Lariat-capped RNA for improving intracellular safety and biosynthesis of mRNA, and its uses

Abstract

Unlike DNA, mRNA has the advantage of being able to express desired proteins immediately and temporarily in the cytoplasm without the need to enter the nucleus, so attempts to use mRNA vaccines are actively underway. However, mRNA is structurally less stable than DNA, which limits its industrial use. Therefore, the present invention relates to a technology that significantly improves the intracellular safety and biosynthesis of mRNA.The mRNA stabilization method and mRNA stabilization composition of the present invention are expected to be widely used in the health and medical fields because they are highly effective in stabilizing target nucleic acids and enhancing target protein expression in mRNA vaccines and other applications.

Description

[Technical Field]

[0001] The present invention relates to a sequence for stabilizing nucleic acids, specifically an RNA sequence with a lariat cap structure that improves the intracellular safety and biosynthesis of mRNA, and a composition for stabilizing nucleic acids containing the same. [Background technology]

[0002] Unlike DNA, mRNA has the advantage of being able to express desired proteins immediately and temporarily in the cytoplasm without the need to enter the nucleus. This has garnered attention as a new therapeutic approach in the health and medical fields. Global biotech and pharmaceutical companies are actively pursuing the use of mRNA vaccines for disease treatment and prevention. For example, in the case of new infectious diseases, changing the mRNA base sequence can facilitate rapid vaccine production. Furthermore, the mRNA used in vaccines is eliminated quickly after protein expression within human cells, potentially offering superior safety compared to DNA vaccines. However, mRNA's structural stability is less stable than DNA, limiting its industrial use. The first mRNA vaccines attempted against COVID-19 were unstable, with a half-life of approximately four hours. Furthermore, a single dose of approximately 30–100 μg of mRNA was required to express sufficient protein. This single, large dose of mRNA can cause various side effects depending on the individual. Therefore, the present invention has been devised to solve the above-mentioned problems and relates to a technology that significantly improves the intracellular safety and biosynthesis of mRNA.The mRNA stabilization method and mRNA stabilization composition of the present invention are expected to be widely used in the health / medical fields because they are effective in stabilizing target nucleic acids and enhancing target protein expression in mRNA vaccines, etc. Summary of the Invention [Problem to be solved by the invention]

[0003] One object of the present invention is to provide a method for stabilizing a nucleic acid of interest, in particular mRNA.

[0004] Another object of the present invention is to provide a vector for improving the safety of a target nucleic acid, particularly mRNA.

[0005] Another object of the present invention is to provide a composition for stabilizing a target nucleic acid, particularly mRNA.

[0006] However, the technical problems that the present invention aims to achieve are not limited to those mentioned above, and other problems not mentioned will be clearly understood by those skilled in the art from the following description. [Means for solving the problem]

[0007] Various embodiments described herein will now be described with reference to the drawings. In the following description, various specific details, such as specific configurations, compositions, and processes, are set forth to provide a thorough understanding of the present invention. However, a particular embodiment may be practiced with one or more of these specific details, or with other known methods and configurations. In other instances, known processes and manufacturing techniques are not described in specific detail to avoid unnecessarily obscuring the present invention. References throughout this specification to "an embodiment" or "an embodiment" mean that a particular feature, configuration, composition, or characteristic described in connection with the embodiment is included in one or more embodiments of the present invention. Therefore, the appearance of "an embodiment" or "an embodiment" in various places throughout this specification does not necessarily refer to the same embodiment of the present invention. Furthermore, particular features, configurations, compositions, or characteristics may be combined in any suitable manner in one or more embodiments.

[0008] Unless otherwise defined herein, all scientific and technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0009] The term "lariat structure" as used herein refers to a type of structure found during the splicing process of mRNA precursors in the nucleus. As a result of splicing, lariat-type introns are always generated as by-products, and most of the generated lariat introns are removed from the nucleus. As a related concept, the term "lariat cap" as used herein refers to the formation of an RNA similar to the artificial lariat structure generated as a result of splicing at the 5' end of a target sequence to be expressed through an in vitro transcription process. GIR1, an RNA sequence present in the myxomycete species Didymium iridis, is known to function as a ribozyme. In particular, this RNA sequence induces a highly specific reaction that directly ligates the first and third base sequences of RNA. As a result, linear RNA with a lariat cap structure, in which the first and third base sequences at the 5' end are linked, can be produced, rather than a completely linear RNA. In the present invention, lariat capping refers to the formation of a lariat cap at the 5' end of a target sequence to be expressed using the lariat capping sequence described above. However, the ribozyme used for this purpose is not limited to GIR1 or SEQ ID NOS: 1 to 3 used in the present invention, and any sequence capable of forming a lariat cap can be used without limitation.

