Novel OMNI-59, 61, 67, 76, 79, 80, 81 and 82 Crispane Crease

The OMNI CRISPR nucleases address sequence specificity and delivery limitations by forming targeted complexes with RNA molecules, enhancing genome editing efficacy and applicability in genome engineering and diagnostics.

JP2026136129APending Publication Date: 2026-08-25EMENDOBIO INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2026071479
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2020-12-08
Filing Date
2026-04-23
Publication Date
2026-08-25

AI Technical Summary

Technical Problem

Current CRISPR nucleases exhibit limitations in sequence specificity, expression, and delivery, which restrict their applications in genome engineering due to PAM site constraints and potential preimmunization, limiting their in vivo applicability.

Method used

Development of novel CRISPR nucleases, termed 'OMNI', with specific amino acid sequences and RNA molecules that enhance targeting flexibility and efficiency by forming complexes with RNA molecules to hybridize with target DNA sequences, overcoming PAM site limitations and improving in vivo applicability.

Benefits of technology

The OMNI CRISPR nucleases demonstrate enhanced genome editing capabilities, including mutations and DNA sequence modifications, by targeting specific genomic sites with improved specificity and efficiency, facilitating effective genome engineering and diagnostics.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026136129000001_ABST
    Figure 2026136129000001_ABST
Patent Text Reader

Abstract

The present invention provides a non-natural composition comprising a CRISPR nuclease or a nucleic acid molecule containing a sequence encoding the CRISPR nuclease. [Solution] A non-natural composition is provided comprising a CRISPR nuclease having at least 90% identity with an amino acid sequence selected from a specific group, or a nucleic acid molecule having a sequence encoding the CRISPR nuclease, wherein, in one embodiment, the composition further comprises one or more RNA molecules, or a DNA polynucleotide encoding any one of the one or more RNA molecules, wherein the one or more RNA molecules and the CRISPR nuclease are not found together in nature, and the one or more RNA molecules are configured to form a complex with the CRISPR nuclease and / or direct the complex to a target site.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Throughout this application, various publications are referenced, including those within parentheses. The entire disclosure of all publications mentioned in this application is hereby incorporated by reference into this application to supplement the description of the technology related to the present invention and the features of the technology that can be used in the present invention.

[0002] Reference to Sequence Listing This application was created on June 2, 2021 in the form of an IBM-PC machine using an operating system compatible with MS-Windows (registered trademark), and a text file with a size of 245 KB, named "210604_91412-A-PCT_SequenceListing_AWG.txt", which was filed on June 4, 2021 as part of this application, and the nucleotide sequences therein are incorporated by reference.

[0003] Technical Field The present invention relates, inter alia, to compositions and methods for genome editing.

Background Art

[0004] Clustered, regularly interspaced short palindromic repeat (CRISPR) systems, used in adaptive immunization of bacteria and archaea, exhibit extreme diversity in protein composition and genomic locus structure. CRISPR systems have become a crucial tool in research and genome engineering. Nevertheless, much of the details of CRISPR systems remain unknown, and the application of CRISPR nucleases may be limited by sequence specificity, expression, or delivery. Different CRISPR nucleases exhibit diverse characteristics such as size, PAM site, on-target activity, specificity, cleavage pattern (e.g., blunt ends, adherent ends), and prominent patterns of post-cleavage indel formation. Combinations of these different properties may serve diverse applications. For example, some CRISPR nucleases can target specific genomic loci, while others cannot due to PAM site limitations. Furthermore, some CRISPR nucleases currently in use exhibit preimmunization, potentially limiting their in vivo applicability. See Charlesworth et al., Nature Medicine (2019) and Wagner et al., Nature Medicine (2019). Therefore, the discovery, practical application, and improvement of novel CRISPR nucleases are important. [Overview of the project]

[0005] This specification discloses compositions and methods that may be used in genome engineering, epigenome engineering, genome targeting, cell genome editing, and / or in vitro diagnostics.

[0006] The disclosed compositions may be used to modify genomic DNA sequences. In this specification, genomic DNA refers to linear and / or chromosomal DNA and / or plasmid or other extrachromosomal DNA sequences present in the target cells or cell populations. In some embodiments, the target cells are eukaryotic cells. In some embodiments, the target cells are prokaryotic cells. In some embodiments, this method induces double-strand breaks (DSBs) at predetermined target sites in the genomic DNA sequence, resulting in mutations, insertions, and / or deletions of the DNA sequence at target sites in the genome.

[0007] Therefore, in some embodiments, the composition comprises clustered, regularly spaced short palindromic repeats (CRISPR) nucleases. In some embodiments, the CRISPR nucleases are CRISPR-related proteins.

[0008] In some embodiments, the composition contains Acetobacterium sp. KB-1, Alistipes sp. An54, Bartonella apis, Blastopirellula marina, Bryobacter aggregatus MPL3, Algoriphagus marinus, Butyrivibrio sp. AC2005, Bacterium LF-3, Aliiarcobacter faecis, Caviibacter abscessus, Arcobacter sp. SM1702, Arcobacter mytili, and Arcobacter Arcobacter thereius, Carnobacterium funditum, Peptoniphilus obesi ph1, Carnobacterium iners, Lactobacillus allii, Bacteroides coagulans, Butyrivibrio sp. NC3005, Clostridium sp. AF02-29, or Algoriphagus antarcticus This includes clustered, regularly spaced short palindromic repeats (CRISPR) derived from *Antarcticus*, and CRISPR nucleases with 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, and 85% identity. The feasibility of each is shown in its individual form.

[0009] OMNI CRISPR Nuclease One aspect of the present invention provides a CRISPR nuclease called "OMNI" nuclease, as shown in Table 1.

[0010] The present invention provides a method for modifying a nucleotide sequence at a target site in the genome of a mammalian cell, comprising introducing into a cell (i) a composition comprising a CRISPR nuclease having at least 95% identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 8, or a nucleic acid molecule comprising a sequence encoding a CRISPR nuclease having at least 95% identity with a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 9 to 24, and (ii) a DNA targeting RNA molecule, or a DNA polynucleotide encoding a DNA targeting RNA molecule comprising a nucleotide sequence complementary to the sequence of target DNA.

[0011] The present invention a) One or more RNA molecules containing a guide sequence that is directly linked to a repeat sequence and can hybridize with a target sequence, or one or more nucleotide sequences encoding the one or more RNA molecules; and b) A CRISPR nuclease containing an amino acid sequence having at least 95% identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 8, or a nucleic acid molecule containing a sequence encoding the said CRISPR nuclease; We also provide non-natural compositions including CRISPR-related systems, The one or more RNA molecules hybridize to the target sequence, the target sequence is adjacent to the 3' end of the complementary sequence of the protospacer adjacency motif (PAM), and the one or more RNA molecules form a complex with the CRISPR nuclease.

[0012] The present invention a) A CRISPR nuclease containing a sequence having at least 95% identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 8, or a nucleic acid molecule containing a sequence encoding the said CRISPR nuclease; and b) i) Nucleotide sequences of nuclease-binding RNA capable of interacting with / binding to the CRISPR nuclease; and ii) A nucleotide sequence of DNA targeting RNA containing a sequence complementary to the sequence in the target DNA sequence, One or more RNA molecules comprising at least one of the above, or one or more DNA polynucleotides encoding the one or more RNA molecules, We also provide non-natural compositions that include, The CRISPR nuclease can form a complex with one or more RNA molecules to form a complex that can hybridize with the target DNA sequence. [Brief explanation of the drawing]

[0013] [Figure 1A] Figure 1 shows the predicted secondary structure of the single guide RNA (sgRNA) (crRNA-tracrRNA) of Novosphingobium sp. SYSU G00007 (OMNI-79), showing the crRNA and tracrRNA portions of the sgRNA. Figure 1A: Native immature crRNA-tracrRNA duplex. [Figure 1B] Figure 1 shows the predicted secondary structure of the single guide RNA (sgRNA) (crRNA-tracrRNA) of Novosphingobium sp. SYSU G00007 (OMNI-79), showing the crRNA and tracrRNA portions of the sgRNA. Figure 1B: Example of V1 sgRNA design by duplex shortening (indicated by triangle A) compared to native design. [Figure 1C] Figure 1 shows the predicted secondary structure of the single guide RNA (sgRNA) (crRNA-tracrRNA) of Novosphingobium sp. SYSU G00007 (OMNI-79), showing the crRNA and tracrRNA portions of the sgRNA. Figure 1C: Example of V2 sgRNA design by duplex shortening (indicated by triangle A) compared to native. [Figure 2A]Figure 2 shows the results of PAM depletion of OMNI nucleases by TXTL in vitro. The PAM logo schematically represents the proportion of depleted sites. A condensed 4N window library of all possible PAM sites along the 8bp sequence of each OMNI nuclease in a cell-free in vitro TXTL system is shown. Sequence motifs created for in vitro PAM sites are based on the results of the depletion assay. Activity was estimated based on the average of the two most depleted sequences and calculated as a 1-depletion score. Figure 2A shows the results of in vitro PAM depletion of OMNI-59 sgRNA v1 and v2. [Figure 2B] Figure 2 shows the results of PAM depletion of OMNI nucleases by TXTL in vitro. The PAM logo schematically represents the proportion of depleted sites. A condensed 4N window library of all possible PAM sites along the 8bp sequence of each OMNI nuclease in a cell-free in vitro TXTL system is shown. Sequence motifs created for in vitro PAM sites are based on the results of the depletion assay. Activity was estimated based on the average of the two most depleted sequences and calculated as a 1-depletion score. Figure 2B shows the results of in vitro PAM depletion of OMNI-61 sgRNA v1 and v2. [Figure 2C] Figure 2 shows the results of PAM depletion of OMNI nucleases by TXTL in vitro. The PAM logo schematically represents the proportion of depleted sites. A condensed 4N window library of all possible PAM sites along the 8bp sequence of each OMNI nuclease in a cell-free in vitro TXTL system is shown. Sequence motifs created for in vitro PAM sites are based on the results of the depletion assay. Activity was estimated based on the average of the two most depleted sequences and calculated as a 1-depletion score. Figure 2C shows the results of in vitro PAM depletion of OMNI-67 sgRNA v1 and v2. [Figure 2D]Figure 2 shows the results of PAM depletion of OMNI nucleases by TXTL in vitro. The PAM logo schematically represents the proportion of depleted sites. A condensed 4N window library of all possible PAM sites along the 8bp sequence of each OMNI nuclease in a cell-free in vitro TXTL system is shown. Sequence motifs created for in vitro PAM sites are based on the results of the depletion assay. Activity was estimated based on the average of the two most depleted sequences and calculated as a 1-depletion score. Figure 2D shows the results of in vitro PAM depletion of OMNI-76 sgRNA v1 and v2. [Figure 2E] Figure 2 shows the results of PAM depletion of OMNI nucleases by TXTL in vitro. The PAM logo schematically represents the proportion of depleted sites. A condensed 4N window library of all possible PAM sites along the 8bp sequence of each OMNI nuclease in a cell-free in vitro TXTL system is shown. Sequence motifs created for in vitro PAM sites are based on the results of the depletion assay. Activity was estimated based on the average of the two most depleted sequences and calculated as a 1-depletion score. Figure 2E shows the results of in vitro PAM depletion of OMNI-79 sgRNA v1 and v2. [Figure 2F] Figure 2 shows the results of PAM depletion of OMNI nucleases by TXTL in vitro. The PAM logo schematically represents the proportion of depleted sites. A condensed 4N window library of all possible PAM sites along the 8bp sequence of each OMNI nuclease in a cell-free in vitro TXTL system is shown. Sequence motifs created for in vitro PAM sites are based on the results of the depletion assay. Activity was estimated based on the average of the two most depleted sequences and calculated as a 1-depletion score. Figure 2F shows the results of in vitro PAM depletion of OMNI-80 sgRNA v1 and v2. [Figure 2G]Figure 2 shows the results of PAM depletion of OMNI nucleases by TXTL in vitro. The PAM logo schematically represents the proportion of depleted sites. A condensed 4N window library of all possible PAM sites along the 8bp sequence of each OMNI nuclease in a cell-free in vitro TXTL system is shown. Sequence motifs created for in vitro PAM sites are based on the results of the depletion assay. Activity was estimated based on the average of the two most depleted sequences and calculated as a 1-depletion score. Figure 2G shows the results of in vitro PAM depletion of OMNI-81 sgRNA v1 and v2. [Figure 2H] Figure 2 shows the results of PAM depletion of OMNI nucleases by TXTL in vitro. The PAM logo schematically represents the proportion of depleted sites. A condensed 4N window library of all possible PAM sites along the 8bp sequence of each OMNI nuclease in a cell-free in vitro TXTL system is shown. Sequence motifs created for in vitro PAM sites are based on the results of the depletion assay. Activity was estimated based on the average of the two most depleted sequences and calculated as a 1-depletion score. Figure 2H shows the results of in vitro PAM depletion of OMNI-82 sgRNA v1 and v2. [Figure 3A] Figure 3A shows in vivo PAM enrichment by DNA transfection with OMNI nuclease. Hek293 cells containing a 6N PAM library after the T2 site were transfected with OMNI-79 nuclease and T2 sgRNA. Cells were harvested on day 6 and probed by Western blotting using an antibody against the HA tag to confirm the expression of OMNI-79 nuclease in mammalian cells. Lane 1 is a lysate containing SpCas9-HA, Lane 2 is a lysate containing OMNI-79-HA, and Lane 3 is an untransfected lysate. [Figure 3B] Figure 3B shows the NGS analysis, which selected sequences containing indels. It illustrates the nucleotide frequencies of all PAM locations in the enriched population of sgRNA V1 and V2. [Figure 4A] Figure 4 shows the OMNI-79 activity in variant forms of gRNA. The predicted secondary structures of a single guide RNA (sgRNA) (crRNA-tracrRNA) scaffold from Novosphingobium sp. and two other scaffolds (SpSpCAP1 and SpSaNXO2) are shown. [Figure 4B] Figure 4 shows the OMNI-79 activity in variant forms of gRNA. HeLa cells were transfected with gRNA molecules composed of a spacer directed to the CXCR4, TRAC or ELANE gene and either the OMNI-79 native scaffold, the SpSpCAP1 scaffold or the SpSaNXO2 scaffold. The editing activity of the OMNI-79 nuclease was determined for each RNA molecule by next-generation sequencing (NGS) of the amplification products for measuring indel frequencies. [Figure 5A] Figure 5 shows the activity of OMNI-79 by AAV delivery. HeLa cells were infected with AAV particles carrying the OMNI-79 CRISPR nuclease under the CMV promoter, a gRNA molecule targeting the CXCR4, ELANE or A1AT gene, and the U6 promoter. The editing activity was determined by next-generation sequencing (NGS) of the amplification products for measuring indel frequencies. [Figure 5B] Figure 5 shows the activity of OMNI-79 by AAV delivery. HepG2 cells were infected with the OMNI-79 CRIPSR nuclease and a gRNA molecule targeting A1AT in the presence or absence of bortezomib (BTZ). The editing activity was determined by next-generation sequencing (NGS) of the amplification products for measuring indel frequencies. [Figure 6A]Figure 6 shows the optimization of the OMNI-79 CRISPR nuclease spacer. The OMNI-79 protein was purified, and RNP complexes were assembled using gRNA molecules targeting ELANE g35 with spacer lengths of 20 nt, 21 nt, 22 nt, 23 nt, 24 nt, 25 nt, or 26 nt. All gRNA molecules were synthesized with 2'-O-methyl-3'-phosphorothioate modifications on the first and last three nucleotides. A gRNA molecule with a spacer length of 25 nucleotides was also synthesized without modification. The activity of the OMNI-79 CRISPR nuclease was tested using various gRNA molecules in U2OS cells. [Figure 6B] Figure 6 shows the optimization of the OMNI-79 CRISPR nuclease spacer. The OMNI-79 protein was purified, and RNP complexes were assembled using gRNA molecules targeting ELANE g35 with spacer lengths of 20 nt, 21 nt, 22 nt, 23 nt, 24 nt, 25 nt, or 26 nt. All gRNA molecules were synthesized with 2'-O-methyl-3'-phosphorothioate modifications on the first and last three nucleotides. A gRNA molecule with a spacer length of 25 nucleotides was also synthesized without modification. In an in vitro activity assay, the activity of the OMNI-79 CRISPR nuclease was tested using various gRNA molecules. **Modes for Carrying Out the Invention**

[0014] **Detailed Description** According to an aspect of the present invention, there is provided a non-natural composition comprising a CRISPR nuclease having at least 90% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 8, or a nucleic acid molecule comprising a sequence encoding the CRISPR nuclease.

[0015] In some embodiments, the composition further comprises one or more RNA molecules, or a DNA polynucleotide encoding any one of the one or more RNA molecules, wherein the one or more RNA molecules and the CRISPR nuclease are not found together in nature, and the one or more RNA molecules are configured to form a complex with the CRISPR nuclease and / or direct the complex to a target site. In some embodiments, the target site is a genomic DNA target site in a eukaryotic cell. In some embodiments, the RNA molecules are modified to have a 2'-O-methyl-3'-phosphorothioate group at their 3' end, 5' end, or both.

[0016] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 5, and at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 63 to 90.

[0017] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 5, and at least one RNA molecule is a CRISPR RNA (crRNA) molecule comprising a guide sequence and a sequence selected from the group consisting of SEQ ID NOs: 63, 64, 71-73, and 81-83.

[0018] In some embodiments, the composition further comprises a transactivated CRISPR RNA (tracrRNA) molecule containing the sequence represented by the group consisting of SEQ ID NOs. 65-69, 74-79, and 84-89.

[0019] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 5, and at least one RNA molecule is a single guide RNA (sgRNA) molecule comprising a guide sequence and a sequence selected from the group consisting of SEQ ID NOs: 63-90.

[0020] In some embodiments, the length of the guide sequence is 25 or 26 bases.

[0021] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 5, and the CRISPR nuclease is a nickas formed by the substitution of amino acids D8, E502, H735, or D738 in SEQ ID NO: 5.

[0022] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 5, and the CRISPR nuclease is a nickas formed by the substitution of amino acids D586, H587, or N610 in SEQ ID NO: 5.

[0023] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 5, and the CRISPR nuclease is a non-catalyzed nuclease formed by the substitution of amino acids D8, E502, H735, or D738 of SEQ ID NO: 5, and the substitution of amino acids D586, H587, or N610 of SEQ ID NO: 5.

[0024] In some embodiments, the CRISPR nuclease includes a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 5, and the CRISPR nuclease includes a domain A that has at least 90% identity with an amino acid sequence having at least 90% sequence identity with amino acids 1-40 of SEQ ID NO: 5.

[0025] In some embodiments, the CRISPR nuclease includes a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 5, and the CRISPR nuclease includes a domain B that has at least 90% identity with an amino acid sequence having at least 90% sequence identity with amino acids 41-76 of SEQ ID NO: 5.

[0026] In some embodiments, the CRISPR nuclease includes a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 5, and the CRISPR nuclease includes a domain C having at least 90% identity with an amino acid sequence having at least 90% sequence identity with amino acids 77-228 of SEQ ID NO: 5.

[0027] In some embodiments, the CRISPR nuclease includes a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 5, and the CRISPR nuclease includes a domain D that has at least 90% identity with an amino acid sequence having at least 90% sequence identity with amino acids 229-446 of SEQ ID NO: 5.

[0028] In some embodiments, the CRISPR nuclease includes a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 5, and the CRISPR nuclease includes a domain E having at least 90% identity with an amino acid sequence having at least 90% sequence identity with amino acids 447-507 of SEQ ID NO: 5.

[0029] In some embodiments, the CRISPR nuclease includes a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 5, and the CRISPR nuclease includes a domain F having at least 90% identity with an amino acid sequence having at least 90% sequence identity with amino acids 539-648 of SEQ ID NO: 5.

[0030] In some embodiments, the CRISPR nuclease includes a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 5, and the CRISPR nuclease includes a domain G having at least 90% identity with an amino acid sequence having at least 90% sequence identity with amino acids 655-822 of SEQ ID NO: 5.

[0031] In some embodiments, the CRISPR nuclease includes a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 5, and the CRISPR nuclease includes a domain H that has at least 90% identity with an amino acid sequence having at least 90% sequence identity with amino acids 823-921 of SEQ ID NO: 5.

[0032] In some embodiments, the CRISPR nuclease includes a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 5, and the CRISPR nuclease includes a domain I that has at least 90% identity with an amino acid sequence having at least 90% sequence identity with amino acids 922-1062 of SEQ ID NO: 5.

[0033] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 1, and at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 25-29.

[0034] In some embodiments, the CRISPR nuclease contains a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 1, and at least one RNA molecule is a CRISPR RNA (crRNA) molecule containing a guide sequence and the sequence shown in SEQ ID NO: 25.

[0035] In some embodiments, the composition further comprises a transactivated CRISPR RNA (tracrRNA) molecule containing the sequence represented by the group consisting of SEQ ID NOs. 26-28.

[0036] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 1, and at least one RNA molecule is a single guide RNA (sgRNA) molecule comprising a guide sequence and a sequence selected from the group consisting of SEQ ID NOs: 25-29.

[0037] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 1, and the CRISPR nuclease is a nickas formed by the substitution of amino acids D24, E557, H785, or D788 in SEQ ID NO: 1.

[0038] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 1, and the CRISPR nuclease is a nicasse formed by the substitution of amino acids E644, H645, or N668 in SEQ ID NO: 1.

