an "shRNA (short hairpin RNA) agent." In addition to the double-stranded portion, the hairpin structure may contain a loop portion located between the two sequences forming the duplex. The length of the loop may vary. In some embodiments, the loop is 5, 6, 7, 8, 9, 10, 11, 12, or 13 nucleotides in length. The hairpin structure may also contain a 3' or 5' overhang. In some embodiments, the overhang is 0, 1, 2, 3, 4, or 5 nucleotides in length. Generally, the level of a target gene expression product (e.g., mRNA, polypeptide, etc.) is reduced by an siRNA agent (e.g., siRNA, shRNA, etc.) containing a specific double-stranded nucleotide sequence complementary to at least a 19-25 nucleotide-long segment (e.g., a 20-21 nucleotide sequence) of the target gene transcript, including the 5' untranslated (UT) region, ORF, or 3'UT region. In some embodiments, the small interfering RNA is approximately 19-25 nt in length.For example, for the description of siRNA technology, refer to PCT application WO0 / 44895, WO99 / 32619, WO01 / 75164, WO01 / 92513, WO01 / 29058, WO01 / 89304, WO02 / 16620 and WO02 / 29858; and US Patent Application Publication No. 20040023390. siRNA and / or shRNA can be coded by nucleic acid sequence, and nucleic acid sequence can also comprise promoter. Nucleic acid sequence can also comprise polyadenylation signal. In some embodiments, polyadenylation signal is synthetic minimal polyadenylation signal.

[0109] (ii) Antisense RNA is RNA complementary to gene expression products. For example, antisense RNA targeted to specific mRNA is RNA-based agent (or may be modified RNA) complementary to mRNA, in which case, the hybridization of antisense RNA to mRNA changes the expression of mRNA (for example, by changing RNA stability, by changing RNA translation, etc.). The nucleic acid encoding antisense RNA is also included in "antisense RNA".

[0110] (iii) CRISPR Agents. The CRISPR (clustered regularly interspaced short palindromic repeats) / CRISPR-associated (Cas) system provides adaptive immunity to viruses and plasmids in bacteria and archaea by using CRISPR RNA (crRNA) to guide the silencing of invading nucleic acids. The Cas9 protein (or its functional equivalents and / or variants, i.e., Cas9-like proteins) naturally contains DNA endonuclease activity, which depends on the protein's association with two naturally occurring or synthetic RNA molecules (also referred to as guide RNAs) called crRNA and tracrRNA. In some cases, the two molecules are covalently linked to form a single molecule (also referred to as a single guide RNA ("sgRNA")). Thus, Cas9 or Cas9-like proteins associate with a DNA-targeting RNA (this term encompasses both two-molecule and single-molecule guide RNA configurations), thereby activating the Cas9 or Cas9-like protein and guiding the protein to the target nucleic acid sequence. When Cas9 or Cas9-like proteins retain their native enzymatic function, they cleave target DNA, creating double-strand breaks that result in genomic modifications (i.e., editing: deletions, insertions (if a donor polynucleotide is present), replacements, etc.), which can alter gene expression. Some variants of Cas9 (which variants are encompassed by the term Cas9-like) have been modified to have reduced DNA cleavage activity (in some cases, they cleave a single strand instead of both strands of the target DNA, while in other cases, DNA cleavage activity is severely reduced to the point of no activity). Cas9-like proteins with reduced (or even no) DNA cleavage activity can still be guided to target DNA and block RNA polymerase activity. Thus, enzymatically inactive Cas9-like proteins can be targeted to specific locations within target DNA by DNA-targeting RNA to block transcription of the target DNA.For more information on CRISPR agents, see, for example, (a) Jinek et. al., Science. 2012 Aug. 17; 337 (6096): 816-21: "A programmable dual-RNA-guided DNA endonuclease in adaptive bacteria." immunity”;(b)Qi et al., Cell. 2013 Feb. 28; 152 (5): 1173-83: "Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression," and (c) U.S. Patent Application No. 13 / 842,859 and PCT Application No. PCT / US13 / 32589, which are incorporated herein by reference in their entireties. Accordingly, the term "CRISPR agent," as used herein, encompasses any agent (or nucleic acid encoding such an agent) comprising a naturally occurring and / or synthetic sequence that can be used in a Cas9-based system (e.g., a Cas9 or Cas9-like protein; any component of a DNA-targeting RNA, e.g., a crRNA-like RNA, a tracrRNA-like RNA, a single guide RNA, etc.; a donor polynucleotide; etc.).

[0111] (iv) Zinc finger nuclease (ZFN) agents. Zinc finger nucleases (ZFNs) are artificial DNA endonucleases created by fusing a zinc finger DNA binding domain to a DNA cleavage domain. ZFNs can be engineered to target a desired DNA sequence, allowing the zinc finger nuclease to cleave a unique target sequence. When introduced into a cell, ZFNs can be used to edit target DNA within the cell (e.g., the cell's genome) by inducing a double-strand break.For more information regarding the use of ZFNs, see, for example, Asuri et al., Mol Ther. 2012 February; 20 (2): 329-38; Bibikova et al. Science. 2003 May 2; 300 (5620): 764; Wood et al. Science. 2011 July 15; 333 (6040): 307; Ochiai et al. Genes Cells. 2010 August; 15 (8): 875-85; Takasu et al., Insect Biochem Mol Biol. 2010 October; 40 (10): 759-65; Ekker et al., Zebrafish 2008 Summer; 5 (2): 121-3; Young et al., Proc Natl Acad Sci USA. 2011 2010 Mar. 5; 140 (5): 678-91;Geurts et al, Science. 2009 Jul. 24; 325 (5939): 433;Flisikowska et al, PLoS One. 2011; 6 (6): e21045. doi: 10.1371 / journal.pone.0021045. Epub 2011 Jun. 13;Hauschild et al, Proc Natl Acad Sci USA. 2011 Jul. 19; 108 (29): 12013-7; and Yu et al, Cell Res. 2011 November; 21 (11): 1638-40. The term "ZFN agent" encompasses zinc finger nucleases and / or polynucleotides comprising a nucleotide sequence encoding a zinc finger nuclease.

[0112] (v) Transcription Activator-Like Effector Nuclease (TALEN) Agents. Transcription Activator-Like Effector Nucleases (TALENs) are artificial DNA endonucleases created by fusing a TAL (transcription activator-like) effector DNA binding domain to a DNA cleavage domain. TALENs can be rapidly engineered to bind to virtually any desired DNA sequence, and when introduced into cells, TALENs can be used to edit target DNA within the cell (e.g., the cell's genome) by inducing double-strand breaks. For more information on the use of TALENs, see, for example, Hockemeyer et al. Nat Biotechnol. 2011 Jul. 7; 29 (8): 731-4; Wood et al. Science. 2011 Jul. 15; 333 (6040): 307; Tesson et al. Nat Biotechnol. 2011 Aug. 5; 29 (8): 695-6; and Huang et al., Nat Biotechnol. 2011 Aug. 5; 29 (8): 699-700, all of which are incorporated herein by reference for their teachings on TALENs. The term "TALEN agent" encompasses TALENs and / or polynucleotides comprising a nucleotide sequence encoding a TALEN.

[0113] A "control element" or "control sequence" is a nucleotide sequence involved in a molecular interaction that contributes to the functional regulation of a polynucleotide, including the replication, duplication, transcription, splicing, translation, or degradation of the polynucleotide. Regulation can affect the frequency, speed, or specificity of the process and can be enhancing or inhibitory in nature. Control elements known in the art include, for example, transcriptional regulatory sequences such as promoters and enhancers. A promoter is a DNA region that, under certain conditions, is capable of binding RNA polymerase and initiating transcription of a coding region that is usually located downstream (3' direction) of the promoter.

[0114] "Operably linked" or "operably linked" refers to genetic elements that are in a juxtaposition that permits the elements to operate in the expected manner. For example, a promoter is operably linked to a coding region if it helps initiate transcription of the coding sequence. There can be intervening residues between the promoter and the coding region so long as this functional relationship is maintained.

[0115] An "expression vector" is a vector containing a region encoding a polypeptide of interest and is used to effect expression of the protein in an intended target cell. Expression vectors also contain control elements operably linked to the coding region to facilitate expression of the protein in the target. The combination of control elements and the gene(s) to which they are operably linked for expression is sometimes referred to as an "expression cassette," and many expression cassettes are known and available in the art or can be readily constructed from components available in the art.

[0116] "Heterologous" means that an entity is of different genotypic origin from the rest of the entity to which it is compared. For example, a polynucleotide introduced into a plasmid or vector from a different species by genetic engineering techniques is a heterologous polynucleotide. A promoter removed from its native coding sequence and operably linked to a coding sequence that is not found to be linked in nature is a heterologous promoter. Thus, for example, an rAAV containing a heterologous nucleic acid encoding a heterologous gene product is an rAAV containing a nucleic acid that is not normally contained in naturally occurring wild-type AAV, and the encoded heterologous gene product is a gene product that is not normally encoded by naturally occurring wild-type AAV.

[0117] "2A peptide" refers to a "self-cleaving" peptide of approximately 20 amino acids that generates equimolar levels of multiple genes from the same mRNA and can be used in place of an IRES element in a multicistronic vector. Non-limiting examples include the T2A, P2A, E2A, and F2A peptide sequences.

[0118] The terms "genetic alteration" and "genetic modification" (and grammatical variations thereof) are used interchangeably herein to refer to a process by which a genetic element (e.g., a polynucleotide) is introduced into a cell other than by mitosis or meiosis. The element may be heterologous to the cell, or may be an additional copy or improved version of an element already present in the cell. Genetic alteration can occur, for example, by transfecting a cell with a recombinant plasmid or other polynucleotide by any process known in the art, such as electroporation, calcium phosphate precipitation, or by contacting the cell with a polynucleotide-liposome complex. Genetic alteration can also occur, for example, by transducing or infecting the cell with a DNA or RNA virus or viral vector. Generally, the genetic element is introduced into a chromosome or minichromosome within the cell, but any alteration that alters the phenotype and / or genotype of the cell and its progeny is included in the term.

[0119] A cell has been "genetically modified" or "transformed" or "transfected" by exogenous DNA when such DNA has been introduced inside the cell (e.g., via a recombinant virus). The presence of the exogenous DNA results in a permanent or transient genetic change. The transforming DNA may or may not be integrated (covalently linked) into the genome of the cell. A "clone" is a population of cells derived by mitosis from a single cell or common ancestor. A "cell line" is a clone of a primary cell that is capable of stable growth in vitro for many generations.

[0120] A cell is said to be "stably" modified, transduced, genetically altered, or transformed with a sequence if the gene sequence is available to perform its function during long-term culture of the cell in vitro and / or in vivo. Generally, such cells are "genetically" altered (genetically modified) in that a genetic alteration is introduced that is inherited by the progeny of the altered cell.

[0121] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to polymers of amino acids of any length. The terms also encompass amino acid polymers that have been modified, for example, by disulfide bond formation, glycosylation, lipidation, phosphorylation, or conjugation with a labeling moiety. Polypeptides, such as antiangiogenic polypeptides, neuroprotective polypeptides, and the like, when discussed in the context of delivering gene products to mammalian subjects and compositions therefor, refer to the respective intact polypeptides or any fragments or genetically engineered derivatives thereof that retain the desired biochemical function of the intact protein. Similarly, reference to nucleic acids encoding antiangiogenic polypeptides, nucleic acids encoding neuroprotective polypeptides, and other such nucleic acids (which may be referred to as "transgenes" delivered to recipient cells) for use in delivering gene products to mammalian subjects includes polynucleotides encoding the intact polypeptides or any fragments or genetically engineered derivatives having the desired biochemical function.

[0122] An "isolated" plasmid, nucleic acid, vector, virus, virion, host cell, protein, or other substance refers to a preparation of the substance that lacks at least some of the other components that may also be present in the location where the substance or similar substance naturally occurs or was originally prepared. Thus, for example, an isolated substance can be prepared by enriching the substance from a source mixture using a purification technique. Enrichment can be measured in absolute terms, such as weight per volume of solution, or in relation to a second, potentially interfering substance present in the source mixture. Increased enrichment, with respect to embodiments of the present disclosure, is an additional increase in isolation. Isolated plasmids, nucleic acids, vectors, viruses, host cells, or other substances are, in some embodiments, purified to, for example, about 80% to about 90% pure, at least about 90% pure, at least about 95% pure, at least about 98% pure, or at least about 99% or greater purity.

[0123] As used herein, the terms "treatment," "treating," and the like refer to obtaining a desired pharmacological and / or physiological effect. The effect may be prophylactic, in that a disease or its symptoms are completely or partially prevented, and / or therapeutic, in that a disease and / or adverse effects caused by the disease are partially or completely cured. "Treatment," as used herein, encompasses any treatment of disease in mammals, particularly humans, and includes (a) preventing the disease (and / or symptoms caused by the disease) from occurring in a subject who may be predisposed to the disease or at risk of developing the disease later, but who has not yet been diagnosed with it; (b) inhibiting the disease (and / or symptoms caused by the disease), i.e., arresting its occurrence; and (c) alleviating the disease (and / or symptoms caused by the disease), i.e., causing regression of the disease (and / or symptoms caused by the disease).

[0124] The terms "individual," "host," "subject," and "patient" are used interchangeably herein and refer to mammals, including, but not limited to, humans; non-human primates, including monkeys; mammalian sports animals (e.g., horses); mammalian farm animals (e.g., sheep, goats, etc.); mammalian pet animals (dogs, cats, etc.); and rodents (e.g., mice, rats, etc.).

[0125] In some embodiments, the individual is a human who has previously been exposed to AAV naturally and, as a result, has anti-AAV antibodies (i.e., AAV neutralizing antibodies). In some embodiments, the individual is a human who has previously been administered an AAV vector (which may, as a result, have anti-AAV antibodies) and requires readministration of the vector for treatment of a different condition or for further treatment of the same condition. For example, based on positive results in clinical trials involving AAV gene delivery to the liver, muscle, and retina—all tissues affected by neutralizing antibodies to this vehicle—many applications / disease targets for such treatment exist.

[0126] The term "effective amount," as used herein, refers to an amount sufficient to produce a beneficial or desired clinical result. An effective amount can be administered in one or more doses. For purposes of this disclosure, an effective amount of a compound (e.g., infectious rAAV virions) is an amount sufficient to alleviate, ameliorate, stabilize, reverse, prevent, slow or delay the progression of a particular pathology (e.g., cancer) (and / or its associated symptoms). Thus, an effective amount of infectious rAAV virions is an amount of infectious rAAV virions capable of evading the neutralizing activity of an individual's anti-AAV antibodies and thus effectively delivering heterologous nucleic acid to the individual's target cell(s).

[0127] Before further describing the present invention, it is to be understood that this invention is not limited to the particular embodiments described, as such embodiments may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

[0128] Where a range of values ​​is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limits of that range, and any other stated or intervening values ​​within that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may be individually included in the smaller ranges, and are also encompassed within the invention, subject to any specifically excluded ranges within the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

[0129] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention belongs.Although any method and material similar or equivalent to the methods and materials described herein can also be used to implement or test this invention, preferred methods and materials are described herein.All publications mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with the cited publications.

[0130] It should be noted that, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, a reference to "an infectious recombinant adeno-associated virus (rAAV) virion" includes a plurality of such virions; a reference to "the infectious recombinant adeno-associated virus (rAAV) virion" includes reference to one or more such virions and equivalents thereof known to those skilled in the art, and so forth. It should be further noted that the claims may be drafted to exclude any non-essential element. Accordingly, this statement is intended to serve as a premise for the use of exclusive terminology such as "solely," "only," or the use of a "negative" limitation in connection with the recitation of claim elements.

[0131] It is understood that certain features of the invention, which are for clarity described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are for brevity described in the context of a single embodiment, may also be provided separately or in any suitable subcombination. All combinations of the embodiments of the invention are specifically embraced by the present invention and are disclosed herein just as if each and every combination were individually and explicitly disclosed. Furthermore, all subcombinations of the various embodiments and elements thereof are also specifically embraced by the present invention and are disclosed herein just as if each and every such subcombination were individually and explicitly disclosed herein.

[0132] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein should be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates, which may need to be independently confirmed.

[0133] The present disclosure provides infectious recombinant adeno-associated virus (rAAV) virions comprising a variant capsid protein and a heterologous nucleic acid. The present disclosure further provides variant adeno-associated virus (AAV) capsid proteins (and / or nucleic acids encoding the variant AAV capsid proteins) that confer increased resistance to human AAV neutralizing antibodies on the infectious rAAV virions. The present disclosure further provides host cells comprising infectious rAAV virions and / or nucleic acids encoding the subject variant AAV capsid proteins. The present disclosure further provides libraries of the above-described virions, capsid proteins, nucleic acids, and / or host cells, wherein the variant AAV capsid protein of at least one member of the library comprises an amino acid sequence having at least one amino acid substitution compared to the amino acid sequence set forth in one of SEQ ID NOs: 10-13 and 26-33.

[0134] The present disclosure further provides a method for delivering a heterologous nucleic acid to a target cell, the method comprising contacting the target cell with a subject infectious rAAV virion. The present disclosure also provides a method for delivering a gene product to an individual, the method generally comprising administering an effective amount of a subject rAAV virion to an individual in need thereof. Compositions and kits for carrying out the subject methods are also provided herein. In many embodiments, a subject infectious rAAV virion, a subject nucleic acid, a subject variant AAV capsid protein, a subject host cell, or the like is isolated.

[0135] Variant AAV capsid polypeptides

[0136] A subject variant AAV capsid polypeptide (or variant AAV capsid protein encoded by a subject nucleic acid) confers on infectious rAAV virions comprising the variant AAV capsid polypeptide increased resistance to human AAV neutralizing antibodies compared to the resistance exhibited by wild-type AAV (e.g., AAV2 (wild-type AAV serotype 2)) or AAV comprising the wild-type capsid protein. In some embodiments, the increased resistance is at least about 1.5-fold (e.g., at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 7.5-fold, at least about 10-fold, at least about 12-fold, at least about 15-fold, at least about 17-fold, at least about 20-fold, at least about 25-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 75-fold, at least about 100-fold, at least about 150-fold, at least about 200-fold, at least about 250-fold, at least about 300-fold, etc.) greater than the resistance exhibited by a wild-type AAV (e.g., AAV2 (wild-type AAV serotype 2)) or an AAV comprising a wild-type capsid protein.

[0137] A subject variant AAV capsid protein (or a variant AAV capsid protein encoded by a subject nucleic acid) can be said to confer to infectious rAAV virions increased transduction of mammalian cells in the presence of human AAV neutralizing antibodies compared to the transduction exhibited by wild-type AAV (e.g., AAV2 (wild-type AAV serotype 2)) or an AAV comprising the wild-type capsid protein. In some embodiments, the increase in transduction is at least about 1.5-fold (e.g., at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 7.5-fold, at least about 10-fold, at least about 12-fold, at least about 15-fold, at least about 17-fold, at least about 20-fold, at least about 25-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 75-fold, at least about 100-fold, at least about 150-fold, at least about 200-fold, at least about 250-fold, at least about 300-fold, etc.) greater than the transduction exhibited by wild-type AAV (e.g., AAV2 (wild-type AAV serotype 2)) or an AAV comprising a wild-type capsid protein.

[0138] In some embodiments, a subject variant AAV capsid protein (or a variant AAV capsid protein encoded by a subject nucleic acid) exhibits reduced binding to neutralizing antibodies that bind wild-type AAV capsid protein. For example, a subject variant AAV capsid protein may exhibit reduced binding (e.g., reduced affinity) to a neutralizing antibody that binds a wild-type capsid AAV protein, compared to the antibody's binding affinity for the wild-type AAV capsid protein, by at least about 1.5 fold (e.g., at least about 1.5 fold, at least about 2 fold, at least about 3 fold, at least about 4 fold, at least about 5 fold, at least about 7.5 fold, at least about 10 fold, at least about 12 fold, at least about 15 fold, at least about 17 fold, at least about 20 fold, at least about 25 fold, at least about 30 fold, at least about 40 fold, at least about 50 fold, at least about 75 fold, at least about 100 fold, at least about 150 fold, at least about 200 fold, at least about 250 fold, at least about 300 fold, etc.).

[0139] In some embodiments, an anti-AAV neutralizing antibody binds to a subject variant AAV capsid protein (or a variant AAV capsid protein encoded by a subject nucleic acid) at a concentration of about 10 -7 Less than M, approximately 5 x 10 -6 Less than M, about 10 -6 Less than M, approximately 5 x 10 -5 Less than M, about 10 -5 Less than M, about 10 -4 binds with an affinity less than or equal to M

[0140] The term "variant capsid protein" does not encompass wild-type AAV capsid proteins. A "variant AAV capsid protein" does not include an amino acid sequence present in a naturally occurring AAV capsid protein. For example, a subject variant capsid protein does not include an amino acid sequence having 100% sequence identity to any of the sequences set forth in SEQ ID NOs: 1-9. In other words, a subject variant capsid protein does not include an amino acid sequence as set forth in any of SEQ ID NOs: 1-9. A variant capsid protein may differ in amino acid sequence from a "starter" or "parent" AAV capsid protein, which may be a wild-type AAV capsid protein or a non-wild-type AAV capsid protein.

[0141] In some embodiments, a subject variant AAV capsid protein (or a variant AAV capsid protein encoded by a subject nucleic acid) comprises an amino acid sequence having at least about 90% (e.g., at least about 92%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 99.5%, or 100%) amino acid sequence identity to amino acids 203-736 of the amino acid sequence set forth in one of SEQ ID NOs: 10-13 and 26-33.

[0142] In some embodiments, a subject variant AAV capsid protein (or a variant AAV capsid protein encoded by a subject nucleic acid) comprises an amino acid sequence having at least about 90% (e.g., at least about 92%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 99.5%, or 100%) amino acid sequence identity to the amino acid sequence set forth in one of SEQ ID NOs: 10-13 and 26-33.

[0143] In some embodiments, a subject variant AAV capsid protein (or a variant AAV capsid protein encoded by a subject nucleic acid) comprises an amino acid sequence having at least about 95% (e.g., at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 99.5%, or 100%) amino acid sequence identity to amino acids 203-736 of the amino acid sequence set forth in SEQ ID NO: 10, and includes the amino acid substitutions N312K, N449D, D472N, N551S, I698V, and L735Q compared to the corresponding positions in the AAV capsid protein of AAV2 (e.g., SEQ ID NO: 2) or another AAV parent serotype.

[0144] In some embodiments, a subject variant AAV capsid protein (or a variant AAV capsid protein encoded by a subject nucleic acid) comprises an amino acid sequence having at least about 95% (e.g., at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 99.5%, or 100%) amino acid sequence identity to the amino acid sequence set forth in SEQ ID NO: 10, and includes the amino acid substitutions N312K, N449D, D472N, N551S, I698V, and L735Q compared to the corresponding positions in the AAV capsid protein of AAV2 (e.g., SEQ ID NO: 2) or another AAV parent serotype.

[0145] In some embodiments, a subject variant AAV capsid protein (or a variant AAV capsid protein encoded by a subject nucleic acid) comprises an amino acid sequence having at least about 95% (e.g., at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 99.5%, or 100%) amino acid sequence identity to amino acids 203-736 of the amino acid sequence set forth in SEQ ID NO:31, and includes the amino acid substitutions N312K, N449D, N551S, and I698V compared to the corresponding positions in the AAV capsid protein of AAV2 (e.g., SEQ ID NO:2) or another AAV parent serotype.

[0146] In some embodiments, a subject variant AAV capsid protein (or a variant AAV capsid protein encoded by a subject nucleic acid) comprises an amino acid sequence having at least about 95% (e.g., at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 99.5%, or 100%) amino acid sequence identity to the amino acid sequence set forth in SEQ ID NO:31, and includes the amino acid substitutions N312K, N449D, N551S, and I698V compared to the corresponding positions in the AAV capsid protein of AAV2 (e.g., SEQ ID NO:2) or another AAV parent serotype.