[0010] The term "nucleic acid" as used herein encompasses DNA (deoxyribonucleic acid) and RNA (ribonucleic acid). It is used synonymously with the term "polynucleotide." Preferably, it refers to a polymer comprising nucleotide monomers covalently linked to each other by phosphodiester bonds in the sugar / phosphate backbone. It also includes base-, sugar-, or backbone-modified DNA or RNA. However, considering the purpose of the present invention, the term "nucleic acid" preferably refers to RNA, particularly mRNA. As a related concept, the nucleic acid targeted for expression in the present invention may have a meaning corresponding to the target sequence targeted for expression, and may be a target mRNA sequence whose stabilization is desired to be improved using the nucleic acid stabilization method or nucleic acid stabilization composition of the present invention.

[0011] The term "stabilizing nucleic acid" as used herein refers to the concept of stabilizing nucleic acid structures by preventing their degradation or deformation inside or outside cells. Generally, RNA is single-stranded and has higher activity than DNA, resulting in lower structural stability. Therefore, nucleic acid stabilization in the present invention refers to preventing the structural degradation or deformation of DNA or RNA, more preferably RNA, and even more preferably mRNA, and refers to delaying the structural degradation or deformation of nucleic acids to be expressed using methods or compositions that use sequences capable of forming a lariat cap of the present invention.

[0012] The term "sequence homology" as used herein refers to the percentage of similarity between two compared sequences. To determine the degree of homology, the sequences compared are preferably of the same length. However, if the sequences are different in length, the longer sequence is used as the basis for calculation. For example, a 10-nt sequence has 80% homology with an 8-nt sequence that is partially identical to the 10-nt sequence. In the present invention, the ribozyme used as a means for achieving the nucleic acid stabilization effect of the present invention may be, specifically, any one of SEQ ID NOS: 1 to 3, or a sequence having 70% or more homology with any one of SEQ ID NOS: 1 to 3. Alternatively, it may be a sequence having 80% or more homology with any one of SEQ ID NOS: 1 to 3. Alternatively, it may be a sequence having 90% or more homology with any one of SEQ ID NOS: 1 to 3. Alternatively, it may be a sequence having 95% or more homology with any one of SEQ ID NOS: 1 to 3. The homology is not limited to a specific percentage, and can be any percentage as long as the sequence retains the characteristic of forming a lariat cap.