[0039] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 1, and the CRISPR nuclease is a non-catalyzed nuclease formed by the substitution of amino acids D24, E557, H785 or D788 of SEQ ID NO: 1, and the substitution of amino acids E644, H645 or N668 of SEQ ID NO: 1.

[0040] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 2, and at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 30-39.

[0041] In some embodiments, the CRISPR nuclease contains a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 2, and at least one RNA molecule is a CRISPR RNA (crRNA) molecule containing a guide sequence and a sequence selected from the group consisting of SEQ ID NOs: 30-32.

[0042] In some embodiments, the composition further comprises a transactivated CRISPR RNA (tracrRNA) molecule containing the sequence represented by the group consisting of SEQ ID NOs. 33 to 38.

[0043] In some embodiments, the CRISPR nuclease contains a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 2, and at least one RNA molecule is a single guide RNA (sgRNA) molecule containing a guide sequence and a sequence selected from the group consisting of SEQ ID NOs: 30-39.

[0044] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 2, and the CRISPR nuclease is a nickas formed by the substitution of amino acids D19, E528, H750, or D753 in SEQ ID NO: 2.

[0045] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 2, and the CRISPR nuclease is a nickas formed by the substitution of amino acids D609, H610, or N633 in SEQ ID NO: 2.

[0046] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 2, and the CRISPR nuclease is a non-catalyzed nuclease formed by the substitution of amino acids D19, E528, H750 or D753 of SEQ ID NO: 2, and the substitution of amino acids D609, H610 or N633 of SEQ ID NO: 2.

[0047] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 3, and at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 40-52.

[0048] In some embodiments, the CRISPR nuclease contains a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 3, and at least one RNA molecule is a CRISPR RNA (crRNA) molecule containing a guide sequence and a sequence selected from the group consisting of SEQ ID NOs: 40-43.

[0049] In some embodiments, the composition further comprises a transactivated CRISPR RNA (tracrRNA) molecule containing a sequence represented by the group consisting of SEQ ID NOs: 44-51.

[0050] In some embodiments, the CRISPR nuclease contains a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 3, and at least one RNA molecule is a single guide RNA (sgRNA) molecule containing a guide sequence and a sequence selected from the group consisting of SEQ ID NOs: 40-52.

[0051] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 3, and the CRISPR nuclease is a nickas formed by the substitution of amino acids D8, E503, H729, or D732 in SEQ ID NO: 3.

[0052] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 3, and the CRISPR nuclease is a nicasse formed by the substitution of amino acids E584, H585, or N607 in SEQ ID NO: 3.

[0053] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 3, and the CRISPR nuclease is a non-catalyzed nuclease formed by the substitution of amino acids D8, E503, H729, or D732 in SEQ ID NO: 1 and the substitution of amino acids E584, H585, or N607 in SEQ ID NO: 3.

[0054] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 4, and at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 53-62.

[0055] In some embodiments, the CRISPR nuclease contains a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 4, and at least one RNA molecule is a CRISPR RNA (crRNA) molecule containing a guide sequence and a sequence selected from the group consisting of SEQ ID NOs: 53-55.

[0056] In some embodiments, the composition further comprises a transactivated CRISPR RNA (tracrRNA) molecule containing the sequence represented by the group consisting of SEQ ID NOs. 56 to 61.

[0057] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 4, and at least one RNA molecule is a single guide RNA (sgRNA) molecule comprising a guide sequence and a sequence selected from the group consisting of SEQ ID NOs: 53-62.

[0058] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 4, and the CRISPR nuclease is a nickas formed by the substitution of amino acids D12, E543, H770, or D773 in SEQ ID NO: 4.

[0059] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 4, and the CRISPR nuclease is a nickas formed by the substitution of amino acids E630, H631, or N654 in SEQ ID NO: 4.

[0060] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 4, and the CRISPR nuclease is a non-catalyzed nuclease formed by the substitution of amino acids D12, E543, H770 or D773 of SEQ ID NO: 4, and the substitution of amino acids E630, H631 or N654 of SEQ ID NO: 4.

[0061] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 6, and at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 91-98.

[0062] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 6, and at least one RNA molecule is a CRISPR RNA (crRNA) molecule comprising a guide sequence and a sequence selected from the group consisting of SEQ ID NOs: 91 and 92.

[0063] In some embodiments, the composition further comprises a transactivated CRISPR RNA (tracrRNA) molecule containing the sequence represented by the group consisting of SEQ ID NOs. 93 to 97.

[0064] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 6, and at least one RNA molecule is a single guide RNA (sgRNA) molecule comprising a guide sequence and a sequence selected from the group consisting of SEQ ID NOs: 91-98.

[0065] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 6, and the CRISPR nuclease is a nickas formed by the substitution of amino acids D8, E523, H757, or D760 in SEQ ID NO: 6.

[0066] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 6, and the CRISPR nuclease is a nickas formed by the substitution of amino acids D607, H608, or N631 in SEQ ID NO: 6.

[0067] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 6, and the CRISPR nuclease is a non-catalyzed nuclease formed by the substitution of amino acids D8, E523, H757 or D760 of SEQ ID NO: 6, and the substitution of amino acids D607, H608 or N631 of SEQ ID NO: 6.

[0068] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 7, and at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 99-108.

[0069] In some embodiments, the CRISPR nuclease contains a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 7, and at least one RNA molecule is a CRISPR RNA (crRNA) molecule containing a guide sequence and a sequence selected from the group consisting of SEQ ID NOs: 99-101.

[0070] In some embodiments, the composition further comprises a transactivated CRISPR RNA (tracrRNA) molecule containing the sequence represented by the group consisting of SEQ ID NOs: 102-107.

[0071] In some embodiments, the CRISPR nuclease contains a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 7, and at least one RNA molecule is a single guide RNA (sgRNA) molecule containing a guide sequence and a sequence selected from the group consisting of SEQ ID NOs: 99-108.

[0072] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 7, and the CRISPR nuclease is a nickas formed by the substitution of amino acids D12, E527, H756, or D759 in SEQ ID NO: 7.

[0073] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 7, and the CRISPR nuclease is a nickas formed by the substitution of amino acids E615, H616, or N639 in SEQ ID NO: 7.

[0074] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 7, and the CRISPR nuclease is a non-catalyzed nuclease formed by the substitution of amino acids D12, E527, H756, or D759 of SEQ ID NO: 7, and the substitution of amino acids E615, H616, or N639 of SEQ ID NO: 7.

[0075] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 8, and at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 109-120.

[0076] In some embodiments, the CRISPR nuclease contains a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 8, and at least one RNA molecule is a CRISPR RNA (crRNA) molecule containing a guide sequence and a sequence selected from the group consisting of SEQ ID NOs: 109-112.

[0077] In some embodiments, the composition further comprises a transactivated CRISPR RNA (tracrRNA) molecule containing the sequence represented by the group consisting of SEQ ID NOs: 113-119.

[0078] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 8, and at least one RNA molecule is a single guide RNA (sgRNA) molecule comprising a guide sequence and a sequence selected from the group consisting of SEQ ID NOs: 109-120.

[0079] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 8, and the CRISPR nuclease is a nickas formed by the substitution of amino acids D6, E524, H756, or D759 in SEQ ID NO: 8.

[0080] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 8, and the CRISPR nuclease is a nickas formed by the substitution of amino acids D608, H609, or N632 in SEQ ID NO: 8.

[0081] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 8, and the CRISPR nuclease is a non-catalyzed nuclease formed by the substitution of amino acids D6, E524, H756 or D759 in SEQ ID NO: 8, and the substitution of amino acids D608, H609 or N632 in SEQ ID NO: 8.

[0082] According to an aspect of the present invention, a non-natural composition comprising a CRISPR nuclease is provided, wherein the CRISPR nuclease comprises an amino acid sequence corresponding to at least one amino acid sequence of domain A, domain B, domain C, domain D, domain E, domain F, domain G, domain H, or domain I of OMNI-79 CRISPR nuclease (SEQ ID NO: 5).

[0083] In some embodiments, the CRISPR nuclease includes a domain A that has at least 97% sequence identity with amino acids 1-40 of SEQ ID NO: 5.

[0084] In some embodiments, the CRISPR nuclease includes a domain B that has at least 97% sequence identity with amino acids 41-76 of SEQ ID NO: 5.

[0085] In some embodiments, the CRISPR nuclease includes a domain C that has at least 97% sequence identity with amino acids 77-228 of SEQ ID NO: 5.

[0086] In some embodiments, the CRISPR nuclease includes a domain D having at least 97% sequence identity with amino acids 229-446 of SEQ ID NO: 5.

[0087] In some embodiments, the CRISPR nuclease contains a domain E that has at least 97% sequence identity with amino acids 447-507 of SEQ ID NO: 5.

[0088] In some embodiments, the CRISPR nuclease contains a domain F having at least 97% sequence identity with amino acids 539-648 of SEQ ID NO: 5.

[0089] In some embodiments, the CRISPR nuclease includes a domain G which has at least 97% sequence identity with amino acids 665-822 of SEQ ID NO: 5.

[0090] In some embodiments, the CRISPR nuclease contains a domain H that has at least 97% sequence identity with amino acids 823-921 of SEQ ID NO: 5.

[0091] In some embodiments, the CRISPR nuclease includes a domain I that has at least 97% sequence identity with amino acids 922-1062 of SEQ ID NO: 5.

[0092] In some embodiments, the length of the CRISPR nuclease sequence is at least 100-250, 250-500, 500-1000, or 1000-2000 amino acids.

[0093] A non-natural composition comprising a peptide or a polynucleotide encoding the peptide, wherein the peptide comprises an amino acid sequence having at least 97% sequence identity with respect to at least one amino acid sequence of domain A, domain B, domain C, domain D, domain E, domain F, domain G, domain H, or domain I of OMNI-79 CRISPR nuclease.

[0094] According to an embodiment of the present invention, One or more RNA molecules, one or more nucleotide sequences encoding the one or more RNA molecules, or one or more RNA molecules comprising a guide sequence that can hybridize with a target sequence and is directly linked to a repeat sequence; and A CRISPR nuclease containing an amino acid sequence having at least 90% identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 8, or a nucleic acid molecule containing a sequence encoding the said CRISPR nuclease; A modified non-natural composition is provided, which includes a CRISPR-related system, The one or more RNA molecules hybridize to the target sequence, the target sequence is adjacent to the 3' end of the complementary sequence of the protospacer adjacency motif (PAM), and the one or more RNA molecules form a complex with the CRISPR nuclease.

[0095] According to aspects of the present invention, a method is provided for modifying a nucleotide sequence in a cell-free system or at a target site in the genome of a cell, comprising introducing any one of the compositions of the present application into a cell.

[0096] In some embodiments, the cells are eukaryotic or prokaryotic.

[0097] In some aspects, eukaryotic cells are mammalian cells.

[0098] In some aspects, mammalian cells are human cells.

[0099] In some embodiments, the CRISPR nuclease forms a complex with one or more RNA molecules and acts to cleave DNA strands adjacent to a protospacer-adjacent motif (PAM) sequence, and / or acts to cleave DNA strands adjacent to a sequence complementary to the PAM sequence.

[0100] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the sequence shown in Sequence ID No. 1, and the PAM site is an NGCNNT.

[0101] In some embodiments, the CRISPR nuclease is a nickasase formed by the amino acid substitution of D24, E557, H785, or D788 in SEQ ID NO: 1, which acts to cleave DNA strands adjacent to the PAM sequence.

[0102] In some embodiments, the CRISPR nuclease is a nickasase formed by the amino acid substitution of E644, H645, or N668 in SEQ ID NO: 1, which acts to cleave DNA strands adjacent to sequences complementary to the PAM sequence.

[0103] In some embodiments, the CRISPR nuclease contains a sequence having at least 90% identity with the sequence shown in SEQ ID NO: 2, and the PAM sequence is NSHNAC.

[0104] In some embodiments, the CRISPR nuclease is a nickasase formed by the amino acid substitution of D19, E528, H750, or D753 in SEQ ID NO: 2, which acts to cleave DNA strands adjacent to the PAM sequence.

[0105] In some embodiments, the CRISPR nuclease is a nickasase formed by the amino acid substitution of D609, H610, or N633 in SEQ ID NO: 2, which acts to cleave DNA strands adjacent to sequences complementary to the PAM sequence.

[0106] In some embodiments, the CRISPR nuclease contains a sequence having at least 90% identity with the sequence shown in Sequence ID No. 3, and the PAM sequence is NRRCM.

[0107] In some embodiments, the CRISPR nuclease is a nickasase formed by the amino acid substitution of D8, E503, H729, or D732 in SEQ ID NO: 3, which acts to cleave DNA strands adjacent to the PAM sequence.

[0108] In some embodiments, the CRISPR nuclease is a nickasase formed by the amino acid substitution of E584, H585, or N607 in SEQ ID NO: 3, which acts to cleave DNA strands adjacent to sequences complementary to the PAM sequence.

[0109] In some embodiments, the CRISPR nuclease contains a sequence having at least 90% identity with the sequence shown in Sequence ID No. 4, and the PAM sequence is NGSNNT.

[0110] In some embodiments, the CRISPR nuclease is a nickasase formed by the amino acid substitution of D12, E543, H770, or D773 in SEQ ID NO: 4, which acts to cleave DNA strands adjacent to the PAM sequence.

[0111] In some embodiments, the CRISPR nuclease is a nickasase formed by the substitution of amino acids E630, H631, or N654 in SEQ ID NO: 4, which acts to cleave DNA strands adjacent to sequences complementary to the PAM sequence.

[0112] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the sequence shown in Sequence ID No. 5, and the PAM sequence is NGR or NGG.

[0113] In some embodiments, the CRISPR nuclease is a nickasase formed by the amino acid substitution of D8, E502, H735, or D738 in SEQ ID NO: 5, which acts to cleave DNA strands adjacent to the PAM sequence.

[0114] In some embodiments, the CRISPR nuclease is a nickasase formed by the amino acid substitution of D586, H587, or N610 in SEQ ID NO: 5, which acts to cleave DNA strands adjacent to sequences complementary to the PAM sequence.

[0115] In some embodiments, the CRISPR nuclease contains a sequence having at least 90% identity with the sequence shown in Sequence ID No. 6, and the PAM sequence is NNRGAY.

[0116] In some embodiments, the CRISPR nuclease is a nickasase formed by the amino acid substitution of D8, E523, H757, or D760 in SEQ ID NO: 6, which acts to cleave DNA strands adjacent to the PAM sequence.

[0117] In some embodiments, the CRISPR nuclease is a nickasase formed by the amino acid substitution of D607, H608, or N631 in SEQ ID NO: 6, which acts to cleave DNA strands adjacent to sequences complementary to the PAM sequence.

[0118] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the sequence shown in Sequence ID No. 7, and the PAM sequence is NRRAA.

[0119] In some embodiments, the CRISPR nuclease is a nickasase formed by the amino acid substitution of D12, E527, H756, or D759 in SEQ ID NO: 7, which acts to cleave DNA strands adjacent to the PAM sequence.

[0120] In some embodiments, the CRISPR nuclease is a nickasase formed by the substitution of amino acids E615, H616, or N639 in SEQ ID NO: 7, which acts to cleave DNA strands adjacent to sequences complementary to the PAM sequence.

[0121] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity with the sequence shown in Sequence ID No. 8, and the PAM sequence is NRRNTT.

[0122] In some embodiments, the CRISPR nuclease is a nickasase formed by the amino acid substitution of D6, E524, H756, or D759 in SEQ ID NO: 8, which acts to cleave DNA strands adjacent to the PAM sequence.

[0123] In some embodiments, the CRISPR nuclease is a nickasase formed by the amino acid substitution of D608, H609, or N632 in SEQ ID NO: 8, which acts to cleave DNA strands adjacent to sequences complementary to the PAM sequence.

[0124] In some aspects of the present invention, the disclosed compositions include nucleic acid molecules comprising clustered, regularly spaced short palindromic repeats (CRISPR) nucleases and / or sequences encoding them.

[0125] Table 1 shows novel CRISPR nucleases and substitutions at one or more positions within each nuclease to convert them into nickases or non-catalyzed nucleases.

[0126] Table 2 shows crRNA, tracrRNA, and single guide RNA (sgRNA) sequences, as well as some crRNA, tracrRNA, and sgRNA sequences compatible with each of the CRISPR nucleases described. Therefore, crRNA molecules that can bind to and target the OMNI nucleases shown in Table 2 as part of a crRNA:tracrRNA complex may contain the crRNA sequences shown in Table 2. Similarly, tracrRNA molecules that can bind to and target the OMNI nucleases shown in Table 2 as part of a crRNA:tracrRNA complex may contain the crRNA sequences shown in Table 2. Furthermore, single guide RNA molecules that can bind to and target the OMNI nucleases shown in Table 2 may contain the sequences shown in Table 2.

[0127] For example, the crRNA molecule of OMNI-61 nuclease (SEQ ID NO: 2) may contain sequences 30-32; the tracrRNA molecule of OMNI-61 nuclease may contain any one of sequences 33-38; and the sgRNA molecule of OMNI-62 nuclease may contain any one of sequences 30-39. Other crRNA, tracrRNA, or sgRNA molecules of each OMNI nuclease may be derived from the sequences shown in Table 2 in the same manner.

[0128] In some embodiments, the CRISPR nuclease comprises an amino acid sequence having at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, or 82% amino acid sequence identity with the CRISPR nuclease sequence shown in any of SEQ ID NOs: 1 to 8. In some embodiments, the sequence encoding the CRISPR nuclease has at least 95% identity with a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 9 to 24.

[0129] In some embodiments, CRISPR nucleases are found in Comamonadaceae bacterium NML00-0135, Demequina sediminicola, Fuerstia marisgermanicae, Nitrosomonas sp. Nm33, Novosphingobium sp. SYSU G00007, Paracoccus bengalensis, Parvibium lacunae, or Pelagicola sp. The CRISPR nuclease derived from LXJ1103 contains amino acid sequences having at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, and 75% amino acid sequence identity. The feasibility of each is shown in the individual embodiments.

[0130] In some embodiments, the CRISPR nuclease is a nickas having an inactivated RuvC domain created by amino acid substitutions at the positions shown for the CRISPR nuclease in Table 1.

[0131] In some embodiments, the CRISPR nuclease is a nickas having an inactivated HNH domain created by amino acid substitutions at the positions shown for the CRISPR nuclease in Table 1.

[0132] In some embodiments, the CRISPR nuclease is a non-catalytic nuclease having an inactivated RuvC domain and an inactivated HNH domain created by repositional substitution as shown for the CRISPR nuclease in Table 1.

[0133] For example, the RuvC domain of OMNI-59 can be inactivated by substituting the aspartic acid residue (D) at position 24 of the amino acid sequence (SEQ ID NO: 1) with another amino acid (e.g., alanine (A)), thereby creating a nickase of the OMNI-59 nuclease. Substitutions to other amino acids are permitted for each of the amino acid positions shown in Table 1, except when an asterisk follows the amino acid position indicating that any substitution other than the substitution from aspartic acid (D) to glutamic acid (E) or from glutamic acid (E) to aspartic acid (D) results in inactivation. For example, the HNH domain of OMNI-79 can be inactivated by substituting the aspartic acid residue (D) at position 586 of the amino acid sequence (SEQ ID NO: 5) with an amino acid other than glutamic acid (E) (e.g., alanine (A)), thereby creating a nickase of the OMNI-79 nuclease. Other nickases or nucleases without catalytic activity can be created using the same notation in Table 1.

[0134] In some embodiments, CRISPR nucleases utilize the protospacer-adjacent motif (PAM) sequences shown for the CRISPR nucleases in Table 3.

[0135] In some aspects of the present invention, a method for modifying a nucleotide sequence in a cell-free system or at a DNA target site in the genome of a cell is disclosed, comprising introducing one of the CRISPR nucleases and a suitable crRNA:tracrRNA complex or sgRNA molecule into a cell.

[0136] In some embodiments, CRISPR nucleases act to cleave DNA strands adjacent to protospacer-adjacent motif (PAM) sequences, as shown for CRISPR nucleases in Table 3, and to cleave DNA strands adjacent to sequences complementary to PAM sequences. For example, an OMNI-79 nuclease containing a suitable target sgRNA molecule or crRNA:tracrRNA complex can form DNA cleavage on strands adjacent to NGR or NGG sequences, and on DNA strands adjacent to sequences complementary to NGR or NGG sequences. In some embodiments, the DNA strands are located within the cell nucleus.

[0137] In some aspects of the present invention, the disclosed compositions comprise a DNA construct or vector system comprising a nucleotide sequence encoding a CRISPR nuclease or a CRISPR nuclease variant. In some embodiments, the nucleotide sequence encoding the CRISPR nuclease or CRISPR nuclease variant is operably linked to a promoter that is activatable in the target cell. In some embodiments, the target cell is a eukaryotic cell. In some embodiments, the target cell is a mammalian cell. In some embodiments, the nucleic acid sequence encoding the modified CRISPR nuclease is codon-optimized for use in the cells of a particular organism. In some embodiments, the nucleic acid sequence encoding the nuclease is codon-optimized for E. coli. In some embodiments, the nucleic acid sequence encoding the nuclease is codon-optimized for eukaryotic cells. In some embodiments, the nucleic acid sequence encoding the nuclease is codon-optimized for mammalian cells.