[0147] In some embodiments, a subject variant AAV capsid protein (or a variant AAV capsid protein encoded by a subject nucleic acid) comprises an amino acid sequence having at least about 95% (e.g., at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 99.5%, or 100%) amino acid sequence identity to amino acids 203-736 of the amino acid sequence set forth in SEQ ID NO: 32, and includes the amino acid substitutions D180N, N312K, Q385R, N449D, N551S, I698V, and S721T compared to the corresponding positions in the AAV capsid protein of AAV2 (e.g., SEQ ID NO: 2) or another AAV parent serotype.

[0148] In some embodiments, a subject variant AAV capsid protein (or a variant AAV capsid protein encoded by a subject nucleic acid) comprises an amino acid sequence having at least about 95% (e.g., at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 99.5%, or 100%) amino acid sequence identity to the amino acid sequence set forth in SEQ ID NO: 32, and includes the amino acid substitutions D180N, N312K, Q385R, N449D, N551S, I698V, and S721T compared to the corresponding positions in the AAV capsid protein of AAV2 (e.g., SEQ ID NO: 2) or another AAV parent serotype.

[0149] In some embodiments, a subject variant AAV capsid protein (or a variant AAV capsid protein encoded by a subject nucleic acid) comprises an amino acid sequence having at least about 95% (e.g., at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 99.5%, or 100%) amino acid sequence identity to amino acids 203-736 of the amino acid sequence set forth in SEQ ID NO: 33, and includes the amino acid substitutions N312K, N449D, T450A, N551S, and I698V compared to the corresponding positions in the AAV capsid protein of AAV2 (e.g., SEQ ID NO: 2) or another AAV parent serotype.

[0150] In some embodiments, a subject variant AAV capsid protein (or a variant AAV capsid protein encoded by a subject nucleic acid) comprises an amino acid sequence having at least about 95% (e.g., at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 99.5%, or 100%) amino acid sequence identity to the amino acid sequence set forth in SEQ ID NO: 33, and includes the amino acid substitutions N312K, N449D, T450A, N551S, and I698V compared to the corresponding positions in the AAV capsid protein of AAV2 (e.g., SEQ ID NO: 2) or another AAV parent serotype.

[0151] Exemplary variant AAV capsid proteins include, but are not limited to, the following (see Figures 8-10 for selected exemplary sequence alignments):

[0152] SM10-2 (amino acid sequence) (SEQ ID NO: 10); SM10-2 (nucleotide sequence) (SEQ ID NO: 22); Shuffle100-1 (amino acid sequence) (SEQ ID NO: 11); Shuffle100-1 (nucleotide sequence) (SEQ ID NO: 23);

[0153] Shuffle100-3 (amino acid sequence) (SEQ ID NO: 12): [ka] [ka]

[0154] Shuffle100-3 (nucleotide sequence) (SEQ ID NO: 24): [ka]

[0155] Shuffle100-7 (amino acid sequence) (SEQ ID NO: 13); Shuffle100-7 (nucleotide sequence) (SEQ ID NO: 25); Shuffle10-2 (amino acid sequence) (SEQ ID NO: 26); Shuffle10-2 (nucleotide sequence) (SEQ ID NO: 34); Shuffle10-6 (amino acid sequence) (SEQ ID NO: 27); Shuffle10-6 (nucleotide sequence) (SEQ ID NO: 35); Shuffle10-8 (amino acid sequence) (SEQ ID NO: 28); Shuffle10-8 (nucleotide sequence) (SEQ ID NO: 36); Shuffle100-2 ( SM10-1 (amino acid sequence) (SEQ ID NO: 29); Shuffle100-2 (nucleotide sequence) (SEQ ID NO: 37); SM10-1 (amino acid sequence) (SEQ ID NO: 30); SM10-1 (nucleotide sequence) (SEQ ID NO: 38); SM10-8 (amino acid sequence) (SEQ ID NO: 31); SM10-8 (nucleotide sequence) (SEQ ID NO: 39); SM100-3 (amino acid sequence) (SEQ ID NO: 32); SM100-3 (nucleotide sequence) (SEQ ID NO: 40); SM100-10 (amino acid sequence) (SEQ ID NO: 33); and SM100-10 (nucleotide sequence) (SEQ ID NO: 41).

[0156] Nucleic Acids and Host Cells

[0157] The present disclosure provides nucleic acids comprising nucleotide sequences encoding variant AAV capsid proteins (as described above), as well as host cells comprising the subject nucleic acids. The nucleic acids and host cells are useful for producing rAAV virions (as described below).

[0158] The present disclosure provides host cells, e.g., isolated host cells, comprising a subject nucleic acid. A subject host cell can be referred to as a "genetically modified host cell" and is generally an isolated cell, e.g., a cell in in vitro culture. A subject host cell is useful for producing a subject rAAV virion, as described below. A subject host cell is referred to as a "packaging cell" when used to produce a subject rAAV virion. In some embodiments, a subject host cell is stably genetically modified (i.e., stably transfected) with a subject nucleic acid. In other embodiments, a subject host cell is transiently genetically modified (i.e., transiently transfected) with a subject nucleic acid.

[0159] The subject nucleic acids are stably or transiently introduced into host cells using established techniques, including, but not limited to, electroporation, calcium phosphate precipitation, liposome-mediated transfection, etc. For stable transformation, the subject nucleic acids generally further include a selectable marker, e.g., any of several well-known selectable markers such as neomycin resistance.

[0160] The subject host cells are generated by introducing a subject nucleic acid into any of a variety of cells, e.g., mammalian cells, including, for example, mouse cells and primate cells (e.g., human cells). Suitable mammalian cells include, but are not limited to, primary cells and cell lines, and suitable cell lines include, but are not limited to, 293 cells, COS cells, HeLa cells, Vero cells, 3T3 mouse fibroblasts, C3H10T1 / 2 fibroblasts, CHO cells, and the like.

[0161] In some embodiments, a subject host cell comprises a nucleic acid comprising a nucleotide sequence encoding one or more AAV rep proteins in addition to a nucleic acid comprising a nucleotide sequence encoding a mutant capsid protein. In other embodiments, a subject host cell further comprises an rAAV vector, as described below. As described in more detail below, rAAV virions are produced using a subject host cell.

[0162] Infectious rAAV virions

[0163] The subject infectious rAAV virions comprise a variant AAV capsid protein and a heterologous nucleic acid (described in more detail below) and exhibit increased resistance to human AAV neutralizing antibodies compared to the resistance exhibited by wild-type AAV (e.g., AAV2 (wild-type AAV serotype 2)) or an AAV comprising a wild-type capsid protein. "Increased resistance" means that the subject infectious rAAV virions exhibit increased infectivity in the presence of human anti-AAV antibodies. As described above, viral infectivity can be expressed as the ratio of infectious viral particles to total viral particles. Thus, increased infectivity refers to an increased ratio of infectious viral particles to total viral particles. To determine the resistance of an AAV to human anti-AAV antibodies, the infectivity of the AAV is measured in the presence of various concentrations of human anti-AAV antibodies to obtain the antibody concentration (e.g., serum concentration, IVIG concentration, etc.) (mg / mL) required to reduce the gene delivery efficiency (i.e., infectivity) to 50% of the gene delivery efficiency (i.e., infectivity) in the absence of the human anti-AAV antibodies. A virus that requires a higher concentration of human anti-AAV antibodies to reduce gene delivery efficiency to 50% of the efficiency in the absence of the antibodies is said to have increased resistance to antibody neutralization. Therefore, a two-fold increase in resistance means that a two-fold increase in antibody concentration is required to reduce gene delivery efficiency to 50% of the efficiency in the absence of the antibodies. In some embodiments, a subject infectious rAAV virion exhibits at least about 1.5-fold (e.g., at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 7.5-fold, at least about 10-fold, at least about 12-fold, at least about 15-fold, at least about 17-fold, at least about 20-fold, at least about 25-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 75-fold, at least about 100-fold, at least about 150-fold, at least about 200-fold, at least about 250-fold, at least about 300-fold, etc.) greater resistance to human AAV neutralizing antibodies than the resistance exhibited by wild-type AAV (e.g., AAV2 (wild-type AAV serotype 2)) or an AAV comprising a wild-type capsid protein.

[0164] A subject infectious rAAV virion can be said to exhibit increased transduction of mammalian cells in the presence of human AAV neutralizing antibodies. In some embodiments, a subject infectious rAAV virion exhibits increased transduction of mammalian cells in the presence of human AAV neutralizing antibodies that is at least about 1.5-fold (e.g., at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 7.5-fold, at least about 10-fold, at least about 12-fold, at least about 15-fold, at least about 17-fold, at least about 20-fold, at least about 25-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 75-fold, at least about 100-fold, at least about 150-fold, at least about 200-fold, at least about 250-fold, at least about 300-fold, etc.) greater than the transduction exhibited by wild-type AAV (e.g., AAV2 (wild-type AAV serotype 2)) or an AAV comprising a wild-type capsid protein.

[0165] In some embodiments, the subject infectious rAAV virions exhibit reduced binding to neutralizing antibodies that bind wild-type AAV capsid proteins. For example, a subject infectious rAAV virion may exhibit at least about 1.5-fold (e.g., at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 7.5-fold, at least about 10-fold, at least about 12-fold, at least about 15-fold, at least about 17-fold, at least about 20-fold, at least about 25-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 75-fold, at least about 100-fold, at least about 150-fold, at least about 200-fold, at least about 250-fold, at least about 300-fold, etc.) reduced binding (e.g., reduced affinity) to a neutralizing antibody that binds wild-type AAV capsid protein, compared to the antibody's binding affinity for the wild-type AAV capsid protein.

[0166] In some embodiments, the anti-AAV neutralizing antibodies bind to the subject infectious rAAV virions at a concentration of about 10-7 Less than M, approximately 5 x 10 -6 Less than M, about 10 -6 Less than M, approximately 5 x 10 -5 Less than M, about 10 -5 Less than M, about 10 -4 binds with an affinity less than or equal to M

[0167] In some embodiments, the subject infectious rAAV virions have an in vivo virion activity comparable to that of wild-type AAV. For example, a subject infectious rAAV virion exhibits a residence time that is at least about 10%, at least about 25%, at least about 50%, at least about 100%, at least about 3-fold, at least about 5-fold, at least about 10-fold, at least about 25-fold, at least about 50-fold, at least about 100-fold, or more times longer than the residence time of wild-type AAV.

[0168] Whether infectious rAAV virions of a given subject exhibit reduced binding to and / or increased resistance to neutralizing antibodies can be determined using any conventional assay known to those of skill in the art.

[0169] In some embodiments, a subject infectious rAAV virion comprises wild-type Rep78, Rep68, Rep52, and Rep40 proteins. In other embodiments, a subject infectious rAAV virion comprises one or more mutations in one or more of the Rep78, Rep68, Rep52, and Rep40 proteins, in addition to one or more variant capsid proteins.

[0170] heterologous nucleic acid

[0171] Heterologous DNA molecules (also referred to herein as "heterologous nucleic acids") suitable for use in a subject rAAV vector (e.g., a subject infectious rAAV virion) can be any heterologous nucleic acid. In some embodiments, the heterologous nucleic acid comprises a nucleotide sequence encoding a polypeptide (e.g., a protein that confers some desired characteristic on the target cell, such as a fluorescent protein that allows cell tracking, an enzyme that provides a missing or altered activity in the target cell, etc.). In some embodiments, the heterologous nucleic acid comprises an RNA interference agent (as defined above).

[0172] The subject heterologous nucleic acids are generally less than about 5 kilobases (kb) in size and include, for example, genes (nucleotide sequences) encoding proteins that are defective or absent in the recipient individual or target cell; genes encoding proteins having a desired biological or therapeutic effect (e.g., antibacterial, antiviral, or antitumor / anticancer); nucleotide sequences encoding RNA that inhibits or reduces the production of harmful or otherwise undesirable proteins (e.g., nucleotide sequences encoding RNA interference agents, as defined above); and / or nucleotide sequences encoding antigenic proteins.

[0173] Suitable heterologous nucleic acids include, but are not limited to, nucleic acids encoding inflammatory, autoimmune, chronic and infectious diseases, e.g., acquired immune deficiency syndrome (AIDS); cancer, hypercholesterolemia, lysosomal storage diseases, e.g., activator factor deficiency / GM2 gangliosidosis, alpha-mannosidosis, aspartylglucosaminuria, cholesteryl ester storage disease, chronic hexosaminidase A deficiency, cystinosis, Danon disease, Fabry disease, and the like. -Disease, Farber disease, fucosidosis, galactosialidosis, Gaucher disease, GM1 gangliosidosis, I-cell disease / mucolipidosis II, infantile free sialic acid storage disease / ISSD, juvenile hexosaminidase A deficiency, Krabbe disease, lysosomal acid lipase deficiency, metachromatic leukodystrophy, mucopolysaccharidosis disorders (pseudo-Hurler polydystrophy / mucolipidosis IIIA, MPS-I-Hurler syndrome, MPS-I-Scheie ... Hurler-Scheie syndrome, MPS II Hunter syndrome, Sanfilippo syndrome type A / MPS III A, Sanfilippo syndrome type B / MPS III B, Sanfilippo syndrome type C / MPS III C, Sanfilippo syndrome type D / MPS III D, Morquio syndrome type A / MPS IVA, Morquio syndrome type B / MPS IVB, MPS IX hyaluronidase deficiency, MPS VI Maroteaux-Lamy, MPS VII Sly syndrome, mucolipidosis I / sialidosis, mucolipidosis IIIC, and mucolipidosis IV), multiple sulfatase deficiency, Niemann-Pick disease, neuronal ceroid lipofuscinosis, Pompe disease / glycogenosis type II, pyknodysostosis, Sandhoff disease / adult-onset / GM2 gangliosidosis, Sandhoff disease / infantile GM2 gangliosidosis, Sandhoff disease / juvenile GM2 gangliosidosis, Schindler disease, Salla disease / sialic acid storage disease These include genes encoding proteins used for the treatment of endocrine, metabolic, hematological, cardiovascular, neurological, musculoskeletal, urinary, pulmonary, and immune disorders, including disorders such as Tay-Sachs / GM2 gangliosidosis, and Wolman disease; insulin disorders, e.g., diabetes; growth disorders; various blood disorders, including various anemias, thalassemia, and hemophilia; and gene defects, e.g., cystic fibrosis, Gaucher disease, Hurler disease, adenosine deaminase (ADA) deficiency, emphysema, and the like.

[0174] Suitable heterologous nucleic acids include, but are not limited to, those encoding any of a variety of proteins, including interferons (e.g., IFN-γ, IFN-α, IFN-β, IFN-ω; IFN-τ); insulin (e.g., Novolin, Humulin, Humalog, Lantus, Ultralente, etc.); erythropoietin ("EPO"; e.g., Procrit®, Eprex®, or Epogen® (epoetin-α); Aranesp® ( darbepoetin-α; NeoRecormon®, Epogin® (epoetin-β); etc.; antibodies (e.g., monoclonal antibodies) (e.g., Rituxan® (rituximab); Remicade® (infliximab); Herceptin® (trastuzumab); Humira™ (adalimumab); Xolair® (omalizumab); Bexxar® (antibody); blood factors (e.g., Activase® (alteplase) tissue plasminogen activator; NovoSeven® (recombinant human Factor VIIa); Factor VIIa; Factor VIII (e.g., Kogenate®); Factor IX; β-globin; hemoglobin; etc.); colony-stimulating factors (e.g., Neupogen® (filgravir); Grastim; G-CSF; Neulasta (pegfilgrastim); granulocyte colony-stimulating factor (G-CSF), granulocyte-monocyte colony-stimulating factor, macrophage colony-stimulating factor, megakaryocyte colony-stimulating factor; etc.; growth hormones (e.g., somatotropins, e.g., Genotropin®, Nutropin®, Norditropin®, Saizen®, Serostim®, Humatrope®, etc.; human growth hormone; etc.); interleukins (e.g., IL-1;IL-2, including, for example, Proleukin®; IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9; and the like; growth factors (e.g., Regranex® (beclamethasone; PDGF); Fiblast® (trafermin; bFGF); Stemgen® (ansestim; stem cell factor); keratinocyte growth factor; acidic fibroblast growth factor, stem cell factor, basic fibroblast growth factor, hepatocyte growth factor; and the like); soluble receptors (e.g., soluble receptors that bind TNF-α, e.g., Enbrel® (etanercept); soluble VEGF receptors; soluble interleukin receptors; soluble gamma / delta receptors). T cell receptors; etc.); enzymes (e.g., α-glucosidase; Cerazyme® (imiglucarase); β-glucocerebrosidase, Ceredase® (alglucerase); enzyme activators (e.g., tissue plasminogen activator); chemokines (e.g., IP-10; Mig; Groα / IL-8, RANTES; MIP-1α; MIP-1β; MCP-1; PF-4; etc.); angiogenic agents (e.g., vascular endothelial growth factor (VEGF); anti-angiogenic agents (e.g., soluble VEGF receptors); protein vaccines; Transstimulatory peptides, such as bradykinin, cholecystokinin, gastin, secretin, oxytocin, gonadotropin-releasing hormone, beta-endorphin, enkephalin, substance P, somatostatin, prolactin, galanin, growth hormone-releasing hormone, bombesin, dynorphin, neurotensin, motilin, thyroid-stimulating hormone, neuropeptide Y, luteinizing hormone, calcitonin, insulin, glucagon, vasopressin, angiotensin II, thyrotropin-releasing hormone, vasoactive intestinal peptide, sleep peptides, etc.;Other proteins, such as thrombolytic agents, atrial natriuretic peptide, bone morphogenetic proteins, thrombopoietin, relaxin, glial fibrillary acidic protein, follicle-stimulating hormone, human alpha-1 antitrypsin, leukemia inhibitory factor, transforming growth factor, insulin-like growth factor, luteinizing hormone, macrophage-activating factor, tumor necrosis factor, neutrophil chemotactic factor, nerve growth factor, tissue inhibitors of metalloproteinases; vasoactive intestinal peptide, angiogenin, angiotropin, fibrin; hirudin; leukemia inhibitory factor; IL-1 receptor antagonists (e.g., Kineret® (anakinra)); ion channels, such as cystic fibrosis transmembrane conductance regulator (CFTR); dystrophin; utrophin, tumor suppressor; lysosomal enzyme acid alpha-glucosidase (GAA); etc. Suitable nucleic acids also include those encoding functional fragments of any of the above-mentioned proteins; and nucleic acids encoding functional variants of any of the above-mentioned proteins. ;

[0175] Suitable heterologous nucleic acid also includes those encoding antigenic protein.The subject rAAV vector that comprises heterologous nucleic acid encoding antigenic protein is suitable for stimulating the immune response to antigenic protein in mammalian host.Antigenic protein is derived from self-antigen, allergen, tumor / cancer-associated antigen, pathogenic virus, pathogenic bacterium, pathogenic protozoan, pathogenic helminth or any other pathogenic organism that infects mammalian host. As used herein, the term "nucleic acid encoding an antigenic protein derived from" includes nucleic acids encoding wild-type antigenic proteins, e.g., nucleic acids isolated from pathogenic viruses that encode viral proteins; synthetic nucleic acids generated in a laboratory that encode antigenic proteins that have the same amino acid sequence as naturally occurring antigenic proteins; synthetic nucleic acids generated in a laboratory that encode antigenic proteins that differ in amino acid sequence (e.g., by 1 to about 15 amino acids) from naturally occurring antigenic proteins but that nevertheless induce an immune response against the corresponding naturally occurring antigenic proteins; and synthetic nucleic acids generated in a laboratory that encode fragments of antigenic proteins (e.g., fragments of about 5 to about 50 amino acids, which fragments comprise one or more antigenic epitopes) that induce an immune response against the corresponding naturally occurring antigenic proteins.

[0176] Similarly, antigenic proteins "derived from" autoantigens, allergens, tumor / cancer-associated antigens, pathogenic viruses, pathogenic bacteria, pathogenic protozoans, pathogenic helminths, or any other pathogenic organism that infects a mammalian host include proteins that have identical amino acid sequences to naturally occurring antigenic proteins, and proteins that differ in amino acid sequence (e.g., by 1 amino acid to about 15 amino acids) from naturally occurring antigenic proteins but that nevertheless induce an immune response against the corresponding naturally occurring antigenic protein; as well as fragments of antigenic proteins (e.g., fragments of about 5 amino acids to about 100 amino acids, e.g., about 5 to about 50 amino acids, which fragments contain one or more antigenic epitopes) that induce an immune response against the corresponding naturally occurring antigenic protein.

[0177] In some embodiments, an immune response to an antigenic protein encoded by a subject rAAV vector stimulates a protective immune response in a mammalian host against a pathogenic organism that displays the antigenic protein or antigenic epitope (or a protein or epitope that is cross-reactive with the antigenic protein or antigenic epitope encoded by the rAAV). In some embodiments, a cytotoxic T lymphocyte (CTL) response is induced in the mammalian host against the antigenic protein encoded by the rAAV. In other embodiments, a humoral response is induced in the mammalian host against the antigenic protein encoded by the rAAV, thereby generating antibodies specific to the antigenic protein. In many embodiments, a TH1 immune response is induced in the mammalian host against the antigenic protein encoded by the rAAV. Suitable antigenic proteins include tumor / cancer-associated antigens, viral antigens, bacterial antigens, and protozoan antigens; and antigenic fragments thereof. In some embodiments, the antigenic protein is derived from an intracellular pathogen. In other embodiments, the antigenic protein is an autoantigen. In still other embodiments, the antigenic protein is an allergen.

[0178] Tumor / cancer-specific antigens include, but are not limited to, any of the various MAGEs (melanoma-associated antigen E), including MAGE1 (e.g., GenBank accession number M77481), MAGE2 (e.g., GenBank accession number U03735), MAGE3, MAGE4, ​​etc.; any of the various tyrosinases; mutant ras; mutant p53 (e.g., GenBank accession numbers X54156 and AA494311); and p97 melanoma antigen (e.g., GenBank accession number M12154). Other tumor / cancer-specific antigens include the Ras peptide and p53 peptide associated with advanced cancer, the HPV16 / 18 and E6 / E7 antigens associated with cervical cancer, the MUCI1-KLH antigen associated with breast cancer (for example, GenBank accession number J03651), the CEA (carcinoembryonic antigen) associated with colorectal cancer (for example, GenBank accession number X98311), gp100 (for example, GenBank accession number S73003) or the MART1 antigen associated with melanoma, and the PSA antigen associated with prostate cancer (for example, GenBank accession number X14810).The p53 gene sequence is known (for example, see Harris et al. (1986) Mol. Cell. Biol., 6:4650-4656) and is deposited in GenBank under accession number M14694. Thus, the subject proteins, nucleic acids, and / or virions can be used as immunotherapeutics against cancers, including but not limited to cervical cancer, breast cancer, colorectal cancer, prostate cancer, lung cancer, and against melanoma.

[0179] Viral antigens are derived from known pathogens causing diseases, including, but not limited to, measles, mumps, rubella, poliomyelitis, hepatitis A, hepatitis B (e.g., GenBank Accession No. E02707), and hepatitis C (e.g., GenBank Accession No. E06890), as well as other hepatitis viruses, influenza, adenovirus (e.g., types 4 and 7), rabies (e.g., GenBank Accession No. M34678), yellow fever, Japanese encephalitis (e.g., GenBank Accession No. E07883), dengue (e.g., GenBank Accession No. M24444), hantavirus, and human immunodeficiency virus (e.g., GenBank Accession No. U18552).