[0013] The term "artificial nucleic acid" as used herein can be understood as a non-natural nucleic acid molecule that does not originally exist in nature. The artificial nucleic acid may be composed entirely of a sequence that does not exist in nature, or may be composed of a mixture of a portion of a naturally occurring (wild-type) sequence and a portion of a non-natural sequence. When composed solely of naturally occurring sequences, the sequence may be a mixture of sequences derived from different species. When composed of a mixture of a portion of a naturally occurring sequence and a portion of a non-natural sequence, the naturally occurring sequence may be a mixture of sequences derived from one or more species. Artificial nucleic acids may be non-natural due to non-natural variations in their individual sequences, such as structural variations of non-naturally occurring nucleotides. Artificial nucleic acids may also be DNA molecules, RNA molecules, or hybrid molecules containing DNA and RNA portions. The nucleic acid of interest in the present invention, particularly the nucleic acid used for stabilizing mRNA, may be an artificial nucleic acid in which a sequence derived from a single species has been artificially modified, or a sequence derived from different species is mixed. Specifically, it may be a mixture of a natural ribozyme sequence derived from one species and a sequence encoding an internal ribosome entry site (IRES) derived from another species. In this case, the sequence for forming the lariat cap may be one or more selected from SEQ ID NOS: 1 to 3, and the IRES may be a conventionally known sequence or the sequence represented by SEQ ID NOS: 4. The artificial nucleic acid may be considered a type of vector. In the context of the present invention, a vector may contain an artificial nucleic acid selected for nucleic acid stabilization, specifically an artificial nucleic acid that combines a natural ribozyme sequence from any one species with a sequence encoding an internal ribosome entry site (IRES) from the same or a different species.In such cases, the natural ribozyme sequence from one species and the sequence encoding an internal ribosome entry site (IRES) from another species may be located in a single vector, either linked or spaced apart. Such vectors may be storage vectors, expression vectors, cloning vectors, transport vectors, etc. Storage vectors are vectors that allow convenient storage of nucleic acid molecules, such as mRNA molecules. Expression vectors can be used to produce expression products such as RNA, e.g., mRNA, or peptides, polypeptides, or proteins. Cloning vectors typically contain a cloning site that can be used to incorporate nucleic acid sequences into the vector. Cloning vectors may be, for example, plasmid vectors or bacteriophage vectors. Transport vectors are vectors suitable for transporting nucleic acid molecules into cells or organisms, such as viral vectors. In the context of the present invention, vectors may be, for example, RNA or DNA vectors. Preferably, the vector of the present invention is a plasmid vector or a viral vector, but is not limited thereto. The vector can be used to introduce a target DNA or RNA (e.g., mRNA) nucleic acid into a cell, preferably a eukaryotic cell, thereby changing the original trait of the subject. This process is called transformation (transfection). The transformation can be carried out by any method known to those of ordinary skill in the art for introducing nucleic acid molecules into a cell, preferably a eukaryotic cell such as a mammalian cell. Such methods include, for example, electroporation, cationic gel and / or liposome-based lipofection, calcium phosphate precipitation, nanoparticle-based transfection, virus-based transfection, or cationic polymer-based transfection, such as DEAE-dextran or polyethyleneimine. Alternatively, the transformation can be carried out using a virus, such as a lentivirus.The target organism transformed by the above method and whose original traits have been changed is called a transformant. The transformant may be a virus, bacterium, plant cell, or animal cell.

