Flow cell with patterned substrate

Abstract

An example flow cell includes a substrate, a plurality of reaction regions spatially separated from one another across the substrate, and a plurality of independently removable coatings disposed on each of the plurality of reaction regions, each of the plurality of reaction regions including a polymer hydrogel layer and a reactive entity attached to the polymer hydrogel layer, and at least one of the independently removable coatings is a composite material including a thermoresponsive polymer and a photothermal additive.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 63 / 586,716, filed September 29, 2023, and U.S. Provisional Patent Application No. 63 / 387,874, filed December 16, 2022, the contents of each of which are incorporated herein by reference in their entirety.

[0002] Sequence Listing Reference The Sequence Listing submitted herewith is incorporated by reference in its entirety. The file name is "ILI251B2PCT_IP-2639-PCT_Sequence_Listing.xml", the file size is 17,871 bytes, and the file creation date is December 11, 2023. [Background technology]

[0003] Some biological and / or chemical vessels, such as assay plates and flow cells, contain designated reaction areas in which surface chemistry that enables a desired interaction or reaction is localized. When a reactive species is introduced into the vessel, the reactive species interacts or reacts with the surface chemistry to generate a detectable signal (e.g., an electrical or optical signal). Many vessels are configured with multiple reaction areas in fluid communication with a single flow channel. In these vessels, a single sample can be introduced into the flow channel and its associated reaction area, or multiple samples can be pooled and introduced into the flow channel and its associated reaction area. Summary of the Invention

[0004] The biological and / or chemical reservoirs disclosed herein include multiple reaction regions spatially separated from one another across a substrate, each containing a respective reactive entity, which may be the same or different.

[0005] In some examples disclosed herein, each reaction area is coated with an independently removable coating, which may be a photoreactive coating. These independently removable coatings allow controlled access to the reaction areas. For example, one or more coatings may be removed by exposure to light, while one or more other coatings remain intact. The reaction areas exposed by coating removal become active and can thereby participate in a designated reaction. The reaction area(s) with intact coating(s) remain passivated or protected, and therefore inactive.

[0006] In some other examples disclosed herein, each reaction area is independently electrically addressable. Independent electrical addressability allows conductive fluid to be directed to specific reaction areas, while other reaction areas remain fluid-free. Controlled fluid exposure allows designated reactions to occur in specific reaction areas. Unexposed reaction areas remain inactive. [Brief explanation of the drawings]

[0007] Features of examples of the present disclosure will become apparent by reference to the following detailed description and drawings, in which like reference numbers correspond to similar, if not identical, components, and for the sake of brevity, reference numbers or features having a previously mentioned function may or may not be described with reference to other drawings in which they appear. [Figure 1A] FIG. 2 is a top view of the flow cell. [Figure 1B] FIG. 1B is a semi-schematic, partially cross-sectional and partially perspective view of an exemplary construction of the flow cell of FIG. 1A. [Figure 1C] 1B is a semi-schematic, partially cross-sectional and partially perspective view of another exemplary construction of the flow cell of FIG. 1A. [Figure 2A] 1A-1C are schematic cross-sectional views of reaction areas defined within recesses and coated with different removable coatings. [Figure 2B] 1 is a schematic cross-sectional view of reaction areas defined within recesses and coated with different removable coatings, some of which include multiple sublayers. [Figure 2C] 1A-1C are schematic cross-sectional views of reaction areas defined within recesses and coated with the same removable coating having different thicknesses. [Figure 3A] 1A-1C are schematic cross-sectional views of reaction areas defined on raised portions and coated with different removable coatings. [Figure 3B] 1 is a schematic cross-sectional view of reaction areas defined on protrusions and coated with different removable coatings, some of which include multiple sublayers. [Figure 3C] 1A-1C are schematic cross-sectional views of reaction areas defined on protrusions and coated with the same removable coating having different thicknesses. [Figure 3D] 1 is a schematic cross-sectional view of a reaction area defined on a protrusion and coated with a single removable coating having a step thickness gradient. [Figure 3E] 1 is a schematic cross-sectional view of a reaction area defined on a protrusion and coated with a single removable coating having a linear thickness gradient. [Figure 4] FIG. 1 is a schematic diagram illustrating two exemplary methods (A.-E. or A., ​​B., F., G., E.) using two photoreactive protective layers, where A. shows exposing one photoreactive protective layer to light, B. shows introducing a first library template strand, C. shows seeding of the first library template strand and exposing the other photoreactive protective layer to light, D. shows introducing a second library template strand, and E. shows an amplified template strand; where A. shows exposing one of the photoreactive protective layers to light, B. shows introducing the first library template strand, F. shows seeding and amplification of the first library template strand and exposing the other photoreactive protective layer to light, G. shows introducing a second library template strand, and E. shows an amplified template strand. [Figure 5A] is the chemical structure of an example of a photoreactive protective layer comprising a hydrophilic polymer crosslinked with a photocleavable crosslinker. [Figure 5B] 1 shows the chemical structure of another example of a photoreactive protective layer comprising a hydrophilic polymer crosslinked with a photocleavable crosslinker, and reactions involving the photoreactive protective layer. [Figure 5C] 1 shows the chemical structure of yet another example of a photoreactive protective layer comprising a hydrophilic polymer crosslinked with a photocleavable crosslinker, and another reaction involving the photoreactive protective layer. [Figure 6A] is an example chemical structure of a photoreactive protective layer comprising a polymer capped with photocleavable hydrophobic groups or acid labile groups. [Figure 6B] 1 shows the chemical structure of another example of a photoreactive protective layer (comprising a polymer capped with photocleavable hydrophobic groups or acid-labile groups) and reactions involving the photoreactive protective layer. [Figure 7] FIG. 1 is a schematic diagram of a digital fluidics system. [Figure 8A] FIG. 1 shows a top view of the resin layer of a digital fluidics cartridge patterned with three different reaction regions. [Figure 8B] FIG. 1 is a top view of an array of individually addressable control electrodes of the device. [Figure 8C] 8B. FIG. 8C is a top view showing the resin layer of FIG. 8A overlying the array of individually addressable control electrodes of FIG. 8B. [Figure 9] FIG. 1 is a schematic diagram of a complementary metal oxide semiconductor imaging device bonded to a substrate.