[0138] In some embodiments, the composition comprises a recombinant nucleic acid comprising a heterologous promoter operably ligated to a polynucleotide encoding a CRISPR enzyme whose identity with any of the sequences of SEQ ID NOs: 1-8 is at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, and 90%. The feasibility of each embodiment is shown separately.

[0139] In one embodiment of the composition, the CRISPR nuclease has at least 75%, 80%, 85%, 90%, 95%, or 97% identity with the amino acid sequence shown in SEQ ID NO: 1, or the sequence encoding the CRISPR nuclease has at least 75%, 80%, 85%, 90%, 95%, or 97% sequence identity with a nucleotide sequence selected from the group consisting of SEQ ID NOs: 9 and 17.

[0140] In one embodiment of the composition, the CRISPR nuclease has at least 75%, 80%, 85%, 90%, 95%, or 97% identity with the amino acid sequence shown in SEQ ID NO: 2, or the sequence encoding the CRISPR nuclease has at least 75%, 80%, 85%, 90%, 95%, or 97% sequence identity with a nucleotide sequence selected from the group consisting of SEQ ID NOs: 10 and 18.

[0141] In one embodiment of the composition, the CRISPR nuclease has at least 75%, 80%, 85%, 90%, 95%, or 97% identity with the amino acid sequence shown in SEQ ID NO: 3, or the sequence encoding the CRISPR nuclease has at least 75%, 80%, 85%, 90%, 95%, or 97% sequence identity with a nucleotide sequence selected from the group consisting of SEQ ID NOs: 11 and 19.

[0142] In one embodiment of the composition, the CRISPR nuclease has at least 75%, 80%, 85%, 90%, 95%, or 97% identity with the amino acid sequence shown in SEQ ID NO: 4, or the sequence encoding the CRISPR nuclease has at least 75%, 80%, 85%, 90%, 95%, or 97% sequence identity with a nucleotide sequence selected from the group consisting of SEQ ID NOs: 12 and 20.

[0143] In one embodiment of the composition, the CRISPR nuclease has at least 75%, 80%, 85%, 90%, 95%, or 97% identity with the amino acid sequence shown in SEQ ID NO: 5, or the sequence encoding the CRISPR nuclease has at least 75%, 80%, 85%, 90%, 95%, or 97% sequence identity with a nucleotide sequence selected from the group consisting of SEQ ID NOs: 13 and 21.

[0144] In one embodiment of the composition, the CRISPR nuclease has at least 75%, 80%, 85%, 90%, 95%, or 97% identity with the amino acid sequence shown in SEQ ID NO: 6, or the sequence encoding the CRISPR nuclease has at least 75%, 80%, 85%, 90%, 95%, or 97% sequence identity with a nucleotide sequence selected from the group consisting of SEQ ID NOs: 14 and 22.

[0145] In one embodiment of the composition, the CRISPR nuclease has at least 75%, 80%, 85%, 90%, 95%, or 97% identity with the amino acid sequence shown in SEQ ID NO: 7, or the sequence encoding the CRISPR nuclease has at least 75%, 80%, 85%, 90%, 95%, or 97% sequence identity with a nucleotide sequence selected from the group consisting of SEQ ID NOs: 15 and 23.

[0146] In one embodiment of the composition, the CRISPR nuclease has at least 75%, 80%, 85%, 90%, 95%, or 97% identity with the amino acid sequence shown in SEQ ID NO: 8, or the sequence encoding the CRISPR nuclease has at least 75%, 80%, 85%, 90%, 95%, or 97% sequence identity with a nucleotide sequence selected from the group consisting of SEQ ID NOs: 16 and 24.

[0147] According to several embodiments, there are provided modified or non-naturally occurring compositions comprising a CRISPR nuclease containing a sequence having at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, and 80% identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 8, or a nucleic acid molecule containing a sequence encoding the CRISPR nuclease. The feasibility of each is shown in the individual embodiments. In some embodiments, CRISPR nucleases are modified or do not exist in nature. CRISPR nucleases may also be recombinant. Such CRISPR nucleases are created by collecting genetic material from multiple sources and using laboratory methods (molecular cloning) to construct sequences that are not otherwise found in living organisms.

[0148] In one embodiment, the CRISPR nuclease of the present invention exhibits increased specificity to the target site compared to the SpCas9 nuclease when it forms a complex with one or more RNA molecules.

[0149] In one embodiment, the complex of the CRISPR nuclease of the present invention with one or more RNA molecules maintains at least on-target editing activity at the target site and reduces off-target activity compared to the SpCas9 nuclease.

[0150] In one embodiment, the CRISPR nuclease further comprises an RNA-binding site capable of interacting with DNA-targeting RNA molecules (gRNAs), and an active site exhibiting site-specific enzymatic activity.

[0151] In one embodiment, the composition further comprises a DNA-targeting RNA molecule, or a DNA polynucleotide encoding a DNA-targeting RNA molecule, wherein the DNA-targeting RNA comprises a nucleotide sequence complementary to the sequence within the target region, and the DNA-targeting RNA molecule and the CRISPR nuclease are not found together in nature.

[0152] In one embodiment, the DNA-targeting RNA further comprises a nucleotide sequence capable of forming a complex with a CRISPR nuclease.

[0153] The present invention a) One or more RNA molecules containing a guide sequence that is directly linked to a repeat sequence and can hybridize with a target sequence, or one or more nucleotide sequences encoding the one or more RNA molecules; and b) A CRISPR nuclease containing an amino acid sequence having at least 95% identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 8, or a nucleic acid molecule containing a sequence encoding the said CRISPR nuclease; We also provide non-natural compositions including CRISPR-related systems, The one or more RNA molecules hybridize to the target sequence, the target sequence is adjacent to the 3' end of the complementary sequence of the protospacer adjacency motif (PAM), and the one or more RNA molecules form a complex with the CRISPR nuclease.

[0154] In one embodiment, the composition further comprises an RNA molecule (tracrRNA) containing a nucleotide sequence capable of forming a complex with a CRISPR nuclease, or a DNA polynucleotide containing a sequence encoding an RNA molecule capable of forming a complex with a CRISPR nuclease.

[0155] In one embodiment, the system further includes a donor template for homologous recombination repair (HDR).

[0156] In one embodiment, the composition can edit a target region of the cell's genome.

[0157] In one aspect of the composition: a) The CRISPR nuclease has at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, and 80% identity with the sequence shown in SEQ ID NO: 1, and the RNA molecule contains a sequence selected from the group consisting of SEQ ID NOs: 25-29; b) The CRISPR nuclease has at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, and 80% identity with the sequence shown in SEQ ID NO: 2, and the RNA molecule contains a sequence selected from the group consisting of SEQ ID NOs: 30-39; c) The CRISPR nuclease has at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, and 80% identity with the sequence shown in SEQ ID NO: 3, and the RNA molecule contains a sequence selected from the group consisting of SEQ ID NOs: 40-52; d) The CRISPR nuclease has at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, and 80% identity with the sequence shown in SEQ ID NO: 4, and the RNA molecule contains a sequence selected from the group consisting of SEQ ID NOs: 53-62; e) The CRISPR nuclease has at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, and 80% identity with the sequence shown in SEQ ID NO: 5, and the RNA molecule contains a sequence selected from the group consisting of SEQ ID NOs: 63-90; f) The CRISPR nuclease has at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, and 80% identity with the sequence shown in SEQ ID NO: 6, and the RNA molecule contains a sequence selected from the group consisting of SEQ ID NOs: 91-98; g) The CRISPR nuclease has at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, and 80% identity with the sequence shown in SEQ ID NO: 7, and the RNA molecule contains a sequence selected from the group consisting of SEQ ID NOs: 99-108; or h) The CRISPR nuclease has at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, and 80% identity with the sequence shown in SEQ ID NO: 8, and the RNA molecule contains a sequence selected from the group consisting of SEQ ID NOs: 109 to 120.

[0158] According to some aspects, (a) RNA binding site; and Active site exhibiting site-specific enzyme activity A CRISPR nuclease or a polynucleotide encoding the CRISPR nuclease, Here, the CRISPR nuclease has at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, and 80% identity with any of SEQ ID NOs: 1 to 8; and, (b) i) DNA targeting RNA sequences containing nucleotide sequences complementary to the target DNA sequence; and ii) A protein-binding RNA sequence that can interact with the RNA-binding site of the CRISPR nuclease. A DNA polynucleotide comprising one or more RNA molecules or the one or more RNA molecules said, Here, the DNA-targeting RNA sequence and the CRISPR nuclease are not found together in nature. Non-natural compositions containing the following are provided. The feasibility of each is shown in individual aspects.

[0159] In some embodiments, a single RNA molecule is provided containing a DNA-targeting RNA sequence and a protein-binding RNA sequence, the RNA molecule being able to complex with a CRISPR nuclease and function as a DNA-targeting module. In some embodiments, the length of the RNA molecule is up to 1000 bases, 900 bases, 800 bases, 700 bases, 600 bases, 500 bases, 400 bases, 300 bases, 200 bases, 100 bases, and 50 bases. The feasibility of each is shown in the individual embodiments. In some embodiments, a first RNA molecule containing a DNA-targeting RNA sequence and a second RNA molecule containing a protein-binding RNA sequence interact by base pairing or fuse with each other to form a complex with a CRISPR nuclease and form one or more RNA molecules that function as a DNA-targeting module.

[0160] In some embodiments, the CRISPR nuclease has at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, and 80% identity with the sequence shown in SEQ ID NO: 1, and the RNA molecule contains a sequence selected from the group consisting of SEQ ID NOs: 25 to 29.

[0161] In some embodiments, the CRISPR nuclease has at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, and 80% identity with the sequence shown in SEQ ID NO: 2, and the RNA molecule contains a sequence selected from the group consisting of SEQ ID NOs: 30 to 39.

[0162] In some embodiments, the CRISPR nuclease has at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, and 80% identity with the sequence shown in SEQ ID NO: 3, and the RNA molecule contains a sequence selected from the group consisting of SEQ ID NOs: 40 to 52.

[0163] In some embodiments, the CRISPR nuclease has at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, and 80% identity with the sequence shown in SEQ ID NO: 4, and the RNA molecule contains a sequence selected from the group consisting of SEQ ID NOs: 53 to 62.

[0164] In some embodiments, the CRISPR nuclease has at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, and 80% identity with the sequence shown in SEQ ID NO: 5, and the RNA molecule contains a sequence selected from the group consisting of SEQ ID NOs: 63 to 90.

[0165] In some embodiments, the CRISPR nuclease has at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, and 80% identity with the sequence shown in SEQ ID NO: 6, and the RNA molecule contains a sequence selected from the group consisting of SEQ ID NOs: 91 to 98.

[0166] In some embodiments, the CRISPR nuclease has at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, and 80% identity with the sequence shown in SEQ ID NO: 7, and the RNA molecule contains a sequence selected from the group consisting of SEQ ID NOs: 99 to 108.

[0167] In some embodiments, the CRISPR nuclease has at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, and 80% identity with the sequence shown in SEQ ID NO: 8, and the RNA molecule contains a sequence selected from the group consisting of SEQ ID NOs: 109 to 120.

[0168] The present invention a) A CRISPR nuclease containing a sequence having at least 95% identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 8, or a nucleic acid molecule containing a sequence encoding the said CRISPR nuclease; and b) i) Nucleotide sequences of nuclease-binding RNA capable of interacting with / binding to the CRISPR nuclease; and ii) A nucleotide sequence of DNA targeting RNA containing a sequence complementary to the sequence in the target DNA sequence, One or more RNA molecules comprising at least one of the above, or one or more DNA polynucleotides encoding the one or more RNA molecules, We also provide non-natural compositions that include, The CRISPR nuclease can form a complex with one or more RNA molecules to form a complex that can hybridize with the target DNA sequence.

[0169] In one embodiment, a CRISPR nuclease and one or more RNA molecules form a CRISPR complex that can bind to a target DNA sequence and cleave the target DNA sequence.

[0170] In some embodiments, a CRISPR nuclease and at least one of one or more RNA molecules are not found together in nature.

[0171] In some cases: a) CRISPR nucleases contain an RNA binding site and an active site that exhibits site-specific enzymatic activity; b) The nucleotide sequence of the DNA-targeting RNA contains a nucleotide sequence complementary to the target DNA sequence; and c) The nucleotide sequence of the nuclease-binding RNA includes a sequence that interacts with the RNA-binding site of the CRISPR nuclease.

[0172] In one embodiment, the nucleotide sequences of the nuclease-binding RNA and the DNA-targeting RNA are located on a single guide RNA molecule (sgRNA), and the sgRNA molecule can form a complex with a CRISPR nuclease to function as a DNA targeting module.

[0173] In one embodiment, the nucleotide sequence of the nuclease-binding RNA is located on a first RNA molecule, and the nucleotide sequence of the DNA-targeting RNA is located on a single-guide RNA molecule, and the first and second RNA sequences interact by base pairing or fuse with each other to form a complex with a CRISPR nuclease to form one or more RNA molecules or sgRNAs that function as a targeting module.

[0174] In some embodiments, the length of sgRNA can be up to 1000 bases, 900 bases, 800 bases, 700 bases, 600 bases, 500 bases, 400 bases, 300 bases, 200 bases, 100 bases, or 50 bases.

[0175] In one embodiment, the system further includes a donor template for homologous recombination repair (HDR).

[0176] In some embodiments, (a) the CRISPR nuclease has sequence identity with the sequence shown in SEQ ID NO: 1 to at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, or 80%, or (b) the nucleic acid molecule containing the sequence encoding the CRISPR nuclease contains a sequence that has sequence identity with the nucleic acid sequence shown in SEQ ID NO: 9 or 17 to at least 95%, and the PAM is NGCNNT. In some embodiments, the DNA targeting RNA molecule contains a sequence selected from SEQ ID NOs: 25-29.

[0177] In some embodiments, (a) the CRISPR nuclease has sequence identity with the sequence shown in SEQ ID NO: 2 to at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, or 80%, or (b) the nucleic acid molecule containing the sequence encoding the CRISPR nuclease contains a sequence that has sequence identity with the nucleic acid sequence shown in SEQ ID NO: 10 or 18 to at least 95%, and the PAM is NSHNAC. In some embodiments, the DNA targeting RNA molecule contains a sequence selected from SEQ ID NOs: 30-39.

[0178] In some embodiments, (a) the CRISPR nuclease has sequence identity with the sequence shown in SEQ ID NO: 3 of at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, or 80%, or (b) the nucleic acid molecule containing the sequence encoding the CRISPR nuclease contains a sequence that has sequence identity with the nucleic acid sequence shown in SEQ ID NO: 11 or 19 of at least 95%, and the PAM is an NRRCM. In some embodiments, the DNA targeting RNA molecule contains a sequence selected from SEQ ID NOs: 40-52.

[0179] In some embodiments, (a) the CRISPR nuclease has sequence identity with the sequence shown in SEQ ID NO: 4 of at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, or 80%, or (b) the nucleic acid molecule containing the sequence encoding the CRISPR nuclease contains a sequence that has sequence identity with the nucleic acid sequence shown in SEQ ID NO: 12 or 20 of at least 95%, and the PAM is NGSNNT. In some embodiments, the DNA targeting RNA molecule contains a sequence selected from SEQ ID NOs: 53-62.

[0180] In some embodiments, (a) the CRISPR nuclease has sequence identity with the sequence shown in SEQ ID NO: 5 to at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, or 80%, or (b) the nucleic acid molecule containing the sequence encoding the CRISPR nuclease contains a sequence that has sequence identity with the nucleic acid sequence shown in SEQ ID NO: 13 or 21 to at least 95%, and the PAM is NGR or NGG. In some embodiments, the DNA targeting RNA molecule contains a sequence selected from SEQ ID NOs: 63 to 90.

[0181] In some embodiments, (a) the CRISPR nuclease has sequence identity with the sequence shown in SEQ ID NO: 6 of at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, or 80%, or (b) the nucleic acid molecule containing the sequence encoding the CRISPR nuclease contains a sequence that has sequence identity with the nucleic acid sequence shown in SEQ ID NO: 14 or 22 of at least 95%, and the PAM is NNRGAY. In some embodiments, the DNA targeting RNA molecule contains a sequence selected from SEQ ID NOs: 91-98.

[0182] In some embodiments, (a) the CRISPR nuclease has sequence identity with the sequence shown in SEQ ID NO: 7 to at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, or 80%, or (b) the nucleic acid molecule containing the sequence encoding the CRISPR nuclease contains a sequence that has sequence identity with the nucleic acid sequence shown in SEQ ID NO: 15 or 23 to at least 95%, and the PAM is NRRAA. In some embodiments, the DNA targeting RNA molecule contains a sequence selected from SEQ ID NOs: 99 to 108.

[0183] In some embodiments, (a) the CRISPR nuclease has sequence identity with the sequence shown in SEQ ID NO: 8 to at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, or 80%, or (b) the nucleic acid molecule containing the sequence encoding the CRISPR nuclease contains a sequence that has sequence identity with the nucleic acid sequence shown in SEQ ID NO: 16 or 24 to at least 95%, and the PAM is NRRNTT. In some embodiments, the DNA targeting RNA molecule contains a sequence selected from SEQ ID NOs: 109-120.

[0184] In one embodiment, the CRISPR nuclease contains 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-110, 110-120, 120-130, 130-140, or 140-150 amino acid substitutions, deletions, and / or insertions compared to its wild-type amino acid sequence.

[0185] In one embodiment, the CRISPR nuclease exhibits increased specificity of at least 2%, 5%, 7%, 10%, 15%, 20%, 25%, 30%, or 35% compared to its wild type.

[0186] In one embodiment, the CRISPR nuclease exhibits increased activity of at least 2%, 5%, 7%, 10%, 15%, 20%, 25%, 30%, or 35% compared to its wild type.

[0187] In some embodiments, CRISPR nucleases exhibit altered PAM specificity compared to their wild-type counterparts.

[0188] In some cases, CRISPR nucleases do not exist in nature.

[0189] In some embodiments, the CRISPR nuclease is modified to include unnatural or synthetic amino acids.

[0190] In one embodiment, the CRISPR nuclease is modified to include one or more nuclear localization sequences (NLS), cell-permeable peptide sequences, and / or affinity tags.

[0191] In one embodiment, the CRISPR nuclease includes one or more nuclear localization sequences of sufficient strength to drive the accumulation of a CRISPR complex containing a detectable amount of the CRISPR nuclease in the nucleus of a eukaryotic cell.

[0192] The present invention also provides a method for modifying nucleotide sequences in a cell-free system or at a target site in the genome of a cell, which includes introducing the composition of the present invention into cells.

[0193] In some cases, the cells are eukaryotic cells.

[0194] In another embodiment, the cell is a prokaryotic cell.

[0195] In some embodiments, one or more RNA molecules further comprise an RNA sequence (tracrRNA) containing a nucleotide molecule capable of forming a complex with an RNA nuclease, or a DNA polynucleotide encoding an RNA sequence containing a nucleotide sequence capable of forming a complex with a CRISPR nuclease.

[0196] In some embodiments, the CRISPR nuclease contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more NLS at or near the amino terminus, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more NLS at or near the carboxyl terminus, or a combination of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more NLS at or near the amino terminus and 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more NLS at or near the carboxyl terminus. In some embodiments, 1 to 4 NLS are fused with the CRISPR nuclease. In some embodiments, the NLS are located inside the open reading frame (ORF) of the CRISPR nuclease.

[0197] Methods for fusing NLS at or near the amino terminus, carboxyl terminus, or within an ORF of an expressed protein are widely known in the art. For example, to fuse NLS to the amino terminus of a CRISPR nuclease, the nucleic acid sequence of NLS is placed immediately after the start codon of the CRISPR nuclease in the nucleic acid encoding the NLS-fused CRISPR nuclease. Alternatively, to fuse NLS to the carboxyl terminus of a CRISPR nuclease, the nucleic acid sequence of NLS is placed after the codon encoding the last amino acid of the CRISPR nuclease and before the stop codon.

[0198] In this invention, a combination of NLS, a cell-permeable peptide sequence, and / or an affinity tag is planned at a position along the ORF of the CRISPR nuclease.

[0199] The amino acid sequence and nucleic acid sequence of the CRISPR nuclease of the present invention may include NLS and / or TAGs inserted to interrupt the continuous amino acid or nucleic acid sequence of the CRISPR nuclease.

[0200] In one embodiment, one or more NLSs are in tandem repeat.

[0201] In one embodiment, one or more NLSs are considered to be close to the N-terminus or C-terminus if the nearest amino acid of an NLS is located about 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 40, 50 or more amino acids along the polypeptide chain from the N-terminus or C-terminus.

[0202] As discussed, CRISPR nucleases may be modified to include one or more nuclear localization sequences (NLS), cell-permeable peptide sequences, and / or affinity tags.

[0203] In some embodiments, when a CRISPR nuclease forms a complex with one or more RNA molecules, its specificity to the target site increases compared to its wild-type form.

[0204] In some embodiments, a complex of a CRISPR nuclease with one or more RNA molecules maintains at least on-target editing activity at the target site and reduces off-target activity compared to the wild-type CRISPR nuclease.

[0205] In one embodiment, the composition further comprises a recombinant nucleic acid molecule comprising a heterologous promoter operably linked to a nucleotide acid molecule containing a sequence encoding a CRISPR nuclease.

[0206] In some embodiments, CRISPR nucleases or nucleic acid molecules containing sequences encoding such CRISPR nucleases are either not found in nature or have been modified.

[0207] The present invention also provides non-natural or modified compositions comprising a vector system containing a nucleic acid molecule comprising a sequence encoding the CRISPR nuclease of the present invention.