[0180] Suitable bacterial and parasitic antigens include, but are not limited to, antigens from diphtheria, pertussis (e.g., GenBank Accession No. M35274), tetanus (e.g., GenBank Accession No. M64353), tuberculosis, bacterial and fungal pneumonia (e.g., Haemophilus influenzae, Pneumocystis carinii), cholera, typhoid, plague, shigellosis, salmonellosis (e.g., GenBank Accession No. L03833), legionellosis, Lyme disease (e.g., GenBank Accession No. U59487), malaria (e.g., GenBank Accession No. X53832), hookworms, onchocerciasis (e.g., GenBank Accession No. M27807), schistosomiasis (e.g., GenBank Accession No. L08198), trypanosomiasis, leishmaniasis, giardiasis (e.g., GenBank Accession No. M33641), amebiasis, filariasis (e.g., GenBank Accession No. J03266), borreliosis, and trichinosis.

[0181] Suitable heterologous nucleic acids encoding heterologous gene products include non-translated RNA, such as RNAi agents (described in more detail above) (e.g., antisense RNA; siRNA; shRNA; double-stranded RNA (dsRNA); CRISPR agents, such as Cas9 or Cas9-like proteins, crRNA-like RNA, tracrRNA-like RNA, single guide RNA, and / or donor polynucleotides; etc.), ribozymes, etc. RNAi agents can be used to inhibit gene expression. Some RNAi agents provide tools that can be used to subsequently inhibit gene expression (e.g., CRISPR agents, such as cas9 or cas9-like proteins).

[0182] Target genes include any gene that encodes a harmful (e.g., pathological) target gene product (RNA or protein), for example, a target gene product that is malfunctioning (e.g., due to a mutation in the encoded protein sequence, due to a mutation in a non-coding sequence that controls the steady-state level of the gene product, etc.). Target gene products include, but are not limited to, huntingtin; hepatitis C virus; human immunodeficiency virus; amyloid precursor protein; tau; proteins containing polyglutamine repeats; herpes viruses (e.g., varicella-zoster); any pathological virus; and the like.

[0183] Thus, the subject rAAVs comprising a heterologous nucleic acid encoding an RNAi agent are useful for treating a variety of disorders and conditions, including, but not limited to, neurodegenerative diseases, e.g., trinucleotide repeat diseases, e.g., polyglutamine repeat-associated diseases, e.g., Huntington's disease, spinocerebellar ataxia, spinal-bulbar muscular atrophy (SBMA), dentatorubral-pallidoluysian atrophy (DRPLA), and the like; acquired pathologies (e.g., diseases or syndromes manifested by abnormal physiological, biochemical, cellular, structural, or molecular biological states), e.g., hepatitis resulting from or likely to result from viral infections, e.g., HCV infection, acquired immune deficiency syndrome resulting from HIV infection; cancer; and the like.

[0184] In many embodiments, the heterologous nucleic acid that encodes RNAi agent is operably linked to promoter.Suitable promoter is known to those skilled in the art, and includes the promoter of any protein-coding gene, for example, the promoter of endogenously regulated gene or constitutively expressed gene.For example, the promoter of the gene that is regulated by the physiological events of cell, for example, heat shock, oxygen level and / or carbon monoxide level in hypoxic condition, can be operably linked to siRNA-encoding nucleic acid.

[0185] A selected heterologous nucleotide sequence, such as one encoding EPO or a nucleic acid of interest, is operably linked to control elements that direct the transcription or expression of the nucleotide sequence in vivo. Such control elements may include control sequences normally associated with the selected gene (e.g., endogenous cellular control elements). Alternatively, heterologous control sequences can be used. Useful heterologous control sequences generally include those derived from sequences encoding mammalian or viral genes. Examples include, but are not limited to, the SV40 early promoter, the mouse mammary tumor virus long terminal repeat (LTR) promoter; the adenovirus major late promoter (Ad MLP); the herpes simplex virus (HSV) promoter, endogenous cellular promoters heterologous to the gene of interest, the cytomegalovirus (CMV) promoter such as the CMV immediate early promoter region (CMVIE), the Rous sarcoma virus (RSV) promoter, synthetic promoters, hybrid promoters, and the like. Additionally, sequences derived from non-viral genes, such as the mouse metallothionein gene, are also useful herein. Such promoter sequences are commercially available, for example, from Stratagene (San Diego, Calif.).

[0186] In some embodiments, a cell-type- or tissue-specific promoter is operably linked to the heterologous nucleic acid encoding the heterologous gene product, such that the gene product is selectively or preferentially produced in a particular cell type(s) or tissue(s). In some embodiments, an inducible promoter is operably linked to the heterologous nucleic acid.

[0187] For example, muscle-specific and inducible promoters, enhancers, etc. are useful for delivering gene products to muscle cells. Such control elements include, but are not limited to, those derived from the actin and myosin gene families, such as those derived from the myoD gene family; muscle cell-specific enhancer-binding factor MEF-2; control elements derived from the human skeletal actin gene and cardiac actin gene; muscle creatine kinase sequence elements and mouse creatine kinase enhancer (mCK) elements; control elements derived from the fast skeletal troponin C gene, the slow cardiac troponin C gene, and the slow troponin I gene; hypoxia-inducible nuclear factor; steroid-inducible elements and promoters such as glucocorticoid response elements (GREs); fusion consensus elements for RU486 induction; and elements that result in tetracycline-regulated gene expression.

[0188] By directly inserting a selected sequence(s) into the AAV genome from which the major AAV open reading frame ("ORF") has been excised, an AAV expression vector can be constructed that has the desired DNA molecule (heterologous DNA) bound to the AAV ITRs. Other portions of the AAV genome can also be deleted, as long as a sufficient portion of the ITRs remains to enable replication and packaging functions. Such constructs can be designed using techniques well known in the art. See, e.g., U.S. Patent Nos. 5,173,414 and 5,139,941; International Publication Nos. WO 92 / 01070 (published January 23, 1992) and WO 93 / 03769 (published March 4, 1993); Lebkowski et al. (1988) Molec. Cell. Biol. 8:3988-3996; Vincent et al. (1990) Vaccines 90 (Cold Spring Harbor Laboratory Press); Carter, BJ (1992) Current Opinion in Biotechnology 3:533-539;Muzyczka, N. (1992) Current Topics in Microbiol. Immunol. 158:97-129;Kotin, RM (1994) See Human Gene Therapy 5:793-801; Shelling and Smith (1994) Gene Therapy 1:165-169; and Zhou et al. (1994) J. Exp. Med. 179:1867-1875.

[0189] Alternatively, AAV ITRs can be excised from the viral genome or from an AAV vector containing the viral genome and fused to the 5' and 3' ends of a selected nucleic acid construct present in another vector using any conventional method known to those skilled in the art. For example, one suitable approach uses standard ligation techniques, such as those described in Sambrook et al., supra. For example, ligation can be accomplished in 20 mM Tris-Cl pH 7.5, 10 mM MgCl2, 10 mM DTT, 33 μg / ml BSA, 10 mM to 50 mM NaCl, and 40 μM ATP with 0.01 to 0.02 (Weiss) units of T4 DNA ligase at 0°C to 16°C (for "sticky end" ligation), or in 1 mM ATP with 0.3 to 0.6 (Weiss) units of T4 DNA ligase at 14°C (for "blunt end" ligation). Intermolecular "sticky end" ligation is typically performed at a total DNA concentration of 30-100 μg / ml (total final concentration 5-100 nM). AAV vectors containing ITRs are described, for example, in U.S. Patent No. 5,139,941. In particular, several AAV vectors available from the American Type Culture Collection ("ATCC") under accession numbers 53222, 53223, 53224, 53225, and 53226 are described therein.

[0190] Furthermore, chimeric genes can be synthetically produced to include AAV ITR sequences located 5' and 3' of one or more selected nucleic acid sequences. Preferred codons can be used for the expression of chimeric gene sequences in mammalian muscle cells. The complete chimeric sequence is assembled from overlapping oligonucleotides prepared by standard methods. See, for example, Edge, Nature (1981) 292:756; Nambair et al. Science (1984) 223:1299; Jay et al. J. Biol. Chem. (1984) 259:6311.

[0191] Generation of subject infectious rAAV virions

[0192] By way of introduction, host or "producer" cells are typically used for replication and packaging of rAAV vectors. Such producer cells (usually mammalian host cells) generally contain or are modified to contain several different types of components for rAAV production. The first component is a recombinant adeno-associated virus (rAAV) vector genome (or "rAAV provector") that can be replicated by a host packaging cell and packaged into a vector particle. The rAAV provector typically contains a heterologous polynucleotide (or "transgene") with which it is desired to genetically alter another cell for gene therapy (since packaging of such a transgene into rAAV vector particles can be effectively used to deliver the transgene to a variety of mammalian cells). The transgene is generally flanked by two AAV inverted terminal repeats (ITRs), which contain sequences recognized during excision, replication, and packaging of the AAV vector, as well as during integration of the vector into the genome of the host cell.

[0193] The second component is a helper virus that can provide helper functions for AAV replication. Adenovirus is commonly used, but other helper viruses can also be used as known in the art. Alternatively, the necessary helper virus functions can be genetically isolated from the helper virus, and the encoding genes can be used to provide the helper virus functions in trans. The AAV vector elements and the helper virus (or helper virus functions) can be introduced into host cells simultaneously or sequentially in any order.

[0194] The final components for AAV production provided in the producer cell are the "AAV packaging genes," such as the AAV rep and cap genes, which provide replication and encapsidation proteins, respectively. Several different versions of the AAV packaging genes can be provided (including the rep-cap cassette, as well as separate rep and / or cap cassettes, where the rep and / or cap genes can remain under the control of their native promoters or can be operably linked to heterologous promoters. Such AAV packaging genes can be transiently or stably introduced into the host packaging cell, as known in the art and described in more detail below.

[0195] 1. rAAV vector

[0196] A subject rAAV virion containing a heterologous DNA of interest ("heterologous DNA of interest" is also referred to herein as "heterologous nucleic acid") can be produced using standard methodologies known to those skilled in the art. The methods generally involve: (1) introducing a subject rAAV vector into a host cell; (2) introducing an AAV helper construct into the host cell, the helper construct comprising an AAV coding region capable of being expressed in the host cell to complement AAV helper functions missing from the AAV vector; (3) introducing one or more helper viruses and / or accessory function vectors into the host cell, the helper viruses and / or accessory function vectors providing accessory functions capable of supporting efficient recombinant AAV ("rAAV") virion production in the host cell; and (4) culturing the host cell to produce rAAV virions. The AAV expression vector, AAV helper construct, and helper virus or accessory function vector(s) can be introduced into the host cell simultaneously or sequentially using standard transfection techniques.

[0197] AAV expression vectors are constructed using known techniques, providing at least the following components in the transcription direction: a control element including a transcription initiation region, a target DNA, and a transcription termination region.The control element is selected to be functional in mammalian muscle cells.The resulting construct containing the components in the transcription direction is linked with functional AAV ITR sequences (5' and 3').

[0198] The nucleotide sequences of the AAV ITR regions are known. For the AAV-2 sequence, see, for example, Kotin, RM (1994) Human Gene Therapy 5:793-801; Berns, KI "Parvoviridae and Their Replication" in Fundamental Virology, 2nd Edition, (BN Fields and DM Knipe, eds.). The AAV ITRs used in the vectors of the present invention need not have the wild-type nucleotide sequence but may be altered, for example, by nucleotide insertion, deletion, or substitution. Furthermore, the AAV ITRs may be derived from any of several AAV serotypes, including, but not limited to, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-7, etc. Furthermore, the 5' and 3' ITRs flanking a selected nucleotide sequence in an AAV expression vector do not necessarily need to be identical or derived from the same AAV serotype or isolate, so long as they function as intended, i.e., allowing for excision and rescue of the sequence of interest from the host cell genome or vector, and allowing integration of the DNA molecule into the recipient cell genome when the AAV Rep gene products are present in the cell. The ITRs allow replication of the vector sequences in the presence of the appropriate mixture of Rep proteins. The ITRs also allow for incorporation of the vector sequences into the capsid to generate AAV particles.

[0199] To produce rAAV virions, AAV expression vectors are introduced into suitable host cells using known techniques, such as by transfection.Several transfection techniques are generally known in the art.For example, see Graham et al. (1973) Virology, 52:456, Sambrook et al. (1989) Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratories, New York, Davis et al. (1986) Basic Methods in Molecular Biology, Elsevier, and Chu et al. (1981) Gene 13:197. Particularly suitable transfection methods include calcium phosphate coprecipitation (Graham et al. (1973) Virol. 52:456-467), direct microinjection into cultured cells (Capecchi, MR (1980) Cell 22:479-488), electroporation (Shigekawa et al. (1988) BioTechniques 6:742-751), and liposome-mediated gene transfer (Mannino et al. (1988) BioTechniques 6:682-690), lipid-mediated transduction (Felgner et al. (1987) Proc. Natl. Acad. Sci. USA 84:7413-7417), and nucleic acid delivery using high-velocity microprojectiles (Klein et al. (1987) Nature 327:70-73).

[0200] For purposes of this disclosure, suitable host cells for producing rAAV virions include microorganisms, yeast cells, insect cells, and mammalian cells that can be or have been used as recipients of heterologous DNA molecules. The term includes the progeny of the original transfected cell. Thus, "host cells" for producing rAAV virions generally refer to cells transfected with an exogenous DNA sequence. In many embodiments, cells derived from the stable human cell line, 293 (e.g., readily available through the American Type Culture Collection under accession number ATCC CRL1573) are used. In particular, the human cell line, 293, is a human embryonic kidney cell line that has been transformed with adenovirus type 5 DNA fragments (Graham et al. (1977) J. Gen. Virol. 36:59) and expresses the adenovirus E1a and E1b genes (Aiello et al. (1979) Virology 94:460). The 293 cell line is easily transfected and provides a particularly easy-to-use platform for producing rAAV virions.

[0201] 2.AAV helper function

[0202] Host cells containing the above-mentioned AAV expression vectors must be capable of providing AAV helper functions to replicate and encapsidate the nucleotide sequence flanked by the AAV ITRs to produce rAAV virions. AAV helper functions are generally coding sequences derived from AAV that can be expressed to provide AAV gene products that function in trans for productive AAV replication. AAV helper functions are used herein to complement necessary AAV functions missing from an AAV expression vector. Thus, AAV helper functions include one or both of the major AAV ORFs, i.e., the rep coding region and the cap coding region, or functional homologs thereof. In the context of the present disclosure, the cap function includes one or more mutant capsid proteins, wherein at least one capsid protein contains at least one of the above-mentioned mutations.

[0203] "AAV rep coding region" refers to the region of the AAV genome that encodes the replication proteins Rep78, Rep68, Rep52, and Rep40, as understood in the art. These Rep expression products have been shown to have many functions, including recognition, binding, and nicking of the AAV DNA replication origin, DNA helicase activity, and modulation of transcription from AAV (or other heterologous) promoters. The Rep expression products are collectively required for replicating the AAV genome. For a description of the AAV rep coding region, see, e.g., Muzyczka, N. (1992) Current Topics in Microbiol. and Immunol. 158:97-129; and Kotin, RM (1994) Human Gene Therapy 5:793-801. Suitable homologs of the AAV rep coding region include the human herpesvirus 6 (HHV-6) rep gene, which has also been shown to mediate AAV-2 DNA replication (Thomson et al. (1994) Virology 204:304-311).

[0204] AAV cap proteins include VP1, VP2, and VP3, wherein at least one of VP1, VP2, and VP3 contains at least one mutation described above.

[0205] AAV helper functions are introduced into host cells by transfecting them with an AAV helper construct prior to or in conjunction with the transfection of an AAV expression vector. Thus, to complement missing AAV functions necessary for productive AAV infection, AAV helper constructs are used to provide at least transient expression of the AAV rep and / or cap genes. AAV helper constructs lack AAV ITRs and cannot replicate or be packaged by themselves. These constructs may be in the form of a plasmid, phage, transposon, cosmid, virus, or virion. Several commonly used AAV helper constructs, such as the plasmids pAAV / Ad and pIM29+45, which encode both Rep and Cap expression products, have been described. See, for example, Samulski et al. (1989) J. Virol. 63:3822-3828; and McCarty et al. (1991) J. Virol. 65:2936-2945. Several other vectors have been described that encode Rep and / or Cap expression products, see, e.g., U.S. Patent No. 5,139,941.

[0206] Both the AAV expression vector and the AAV helper construct can be constructed to contain one or more selectable markers as needed. Suitable markers include genes that confer antibiotic resistance or sensitivity, color, or alter antigenic characteristics to cells transfected with a nucleic acid construct containing the selectable marker when the cells are grown in an appropriate selective medium. Some selectable marker genes useful for carrying out the method of the present disclosure include the hygromycin B resistance gene (encoding aminoglycoside phosphotransferase (APH)), which confers resistance to hygromycin, thereby enabling selection in mammalian cells; the neomycin phosphotransferase gene (encoding neomycin phosphotransferase), which confers resistance to G418, thereby enabling selection in mammalian cells; and the like. Other suitable markers are known to those skilled in the art.

[0207] 3.AAV accessory functions

[0208] To produce rAAV virions, the host cell (or packaging cell) must also be able to provide non-AAV-derived functions, or "accessory functions." Accessory functions are non-AAV-derived viral and / or cellular functions that AAV depends on for replication. Thus, accessory functions include at least non-AAV proteins and RNAs required for AAV replication, including those involved in the activation of AAV gene transcription, stage-specific AAV mRNA splicing, AAV DNA replication, Cap expression product synthesis, and AAV capsid assembly. Viral-based accessory functions may be derived from any known helper virus.

[0209] In particular, accessory functions can be introduced into host cells using methods known to those skilled in the art, and then expressed.Generally, accessory functions are provided by the infection of host cells with unrelated helper viruses.Several suitable helper viruses are known, including adenovirus; herpesviruses such as herpes simplex virus type 1 and type 2; and vaccinia virus.Non-viral accessory functions, such as those provided by cell synchronization using any of a variety of known agents, are also used herein.For example, see Buller et al. (1981) J. Virol. 40:241-247; McPherson et al. (1985) Virology 147:217-222; Schlehofer et al. (1986) Virology 152:110-117.

[0210] Alternatively, accessory function vectors can be used to provide accessory functions. Accessory function vectors contain nucleotide sequences that provide one or more accessory functions. Accessory function vectors can be introduced into suitable host cells to support efficient AAV virion production in the host cells. Accessory function vectors can be in the form of plasmids, phages, transposons, cosmids, or other viruses. Accessory vectors can also be in the form of one or more linearized DNA or RNA fragments, which, when associated with appropriate control elements and enzymes, can be transcribed or expressed in host cells to provide accessory functions.

[0211] Nucleic acid sequences that provide accessory functions can be obtained from natural sources, such as from the genome of an adenovirus particle, or can be constructed using recombinant or synthetic methods known in the art. In this regard, adenovirus-derived accessory functions have been extensively studied, and several adenovirus genes involved in accessory functions have been identified and partially characterized. See, for example, Carter, BJ (1990) "Adeno-Associated Virus Helper Functions", in CRC Handbook of Parvoviruses, vol. See, e.g., J. I (P. Tijssen, ed.), and Muzyczka, N. (1992) Curr. Topics. Microbiol. and Immun. 158:97-129. Specifically, the early adenovirus gene regions E1a, E2a, E4, VAI RNA, and possibly E1b are thought to be involved in the accessory process. Janik et al. (1981) Proc. Natl. Acad. Sci. USA 78:1925-1929. Accessory functions from herpesviruses have been described. See, e.g., Young et al. (1979) Prog. Med. Virol. 25:113. Accessory functions from vaccinia virus have also been described. See, e.g., Carter, BJ (1990) supra; Schlehofer et al. (1986) Virology 152:110-117.

[0212] As a result of the infection of host cells with helper viruses or the transfection of host cells with accessory function vectors, accessory functions are expressed, thereby transactivating the AAV helper construct to produce AAV Rep and / or Cap proteins.The Rep expression product excises recombinant DNA (including target DNA, for example, heterologous nucleic acid) from the AAV expression vector.The Rep protein also functions to replicate the AAV genome.The expressed Cap protein is assembled into capsids, and the recombinant AAV genome is packaged within the capsids.Therefore, productive AAV replication occurs, and DNA is packaged within rAAV virions.

[0213] After recombinant AAV replication, rAAV virions can be purified from host cells using various conventional purification methods, such as CsCl gradient, affinity chromatography, and ion exchange chromatography. Furthermore, when infection is used to express accessory functions, residual helper virus can be inactivated using known methods. For example, adenovirus can be inactivated by heating to a temperature of approximately 60°C for, for example, 20 minutes or longer. Because AAV is highly thermostable, while helper adenovirus is heat-labile, this treatment effectively inactivates only the helper virus.

[0214] The resulting rAAV virions are now ready to be used for DNA delivery, such as in gene therapy applications, or for delivery of a gene product to a mammalian host.

[0215] Delivery of heterologous nucleic acids

[0216] The present disclosure further provides a method for delivering heterologous nucleic acid to target cells and / or individuals in need thereof. In some embodiments, the individuals in need thereof are humans who have previously been naturally exposed to AAV and consequently have anti-AAV antibodies (i.e., AAV neutralizing antibodies). For example, based on the positive results in clinical trials involving AAV gene delivery to the liver, muscle, and retina, all tissues affected by neutralizing antibodies against this vehicle, there are many applications / disease targets for such treatment.

[0217] The subject methods generally involve (i) administering to an individual an effective amount of a subject rAAV virion, and / or (ii) contacting target cells with a subject virion. Generally, the rAAV virion is administered to the subject using either in vivo ("direct") or in vitro ("indirect") transduction techniques. When transducing in vitro ("indirectly"), the desired recipient cells (i.e., "target cells") can be removed from the individual, transduced with rAAV virions, and reintroduced into the individual. Alternatively, syngeneic or xenogeneic cells can be used, provided they do not elicit an inappropriate immune response in the individual.

[0218] Suitable methods for the delivery and introduction of transduced target cells into an individual have been described, for example, by combining recombinant AAV virions with cells, e.g., in a suitable medium, and screening for cells containing the DNA of interest using conventional techniques such as Southern blot and / or PCR, or by using a selectable marker. The cells can be transduced in vitro. The transduced cells can then be formulated into pharmaceutical compositions, as described in more detail below, and the compositions can be introduced into a subject by a variety of techniques, for example, by intramuscular, intravenous, subcutaneous, and intraperitoneal injection.

[0219] For in vivo (i.e., "direct") delivery, the rAAV virions are formulated into a pharmaceutical composition and generally administered by a parenteral route of administration (e.g., via intramuscular, subcutaneous, intratumoral, transdermal, intrathecal, intravenous, etc.).

[0220] A pharmaceutical composition contains sufficient genetic material to produce a therapeutically effective amount of a desired gene expression product, i.e., an amount sufficient to reduce or ameliorate the symptoms of the condition in question or to confer a desired benefit. A pharmaceutical composition also contains a pharmaceutically acceptable excipient. Such excipients include any pharmaceutical agent that does not itself induce the production of antibodies harmful to the individual receiving the composition and that can be administered without undue toxicity. Pharmaceutically acceptable excipients include liquids such as water, saline, glycerol, and ethanol. Pharmaceutically acceptable excipients can include pharmaceutically acceptable salts, such as mineral acid salts (e.g., hydrochloride, hydrobromide, phosphate, sulfate, etc.) and salts of organic acids (e.g., acetate, propionate, malonate, benzoate, etc.). Additionally, auxiliary substances, such as wetting or emulsifying agents, pH buffering substances, and the like, can also be present in such vehicles. A wide variety of pharmaceutically acceptable excipients are known in the art and need not be discussed in detail herein. Pharmaceutically acceptable excipients are described, for example, in A. Gennaro (2000) "Remington: The Science and Practice of Pharmacy", 20th edition, Lippincott, Williams, & Wilkins Pharmaceutical Dosage Forms and Drug Delivery Systems (1999) H.C. Ansel et al., eds., 7 th ed., Lippincott, Williams, & Wilkins and Handbook of Pharmaceutical Excipients (2000) AH Kibbe et al., eds., 3 rded. Amer. Pharmaceutical Assoc.