[0008] definition Terms used herein should be understood to have their ordinary meaning in the relevant art unless otherwise specified. Some terms used herein and their meanings are described below.

[0009] The singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0010] The terms comprising, including, containing, and the various forms of these terms are synonymous and intended to be equally broad.

[0011] Terms such as top, bottom, lower, upper, on, etc. are used herein to describe the flow cell and / or various components of the flow cell. It should be understood that these directional terms are not meant to indicate a specific orientation, but are used to designate the relative orientation between components. The use of directional terms should not be construed to limit the examples disclosed herein to any specific orientation.

[0012] The terms first, second, etc. are also not meant to indicate a particular orientation or order, but rather are used to distinguish one component from another.

[0013] Ranges provided herein should be understood to include the stated range and any value or subrange within that stated range, as if such value or subrange were explicitly recited. For example, a range of about 400 nm to about 1 μm (1000 nm) should be interpreted to include not only the explicitly recited limits of about 400 nm to about 1 μm, but also individual values, such as about 708 nm, about 945.5 nm, etc., and subranges, such as about 425 nm to about 825 nm, about 550 nm to about 940 nm, etc. Furthermore, when "about" and / or "substantially" are used to describe values, these are meant to encompass small variations (up to ±10%) of the stated value.

[0014] "Acrylamide monomer" has the structure

[0015] [ka] or a monomer containing an acrylamide group. An example of a monomer containing an acrylamide group is azidoacetamidopentyl acrylamide:

[0016] [ka] and N-isopropylacrylamide:

[0017] [ka] Other acrylamide monomers may also be used.

[0018] As used herein, the term "activation" refers to a process of generating reactive groups on the surface of a substrate. Activation can be achieved using silanization or plasma ashing. While the figures do not show a separate silanized layer or hydroxyl (-OH) groups from plasma ashing, it is understood that activation generates a silanized layer or -OH groups on the surface of the activated substrate or layer for covalently attaching the functionalized layer to the underlying substrate or layer.

[0019] An aldehyde, as used herein, is an organic compound containing a functional group having the structure -CHO, which includes a carbonyl center (i.e., a carbon double-bonded to oxygen) with a carbon atom also bonded to a hydrogen and an R group, such as an alkyl or other side chain. The general structure of an aldehyde is:

[0020] [ka] is.

[0021] As used herein, "alkyl" refers to a straight or branched hydrocarbon chain that is fully saturated (i.e., contains no double or triple bonds). The alkyl group can have 1 to 20 carbon atoms. Exemplary alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tertiary butyl, pentyl, hexyl, and the like. As an example, the designation "C1-4 alkyl" indicates that there are 1 to 4 carbon atoms in the alkyl chain, i.e., the alkyl chain is selected from the group consisting of methyl, ethyl, propyl, isopropyl, n-butyl, isobutyl, sec-butyl, and t-butyl.

[0022] As used herein, "alkenyl" refers to a straight or branched hydrocarbon chain containing one or more double bonds. Alkenyl groups can have 2 to 20 carbon atoms. Exemplary alkenyl groups include ethenyl, propenyl, butenyl, pentenyl, hexenyl, and the like.

[0023] As used herein, "alkyne" or "alkynyl" refers to a straight or branched hydrocarbon chain containing one or more triple bonds. Alkynyl groups can have 2 to 20 carbon atoms.

[0024] As used herein, "aryl" refers to an aromatic ring or ring system (i.e., two or more fused rings that share two adjacent carbon atoms) containing only carbon in the ring backbone. When aryl is a ring system, all rings in the system are aromatic. Aryl groups can have 6 to 18 carbon atoms. Examples of aryl groups include phenyl, naphthyl, azulenyl, and anthracenyl.

[0025] An "amine" or "amino" functional group is -NR a R b refers to a group, wherein R a and R b are each hydrogen, as defined herein.

[0026] [ka] It is independently selected from C1-6 (or C1-C6) alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-7 carbocycle, C6-10 aryl, 5-10 membered heteroaryl, and 5-10 membered heterocycle.

[0027] As used herein, the term "attached" refers to the state in which two things are joined, fastened, adhered, connected, or bonded to each other, either directly or indirectly. For example, nucleic acids can be attached to a polymer hydrogel layer by covalent or non-covalent bonds. Covalent bonds are characterized by the sharing of electron pairs between atoms. Non-covalent bonds are physical bonds that do not involve the sharing of electron pairs, and can include, for example, hydrogen bonds, ionic bonds, van der Waals forces, hydrophilic interactions, and hydrophobic interactions.

[0028] An "azide" or "azido" functional group refers to an -N3.

[0029] As used herein, a "bonding region" refers to a region of a patterned structure that is bonded to another material, which may be, by way of example, a spacer layer, a lid, another patterned structure, etc., or a combination thereof (e.g., a spacer layer and a lid, or a spacer layer and another patterned structure). The bond formed in the bonding region may be a chemical bond or a mechanical bond (e.g., using fasteners, etc.).