[0208] The present invention also provides the use of the compositions of the present invention for the treatment of subjects suffering from diseases associated with genomic mutations, which involves modifying the nucleotide sequence at a target site in the target genome.

[0209] The present invention provides a method for modifying a nucleotide sequence at a target site in the genome of a mammalian cell, comprising introducing into a cell (i) a composition comprising a CRISPR nuclease having at least 95% identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 8, or a nucleic acid molecule comprising a sequence encoding a CRISPR nuclease having at least 95% identity with a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 9 to 24, and (ii) a DNA targeting RNA molecule, or a DNA polynucleotide encoding a DNA targeting RNA molecule comprising a nucleotide sequence complementary to the sequence of target DNA.

[0210] In some embodiments, this method is performed ex vivo. In some embodiments, this method is performed in vivo. In some embodiments, some steps of this method are performed ex vivo and some steps are performed in vivo. In some embodiments, the mammalian cells are human cells.

[0211] In one embodiment, the method further comprises (iii) introducing into cells an RNA molecule containing a nuclease-binding RNA sequence, or a DNA polynucleotide encoding an RNA molecule containing a nuclease-binding RNA that interacts with a CRISPR nuclease.

[0212] In one embodiment, a DNA-targeting RNA molecule is a crRNA molecule suitable for forming an active complex with a CRISPR nuclease.

[0213] In one embodiment, an RNA molecule containing a nuclease-binding RNA sequence is a tracrRNA molecule suitable for forming an active complex with a CRISPR nuclease.

[0214] In one embodiment, the DNA-targeting RNA molecule and the RNA molecule containing the nuclease-binding RNA sequence are fused in the form of a single guide RNA molecule.

[0215] In one embodiment, the method further includes (iv) introducing an RNA molecule containing a sequence complementary to the protospacer sequence into the cell.

[0216] In one embodiment, a CRISPR nuclease forms a complex with one or more RNA molecules and acts to break the double-strand at the 3' of the protospacer-adjacent motif (PAM).

[0217] In one embodiment, a CRISPR nuclease forms a complex with one or more RNA molecules and acts to cause double-strand breaks at the 5' of the protospacer-adjacent motif (PAM).

[0218] In some embodiments, (a) the CRISPR nuclease has sequence identity with the sequence shown in SEQ ID NO: 1 to at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, or 80%, or (b) the nucleic acid molecule containing the sequence encoding the CRISPR nuclease contains a sequence that has sequence identity with the nucleic acid sequence shown in SEQ ID NO: 9 or 17 to at least 95%, and the PAM is NGCNNT. In some embodiments, the DNA targeting RNA molecule contains a sequence selected from SEQ ID NOs: 25-29.

[0219] In some embodiments, (a) the CRISPR nuclease has sequence identity with the sequence shown in SEQ ID NO: 2 to at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, or 80%, or (b) the nucleic acid molecule containing the sequence encoding the CRISPR nuclease contains a sequence that has sequence identity with the nucleic acid sequence shown in SEQ ID NO: 10 or 18 to at least 95%, and the PAM is NSHNAC. In some embodiments, the DNA targeting RNA molecule contains a sequence selected from SEQ ID NOs: 30-39.

[0220] In some embodiments, (a) the CRISPR nuclease has sequence identity with the sequence shown in SEQ ID NO: 3 of at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, or 80%, or (b) the nucleic acid molecule containing the sequence encoding the CRISPR nuclease contains a sequence that has sequence identity with the nucleic acid sequence shown in SEQ ID NO: 11 or 19 of at least 95%, and the PAM is an NRRCM. In some embodiments, the DNA targeting RNA molecule contains a sequence selected from SEQ ID NOs: 40-52.

[0221] In some embodiments, (a) the CRISPR nuclease has sequence identity with the sequence shown in SEQ ID NO: 4 of at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, or 80%, or (b) the nucleic acid molecule containing the sequence encoding the CRISPR nuclease contains a sequence that has sequence identity with the nucleic acid sequence shown in SEQ ID NO: 12 or 20 of at least 95%, and the PAM is NGSNNT. In some embodiments, the DNA targeting RNA molecule contains a sequence selected from SEQ ID NOs: 53-62.

[0222] In some embodiments, (a) the CRISPR nuclease has sequence identity with the sequence shown in SEQ ID NO: 5 to at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, or 80%, or (b) the nucleic acid molecule containing the sequence encoding the CRISPR nuclease contains a sequence that has sequence identity with the nucleic acid sequence shown in SEQ ID NO: 13 or 21 to at least 95%, and the PAM is NGR or NGG. In some embodiments, the DNA targeting RNA molecule contains a sequence selected from SEQ ID NOs: 63 to 90.

[0223] In some embodiments, (a) the CRISPR nuclease has sequence identity with the sequence shown in SEQ ID NO: 6 of at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, or 80%, or (b) the nucleic acid molecule containing the sequence encoding the CRISPR nuclease contains a sequence that has sequence identity with the nucleic acid sequence shown in SEQ ID NO: 14 or 22 of at least 95%, and the PAM is NNRGAY. In some embodiments, the DNA targeting RNA molecule contains a sequence selected from SEQ ID NOs: 91-98.

[0224] In some embodiments, (a) the CRISPR nuclease has sequence identity with the sequence shown in SEQ ID NO: 7 to at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, or 80%, or (b) the nucleic acid molecule containing the sequence encoding the CRISPR nuclease contains a sequence that has sequence identity with the nucleic acid sequence shown in SEQ ID NO: 15 or 23 to at least 95%, and the PAM is NRRAA. In some embodiments, the DNA targeting RNA molecule contains a sequence selected from SEQ ID NOs: 99 to 108.

[0225] In some embodiments, (a) the CRISPR nuclease has sequence identity with the sequence shown in SEQ ID NO: 8 to at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, or 80%, or (b) the nucleic acid molecule containing the sequence encoding the CRISPR nuclease contains a sequence that has sequence identity with the nucleic acid sequence shown in SEQ ID NO: 16 or 24 to at least 95%, and the PAM is NRRNTT. In some embodiments, the DNA targeting RNA molecule contains a sequence selected from SEQ ID NOs: 109-120.

[0226] In any aspect of the present invention, the method is for treating a subject suffering from a disease associated with a genomic mutation, and includes modifying the nucleotide sequence at a target site of the genome in question.

[0227] In one embodiment, the method first involves selecting subjects suffering from a disease associated with a genomic mutation and obtaining cells from those subjects.

[0228] The present invention also provides modified cells obtained by the method of the present application. In some embodiments, these modified cells can produce progeny cells. In some embodiments, these modified cells can produce progeny cells after transplantation.

[0229] The present invention also provides compositions comprising these modified cells and pharmaceutically acceptable carriers. Furthermore, it provides in vitro or ex vivo methods for preparing these compositions, comprising mixing the cells with the pharmaceutically acceptable carriers.

[0230] DNA-targeting RNA molecule The "guide sequence" of an RNA molecule refers to a nucleotide sequence that can hybridize with a specific target DNA sequence. For example, a guide sequence has a nucleotide sequence that is partially or completely complementary to the target DNA sequence along the length of the guide sequence. In some embodiments, the length of the guide sequence is 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides, or approximately 17-50, 17-49, 17-48, 17-47, 17-46, 17-45, 17-44, 17-43, 17-42, 17-41, 17-40, 17-3 The nucleotides are 9, 17-38, 17-37, 17-36, 17-35, 17-34, 17-33, 17-31, 17-30, 17-29, 17-28, 17-27, 17-26, 17-25, 17-24, 17-22, 17-21, 18-25, 18-24, 18-23, 18-22, 18-21, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-22, 18-20, 20-21, 21-22, or 17-20 nucleotides. The full length of the guide sequence is perfectly complementary to the target DNA sequence along the length of the guide sequence. The guide sequence may be a portion of an RNA molecule capable of forming a complex with a CRISPR nuclease having a guide sequence that functions as the DNA targeting portion of the CRISPR complex. When the DNA molecule having the guide sequence is present simultaneously with the CRISPR molecule, the RNA molecule can target the CRISPR nuclease to a specific target DNA sequence. Each feasibility is described in separate embodiments. The RNA molecule can be specifically designed to target a desired sequence. Thus, a molecule containing a “guide sequence” is a type of targeting molecule. Throughout this application, the terms “guide molecule,” “RNA guide molecule,” “guide RNA molecule,” and “gRNA molecule” are synonymous with a molecule containing a guide sequence, and the term “spacer” is synonymous with “guide sequence.”

[0231] In an embodiment of the present invention, the CRISPR nuclease exhibits maximum cleavage activity when used with an RNA molecule containing a guide sequence having 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.

[0232] In some embodiments, OMNI-79 CRISPR nuclease exhibits maximum cleavage activity when used with RNA molecules containing guide sequences with 25-26 nucleotides, compared to when used with RNA molecules containing guide sequences with 24 or fewer nucleotides and / or 27 or more nucleotides.

[0233] In some aspects of the present invention, the disclosed methods include methods for modifying nucleotide sequences in a cell-free system or at target sites in the genome of cells, which include introducing the compositions described in the specification into cells.

[0234] In some embodiments, the cells are eukaryotic cells, preferably mammalian cells or plant cells.

[0235] In some aspects of the present invention, the disclosed methods include the use of the compositions of the present application for the treatment of subjects suffering from diseases associated with genomic mutations, which involves modifying the nucleotide sequence at a target site of the genome in question.

[0236] In some aspects of the present invention, the disclosed method includes a method for treating a subject having a mutation disorder, which involves targeting an allele associated with the mutation disorder with the composition of the present application.

[0237] In some embodiments, mutation disorders are associated with diseases or disorders selected from among tumorigenesis, age-related macular degeneration, schizophrenia, neuropathy, neurodegenerative diseases, motor disorders, fragile X syndrome, secretase-related disorders, prion-related disorders, ALS, addiction, autism, Alzheimer's disease, neutropenia, inflammation-related disorders, Parkinson's disease, blood and coagulation disorders, cytodysregulation, tumor-related disorders, inflammation and immune-related disorders, metabolic, liver, kidney and protein disorders, musculoskeletal disorders, skin disorders, neurological disorders, and eye disorders.

[0238] In some embodiments, the mutational disorder is beta-thalassemia or sickle cell anemia.

[0239] In some embodiments, the disease-associated allele is BCL11A.

[0240] Domain of OMNI-79 CRISPR nuclease The characteristic target nuclease activity of CRISPR nucleases is conferred by the various functions of each of their domains. In this application, the domains of OMNI-79 are divided into domain A, domain B, domain C, domain D, domain E, domain F, domain G, domain H, and domain I.

[0241] In this specification, domain A begins with amino acids 1-10 and ends with amino acids 35-45 of the sequence shown in SEQ ID NO: 5. Based on a preferred analysis of local alignments obtained by the Smith-Waterman algorithm, in one embodiment, domain A was identified as amino acids 1-40 of SEQ ID NO: 5.

[0242] In this specification, domain E begins at amino acids 442–452 and ends at amino acids 502–512 of the sequence shown in SEQ ID NO: 5. Based on a preferred analysis of local alignments obtained by the Smith-Waterman algorithm, in one embodiment, domain E was identified as amino acids 447–507 of SEQ ID NO: 5.

[0243] In this specification, domain G begins at amino acids 660–670 and ends at amino acids 817–827 of the sequence shown in SEQ ID NO: 5. Based on a preferred analysis of local alignments obtained by the Smith-Waterman algorithm, in one embodiment, domain G was identified as amino acids 665–822 of SEQ ID NO: 5.

[0244] In this specification, domain B begins at amino acids 36–46 and ends at amino acids 71–81 of the sequence shown in SEQ ID NO: 5. Based on a preferred analysis of local alignments obtained by the Smith-Waterman algorithm, in one embodiment, domain B was identified as amino acids 41–76 of SEQ ID NO: 5.

[0245] In this specification, domain C begins at amino acids 72–82 and ends at amino acids 223–233 of the sequence shown in SEQ ID NO: 5. Based on an analysis of local alignments obtained by the Smith-Waterman algorithm, in one embodiment, domain C was identified as amino acids 77–228 of SEQ ID NO: 5.

[0246] In this specification, domain D begins at amino acids 224–234 and ends at amino acids 441–451 of the sequence shown in SEQ ID NO: 5. Based on an analysis of local alignments obtained by the Smith-Waterman algorithm, in one embodiment, domain D was identified as amino acids 229–446 of SEQ ID NO: 5.

[0247] In this specification, domain F begins at amino acids 534–544 and ends at amino acids 643–653 of the sequence shown in SEQ ID NO: 5. Based on a preferred analysis of local alignments obtained by the Smith-Waterman algorithm, in one embodiment, domain F was identified as amino acids 539–648 of SEQ ID NO: 5.

[0248] In this specification, domain H begins at amino acids 818–828 and ends at amino acids 916–926 of the sequence shown in SEQ ID NO: 5. Based on a preferred analysis of local alignments obtained by the Smith-Waterman algorithm, in one embodiment, domain H was identified as amino acids 823–921 of SEQ ID NO: 5.

[0249] In this specification, domain I begins at amino acids 917–927 and ends at amino acids 1057–1067 of the sequence shown in SEQ ID NO: 5. Based on a preferred analysis of local alignments obtained by the Smith-Waterman algorithm, in one embodiment, domain I was identified as amino acids 922–1062 of SEQ ID NO: 5.

[0250] The activity of each domain of the OMNI-79 nuclease is described in this specification, and the activity of each domain provides advantageous characteristics of the nuclease.

[0251] Specifically, domains A, E, and G of OMNI-79 form a substructure of the CRISPR OMNI-79 nuclease, which contains a nuclease active site involved in DNA strand cleavage. The substructure formed by domains A, E, and G cleaves the DNA strand to which the guide RNA molecule binds at the DNA target site.

[0252] Domain B is involved in initiating DNA cleavage activity when the OMNI-79 CRISPR nuclease binds to the target DNA site.

[0253] Domains C and D bind to guide RNA molecules and are involved in providing specificity for target site recognition. More specifically, domains C and D are involved in detecting DNA target sites, domain D is involved in regulating the activation of nuclease domains (e.g., domain F), and domain C is involved in immobilizing nuclease domains at the target site. Therefore, domains C and D are involved in regulating off-target sequence cleavage.

[0254] Domain F contains a nuclease active site involved in DNA strand cleavage. Domain F cleaves DNA strands that have been shifted by a guide RNA molecule that binds to a target site on double-stranded DNA.

[0255] Domain H is also involved in the recognition of guide RNA molecules or complexes (e.g., tracrRNA molecules, crRNA:tracrRNA complexes, or binding regions in sgRNA scaffolds).

[0256] Domain I is involved in providing PAM site specificity to the OMNI-79 nuclease, including PAM site exploration and recognition. Domain I also contributes to topoisomerase activity.

[0257] Other domains of CRISPR nucleases and their general functions are further described, among others, in Mir et al., ACS Chem. Biol. (2019), Palermo et al., Quarterly Reviews of Biophysics (2018), Jiang and Doudna, Annual Review of Biophysics (2017), Nishimasu et al., Cell (2014), and Nishimasu et al., Cell (2015), which are incorporated by reference in this specification.

[0258] In one aspect of the invention, amino acid sequences similar to the OMNI-79 domain may be used in the design and production of peptides that do not exist in nature, such as CRISPR nucleases that exhibit the advantageous characteristics of OMNI-79 domain activity.

[0259] In one embodiment, such a peptide, for example, a CRISPR nuclease, contains an amino acid sequence having at least 100%, 99.5%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, or 70% identity with at least one amino acid sequence of domain A, domain B, domain C, domain D, domain E, domain F, domain G, domain H, or domain I of the OMNI-79 nuclease. In some embodiments, identity is to at least one, at least two, at least three, at least four, at least five, at least six, at least seven, or at least eight amino acid sequences of domain A, domain B, domain C, domain D, domain E, domain F, domain G, domain H, or domain I of the OMNI-79 CRISPR nuclease. Each feasibility is shown in the individual embodiments. In some embodiments, identity is to the amino acid sequence in at least one of domain A, domain B, domain C, domain D, domain F, domain G, domain H, or domain I of the OMNI-79 nuclease. In some embodiments, identity is to the amino acid sequence in at least one of domains F and G of the OMNI-79 nuclease. In some embodiments, the CRISPR nuclease contains amino acid sequences corresponding to the amino acid sequences of domains G and F of the OMNI-79 nuclease. In some embodiments, the CRISPR nuclease contains an amino acid sequence having at least 100%, 99.5%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, or 70% identity with the amino acid sequences of domains G and F of the OMNI-79 nuclease.In one embodiment, the peptide exhibits extensive amino acid variation compared to the full-length OMNI-79 amino acid sequence outside the amino acid sequence of the peptide having at least 100%, 99.5%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, or 70% identity with at least one amino acid sequence of domain A, B, C, D, E, F, G, H, or I of the OMNI-79 nuclease (SEQ ID NO: 5). In one embodiment, the peptide includes an amino acid sequence interposed between two domains. In one embodiment, the amino acid length of the intervening amino acid sequence is 1-10, 10-20, 20-40, 40-50, or up to 100. In another embodiment, the intervening sequence is a linker sequence.

[0260] In one aspect of the invention, the amino acid sequence encoding the domain of the OMNI-79 nuclease described herein may contain one or more amino acid substitutions from the original OMNI-79 domain sequence. The amino acid substitutions may be conservative substitutions, i.e., substitutions to amino acids having similar chemical properties to the original amino acid. For example, a positively charged amino acid may be substituted for another positively charged amino acid, for example, an arginine residue may be substituted for a lysine residue, or a polar amino acid may be substituted for another polar amino acid. Conservative substitutions are more preferable, and the amino acid sequence encoding the domain of the OMNI-79 nuclease may contain as much as 10% of such substitutions. The amino acid substitutions may also be radical substitutions, i.e., substitutions to amino acids with different chemical properties from the original amino acid. For example, a positively charged amino acid may be substituted for a negatively charged amino acid, for example, an arginine residue may be substituted for a glutamic acid residue, or a polar amino acid may be substituted for a nonpolar amino acid. The amino acid substitutions may be semi-conservative substitutions, or the amino acid substitutions may be substitutions to other amino acids. The substitution may alter the activity compared to the function of the original OMNI-79 domain, for example, by reducing nuclease catalytic activity.

[0261] In some aspects of the present invention, the disclosed composition comprises a non-natural composition comprising a CRISPR nuclease, wherein the CRISPR nuclease comprises an amino acid sequence corresponding to at least one amino acid sequence of domain A, domain B, domain C, domain D, domain E, domain F, domain G, domain H, or domain I of the OMNI-79 nuclease. In some aspects of the present invention, the CRISPR nuclease comprises at least one, at least two, at least three, at least four, or at least five amino acid sequences, wherein each amino acid sequence corresponds to any one of the amino acid sequences of domain A, domain B, domain C, domain D, domain E, domain F, domain G, domain H, or domain I of the OMNI-79 nuclease. Thus, the CRISPR nuclease may comprise any combination of amino acid sequences corresponding to any one of domain A, domain B, domain C, domain D, domain E, domain F, domain G, domain H, or domain I of the OMNI-79 nuclease. In some embodiments, the amino acid length of the amino acid sequence is at least 100-250, 250-500, 500-1000, 1000-1500, 1000-1700, or 1000-2000.

[0262] Diseases and Treatments One aspect of the present invention involves targeting a nuclease to a specific gene locus associated with a disease or disorder as a form of gene editing, treatment, or therapy. For example, a novel nuclease disclosed in the specification may be specifically targeted to a pathogenic variant allele of a gene using a specially designed guide RNA molecule to induce gene editing or knockout. It is preferable to design the guide RNA molecule with the PAM requirements of the nuclease in mind first, and this also depends on the system in which the gene editing is performed, as shown in the specification. For example, a guide RNA molecule designed to direct the OMNI-79 nuclease to a target site is designed to include a spacer region complementary to a region adjacent to a sequence complementary to the OMNI-79 PAM sequence "NGG". The guide RNA molecule is further preferably designed to include a spacer region of sufficient, and preferably optimal, length (i.e., a region of the guide RNA molecule complementary to the target allele) to increase the specific activity of the nuclease and reduce off-target effects.

[0263] As a non-limiting example, a guide RNA molecule may be designed to target a specific region of a mutant allele, for example, near the start codon, so that the non-homologous end joining (NHEJ) pathway is induced upon nuclease-mediated DNA damage, resulting in silencing of the mutant allele by introducing a frameshift mutation. This approach to designing guide RNA molecules is particularly useful for altering the action of dominant-negative mutations and thereby treating a target. As another non-limiting example, a guide RNA molecule may be designed to target a specific pathogenic mutation of a mutant allele so that the homology-directed repair (HDR) pathway is induced upon nuclease-mediated DNA damage, resulting in template-mediated modification of the mutant allele. This approach to designing guide RNA molecules is particularly useful for altering the haploinsufficiency of a mutant allele and thereby treating a target.

[0264] Non-limiting examples of genes that may be targets for modification to treat a disease or disorder are shown below. Disease-related genes that induce a mutation disorder and the mutations have been described in the literature. Such mutations can be used to design DNA targeting RNA molecules that target alleles of the disease-related gene to induce a DNA repair pathway by causing DNA damage to modify the allele, thereby treating the mutation disorder with a CRISPR composition.

[0265] Mutations in the ELANE gene are associated with neutropenia. Thus, aspects of the present invention that target ELANE are methods of treating a subject afflicted with neutropenia and may be used without limitation.