[0014] The artificial nucleic acid or nucleic acid-stabilized composition of the present invention can be used to enhance the immune system of a target individual. "Immune enhancement" refers to the amplification of a desired immune response against a selected antigen, such as a characteristic component of the surface of bacteria, a virus particle, or a tumor antigen. Immune responses can be induced naturally or artificially, with vaccine administration being the most common method for artificially enhancing immune responses. A vaccine is typically understood as a prophylactic or therapeutic substance that provides at least one antigen, preferably an immunogen. The antigen or immunogen may be derived from a substance suitable for vaccination. For example, the antigen or immunogen may be derived from bacteria, a virus particle, or a tumor or cancer tissue. The antigen or immunogen stimulates the adaptive immune system in vivo. While traditional vaccines primarily use proteins or peptides derived from antigens or immunogens as stimulants for the adaptive immune system in vivo, recent efforts have focused on using nucleic acids as stimulants. Unlike DNA, mRNA has the advantage of being able to express desired proteins immediately and temporarily in the cytoplasm without the need to enter the nucleus. This has garnered attention as a new therapeutic approach in the health and medical fields. For example, in the case of new infectious diseases, changing the mRNA base sequence alone can facilitate rapid vaccine production. Furthermore, the mRNA used in vaccines is eliminated quickly after expressing proteins within human cells, potentially offering superior safety compared to DNA vaccines. However, mRNA is structurally less stable than DNA, limiting its industrial use. The first mRNA vaccines attempted against COVID-19 were unstable, with a half-life of approximately four hours. To express sufficient protein, a single dose of approximately 30–100 μg of mRNA was required. This single, large dose of mRNA caused various side effects depending on the individual.Therefore, in order to solve these problems, the artificial nucleic acid of the present invention, which has excellent nucleic acid stabilization effects, includes a sequence for lariat cap formation, or includes a sequence for lariat cap formation and a sequence encoding an internal ribosome entry site (IRES), can be administered as a vaccine together with a nucleic acid derived from an antigen or immunogen suitable for the desired immune enhancement. In this case, the sequence for lariat cap formation is preferably located 5' of the antigen genetic information in the nucleic acid vaccine, and the sequence encoding the internal ribosome entry site (IRES) is preferably located between the sequence for lariat cap formation and the antigen genetic information. In addition, the safety of nucleic acid vaccines is improved and antigens can be efficiently synthesized in vivo, thereby enabling high efficacy in disease treatment and prevention even with the administration of a small amount of vaccine. Furthermore, since a smaller vaccine dose is administered to achieve the desired therapeutic effect, the vaccine production value can be reduced. The vaccine can further contain an adjuvant (component) to boost the desired effect. An adjuvant is typically a pharmaceutical and / or immunological agent that can modify or enhance the effect of other agents, such as drugs or vaccines. This term is interpreted broadly and refers to a wide range of substances. Typically, these substances can increase the immunogenicity of an antigen. For example, adjuvants can be recognized by the innate immune system and induce an innate immune response. The artificial sequences or vaccines of the present invention, which contain a sequence for lariat-cap formation along with a nucleic acid intended for expression as an antigen, can have infinitely expanded uses depending on the type of antigen or immunogen contained. For example, when a viral nucleic acid is contained as an antigen or immunogen, the vaccine is a vaccine for that virus.For example, if the antigen or immunogen is derived from the SARS-CoV-2 virus, the vaccine is a coronavirus disease (COVID-19) vaccine. If the antigen or immunogen is derived from influenza virus A, B, or C, the vaccine is an influenza vaccine. If the antigen or immunogen is derived from a papillomavirus or papillomavirus, the vaccine is a cervical cancer vaccine.