[0221] The appropriate dose will depend on, among other factors, the mammal being treated (e.g., a human or non-human primate or other mammal), the age and general condition of the subject being treated, the severity of the condition being treated, the particular therapeutic protein in question, and its mode of administration. An appropriate effective amount can be readily determined by one of ordinary skill in the art.

[0222] Thus, a "therapeutically effective amount" falls within a relatively broad range that can be determined through clinical trials. For example, for in vivo injection, i.e., direct injection into skeletal or cardiac muscle, a therapeutically effective dose is approximately about 10 6 ~about 10 15 rAAV virions, e.g., approximately 10 8 ~10 12 For in vitro transduction, the effective amount of rAAV virions delivered to cells is approximately 10 8 ~about 10 13 Other effective dosages can be readily established by one of ordinary skill in the art through routine testing to establish dose-response curves.

[0223] Dosage treatment can be a single dose schedule or a multiple dose schedule. Furthermore, as many doses as needed can be administered to a subject. Those skilled in the art can easily determine the appropriate number of doses.

[0224] The cells of interest (i.e., "target cells") are generally mammalian, where the term refers to any animal classified as a mammal, including humans, domestic and farm animals, and zoo, laboratory, sport, or pet animals, such as dogs, horses, cats, cows, mice, rats, rabbits, etc. In some embodiments, the target cells are human cells.

[0225] Target cells of interest include any cell susceptible to infection by the subject rAAV virions. In some cases, for example, when the method is a method for delivering heterologous nucleic acid to a target cell, the target cell may be a cell removed from an individual (e.g., a "primary" cell), or the target cell may be a tissue culture cell (e.g., from an established cell line).

[0226] Exemplary target cells include, but are not limited to, hepatocytes, pancreatic cells (e.g., pancreatic islet cells: alpha cells, beta cells, delta cells, gamma cells, and / or epsilon cells), skeletal muscle cells, cardiomyocytes, fibroblasts, retinal cells, synovial joint cells, lung cells, T cells, neurons, glial cells, stem cells, hematopoietic progenitor cells, neural progenitor cells, endothelial cells, and cancer cells. Exemplary stem cell target cells include, but are not limited to, hematopoietic stem cells, neural stem cells, neural crest stem cells, embryonic stem cells, induced pluripotent stem cells (iPS cells), mesenchymal stem cells, mesodermal stem cells, hepatic stem cells, pancreatic stem cells, muscle stem cells, and retinal stem cells.

[0227] The term "stem cell" is used herein to refer to mammalian cells that have both the ability to self-renew and the ability to generate differentiated progeny (see, e.g., Morrison et al. (1997) Cell 88:287-298). Generally, stem cells also have one or more of the following characteristics: the ability to undergo asynchronous or symmetric replication, in which the two daughter cells after division can have different phenotypes; extensive self-renewal; the ability to exist in a mitotically quiescent form; and the ability to clonal regeneration of all tissues in which they reside, e.g., hematopoietic stem cells, to reconstitute all hematopoietic lineages. As will be understood by those skilled in the art, "progenitor cells" differ from stem cells in that they generally do not have extensive self-renewal ability and often can only give rise to a more restricted subset of the lineages of the tissue from which they originate, e.g., in the hematopoietic context, only lymphoid or erythroid lineages. As used herein, the term "stem cell" encompasses both "stem cells" and "progenitor cells" as defined above.

[0228] Stem cells can be characterized both by the presence of markers associated with particular epitopes identified by antibodies, and by the absence of certain markers identified by the lack of binding with specific antibodies. Stem cells can also be identified by functional assays, both in vitro and in vivo, particularly assays for the ability of stem cells to give rise to large numbers of differentiated progeny.

[0229] Suitable stem cells of interest include, but are not limited to, hematopoietic stem cells and progenitor cells derived therefrom (U.S. Patent No. 5,061,620); neural crest stem cells (Morrison et al. (1999) Cell 96:737-749); neural stem and progenitor cells; embryonic stem cells; mesenchymal stem cells; mesodermal stem cells; hepatic stem cells, muscle stem cells, retinal stem cells, induced pluripotent stem cells (iPS cells), etc. Other hematopoietic "progenitor" cells of interest include cells that commit to lymphoid lineages, e.g., immature T cell and B cell populations.

[0230] Purified stem or progenitor cell populations can be used. For example, human hematopoietic stem cells can be positively selected using antibodies specific for CD34 and Thy-1, or negatively selected using lineage-specific markers, which may include glycophorin A, CD3, CD24, CD16, CD14, CD38, CD45RA, CD36, CD2, CD19, CD56, CD66a, and CD66b; T cell-specific markers; tumor / cancer-specific markers; and the like. Markers useful for isolating mesodermal stem cells include FcγRII, FcγRIII, Thy-1, CD44, VLA-4a, LFA-113, HSA, ICAM-1, CD45, Aa4.1, Sca-1, and the like. Neural crest stem cells can be positively selected using antibodies specific for the low-affinity nerve growth factor receptor (LNGFR) and the markers sulfatide, glial fibrillary acidic protein (GFAP), and myelin protein P. oHuman mesenchymal stem cells can be positively isolated using the markers SH2, SH3, and SH4.

[0231] The target cells used may be fresh, frozen, or pre-cultured. The target cells used may be fetal, neonatal, or adult. Hematopoietic cells may be obtained from fetal liver, bone marrow, blood, particularly G-CSF- or GM-CSF-mobilized peripheral blood, or any other conventional source. The manner in which stem cells are separated from other cells of hematopoietic or other lineages is not critical to the present disclosure. As described above, a substantially homogeneous population of stem or progenitor cells can be obtained by selective isolation of cells that exhibit epitopes characteristic of stem cells while lacking markers associated with differentiated cells.

[0232] Nucleic acids that can be delivered to an individual include any of the heterologous nucleic acids defined above. Proteins that can be delivered using the subject methods also include functional fragments of any of the above-mentioned proteins; and functional variants of any of the above-mentioned proteins.

[0233] In some embodiments, therapeutically effective amount of protein is produced in mammalian host.Whether therapeutically effective amount of specific protein is produced in mammalian host by using the subject method can be easily determined by using the assay suitable for specific protein.For example, if protein is EPO, hematocrit is measured.

[0234] When the rAAV encodes an antigenic protein, suitable antigenic proteins that can be delivered to an individual using the subject method include, but are not limited to, tumor / cancer-associated antigens, autoantigens ("self" antigens), viral antigens, bacterial antigens, protozoan antigens, and allergens; and antigenic fragments thereof. In some embodiments, a cytotoxic T lymphocyte (CTL) response is induced in a mammalian host against the antigenic protein encoded by the rAAV. In other embodiments, a humoral response is induced in a mammalian host against the antigenic protein encoded by the rAAV, thereby producing antibodies specific to the antigenic protein. In many embodiments, a TH1 immune response is induced in a mammalian host against the antigenic protein encoded by the rAAV. Whether an immune response to the antigenic protein has occurred can be easily determined using well-established methods. For example, enzyme-linked immunosorbent assays can be used to determine whether antibodies have occurred to the antigenic protein. Methods for detecting antigen-specific CTLs are well known in the art. For example, detectably labeled target cells expressing the antigenic protein on their surface can be used to assay for the presence of antigen-specific CTLs in a blood sample.

[0235] Whether a therapeutically effective amount of a heterologous nucleic acid (e.g., a nucleic acid encoding a polypeptide, an RNAi agent, etc.) has been delivered to a mammalian host using the subject methods is readily determined using any suitable assay. For example, if the gene product is an RNAi agent that inhibits HIV, viral load can be measured.

[0236] Methods for generating and identifying modified rAAV virions

[0237] The present disclosure provides methods for generating and identifying modified infectious recombinant adeno-associated virus (rAAV) virions comprising variant capsid proteins comprising an amino acid sequence having at least one amino acid substitution (including deletion, insertion, etc.) compared to a starter AAV capsid protein, the starter AAV capsid protein comprising the amino acid sequence set forth in one of SEQ ID NOs: 10-13 and 26-33.

[0238] The methods generally involve generating a mutant rAAV virion library and selecting the library for modified rAAV virions that have altered properties relative to a starter rAAV virion. The starter rAAV virion comprises a variant AAV capsid protein comprising an amino acid sequence set forth in one of SEQ ID NOs: 10-13 and 26-33. The disclosure further provides libraries and compositions comprising the libraries.

[0239] In some embodiments, a given selection step is repeated two, three, four, or more times to enrich the subject AAV library for the altered virion property. In some embodiments, after AAV library selection, individual clones are isolated and sequenced.

[0240] Generation of mutant AAV libraries

[0241] A mutant AAV library containing one or more mutations compared to a starter AAV cap gene is generated. The starter cap gene is a cap containing a nucleotide sequence encoding a variant AAV capsid protein containing the amino acid sequence set forth in one of SEQ ID NOS: 10-13 and 26-33. Mutations in the rAAV cap gene are generated using any known method. Suitable methods for mutagenesis of the starter AAV cap gene include, but are not limited to, polymerase chain reaction (PCR)-based methods, oligonucleotide-directed mutagenesis, saturation mutagenesis, loop-swapping mutagenesis, fragment-shuffling mutagenesis (i.e., DNA shuffling), and the like. Methods for generating mutations are well described in the art. See, for example, Zhao et al. Nat Biotechnol. 1998 March; 16(3):234-5; Koerber et al.; Mol Ther. 2008 October; 16(10):1703-9;Koerber et. al.; Mol Ther. 2009 December; 17(12):2088-95; U.S. Patent No. 6,579,678; U.S. Patent No. 6,573,098; and U.S. Patent No. 6,582,914; all of which are incorporated herein by reference for their teachings regarding mutagenesis.

[0242] In some embodiments, mutant AAV libraries containing mutations in the cap gene are generated using a staggered extension process. The staggered extension process involves amplifying the cap gene using a PCR-based method. The template cap gene is primed using specific PCR primers, followed by repeated cycles of denaturation and very short annealing / polymerase-catalyzed extension. In each cycle, growing fragments anneal to different templates based on sequence complementarity and are further extended. Cycles of denaturation, annealing, and extension are repeated until full-length sequences are formed. The resulting full-length sequences contain at least one mutation in the cap gene compared to the wild-type AAV cap gene.

[0243] The PCR product containing the AAV cap sequence containing one or more mutations is inserted into a plasmid containing the wild-type AAV genome. The result is a library of AAV cap mutants. Thus, the present disclosure provides a library of AAV cap mutants, ranging from about 10 to about 10 10 The present invention provides a mutant AAV cap gene library that includes members of a species and contains mutations in the AAV cap gene. A given member of the library has from about 1 to about 50 mutations in the AAV cap gene. The subject libraries can range from 10 to about 10 9 It comprises distinct members of the species, each with a different mutation(s) in the AAV cap gene.

[0244] Once the cap mutant library is generated, viral particles are generated that can be subsequently selected based on their altered capsid properties. The library's plasmid DNA is transfected into suitable host cells (e.g., 293 cells), which are then transfected with a helper virus. The viral particles (rAAV library particles) produced by the transfected host cells are harvested.

[0245] Library Selection

[0246] Once the library is generated, it is selected for specific virion properties (i.e., altered infection properties). Virus particles are generated as described above (thus creating a library of modified rAAV virions) and subjected to one or more selection steps to identify modified rAAV virions with altered infection properties (relative to infectious rAAV virions comprising a variant capsid protein comprising an amino acid sequence set forth in one of SEQ ID NOS: 10-13 and 26-33). Selected infection properties can include, but are not limited to, 1) altered binding to AAV neutralizing antibodies (e.g., reduced binding); 2) increased evasion of AAV neutralizing antibodies; 3) increased infectivity for cells resistant to AAV infection; and 4) altered heparin binding.

[0247] 1. Selection for reduced binding to AAV neutralizing antibodies

[0248] In some embodiments, the subject AAV libraries are selected for altered (e.g., reduced) binding to neutralizing antibodies that bind to and neutralize wild-type AAV virions, compared to the binding of such antibodies to and neutralization of wild-type AAV virions (or compared to infectious rAAV virions containing a variant capsid protein comprising an amino acid sequence set forth in one of SEQ ID NOS: 10-13 and 26-33). The AAV library particles (AAV library virions) are contacted with the neutralizing antibody, and the ability of the AAV library particles to infect permissive host cells is tested. Typically, the AAV library particles are contacted with various concentrations of the neutralizing antibody. The higher the concentration of neutralizing antibody required to reduce the infectivity of the AAV library particles, the more resistant the AAV particles are to neutralization. Any conventional assay known to those skilled in the art can be used to directly measure the binding of AAV library virions to anti-AAV neutralizing antibodies (e.g., to measure binding affinity).

[0249] 2. Selection for increased evasion of AAV neutralizing antibodies

[0250] In some embodiments, the subject AAV libraries are selected for increased neutralizing antibody evasion (i.e., increased resistance to human AAV neutralizing antibodies) relative to infectious rAAV virions comprising a variant capsid protein comprising an amino acid sequence set forth in one of SEQ ID NOS: 10-13 and 26-33. The AAV library particles are contacted with target cells in the presence of an AAV neutralizing antibody (typically a human anti-AAV neutralizing antibody). After a suitable time to allow infection of the cells with the AAV library particles, helper virus is added, and AAV library particles that successfully infect the cell(s) are collected. In some embodiments, the infectivity of virions that exhibit successful infection is measured (e.g., as described above). In some embodiments, the cycle of infection, helper virus addition, and AAV particle collection is repeated one, two, three, or more times. Selection can be performed using various amounts (concentrations) of AAV neutralizing antibodies to select for different degrees of evasion (e.g., each repeated round can utilize an increasing concentration of antibody compared to the previous round).

[0251] 3. Selection for increased infectivity against non-permissive cells

[0252] In some embodiments, the subject AAV libraries are selected for increased infectivity toward non-permissive cells (compared to infectious rAAV virions comprising a variant capsid protein comprising an amino acid sequence set forth in one of SEQ ID NOS: 10-13 and 26-33). The AAV library particles are contacted with non-permissive cells (e.g., a population of non-permissive cells). After a suitable time to allow infection of the cells with the AAV library particles, helper virus is added, and AAV library particles that successfully infect the non-permissive cell(s) are collected. In some embodiments, the cycle of infection, helper virus addition, and AAV particle collection is repeated one, two, three, or more times.

[0253] 4. Selection for Heparin Binding Modifications

[0254] In some embodiments, the subject libraries are selected for altered heparin binding, including increased and decreased heparin binding, compared to the heparin binding of wild-type AAV virions (or compared to infectious rAAV virions containing a variant capsid protein comprising an amino acid sequence set forth in one of SEQ ID NOS: 10-13 and 26-33). The AAV library particles are contacted with a heparin affinity matrix. For example, the AAV library particles are loaded onto a heparin affinity column under conditions that allow binding of the AAV library particles to heparin. Exemplary conditions include equilibrating the column with 0.15 M NaCl and 50 mM Tris, pH 7.5. After binding of the AAV library particles to the heparin affinity matrix, the AAV library particle / heparin affinity matrix complexes are washed extensively with buffers containing increasing concentrations of NaCl, and eluted AAV library particles are collected at each NaCl concentration. For example, after binding, the AAV library particle / heparin affinity matrix complexes are washed with 50 mM Tris buffer, pH 7.5, containing 200 mM NaCl, and the eluted AAV library particles are collected. The elution step is repeated using 50 mM Tris buffer, pH 7.5, containing about 250 mM NaCl, about 300 mM NaCl, about 350 mM, about 400 mM NaCl, about 450 mM NaCl, about 500 mM NaCl, about 550 mM NaCl, about 600 mM NaCl, about 650 mM NaCl, about 700 mM NaCl, or about 750 mM NaCl.

[0255] AAV library particles eluted at NaCl concentrations less than about 450 mM NaCl exhibit reduced heparin binding properties compared to wild-type AAV, and AAV library particles eluted at NaCl concentrations greater than about 550 mM NaCl exhibit increased heparin binding properties compared to wild-type AAV.

[0256] In some embodiments, the eluted AAV library particles are amplified by co-infection of permissive cells with a helper virus and re-fractionated on a heparin affinity matrix, and this step can be repeated multiple times to enrich for AAV library particles with altered heparin-binding properties.

[0257] In the present methods, generation of AAV library particles can be followed by one or more selection steps. For example, in some embodiments, the method includes selecting for increased heparin binding, followed by selecting for reduced binding to neutralizing antibodies. In other embodiments, the method includes selecting for reduced binding to neutralizing antibodies, followed by selecting for increased heparin binding. In other embodiments, the method includes selecting for reduced binding to neutralizing antibodies, followed by selecting for reduced binding to neutralizing antibodies. In other embodiments, the method includes selecting for reduced binding to neutralizing antibodies, followed by selecting for reduced heparin binding. In other embodiments, the method includes selecting for reduced binding to neutralizing antibodies, followed by selecting for increased infectivity for stem cells. In other embodiments, the method includes selecting for reduced binding to neutralizing antibodies, followed by selecting for increased evasion of neutralizing antibodies. In other embodiments, the method includes selecting for increased evasion of neutralizing antibodies, followed by selecting for reduced binding to neutralizing antibodies.

[0258] Thus, the present disclosure provides an adeno-associated virus (AAV) library comprising a plurality of nucleic acids, each of which comprises a nucleotide sequence encoding a variant AAV capsid protein. The encoded variant AAV capsid protein comprises at least one amino acid substitution compared to the sequence set forth in one of SEQ ID NOs: 10-13 and 26-33. The present disclosure provides a library of mutant adeno-associated virus (AAV) particles comprising a plurality of AAV particles, each of which comprises an AAV capsid protein comprising at least one amino acid substitution compared to the sequence set forth in one of SEQ ID NOs: 10-13 and 26-33. The nucleic acids encoding the mutant AAV capsid proteins are described above, as are the properties of the encoded mutant AAV capsid proteins.

[0259] The disclosure further provides a library comprising at least one of: (i) two or more infectious rAAV virions, each comprising a variant adeno-associated virus (AAV) capsid protein and a heterologous nucleic acid; (ii) two or more isolated nucleic acids, each comprising a nucleotide sequence encoding a variant AAV capsid protein; (iii) two or more host cells, each comprising a nucleic acid comprising a nucleotide sequence encoding a variant AAV capsid protein; and (iv) two or more variant AAV capsid proteins, wherein the variant AAV capsid protein of at least one member of the library comprises an amino acid sequence having at least one amino acid substitution compared to the amino acid sequence set forth in one of SEQ ID NOs: 10-13 and 26-33.

[0260] Compositions and Kits

[0261] Compositions and kits for use in the methods of the present disclosure are also provided. The subject compositions and kits include at least one of the following: a subject infectious rAAV virion, a subject rAAV vector, a subject nucleic acid (nucleotide acid) comprising a nucleotide sequence encoding a subject variant AAV capsid protein, an isolated host cell comprising a subject nucleic acid (i.e., a subject genetically modified host cell comprising a nucleic acid comprising a nucleotide sequence encoding a subject variant AAV capsid protein); a subject library (e.g., any of the libraries described above); and a subject variant AAV capsid protein. The composition or kit may include any conventional combination of the above. The composition or kit may also include a helper virus and / or a nucleic acid comprising a nucleotide sequence encoding the helper virus. The kit may also include reagents for generating a nucleic acid encoding a modified variant AAV capsid protein (i.e., a "mutant" nucleic acid).

[0262] In addition to the above components, the subject kit may further include instructions for carrying out the subject method (in certain embodiments).These instructions may be present in the subject kit in various forms, one or more of which may be present in the kit.One form in which these instructions may be present is as information printed on a suitable medium or substrate, such as in the kit packaging, in a package insert, or the like, such as one or more sheets of paper on which the information is printed.Another form in which these instructions may be present is a computer-readable medium on which the information is recorded, such as a diskette, a compact disc (CD), a flash drive, etc.Another form in which these instructions may be present is a website address that can be used via the Internet to access information at a remote site.

[0263] The present invention now being fully described, it will be apparent to those skilled in the art that various changes and modifications can be made without departing from the spirit or scope of the invention. [Example]

[0264] Example 1

[0265] Adeno-associated virus (AAV) gene therapy vectors have demonstrated considerable promise in several clinical trials to date. However, circulating anti-AAV antibodies resulting from childhood exposure to AAV vectors or previous administration of AAV vectors have prevented the implementation of AAV gene therapy in many potential patients. We isolated novel AAV variants capable of enhanced anti-AAV antibody evasion both in vitro and in vivo. Stringent pressure resulting from selection using low- and high-potency human serum pools and human IVIG led to the evolution of AAV variants capable of evading neutralization by antibodies derived from individual human sera, human IVIG, and mouse sera—the most broadly evasive variants to date.

[0266] material and method

[0267] cell line

[0268] Cell lines were cultured at 37°C and 5% CO2 and were obtained from the American Type Culture Collection (Manassas, Va.) unless otherwise specified. HEK293T, HeLa, and HT1080 cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (Gibco, Carlsbad, Calif.) and 1% penicillin / streptomycin (Invitrogen, Carlsbad, Calif.). CHO K1 and CHO pgsA cells were cultured in F-12K medium (ATCC) supplemented with 10% fetal bovine serum (Gibco) and 1% penicillin / streptomycin (Invitrogen). Pro5 and Lec1 cells were cultured in MEM-alpha medium (Gibco) supplemented with 10% fetal bovine serum (Gibco) and 1% penicillin / streptomycin (Invitrogen).

[0269] Human serum pool for selection

[0270] Eighteen individual human serum samples were obtained from Innovative Research, Inc. (Southfield, Mich.), and neutralizing antibody titers against wild-type AAV2 were determined for each sample (Table 2). Because individual samples may vary in both antibody affinity and epitope specificity, equal volumes of individual serum samples were mixed to generate three highly potent serum pools (α = A + F + G, β = B + H + M, and γ = I + J + N). Selection in the presence of these antibody variations should result in a general increase in resistance to many pre-existing human antibodies. Subsequent selections were performed in the presence of Gamimune N, 10% human IVIG (Bayer, Elkhart Ind.) to select for resistance to an even broader range of antibodies.

[0271] Table 2: Neutralizing antibody titers of individual human serum samples The neutralizing antibody (NAb) titer for each sample is reported as the reciprocal of the volume fraction of serum required to reduce infectivity to 37% of that measured in the absence of serum. Three serum pools (α = A + F + G, β = B + H + M, and γ = I + J + N) were then generated by mixing equal volumes of the three individual serum samples.