[0266] CXCR4 is a co-receptor in human immunodeficiency virus type 1 (HIV-1) infection. Thus, aspects of the present invention that target CXCR4 may be used without limitation in methods of treating a subject afflicted with HIV-1 or in methods of conferring resistance to HIV-1 infection to a subject.

[0267] Disruption of programmed cell death protein 1 (PD-1) promotes the killing of tumor cells by CAR-T cells, and PD-1 may be a target for cancer treatment. Thus, aspects of the present invention that target PD-1 are methods of treating a subject afflicted with cancer and may be used without limitation. In one aspect, the treatment is CAR-T cell therapy with T cells modified according to the present invention to be PD-1 deficient.

[0268] Moreover, BCL11A is a gene involved in suppressing hemoglobin production. By inhibiting BCL11A, globin production can be increased, and diseases such as thalassemia and sickle cell anemia may be treated. For example, see PCT International Publication No. 2017 / 077394 (A2); US Patent Application Publication No. 2011 / 0182867; Humbert et al. Sci. Transl. Med. (2019) and Canver et al. Nature (2015). Accordingly, aspects of the present invention that target enhancers of BCL11A may be used without limitation in methods of treating subjects suffering from beta thalassemia or sickle cell anemia.

[0269] Aspects of the present invention may also be used to target disease-related genes in the study, modification, or treatment of the diseases or disorders listed in Table A or Table B below. In fact, disease-related genes having a locus may be studied, modified, or treated by targeting appropriate disease-related genes, such as those listed in US Patent Application Publication No. 2018 / 0282762 and European Patent No. 3079726 (B1), using the nucleases disclosed herein.

[0270]

Table A-1

[0271]

Table A-2

[0272]

Table B-1

[0273]

Table B-2

[0274]

Table B-3

[0275] Unless otherwise defined, all technical and / or scientific terms used in this specification have the same meaning as those commonly understood by those skilled in the art relating to the present invention. Similar or equivalent methods and materials may be used in carrying out or testing embodiments of the present invention, but representative methods and / or materials are described below. In case of any conflict, the specification containing the definitions shall prevail. Furthermore, the materials, methods and examples are for illustrative purposes only and are not necessarily intended to be limiting.

[0276] Unless otherwise specifically mentioned in the discussion, adjectives such as “substantially” and “about” that modify the state or relevance of the features of the embodiments of the invention are understood to mean that the state or relevance is defined to an extent acceptable to the operation of the embodiments of the intended use. Unless otherwise indicated, the term “or” in the specification and claims is considered inclusive “or” rather than exclusive “or” and indicates at least one and any combination of the items being joined.

[0277] In this specification, the terms "a" and "an" refer to "one or more" of the enumerated components. Unless otherwise specified, it will be obvious to those skilled in the art that the use of the singular includes the plural. Therefore, the terms "a," "an," and "at least one" have the same meaning in this application.

[0278] To better understand this instruction and in no way limit its scope, unless otherwise specified, all figures indicating quantities, proportions, or ratios, and other numerical values ​​used in the specification and claims, should be understood in all cases to be modified by the term “approximately.” Therefore, unless otherwise indicated, the numerical values ​​described in the specification and claims are approximations that may vary depending on the desired characteristics to be obtained. At a minimum, each numerical value should be interpreted using standard rounding techniques, taking into account the reported number of significant figures.

[0279] Where numerical ranges are described herein, the present invention shall be understood to mean each integer between the upper and lower limits (including the upper and lower limits), unless otherwise specified.

[0280] In this specification and claims, the verbs “contain,” “include,” and “have,” and each of their conjugations, are used to indicate that the object of the verb is not necessarily a complete list of components, elements, or parts of the subject of the verb. Other terms in this specification are meant to have meanings well known in the art.

[0281] The terms "polynucleotide," "nucleotide," "nucleotide sequence," "nucleic acid," and "nucleotide" are synonymous. They refer to a polymeric form of nucleotides of any length, which may be deoxyribonucleotides, ribonucleotides, or analogs thereof. The three-dimensional structure of a polynucleotide may be any and may exhibit known or unknown functions. The following are non-limiting examples of polynucleotides: coding or non-coding regions of genes or gene fragments, loci determined by linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, small interfering RNA (siRNA), small hairpin RNA (shRNA), microRNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, sequences of isolated DNA, sequences of isolated RNA, nucleic acid probes, and primers. A polynucleotide may contain one or more modified nucleotides, such as methylated nucleotides or their analogs. If present, modifications to the nucleotide structure may occur before or after the assembly of the polymer. The nucleotide sequence may be interrupted by non-nucleotide elements. Polynucleotides may be further modified after polymerization, such as by binding with a labeling component.

[0282] The term "nucleotide analog" or "modified nucleotide" refers to a nucleotide containing one or more various chemical modifications (e.g., substitutions) in or on the nitrogen-containing base of a nucleoside (e.g., cytosine (C), thymine (T) or uracil (U), adenine (A) or guanine (G)), in or on the sugar moiety of a nucleoside (e.g., ribose, deoxyribose, modified ribose, modified deoxyribose, 6-membered sugar analog or open-chain sugar analog), or in the phosphate moiety. Each of the RNA sequences described herein may contain one or more nucleotide analogs.

[0283] As used herein, the following nucleotide identifiers are used to represent nucleotide bases:

[0284]

Table C

[0285] As used herein, the term "targeting sequence" or "targeting molecule" refers to a nucleotide sequence or a molecule containing a nucleotide sequence that can hybridize to a specific target sequence. For example, a targeting sequence has a nucleotide sequence that is at least partially complementary to the sequence being targeted along its length. A targeting sequence or targeting molecule may be part of a targeting RNA molecule having a targeting sequence that can form a complex with a CRISPR nuclease that functions as the targeting portion of the CRISPR complex. When a molecule having a targeting sequence is present simultaneously with a CRISPR molecule, the RNA molecule can target the CRISPR nuclease to a specific target sequence. Each possibility represents an individual aspect. The targeting RNA molecule can be specifically designed to target a desired sequence.

[0286] In this specification, the term “target” refers to the preferential hybridization of a targeting sequence or targeting molecule with a nucleic acid containing a target nucleotide sequence. The term “target” is understood to encompass variable hybridizations in which preferential targeting of nucleic acids containing a target nucleotide sequence exists, but unintended off-target hybridization may also occur in addition to on-target hybridization. When an RNA molecule targets a sequence, it is understood that nuclease activity causes the complex of the RNA molecule and the CRISPR nuclease molecule to target the sequence.

[0287] When targeting DNA sequences present in multiple cells, targeting is understood to encompass hybridization of the RNA molecule's guide sequence with the sequence in one or more cells, and also hybridization of the RNA molecule with the target sequence in some but not all of the cells among the multiple cells. Therefore, when an RNA molecule targets sequences in multiple cells, the RNA molecule-CRISPR nuclease complex is understood to hybridize with the target sequence in one or more cells, and may also hybridize with the target sequence in some but not all cells. Therefore, the RNA molecule-CRISPR nuclease complex may hybridize with the target sequence in one or more cells to introduce double-strand breaks, and may also hybridize with the target sequence in some but not all cells to introduce double-strand breaks. In this specification, the term “modified cell” refers to a cell that has been double-stranded by the RNA molecule-CRISPR nuclease complex as a result of hybridization with the target sequence, i.e., on-target hybridization.

[0288] In this specification, the term “wild type” is a technical term understood by those skilled in the art, and means a representative form of an organism, strain, gene, or trait found in nature, distinct from a variant or variety. Accordingly, in this specification, when an amino acid sequence or nucleotide sequence refers to a wild-type sequence, a variant refers to a variant of that sequence, including, for example, substitutions, deletions, and insertions. In aspects of the present invention, a modified CRISPR nuclease is a variant of a CRISPR nuclease comprising at least one amino acid modification (e.g., substitution, deletion, and / or insertion) compared to any of the CRISPR nucleases shown in Table 1.

[0289] The terms “unnatural,” “not naturally occurring,” or “artificial” are used interchangeably and refer to human modification. When used with nucleic acid molecules or polypeptides, these terms may mean that the nucleic acid molecule or polypeptide does not contain, at least substantially, at least one component that is naturally associated with and found in nature.

[0290] In this specification, the term “amino acid” includes natural and / or unnatural or synthetic amino acids, glycine and optical isomers of D or I, as well as amino acid analogs and peptide mimes.

[0291] In this specification, “genomic DNA” means linear and / or chromosomal DNA, and / or plasmid or extrachromosomal DNA sequences present in the target cells or cell populations. In some embodiments, the target cells are eukaryotic cells. In some embodiments, the target cells are prokaryotic cells. In some embodiments, this method produces double-strand breaks (DSBs) at predetermined target sites in the genomic DNA sequence, resulting in mutations, insertions, and / or deletions of the DNA sequence at target sites in the genome.

[0292] Eukaryotic cells include, but are not limited to, fungal cells (such as yeast), plant cells, animal cells, mammalian cells, and human cells.

[0293] In this specification, the term “nuclease” refers to an enzyme capable of cleaving phosphodiester bonds between nucleotide subunits of nucleic acids. Nucleases may be isolated or derived from natural sources. Natural sources may be any organism. Alternatively, nucleases may be modified or synthetic proteins having phosphodiester bond cleavage activity.

[0294] In this specification, the term "PAM" refers to the nucleotide sequence of the target DNA located near the target DNA sequence and recognized by the CRISPR nuclease. The PAM sequence may differ depending on the nuclease.

[0295] In this specification, the terms “mutation disorder” or “mutation disease” refer to a disorder or disease associated with a gene dysfunction caused by a mutation. A dysfunctional gene that manifests as a mutation disorder contains a mutation in at least one of its alleles and is called a “disease-related gene.” The mutation may be located in any part of the disease-related gene, for example, in a regulatory, coding, or non-coding region. The mutation may be a substitution, insertion, or deletion. Mutations in disease-related genes may manifest as disorders or diseases according to any mutation mechanism, such as recessive, dominant-negative, gain-of-function, loss-of-function, or mutations leading to haploinsufficiency of the gene product.

[0296] Those skilled in the art will understand that aspects of the present invention disclose an RNA molecule capable of forming a complex with a nuclease, such as a CRISPR nuclease, which binds to a target genomic DNA sequence adjacent to a protospacer-adjacent motif (PAM). The nuclease then generates a double-strand break within the protospacer by cleaving the target DNA.

[0297] In embodiments of the present invention, a CRISPR nuclease and a targeting molecule form a CRISPR complex that binds to and cleaves a target DNA sequence. The CRISPR nuclease may form a CRISPR complex containing the CRISPR nuclease and RNA molecule without any further tracrRNA molecule. Alternatively, the CRISPR nuclease may form a CRISPR complex between the CRISPR nuclease, RNA molecule, and tracrRNA molecule.

[0298] The terms "protein-binding sequence" or "nuclease-binding sequence" refer to sequences that can bind to CRISPR nucleases to form CRISPR complexes. Those skilled in the art will understand that tracrRNAs capable of binding to CRISPR nucleases to form CRISPR complexes contain protein or nuclease-binding sequences.

[0299] The "RNA-binding portion" of a CRISPR nuclease refers to the part of the CRISPR nuclease that can bind to an RNA molecule and form a CRISPR complex, for example, the nuclease-binding sequence of a tracrRNA molecule. The "active portion" of a CRISPR nuclease refers to the part of the CRISPR nuclease that, for example, forms a complex with a DNA-targeting RNA molecule and performs double-strand breaks on the DNA molecule.

[0300] The RNA molecule may contain a sequence that is sufficiently complementary to the tracrRNA molecule so as to hybridize to tracrRNA by base pairing and promote the formation of the CRISPR complex (e.g., U.S. Patent No. 8,906,616). In an embodiment of the present invention, the RNA molecule may further contain a tracrmate sequence.

[0301] In embodiments of the present invention, the targeting molecule may further comprise a sequence of a tracrRNA molecule. Such embodiments may be designed as a synthetic fusion of a guide portion (gRNA or crRNA) of an RNA molecule and a transactivating crRNA (tracrRNA), together forming a single guide RNA (sgRNA) (see Jinek et al., Science (2012)). Embodiments of the present invention may also form a CRISPR complex using a separate tracrRNA molecule and a separate RNA molecule containing a guide sequence. In such embodiments, the tracrRNA molecule may hybridize with the RNA molecule by base pairing, which may be advantageous in the specific applications of the present invention described in the specification.

[0302] In embodiments of the present invention, the RNA molecule may include a "nexus" region and / or a "hairpin" region that may further specify the structure of the RNA molecule (see Briner et al., Molecular Cell (2014)).

[0303] In this specification, the term “direct repeat sequence” refers to two or more repeats of a specific amino acid sequence within a nucleotide sequence.

[0304] In this specification, an RNA sequence or molecule that can “interact with” or “bind to” a CRISPR nuclease refers to the ability of an RNA sequence or molecule to form a CRISPR complex with a CRISPR nuclease.

[0305] In this specification, the term “operably linked” refers to a relationship between two sequences or molecules (i.e., fusion, hybridization) that enables them to function in the intended manner. In embodiments of the present invention, when an RNA molecule is operably linked to a promoter, the RNA molecule and the promoter can function in the intended manner.

[0306] In this specification, the term "heterogeneous promoter" refers to a promoter that is not found in nature together with the molecule or pathway being promoted.

[0307] In this specification, a sequence or molecule has X% "sequence identity" with respect to each other if X% of the bases or amino acids between the sequences of a molecule are the same and in the same relative positions. For example, a first nucleotide sequence that has at least 95% sequence identity with a second nucleotide sequence has at least 95% of the bases in the same relative positions as the other sequence.

[0308] nuclear localization sequence The terms "nuclear localization sequence" and "NLS" are used interchangeably to refer to an amino acid sequence / peptide that directs the transport of an associated protein from the cytoplasm of a cell across the nuclear membrane barrier. The term "NLS" is intended to encompass not only the nuclear localization sequence of a particular peptide, but also its derivatives that can direct the translocation of cytoplasmic polypeptides across the nuclear membrane barrier. An NLS can direct the nuclear translocation of a polypeptide if it is attached to the N-terminus, C-terminus, or both. Furthermore, polypeptides with NLSs attached at the N-terminus or C-terminus to the side chains of randomly located amino acids in the polypeptide's amino acid sequence will translocate. Typically, an NLS consists of one or more short sequences of positively charged lysine or arginine exposed on the protein surface, although other types of NLSs are also known. Non-exclusive examples of NLS include SV40 virus large T antigen, nucleoplasmin, c-myc, hRNPA1 M9 NLS, importin α-derived IBB domain, myoma T protein, human p53, mouse c-abl IV, influenza virus NS1, hepatitis virus δ antigen, mouse Mx1 protein, human poly(ADP-ribose) polymerase, and steroid hormone receptor (human) glucocorticoid-derived NLS sequences.

[0309] delivery The CRISPR nucleases or CRISPR compositions of this application may be delivered as proteins, DNA molecules, RNA molecules, ribonucleoproteins (RNPs), nucleic acid vectors, or combinations thereof. In some embodiments, the RNA molecules include chemical modifications. Non-limiting examples of suitable chemical modifications include 2'-O-methyl (M), 2'-O-methyl-3'-phosphorothioate (MS), or 2'-O-methyl-3'-thioPACE (MSP), pseudouridine, and 1-methylpseudridine. The feasibility of each is described in separate embodiments.

[0310] The CRISPR nuclease and / or the polynucleotide encoding it, and optionally additional proteins (e.g., ZFPs, TALENs, transcription factors, restriction enzymes) and / or nucleotide molecules such as guide RNA, may be delivered to target cells by appropriate means. Target cells may be any cells, such as eukaryotic or prokaryotic cells, isolated or unisolated, in culture, or in any environment such as in vitro, ex vivo, in vivo, or in planta.

[0311] In some embodiments, the delivered composition comprises nuclease mRNA and guide RNA. In some embodiments, the delivered composition comprises nuclease mRNA, guide RNA and a donor template. In some embodiments, the delivered composition comprises CRISPR nuclease and guide RNA. In some embodiments, the delivered composition comprises CRISPR nuclease, guide RNA and a donor template for gene editing, for example, by homology repair. In some embodiments, the delivered composition comprises nuclease mRNA, DNA targeting RNA and tracrRNA. In some embodiments, the delivered composition comprises nuclease mRNA, DNA targeting RNA, tracrRNA and a donor template. In some embodiments, the delivered composition comprises CRISPR nuclease, DNA targeting RNA and tracrRNA. In some embodiments, the delivered composition comprises CRISPR nuclease, DNA targeting RNA, tracrRNA and a donor template for gene editing, for example, by homology repair.

[0312] RNA compositions can be delivered using appropriate viral vector systems. Nucleic acids and / or CRISPR nucleases can be introduced into cells (e.g., mammalian cells, plant cells, etc.) and target tissues using conventional viral and nonviral-based gene transfer methods. Such methods can also be used to administer in vitro encoded nucleic acids and / or CRISPR nuclease proteins to cells. In certain embodiments, nucleic acids and / or CRISPR nucleases are administered for gene therapy in vivo or ex vivo. Nonviral vector delivery systems include naked nucleic acids and nucleic acids complexed with a delivery vehicle such as a liposome or poloxamer. For a review of gene therapy procedures, see Anderson, Science (1992); Nabel and Felgner, TIBTECH (1993); Mitani and Caskey, TIBTECH (1993); Dillon, TIBTECH (1993); Miller, Nature (1992); Van Brunt, Biotechnology (1988); Vigne et al., Restorative Neurology and Neuroscience 8:35-36 (1995); Kremer and Perricaudet, British Medical Bulletin (1995); Haddada et al., Current Topics in Microbiology and Immunology (1995); and Yu et al., Gene Therapy 1:13-26 (1994).

[0313] Nonviral delivery methods for nucleic acids and / or proteins include electroporation, lipofection, microinjection, bioristics, particle gun acceleration, virosomes, liposomes, immunoliposomes, polycations or lipids: nucleic acid conjugates, artificial virions, and drug-assisted uptake of nucleic acids, or delivery to plant cells by bacteria or viruses (e.g., Agrobacterium, Rhizobium sp. NGR234, Sinorhizoboium meliloti, Mesorhizobium loti, tobacco mosaic virus, potato virus X, cauliflower mosaic virus, cassava vein mosaic virus). See, for example, Chung et al. Trends Plant Sci. (2006). For example, sonoporation using the Sonitron 2000 system (Rich-Mar) can also be used for nucleic acid delivery. Cationic lipid-mediated delivery of proteins and / or nucleic acids is also being investigated as an in vivo or in vitro delivery method. See Zuris et al., Nat. Biotechnol. (2015); Coelho et al., N. Engl. J. Med. (2013); Judge et al., Mol. Ther. (2006) and Basha et al., Mol. Ther. (2011).

[0314] Other representative nucleic acid delivery systems include those offered by Amaxa® Biosystems (Cologne, Germany), Maxcyte, Inc. (Rockville, Md.), BTX Molecular Delivery Systems (Holliston, Mass.), and Copernicus Therapeutics Inc. (see, for example, U.S. Patent No. 6,008,336). Lipofectins are described, for example, in U.S. Patents No. 5,049,386, 4,946,787, and 4,897,355, and lipofection reagents are commercially available (e.g., Transfectam®, Lipofectin®, and Lipofectamine® RNAiMAX). Cationic and neutral lipids suitable for efficient receptor recognition lipofection of polynucleotides include those disclosed in PCT International Publications 1991 / 017424 and 1991 / 016024. It can be delivered to cells (ex vivo administration) or target tissues (in vivo administration).

[0315] The preparation of lipid:nucleic acid complexes, including target liposomes such as immunolipid complexes, is widely known to those skilled in the art (see, for example, Crystal, Science (1995); Blaese et al., Cancer Gene Ther. (1995); Behr et al., Bioconjugate Chem. (1994); Remy et al., Bioconjugate Chem. (1994); Gao and Huang, Gene Therapy (1995); Ahmad and Allen, Cancer Res., (1992); U.S. Patents No. 4,186,183; No. 4,217,344; No. 4,235,871; No. 4,261,975; No. 4,485,054; No. 4,501,728; No. 4,774,085; No. 4,837,028 and No. 4,946,787).

[0316] Another delivery method involves packaging nucleic acids to be delivered via an EnGeneIC delivery vehicle (EDV). The EDV is specifically delivered to the target tissue using a bispecific antibody, where one arm of the antibody is specific to the target tissue and the other arm is specific to the EDV. The antibody carries the EDV to the surface of the target cell, where it is then transported into the cell by endocytosis. Upon entering the cell, the contents are released (see MacDiamid et al., Nature Biotechnology (2009)).