[0030] As used herein, "carbocycle" refers to a non-aromatic cyclic ring or ring system containing only carbon atoms in the ring system backbone. When a carbocycle is a ring system, two or more rings can be joined together in a fused, bridged, or spiro-connected manner. Carbocycles can have any degree of saturation, provided that at least one ring in the ring system is not aromatic. Thus, carbocycles include cycloalkyl, cycloalkenyl, and cycloalkynyl. Carbocyclic groups can have 3 to 20 carbon atoms. Examples of carbocyclic rings include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclohexenyl, 2,3-dihydro-indene, bicyclo[2.2.2]octanyl, adamantyl, and spiro[4.4]nonanyl.

[0031] As used herein, the term "carboxylic acid" or "carboxyl" refers to --COOH.

[0032] As used herein, "cycloalkylene" means a fully saturated carbocyclic ring or ring system attached to the rest of the molecule through two points of attachment.

[0033] As used herein, "cycloalkenyl" or "cycloalkene" means a carbocyclic ring or ring system having at least one double bond, wherein none of the rings within the ring system are aromatic. Examples include cyclohexenyl or cyclohexene and norbornenyl or norbornene. Also, as used herein, "heterocycloalkenyl" or "heterocycloalkene" means a carbocyclic ring or ring system having at least one double bond and at least one heteroatom within the ring backbone, wherein none of the rings within the ring system are aromatic.

[0034] As used herein, "cycloalkynyl" or "cycloalkyne" means a carbocyclic ring or ring system having at least one triple bond, wherein none of the rings in the ring system is aromatic. An example is cyclooctyne. Another example is biclononyne. As used herein, "heterocycloalkynyl" or "heterocycloalkyne" means a carbocyclic ring or ring system having at least one heteroatom in the ring backbone, wherein the ring has at least one triple bond, wherein none of the rings in the ring system is aromatic.

[0035] As used herein, the term "deposition" refers to any suitable application technique, which may be manual or automated, and which, in some cases, results in the modification of surface properties. Generally, deposition may be carried out using evaporation techniques, coating techniques, grafting techniques, etc. Some specific examples include chemical vapor deposition (CVD), spray coating (e.g., ultrasonic spray coating), spin coating, dunk or dip coating, doctor blade coating, puddle dispensing, flow-through coating, aerosol printing, screen printing, microcontact printing, inkjet printing, etc.

[0036] As used herein, the term "recess" refers to a discrete concave feature defined in a substrate and having a surface opening at least partially surrounded by a void region(s) of the substrate. The recess can take a variety of shapes at the surface opening, such as, for example, a circle, an ellipse, a square, a polygon, a star (with any number of vertices), etc. The cross section of the recess taken perpendicular to the surface can be curved, square, polygonal, hyperbolic, conical, angular, etc.

[0037] The term "each," when used in reference to a collection of items, is intended to identify each individual item in the set, but does not necessarily refer to every item in the set. Exceptions may occur where express disclosure or context clearly dictates otherwise.

[0038] As used herein, the term "epoxy" (also referred to as a glycidyl group or an oxirane group) refers to

[0039] [ka] Refers to...

[0040] As used herein, the term "flow cell" is intended to mean a vessel having a flow channel in which a reaction can occur, an inlet for delivering a reagent(s) to the flow channel, and an outlet for removing a reagent(s) from the flow channel. In some examples, the flow cell provides a site for detection of a reaction occurring within the flow cell. For example, the flow cell may include one or more transparent surfaces that allow for optical detection of arrays, optically labeled molecules, and the like.

[0041] As used herein, a "flow channel" or "channel" can be a region defined between two bonded components or a region defined within a patterned structure that is open to the external environment, either of which can selectively accept a liquid sample. In some examples, a flow channel can be defined between two patterned structures, thereby fluidly communicating with the surface chemistry of each of the patterned structures. In other examples, a flow channel can be defined between a patterned structure and a lid, thereby fluidly communicating with the surface chemistry of one patterned structure. In yet other examples, a flow channel can be defined within the substrate of a patterned structure such that it is open to the external environment.

[0042] As used herein, "heteroaryl" refers to an aromatic ring or ring system (i.e., two or more fused rings that share two adjacent atoms) containing one or more heteroatoms in the ring backbone, i.e., elements other than carbon, including, but not limited to, nitrogen, oxygen, and / or sulfur. When a heteroaryl is a ring system, all rings in the system are aromatic. Heteroaryl groups can have 5 to 18 ring members.

[0043] As used herein, "heterocycle" refers to a non-aromatic ring or ring system containing at least one heteroatom in the ring backbone. Heterocycles may be joined together in fused, bridged, or spiro-linked configurations. Heterocycles may have any degree of saturation, provided that at least one ring in the ring system is not aromatic. Within the ring system, the heteroatom may be present in either the non-aromatic or aromatic ring. Heterocyclic groups may have 3 to 20 ring members (i.e., the number of atoms forming the ring backbone, including carbon atoms and heteroatoms). In some examples, the heteroatom is O, N, or S.

[0044] As used herein, the term "hydrazine" or "hydrazinyl" refers to the group -NHNH2.

[0045] As used herein, the term "hydrazone" or "hydrazonyl" means

[0046] [ka] refers to a group, wherein R a and R b are each independently selected from hydrogen, C alkyl, C alkenyl, C alkynyl, C carbocycle, C aryl, 5-10 membered heteroaryl, and 5-10 membered heterocycle, as defined herein.

[0047] As used herein, "hydroxy" or "hydroxyl" refers to an --OH group.

[0048] As used herein, the term "gap region" refers to a region of, for example, a substrate, that separates recesses or protrusions. For example, a gap region can separate one recess or protrusion of an array from another recess or protrusion of an array. Two recesses or protrusions that are separated from each other can be distinct, i.e., lack physical contact with each other. In many instances, the gap region is continuous, but the recesses or protrusions are discontinuous, as in the case of, for example, multiple recesses defined in an otherwise continuous surface or multiple protrusions defined in an otherwise continuous surface. The gap region can have a surface material that is different from the surface material of the recesses or protrusions. For example, the recesses can have a polymer hydrogel layer and a primer therein, while the gap region can be free of the polymer hydrogel layer and primer.