[0272] [Table 2-1] [Table 2-2]

[0273] Library generation and virus production

[0274] To create a saturation mutagenesis library, an AAV2 cap library was generated by error-prone PCR using 5'-GCGGAAGCTTCGATCAACTACGC-3' (SEQ ID NO: 14) and 5'-GGGGCGGCCGCAATTACAGATTACGAGTCAGGTATCTGGTG-3' (SEQ ID NO: 15) as the forward and reverse primers, respectively, followed by the staggered extension process described by Zhao et al. Selection using pooled individual human sera revealed a variant containing four point mutations (described in the Results section) that served as the basis for the saturation mutagenesis library. The cap gene of this variant was subjected to further mutagenesis by changing amino acids at specific sites. Primer 5'-catt NNK The R471 amino acid site was mutagenized using the primer 5'gccacaaggacgatgaagaa-3' (SEQ ID NO: 16) and the corresponding reverse complement primer. NNK ttttttcctcagagcggggttctcatctttgggaagcaaggctca NNK The K532 and E548 amino acid sites were mutagenized using the primer 5'-ccaacctccagagaggc aaaacaagt gtggacattg-3' (SEQ ID NO: 17) and the corresponding reverse complement primer. NNK The N587 amino acid site was mutagenized using the primer agacaagcagctacc-3' (SEQ ID NO: 18) and the corresponding reverse complement primer: 5'-ccaactacaacaagtct NNK aatgtggactttactgtggac NNKThe V708 and T716 amino acid sites were mutagenized using the primer aatggcgtgtatt-3' (SEQ ID NO: 19) and the corresponding reverse complement primer. A library consisting of AAV2 containing randomized cap loop regions and a library containing shuffled DNA from wild-type AAV1, AAV2, AAV4, AAV5, AAV6, AAV8, and AAV9 cap genes were packaged and pooled for the first selection step (Koerber et al., Mol Ther. 2008 October; 16(10):1703-9; and Koerber et al., Mol Ther. 2009 December; 17(12):2088-95; both of which are incorporated herein by reference in their entireties).

[0275] For the second and third rounds of evolution, random mutagenesis libraries were generated by error-prone PCR of the cap genes from the loop-swap / shuffle library and the saturation mutagenesis library using 5'-CATGGGAAAGGTGCCAGACG-3' (SEQ ID NO: 20) and 5'-ACCATCGGCAGCCATACCTG-3' (SEQ ID NO: 21) as forward and reverse primers, respectively, as previously described. Replication-competent AAV libraries and recombinant AAV vectors expressing GFP under the control of the CMV promoter were packaged in HEK293T cells (ATCC) using calcium phosphate transfection, and the virus was purified by iodixonal gradient centrifugation. For in vivo use, recombinant AAV vectors expressing GFP or luciferase under the control of the CMV promoter were further purified by Amicon filtration. Deoxyribonuclease-resistant genomic titers were determined by quantitative PCR (Excoffon et al., Proc Natl Acad Sci USA. 2009 Mar. 10; 106(10):3865-70; and Maheshri et al., Nat Biotechnol. 2006 February; 24(2):198-204; both of which are incorporated herein by reference in their entireties).

[0276] Library selection and evolution

[0277] One round of selection was defined as infection of HEK293T cells with an AAV starting library (preinfection was incubated at room temperature for 30 minutes for pooled individual human sera or at 37°C for 1 hour with heat-inactivated IVIG), followed by adenovirus rescue and collection of successful variants. Each round of evolution consisted of mutagenesis of the cap gene to create a starting library and three rounds of selection. Three rounds of evolution were performed with each library, with clonal analysis performed between each round of evolution. The starting library for each round of evolution was generated as described above. After the third round of selection, the AAV cap gene was isolated from the pool of successful AAV variants and amplified by PCR. The cap gene was inserted into the pXX2 recombinant AAV packaging plasmid using NotI and HindIII. The cap gene was then sequenced at the University of California, Berkeley DNA sequencing facility and analyzed using Geneious software (Biomatters, Auckland, New Zealand). A three-dimensional model of the AAV2 capsid (Protein Databank accession number 1LP3) was rendered in Pymol (DeLano Scientific, San Carlos, Calif.).

[0278] In vitro transduction analysis of antibody escape variants

[0279] HEK293T cells were infected with 3 × 10 4 Cells were plated at a density of 100 cells / well. Variants were incubated with heat-inactivated IVIG, individual human sera, or individual mouse sera at 37°C for 1 hour prior to infection, and then cells were infected with rAAV-GFP at a genome MOI of 2000. The percentage of GFP-positive cells was determined 48 hours post-infection using ImageXpress Micro Cellular Imaging and Analysis System (Molecular Devices, Sunnyvale, Calif.) and MetaXpress Image Analysis Evaluation was performed using the Software, version 3.1.0, Multi Wavelength Cell Scoring Application Module (Molecular Devices).

[0280] In vitro transduction analysis

[0281] To determine the relative transduction efficiency of selected mutants compared with the parent wild-type AAV serotype, HEK293T cells, CHO K1 cells, CHO pgsA cells (lacking all surface glycosaminoglycans), CHO Pro5 cells (parental line for several glycosylation mutants, including Lec1 cells), CHO Lec1 cells (glycosylation-deficient), HeLa cells, and HT1080 cells (human fibrosarcoma cell line) were transfected at 2.5 × 10 per well 24 hours prior to infection. 4 Cells were plated at a density of 1 / 3 of a cell. Cells were infected with rAAV1-GFP, rAAV2-GFP, rAAV6-GFP, Shuffle100.1-GFP, Shuffle100.3-GFP, SM10.2-GFP, or Shuffle100.7-GFP at MOIs ranging from 100 to 1000. The percentage of GFP-positive cells was assessed 48 hours postinfection using a Beckman-Coulter Cytomics FC500 flow cytometer (Beckman-Coulter, Brea, Calif.).

[0282] In vivo analysis of antibody escape variants

[0283] For analysis of gene expression in vivo, 8-week-old female Balb / c mice were primed with 4 mg of IVIG or phosphate-buffered saline (for control mice) per mouse via tail vein injection, and 24 hours later, administered recombinant Shuffle100-3 (see SEQ ID NO: 12), SM10-2 (see SEQ ID NO: 10), or AAV2 vectors. Mice were administered 100 μg of recombinant AAV vector encoding luciferase under the control of the CMV promoter. 11 Viral genomes were injected via tail vein. For bioluminescence imaging, mice were anesthetized with 2% isoflurane and oxygen. D-luciferin substrate (GOLD Biotechnology, St. Louis, MO) was injected intraperitoneally at a dose of 500 μg / g body weight. Images were generated using a VivoVision IVIS Lumina imager (Xenogen, Alameda, California). Ventral images were taken 7–10 min after substrate injection for each mouse weekly for 4 weeks. Five weeks postinfection, serum was collected by cardiac puncture, and the mice were then perfused with 0.9% saline solution. Heart, liver, lungs, kidneys, spleen, brain, spinal cord, and hindlimb muscles were collected and frozen. For in vitro luciferase analysis, frozen tissue samples were homogenized and resuspended in reporter lysis buffer (Promega, Mannheim, Germany). The luciferase-containing lysate was clarified by centrifugation at 10,000 g for 10 minutes. To assay the sample, 20 μL of lysate was added to 100 μL of luciferase assay buffer, mixed, incubated for 5 minutes, and placed in a luminometer. The signal was integrated for 30 seconds with a 2-second delay and reported as relative light units (RLU) detected by a TD 20 / 20 luminometer (Turner Designs, Sunnyvale, Calif.). The luciferase signal was normalized to total protein content determined by bicinchoninic acid assay (Pierce).

[0284] result

[0285] Our results demonstrate that AAV can be evolved to largely overcome neutralization by anti-AAV antibodies both in vitro and in vivo. We isolated novel AAV variants that required neutralizing antibody titers (using human IVIG) 2-35 times higher than wild-type AAV in vitro. The neutralizing properties of the antibodies also resulted in enhanced transduction in vivo in the presence of neutralizing antibodies. The isolation of such novel clones resistant to anti-AAV antibodies will enable more widespread implementation of AAV-based treatments as nucleic acid delivery vectors, including in individuals with high antibody titers who are currently ineligible for AAV gene therapy.

[0286] Generation and selection of AAV libraries by directed evolution

[0287] Figure 1a shows a schematic diagram of the directed evolution approach used to isolate novel AAV variants capable of evading neutralization by human antibodies. A viral library was created using the DNA mutagenesis technique described in the following paragraphs (Figure 1a, steps 1 and 2). During the initial selection, a viral library pool developed from error-prone PCR mutations in the AAV2 cap gene was incubated with various dilutions of a low-potency α-human serum pool at room temperature for 30 minutes before infecting HEK293T cells (step 3). Following three rounds of selection against the low-potency α-human serum pool (Figure 1a, steps 4 and 5), several variants with enhanced resistance to this neutralizing serum pool were obtained (Figure 1a, step 6, Figure 7a). Variant 1.45 contained two point mutations (N312K, N449D) that conferred more than 10-fold resistance to neutralization by the α-pool compared to wild-type AAV2.

[0288] The cap gene from variant 1.45 was subjected to further random mutagenesis, and the resulting library was selected for three additional rounds of selection against parallel β and γ pools. Since only minor improvements in antibody escape were observed (data not shown), the recovered cap genes were pooled and subjected to DNA shuffling and EP. The β and γ pools were subjected to further diversification by PCR. Three additional rounds of selection against increasing amounts of serum from both pools resulted in substantial enrichment of the amount of virus recovered from the viral library compared to wild-type AAV2 (Fig. 7b, c). Sequencing of the cap genes of successful pools revealed several low-frequency variants present in both libraries and a single dominant variant, variant γ4.3, containing four point mutations (N312K, N449D, N551S, and 1698V). In the presence of human IVIG, variant 1.45 exhibited a modest 1.2-fold increased resistance to neutralization, while γ4.3 exhibited a 3.1-fold increased resistance to neutralization (Fig. 7d). This observation confirms the hypothesis that pools of individual human sera can be used to isolate AAV variants capable of enhanced evasion of antibodies present in the general human population.

[0289] The moderate success of variant γ4.3 in resisting neutralization by anti-AAV antibodies prompted the development of a library based on the γ4.3 cap gene. To identify amino acid mutations that could improve antibody resistance of γ4.3, we subjected amino acid sites R471, K532, E548, N587, V708, and T716, previously determined to be immunogenic sites in the AAV2 capsid, to saturation mutagenesis. This "saturation mutagenesis" library was subjected to three additional rounds of selection, along with a "shuffled" library consisting of random cap chimeras of seven parental AAV serotypes and a "loop-swap" library consisting of AAV2 caps with substituted loop regions. For this selection, the viral library pool was incubated with various dilutions of human IVIG at 37°C for 1 hour before infecting HEK293T cells. Following infection with the AAV library and amplification of infectious AAV variants by adenovirus superinfection, the number of viral genomes or viral titers from each library condition was quantified and compared to the titer of wild-type AAV2 as a method to determine the success of selection (Figure 1b). For each round of selection using saturation mutagenesis and loop-swapped / shuffled libraries, viral pools from the 1:10 and 1:100 IVIG dilution conditions that produced viral titers higher than wild-type AAV2 were used as the starting point for subsequent rounds of selection. After three rounds of selection, successful viral cap genes were isolated and individually tested to determine the virus with the most efficient gene delivery. Furthermore, cap genes isolated in the third round of selection were subjected to an additional round of error-prone PCR mutagenesis, and the process was repeated to iteratively increase viral fitness.

[0290] Figure 1 shows the directed evolution of AAV for enhanced antibody evasion. (a) Schematic of directed evolution. 1) A viral library is created by genetically diversifying the cap gene using several complementary methods. 2) Viruses are packaged into HEK293T cells using plasmid transfection, then harvested and purified. 3) The viral library is incubated with several concentrations of human IVIG and transduced into HEK293T cells in vitro. 4) Successful viruses are amplified by adenoviral superinfection and recovered. 5) Successful clones are enriched by repeated selection at a low MOI. 6) Isolated viral DNA reveals successful cap genes. 7) Successful cap genes are mutated again to serve as new starting points for selection. (b) Selection of antibody-evading mutants from loop-swapped / shuffled and saturation mutagenesis libraries. HEK293T cells were infected with the viral library for 24 hours. Viral particles that productively infected the cells were amplified by adenovirus infection, and the rescued AAV was quantified by qPCR (quantitative polymerase chain reaction). A 1:10 dilution of IVIG corresponds to a concentration of 10 mg IVIG / mL. Error bars indicate standard deviation (n=3).

[0291] Figure 7 shows the generation of AAV2-based human antibody evaders. (a) Four viral clones selected after three rounds of selection against the low-stringency α pool show enhanced resistance to 1 μL of α serum at an MOI of 1. Two additional rounds of diversification (i.e., mutagenesis and DNA shuffling) and selection (three rounds with increasing serum amounts) resulted in significantly enhanced virus recovery in the presence of large amounts of the highly potent (b) β pool and (c) γ pool. (d) Furthermore, two viral clones (1.45 and γ4.3) show 1.23- and 3.10-fold enhanced resistance compared to wild-type AAV2 against a highly diverse pool of pre-existing antibodies presenting pooled human intravenous immunoglobulin (IVIg) from approximately 100,000 individuals.

[0292] Enhanced in vitro antibody escape of novel evolved AAV variants

[0293] Of the 12 clones selected and packaged for individual analysis from the saturation mutagenesis and loop-swap / shuffled libraries after nine rounds of screening against human IVIG, all 12 required higher neutralizing antibody titers than both wild-type AAV1 and AAV2 (Fig. 2a and Table 1). Variant Shuffle100-3 (see SEQ ID NO: 12), which required a 35-fold higher in vitro IVIG concentration than wild-type AAV2 for neutralization, was still able to transduce approximately 10% of cells in the presence of 1 mg / mL IVIG (Fig. 2b). Furthermore, variant SM10-2 from the AAV2 saturation mutagenesis library required a 7.5-fold higher in vitro IVIG concentration than wild-type AAV2 for neutralization. Furthermore, variants Shuffle100-3 and SM10-2 (see SEQ ID NO: 10) showed enhanced transduction in the presence of serum samples from individual patients who were excluded from hemophilia B clinical trials (Figure 3) (Nathwani et al., N Engl J Med. 2011 Dec. 22; 365(25):2357-65).

[0294] Figure 2 shows the neutralization profiles of antibody escape variants. The cap genes of antibody escape variants isolated after three rounds of evolution were used to package recombinant AAV encoding GFP, which was then incubated with human IVIG and used to infect HEK293T cells. The percentage of remaining infectious particles was determined using high-content fluorescence imaging and normalized to the infectious titer in the absence of IVIG. Two clones from each library that were resistant to IVIG are shown. Data for other clones analyzed are shown in Table 1. (a) Neutralization curves. Error bars indicate standard deviation (n = 3). (b) Representative fluorescence images from several IVIG dilutions demonstrate that the variants are capable of transducing HEK293T cells in the presence of high concentrations of neutralizing antibodies.

[0295] Figure 3 shows the neutralization profiles of antibody escape variants. Human serum was obtained from individuals who were excluded from hemophilia B clinical trials due to the presence of high neutralizing antibody titers against AAV. Recombinant AAV encoding GFP was incubated with individual human serum samples prior to infection into HEK293T cells. The percentage of remaining infectious particles was determined using fluorescence microscopy and normalized to the infectious titer in the absence of human serum. Error bars indicate standard deviation (n=3).

[0296] Sequence analysis of the 12 clones revealed that the two variants most resistant to neutralizing antibodies, Shuffle100-3 (see SEQ ID NO: 12) and Shuffle100-1 (see SEQ ID NO: 11), contain nearly identical shuffled capsids containing fragments of AAV1-4, AAV6, and AAV9 (Figure 4). Differences at amino acids 469 (AAV6 to AAV7 residues) and 598 (AAV6 to AAV1 residues) between these two variants correspond to a nearly three-fold increase in neutralizing antibody titer for Shuffle100-3 (see SEQ ID NO: 12) (Table 1). Variant Shuffle100-7 (see SEQ ID NO: 13), which had the fourth highest resistance to neutralizing antibodies (Table 1), also has a shuffled capsid and contains fragments of AAV1, AAV6, and AAV8 (Figure 4), which is in good agreement with reported data showing that wild-type AAV1 and AAV8 are effective in evading anti-AAV2 antibodies. Interestingly, variant SM10-2 (see SEQ ID NO: 10) retained the point mutation acquired by variant γ4.3 and also retained wild-type residues at the saturation mutagenesis site. Variant SM10-2 (see SEQ ID NO: 10) acquired additional point mutations at surface residue D472N and internal residue L735Q. Figure 4 shows the amino acid sequences of loop-swap / shuffled and saturation mutagenesis clones. (a) Schematic diagrams of the capsid proteins are shown for the two clones from each library with the highest neutralizing IVIG concentrations. Each region is shaded according to the parent serotype from which it is derived. Black arrows indicate (from left to right) the start codons of the VP1, VP2, and VP3 capsid proteins. Gray arrows indicate (from left to right) surface loop regions I, II, III, IV, and V based on the AAV2 capsid. (b) Molecular models of the complete AAV2 capsid based on the solved structure are shown for the two clones from each library with the highest neutralizing IVIG concentrations. Each region is shaded according to the parent serotype from which it is derived. For variant Shuffle100-3 (see SEQ ID NO: 12), black arrows indicate the differences from variant Shuffle100-1 (see SEQ ID NO: 11).For variant SM10-2 (see SEQ ID NO: 10), mutations N449D, D472N, N551S, and 1698V are surface mutations (black).

[0297] Table 1: IVIG neutralizing antibody titers of library clones and parental serotypes

[0298] Human IVIG was used to neutralize recombinant AAV-GFP vectors bearing capsids derived from wild-type AAV1, AAV2, AAV8, and variants recovered from loop-swapped / shuffled and saturation mutagenesis libraries. The IVIG concentrations (mg / mL) required to reduce gene delivery efficiency to 50% of that in the absence of IVIG are shown and compared to the concentration required to reduce AAV2 delivery. All analyzed variants required higher concentrations of IVIG than wild-type AAV1 and AAV2. Neutralizing antibody titers were determined by exponential fitting of the curves in Figure 2. SEQ ID NOs are listed as "amino acid, nucleotide."

[0299] [Table 1]

[0300] Variants Shuffle100-3 (see SEQ ID NO: 12), Shuffle100-1 (see SEQ ID NO: 11), and Shuffle100-7 (see SEQ ID NO: 13) have transduction profiles that mimic those of the parent serotypes AAV1 and AAV6 (Figure 5). Furthermore, mutations in SM10-2 (see SEQ ID NO: 10) do not disrupt heparin dependency (seen in the parent serotype AAV2), resulting in a profile similar to that of AAV2 (Figure 5).

[0301] Figure 5 shows the in vitro tropism of novel AAV variants. Recombinant AAV vectors expressing green fluorescent protein were used to transduce a panel of cell lines: CHO, pgsA (lacking all surface glycosaminoglycans), Pro5, Lec1 (lacking sialic acid), HEK293T, HeLa, and HT1080 (a human fibrosarcoma cell line) to profile the transduction properties of the new AAV variants. Error bars indicate standard deviation (n = 3).

[0302] Increased antibody escape of novel evolved AAV variants in vivo

[0303] To determine the localization patterns of variants Shuffle100-3 and Shuffle100-7, we examined luciferase enzyme activity in various tissues of naive mice injected with AAV2, Shuffle100-3, or Shuffle100-7 (Fig. 6a). Variant Shuffle100-7 exhibited similar in vivo tropism compared to AAV2, except that it transduced the heart 7-fold, the lung 5-fold, and the liver 4.5-fold less efficiently. The Shuffle100-3 variant exhibited over fourfold greater brain transduction, over threefold greater lung transduction, and 27-fold greater muscle transduction than AAV2. Analysis of sera from these mice showed that for variant Shuffle100-3, serum from mice receiving AAV1, AAV2, AAV8, or Shuffle100-3 gene delivery vectors required in vitro serum concentrations equal to or higher than those for AAV1 and AAV8 for neutralization (Figure 11). For Shuffle100-7, serum from mice receiving AAV1, AAV2, AAV8, Shuffle100-3, or SM10-2 gene delivery vectors required in vitro serum concentrations equal to or higher than those for AAV1 for neutralization (Figure 11). Furthermore, both variants were less neutralized by serum from mice receiving AAV2 gene delivery vectors than all wild-type AAV serotypes tested. Interestingly, variant Shuffle100-3 was also less neutralized by serum from mice immunized against Shuffle100-3 than any of the other serotypes or variants tested (Figure 11). This data illustrates the potential for these variants to be used in combination with wild-type AAV serotypes or other variants in applications requiring multiple vector administrations.

[0304] Figure 11 shows the neutralizing antibody titers of library clones and parent serotypes in immunized mouse serum. Serum from mice administered library clones or wild-type AAV was used to neutralize recombinant AAV-GFP vectors bearing capsids derived from wild-type AAV1, AAV2, AAV8, and variants recovered from loop-swap / shuffled and saturation mutagenesis libraries. The serum dilution required to reduce gene delivery efficiency to 50% of that in the absence of serum is shown.

[0305] To determine the ability of variants Shuffle100-7 and Shuffle100-3 to evade antibody neutralization in vivo, mice were passively immunized with human IVIG and then injected with AAV. Variant Shuffle100-7 significantly increased transduction in the heart, liver, and muscle compared with AAV2, as measured by luciferase enzyme activity (Fig. 6b). Variant Shuffle100-3 significantly increased transduction in the heart and muscle compared with AAV2 (Fig. 6b).

[0306] Figure 6 shows the in vivo localization and neutralization of novel AAV variants. (a) A recombinant AAV vector encoding luciferase was administered to female BALB / c mice via tail vein injection. Five weeks later, the level of luciferase activity was determined and normalized to total protein for each sample analyzed. (b) 24 hours after tail vein injection of 4 mg of human IVIG, a recombinant AAV vector expressing luciferase was administered to female BALB / c mice via tail vein injection. Five weeks later, the level of luciferase expression was normalized to total protein for each sample analyzed. Error bars indicate standard deviation (n=3). * = p<0.05. RLU, relative luciferase units.

[0307] Variant γ4.3, isolated from an error-prone AAV2 library selected against a pool of individual human sera, contained four point mutations (N312K, N449D, N551S, and I698V). Interestingly, two of these positions (N449 and N551) had previously been identified as immunogenic residues using other pools of human sera, demonstrating that the antigenic epitopes associated with these sites are targeted by many different neutralizing antibodies. These sites are therefore interesting and valuable targets for mutation. Directed evolution and rational design in a saturation mutagenesis library resulted in the isolation of variant SM10-2, which exhibits greater antibody resistance in vitro than both AAV1 and AAV2. Variant SM10-2 incorporates two additional point mutations (D472N and L735Q) relative to those found in variant γ4.3. The D472N mutation has previously been shown to increase the level of capsid synthesis in HEK293 cells. Similarly, the replacement of the positively charged lysine side chain at amino acid position 735 with an uncharged glutamine side chain, which is also present in variant Shuffle100-7 despite being located internally in the assembled capsid, may function to stabilize the capsid (Figure 4).

[0308] The creation of chimeric AAV capsids allows for the creation of viral variants that can combine desirable properties from multiple AAV serotypes. AAV8 and AAV9 have also been shown to be much more resistant to neutralization by IVIG than AAV2, but the amino acids specific to these capsids were present in only small areas on the surface of the shuffled variants isolated during our selection (Figure 4). Shuffle100-3, a variant that exhibited more efficient evasion of antibody neutralization in vitro, exhibited similar in vitro tropism to its parent serotypes, AAV1 and AAV6, but had higher infectivity than either wild-type serotype. The differences in amino acids 469 and 598 between variants Shuffle100-1 and Shuffle100-3 correspond to a nearly threefold increase in neutralizing antibody titers for Shuffle100-3. A study by Lochrie et al. reported that the immunogenic residues recognized by human serum and IVIG differ, suggesting that different humans may produce various neutralizing antibodies against different sets of epitopes on the AAV capsid, and that complete escape from neutralization is not easy (Lochrie et al., J Virol. 2006 January; 80(2):821-34). Our study demonstrates that the use of multiple rounds of directed evolution using several different serum pools containing anti-AAV antibodies of various amounts and potencies results in the isolation of novel AAV variants capable of enhanced cell transduction in the presence of multiple anti-AAV antibody pools, both in vitro and in vivo.