[0317] The use of RNA or DNA virus-based systems for nucleic acid delivery utilizes highly evolved methods to target viruses to specific cells in the body and deliver the viral payload to the nucleus. Viral vectors can be administered directly to patients (in vivo) or used to process cells in vitro to deliver modified cells to patients (ex vivo). RNA or DNA virus-based systems for nucleic acid delivery include, but are not limited to, recombinant retrovirus, lentivirus, adenovirus, adeno-associated virus, vaccinia virus, and herpes simplex virus vectors for gene transfer. However, RNA viruses are preferred for the delivery of the RNA composition of this application. Furthermore, high transduction efficiency has been observed in various cells and target tissues. The nucleic acids of the present invention may also be delivered by non-integrated lentiviruses. If necessary, RNA delivery by lentivirus is utilized. In some cases, the lentivirus includes nuclease mRNA and guide RNA. In some cases, the lentivirus includes nuclease mRNA, guide RNA, and a donor template. In some cases, the lentivirus contains a nuclease protein and guide RNA. In some cases, the lentivirus contains a nuclease protein, guide RNA, and / or a donor template for gene editing, for example, by homologous repair. In some cases, the lentivirus contains nuclease mRNA, DNA targeting RNA, and tracrRNA. In some cases, the lentivirus contains nuclease mRNA, DNA targeting RNA, tracrRNA, and a donor template. In some cases, the lentivirus contains a nuclease protein, DNA targeting RNA, and tracrRNA. In some cases, the lentivirus contains a nuclease protein, DNA targeting RNA, tracrRNA, and a donor template for gene editing, for example, by homologous repair.

[0318] As previously stated, the compositions of the present application can be delivered to target cells using non-embedded lentiviral particle methods (e.g., LentiFlash® systems). Such methods may be used to deliver mRNA or other RNA to target cells such that the delivery of RNA to the target cells results in the assembly of the compositions of the present application within the target cells. See also PCT International Publications 2013 / 014537, 2014 / 016690, 2016 / 185125, 2017 / 194902 and 2017 / 194903.

[0319] Retroviral tropism can be modified by incorporating foreign envelope proteins, expanding the potential targeting of target cells. Lentiviral vectors are retroviral vectors that can transduce or infect non-dividing cells, typically producing high viral titers. The choice of retroviral gene transduction system depends on the target tissue. Retroviral vectors consist of cis-acting long terminal repeat sequences that can package foreign sequences up to 6–10 kb. A minimal cis-acting LTR is sufficient for vector replication and packaging, after which the therapeutic gene is incorporated into target cells to provide permanent transgene expression. Widely used retroviral vectors include those based on mouse leukemia virus (MuLV), gibbon leukemia virus (GaLV), simian immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations thereof (see, for example, Buchscher Panganiban, J. Virol. (1992); Johann et al., J. Virol. (1992); Sommerfelt et al., Virol. (1990); Wilson et al., J. Virol. (1989); Miller et al., J. Virol. (1991); and PCT International Publication No. 1994 / 026877(A1)).

[0320] In clinical trials, at least six viral vector methods are currently available for gene transfer, and transduction agents are produced using methods that include supplementing defective vectors with genes inserted into helper cell lines.

[0321] pLASN and MFG-S are examples of retroviral vectors used in clinical trials (Dunbar et al., Blood (1995); Kohn et al., Nat. Med. (1995); Malech et al., PNAS (1997)). PA317 / pLASN was the first therapeutic vector used in gene therapy (Blaese et al., Science (1995)). Transduction efficiencies of over 50% have been observed with MFG-S packaged vectors (Ellem et al., Immunol Immunother. (1997); Dranoff et al., Hum. Gene Ther. (1997)).

[0322] The cells used for packaging are those that form viral particles capable of infecting host cells. Such cells include 293 cells for packaging adenovirus AAV, and psi.2 or PA317 cells for packaging retroviruses. Viral vectors used in gene therapy are typically obtained by producer cell lines that package nucleic acid vectors into viral particles. The vector usually contains the minimum viral sequence necessary for packaging and subsequent integration into the host (if applicable), and other viral sequences that are replaced by an expression cassette encoding the protein to be expressed. Missing viral functions are supplied trans by the packaging cell line. For example, AAV vectors used in gene therapy typically contain only the terminal reverse repeat (ITR) sequence of the AAV genome necessary for packaging and integration into the host genome. The viral DNA is packaged into a cell line containing other AAV genes, namely rep and cap, but lacking the ITR sequence. The cell line is also infected with adenovirus as a helper. The helper virus facilitates the replication of the AAV vector and the expression of the AAV gene from the helper plasmid. Helper plasmids are not packaged in large quantities because they lack an ITR sequence. Adenovirus contamination can be reduced, for example, by heat treatment, which makes the adenovirus more susceptible than AAV. Furthermore, AAV can be produced on a clinical scale using baculovirus systems (see U.S. Patent No. 7,479,554).

[0323] In many gene therapies, it is desirable that gene therapy vectors be delivered to specific tissues with high specificity. Therefore, viral vectors can be modified to be specific to target cells by expressing ligands as fusion proteins with viral coat proteins on the outer surface of the virus. The ligands are selected to have affinity for receptors known to be present on the target cells. For example, Han et al., Proc. Natl. Acad. Sci. USA (1995) reported that Moloney mouse leukemia virus could be modified to express human heregurin fused to gp70, and that the recombinant virus infected specific human breast cancer cells expressing the human epidermal growth factor receptor. This principle can be extended to other virus-target cell pairs where the target cell expresses the receptor and the virus expresses a fusion protein containing the ligand for the cell surface receptor. For example, filamentous phages can be modified to present antibody fragments (e.g., FAB or Fv) with specific binding affinity to virtually any cell receptor. While this explanation primarily applies to viral vectors, the same principles can be applied to non-viral vectors. Such vectors can be modified to include uptake sequences that promote uptake by specific target cells.

[0324] Gene therapy vectors can typically be delivered in vivo to individual patients by systemic administration (e.g., intravenous, intraperitoneal, intramuscular, subcutaneous, or intracranial injection) or topical application, as described below. Alternatively, the vectors can be delivered ex vivo to cells transplanted from individual patients (e.g., lymphocytes, bone marrow aspirate, biopsy tissue) or hematopoietic stem cells from universal donors, which are then usually re-transplanted into the patient after selection of the vector-containing cells. In some embodiments, in vivo and ex vivo delivery of mRNA, as well as delivery of RNPs, may be utilized.

[0325] Ex vivo cell transfection for diagnostic, research, or gene therapy (e.g., by reinjection of transfected cells into a host organism) is well known to those skilled in the art. In a preferred embodiment, cells are isolated from a target organism, transfected with an RNA composition, and reinjected into the target organism (e.g., a patient). Various cells suitable for ex vivo transfection are well known to those skilled in the art (see, for example, Freshney, “Culture of Animal Cells, A Manual of Basic Technique and Specialized Applications (6th edition, 2010)” and the literature cited therein that discusses methods for isolating and culturing cells from a patient).

[0326] Suitable cells include, but are not limited to, eukaryotic and prokaryotic cells and / or cell lines. Non-limiting examples of such cells or cell lines derived from such cells include COS, CHO (e.g., CHO-S, CHO-K1, CHO-DG44, CHO-DUXB11, CHO-DUKX, CHOK1SV), VERO, MDCK, WI38, V79, B14AF28-G3, BHK, HaK, NSO, SP2 / 0-Ag14, HeLa, HEK293 (e.g., HEK293-F, HEK293-H, HEK293-T), and perC6 cells, any plant cells (differentiated or undifferentiated), as well as insect cells such as Spodoptera fugifera (Sf), or fungal cells such as Saccharomyces, Pichia, and Chizosaccharomyces. In some embodiments, the cell line is the CHO-K1, MDCK, or HEK293 cell line. Furthermore, primary cells may be isolated and treated with a nuclease (e.g., ZFN or TALEN) or a nuclease system (e.g., CRISPR) before being used ex vivo for reintroduction into the therapeutic target. Suitable primary cells include peripheral blood mononuclear cells (PBMCs) and subsets of hematopoietic cells such as, but not limited to, CD4+ T cells or CD8+ T cells. Suitable cells also include stem cells such as embryonic stem cells, induced pluripotent stem cells, hematopoietic stem cells (CD34+), neural stem cells, and mesenchymal stem cells.

[0327] In some embodiments, stem cells are used in cell transfection and ex vivo procedures for gene therapy. The advantages of using stem cells include their ability to differentiate into other cell types in vitro or to be introduced into mammals that engraft in bone marrow (such as cell donors). Methods are known to differentiate CD34+ cells into clinically important immune cell types in vitro using cytokines such as GM-CSF, IFN-γ, and TNF-α (see Inaba et al., J. Exp. Med. (1992) for a non-limiting example).

[0328] Stem cells are isolated for transduction and differentiation by known methods. For example, stem cells can be isolated from bone marrow cells by panning them with antibodies that bind to unwanted cells such as CD4+ and CD8+ (T cells), CD45+ (pan B cells), GR-1 (granulocytes), and Iad (differentiated antigen-presenting cells) (see Inaba et al., J. Exp. Med. (1992) for a non-limiting example). In some embodiments, modified stem cells can also be used.

[0329] In particular, the CRISPR nucleases of the present invention may be suitable for genome editing of postmittal cells or cells that are not actively dividing (e.g., arrest cells). Examples of postmittal cells that may be edited using the CRISPR nucleases of the present invention include, but are not limited to, muscle cells, cardiomyocytes, hepatocytes, osteocytes, and neurons.

[0330] Vectors containing therapeutic RNA compositions (e.g., retroviruses, liposomes, etc.) can also be administered directly to organisms for in vivo cell transduction. Alternatively, naked RNA or mRNA can be administered. Administration may include, but is not limited to, injection, infusion, topical application, and electroporation, which are commonly used to introduce molecules into blood or tissue cells. While suitable methods for administering such nucleic acids are available and well known to those skilled in the art, and multiple routes for administering a particular composition may be usable, in many cases, a particular route yields a faster and more effective response than others.

[0331] Vectors suitable for introducing transgenes into immune cells (e.g., T cells) include non-integrated lentiviral vectors. See, for example, U.S. Patent Application Publication 2009 / 0117617.

[0332] The pharmaceutically acceptable carrier is determined in part by the composition being administered and the method used to administer the composition. Therefore, there is a wide variety of suitable formulations of available pharmaceutical compositions; see, for example, Remington's Pharmaceutical Sciences, 17th ed., 1989.

[0333] Homologous recombination-mediated DNA repair The term “homologous recombination repair” or “HDR” refers to a mechanism for repairing intracellular DNA damage, such as during the repair of double-strand and single-strand breaks in DNA. HDR requires homology of nucleotide sequences and uses a “nucleic acid template” (nucleic acid template or donor template as used synonymously in this specification) to repair a sequence (e.g., a DNA target sequence) where a double-strand or single-strand break has occurred. This results in, for example, the transfer of genetic information from the nucleic acid template to the DNA target sequence. If the nucleic acid template sequence differs from the DNA target sequence, and some or all of the nucleic acid template polynucleotide or oligonucleotide is incorporated into the DNA target sequence, HDR may lead to alteration of the DNA target sequence (e.g., insertions, deletions, mutations). In some embodiments, all or part of the nucleic acid template polynucleotide, or a copy of the nucleic acid template, is incorporated into a site in the DNA target sequence.

[0334] The terms “nucleic acid template” and “donor” refer to nucleotide sequences that are inserted into or copied into the genome. A nucleic acid template includes, for example, a sequence of one or more nucleotides that may be added to a target nucleic acid, use a change in the target nucleic acid as a template, or use to modify the target sequence. The length of the nucleic acid template sequence is arbitrary, for example, 2 to 10,000 nucleotides (or any integer between or greater than that), preferably about 100 to 1,000 nucleotides (or any integer between that), more preferably about 200 to 500 nucleotides. The nucleic acid template may be a single-stranded nucleic acid or a double-stranded nucleic acid. In some embodiments, the nucleic acid template includes, for example, a sequence of one or more nucleotides corresponding to the wild-type sequence of the target nucleic acid at the target position. In some embodiments, the nucleic acid template includes, for example, a sequence of one or more ribonucleotides corresponding to the wild-type sequence of the target nucleic acid at the target position. In some embodiments, the nucleic acid template includes modified ribonucleotides.

[0335] For example, insertion of an exogenous sequence (also called a "donor sequence," "donor template," or "donor") can be performed to correct a mutated gene or increase the expression of a wild-type gene. It is readily apparent that a donor sequence is usually not identical to the genomic sequence in which it is placed. A donor sequence may contain non-homologous sequences with two homologous regions adjacent to each other to enable efficient HDR at the target site. Furthermore, a donor sequence may contain a vector molecule containing a sequence that is not homologous to the target region in cellular chromatin. A donor molecule may contain discontinuous regions homologous to cellular chromatin. For example, to target insertion of a sequence that is not normally present in the target region, the sequence may be present in the donor nucleic acid molecule and may be adjacent to a region homologous to the sequence in the target region.

[0336] The donor polynucleotide may be single-stranded and / or double-stranded DNA or RNA, and may be introduced into cells in a linear or circular form. See, for example, U.S. Patent Application Publications 2010 / 0047805; 2011 / 0281361; 2011 / 0207221 and 2019 / 0330620. When introduced in a linear form, the ends of the donor sequence can be protected (e.g., from degradation by exonucleases) in a manner known to those skilled in the art. For example, by adding one or more dideoxynucleotide residues to the 3' end of the linear molecule and / or by ligating a self-complementary oligonucleotide to one or both ends. See, for example, Chang and Wilson, Proc. Natl. Acad. Sci. USA (1987); Nehls et al., Science (1996). Other methods for protecting exogenous polynucleotides from degradation include, but are not limited to, the addition of terminal amino groups and the use of modified nucleotide bonds (e.g., phosphorothioates, phosphoramidates, and O-methylribose or deoxyribose residues).

[0337] Accordingly, embodiments of the present invention that use a donor template for repair may use DNA or RNA, which are single-stranded and / or double-stranded donor templates that can be introduced into cells in a linear or circular form. In embodiments of the present invention, the gene editing composition comprises (1) an RNA molecule containing a guide sequence that breaks the gene in double strands before repair, and (2) a donor RNA template for repair, wherein the RNA molecule containing the guide sequence is a first RNA molecule and the donor RNA template is a second RNA molecule. In some embodiments, the guide RNA molecule and the template RNA molecule are linked together as part of a single molecule.

[0338] The donor sequence may be an oligonucleotide and may be used for gene modification or modification by targeting an endogenous sequence. The oligonucleotide may be introduced into cells by a vector, by electroporation, or by other methods known in the art. The oligonucleotide may be used for "correction" of a mutant sequence of an endogenous gene (e.g., a sickle mutation in betaglobin) or for insertion of a sequence into an endogenous gene locus for a desired purpose.

[0339] Polynucleotides can be introduced into cells as part of a vector molecule containing additional sequences, such as genes encoding origins of replication, promoters, and antibiotic resistance. Furthermore, donor polynucleotides can be introduced as naked nucleic acids, as nucleic acids complexed with drugs such as liposomes or poloxamers, or delivered by recombinant viruses (e.g., adenoviruses, AAVs, herpesviruses, retroviruses, lentiviruses, and integrase-deficient lentiviruses (IDLVs)).

[0340] Generally, donors are inserted so that their expression is driven by the endogenous promoter of the integration site, i.e., the promoter that drives the expression of the endogenous gene into which the donor is inserted. However, it is clear that donors may also include promoters and / or enhancers, such as constitutive promoters or inducible or tissue-specific promoters.

[0341] The donor molecule may be inserted into an endogenous gene so that all or part of the endogenous gene is expressed, or so that it is not expressed at all. For example, the transgene of this invention may be inserted into an endogenous locus, for example, as a fusion with the transgene, so that part of the endogenous sequence (the N-terminus and / or C-terminus of the transgene) is expressed, or so that it is not expressed at all. In other embodiments, the transgene (with or without additional coding sequences, e.g., endogenous genes) is incorporated into any endogenous locus, such as a safe harbor locus (e.g., the CCR5 gene, CXCR4 gene, PPP1R12c (also known as AAVS1) gene, albumin gene, or Rosa gene). See, for example, U.S. Patent Nos. 7,951,925 and 8,110,379; U.S. Patent Application Publications 2008 / 0159996; 20100 / 0218264; 2010 / 0291048; 2012 / 0017290; 2011 / 0265198; 2013 / 0137104; 2013 / 0122591; 2013 / 0177983 and 2013 / 0177960, and U.S. Provisional Patent Application No. 61 / 823,689.

[0342] When an endogenous sequence (either endogenous or a portion of a transgene) is expressed together with a transgene, the endogenous sequence may be a full-length sequence (wild-type or mutant) or a partial sequence. Preferably, the endogenous sequence is functional. Non-limiting examples of the function of these full-length or partial sequences include increasing the half-life of a polypeptide expressed and / or acting as a carrier by the transgene (e.g., a therapeutic gene).

[0343] Furthermore, although not essential for expression, the exogenous sequence may also include transcriptional or translational regulatory sequences, such as promoters, enhancers, insulators, internal ribosome entry sites, sequences encoding the 2A peptide, and / or polyadenylation signals.

[0344] In one embodiment, the donor molecule includes a sequence selected from the group consisting of a protein-coding gene (a coding sequence that codes for a protein that is missing in the cell or organism, or another version of a protein-coding gene), a regulatory sequence, and / or a sequence that codes for a structural nucleic acid such as microRNA or siRNA.

[0345] The embodiments described herein are intended to be mutually applicable. For example, it is understood that any RNA molecule or composition of the present invention may be used in any manner of the present invention.

[0346] In this specification, all headings are for organizational purposes only and are not intended to restrict disclosure in any way. The content of each section applies equally to all sections.

[0347] Additional objectives, advantages, and novel features of the present invention will become apparent to those skilled in the art by considering the following examples, which are not intended to be limiting. Furthermore, each of the various aspects and features of the present invention described herein and claimed herein is experimentally supported in the following examples.

[0348] For clarity, it should be understood that features of the present invention described as separate embodiments may be provided in combination in a single embodiment. Conversely, for brevity, various features of the present invention described as a single embodiment may be provided separately, as appropriate subcombinations, or appropriately in other embodiments of the present invention. Unless the embodiment would not function without those elements, specific features described as different embodiments should not be considered essential features of those embodiments.

[0349] In general, the nomenclature used in this specification and the experimental procedures utilized in this invention include molecular, biochemical, microbiological, and recombinant DNA techniques. Such techniques are well described in the literature. For example, Sambrook et al., "Molecular Cloning: A Laboratory Manual" (1989); Ausubel, RM (Ed.), "Current Protocols in Molecular Biology" Volumes I-III (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (Eds.), "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New York. (1998); Methods described in U.S. Patent Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; Cellis, JE (Ed.), "Cell Biology: A Laboratory Handbook", Volumes I-III (1994); Freshney, "Culture of Animal Cells - A Manual of Basic Technique" Third Edition, Wiley-Liss, NY (1994); Coligan, JE (Ed.), "Current Protocols in Immunology" Volumes I-III (1994); Stites et al. (Eds.See also "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (Eds.), "Strategies for Protein Purification and Characterization - A Laboratory Course Manual" CSHL Press (1996); Clokie and Kropinski (Eds.), "Bacteriophage Methods and Protocols", Volume 1: Isolation, Characterization, and Interactions (2009). All of these are incorporated by reference. Other general reference materials are provided throughout this specification.

[0350] To facilitate a complete understanding of the present invention, examples are provided below. The following examples illustrate typical ways in which the present invention is manufactured and carried out. However, the scope of this invention is not limited to the specific embodiments disclosed in these examples, and they are for illustrative purposes only. [Examples]

[0351] To facilitate a more complete understanding of the present invention, examples are provided below. The following examples illustrate exemplary modes of giving rise to and carrying out the present invention. However, the scope of the present invention is not limited to the specific embodiments disclosed in these examples, and they are for illustrative purposes only.

[0352] CRISPR repeats (crRNA), transactivating crRNA (tracrRNA), nuclease polypeptides, and PAM sequences were predicted from various metagenomic databases of environmental samples. Table 1 lists the bacterial species / strains for which CRISPR repeats, tracRNA sequences, and nuclease polypeptide sequences were predicted.

[0353] Construction of OMNI nuclease polypeptide To construct OMNI nuclease polypeptides, open reading frames (ORFs) of several OMNI nucleases (OMNI) were codon-optimized for expression in human cell lines. The ORFs were cloned into the bacterial plasmid pb-NNC and the mammalian plasmid pmOMNI (Table 4).

[0354] sgRNA prediction and construction For each OMNI, sgRNA was predicted by detecting CRISPR repeat sequences (crRNA) and trans-activated crRNA (tracrRNA) in the respective bacterial genome. In silico, native, immature crRNA and tracrRNA sequences were concatenated with the tetraloop "gaaa," and the duplex secondary structure elements were predicted using an RNA secondary structure prediction tool.

[0355] The predicted secondary structures of the entire duplex RNA element (crRNA-tracrRNA chimera) were used to identify possible tracr sequences for the design of sgRNAs with various versions of each OMNI nuclease. By shortening the duplex of the upper stem at different positions, the crRNA and tracrRNA were linked to a tetraloop "gaaa" to generate possible sgRNA scaffolds (sgRNA designs for all OMNIs are shown in Table 2). For each OMNI, at least two versions of the designable scaffold were synthesized, ligated downstream with a 22nt universal and unique spacer sequence (T2, SEQ ID NO: 41), and cloned into bacterial expression plasmids under a constitutive promoter and mammalian expression plasmids under a U6 promoter (pbSGR2 and pmGuide, respectively, Table 4).