[0015] The artificial nucleic acid or nucleic acid-stabilizing composition of the present invention can be used in a pharmaceutical composition for preventing or treating a target disease by enhancing the immunity of a target individual. The artificial nucleic acid or nucleic acid-stabilizing composition of the present invention can be used in a pharmaceutical composition for the prevention or treatment of various genetic diseases and disorders caused by quantitative deficiencies of specific mRNAs or specific proteins. Here, "gene deficiency disease" is used in the same sense as "genetic disease" and encompasses diseases caused by abnormalities in the DNA base sequence, which is the main body of genes. They can be divided into autosomal gene deficiency diseases and sex chromosome gene deficiency diseases, and each can be divided into recessive trait deficiency diseases and dominant trait deficiency diseases. Specific examples of autosomal recessive trait deficiency disorders include, but are not limited to, phenylketonuria (PKU), sickle cell anemia, cystic fibrosis, albinism, xeroderma pigmentosum, Wilson's disease, Hurler-Scheie syndrome, Tay-Sachs disease, haemochromatosis type 1, and Gitelman syndrome. Examples of autosomal dominant trait deficiency disorders include neurofibromatosis type 1 (NF-1), autosomal dominant polycystic kidney disease (ADHD), and autosomal dominant polycystic kidney disease (ADHD). These include ADPKD (adrenergic phosphokinase), Huntington's disease, muscular dystrophy, fatal familial insomnia (FFI), Charcot-Marie-Tooth disease (CMT), and Treacher Collins syndrome. Sex chromosome recessive trait defect disorders include Duchenne muscular dystrophy.Examples of genetic disorders include hemophilia, X-linked agammaglobulinema (XLA), testicular feminization syndrome, color blindness, azoospermia, and primary immune deficiency syndromes, including selective IgA deficiency, panhypogammaglobulinemia, DiGeorge syndrome, severe combined immunodeficiency, hyper-IgE syndrome, hyper-IgM syndrome, Wiskott-Aldrich syndrome, chronic granulomatous disease of childhood, and congenital neutropenia. Sex chromosome dominant trait deficiency disorders include congenital generalized hypertrichosis and hereditary alopecia. The pharmaceutical composition of the present invention can be used to treat such genetic disorders. The term "pharmaceutical composition" as used herein refers to a composition administered for the prevention or treatment of a target disease. The disease may be selected without limitation as long as it requires prevention or treatment. For the purposes of the present invention, the disease may be prevented or treated by regulating gene expression. The gene may directly affect the prevention or treatment of a disease, such as a genetic disease, or may indirectly prevent or treat the disease through in vivo immune enhancement, such as by stimulating immune cells. The pharmaceutical composition is characterized by being in the form of a capsule, tablet, granule, injection, ointment, powder, or drink, and is intended for humans. The pharmaceutical composition of the present invention can be formulated into oral dosage forms such as powder, granule, capsule, tablet, or aqueous suspension, topical agent, suppository, and injection by conventional methods, with suppositories or injection being preferred. The pharmaceutical composition of the present invention may also contain a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers may include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, dyes, and flavorings for oral administration; buffers, preservatives, soothing agents, solubilizers, isotonicity agents, and stabilizers for injections; and bases, excipients, lubricants, and preservatives for topical administration. The pharmaceutical composition of the present invention may be prepared in various dosage forms by mixing with the aforementioned pharmaceutically acceptable carriers. For example, the composition may be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like for oral administration; and in the form of unit-dose ampoules or multi-dose forms for injections. Other dosage forms include solutions, suspensions, tablets, capsules, sustained-release formulations, and the like.Examples of suitable carriers, excipients, and diluents for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. The composition may further contain fillers, anti-agglomerating agents, lubricants, humectants, flavorings, emulsifiers, preservatives, and the like. The pharmaceutical composition according to the present invention may be administered orally, intravenously, intramuscularly, intraarterially, intramedullary, intrathecally, intracardially, transdermally, subcutaneously, intraperitoneally, intranasally, intestinal, topically, sublingually, or rectally, although parenteral administration is preferred, as described above. Parenteral administration includes subcutaneous, intradermal, intravenous, intramuscular, intra-articular, intrasynovial, intrasternal, intradural, intralesional, and intracranial injection or infusion techniques. The pharmaceutical composition of the present invention may also be administered in the form of a suppository for rectal administration. The dosage of the pharmaceutical composition of the present invention may vary depending on various factors, including the activity of the specific compound used, age, body weight, general health, sex, diet, administration time, administration route, excretion rate, drug formulation, and the severity of the specific disease to be prevented or treated. The dosage of the pharmaceutical composition varies depending on the patient's condition, body weight, severity of the disease, drug form, administration route, and duration, and can be appropriately selected by those skilled in the art. Administration can be once a day or in several divided doses. The dosages mentioned above are not intended to limit the scope of the present invention in any way. The artificial nucleic acid or nucleic acid-stabilizing composition of the present invention can be used as an alternative to various existing disease treatment methods using DNA. The present invention will now be described in detail with reference to examples. [Effects of the Invention]