[0309] Adaptive immune responses to AAV vector components in animals and humans often prevent re-administration of AAV vectors of the same serotype, making gene delivery applications requiring multiple vector administrations challenging. In vitro neutralization assays using sera from mice used in biodistribution studies demonstrated that these sera neutralized the variants less than wild-type AAV (Figure 11), potentially making the variants useful for gene therapy strategies requiring vector re-administration. For example, Shuffle100-3 was not neutralized by sera from mice injected with AAV2, and AAV2 was not neutralized by sera from mice injected with Shuffle100-3, suggesting that this variant could be used in combination with wild-type AAV serotypes or in applications requiring multiple vector administrations. In conclusion, we used directed evolution to isolate novel AAV variants capable of reduced neutralization by anti-AAV antibodies from individual human patients, pooled human sera, and mouse sera, both in vitro and in vivo. Example 2 Identification of capsid variants suitable for use in primate lung gene therapy

[0310] Introduction

[0311] We used a directed evolution strategy to identify AAV capsid variants that exhibited enhanced gene delivery efficiency to nonhuman primate (NHP) alveolar epithelial type II (AT II) cells after intratracheal aerosol administration in the presence of human neutralizing antibodies (NAbs). Briefly, wild-type adeno-associated virus (AAV) cap genes were diversified by several methods to create large genetic libraries, which were packaged to generate libraries of viral particles. Selection pressure was then applied to isolate novel variants that could overcome barriers to gene delivery, including, but not limited to, anti-capsid immune responses, limited transduction to certain tissues, and the inability to target delivery to specific cell types.

[0312] method

[0313] Cell line and library generation

[0314] HEK293T cells were obtained from the American Type Culture Collection (Manassas, VA). Cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (Gibco, Carlsbad, CA) and 1% penicillin / streptomycin (Invitrogen, Carlsbad, CA) at 37°C and 5% CO2. Viral libraries were generated in HEK293T cells using triple transfection, and viruses were purified by iodixanol gradient centrifugation and Amicon filtration. DNase-resistant genome titers were determined by quantitative PCR (qPCR).

[0315] Intratracheal injection and tissue collection

[0316] Each delivery device used in the selection was administered to a single male cynomolgus monkey (macaca fascicularis), aged 4-6 years and weighing 5.5-6.0 kg. Animals were anesthetized with 10 mg / kg ketamine and 15 μg / kg dexmedetomidine delivered intramuscularly (IM). Five mL of the library was precomplexed with 1.75 mg / mL human intravenous immunoglobulin (IVIG) and administered as follows: Each animal was intubated with a 5 mm endotracheal tube, with the tip of the tube positioned at clavicle level (approximately 5 cm above the carina), and its position confirmed by fluoroscopy.

[0317] A nebulizer device was attached to the distal end of the endotracheal tube, and breaths were delivered at a rate of 15 ± 1 breaths / min at a pressure of 20 cm HO using a Bard ventilator. An AeroProbe® catheter (Trudell Medical International) was attached with a piece of 0.144-inch star-shaped tubing to facilitate proper positioning within the endotracheal tube. The tip of the catheter was positioned just above the tip of the endotracheal tube. The AeroProbe® catheter was connected to an AeroProbe Catheter Control System, and a ventilator (Harvard Appartatus) was used to deliver breaths at a rate of 20 breaths / min at a pressure of 18–20 cm HO. After administration was completed, each animal was extubated and relieved of sedation with 0.15 mg / kg atipamezole IM. Animals were visually monitored until they fully recovered from anesthesia and then returned to their home cages.

[0318] On day 15±1, euthanasia was performed using 100 mg / kg sodium pentobarbital delivered intravenously by trained veterinary personnel. Lungs, including tracheas, were removed and dissected as detailed below. DNA was isolated from AT II cells and stored at −20°C until viral genome amplification.

[0319] Isolation of alveolar epithelial type II (AT II) cells

[0320] AT II cells were isolated from non-human primate lungs as described in Fang et al., Measurement of Protein Permeability and Fluid Transport of Human Alveolar Epithelial Type II Cells Under Pathological Conditions. Humana Press, New York, NY, 2018, pp. 121-128. Briefly, lungs were flushed with 500 mL of PBS containing 5 mM EDTA and 5 mM EGTA using a syringe placed in the trachea. The lungs were then filled with 250 mL of 1.2 mg / mL elastase solution and incubated at 37°C for 1 hour. The lungs were homogenized to release the cells lining the lungs, and the airways were discarded. AT II cells were isolated after a series of inclusion and exclusion steps involving Percoll gradients and CD14 / CD45 Dynabeads. AT II cells were plated on type IV collagen-coated inserts for 24 hours, after which DNA was isolated. To ensure the purity of the cell isolates, they were characterized by Lysotracker and surfactant protein C assays using flow cytometry and immunocytochemistry.

[0321] Therapeutic vector evolution

[0322] The vector evolution process used is shown in Figure 12. Briefly, a viral capsid library containing unique combinations of DNA mutation techniques and cap genes was created (a). Virus was then packaged so that each particle consisted of a mutant capsid surrounding the cap gene encoding the capsid (b) and purified. The capsid library was subjected to in vivo selection pressure. Tissues or cell types of interest were harvested to isolate AAV variants that successfully localized to the target. Successful viruses were recovered by PCR amplification. Successful clones were enriched by repeated selection (Step I-(c)). Selected cap genes were then subjected to unique re-diversification and enriched by additional selection steps to iteratively increase viral fitness (Step 2-(d)). Variants identified as hits during vector selection steps 1 and 2 were evaluated to identify capsid variants with desired properties (e).

[0323] A motif was declared a "hit" if it met the following criteria: 1) the motif accounted for approximately 5% of the sequenced population in two or more consecutive rounds of selection; or 2) the motif accounted for at least 10% of the sequenced population in one or more rounds of selection.

[0324] result

[0325] Pilot study of delivery device parameters and isolation of AT II cells

[0326] Two delivery devices were used to allow downstream compatibility with multiple clinically transferable devices: the AeroProbe® catheter (Trudell Medical International) and a CRO-proprietary nebulizer. Both delivery devices were evaluated in a pilot study to deliver Evans blue dye to ensure ventilation parameters resulted in adequate distribution to all lung lobes and alveolar sacs. Both delivery devices demonstrated good distribution to all lobes, including the alveolar compartment, with more intense staining observed in the dependent lobes.

[0327] The AT II cell isolation protocol was optimized using a total of six NHP lungs, resulting in high yields and purity of AT II cells isolated from both NHP lungs used during therapeutic vector evolution.

[0328] Therapeutic vector evolution

[0329] Prior to the initiation of Round 1 of the therapeutic vector evolution program, 37 vector libraries were synthesized, manufactured, and characterized. As shown in Figure 13A, the diversity of the plasmid libraries was approximately 1 x 10 per library. 6 Seed~1×10 8 It is estimated that each library contains less than a single species of unique individual variants. This corresponds to a high-quality, highly diverse starting library of AAV variants. Next, the construction of each individual library was completed to generate sufficient material for the first round of selection. As shown in Figure 13B, all libraries were produced at a sufficient level to generate material for in vivo therapeutic vector evolutionary selection.

[0330] All 37 libraries were combined and successfully administered to both NHPs via single-dose aerosol administration using either an AeroProbe® or a nebulizer. Prior to administration, the libraries were incubated with 1.75 mg / mL of human intravenous immunoglobulin, which corresponds to a high, yet still physiologically relevant, lung mucus concentration of human NAbs. 1.7 x 10 per NHP 12 The library dose of vg represents approximately one-tenth of the current maximum feasible dose based on manufacturing considerations. Therefore, this represents stringent selection pressure to enable the discovery of vectors capable of transducing AT II cells in the alveolar space in the presence of NAbs. NHP lungs were harvested two weeks after administration. AT II cells were isolated from the lungs, and DNA was isolated from the AT II cells.

[0331] Successful amplification of the AAV capsid genome

[0332] Amplification of capsid genes from tissues represents successful localization of the library vector to the cell type of interest. Capsids amplified from each delivery device (Figure 14A-B) were cloned into AAV library packaging plasmids for sequence analysis and to initiate subsequent rounds of selection (if necessary).

[0333] Sequencing analysis

[0334] Sequencing was performed on individual clones within the library to determine the frequency of variants within the population. Sequencing was performed on a minimum of 90 clones from each delivery device. Variants were evaluated for the presence of motifs within the sequencing data. Variants were grouped into motifs based on the presence of integrative variations (e.g., specific point mutations or specific peptide insertion sequences at consistent locations within the capsid) present in multiple sequences. Motifs were advanced for further evaluation only if they accounted for at least 5% of the population sequenced in two or more consecutive rounds of selection, or at least 10% of the population sequenced in one or more rounds of selection. Motifs that met the latter criterion are shown in Figures 15A-B. After the first round, strong convergence to the A101 variant (containing the capsid protein of SEQ ID NO: 12) was observed using both delivery devices, and selection was therefore considered complete.

[0335] Based on the above ranking criteria, the A101 capsid variant, containing the capsid protein of SEQ ID NO: 12, was identified as conferring enhanced gene delivery efficiency to the lungs of primates after intratracheal aerosol administration in the presence of human neutralizing antibodies (NAbs). A101 is a chimera consisting primarily of AAV1 but also containing amino acids from AAV2, AAV4, AAV6, and AAV9. Example 3

[0336] Although the first attempt to develop AAV-based gene therapy for lungs demonstrated clinical safety, the use of AAV2 vector ultimately failed to efficiently transduce lung cells and demonstrate clinical usefulness in cystic fibrosis.More recently, additional AAV serotypes, including AAV1 and AAV5, have demonstrated improved, but still suboptimal, transduction of primate lungs after aerosol administration.The following experimental data confirm the surprising suitability of rAAV that comprises capsids containing the capsid protein of SEQ ID NO: 12 as a vehicle for efficiently delivering transgenes such as human CFTR throughout the lungs of primates in the presence of human neutralizing antibodies.

[0337] Gene delivery by a recombinant AAV (rAAV) containing (i) a capsid comprising the capsid protein of SEQ ID NO: 12 and (ii) a nucleic acid comprising a nucleotide sequence encoding a reporter transgene (GFP or EGFP) operably linked to a CAG promoter was characterized (including histopathological evaluation) following aerosol administration to three non-human primates (NHPs). Aerosol delivery of rAAV resulted in robust delivery of the viral genome to all regions of the lung, including the periphery (bronchoalveolar epithelial region), with minimal systemic biodistribution, and rAAV mediated protein expression to all regions of the lung, including the alveoli.

[0338] material and method

[0339] Neutralizing antibody assay

[0340] HEK2v6.11 cells (obtained from John Hopkins University) were plated in black opaque 96-well plates at a cell density of 30,000 cells / well in Dulbecco's modified Eagle's medium (DMEM; Corning) with 1% heat-inactivated fetal bovine serum (FBS; GE Healthcare Life Sciences) and 1% penicillin / streptomycin (Invitrogen). Cells were allowed to adhere to the plates for 24 hours before the start of the experiment.

[0341] Each NHP serum sample was assayed at dilutions of 1:10, 1:25, and 1:50. Each plate contained positive and negative transduction controls. NHP serum samples were incubated with rAAV containing (i) a capsid comprising the capsid protein of SEQ ID NO: 12 and (ii) a nucleic acid comprising a CAG promoter operably linked to a luciferase gene at an MOI of 1,000 at 37°C for 1 hour. After the 1-hour incubation, each NHP serum sample dilution plus rAAV was added to individual wells of a black, opaque 96-well plate containing 2V6.11 cells. Forty-eight hours after transduction, luciferase was assayed using ONE-Glo Detection was performed using the ONE-Glo EX Luciferase assay kit (Promega). Following the addition of ONE-Glo EX, cells were lysed and luciferase substrate was added to the cells in a single step. Luminescence was read using a Cytation 3 microplate reader (BioTek).

[0342] The coefficient of variation (CV) and standard deviation were calculated for all NHP serum sample dilutions and each point on the standard curve. NHP serum samples were normalized to the transduction positive control. Each NHP was assigned a neutralizing antibody titer. The neutralizing antibody titer for each NHP serum sample was defined as the lowest serum dilution at which ≥50% transduction was observed. NHPs with ≥50% transduction observed at a serum dilution of 1:10 were considered for inclusion in the study.

[0343] Test Systems and Immunosuppression

[0344] Three male cynomolgus monkeys were included in the study. Animal ages ranged from 4 years 10 months to 9 years 8 months, and body weights ranged from 4.73 kg to 7.09 kg. Animals received immunosuppression with methylprednisolone (20 mg / kg, intramuscularly) once weekly, starting on day -7.

[0345] Test Article Preparation and Administration

[0346] Test article lots of rAAV comprising (i) a capsid comprising the capsid protein of SEQ ID NO: 12 and (ii) a nucleic acid comprising a CAG promoter operably linked to EGFP were thawed on ice, pooled together, and diluted to 2.80 x 10 per 5 mL in formulation buffer. 12The test article was diluted for delivery to each NHP at a final dose of 0.05 mg / kg. The test article dilutions for each animal are presented in Table 3. Animals were sedated with ketamine and dexmedetomidine. Animals were intubated, with the tip of the intubation tube positioned approximately 5 cm above the tracheal carina. Animals were placed in a seated position in a chair for administration. For each animal, 5 mL of diluted test article was loaded into the AeroEclipse II nebulizer reservoir (Trudell Medical). The pressure was adjusted to 15–20 cm H2O during administration. The test article was administered at a rate of 12–24 breaths / min until no visible mist was produced for 10 pulses (animals were administered continuously for less than 40 minutes). After administration was completed, the animals were extubated and desedated.

[0347] [Table 3]

[0348] Survival, necropsy, and tissue collection

[0349] Cageside observations by CRO personnel were conducted twice daily from day -7 until the time of necropsy. Body weights were assessed weekly, and blood samples were collected for hematology and clinical chemistry at defined time points. On day 57 ± 1, animals were euthanized using an intravenous injection of sodium pentobarbital (100 mg / kg) by trained veterinary personnel, followed by bilateral thoracotomy and transcardial perfusion with heparinized phosphate-buffered saline. After perfusion, the lungs (including the trachea), brain, spinal cord (cervical, thoracic, and lumbar regions), heart (ventricular and atrial regions), liver, spleen, skeletal muscle (triceps brachii, vastus lateralis), diaphragm, and kidneys were harvested. Tissue samples were harvested and flash-frozen for subsequent DNA and protein isolation. Additional samples were collected and fixed in 4% paraformaldehyde (for lung and nerve tissues) or 10% neutral buffered formalin (for peripheral tissues) for subsequent paraffin embedding and sectioning for immunofluorescence.

[0350] The trachea and lungs were sampled extensively to prepare multiple samples for each analytical process. The lungs were harvested, and the trachea was clamped as superiorly as possible. The main bronchus of the right lung was clamped twice, approximately 1 mm apart. The right lung was removed by cutting between the clamps. As described in Figure 16, 16 samples for DNA and protein isolation were collected from areas of the right lung encompassing the primary / secondary bronchi, tertiary bronchi, and alveoli. The trachea and left lung were inflated with 4% paraformaldehyde and fixed in 10x volume of 4% paraformaldehyde. The trachea and left lung were then sectioned to include samples of the trachea, primary / secondary bronchi, tertiary bronchi, and alveoli, as described in Figure 16.

[0351] Biodistribution of viral genomes

[0352] The biodistribution of the viral genome was investigated at the Mattawan site of Charles The assay was performed at River Laboratories using a qualified assay for AAV viral genomes containing EGFP transgene sequences. Total DNA was extracted from tissue samples using a QIAsymphony (Qiagen) and accompanying DSP DNA mini kit. qPCR reactions were performed in 96-well plates, with each plate containing a standard curve, a set of QC samples, and the study sample. Duplicate QC samples were prepared at high, medium, and low copies per reaction in a background of 1,000 ng of NHP matrix DNA per reaction. When possible, tissue DNA samples were tested at 1,000 ng per reaction. If it was not possible to load the above-specified amounts for a particular sample (due to low DNA concentration or limited sample volume), a smaller amount of sample DNA was analyzed.

[0353] All sample reactions were performed in triplicate, and a third reaction was spiked with 200 copies of pAAV-CAG-EGFP-SV40 DNA to assess potential qPCR inhibition. If qPCR inhibition, as indicated by measurements in the third spiked well, was observed with fewer than 110 copies of target DNA, the sample DNA was reanalyzed with a lower amount.

[0354] Biodistribution of protein expression

[0355] Total protein was extracted from tissue samples using a gentleMACS tissue dissociator (Miltenyi Biotec) and accompanying reagents. EGFP was quantified using a GFP ELISA kit (Abcam), and total protein was quantified using a Pierce BCA protein assay kit (ThermoFisher). Reactions were performed in triplicate for both GFP and total protein, and each kit contained a standard curve.

[0356] Immunofluorescence imaging

[0357] The tissue is then placed in the Seventh Wave Laboratory and used in the Sakura VIP Paraffin blocks were processed using standard programs for canine, NHP, and porcine tissues using Seventh Wave Laboratory 5. Slides were cut at 10 μm thickness and stored at 4°C. Immunohistochemistry was performed on six lung sections (including alveolar and bronchial regions) and two tracheal sections from each study animal (n=3) and an additional control animal. Paraffin slides were dehydrated using a standard paraffin antibody staining protocol. Briefly, sections were deparaffinized with xylene and rehydrated using decreasing concentrations of ethanol in water (100%, 90%, 70%, 50%, and 30%), followed by PBS washes. After antigen retrieval, antibody staining was performed using a combination of heat-induced epitope retrieval (HEIR) and pressure. Slides were incubated in boiling sodium citrate buffer for 10 minutes, followed by 3 minutes of pressure incubation. After allowing the slides to cool to room temperature, antibody staining was performed. After antigen retrieval, slides were stained with a primary chicken polyclonal anti-GFP antibody (Abcam #13970) at a dilution of 1:1000, a secondary goat anti-chicken IgY antibody (Abcam #175779) at a dilution of 1:1000, and DAPI. Fluorescence imaging was performed using a Zeiss AxioObserver microscope. Anti-GFP signals were acquired in the far-red channel (647 nm) for 1000 ms. DAPI signals were detected in the blue channel (355 nm) for 100 ms. All images were processed using Zeiss ZenPro software using the same parameters and pixel intensity values ​​in the anti-GFP channel.

[0358] Histopathological evaluation

[0359] Tissue trimming, embedding, sectioning, and H&E staining were performed at Seventh Wave Laboratory. Tissues were processed into paraffin blocks using a Sakura VIP 5 with standard programs for canine, NHP, and porcine tissues. Slides were cut at 4 μm thickness and stained with hematoxylin and eosin (H&E) using a Leica XL automated stainer. Histopathological evaluation was performed on 16 lung sections, 4 tracheal sections, and 1 carina section from each study animal (n = 3) and an additional control animal; the histopathologist was blinded to the treatment conditions. Slides were scored for the nature and severity of findings using a standard grading scale.

[0360] computerized system

[0361] To screen for serum neutralizing antibodies, data were generated and analyzed using a Cytation 3 microplate reader (Biotek), Gen5plus software version 3.03.14, and Microsoft Excel version 15.32.

[0362] For quantification of viral genomes in tissue samples, data were generated and analyzed using a QuantStudio 7 Flex Real-Time PCR System, QuantStudio Real Time PCR Software v1.4, Microsoft Excel, and GraphPad Prism version 8.1.2.

[0363] For quantification of EGFP expression within tissue samples, data were generated and analyzed using a Cytation 3 microplate reader (Biotek), Gen5plus software version 3.03.14, Microsoft Excel version 15.32, and GraphPad Prism version 8.1.2.

[0364] For representative immunofluorescence imaging, images were acquired using a Zeiss Axio Observer z1 microscope and ZenPro software. Images were processed using ZenPro software and transferred to Microsoft PowerPoint version 15.32 for presentation.

[0365] All data analysis and editing was performed on a Macbook Pro running OSX (10.12.6).

[0366] Results and Discussion

[0367] Identifying NHPs for study inclusion by screening for anti-AAV neutralizing antibodies

[0368] A neutralizing antibody assay was used to assess the level of neutralizing antibodies in non-human primate (NHP) serum against AAV capsids having the capsid protein of SEQ ID NO: 12. Each NHP serum sample was assigned a neutralizing antibody titer. Animals were considered seronegative and met the study inclusion criteria if ≥ 50% transduction was observed at a serum dilution of 1:10.

[0369] In total, 20 NHP serum samples were evaluated across four 96-well plates. Assay pass criteria were established for 1) the coefficient of variation (CV) of the standard curve, 2) the CV of the unknown serum samples, and 3) the percent deviation of the standard curve from the actual input protein. An acceptable CV for the standard curve was defined as <25%, with the actual CV not exceeding 5%. An acceptable CV for unknown serum samples falling within the limits of quantitation was defined as <30%, with the actual CV not exceeding 19%. An acceptable percent deviation from the input protein for the standard curve was defined as <25%, with the actual percent deviation not exceeding 19%. All plates met all assay pass criteria, and data from these plates were used for evaluation. Overall, 11 NHP serum samples evaluated (55%) were seronegative for capsids with the capsid protein of SEQ ID NO: 12 (Figure 17). The top three NHPs with the highest percent transduction at a serum dilution of 1:10 were selected for inclusion in the study. All selected NHPs demonstrated transduction that exceeded that observed in the absence of NHP serum. This observation has been noted in previous studies and is likely the result of favorable interactions with unknown serum proteins. The IDs of selected NHPs and percent transduction at a serum dilution of 1:10 are reported in Table 4.

[0370] [Table 4]

[0371] Aerosol delivery of variant capsids containing the capsid protein of SEQ ID NO: 12 is well tolerated in NHPs

[0372] The study design is summarized in Table 5. All animals recovered normally after test article administration and survived to the scheduled necropsy date. No significant clinical findings were reported for any animal at any time during the survival portion of the study. Minor changes outside the reference ranges for hematology and clinical chemistry findings were noted in some animals at some time points, but these variations were interpreted as normal physiological variations. No major findings were reported during macroscopic examination at necropsy.

[0373] [Table 5]

[0374] Variant capsids containing the capsid protein of SEQ ID NO: 12 mediate robust gene delivery to all regions of the lung

[0375] For all samples obtained during autopsy, viral genomes were quantified by qPCR to determine the genome biodistribution of rAAV containing a variant capsid (comprising the capsid protein of SEQ ID NO: 12) and a nucleic acid comprising an EGFP transgene operably linked to a CAG promoter.

[0376] In all 48 lung samples (n = 16 samples per NHP; n = 3 NHPs), representing samples from alveolar sacs, tertiary bronchi, and primary / secondary bronchi, approximately 10 4 ~10 5Large amounts of viral genomes were observed, ranging from 1000 to 10,000 times lower than those present in the lungs. Samples from skeletal muscle (triceps brachii, vastus lateralis), diaphragm, kidney, spleen, brain, and spinal cord were all below the lower limit of quantification (BLQ). Thus, nebulized delivery of rAAV resulted in robust delivery of viral genomes to all lung regions with minimal systemic exposure.

[0377] Variant capsids (comprising the capsid protein of SEQ ID NO: 12) mediate protein expression to all regions of the lung and transduce multiple cell types

[0378] EGFP protein expression was quantified for all samples in which qPCR demonstrated the presence of viral genomes above the lower limit of quantification of the assay. This sample set included all lung samples from all three NHPs, three (out of 15) heart samples from NHP V003424, and ten (out of 10) liver samples from NHP V002969. EGFP expression was observed in all 48 lung samples (n = 16 samples per NHP; n = 3 NHPs), representing samples from alveolar sacs, tertiary bronchi, and primary / secondary bronchi (Figure 19). Expression was highest across all regions and lobes for animal V002969. No significant differences were observed in the amount of EGFP protein expression within different lobes for all three animals. In general, samples from the alveolar region contained average or above-average amounts of EGFP, although this trend was not significant. qPCR+ liver samples from NHP V002969 yielded detectable EGFP protein expression, although expression levels were orders of magnitude lower than those in the lung.