[0356] To overcome transcriptional and structural constraints and evaluate the plasticity of sgRNA scaffolds in human cells, several types of sgRNAs were tested. In all cases, modifications represented slight changes in the nucleotide sequence of the possible sgRNAs (Figure 1C, Table 2). T1 - GGTGCGGTTCACCAGGGTGTCG (Sequence ID 241) T2 - GGAAGAGCAGAGCCTTGGTCTC (Sequence ID 242)

[0357] TXTL-based in vitro depletion assay In vitro PAM sequence depletion was tracked using the method described in Maxwell et al, Methods. 2018. Briefly, linear DNA expressing OMNI nuclease and sgRNA under a T7 promoter were added to a TXTL mix along with a linear construct expressing T7 polymerase. RNA expression and protein translation in the TXTL mix formed an RNP complex. Because linear DNA was used, the RecBCD inhibitor Chi6 sequence was added to protect the DNA from degradation. The sgRNA spacer was designed to target a plasmid library containing a target protospacer (pbPOST2 library, Table 4) adjacent to an 8N randomized set of PAM sequences. PAM sequence depletion from the libraries was measured by high-throughput sequencing using PCR to add the necessary adapters and indices to both the cleaved library and a control library expressing non-target gRNA (T1). After deep sequencing, in vitro activity was confirmed by comparing the proportion of depleted sequences with the same PAM sequence to that of a control, using OMNI nuclease, which indicates functional DNA cleavage in an in vitro system (Figures 2A-2H, Table 3).

[0358] Nuclease expression in mammalian cells First, the expression of optimized DNA sequences encoding OMNI nucleases was verified in mammalian cells. For this purpose, Hek293T cells were introduced with an expression vector encoding HA-tagged OMNI nuclease linked to mCherry by a P2A peptide (pmOMNI, Table 4) or Streptococcus pyogenes Cas9 (SpCas9) using the Jet-optimus® transfection reagent (polyplus-transfection). The P2A peptide is a self-cleaving peptide that can induce the cleavage of recombinant proteins in cells, so that OMNI nucleases and mCherry are cleaved upon expression. mCherry serves as an indicator of the transcription efficiency of OMNI from the expression vector. Expression of all OMNI proteins was confirmed by Western blotting using an anti-HA antibody (Figure 3A).

[0359] Identification and activity of PAM in mammalian cells PAM sequence prioritization is considered a nuclease-specific characteristic, but it may be influenced to some extent by the cellular environment, genomic composition, and genome size. Given the significant differences between the human and bacterial cellular environments, a "fine-tuning" process was introduced to address potential differences in PAM prioritization in human cells. For this purpose, a PAM library was constructed in human cell lines. The PAM library was introduced into cells using viral vectors (see Table 4) as a specific target sequence followed by a 6N stretch. NGS analysis was used to identify edited sequences and their associated PAMs upon introduction of sgRNAs and OMNI targeting specific target sites in the library. Next, a PAM consensus was defined using the enhanced edited sequences. This method was applied to determine the optimized PAM requirements for OMNI nucleases in mammalian cells (Figure 3B, Table 3, "Mammalian Improvements"). The PAM for OMNI-79 is an NGG motif similar to the NGR PAM identified by TXTL.

[0360] Activity against endogenous genomic targets in human cells The ability of OMNI to facilitate editing at specific locations in the human genome was also assayed. For this purpose, for each OMNI, the corresponding OMNI-P2A-mCherry expression vector (pmOMNI, Table 4) was transfected into HeLa cells along with sgRNAs (pmGuide, Table 4) designed to target specific locations in the human genome. Cells were harvested after 72 hours. Half of the cells were used to quantify transfection efficiency by FACS using mCherry fluorescence as a marker. The remaining half of the cells were lysed, and their genomic DNA was used to PCR amplify the corresponding putative genomic targets. NGS was performed on the amplified products, and the percentage of editing at each target site was calculated using the resulting sequences. Short insertions or deletions (indels) around the cleavage sites are typical results of DNA end repair following nuclease-mediated DNA cleavage. Therefore, the percentage of editing was calculated from the percentage of indel-containing sequences in each amplified product.

[0361] The genomic activity of each OMNI was evaluated using a panel of 6–31 sgRNAs, each designed to target a different genomic location. The results of these experiments are summarized in Table 5. As can be seen from the table (column 6, indel percentage), some OMNIs showed significant editing levels compared to the negative control (column 9, editing percentage of the negative control) at multiple target sites tested. OMNI-59 and OMNI-67 showed significant editing levels at 1 / 6 of the tested sites, OMNI-79 showed significantly high editing levels with editing activity exceeding 5% at 19 / 31 of the tested sites, and OMNI-81 showed significantly high editing levels at 6 / 10 of the tested sites.

[0362] OMNI-79 activity associated with gRNA mutations Other gRNA molecules sharing the same repeat sequence as the OMNI-79 gRNA molecule were also identified. Specifically, two gRNA molecules were identified that share the repeat sequence and are predicted to form a similar structure (Figure 4A). The ability of OMNI-79 to function with these gRNA molecules was then tested by DNA targeting such complexes to several genomic locations. The OMNI-79 plasmid was transfected into HeLa cells with sgRNA molecules designed to target specific locations in the human genome (pmGuide, Table 4; spacer sequences, Table 5) designed on either a native scaffold (Novosphingobium sp. SYSU G00007 "WT") or another scaffold ("SpSaNXO2" or "SpSpCAP1"). Cells were harvested after 72 hours, and half of the cells were used to quantify transfection efficiency by FACS using mCherry fluorescence as a marker. The remaining cells were lysed, and their genomic DNA was subjected to PCR to amplify the corresponding putative genomic targets. Next-generation sequencing (NGS) was performed on the amplified products, and the percentage of editing at each target site was calculated using the obtained sequences. Short insertions or deletions (indels) around the cleavage sites are typical results of DNA end repair following nuclease-mediated DNA cleavage. Therefore, the percentage of editing was calculated from the percentage of indel-containing sequences within each amplified product.

[0363] As can be seen from Figure 4B, the editing level achieved by OMNI-79 using the SpSaNXO2 scaffold is comparable to the editing level obtained using the native gRNA molecule at all tested sites. The editing level achieved by OMNI-79 using the SpSpCAP1 gRNA molecule is reduced compared to the editing level obtained using the native gRNA molecule.

[0364] Activation of OMNI-79 by AAV delivery OMNI-79 was subcloned into the AAV packaging construct under the CMV promoter, along with gRNA molecules targeting ELANEg35, CXCR4, or serpin A s12, under the control of the U6 promoter between ITR components (Table 4). AAV particles were prepared by simultaneous transfection of all packaging component plasmids into HEK293 cells and particle purification (VectorBuilder).

[0365] HeLa cells were infected with AAV particles containing OMNI-79 and gRNA molecules at an MOI of 100,000 particles / cell in a 48-well plate. Cells were lysed after 72 hours, and PCR was performed on their genomic DNA to amplify the corresponding putative genomic target. NGS was performed on the amplified products, and the percentage of editing was calculated using the resulting sequences. As can be seen from Figure 5A, editing was observed at all tested sites. The level of editing using AAV delivery was higher at all three sites compared to DNA transfection (see Table 5).

[0366] Next, the editing efficiency of OMNI-79 by AAV delivery was tested in the HepG2 cell line, which is difficult to transfect. AAV particles were used to infect HepG2 cells at an MOI of 100,000 particles / cell in a 48-well plate, with or without the reversible proteasome inhibitor bortezomib (BTZ). Since serpin A s12 is designed to target the SNP site (rs6647), gRNA molecules targeting the ref sequence and gRNA molecules targeting the SNP sequence were tested. As can be seen from Figure 5B, editing of the serpin A s12 site in HepG2 is equivalent to the editing observed in HeLa cells. The addition of BTZ increased the amount of editing by 1.5 to 2 times.

[0367] Purification of OMNI-79 protein The OMNI-79 open reading frame was cloned into a bacterial expression plasmid (T7-NLS-OMNI-NLS-HA-His tag, pET9a, Table 4) and expressed in KRX cells (Promega). The cells were grown in growth medium Terrific Broth + 0.4% glycerin + 0.1% rhamnose + 0.05% glucose. Culture was carried out for 4 hours until the OD600nm value was 5-6, and the temperature was lowered to 18°C ​​16-20 hours before harvesting the cells and freezing them at -80°C. The cell paste was resuspended in lysis buffer (20mM Hepes, 1000mM NaCl, 50mM imidazole pH 7.5, 1mM TCEP) supplemented with EDTA-free complete protease inhibitor cocktail set III (Calbiochem). The cells were lysed using an MC Multi Shot (Constant Systems) French press. Cell disruption was measured by reducing the OD600nm to less than 10% of the initial level. Lysate clarification was performed using a LYNX6000 centrifuge (Thermo Scientific) at 45,000×g for 30 minutes at 4°C. The clear lysate was incubated with Ni Sepharose 6 Fast Flow resin (Cytiva). The resin was packed into a column and washed with washing buffer (20mM Hepes, 500mM NaCl, 50mM imidazole, pH 7.5, 1mM TCEP), and the OMNI protein was eluted with elution buffer (20mM Hepes, 200mM NaCl, 500mM imidazole, 1mM TCEP). The eluted samples were loaded into a pre-equalized HiTrap SP 5 ml (Cytiva) using AKTA Avant (Cytiva, 20 mM Hepes pH 7.5, 200 mM NaCl), and eluted using Buffer B (20 mM Hepes, 1000 mM NaCl pH 7.5) with a 0-100% linear gradient in a 20 column volume. The OMNI-79 nuclease fraction was pooled, concentrated, and loaded onto a Centricone (Amicon Ultra Ultra 15 50K, Merck) column.The concentrated OMNI-79 protein was further purified using SEC with 20 mM Hepes pH 7.5, 300 mM NaCl, and 10% glycerin in an AKTA Pure (Cytiva) equipped with a HiLoad 16 / 600 Superdex 200 pg-SEC. The fraction containing OMNI-79 protein was pooled, concentrated, and loaded onto a Centricon (Amicon Ultra ultra 15 50K, Merck) with final storage buffer of 20 mM Hepes pH 7.5, 300 mM NaCl, 10% glycerin, and 1 mM TCEP. The purified OMNI protein was concentrated to 10-20 mg / ml, filtered through SpinX (Merck), aliquoted, rapidly frozen in liquid nitrogen, and stored at -80°C.

[0368] Optimization of OMNI-79 spacers OMNI-79 sgRNA molecules with three 2'-O-methyl-3'-phosphorothioate groups (Agilent) at the 3' and 5' ends were synthesized. Activity assays of OMNI-79RNP with various spacer lengths (20-26 nucleotides) of guide 35 were performed (Figure 6B, Table 6). Briefly, 4 pmol of OMNI-79 nuclease and 6 pmol of synthetic guide were mixed. After incubation at room temperature for 10 minutes, the RNP complex was reacted with 100 ng of on-target template. Only spacers greater than 22 nucleotides showed cleavage of the on-target template. Furthermore, complete cleavage of the on-target template was observed with a spacer length of only 25 nucleotides. By using a 25-nucleotide spacer, we synthesized gRNA molecules with 2'-O-methyl-3'-phosphorothioate at the 3' and 5' ends and gRNA molecules without 2'-O-methyl-3'-phosphorothioate. Comparison of these two modifications revealed that this modification is important for achieving activity, likely due to its RNA protection effect.

[0369] Spacer length optimization was also tested in mammalian cells. RNPs were assembled by mixing 100 μM nuclease with 120 μM of synthetic guide molecules of various spacer lengths (20–26 nucleotides, Table 6) and 100 μM Cas9 electroporation enhancer (IDT). After incubation at room temperature for 10 minutes, the RNP complexes were mixed with 200,000 washed U2OS cells and electroporated using the Lonza SE Cell Line 4D-Nucleofector®X Kit and DN100 or programmed according to the manufacturer's instructions. Cells were lysed after 72 hours, and PCR was performed on their genomic DNA to amplify the corresponding putative genomic targets. NGS was performed on the amplified products, and the percentage of editing was calculated using the resulting sequences. As can be seen from Figure 6A and Table 6, the editing level of the 20-23 nucleotide spacer is low, the editing level of the 24 nucleotide spacer is moderate, and the editing level of the 25-26 nucleotide spacer is highest. From this point as well, it appears that the 2'-O-methyl-3'-phosphorothioate at the 3' and 5' ends is important for activity, probably for RNA protection.

[0370] [Table 1-1]

[0371] [Table 1-2]

[0372] [Table 2-1]

[0373] [Table 2-2]

[0374] [Table 2-3]

[0375] [Table 2-4]

[0376] [Table 3]

[0377] [Table 4]

[0378] [Table 5-1]

[0379] [Table 5-2]

[0380] [Table 5-3]

[0381] [Table 6]

[0382] References 1. Ahmad and Allen (1992) “Antibody-mediated Specific Binging and Cytotoxicity of Lipsome-entrapped Doxorubicin to Lung Cancer Cells in Vitro”, Cancer Research 52:4817-20. 2. Anderson (1992) “Human gene therapy”, Science 256:808-13. 3. Basha et al. (2011) “Influence of Cationic Lipid Composition on Gene Silencing Properties of Lipid Nanoparticle Formulations of siRNA in Antigen-Presenting Cells”, Mol. Ther. 19(12):2186-200. 4. Behr (1994) “Gene transfer with synthetic cationic amphiphiles: Prospects for gene therapy”, Bioconjuage Chem 5:382-89. 5. Blaese et al. (1995) “Vectors in cancer therapy: how will they deliver”, Cancer Gene Ther. 2:291-97. 6. Blaese et al. (1995) “T lympocyte-directed gene therapy for ADA-SCID: initial trial results after 4 years”, Science 270(5235):475-80. 7. Briner et al. (2014) “Guide RNA functional modules direct Cas9 activity and orthognality”, Molecular Cell 56:333-39. 8. Buchschacher and Panganiban (1992) “Human immunodeficiency virus vectors for inducible expression of foreign genes”, J. Virol. 66:2731-39. 9. Burstein et al. (2017) “New CRISPR-Cas systems from uncultivated microbes”, Nature 542:237-41. 10. Canver et al., (2015) "BCL11A enhancer dissection by Cas9-mediated in situ saturating mutagenesis", Nature Vol. 527, Pgs. 192-214. 11. Chang and Wilson (1987) “Modification of DNA ends can decrease end-joining relative to homologous recombination in mammalian cells”, Proc. Natl. Acad. Sci. USA 84:4959-4963. 12. Charlesworth et al. (2019) “Identification of preexisting adaptive immunity to Cas9 proteins in humans”, Nature Medicine, 25(2), 249. 13. Chung et al. (2006) “Agrobacterium is not alone: gene transfer to plants by viruses and other bacteria”, Trends Plant Sci. 11(1):1-4. 14. Coelho et al. (2013) “Safety and efficacy of RNAi therapy for transthyretin amyloidosis” N. Engl. J. Med. 369, 819-829. 15. Crystal (1995) “Transfer of genes to humans: early lessons and obstacles to success”, Science 270(5235):404-10. 16. Dillon (1993) “Regulation gene expression in gene therapy” Trends in Biotechnology 11(5):167-173. 17. Dranoff et al. (1997) “A phase I study of vaccination with autologous, irradiated melanoma cells engineered to secrete human granulocyte macrophage colony stimulating factor”, Hum. Gene Ther. 8(1):111-23. 18. Dunbar et al. (1995) “Retrovirally marked CD34-enriched peripheral blood and bone marrow cells contribute to long-term engraftment after autologous transplantation”, Blood 85:3048-57. 19. Ellem et al. (1997) “A case report: immune responses and clinical course of the first human use of ganulocyte / macrophage-colony-stimulating-factor-tranduced autologous melanoma cells for immunotherapy”, Cancer Immunol Immunother 44:10-20. 20. Gao and Huang (1995) “Cationic liposome-mediated gene transfer” Gene Ther. 2(10):710-22. 21. Haddada et al. (1995) “Gene Therapy Using Adenovirus Vectors”, in: The Molecular Repertoire of Adenoviruses III: Biology and Pathogenesis, ed. Doerfler and Boehm, pp. 297-306. 22. Han et al. (1995) “Ligand-directed retro-viral targeting of human breast cancer cells”, Proc. Natl. Acad. Sci. USA 92(21):9747-51. 23. Humbert et al., (2019) "Therapeutically relevant engraftment of a CRISPR-Cas9-edited HSC-enriched population with HbF reactivation in nonhuman primates", Sci. Trans. Med., Vol. 11, Pgs. 1-13. 24. Inaba et al. (1992) “Generation of large numbers of dendritic cells from mouse bone marrow cultures supplemented with granulocyte / macrophage colony-stimulating factor”, J Exp Med. 176(6):1693-702. 25. Jiang and Doudna (2017) “CRISPR-Cas9 Structures and Mechanisms”, Annual Review of Biophysics 46:505-29. 26. Jinek et al. (2012) “A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity”, Science 337(6096):816-21. 27. Johan et al. (1992) “GLVR1, a receptor for gibbon ape leukemia virus, is homologous to a phosphate permease of Neurospora crassa and is expressed at high levels in the brain and thymus”, J Virol 66(3):1635-40. 28. Judge et al. (2006) “Design of noninflammatory synthetic siRNA mediating potent gene silencing in vivo”, Mol Ther. 13(3):494-505. 29. Kohn et al. (1995) “Engraftment of gene-modified umbilical cord blood cells in neonates with adnosine deaminase deficiency”, Nature Medicine 1:1017-23. 30. Kremer and Perricaudet (1995) “Adenovirus and adeno-associated virus mediated gene transfer”, Br. Med. Bull. 51(1):31-44. 31. Macdiarmid et al. (2009) “Sequential treatment of drug-resistant tumors with targeted minicells containing siRNA or a cytotoxic drug”, Nat Biotehcnol. 27(7):643-51. 32. Malech et al. (1997) “Prolonged production of NADPH oxidase-corrected granulocyes after gene therapy of chronic granulomatous disease”, PNAS 94(22):12133-38. 33. Maxwell et al. (2018) “A detailed cell-free transcription-translation-based assay to decipher CRISPR protospacer adjacent motifs”, Methods 14348-57 34. Miller et al. (1991) “Construction and properties of retrovirus packaging cells based on gibbon ape leukemia virus”, J Virol. 65(5):2220-24. 35. Miller (1992) “Human gene therapy comes of age”, Nature 357:455-60. 36. Mir et al. (2019) “Type II-C CRISPR-Cas9 Biology, Mechanism and Application”, ACS Chem. Biol. 13(2):357-365. 37. Mitani and Caskey (1993) “Delivering therapeutic genes - matching approach and application”, Trends in Biotechnology 11(5):162-66. 38. Nabel and Felgner (1993) “Direct gene transfer for immunotherapy and immunization”, Trends in Biotechnology 11(5):211-15. 39. Nehls et al. (1996) “Two genetically separable steps in the differentiation of thymic epithelium” Science 272:886-889. 40. Nishimasu et al. “Crystal structure of Cas9 in complex with guide RNA and target DNA” (2014) Cell 156(5):935-49. 41. Nishimasu et al. (2015) “Crystal Structure of Staphylococcus aureus Cas9” Cell 162(5):1113-26. 42. Palermo et al. (2018) “Key role of the REC lobe during CRISPR-Cas9 activation by ‘sensing’, ‘regulating’, and ‘locking’ the catalytic HNH domain” Quarterly Reviews of Biophysics 51, e9, 1-11. 43. Remy et al. (1994) “Gene Transfer with a Series of Lipphilic DNA-Binding Molecules”, Bioconjugate Chem. 5(6):647-54. 44. Sentmanat et al. (2018) “A Survey of Validation Strategies for CRISPR-Cas9 Editing”, Scientific Reports 8:888, doi:10.1038 / s41598-018-19441-8. 45. Sommerfelt et al. (1990) “Localization of the receptor gene for type D simian retroviruses on human chromosome 19”, J. Virol. 64(12):6214-20. 46. Van Brunt (1988) “Molecular framing: transgenic animals as bioactors” Biotechnology 6:1149-54. 47. Vigne et al. (1995) “Third-generation adenovectors for gene therapy”, Restorative Neurology and Neuroscience 8(1,2): 35-36. 48. Wagner et al. (2019) “High prevalence of Streptococcus pyogenes Cas9-reactive T cells within the adult human population” Nature Medicine, 25(2), 242 49. Wilson et al. (1989) “Formation of infectious hybrid virion with gibbon ape leukemia virus and human T-cell leukemia virus retroviral envelope glycoproteins and the gag and pol proteins of Moloney murine leukemia virus”, J. Virol. 63:2374-78. 50. Yu et al. (1994) “Progress towards gene therapy for HIV infection”, Gene Ther. 1(1):13-26. 51. Zetsche et al. (2015) “Cpf1 is a single RNA-guided endonuclease of a class 2 CRIPSR-Cas system” Cell 163(3):759-71. 52. Zuris et al. (2015) “Cationic lipid-mediated delivery of proteins enables efficient protein based genome editing in vitro and in vivo” Nat Biotechnol. 33(1):73-80.

Claims

1. A non-natural composition comprising a CRISPR nuclease having at least 90% identity with an amino acid sequence selected from the group consisting of SEQ ID NOs. 5, 1-4, or 6-8, or a nucleic acid molecule having a sequence encoding the CRISPR nuclease.

2. The composition according to claim 1, further comprising one or more RNA molecules, or a DNA polynucleotide encoding any one of the one or more RNA molecules, wherein the one or more RNA molecules and the CRISPR nuclease are not found together in nature, and the one or more RNA molecules are configured to form a complex with the CRISPR nuclease and / or direct the complex to a target site.

3. The composition according to claim 2, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 5, and the at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 63 to 90.

4. The composition according to claim 3, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 5, and the at least one RNA molecule is a CRISPR RNA (crRNA) molecule comprising a guide sequence and a sequence selected from the group consisting of SEQ ID NOs: 63, 64, 71-73, and 81-83.