[0049] As used herein, "nitrile oxide" refers to

[0050] [ka] means a group, wherein R a is defined herein. Examples of the preparation of nitrile oxides include in situ generation from aldoximes by treatment with chloramide-T, or by the action of base on imidoyl chloride [RC(Cl)=NOH], or by reaction of hydroxylamine with an aldehyde.

[0051] As used herein, "nitrone" refers to

[0052] [ka] means a group, wherein R 3 except that it is not hydrogen (H). 1 , R 2 , and R 3 is R as defined herein a and R b It can be any of the groups.

[0053] As used herein, a "nucleotide" comprises a nitrogen-containing heterocyclic base, a sugar, and one or more phosphate groups. Nucleotides are the monomeric units of nucleic acid sequences. In RNA, the sugar is ribose, and in DNA, the sugar is deoxyribose, i.e., a sugar lacking the hydroxyl group at the 2' position of the ribose. The nitrogen-containing heterocyclic base (i.e., nucleobase) can be a purine base or a pyrimidine base. Purine bases include adenine (A) and guanine (G), as well as modified derivatives or analogs thereof. Pyrimidine bases include cytosine (C), thymine (T), and uracil (U), as well as modified derivatives or analogs thereof. The C-1 atom of deoxyribose is linked to the N-1 atom of a pyrimidine or the N-9 atom of a purine. Nucleic acid analogs may have alterations in the phosphate backbone, sugar, or nucleobase. Examples of nucleic acid analogs include universal base or phosphate-sugar backbone analogs, such as peptide nucleic acids (PNAs).

[0054] In some instances, the term "over" can mean that one component or material is positioned directly on top of another component or material. When one is directly on top of the other, the two are in contact with each other. For example, in FIG. 1C, when multi-layer substrate 18 is included, multiple functionalized pads 24 are positioned directly on layer 28.

[0055] In other examples, the term "over" can mean that one component or material is indirectly positioned on another component or material. Indirectly means that a gap or additional component or material can be positioned between the two components or materials. For example, in FIG. 1C, when multi-layer substrate 18 is included, multiple functionalized pads 24 are indirectly positioned on base support 26. Layer 28 is disposed therebetween.

[0056] A "patterned structure" refers to a substrate that includes surface chemistry in a pattern, e.g., in recesses or as protrusions, across the substrate. The surface chemistry may include a polymeric hydrogel layer and a primer (e.g., used for capture and amplification of library templates). In some examples, the substrate has been exposed to a patterning technique (e.g., etching, lithography, etc.) to generate a pattern for the surface chemistry. However, the term "patterned structure" is not intended to imply that the pattern must be generated using such a patterning technique. Patterned structures may be generated via any of the methods disclosed herein.

[0057] As used interchangeably herein, the terms "photoreactive layer," "photoreactive protective layer," and "photoreactive coating" refer to a shielding layer (e.g., over a reactive entity) that can undergo a chemical / physical reaction upon exposure to a predetermined range of light wavelengths, thereby removing the layer or rendering it removable using a solvent during or after the reaction. The terms can also refer to a material that can prevent the reactive entity from chemically reacting prior to removal of the photoreactive layer.

[0058] As used interchangeably herein, the terms "photothermal filler" and "photothermal additive" refer to nano- or micro-sized structures that absorb light of a specific wavelength and convert the absorbed energy into heat (thermal energy). The photothermal fillers (or photothermal additives) described herein can be included as part of a composite material that includes a thermoresponsive polymer and a photothermal additive, and the composite material is included in an independently removable photoreactive coating.

[0059] As used herein, the term "polyhedral oligomeric silsesquioxane" refers to a hybrid intermediate between silica (SiO) and silicone (RSiO) (e.g., RSiO 1.5An example of a polyhedral oligomeric silsesquioxane may be one described in Kehagias et al., Microelectronic Engineering 86 (2009), pp. 776-778, which is incorporated by reference in its entirety. In one example, the composition may have the chemical formula [RSiO 3 / 2 ] n where the R groups can be the same or different. Exemplary R groups of the polyhedral oligomeric silsesquioxanes include epoxy, azide / azido, thiol, poly(ethylene glycol), norbornene, tetrazine, acrylate, and / or methacrylate, or further, for example, alkyl, aryl, alkoxy, and / or haloalkyl groups.

[0060] As used herein, a "polymer hydrogel layer" refers to a gel material applied over at least a portion of a substrate. The gel material includes functional groups that can attach to a primer. The polymer hydrogel layer may be disposed within a portion of a recess defined in the substrate (see recess 22 in FIG. 1B) or may define a protrusion on the substrate (see protrusion 24 in FIG. 1C).

[0061] As used herein, a "primer" is defined as a single-stranded nucleic acid sequence (e.g., single-stranded DNA). Some primers, referred to herein as amplification primers, function as initiation points for template amplification and cluster generation. Other primers, referred to herein as sequencing primers, function as initiation points for DNA synthesis. The 5' end of the primer may be modified to allow for coupling reactions with a polymer functional group. Primers can be any number of bases in length and can contain a variety of non-naturally occurring nucleotides. In one example, sequencing primers are short, ranging from 10 to 60 bases, or 20 to 40 bases.

[0062] As used herein, the term "protrusion" refers to a discrete convex feature defined on a substrate and surrounded by a void region(s) of the substrate. A protrusion can have any of a variety of shapes at the opening of the surface, including, by way of example, circular, elliptical, square, polygonal, star-shaped (having any number of vertices), etc. A cross-section of a protrusion taken perpendicular to the surface can be curved, square, polygonal, hyperbolic, conical, angular, etc.