[0379] These results are consistent with the genome biodistribution data, which demonstrate that genome localization to the liver was orders of magnitude lower than that to the lung (Figure 18). qPCR+heart samples from NHP V003424 did not contain any detectable EGFP protein expression. These results demonstrate that nebulized delivery of rAAV containing a capsid having the capsid protein of SEQ ID NO: 12 and a nucleic acid encoding a transgene mediates protein expression to all regions of the lung.

[0380] To further define the extent of transduction within different regions of the lung, immunofluorescence imaging was performed. Slides representing six lung sections (including alveolar and bronchial regions) and two tracheal sections from each study animal (n=3) and an additional control animal were scanned, and representative images were obtained for each region. In general, EGFP expression was highest across all regions and all lung lobes for animal V002969, corresponding to the relative expression levels observed across animals as determined by ELISA. Within the trachea and bronchi, EGFP expression was observed primarily in cells of the ciliated epithelial layer (Figure 20). Within the alveoli, widespread EGFP expression was observed (Figure 20), although the presence of ATI and ATII cells cannot be determined without the use of specific cell markers. These results demonstrate that aerosol delivery of rAAV containing a capsid comprising the capsid protein of SEQ ID NO: 12 and a nucleic acid encoding a transgene mediates protein expression to all regions of the lung.

[0381] Administration of rAAV containing capsids containing the capsid protein of SEQ ID NO: 12 is safe and does not cause inflammation in lung tissue

[0382] Cageside observations were conducted twice daily throughout the survival portion of the study, beginning one week prior to dosing. No significant clinical signs were observed in any of the animals throughout the survival portion of the study. Hematology and clinical chemistry analyses of blood samples were performed biweekly throughout the survival portion of the study and one week prior to dosing. Although some individual hematology and / or clinical chemistry laboratory values ​​fell outside the reference ranges, these values ​​were primarily interpreted as physiological variations.

[0383] After necropsy, histopathological evaluation was performed on lung tissue and compared with control (untreated) animals. Focal hemorrhage, black pigment, and minimal mononuclear cell infiltration into the alveolar spaces were observed in all animals, which are common incidental findings in monkeys. Additionally, submucosal lymphoid infiltration in the trachea and inflammation of the mucosal surface of the carina may also be incidental findings and are unrelated to test article administration. No observations were considered adverse. No findings in treated animals were different or more severe than those observed in control animals.

[0384] conclusion rAAV containing a capsid having the variant capsid protein of SEQ ID NO: 12 and a nucleic acid encoding a reporter transgene (EGFP) was characterized by aerosol delivery of the reporter gene to cynomolgus monkeys. Sera were prescreened to identify animals that were seronegative for pre-existing neutralizing antibodies to the test article capsid. Animals (n=3) received the maximum feasible dose of rAAV delivered using the AeroEclipse II device, a clinically relevant working nebulizer.

[0385] Abundant viral genomes (by qPCR) and resulting EGFP expression (by ELISA and immunostaining) were observed in all lung samples from all three NHPs in the study, representing samples from alveolar sacs, tertiary bronchi, and primary / secondary bronchi. Low but detectable viral genomes were present in a few heart and liver samples, and all samples from all other tissues showed no detectable viral genomes. These data demonstrate that nebulized delivery of rAAV results in robust delivery of viral genomes to all regions of the lung, with minimal systemic biodistribution, and that rAAV mediates protein expression in all regions of the lung, including the alveoli. rAAV delivery and EGFP expression were consistent between animals, with uniform distribution across multiple bronchial levels and alveoli, as well as across cranial, central, and caudal sections. The protein expression data are consistent with the genome biodistribution data, which demonstrate that genome localization to the liver was orders of magnitude lower than that to the lung.

[0386] Further experiments will be carried out to determine the efficiency and specificity for AECII cells in the lungs of primates.If more specificity than that inherent in the rAAV that comprises the capsid protein of SEQ ID NO: 12 is desired, cell-specific promoters can be used to drive the expression of target transgenes.The experiments described herein show that the rAAV that comprises the capsid protein of SEQ ID NO: 12 can be used to safely and effectively deliver CFTR transgenes to the lungs of subjects with cystic fibrosis, and to deliver therapeutic genes to treat other lung disorders. Example 4

[0387] overview

[0388] A cell culture model was established using freshly isolated non-human primate lungs and alveolar epithelial type 2 (AECII) cells derived from lungs of human donors who had undergone transplant rejection. This model was used to characterize rAAV containing capsids containing the variant capsid protein of SEQ ID NO: 12, which was identified to target AECII cells. rAAV and the native serotype AAV5 were evaluated for transduction efficiency in air-liquid interface (ALI) cultures of AECII cells. rAAV containing capsids containing the variant capsid protein of SEQ ID NO: 12 demonstrated enhanced transduction of AECII cells compared to AAV5 after apical transduction at a multiplicity of infection (MOI) of 35,000. rAAV also demonstrated potent resistance to human anti-AAV antibodies.

[0389] To confirm that rAAV capsids target AECII cells and transfer infectivity to human AECII cells, AECII cells were isolated from NHP lungs and lungs from human transplant-rejected donors and cultured at the air-liquid interface to mimic the lung environment. At multiple time points post-infection, rAAV transduction efficiency was determined by CAG promoter-driven reporter enhanced green fluorescent protein (eGFP) expression and compared with AAV5.CAG-eGFP. These data demonstrate that rAAV variants containing capsids containing the variant capsid protein of SEQ ID NO:12 are more infectious than naturally occurring serotypes (i.e., are better transducers than AAV5 capsids), potentially leading to improved treatments for genetic diseases.

[0390] A common challenge in preclinical and clinical gene therapy research using AAV is that successful transduction may be inhibited by existing neutralizing antibodies.To understand the ability of rAAVs containing capsids comprising the variant capsid protein of SEQ ID NO: 12 to evade neutralizing antibodies compared with wild-type AAVs in human populations, rAAVs and wild-type AAV1, AAV2, AAV5, AAV8 and AAV9 were analyzed against human IVIG in an in vitro luciferase assay.The data presented herein report that rAAVs containing capsids comprising the variant capsid protein of SEQ ID NO: 12 are resistant to neutralizing antibodies when exposed to human IVIG (4 times higher than AAV5 and 32 times higher than AAV2), which is a crucial component for treatment via aerosol delivery and the selective pressure applied during the therapeutic vector evolution process.

[0391] material and method

[0392] Isolation of alveolar epithelial type 2 cells

[0393] Fang et al. 1,2Alveolar epithelial type 2 cells (AECII) were isolated from non-human primates (NHPs, cynomolgus monkeys, CRO) or human donor lungs (Donor Network West, donor ID: AGES430) after transplant rejection according to the method described in

[10] . For NHP cell isolation, whole lungs were utilized; for human donor lungs, the right middle lobe was dissected and used for cell isolation. Bronchi were flushed with PBS without calcium or magnesium (ThermoFisher) containing EDTA (Sigma) and EGTA (Sigma) followed by distension with elastase (Worthington Chemicals). Tissues were incubated at 37°C for 1 hour. Lungs were homogenized, and the trachea and bronchi were removed. The cell homogenate was passed through a layer of gauze to remove large residual debris. Cells were passed sequentially through 100 μm and 20 μm strainers. Cells were loaded onto a two-step Percoll (ThermoFisher) density gradient (70% and 30%) and centrifuged at 1800 rpm for 20 minutes. The interphase was removed, centrifuged, and washed twice with calcium- or magnesium-free PBS. Monocytes and macrophages were removed using CD14 and CD45 Dynabeads (ThermoFisher). The remaining cells were incubated overnight at 37°C on IgG-coated plates to remove T cells. The next day, nonadherent cells were harvested from the plates, centrifuged, and subjected to hypotonic solution to lyse red blood cells (ACK Lysis Buffer 1:10, ThermoFisher). The resulting cells were plated at 1.5 × 10 cells onto human type IV collagen-coated inserts (Sigma, human placenta type IV collagen, 25°C for 18–24 hours). 6 cells / cm 2The cells were plated at a density of 1000 μg / ml and incubated at 37°C and 5% CO2. Cells were cultured in Airway Epithelial Cell Basal Medium (ATCC) with commercially available supplements, fetal bovine serum (10%, HyClone, ThermoFisher), and insulin, transferrin, and selenium (1:200, ThermoFisher). One day after seeding, the inserts were washed twice with PBS to remove non-adherent cells. The top of the insert was kept dry to ensure the formation of an air-liquid interface (ALI).

[0394] LysoTracker staining

[0395] Cells in which ALI was achieved were examined for LysoTracker staining in culture. LysoTracker (ThermoFisher) is an indicator dye that is absorbed by highly acidic components of living cells, such as lysosomes and lamellar bodies in AECII cells. LysoTracker is routinely used to mark AECII cells.

[0396] LysoTracker and microscopy in adherent cells

[0397] Cells on the stained inserts were washed twice with PBS. LysoTracker concentrate was diluted in culture medium (1:1000). For live cell staining, 100 microliters of diluted LysoTracker was added to the inserts. Cells were incubated at 37°C for 5 minutes. After incubation, the inserts were washed three times with PBS and imaged with a Zeiss Axio Observer D.1 fluorescence microscope. Unstained wells served as controls and set the exposure.

[0398] LysoTracker and flow cytometry in cell suspensions

[0399] Cells were incubated with trypsin-EDTA 0.05% (ThermoFisher) for 10 minutes at 37°C. Trypsin was inactivated with Defined Trypsin Inhibitor (ThermoFisher), and cells were harvested from the inserts and centrifuged at 300 x g for 4 minutes. LysoTracker concentrate was diluted in culture medium (1:1000). 100 microliters of diluted LysoTracker was added to each cell pellet and mixed by vortexing at half speed. Flow cytometry gates were set using an unstained cell sample as a control. Cells were incubated for 5 minutes at 37°C. After incubation, cells were centrifuged and washed twice with PBS. Cells were resuspended in PBS and run on a BD Accuri C6 Plus Flow Cytometer. The LysoTracker-positive population was identified as the population shifting to the right from the unstained control.

[0400] EdU Incorporation

[0401] Cell proliferation was determined using the Click-iT EdU Alexa Fluor Kit (ThermoFisher) according to the manufacturer's instructions. Briefly, cells were pulsed with EdU for 2 hours, washed twice with PBS, and fixed with 4% paraformaldehyde (15 minutes at 4°C). A Click-iT reaction cocktail containing Alexa Fluor azide was prepared and incubated with the cells for 30 minutes at 25°C. After the reaction, the cells were washed twice with PBS and counterstained with DAPI for 10 minutes at 25°C. Cells were imaged using a Zeiss Axio Observer D.1 fluorescence microscope.

[0402] Vector transduction

[0403] NHP AECII cells were transduced two days after seeding. Human AECII cells were transduced one day after seeding. On the day of transduction, three inserts were incubated with trypsin-EDTA 0.05% (ThermoFisher) for 10 minutes at 37°C. Trypsin was inactivated with a defined trypsin inhibitor (ThermoFisher). Cells were harvested from the inserts and counted using a hemocytometer. The average cell number per insert was determined and used to calculate the total viral genomes required per insert. For all experiments, a multiplicity of infection (MOI) of 35,000 was used in a total volume of 100 μl per insert. Cells were apically exposed for 48 hours to rAAV containing a capsid with the capsid protein of SEQ ID NO: 12 and a GFP gene operably linked to a CAG promoter, or to serotype 5 native AAV containing a GFP gene operably linked to a CAG promoter. Two days after infection, virus was removed from the inserts to restore the air-liquid interface. NHP cells were harvested for analysis 3 days after infection and cultured for a total of 5 days. Human cells were harvested for analysis 6 and 10 days after infection and cultured for a total of 7 and 11 days.

[0404] Immunocytochemistry (ICC)

[0405] Cells were washed twice with PBS and fixed with 4% paraformaldehyde (15 min at 4°C). Cells were blocked for 30 min with 5% goat serum and 2% bovine serum albumin (BSA) in 0.2% Triton X-100 in PBS. Cells were incubated with surfactant protein C antibody or IgG control (MilliporeSigma, 1:100) for 2 h at 25°C. The primary antibody was washed three times with 0.2% Triton in PBS and then incubated with secondary antibody (Goat anti-Rabbit Alexa Fluor 555, 1:500) for 30 min at 25°C. Cells were counterstained with DAPI for 10 min at 25°C and washed three times with PBS. Cells were imaged on a Zeiss Axio Observer D.1 fluorescence microscope using the IgG control exposure setting.

[0406] Flow cytometry

[0407] After transduction, cells were detached using trypsin-EDTA 0.05% (ThermoFisher) for 10 minutes at 37°C. Trypsin was inactivated with defined trypsin inhibitor (ThermoFisher), and cells were harvested from the insert and centrifuged at 300 x g for 4 minutes. Cells were resuspended in PBS and run on a BD Accuri C6 Plus Flow Cytometer. Transduced (eGFP-positive) cells were identified as a population shifted to the right from the untransduced control.

[0408] Neutralizing antibody resistance assay

[0409] HEK2V6.11 (obtained from John Hopkins University) cells were plated in a 96-well plate at 3 × 10 cells per well. 4 The cells were plated at a density of 1,000 cells / well. 24 hours after seeding, rAAV containing (i) a capsid ("A101") comprising the capsid protein of SEQ ID NO: 12 and (ii) a luciferase transgene operably linked to a CAG promoter, as well as wild-type AAV (serotypes AAV1, AAV2, AAV5, AAV8, and AAV9, all carrying a luciferase reporter transgene), were incubated with five dilutions of human intravenous immunoglobulin (IVIG) at 1:50, 1:100, 1:200, 1:400, 1:800, and 1:1600 for 1 hour at 37°C before infection. The cells were then infected with rAAV and wild-type AAV at an MOI of 1,000. Each plate contained positive and negative controls for transduction. The positive controls were either rAAV or wild-type AAV in the absence of IVIG. Negative controls for transduction were medium without serum or AAV.CAG-luciferase. Luciferase activity was measured 48 hours postinfection using a Cytation 3 (Biotek) plate reader.

[0410] computerized system

[0411] Flow cytometry data were analyzed using FloJo, LLC Software.

[0412] Microsoft Excel was used to calculate means and standard deviations from the FloJo output and to generate histograms.

[0413] To screen for serum neutralizing antibodies, data were generated and analyzed using a Cytation 3 microplate reader (Biotek), Gen5plus software version 3.03.14, and Microsoft Excel.

[0414] Results and Discussion

[0415] Characterization of non-human primate AECII ALI cultures

[0416] Alveolar epithelial type 2 cells (AECII) were isolated from non-human primate (NHP) lungs and cultured at the air-liquid interface (ALI). Cells were cultured on collagen-coated inserts and analyzed for the AECII-specific markers LysoTracker dye and surfactant protein-C (SPC). Cells on days 1 and 5 contained >90% LysoTracker-positive cells, as shown by ICC and quantified by flow cytometry (Figures 21A and 21B). AECII cultured cells were also examined for the mature AECII marker SPC on days 1 and 5 in culture. Cells expressed SPC by ICC at the time of analysis (Figure 21C). To further characterize the AECII culture system, cell mitosis was monitored over time. Mitosis was monitored by EdU incorporation followed by Click-iT reaction using an azide-linked fluorescent dye.

[0417] Mitosis was examined from days 2 to 5 and reported by fluorescence microscopy and nuclear staining (FIG. 21D). Mitosis was highest 2 days after plating; the number of cells undergoing mitosis decreased as the cells were maintained in culture, as evidenced by a lack of EdU incorporation into the nucleus.

[0418] Characterization of rAAV containing capsids with the variant capsid protein of SEQ ID NO: 12 in a non-human primate AECII ALI culture system

[0419] Two days after seeding AECII cells isolated from NHPs, the cells were transduced with rAAV containing a capsid with the variant capsid protein of SEQ ID NO: 12 and a GFP transgene under the control of a CAG promoter, or with AAV containing a wild-type AAV5 capsid and a GFP transgene under the control of a CAG promoter, at an MOI of 35,000. Three days after infection, after a total of five days of culture, the cells were analyzed for eGFP expression by ICC and flow cytometry. rAAV containing a capsid containing the capsid protein of SEQ ID NO: 12 yielded a significantly higher percentage of eGFP-positive cells (approximately 30%) compared with AAV5 (approximately 8%), indicating better transduction efficiency (Figures 22A and 22B).

[0420] Characterization of human AECII ALI cultures

[0421] AECII cells were isolated from the right middle lobe of a human lung (donor ID: AGES430) obtained from Donor Network West. Cells were grown on collagen-coated inserts and subjected to ALI. To determine purity, two AECII markers, LysoTracker and SPC protein expression, were examined. LysoTracker expression was monitored over time from fresh isolates (day 0) through 11 days in culture. LysoTracker-positive cells remained approximately 80% by day 7. As AECII cells transdifferentiated into AEC1, the LysoTracker-positive cell population decreased to approximately 50% by day 11 (Figures 23A and 23B). Cells also showed strong SPC expression at the time of analysis (Figure 23C).

[0422] Mitosis was monitored over time as in the NHP AECII line, and similar results were observed, with the most cells undergoing mitosis within the first 3 days in culture, decreasing over time (Figure 23D).

[0423] Characterization of 4D-A101 in the human AECII ALI culture system

[0424] One day after seeding, human AECII cells were infected with rAAV containing capsids comprising the capsid protein of SEQ ID NO: 12 or AAV5 containing an eGFP transgene at an MOI of 35,000. Six and ten days after infection, cells were imaged for eGFP expression as a proxy for transduction efficiency. rAAV containing capsids comprising the capsid protein of SEQ ID NO: 12 showed higher levels of eGFP-positive cells compared to AAV5 at both days 6 and 10 after infection ( FIG. 24 ). Cells maintained LysoTracker staining, indicating the AECII cell phenotype.

[0425] Neutralizing antibody resistance assay

[0426] The relative light units (RLU) of each AAV luciferase vector at each IVIG dilution were normalized to the AAV luciferase vector alone, which was the positive control for transduction. After normalization, each vector at each IVIG dilution was converted and expressed as percent transduction. A high percent transduction correlates with low neutralization, and a low percent transduction correlates with high neutralization. Each AAV luciferase vector was then assigned a neutralizing antibody titer, defined as the lowest dilution that achieved greater than 50% transduction. Overall, 4D-A101 demonstrated improved resistance to neutralizing antibodies compared to each wild-type AAV tested (Figure 25, exemplified by percent transduction of HEK2v6.11 cells in the presence of human IVIG). 4D-A101 demonstrated a greater than 32-fold increase in antibody escape compared to wild-type AAV1, AAV2, AAV8, and AAV9, and was 4-fold better at antibody escape compared to wild-type AAV5 (Table 6).

[0427] [Table 6-1]

[0428] conclusion

[0429] AECII cells were isolated and cultured at the ALI and maintained at high purity as determined by Lysotracker staining and SPC expression. rAAV containing capsids containing the capsid protein of SEQ ID NO: 12 demonstrated superior transduction efficiency compared to AAV5 in both NHP and human AECII ALI culture systems.

[0430] The ability of rAAV containing capsids comprising the capsid protein of SEQ ID NO: 12 to evade neutralizing antibodies in pooled human IVIG has been demonstrated to enhance the therapeutic potential of rAAV for patients. Based on these results, it is likely that a much smaller portion of the target patient population will be excluded from treatment based on the presence of pre-existing neutralizing antibodies. Example 5

[0431] Formulation screening studies were performed to select and characterize optimal formulation buffers for the solubility, delivery, and storage of recombinant AAV particles containing capsids including a VP1 capsid protein of SEQ ID NO:12, a VP2 capsid protein comprising amino acids 138-736 of SEQ ID NO:12, and a VP3 capsid comprising amino acids 203-736 of SEQ ID NO:12, and a nucleic acid encoding a transgene (e.g., a reporter gene such as luciferase or green fluorescent protein, or a therapeutic transgene such as CFTR).

[0432] All studies were performed with capsids (containing VP1 of SEQ ID NO: 12) purified by affinity (AVB) and anion exchange (CIMQA) chromatography. Initial studies were performed with purified material pre-formulated in DPBS (Dulbecco's Phosphate Buffered Saline) with 0.005% Pluronic. These lots were diluted or buffer exchanged into the relevant buffer system. Later studies were performed with lots that were buffer exchanged directly into the appropriate buffer system immediately after CIMQA purification.

[0433] Freeze-thaw stability

[0434] Approximately 2-3 x 10 per mL 13 Small sample aliquots (≦100 μL) containing viral genomes were transferred to 1.5 mL polypropylene tubes and subjected to either 5 or 10 cycles of rapid freezing (i.e., rapid cooling at −80°C), followed by thawing at room temperature until ice crystals were no longer visible. 11 A volume of ≥5 mL containing viral genomes / mL was transferred to a 15 mL polypropylene Falcon tube, placed at -80°C for approximately 1 hour (until frozen), and then thawed at room temperature for approximately 1 hour with gentle mixing until no ice crystals were observed. This process was repeated two more times (3xFT). After the third freeze-thaw cycle, samples were stored at room temperature overnight.

[0435] Stability was enhanced at 5°C, room temperature, 37°C, and 40°C / 75%RH

[0436] Approximately 1 x 10 per mL 12 ~6×10 13 Aliquots (≦100 μL) of various samples ranging in viral genome concentration were placed in 1.5 mL polypropylene tubes or 2.0 mL polypropylene cryovials and stored at 5°C, room temperature, 37°C, and 40°C / 75% RH for the time periods specified in each study protocol. Sample tubes were stored in vented storage boxes, and parafilm was routinely used to minimize the effects of evaporative loss during sample storage.

[0437] Stability of mixing

[0438] Approximately 2-3 x 10 per mL 13 A small sample aliquot (≦100 μL) containing the viral genome was transferred to a 1.5 mL polypropylene tube and placed inside a sample box attached to a vortex mixer set at 1500 rpm. The sample was stirred at room temperature for 2–4 days.

[0439] Charge State Modeling

[0440] An Excel-based charge state calculator (online download; Gale Rhodes, University of Southern Maine) was modified to automatically extract and quantitate ionizable and labile residues. The net charge of capsid protein monomers (e.g., VP1 and VP3) was determined by adding a partial negative charge and a partial positive charge to each ionizable species at each pH interval (≤1 pH unit):

[0441] Negative charge contribution = number of residues * - 1 * (10^-(pKa-pH) / ((10^-(pKa-pH))) + 1)

[0442] Positive charge contribution = number of residues * (10^(pKa-pH) / ((10^(pKa-pH))+1) [Table 6-2]

[0443] The reported isoelectric point (pI) is the mathematically determined pH at which the net charge is closest to zero.