5. The composition according to claim 4, further comprising a trans-activated CRISPR RNA (tracrRNA) molecule containing a sequence represented by the group consisting of SEQ ID NOs. 65-69, 74-79, and 84-89.

6. The composition according to claim 2, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 5, and the at least one RNA molecule is a single guide RNA (sgRNA) molecule comprising a guide sequence and a sequence selected from the group consisting of SEQ ID NOs: 63 to 90.

7. The composition according to any one of claims 3 to 6, wherein the length of the guide sequence is 25 or 26 bases.

8. The composition according to any one of claims 3 to 7, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 5, and the CRISPR nuclease is a nickasase formed by the substitution of amino acids D8, E502, H735, or D738 in SEQ ID NO:

5.

9. The composition according to any one of claims 3 to 7, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 5, and the CRISPR nuclease is a nicasse formed by the substitution of the amino acids D586, H587, or N610 of SEQ ID NO:

5.

10. The composition according to any one of claims 3 to 7, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 5, and the CRISPR nuclease is a non-catalytic nuclease formed by the substitution of amino acids D8, E502, H735 or D738 of SEQ ID NO: 5, and the substitution of amino acids D586, H587 or N610 of SEQ ID NO:

5.

11. The composition according to any one of claims 3 to 10, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 5, and the CRISPR nuclease comprises a domain A having at least 90% identity with an amino acid sequence that has at least 90% sequence identity with amino acids 1 to 40 of SEQ ID NO:

5.

12. The composition according to any one of claims 3 to 11, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 5, and the CRISPR nuclease comprises a domain B comprising a sequence having at least 90% identity with an amino acid sequence having at least 90% sequence identity with amino acids 41 to 76 of SEQ ID NO:

5.

13. The composition according to any one of claims 3 to 12, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 5, and the CRISPR nuclease comprises a domain C having at least 90% identity with an amino acid sequence having at least 90% sequence identity with amino acids 77 to 228 of SEQ ID NO:

5.

14. The composition according to any one of claims 3 to 13, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 5, and the CRISPR nuclease comprises a domain D comprising a sequence having at least 90% identity with an amino acid sequence having at least 90% sequence identity with amino acids 229 to 446 of SEQ ID NO:

5.

15. The composition according to any one of claims 3 to 14, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 5, and the CRISPR nuclease comprises a domain E having at least 90% identity with an amino acid sequence having at least 90% sequence identity with amino acids 447 to 507 of SEQ ID NO:

5.

16. The composition according to any one of claims 3 to 15, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 5, and the CRISPR nuclease comprises a domain F having at least 90% identity with an amino acid sequence having at least 90% sequence identity with amino acids 539 to 648 of SEQ ID NO:

5.

17. The composition according to any one of claims 3 to 16, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 5, and the CRISPR nuclease comprises a domain G comprising a sequence having at least 90% identity with an amino acid sequence having at least 90% sequence identity with amino acids 655 to 822 of SEQ ID NO:

5.

18. The composition according to any one of claims 3 to 17, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 5, and the CRISPR nuclease comprises a domain H comprising a sequence having at least 90% identity with an amino acid sequence having at least 90% sequence identity with amino acids 823 to 921 of SEQ ID NO:

5.

19. The composition according to any one of claims 3 to 18, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 5, and the CRISPR nuclease comprises a domain I comprising a sequence having at least 90% identity with an amino acid sequence having at least 90% sequence identity with amino acids 922 to 1062 of SEQ ID NO:

5.

20. The composition according to claim 2, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 1, and the at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 25 to 29.

21. The composition according to claim 20, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 1, and the at least one RNA molecule is a CRISPR RNA (crRNA) molecule comprising a guide sequence and the sequence shown in SEQ ID NO:

25.

22. The composition according to claim 21, further comprising a trans-activated CRISPR RNA (tracrRNA) molecule containing a sequence represented by the group consisting of SEQ ID NOs. 26 to 28.

23. The composition according to claim 2, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 1, and the at least one RNA molecule is a single guide RNA (sgRNA) molecule comprising a guide sequence and a sequence selected from the group consisting of SEQ ID NOs: 25 to 29.

24. The composition according to any one of claims 20 to 23, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 1, and the CRISPR nuclease is a nickasase formed by the substitution of amino acids D24, E557, H785 or D788 in SEQ ID NO:

1.

25. The composition according to any one of claims 20 to 23, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 1, and the CRISPR nuclease is a nicasse formed by the substitution of amino acids E644, H645, or N668 in SEQ ID NO:

1.

26. The composition according to any one of claims 20 to 23, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 1, and the CRISPR nuclease is a non-catalytic nuclease formed by the substitution of amino acids D24, E557, H785 or D788 of SEQ ID NO: 1, and the substitution of amino acids E644, H645 or N668 of SEQ ID NO:

1.

27. The composition according to claim 2, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 2, and the at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 30 to 39.

28. The composition according to claim 27, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 2, and the at least one RNA molecule is a CRISPR RNA (crRNA) molecule comprising a guide sequence and a sequence selected from the group consisting of SEQ ID NOs: 30 to 32.

29. The composition according to claim 28, further comprising a trans-activated CRISPR RNA (tracrRNA) molecule containing a sequence represented by the group consisting of SEQ ID NOs. 33 to 38.

30. The composition according to claim 2, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 2, and the at least one RNA molecule is a single guide RNA (sgRNA) molecule comprising a guide sequence and a sequence selected from the group consisting of SEQ ID NOs: 30 to 39.

31. The composition according to any one of claims 27 to 30, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 2, and the CRISPR nuclease is a nickasase formed by the substitution of amino acids D19, E528, H750 or D753 in SEQ ID NO:

2.

32. The composition according to any one of claims 27 to 30, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 2, and the CRISPR nuclease is a nicasse formed by the substitution of amino acids D609, H610, or N633 of SEQ ID NO:

2.

33. The composition according to any one of claims 27 to 30, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 2, and the CRISPR nuclease is a non-catalytic nuclease formed by the substitution of amino acids D19, E528, H750 or D753 of SEQ ID NO: 2, and the substitution of amino acids D609, H610 or N633 of SEQ ID NO:

2.

34. The composition according to claim 2, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 3, and the at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 40 to 52.

35. The composition according to claim 34, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 3, and the at least one RNA molecule is a CRISPR RNA (crRNA) molecule comprising a guide sequence and a sequence selected from the group consisting of SEQ ID NOs: 40 to 43.

36. The composition according to claim 35, further comprising a trans-activated CRISPR RNA (tracrRNA) molecule containing a sequence represented by the group consisting of SEQ ID NOs: 44 to 51.

37. The composition according to claim 2, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 3, and the at least one RNA molecule is a single guide RNA (sgRNA) molecule comprising a guide sequence and a sequence selected from the group consisting of SEQ ID NOs: 40 to 52.

38. The composition according to any one of claims 34 to 37, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 3, and the CRISPR nuclease is a nickasase formed by the substitution of amino acids D8, E503, H729, or D732 in SEQ ID NO:

3.

39. The composition according to any one of claims 34 to 37, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 3, and the CRISPR nuclease is a nicasse formed by the substitution of amino acids E584, H585, or N607 in SEQ ID NO:

3.

40. The composition according to any one of claims 34 to 37, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 3, and the CRISPR nuclease is a non-catalyzed nuclease formed by the substitution of amino acids D8, E503, H729 or D732 in SEQ ID NO: 1 and the substitution of amino acids E584, H585 or N607 in SEQ ID NO:

3.

41. The composition according to claim 2, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 4, and the at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 53 to 62.

42. The composition according to claim 41, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 4, and the at least one RNA molecule is a CRISPR RNA (crRNA) molecule comprising a guide sequence and a sequence selected from the group consisting of SEQ ID NOs: 53 to 55.

43. The composition according to claim 42, further comprising a trans-activated CRISPR RNA (tracrRNA) molecule containing a sequence represented by the group consisting of SEQ ID NOs. 56 to 61.

44. The composition according to claim 2, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 4, and the at least one RNA molecule is a single guide RNA (sgRNA) molecule comprising a guide sequence and a sequence selected from the group consisting of SEQ ID NOs: 53 to 62.

45. The composition according to any one of claims 41 to 44, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 4, and the CRISPR nuclease is a nicasse formed by the substitution of the amino acids D12, E543, H770, or D773 in SEQ ID NO:

4.

46. The composition according to any one of claims 41 to 44, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 4, and the CRISPR nuclease is a nicasse formed by the substitution of amino acids E630, H631, or N654 of SEQ ID NO:

4.

47. The composition according to any one of claims 41 to 44, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 4, and the CRISPR nuclease is a non-catalytic nuclease formed by the substitution of amino acids D12, E543, H770 or D773 of SEQ ID NO: 4, and the substitution of amino acids E630, H631 or N654 of SEQ ID NO:

4.

48. The composition according to claim 2, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 6, and the at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 91 to 98.

49. The composition according to claim 48, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 6, and the at least one RNA molecule is a CRISPR RNA (crRNA) molecule comprising a guide sequence and a sequence selected from the group consisting of SEQ ID NOs: 91 and 92.

50. The composition according to claim 49, further comprising a trans-activated CRISPR RNA (tracrRNA) molecule containing a sequence represented by the group consisting of SEQ ID NOs. 93 to 97.

51. The composition according to claim 2, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 6, and the at least one RNA molecule is a single guide RNA (sgRNA) molecule comprising a guide sequence and a sequence selected from the group consisting of SEQ ID NOs: 91 to 98.

52. The composition according to any one of claims 48 to 51, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 6, and the CRISPR nuclease is a nicasse formed by the substitution of amino acids D8, E523, H757, or D760 in SEQ ID NO:

6.

53. The composition according to any one of claims 48 to 51, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 6, and the CRISPR nuclease is a nicasse formed by the substitution of amino acids D607, H608, or N631 in SEQ ID NO:

6.

54. The composition according to any one of claims 48 to 51, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 6, and the CRISPR nuclease is a non-catalytic nuclease formed by the substitution of amino acids D8, E523, H757 or D760 of SEQ ID NO: 6, and the substitution of amino acids D607, H608 or N631 of SEQ ID NO:

6.

55. The composition according to claim 2, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 7, and the at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 99 to 108.

56. The composition according to claim 55, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 7, and the at least one RNA molecule is a CRISPR RNA (crRNA) molecule comprising a guide sequence and a sequence selected from the group consisting of SEQ ID NOs: 99 to 101.

57. The composition according to claim 56, further comprising a trans-activated CRISPR RNA (tracrRNA) molecule containing a sequence represented by the group consisting of SEQ ID NOs. 102 to 107.

58. The composition according to claim 2, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 7, and the at least one RNA molecule is a single guide RNA (sgRNA) molecule comprising a guide sequence and a sequence selected from the group consisting of SEQ ID NOs: 99 to 108.

59. The composition according to any one of claims 55 to 58, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 7, and the CRISPR nuclease is a nickasase formed by the substitution of amino acids D12, E527, H756, or D759 in SEQ ID NO:

7.

60. The composition according to any one of claims 55 to 58, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 7, and the CRISPR nuclease is a nicasse formed by the substitution of amino acids E615, H616, or N639 in SEQ ID NO:

7.

61. The composition according to any one of claims 55 to 58, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 7, and the CRISPR nuclease is a non-catalyzed nuclease formed by the substitution of amino acids D12, E527, H756 or D759 of SEQ ID NO: 7, and the substitution of amino acids E615, H616 or N639 of SEQ ID NO:

7.

62. The composition according to claim 2, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 8, and the at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 109 to 120.

63. The composition according to claim 62, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 8, and the at least one RNA molecule is a CRISPR RNA (crRNA) molecule comprising a guide sequence and a sequence selected from the group consisting of SEQ ID NOs: 109 to 112.

64. The composition according to claim 63, further comprising a trans-activated CRISPR RNA (tracrRNA) molecule containing a sequence represented by the group consisting of SEQ ID NOs. 113 to 119.

65. The composition according to claim 2, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 8, and the at least one RNA molecule is a single guide RNA (sgRNA) molecule comprising a guide sequence and a sequence selected from the group consisting of SEQ ID NOs: 109 to 120.

66. The composition according to any one of claims 62 to 65, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 8, and the CRISPR nuclease is a nickasase formed by the substitution of amino acids D6, E524, H756 or D759 in SEQ ID NO:

8.

67. The composition according to any one of claims 62 to 65, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 8, and the CRISPR nuclease is a nickasase formed by the substitution of amino acids D608, H609, or N632 in SEQ ID NO:

8.

68. The composition according to any one of claims 62 to 65, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 8, and the CRISPR nuclease is a non-catalytic nuclease formed by the substitution of amino acids D6, E524, H756 or D759 of SEQ ID NO: 8, and the substitution of amino acids D608, H609 or N632 of SEQ ID NO:

8.

69. A non-natural composition comprising a CRISPR nuclease, wherein the CRISPR nuclease comprises an amino acid sequence corresponding to at least one amino acid sequence of domain A, domain B, domain C, domain D, domain E, domain F, domain G, domain H, or domain I of OMNI-79 CRISPR nuclease (SEQ ID NO: 5).

70. The composition according to claim 69, wherein the CRISPR nuclease comprises domain A having at least 97% sequence identity with amino acids 1 to 40 of SEQ ID NO:

5.

71. The composition according to claim 69 or 70, wherein the CRISPR nuclease comprises domain B having at least 97% sequence identity with amino acids 41-76 of SEQ ID NO:

5.

72. The composition according to any one of claims 69 to 71, wherein the CRISPR nuclease comprises a domain C having at least 97% sequence identity with amino acids 77 to 228 of SEQ ID NO:

5.

73. The composition according to any one of claims 69 to 72, wherein the CRISPR nuclease comprises domain D having at least 97% sequence identity with amino acids 229 to 446 of SEQ ID NO:

5.

74. The composition according to any one of claims 69 to 73, wherein the CRISPR nuclease comprises a domain E having at least 97% sequence identity with amino acids 447 to 507 of SEQ ID NO:

5.

75. The composition according to any one of claims 69 to 74, wherein the CRISPR nuclease comprises domain F having at least 97% sequence identity with amino acids 539 to 648 of SEQ ID NO:

5.

76. The composition according to any one of claims 69 to 75, wherein the CRISPR nuclease comprises domain G having at least 97% sequence identity with amino acids 665 to 822 of SEQ ID NO:

5.

77. The composition according to any one of claims 69 to 76, wherein the CRISPR nuclease comprises domain H having at least 97% sequence identity with amino acids 823 to 921 of SEQ ID NO:

5.

78. The composition according to any one of claims 69 to 77, wherein the CRISPR nuclease comprises domain I, which has at least 97% sequence identity with amino acids 922 to 1062 of SEQ ID NO:

5.

79. The composition according to any one of claims 69 to 78, wherein the length of the CRISPR nuclease sequence is at least 100 to 250, 250 to 500, 500 to 1000, or 1000 to 2000 amino acids.

80. A non-natural composition comprising a peptide or a polynucleotide encoding the peptide, wherein the peptide comprises an amino acid sequence having at least 97% sequence identity with at least one amino acid sequence of domain A, domain B, domain C, domain D, domain E, domain F, domain G, domain H, or domain I of OMNI-79 CRISPR nuclease.

81. The aforementioned composition, One or more RNA molecules, one or more nucleotide sequences encoding the one or more RNA molecules, or one or more RNA molecules including a guide sequence that can hybridize with a target sequence and is directly linked to a repetitive sequence; And, A CRISPR nuclease containing an amino acid sequence having at least 90% identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 8, or a nucleic acid molecule containing a sequence encoding the CRISPR nuclease. A modified non-natural composition containing a CRISPR-related system, The composition according to any one of claims 2 to 80, wherein the one or more RNA molecules hybridize to the target sequence, the target sequence is adjacent to the 3' end of the complementary sequence of a protospacer adjacent motif (PAM), and the one or more RNA molecules form a complex with the CRISPR nuclease.

82. A method for modifying a nucleotide sequence in a cell-free system or at a target site in the genome of a cell, comprising introducing a composition according to any one of claims 1 to 81 into a cell.

83. The method according to claim 82, wherein the cells are eukaryotic cells or prokaryotic cells.

84. The method according to claim 83, wherein the eukaryotic cell is a mammalian cell.

85. The method according to claim 84, wherein the mammalian cells are human cells.

86. The method according to any one of claims 82 to 85, wherein the CRISPR nuclease forms a complex with one or more RNA molecules and acts to cleave DNA strands adjacent to a protospacer-adjacent motif (PAM) sequence, and / or acts to cleave DNA strands adjacent to a sequence complementary to the PAM sequence.

87. The method according to any one of claims 82 to 86, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the sequence shown in Sequence ID No. 1, and the PAM site is an NGCNNT.

88. The method according to claim 18, wherein the CRISPR nuclease is a nickasase formed by the substitution of amino acids D24, E557, H785 or D788 of SEQ ID NO: 1, and acts to cleave DNA strands adjacent to the PAM sequence.

89. The method according to claim 18, wherein the CRISPR nuclease is a nickasase formed by the substitution of amino acids E644, H645, or N668 of SEQ ID NO: 1, and acts to cleave DNA strands adjacent to sequences complementary to the PAM sequence.

90. The method according to any one of claims 82 to 86, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the sequence shown in Sequence ID No. 1, and the PAM site is NSHNAC.

91. The method according to claim 90, wherein the CRISPR nuclease is a nickasase formed by the substitution of amino acids D19, E528, H750 or D753 of SEQ ID NO: 2, and acts to cleave DNA strands adjacent to the PAM sequence.

92. The method according to claim 90, wherein the CRISPR nuclease is a nickasase formed by the substitution of amino acids D609, H610, or N633 of SEQ ID NO: 2, and acts to cleave DNA strands adjacent to sequences complementary to the PAM sequence.

93. The method according to any one of claims 82 to 86, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the sequence shown in Sequence ID No. 3, and the PAM site is an NRRCM.

94. The method according to claim 93, wherein the CRISPR nuclease is a nickasase formed by the substitution of amino acids D8, E503, H729 or D732 of SEQ ID NO: 3, and acts to cleave DNA strands adjacent to the PAM sequence.

95. The method according to claim 93, wherein the CRISPR nuclease is a nickasase formed by the substitution of amino acids E584, H585, or N607 of SEQ ID NO: 3, and acts to cleave DNA strands adjacent to sequences complementary to the PAM sequence.

96. The method according to any one of claims 82 to 86, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the sequence shown in Sequence ID No. 4, and the PAM site is an NGSNNT.

97. The method according to claim 96, wherein the CRISPR nuclease is a nickasase formed by the substitution of amino acids D12, E543, H770 or D773 of SEQ ID NO: 4, and acts to cleave DNA strands adjacent to the PAM sequence.

98. The method according to claim 96, wherein the CRISPR nuclease is a nickasase formed by the substitution of amino acids E630, H631, or N654 of SEQ ID NO: 4, and acts to cleave DNA strands adjacent to sequences complementary to the PAM sequence.

99. The method according to any one of claims 82 to 86, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the sequence shown in Sequence ID No. 4, and the PAM site is NGR or NGG.

100. The method according to claim 99, wherein the CRISPR nuclease is a nickasase formed by the substitution of amino acids D8, E502, H735 or D738 of SEQ ID NO: 5, and acts to cleave DNA strands adjacent to the PAM sequence.

101. The method according to claim 99, wherein the CRISPR nuclease is a nickasase formed by the substitution of amino acids D586, H587, or N610 of SEQ ID NO: 5, and acts to cleave DNA strands adjacent to sequences complementary to the PAM sequence.

102. The method according to any one of claims 82 to 86, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the sequence shown in Sequence ID No. 6, and the PAM site is an NNRGAY.

103. The method according to claim 102, wherein the CRISPR nuclease is a nickasase formed by the substitution of amino acids D8, E523, H757 or D760 of SEQ ID NO: 6, and acts to cleave DNA strands adjacent to the PAM sequence.

104. The method according to claim 102, wherein the CRISPR nuclease is a nickasase formed by the substitution of amino acids D607, H608, or N631 of SEQ ID NO: 6, and acts to cleave DNA strands adjacent to sequences complementary to the PAM sequence.

105. The method according to any one of claims 82 to 86, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the sequence shown in Sequence ID No. 7, and the PAM site is NRRAA.

106. The method according to claim 105, wherein the CRISPR nuclease is a nickasase formed by the substitution of amino acids D12, E527, H756 or D759 of SEQ ID NO: 7, and acts to cleave DNA strands adjacent to the PAM sequence.

107. The method according to claim 105, wherein the CRISPR nuclease is a nickasase formed by the substitution of amino acids E615, H616, or N639 of SEQ ID NO: 7, and acts to cleave DNA strands adjacent to sequences complementary to the PAM sequence.

108. The method according to any one of claims 82 to 86, wherein the CRISPR nuclease comprises a sequence having at least 90% identity with the sequence shown in Sequence ID No. 8, and the PAM site is NRRNTT.

109. The method according to claim 108, wherein the CRISPR nuclease is a nickasase formed by the substitution of amino acids D6, E524, H756 or D759 of SEQ ID NO: 8, and acts to cleave DNA strands adjacent to the PAM sequence.

110. The method according to claim 108, wherein the CRISPR nuclease is a nickasase formed by the substitution of amino acids D608, H609, or N632 of SEQ ID NO: 8, and acts to cleave DNA strands adjacent to sequences complementary to the PAM sequence.