[0016] The mRNA stabilization method and composition of the present invention are expected to be widely used in the health / medical fields because they are highly effective in stabilizing target nucleic acids and enhancing target protein expression in mRNA vaccines and the like. [Brief explanation of the drawings]

[0017] [Figure 1] FIG. 1 shows a schematic diagram of the plasmid design of the test group used in the present invention according to one embodiment of the present invention. Specifically, "Dir-LCrz-Cont-RLuc" is RNA having an analogue of the cap structure present at the 5' end of a typical mRNA, "Dir-LCrz-RLuc" is RNA having a lariat cap structure induced at the 5' end by the ribozyme of SEQ ID NO: 1, "Dir-Cont-IRES-RLuc" is RNA having an analogue of the cap structure present at the 5' end of a typical mRNA and further having a Coxsackievirus B3 (CVB3) IRES of SEQ ID NO: 4 inserted therein, "Dir-LCrz-IRES-RLuc" is RNA having a lariat cap structure induced at the 5' end by the ribozyme of SEQ ID NO: 1 and further having a Coxsackievirus B3 (CVB3) IRES of SEQ ID NO: 4 inserted therein, and "Asp-LCrz-IRES-RLuc" is RNA having a lariat cap structure induced at the 5' end by the ribozyme of SEQ ID NO: 2 and further having a Coxsackievirus B3 (CVB3) IRES of SEQ ID NO: 4 inserted therein. An IRES-inserted RNA, "Npr-LCrz-IRES-RLuc," refers to an RNA in which a lariat cap structure is induced at the 5' end by the ribozyme of SEQ ID NO: 3, and the Coxsackievirus B3 (CVB3) IRES of SEQ ID NO: 4 is further inserted. The above symbols are similarly applied to the following Figures 2 to 6, and the "-" symbol in the middle of the symbol may be omitted. [Figure 2] FIG. 2 shows the results of confirming that lariat-capped RNA was successfully produced from the plasmid of the present invention, according to one embodiment of the present invention. [Figure 3a]FIG. 3a shows the results of confirming the safety of RNA prepared from the plasmid of the present invention and the expression level of the RLuc reporter protein according to one embodiment of the present invention. [Figure 3b] FIG. 3b shows the results of confirming the safety of RNA prepared from the plasmid of the present invention and the expression level of the RLuc reporter protein according to one embodiment of the present invention. [Figure 3c] FIG. 3c shows the results of confirming the safety of RNA prepared from the plasmid of the present invention and the expression level of the RLuc reporter protein according to one embodiment of the present invention. [Figure 4] FIG. 4 shows the results of a comparison of the production efficiency of "Dir-LCrz-RLuc" and "Dir-LCrz-IRES-RLuc" depending on whether or not an IRES is introduced, according to one embodiment of the present invention. [Figure 5a] FIG. 5a shows the results of comparing the efficiency of RLuc RNA formation from lariat-capped RNA using the ribozymes of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, according to one embodiment of the present invention. [Figure 5b] FIG. 5b shows the results of comparing the efficiency of RLuc RNA formation from lariat-capped RNA using the ribozymes of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, according to one embodiment of the present invention. [Figure 5c] FIG. 5c shows the results of comparing the efficiency of RLuc RNA formation from lariat-capped RNA using the ribozyme of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, according to one embodiment of the present invention. [Figure 5d] FIG. 5d shows the results of comparing the efficiency of RLuc RNA formation from lariat-capped RNA using the ribozymes of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, according to one embodiment of the present invention. [Figure 6a] FIG. 6a shows the results of a comparison of intracellular RNA safety and protein translation efficiency of lariat-capped RNA using ribozymes of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3 according to one embodiment of the present invention. [Figure 6b]FIG. 6b shows the results of a comparison of intracellular RNA safety and protein translation efficiency of lariat-capped RNA using ribozymes of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, according to one embodiment of the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0018] To produce lariat caps with improved RNA safety and translation efficiency, we searched for novel ribozymes and selected a ribozyme derived from Allovahlkampfia spelaea (SEQ ID NO: 2) and a ribozyme derived from Naegleria pringsheimi (SEQ ID NO: 3). The GIR1 branching ribozyme (SEQ ID NO: 1) from Example 1 was used as a control to compare the functions of the two novel ribozymes. Experimental results showed that all three ribozymes were capable of producing RNAs with lariat caps. However, under optimized pH conditions, the Naegleria pringsheimi-derived ribozyme corresponding to SEQ ID NO: 3 showed a significantly higher lariat cap formation efficiency of 97.3% (Figures 5a to 5d). This indicates the greater utility of the Naegleria pringsheimi-derived ribozyme than the GIR ribozyme used as a control. [Example]

[0019] The present invention will be described in more detail with reference to the following examples. It will be obvious to those skilled in the art that these examples are provided solely for the purpose of illustrating the present invention in more detail, and that the scope of the present invention is not limited by these examples. Example 1. Preparation of nucleic acid containing GIR1 branching ribozyme and confirmation of its activity To confirm the intracellular safety of RNAs bearing lariat caps compared to the m7G cap structure present at the 5' end of typical mRNAs, we constructed a plasmid containing the GIR1 branching ribozyme (SEQ ID NO: 1), which is known to form the conventional lariat cap structure. The gene expressed was Renilla-luciferin 2-monooxygenase (RLuc), and the specific plasmid structure is shown in Figure 1. This was then subjected to in vitro transcription using a T7 promoter and T7 RNA polymerase, and the synthesized RNA was analyzed using a denaturing agarose gel. The experimental results demonstrated that full-length RNA was successfully synthesized through the in vitro transcription process, as expected. Furthermore, by optimizing the buffer composition for ribozyme activity, we observed a lariat-capped RNA formation efficiency of over 60%. In other words, a short sequence of less than 200 bases (the ribozyme sequence itself) and a novel RNA predicted to be lariat-capped RNA were generated, indicating that the RNA was split in two by the function of the GIR1 ribozyme. In particular, treatment with XRN1, a 5'-to-3' exoribonuclease, significantly reduced short RNAs (less than 200 base pairs), while lariat-capped RNA was largely unaffected. Because lariat-capped RNA lacks a 5' end, resistance to XRN1 treatment indicates that the RNA produced under these experimental conditions is lariat-capped RNA, lacking a 5' end. The results are shown in Figure 2.