[0444] Absorption coefficient at 280 nm (theoretical value)

[0445] The molar masses of VP1, VP2, and VP3 proteins were determined based on their known primary sequences using ProtParam (web.expasy.org / protparam / ). The molar extinction coefficients at 280 nm were calculated according to the following equation: (M cm) = (#Trp) (5,500) + (#Tyr) (1,490) + (#Cystine) (125). Note: VP1, VP2, and VP3 all contain five cysteine ​​residues, but according to the literature, AAV cysteines do not form disulfide bonds (SS = cystine). Abs 280nm 0.1% (or absorbance units equivalent to a 1 mg / mL solution) was calculated by dividing the molar extinction coefficient by the molar mass. [Table 6-3]

[0446] Absorbance at 280 nm (A280) and turbidity by UV spectroscopy

[0447] Approximately 30 μL of sample (or buffer) was transferred to a 3 mm quartz cuvette, and UV spectra (250-400 nm; 1 nm intervals) were collected on a NanoDrop spectrophotometer. Alternatively, multiple test articles (or buffers) were transferred to a UV Star 96-well microtiter plate, and UV spectra (250-400 nm; 1 nm intervals) were collected on a Cytation plate reader. The path length of the microtiter sample wells was determined empirically by measuring the absorbance at 977 and 900 nm and fitting the following equation:

number

[0448] Buffer and sample spectra were normalized to a 1 cm pathlength cell by dividing the optical density (OD) measured at each wavelength by the pathlength of the cuvette or sample well. Normalized spectra were averaged when run in duplicate. Sample spectra were background corrected by subtracting the normalized OD value for the corresponding buffer blank. The light scattering contribution at 280 nm (LS280) was calculated using log-log extrapolation from the non-absorbing UV region (approximately 300-400 nm) and subtracted from A280 (OD280-LS280=A280). The light scattering-corrected A280 was multiplied by the sample dilution factor (if appropriate) to obtain the theoretical VP3 extinction coefficient (Abs 280nm 0.1% Dividing by 0.05 (=1.71) yielded the estimated capsid protein concentration in mg / mL of protein. However, this method is prone to overestimation of capsid protein due to DNA absorbance. Alternatively, in this report, we present A280 values ​​without further conversion to avoid overestimation of capsid protein due to DNA absorbance. OD350 values ​​were initially used to semiquantitatively monitor changes in light scattering or turbidity resulting from self-association. However, in this report, we also present A350 / A280 values, normalizing scattering to the amount of capsid in the soluble fraction.

[0449] pH

[0450] A small-volume or large-volume pH probe was used to measure the pH of the sample or buffer, respectively. The pH probe was calibrated using prepackaged Mettler Toledo pH standards of pH 4.01, 7.01, and 10.01.

[0451] Cryoscopic Osmolality

[0452] 15 μL of reference solution (e.g., 290 mOsm / kg) or sample was transferred to the freezer chamber of an Advanced Instruments Freezing Point Depression Osmometer. The sample was supercooled until frozen, and the temperature was monitored until a plateau was observed. The plateau temperature was used to calculate osmolality according to the following equation: 1 mOsm solute / 1 kg water = 1.858 millidegrees (m°C) depression of the freezing point.

[0453] Hydrodynamic size and polydispersity by dynamic light scattering

[0454] Approximately 30 μL of sample was loaded into a clean 3 mm cuvette (ZN2112) and multiple scans (n=2 or 3) were collected on a Malvern Zetasizer Ultra (dispersant=water, sample type=protein). The scans were averaged to generate plots of intensity (%) and volume (%). Low level HMW species were identified by intensity (LS approx. diameter). 6 About Mw 2 ), the former was utilized during initial formulation screening. Where appropriate, scans were also averaged to generate values ​​for polydispersity by Cumulants Fits, mean size by intensity (10-100 d.nm), mean size by volume (10-100 d.nm), % area by intensity (10-100 d.nm), and % area by volume (10-100 d.nm).

[0455] Subvisible particle selection using Horizon Backgrounded Membrane Imaging (BMI)

[0456] Background membrane imaging (BMI) was performed on the Horizon Particle Analysis System. A blank 96-well sample plate was loaded into the Horizon system and a background image was acquired. The plate was then transferred to the vacuum manifold. Approximately 20-30 μL of sample was loaded per well. Blotting paper and a blotting paper adapter were attached to the vacuum manifold, and the sample plate was repositioned at the top of the stack. The vacuum was turned on to remove any remaining liquid at the bottom of the wells. The sample plate was then transferred to the Horizon instrument. Particle counts and images were taken (2-10 μm, 10-25 μm, >25 μm, and total).

[0457] Titer by droplet digital polymerase chain reaction (ddPCR)

[0458] Frozen aliquots of 5-10 μL were subjected to determination of AAV genome concentration by ddPCR according to SOP-AD-018. Samples of rAAV containing the capsid protein of SEQ ID NO:12 were diluted in Dulbecco's phosphate-buffered saline with calcium and magnesium containing 0.02% Pluronic™ F-68 non-ionic surfactant (DPBS + 0.02% F68), mixed with DNase I enzyme to digest any unencapsidated DNA, and further diluted with DPBS + 0.02% F68 to bring the test article within the dynamic range of the assay. The DNase-treated samples were then mixed with ddPCR Supermix and SV40 (or CFTR) primer / FAM-labeled probe. 20 μL of the reaction mixture was then dispensed into droplets using a Bio-Rad QX200 Auto DG Droplet Generator, subjected to PCR, and then read on a Bio-Rad QX200 Droplet Reader, which individually measures each droplet for fluorescent signal. Data were analyzed using Bio-Rad QuantaSoft software, which uses Poisson statistical analysis of positive and negative droplets to provide absolute quantification of the target sequence(s). A no-template control was used to establish a negative baseline for the samples. ddPCR without treatment with DNase I enzyme was also performed on selected samples.

[0459] Chemical purity by polyacrylamide gel electrophoresis (PAGE)

[0460] A 5-10 μL frozen aliquot was subjected to chemical purity analysis according to SOP-AD-028 Rev.00 (Determination of Capsid Purity by Krypton™ Stained SDS-PAGE) or SOP-AD-002 (Determination of Capsid Purity by Silver Stained SDS-PAGE). Briefly, approximately 1.00 × 10 10 (SOP-AD-028) or 1.00 x 10 9(SOP-AD-002) Viral genomes were mixed with 4x LDS sample buffer, 10x sample reducing agent, and water and heated to 95°C for 10 minutes. A NuPAGE™ 4-12% Bis-Tris gel was placed in a gel box containing an upper chamber (1x SDS buffer + antioxidant) and a lower chamber (1x SDS buffer). The heat-denatured (reduced) reaction mixture was loaded onto the gel. The gel box cover was replaced, and the electrodes were connected to an external power supply. Power was then applied according to the manufacturer's specifications. Current flow was stopped when the sample dye front extended ≥3 / 4 of the total length of the gel. The gel was washed and stained according to the manufacturer's instructions. Gel imaging was performed using a ChemiDoc MP Imager.

[0461] Functional activity due to green fluorescent protein (GFP) expression

[0462] Frozen aliquots of 15 μL were analyzed for green fluorescent protein (GFP) expression. HEK2v6.11 cells were transduced at an MOI of 10,000 and harvested 72 hours post-transduction. GFP expression was imaged by fluorescence microscopy and quantified by flow cytometry.

[0463] Purified AAV was added to a Dulbecco's Phosphate Buffered Saline-based formulation buffer (Dulbecco's Phosphate Buffered Saline with Calcium and Magnesium containing 0.05% Pluronic™ F-68 non-ionic surfactant (DPBS + 0.05% F68) at a concentration of ≥ 1 × 10 13 During concentration to viral genomes per milliliter (vg / mL) and buffer exchange, a significant decrease (approximately 50%) of rAAV with capsids having VP1 of SEQ ID NO: 12 was observed. The experiments described herein determined the underlying cause of the decrease and describe a superior formulation buffer.

[0464] The pIs of VP1, VP2, and VP3 of SEQ ID NO:12 were estimated to be 6.7, 7.4, and 6.8, respectively. VP1 has a larger number of charged residues compared to VP2 and VP3, which may account for the theoretical differences in net charge observed below pH 5 and above pH 9 (Figure 26). However, the net charge between pH 5 and pH 9 appears to be roughly similar for VP1 and VP3, while some slight differences are predicted for VP2. VP1, VP2, and VP3 monomers contain aspartic acid (D), asparagine (N), methionine (M), and a free cysteine ​​(C) residue. Therefore, VP1 and VP3 monomers are expected to be susceptible to aspartic acid shuffling at low pH, deamidation at neutral / basic pH, and oxidation and disulfide shuffling at high pH.

[0465] The pH of DBPS is approximately 7.0, which is very close to the pI, or theoretical solubility minimum, of the VP1 and VP3 proteins. Therefore, we suspected that pH may play a role in the physical instability observed during concentration and buffer exchange by tangential flow filtration.

[0466] pH vs. Solubility

[0467] rAAV starting material (approximately 2 x 10 in DPBS + 0.005% Pluronic F68) containing a capsid with VP1 of SEQ ID NO: 12 and a nucleic acid encoding GFP 13 10 vg / mL) were thawed and diluted at approximately 2 × 10 concentrations in various buffers (pH 4–8) at both low ionic strength (approximately 14 mM NaCl) and physiological ionic strength (approximately 150 mM NaCl). 12 The low ionic strength formulations showed a pH-dependent increase in high molecular weight (HMW) species as the pH increased from 4 to 8. This pH dependence was significantly reduced in the presence of 150 mM NaCl.

[0468] The samples were then stored at room temperature and then evaluated by UV spectroscopy the following day (T = 1 day, room temperature). In Figure 27, UV absorbance at 280 nm (A280) is plotted against pH. Low ionic strength samples showed a very sharp decrease in A280 signal above pH 5 (i.e., inferring a decrease in rAAV concentration), consistent with the physical instability observed by DLS. All samples containing 150 mM NaCl showed similar A280 values. These data indicate that lower pH and the addition of salt appear to improve solubility. Formulation details, sample pH, and A280 values ​​(light scattering and pathlength corrected) can be found below: [Table 6-4]

[0469] These results seem to suggest that both ionic strength and pH affect the solution behavior of rAAV. Therefore, follow-up studies were performed to further evaluate the solubility limit of rAAV in the presence of sodium chloride (ionic strength of approximately 0.15 M) or trisodium citrate (high ionic strength) at pH 5 to 8. rAAV starting material (1.76 x 10 in DPBS + 0.005% Pluronic F68) containing a capsid with VP1 of SEQ ID NO: 12 and a nucleic acid encoding luciferase was used. 13 thawed and diluted to approximately 3 x 10 in various buffers (Table 7). 13 The virus was buffer exchanged and concentrated to a target of 10 ... [Table 7]

[0470] The titer and A280 values ​​showed a similar pH-dependent trend for the sodium chloride-containing samples, i.e., decreased solubility with increasing pH. The high ionic strength formulation (10 mM Tris, pH 8 + 100 mM sodium citrate + 0.005% F68) showed the highest solubility of the tested formulations, further demonstrating the effect of ionic strength. There appeared to be a pH-dependent trend for the 0.2 μm-filtered samples, i.e., OD350 increased at lower pH. However, the 350 / A280 values ​​were also plotted to represent physical instability versus the amount of rAAV in the soluble fraction. The 350 / A280 values ​​indicated instability at pH 5. However, a break was observed at pH 6 (10 mM citrate, pH 6 + 150 mM NaCl + 0.005% F68), which likely represents a balance between high solubility and physical stability. The high ionic strength formulations showed comparable turbidity to the pH 6 formulations. As illustrated by Figure 35 (corresponding to data in Table 7), improved solubility is seen in the presence of 0.15 M NaCl at lower pH (higher solubility at pH 5 and 6 compared to pH 7 and 8 when the salt concentration is approximately 150 mM NaCl), clearly demonstrating the need for increased ionic strength to "restore" solubility at higher pH. These findings ultimately led to the use of the citrate, pH 6 formulation.

[0471] DLS (dynamic light scattering) showed varying levels of HMW species in the concentrated samples, except for the high ionic strength formulation (10 mM Tris, pH 8 + 100 mM trisodium citrate + 0.005% F68). However, HMW species were greatly reduced after 0.2 μm filtration, except for persistent submicron species observed in the 10 mM sodium acetate, pH 5 + 150 mM NaCl + 0.005% F68 formulation. This is consistent with the increase in 350 / A280 observed for the same sample.

[0472] The results of this study showed that at pH ≤ 6 or ionic strength greater than 0.15M, rAAV could be incubated at ≥ 3 × 10 13These results suggest that it is possible to formulate acetaminophen at 2000 mg / mL. However, at low pH (e.g., pH 5), there may be a risk of soluble HMW species, and higher pH formulations may require concentrations of ionic strength adjusters (e.g., sodium citrate) that exceed those found in other approved inhalation products according to the FDA's Inactive Ingredients Database. Therefore, the next study aimed to narrow the pH range of the formulation (6–8), while also evaluating the effect of 20–100 mM sodium citrate.

[0473] rAAV starting material (8.75 x 10 in DPBS + 0.005% Pluronic F68) containing a capsid with VP1 of SEQ ID NO: 12 and a nucleic acid encoding GFP 12 3×10 ATP (vg / mL) was thawed and diluted to approximately 3×10 ATP in various buffers (Table 8; all formulations also contained 0.005% F68). 13 The rAAV starting material was buffer exchanged and concentrated to a target of 8.46 x 10 µg / mL. Buffer pH and osmolality (without rAAV) can be found in Table 9. Formulated samples were 0.2 µm filtered and aliquots were placed in polypropylene tubes. One aliquot for each formulation was used for T=0 measurements and then subjected to 1500 rpm agitation at room temperature for 4 days. Other aliquots were used to evaluate the effects of freeze-thawing (5 / 10 x FT cycles), storage at room temperature (T=13 days), and 28-day storage (15 days at 2-8°C, followed by 13 days at room temperature). The rAAV starting material was dissolved in 8.46 x 10 µg / mL of DPBS + 0.005% F68. 12 vg / mL and evaluated under selected conditions.

[0474] [Table 8] This is a rough estimate derived from

[0475] [Table 9]

[0476] Due to the need to screen a large number of formulations and conditions, titer analysis by ddPCR was used conservatively. However, sample titers at T=0 were approximately 2.3–2.9 × 10 13 The concentrations ranged from 0.01 to 0.05 vg / mL (Table 10). This slight variability was assumed to be related to the small scale of the process, as the majority of conditions appeared to meet or exceed >90% recovery. The exceptions were fPD_2019_006_003, fPD_2019_006_005, and fPD_2019_006_007, which all showed lower recoveries. Sample potencies were also measured after 28 days of storage (15 days at 2-8°C, followed by 13 days at room temperature). All formulations retained ≥100% potency relative to T=0.

[0477] [Table 10]

[0478] Little to no significant changes were observed in the % volume hydrodynamic size for any of the formulations under the conditions tested. Therefore, overlays were generated for % intensity hydrodynamic size, which is generally more sensitive to the presence of low levels of HMW species. fPD_2019_006-05 and fPD_2019_006-10 showed increased peak width after 4 days of stirring at 1500 rpm. This could also be observed in the sample polydispersity plots. The polydispersity at T=0 of the starting material (fPD_2019_006-13) was greater than any of the 12 formulations screened, further suggesting an improvement over the original DPBS formulation.

[0479] Table 9 includes the A280 values ​​and % remaining A280 relative to T=0. The majority of formulations retained ≥95% of their respective A280 signals, except for fPD_2019_006-11 and fPD_2019_006-13 (DPBS controls) and fPD_2019_006-03 after 4 days of stirring at 1500 rpm, and fPD_2019_006-08, which showed a slight drop after 28 days of storage.

[0480] A significantly higher number of particles was observed for the agitated samples compared to the other test conditions, implying that the length of agitation may have been overly aggressive. However, the response of the formulations to the different stress factors applied appeared to vary. For example, fPD_2019_006-05 contained an increased number of particles >10 μm after agitation, while fPD_2019_006-09 and fPD_2019_006-10 showed increased counts after 10 freeze-thaw cycles.

[0481] The potency and physical stability results generated in study fPD_2019_006 were evaluated using a semi-quantitative weighting system, and it was determined that fPD_2019_006-01 (20 mM citrate, pH 6 + 125 mM NaCl + 0.005% F68), fPD_2019_006-02 (50 mM citrate, pH 6 + 70 mM NaCl + 0.005% F68), fPD_2019_006-08 (10 mM phosphate, pH 5 + 50 mM NaCl + 50 mM trisodium citrate + 0.005% F68), and fPD_2019_006-12 (10 mM Tris, pH 8 + 100 mM trisodium citrate + 0.005% F68) all exhibited favorable characteristics that warranted further investigation. Following this determination, remaining aliquots of the 28-day samples were analyzed by Krypton-stained PAGE. VP1, VP2, and VP3 were observed in all samples tested. Low molecular weight (LMW) bands were also observed at various abundances; those in fPD_2019_006-01 were most prominent. Unfortunately, T=0 was unavailable for comparison, as it was unclear whether these LMW bands were degradation products or process impurities. Therefore, chemical stability was evaluated in a follow-up study.

[0482] CIMQA pool of rAAV (lot# dPD_2020_001, 7.92 × 10) containing capsids with VP1 of SEQ ID NO: 12 and nucleic acid encoding CFTR. 11vg / mL) directly into the four buffers identified in fPD_2019_006. 13 The rAAV (Lot#4DER000057 vg / mL) containing a capsid with VP1 of SEQ ID NO: 12 and a nucleic acid encoding GFP in DPBS + 0.005% F68 was buffer exchanged and concentrated to a target of approximately 6E13 vg / mL in 20 mM citrate, pH 6 + 125 mM NaCl + 0.005% F68. Aliquots of the rAAV-CFTR and rAAV-GFP formulations were then placed into polypropylene tubes and subjected to either 10 freeze-thaw cycles, 40 hours of agitation at 1500 rpm, or 40 hours of storage at 40°C.

[0483] [Table 11]

[0484] The titer of rAAV-CFTR at T=0 was 1.7-1.9 × 10 13 vg / mL, which was in the range of 3 × 10 13The potency loss was ≥30% below the target of 1000 mg / mL, but this was attributed to the small working volume rather than solubility limitations. The pH 7 and pH 8 formulations (fPD_2020_001-02 and fPD_2020_001-03) showed approximately 4% loss when subjected to agitation stress, while no loss was observed for the pH 6 formulations (fPD_2020_001-01 and fPD_2020_001-04). This stability trend significantly extended at 40°C, where the pH 7 and pH 8 formulations showed ≥90% loss, while the pH 6 formulation showed a <30% loss. All four rAAV-CFTR formulations retained ≥100% potency after 10 freeze-thaw cycles. rAAV-GFP (fPD_2020_001-05, 5.3E13 vg / mL at T=0) was found to be very stable at pH 6, with no degradation during agitation, and <3% degradation during storage at 40°C and 10 freeze-thaw cycles. The difference in relative stability between rAAV-CFTR and rAAV-GFP formulated in the same buffer is speculated to be related to transgene size; however, further studies are needed.

[0485] fPD_2020_001-02 (pH 7) and fPD_2020_001-03 (pH 8) showed a greater decrease in A280 signal compared to the pH 6 samples during storage at 40°C. This is consistent with the trend observed for titer, although the magnitude of the decrease was reduced. This may be related to an increase in the amount of empty capsids (and free DNA) during storage at 40°C. While empty capsids and DNA would still absorb UV light, the latter would be susceptible to DNase treatment. The A280 results for the rAAV-GFP formulation (fPD_2020_001-05) were also consistent with the titer analysis; minimal to no change.

[0486] [Table 12]

[0487] Hydrodynamic size intensity plots showed an increase in peak width at 40°C for all rAAV-CFTR samples. Low levels of HMW species were detected in fPD_2020_001-01. However, significant differences in titer and UV may suggest that this peak is absent in less stable formulations due to precipitation, surface adsorption, or changes in the empty / full capsid ratio. While size differences were less evident in volume, polydispersity was also found to be highly sensitive to small differences. Consistent with other test methods, rAAV-GFP showed little to no change.

[0488] Storage at 40°C appeared to result in a higher particle count of 2–10 μm for the A101-GFP formulation (fPD_2020_001-05). This was expected to be a concentration-dependent phenomenon (i.e., the rAAV-GFP titer was approximately three times higher than the rAAV-CFTR sample). Interestingly, this sample showed a relatively low number of particles >10 μm, suggesting that the formulation likely prevents the formation of larger aggregates. rAAV-CFTR (fPD_2020_001-01) formulated in the same buffer showed sensitivity to agitation and heat but appeared resistant to the formation of particles >25 μm. Other rAAV-CFTR formulations showed a slight tendency toward particles >25 μm.

[0489] No significant differences were observed at T=0, 1500 rpm for 40 hours, or after 10×FT. However, the pH 7 (fPD_2020_001-02) and pH 8 (fPD_2020_001-03) formulations showed an increase in LMW species and appeared to be overloaded. Conversely, fPD_2020_001-01 showed the presence of several HMW bands after storage at 40°C. However, it was unclear whether this was an artifact related to the sample preparation or staining procedure (e.g., silver staining is considered non-quantitative). Fortunately, Western blot analysis was also performed on the same samples. Western blots clearly demonstrated that the pH 7 and pH 8 40°C samples were overloaded (loaded based on titer). This further supports the notion that the disproportionate decrease in titer compared to A280 could be due to an increase in empty capsids. No HMW bands were observed for the fPD_2020_001-01 sample at 40°C by Western blot analysis.

[0490] The majority of formulation screening efforts have focused on improving the physical stability of rAAV and, to a lesser extent, monitoring its chemical stability. However, a key area remains unaddressed: functional activity. Therefore, rAAV-GFP functional activity was assessed for three of the formulations tested in the fPD_2020_001 study. rAAV-GFP (1.58 × 10) in DPBS + 0.005% F68 was used. 13 (1.58a10 13 ) vg / mL) in 20 mM citrate, pH 6 + 125 mM NaCl + 0.005% F68 (fPD_2020_002-01), 10 mM potassium phosphate, pH 7 + 50 mM citrate + 50 mM NaCl + 0.005% F68 (fPD_2020_002-02), or 50 mM citrate pH 6 + 70 mM NaCl + 0.005% F68 (fPD_2020_002-03). 13The rAAV-GFP preparations were buffer exchanged and concentrated to a target of 130 ...

[0491] [Table 13]

[0492] The hydrodynamic size was assessed at T=0. No differences were observed for the three tested formulations. No decrease in A280 signal was observed during 13 days of storage at room temperature (Table 14).

[0493] [Table 14]

[0494] Fluorescence microscopy and flow cytometry results demonstrated that all rAAV-GFP samples showed green fluorescent protein expression, while no fluorescence was observed with the vehicle. Little to no difference in % GFP-positive cells was observed after 13 days of storage at room temperature, indicating that rAAV functional activity was preserved in all three formulations.

[0495] Based on the results of the fPD_2020_001 and fPD_2020_002 studies, the decision was made to proceed with definitive evaluation of two citrate, pH 6 formulations. Purified rAAV-CFTR (4D130109) formulated in 20 mM citrate, pH 6 + 125 mM NaCl + 0.005% F68 (fPD_2020_003-01, lot#dPD_2020_007) and purified rAAV-CFTR (4D130109) formulated in 50 mM citrate, pH 6 + 85 mM NaCl + 0.005% F68 (fPD_2020_003-02, lot#dPD_2020_007) were thawed and aliquots (approximately 100 μL) were placed into polypropylene tubes. Two aliquots (n = 2) of each formulation were used for T = 0 measurements. The remaining vials were placed at 40 °C / 75% RH and withdrawn after 4 hours (n = 2), 20 hours (n = 2), or 44 hours (n = 2). The 20 mM citrate, pH 6 formulation (fPD_2020_003-01) used the same buffer that had previously demonstrated good stability. The 50 mM citrate formulation was similar to the 50 mM citrate, pH 6 formulation, for which minor changes were identified in previous studies, except that the NaCl concentration was increased from 70 mM to 85 mM to increase solution tonicity. The osmolality of the 20 mM citrate, pH 6 buffer and the 50 mM citrate, pH 6 buffer were 289 mOsm / kg and 295 mOsm / kg, respectively.

[0496] [Table 15]

[0497] Titer analysis by ddPCR (n=2) was performed with and without DNAase pretreatment. Measurable differences were observed between the two methods, suggesting the presence of either free capsid DNA and / or DNase-susceptible capsids (e.g., perturbed or chemically damaged). However, the titer loss at 40°C / 75% RH...

Claims

[Claim 1] The invention described in this specification.