[0063] As used herein, the term "reactive entity" refers to the flow cell surface chemistry that allows for a desired interaction or reaction. By way of example, a reactive entity can be a primer that serves as the initiation point for template amplification and cluster generation, or an enzyme tag such as a transposome complex used in tagmentation, or a reactive functional group such as dibenzocyclooctyne (DBCO), strained alkynes or azides, and biotin.

[0064] "Reactive region," as used herein, refers to a discrete region on or within a substrate that contains a polymeric hydrogel and a reactive entity.

[0065] A "removable coating," "protective coating," or "independently removable coating" is a layer disposed over a reaction area that can be removed from the reaction area without adversely affecting the polymeric hydrogel layer of the reactive entities in the reaction area. The coatings described herein can be affected by a variety of solvents / removals, such that a remover for one type of coating will not remove a different type of coating. These terms can refer to photoreactive coatings (as defined herein) or coatings with different properties with respect to solubility.

[0066] A "removal agent" is a material or mechanism capable of removing a removable coating.

[0067] As used herein, a "spacer layer" refers to a material that bonds two components together. In some examples, the spacer layer can be or be in contact with a radiation absorbing material that aids in bonding.

[0068] The term "substrate" refers to a single layer base support or a multi-layer structure into which the reaction regions are incorporated.

[0069] As used herein, the term "thermally responsive polymer" refers to a polymeric material that can undergo a phase transition (e.g., melting, transitioning from a hydrophobic state to a hydrophilic state, transitioning from a hydrophilic state to a hydrophobic state, etc.) when exposed to a specific temperature change. The thermally responsive polymer(s) described herein can be included as part of a composite material that includes an example of a thermally responsive polymer(s) and a photothermal additive.

[0070] A "thiol" functional group refers to -SH.

[0071] As used herein, the terms "tetrazine" and "tetrazinyl" refer to a six-membered heteroaryl group containing four nitrogen atoms. The tetrazine can be optionally substituted.

[0072] As used herein, "tetrazole" refers to a five-membered heterocyclic group containing four nitrogen atoms. The tetrazole can be optionally substituted.

[0073] Flow cell Examples of flow cells disclosed herein generally include a substrate, a plurality of reaction regions spatially separated from one another across the substrate, each of the plurality of reaction regions comprising a polymer hydrogel layer and a reactive entity attached to the polymer hydrogel layer, and a plurality of independently removable coatings respectively disposed on each of the plurality of reaction regions.

[0074] A top view of flow cell 10 is shown in Figure 1A, and different examples of constructs within flow channel 12 of flow cell 10 are shown in Figures 1B and 1C. Each of the constructs can include one patterned structure 14A or 14B bonded to a lid (not shown), or two patterned structures (the second of which is not shown) bonded to each other. In yet other constructs, patterned structures 14A, 14B are open wafers and therefore not bonded to either a lid or another patterned structure.

[0075] In some examples, flow channel 12 is defined between one patterned structure 14A or 14B and a lid or second patterned structure, which are joined together via a spacer layer (not shown). Thus, in these examples, each flow channel 12 is defined by patterned structure 14A or 14B, the spacer layer, and either the lid or second patterned structure. In other examples, patterned structure 14A or 14B may include sidewalls around its perimeter (e.g., at bond region 20) that extend above gap region 30 to form open flow channel 12.

[0076] 1A includes eight flow channels 12. While eight flow channels 12 are shown, it should be understood that any number of flow channels 12 may be included in the flow cell 10 (e.g., a single flow channel 12, four flow channels 12, etc.). When multiple flow channels 12 are included, each flow channel 12 may be isolated from the other flow channels 12 such that fluid introduced into a flow channel 12 does not flow into adjacent flow channel(s) 12.

[0077] Each flow channel 12 is in fluid communication with an inlet and an outlet (not shown). The inlet and outlet of each flow channel 12 may be located at opposite ends of the flow cell 10. Alternatively, the inlet and outlet of each flow channel 12 may be positioned anywhere along the length and width of the flow channel 12 that allows for the desired fluid flow.

[0078] The inlets allow fluids to be introduced into the flow channel 12, and the outlets allow fluids to be withdrawn from the flow channel 12. Each of the inlets and outlets is fluidly connected to a fluidic control system (e.g., including reservoirs, pumps, valves, waste containers, etc.) that controls the introduction and removal of fluids. Some examples of fluids introduced into the flow channel 12 may introduce reaction components (e.g., DNA sample, polymerase, sequencing primers, nucleotides, etc.), wash solutions, deblocking agents, etc.

[0079] The flow channel 12 can have any desired shape. In one example, the flow channel 12 has a substantially rectangular configuration with curved ends (as shown in FIG. 1A). The length of the flow channel 12 depends in part on the size of the substrate (e.g., 16 or 18, see FIGS. 1B and 1C) used to form the patterned structures 14A, 14B. The width of the flow channel 12 depends in part on the size of the substrate 16 or 18 used to form the patterned structures 14A, 14B, the desired number of flow channels 12, the desired spacing between adjacent channels 12, and the desired spacing around the patterned structures 14A, 14B. The spacing between and around the channels 12 may be sufficient for attachment of a lid (not shown) or another patterned structure (not shown).

[0080] If microcontact printing, aerosol printing, or inkjet printing is used to deposit a separate material (e.g., a spacer layer (not shown)) that defines at least a portion of the sidewall of flow channel 12, the depth of flow channel 12 can be as little as a monolayer thickness. In other examples, the depth of flow channel 12 can be about 1 μm, about 10 μm, about 50 μm, about 100 μm, or more. In one example, the depth can be in the range of about 10 μm to about 100 μm. In another example, the depth can be in the range of about 10 μm to about 30 μm. In yet another example, the depth is about 5 μm or less. It should be understood that the depth of flow channel 12 can be greater, less, or any value in between the values ​​recited above.