[0020] Example 2: Confirmation of the nucleic acid stabilizing effect of lariat-capped RNA Using the plasmid construct of Example 1, the RLuc (Renilla-luciferin 2-monooxygenase) gene was expressed to construct capped RLuc RNA, which has a conventional mRNA cap structure at its 5' end, and lariat-capped RLuc RNA, which has a lariat cap structure at its 5' end. The intracellular safety and protein translation efficiency of these RNAs were then investigated. Experimental results showed that capped RLuc RNA had a half-life of approximately 5 hours in HeLa cells, while lariat-capped RLuc RNA had a half-life of approximately 12 hours. These results indicate that lariat-capped RNA is safer than existing capped RNAs. However, intracellular protein expression was examined through RLuc activity. While capped RLuc RNA exhibited very high translation efficiency, lariat-capped RLuc RNA exhibited near-background levels of RLuc activity due to the lack of an IRES, indicating that the protein translation efficiency of lariat-capped RNA was very low. The results are shown in Figures 3a to 3c.

[0021] Example 3. Preparation of nucleic acids containing reporter RNA and lariat-capped RNA and confirmation of their activity As part of a strategy to overcome the drawback of lariat-capped RNA, namely inefficient protein translation, we constructed a reporter RNA by introducing an IRES (SEQ ID NO: 4) before the RLuc gene. As a result, we confirmed that even though the length of the RNA was sufficiently increased by the introduction of the Coxsackievirus B3 (CVB3) IRES, a large amount of RNA was produced during RNA synthesis using the method constructed in the present invention. The results are shown in Figure 4.

[0022] Example 4. Comparison of the effects of various lariat cap formation-inducing ribozymes To generate lariat caps with improved RNA safety and translation efficiency, we searched for novel ribozymes and selected a ribozyme derived from Allovahlkampfia spelaea (SEQ ID NO: 2) and a ribozyme derived from Naegleria pringsheimi (SEQ ID NO: 3). The GIR1 branching ribozyme (SEQ ID NO: 1) from Example 1 was used as a control to compare the functions of the two novel ribozymes. Furthermore, we constructed lariat-capped IRES RLUC RNAs by inserting an IRES into lariat-capped RNA using the novel ribozymes, and compared the translation efficiency between the ribozymes. Experimental results showed that the Naegleria pringsheimi ribozyme produced lariat-capped IRES RLUC RNAs with higher efficiency than the other two ribozymes. Therefore, it is expected to be a satisfactory substitute for the conventional GIR1 ribozyme (SEQ ID NO: 1). The results are shown in Figures 5a to 5d. A total of four IRES RLuc RNAs (capped RNA and lariat-capped IRES RLuc RNAs synthesized using three different ribozymes) were transfected into HeLa cells, and the half-life and intracellular protein synthesis efficiency of each RNA were compared. The results are shown in Figures 6a and 6b. The experimental results confirmed that the capped IRES RLuc RNA had a half-life of approximately 8 hours, while the lariat-capped IRES RLuc RNAs synthesized using three different ribozymes had a half-life of approximately 11 hours. Furthermore, in terms of protein synthesis efficiency, all lariat-capped IRES RLuc RNAs synthesized using the three different ribozymes used were confirmed to have similar translation efficiency to capped RNA. This result indicates that lariat-capped IRES RNA is significantly more stable in cells than commonly used capped RNAs, while also having similar protein synthesis efficiency. Although certain parts of the present invention have been described in detail above, it will be apparent to those skilled in the art that such specific descriptions are merely preferred embodiments and are not intended to limit the scope of the present invention. Therefore, the true scope of the present invention should be defined by the appended claims and their equivalents. [Industrial Applicability]

[0023] The present invention relates to a technology that significantly improves the intracellular safety and biosynthesis of mRNA. The mRNA stabilization method and composition of the present invention are expected to be widely used in the health and medical fields because they are effective in stabilizing target nucleic acids and enhancing target protein expression in various genetic and metabolic diseases caused by mRNA vaccines and protein deficiencies. [Sequence List Free Text]