[0081] The spacer layer used to attach the patterned structures 14A, 14B and the lid or second patterned structure can be any material that seals portions of the patterned structures 14A, 14B and the lid or second patterned structure. By way of example, the spacer layer can be an adhesive, a radiation absorbing material that aids in bonding, etc. In some examples, the spacer layer is a radiation absorbing material, such as KAPTON® Black.

[0082] The patterned structures 14A, 14B and the lid or second patterned structure may be bonded using any suitable technique, such as laser bonding, diffusion bonding, anodic bonding, eutectic bonding, plasma activated bonding, glass frit bonding, or other methods known in the art.

[0083] If used, the lid can be any material that is transparent to the excitation light directed toward the flow cell 10. In optical detection systems, the lid can also be transparent to the radiation generated from the reaction(s) occurring within the flow cell 10. By way of example, the lid can comprise glass (e.g., borosilicate, fused silica, etc.) or a transparent polymer. A commercially available example of a suitable borosilicate glass is D263® available from Schott North America Inc. Commercially available examples of suitable polymeric materials, i.e., cycloolefin polymers, are ZEONOR® products available from Zeon Chemicals LP. In some cases, the lid is molded to form the top of the flow cell 10; in other cases, the lid is molded to form both the top of the flow cell and the sidewalls of the flow channel 12.

[0084] The patterned structures 14A, 14B may include a bonding region 20 that may be sealed to a lid or a second patterned structure. The bonding region 20 may be located around each flow channel 12 and around the flow cell 10 (as shown in FIGS. 1B and 1C). This region 20 may serve as the perimeter of an open-wafer version of the patterned structures 14A, 14B.

[0085] 1B and 1C can also be used as an open wafer flow cell without a lid or second patterned structure, in which the patterned structures 14A, 14B are open to the external environment.

[0086] Patterned structures 14A, 14B include a substrate 16 or 18, as shown in Figures 1B and 1C. Substrate 16 is a single-layer base support, while substrate 18 is a multi-layer structure. Substrate 16 is a single material having recesses 22 defined therein or protrusions 24 defined thereon. Substrate 18 includes a base support 26 and another layer 28 disposed on base support 26, with the other layer 28 having recesses 22 defined therein or protrusions 24 defined thereon.

[0087] Examples of materials suitable for the substrate 16 include siloxanes (e.g., epoxy siloxanes), glass, modified or functionalized glass, polymeric materials (acrylics, polystyrene and copolymers of styrene with other materials, polypropylene, polyethylene, polybutylene, polyurethane, polytetrafluoroethylene (e.g., TEFLON® from Chemours), polyethylene terephthalate (PET), polycarbonate, cyclic olefins / cyclic olefin polymers (COP) (e.g., ZEONOR® from Zeon), polyimides, nylons (polyamides), etc.), ceramics / ceramic oxides, aluminum silicate, silicon and modified silicon (e.g., boron-doped p+ silicon), silicon nitride (Si3N4), carbon, metals, resins, etc. Examples of suitable inorganic resins include inorganic oxides, such as tantalum pentoxide (e.g., Ta2O5) or other tantalum oxide(s) (TaO x ), aluminum oxide (e.g., Al2O3), silica (i.e., silicon dioxide (SiO2)), fused silica or silica-based materials, hafnium oxide (e.g., HfO2), indium tin oxide, titanium dioxide, etc. Examples of suitable polymer resins include polyhedral oligomeric silsesquioxane-based resins (e.g., POSS® from Hybrid Plastics), non-polyhedral oligomeric silsesquioxane epoxy resins, poly(ethylene glycol) resins, polyether resins (e.g., ring-opened epoxies), acrylic resins, acrylate resins, methacrylate resins, amorphous fluoropolymer resins (e.g., CYTOP® from Bellex), and combinations thereof.

[0088] As mentioned above, an example of a multi-layer structure (i.e., substrate 18) includes a base support 26 and at least one other layer 28 thereon. Any example of a single-layer base support (i.e., substrate 16) can be used as base support 26. In these examples, the other layer 28 can be any material that can be etched or imprinted to form recesses 22. Examples of layer 28 include inorganic oxides such as tantalum oxide (e.g., Ta2O5), aluminum oxide (e.g., Al2O3), silicon oxide (e.g., SiO2), or hafnium oxide (e.g., HfO2), or polymer resins such as polyhedral oligomeric silsesquioxane-based resins (e.g., POSS® from Hybrid Plastics), non-polyhedral oligomeric silsesquioxane epoxy resins, poly(ethylene glycol) resins, polyether resins (e.g., ring-opened epoxies), acrylic resins, acrylate resins, methacrylate resins, amorphous fluoropolymer resins (e.g., CYTOP® from Bellex), and combinations thereof.

[0089] In any of the examples described herein, the substrate 16 or base support 26 may be a circular sheet, panel, wafer, die, etc. having a diameter ranging from about 2 mm to about 300 mm, e.g., from about 200 mm to about 300 mm, or may be a rectangular sheet, panel, wafer, die, etc. having a maximum dimension of up to about 10 feet (about 3 meters). By way of example, a die may have a width ranging from about 0.1 mm to about 10 mm. While exemplary dimensions are provided, it should be understood that the substrate 16 or base support 26 may have any suitable dimensions.

[0090] As shown in Figure 9, an example flow cell 10' includes a complementary metal oxide semiconductor (CMOS) chip 94 attached to a substrate 16. For ease of illustration, the substrate 16 is shown in Figure 9. However, it should be understood that a multi-layer substrate 18 could be used instead, with the CMOS chip 94 attached to the substrate 18 via a base support 26.

[0091] In addition to the complementary metal oxide semiconductor chip 94, this exemplary flow cell 10' includes a substrate 16 on the complementary metal oxide semiconductor chip 94, the substrate 16 including a plurality of recesses 22 separated by gap regions 30, a polymer hydrogel 32 within the recesses 22, and a reactive entity 34 attached to the polymer hydrogel 32.

[0092] In the illustrated example, the substrate 16 may be directly secured to the complementary metal oxide semiconductor chip 94 via one or more securing mechanisms (e.g., adhesives, bonds, fasteners, etc.), thereby physically contacting the complementary metal oxide semiconductor chip 94. It should be understood that the substrate 16 may be removably coupled to the complementary metal oxide semiconductor (CMOS) chip 94.

[0093] The CMOS chip 94 includes multiple stacked layers 96, such as, for example, silicon layer(s), dielectric layer(s), metal-dielectric layer(s), metal layer(s), etc. The stacked layers 96 make up the device circuitry, including the detection circuitry.

[0094] The CMOS chip 94 includes optical components, such as optical sensor(s) 98 and optical waveguide(s) 100. The optical components are arranged such that each optical sensor 98 is at least substantially aligned with, and thereby operatively associated with, a single optical waveguide 100 and a single reaction region 29A or 29B of the flow cell 10′. However, in other examples, a single optical sensor 98 may receive photons via two or more optical waveguides 100 and / or from two or more reaction regions 29A, 29B. In these other examples, a single optical sensor 98 is operatively associated with two or more optical waveguides 100 and / or two or more reaction regions 29A, 29B.

[0095] As used herein, a single optical sensor 98 can be an optical sensor having one pixel or two or more pixels. By way of example, each optical sensor 98 has a pixel size of about 50 μm. 2 As another example, the detection area may be less than about 10 μm2 As yet another example, the detection area may be less than about 2 μm 2 In the latter example, the optical sensor 98 may comprise a single pixel. The average read noise of each pixel of the optical sensor 98 may be, for example, less than about 150 electrons. In other examples, the read noise may be less than about 5 electrons. The resolution of the optical sensor(s) 98 may be greater than about 0.5 megapixels (Mpixels). In other examples, the resolution may be greater than about 5 Mpixels or greater than about 10 Mpixels.

[0096] Also, as used herein, a single optical waveguide 100 may be an optical waveguide including a cured filter material that i) filters excitation light 104 (propagating from outside the flow cell 10′ into the flow channel 12) and ii) allows optical radiation (resulting from reactions in the reaction region(s) 29A, 29B, not shown) to propagate therethrough toward the corresponding optical sensor(s) 98. In one example, the optical waveguide 100 may be, for example, an organic absorption filter. As a specific example, the organic absorption filter may filter excitation light 104 at a wavelength of approximately 532 nm and allow optical radiation at wavelengths of approximately 570 nm or greater. The optical waveguide 100 may be formed by first forming a waveguide cavity in the dielectric layer 106 and then filling the waveguide cavity with an appropriate filter material.

[0097] The light guide 100 can be configured relative to the dielectric material 106 to form a light guiding structure. For example, the light guide 100 can have a refractive index of approximately 2.0 such that optical radiation is substantially reflected at the interface between the light guide 100 and the surrounding dielectric material 106. In a particular example, the light guide 100 is selected so that the optical density (OD) or absorbance of the excitation light 104 is at least approximately 4 OD. More specifically, the filter material can be selected and the light guide 100 can be dimensioned to achieve at least 4 OD. In other examples, the light guide 100 can be configured to achieve at least approximately 5 OD or at least approximately 6 OD.

[0098] In this example, the substrate 16 functions as a passivation layer. At least a portion of the passivation substrate 16 is in contact with the first buried metal layer 112 of the CMOS chip 94 and also in contact with the input region 110 of the optical waveguide 100. The contact between the passivation substrate 16 and the first buried metal layer 112 can be direct contact or indirect contact via the shielding layer 114.

[0099] The substrate 16 (passivation layer) may provide a level of corrosion protection for the buried metal layer 112 of the CMOS chip 94, which is closest to the substrate 16. In this example, the substrate 16 may include a passivation material that is transparent to optical radiation (e.g., visible light) resulting from reactions in the reaction regions 29A, 29B and is at least initially resistant to the fluid environment and moisture that may be introduced or present within the flow channel 12. The at least initially resistant material acts as an etch barrier to high pH reagents (e.g., pH in the range of 8-14) and as a moisture barrier. Examples of suitable materials for the substrate 16 (or base support 26) of the flow cell 10' include silicon nitride (Si3N4), silicon oxide (SiO2), tantalum pentoxide (TaO5), hafnium oxide (HfO2), and boron-doped p+ silicon. The thickness of the substrate 16 may vary depending in part on the dimensions of the sensor. In one example, the thickness of the substrate 16 is in the range of about 100 nm to about 500 nm.

[0100] In one example, the lid 116 of the flow cell 10′ can be a substantially rectangular block having at least a substantially flat outer surface 118 and at least a substantially flat inner surface 120 that defines a portion of the flow channel 12. The block can be placed on the material 64. Alternatively, the block can be etched such that the lid 116 defines both the top and sidewalls of the channel 12. In these examples, a thin layer of material 64 can bond the lid 116 to the substrate 16. In one example, a recess can be etched into a transparent block. When the etched block is placed on the substrate 16, the recess can become the flow channel 12.