[0024] SEQ ID NO: 1: GIR1 branching ribozyme from Didymium iridis ggttgggttgggaagtatcatggctaatcaccatgatgcaatcgggttgaacacttaattgggttaaaacggtgggggacgatcccgtaacatccgtcctaacggcgacagactgcacggccctgcctcttaggtgtgttcaatgaacagtcgttccgaaaggaagcatccggtatcccaagacaatc SEQ ID NO: 2: Ribozyme from Allovahlkampfia spelaea gggcgactttctttttctcttgtgcaatggggtttatgagttaattagccaaaacgggaccttaaaaaggtgtaagtaaccgtactaagttcgtaagaacggaatgtctagagactacacggctgagcgatttagctctcataaatggatagtcctcagtataccatctgagcatcccatacaaaatggttaaatatttc Accession number 3: Ribozyme from Naegleria pringsheimi ggtccctgttattgaggacgttttagtgtgcaatggggttcacacctttatttgccaaaacgggacctctgttgaggttataaaattctaacgaattgaatattccgtactaaggatttaatccggaacgtctagagactacacggcaaaccatattggtggtgtgaatggatagtccctagtaaccatctaggcatcccatacaaaatggtaaccataaaa Accession number 4: 4: Internal ribosome entry site (IRES) ttaaaacagcctgtgggttgatcccacccacaggcccattgggcgctagcactctggtatcacggtacctttgtgcgcctgttttataccccctcccccaactgtaacttagaagtaacacacaccgatcaacagtcagcgtggcacaccagccacgttttgatcaagcacttctgttaccccggactgagtatcaatagactgctcacgcggttgaaggagaaagcgttcgttatccggccaactacttcgaaaaacctagtaacaccgtggaagttgcagagtgtttcgctcagcactaccccagtgtagatcaggtcgatgagtcaccgcattccccacgggcgaccgtggcggtggctgcgttggcggcctgcccatggggaaacccatgggacgctctaatacagacatggtgcgaagagtctattgagctagttggtagtcctccggcccctgaatgcggctaatcctaactgcggagcacacaccctcaagccagagggcagtgtgtcgtaacgggcaactctgcagcggaaccgactactttgggtgtccgtgtttcattttattcctatactggctgcttatggtgacaattgagagatcgttaccatatagctattggattggccatccggtgactaatagagctattatatatccctttgttgggtttataccacttagcttgaaagaggttaaaacattacaattcattgttaagttgaatacagcaaaatg

Claims

1. (a) inserting a sequence for forming a lariat cap at the 5' end of a nucleic acid sequence of interest; and (b) inserting a sequence encoding an internal ribosome entry site (IRES) between the lariat capping sequence and the nucleic acid sequence of interest.

2. The method for stabilizing a nucleic acid of interest according to claim 1 , wherein the nucleic acid of interest is an RNA sequence.

3. 2. The method for stabilizing a nucleic acid of interest according to claim 1, wherein the sequence for forming the lariat cap is at least one selected from SEQ ID NOs: 1 to 3.

4. 2. The method for stabilizing a nucleic acid of interest according to claim 1, wherein the IRES is a conventionally known sequence or the IRES represented by SEQ ID NO:

4.

5. The method for stabilizing a target nucleic acid according to claim 1 , wherein the nucleic acid stabilization is intracellular nucleic acid stabilization.

6. The method for stabilizing a nucleic acid of interest according to claim 1, wherein the method is a method for improving the safety of an RNA vaccine.

7. An artificial nucleic acid for improving the safety of a nucleic acid of interest, comprising a sequence for forming a lariat cap and further comprising a sequence encoding an internal ribosome entry site (IRES).

8. 8. The artificial nucleic acid according to claim 7, wherein the sequence for forming the lariat cap is at least one selected from SEQ ID NOs: 1 to 3.

9. The artificial nucleic acid according to claim 7 , wherein the IRES is a conventional publicly known sequence or the sequence represented by SEQ ID NO:

4.

10. A composition for nucleic acid stabilization, comprising the artificial nucleic acid according to claim 7 .

11. The composition for stabilizing nucleic acids according to claim 10, wherein the composition is for improving the safety of mRNA vaccines or therapeutic mRNA.

12. An immune enhancing composition comprising the artificial nucleic acid of claim 7.

13. The immune enhancing composition according to claim 12, which is a vaccine composition.

14. A vector comprising the artificial nucleic acid of claim 7.

15. The vector according to claim 14 , wherein the vector is a plasmid vector or a viral vector.

16. A transformant transformed with the vector according to claim 14.

17. The transformant according to claim 16, which is a virus, a bacterium, a plant cell, or an animal cell.

18. A pharmaceutical composition for preventing or treating a disease, comprising the artificial nucleic acid according to claim 7.

19. 19. The pharmaceutical composition of claim 18, wherein the disease is a gene defect disease.

Images