[0101] As mentioned above, the lid 116 may be physically connected to the substrate 16 via the material 64. The material 64 is bonded to a portion of the surface of the substrate 16 and extends between that portion of the lid 116 that is intended to contact the substrate 16. In some examples, the material 64 comprises a curable adhesive layer that bonds the lid 116 to the substrate 16 (over a portion of its surface).

[0102] The lid 116 may include inlet and outlet ports 122, 124 configured to fluidly engage with other ports (not shown) to direct fluid(s) into the flow channel 12 (e.g., from a reagent cartridge or other fluid storage system component) and out of the flow channel 12 (e.g., to a waste removal system).

[0103] Flow channel 12 may be sized and shaped to direct fluid along reaction region(s) 29A, 29B. The height of flow channel 12 and other dimensions of flow channel 12 may be configured to maintain a substantially uniform flow of fluid along reaction region(s) 29A, 29B. The dimensions of flow channel 12 may also be configured to control bubble formation. In one example, the height of flow channel 12 may range from about 50 μm to about 400 μm. In another example, the height of flow channel 12 may range from about 80 μm to about 200 μm. It should be understood that the height of flow channel 12 may vary and may be greatest when reaction regions 29A, 29B are located within reaction chambers (e.g., recesses 22) defined in the surface of substrate 16. In these examples, recesses 22 increase the height of flow channel 12 in this particular region.

[0104] Each reaction area 29A, 29B is a localized area within substrate 16 where a designated reaction can occur. In flow cell 10', each reaction area 29A, 29B is a recess 22 having a polymer hydrogel 32 therein, which is functionalized with a reactive entity 34. Although not shown in Figure 9, each reaction area 29A, 29B can include an example of an independently removable coating 36 disclosed herein that covers the reactive entity 34.

[0105] The polymer hydrogel 32 may be selectively deposited (e.g., using sputter coating, thermal evaporation, or any other suitable technique) or applied and polished into the recesses 22 as described herein with reference to FIG. 1B.

[0106] In one example, reaction region 29A or 29B is at least substantially aligned with input region 110 of a single optical waveguide 100. Thus, optical radiation in reaction region 29A, 29B can be directed through waveguide 100 into input region 110 and to an associated optical sensor 98. In another example, one reaction region 29A, 29B can be aligned with multiple input regions 110 of multiple optical waveguides 100. In yet another example, multiple reaction regions 29A, 29B can be aligned with a single input region 110 of a single optical waveguide 100.

[0107] The buried metal layer 112 can be any suitable CMOS metal, such as aluminum (Al), aluminum chloride (AlCl), tungsten (W), nickel (Ni), or copper (Cu). The buried metal layer 112 is a functional part of the CMOS AVdd line and is also electrically connected to the optical sensor 98 through the stacked layers 96. Thus, the buried metal layer 112 participates in the detection / sensing operation.

[0108] It should be understood that the other optical sensors 98 and associated components may be configured in the same or similar manner. However, it should also be understood that the CMOS chip 94 need not be manufactured identically or uniformly throughout. Instead, one or more optical sensors 98 and / or associated components may be manufactured differently or have different relationships with respect to one another.

[0109] The stacked layers 96 may include interconnected conductive elements (e.g., conductors, traces, vias, interconnects, etc.) capable of conducting electrical current. The circuitry may be configured to selectively transmit a data signal based on the detected photons. The circuitry may also be configured for signal amplification, digitization, storage, and / or processing. The circuitry may collect and analyze the detected optical radiation and generate a data signal for communicating the detection data to a bioassay system. The circuitry may also perform additional analog and / or digital signal processing within the CMOS chip 94.

[0110] The CMOS chip 94 may be fabricated using an integrated circuit fabrication process. The CMOS chip 94 may include multiple layers, such as a sensor base / layer (e.g., a silicon layer or wafer). The sensor base may include an optical sensor 98. Once the CMOS chip 94 is fully formed, the optical sensor 98 may be electrically coupled to the rest of the circuitry in the stack layer 96 via gate(s), transistor(s), etc.

[0111] 9, the term "layer" is not limited to a single contiguous body of material unless otherwise specified. For example, a sensor base / layer may include multiple sublayers that are different materials and / or may include coatings, adhesives, etc. Furthermore, one or more layers (or sublayers) may be modified (e.g., etched, deposited with material, etc.) to provide the features described herein.

[0112] The stacked layers 96 also include a plurality of metal-dielectric layers, each of which includes a metal element (e.g., M1-M5, which may be, for example, W (tungsten), Cu (copper), Al (aluminum), or any other suitable CMOS conductive material) and a dielectric material 106 (e.g., SiO2). A variety of metal elements M1-M5 and dielectric materials 106 may be used, such as those suitable for integrated circuit fabrication.

[0113] In the example shown in FIG. 9, each of the multiple metal-dielectric layers L1-L6 includes both metal elements M1, M2, M3, M4, and M5 and a dielectric material 106. In each of layers L1-L6, the metal elements M1, M2, M3, M4, and M5 are interconnected and embedded within the dielectric material 106. Some of the metal-dielectric layers L1-L6 may also include additional metal elements. Some of these additional metal elements may be used to address individual pixels via row and column selectors. The voltages on these elements vary depending on which pixel the device is reading and may switch between approximately −1.4V and approximately 4.4V.

[0114] It should be understood that the configuration of metal elements M1, M2, M3, M4, M5 and dielectric layer 106 in FIG. 9 is an example of a circuit, and other examples may include fewer layers or additional layers and / or have different configurations of metal elements M1-M5.

[0115] 9, the shielding layer 114 is in contact with at least a portion of the substrate 16. The shielding layer 114 has openings at least partially adjacent to the input regions 110 of the optical waveguides 100. The openings allow the reaction regions 29A, 29B (and at least a portion of the optical emission therefrom) to be optically coupled to the waveguides 100. It should be understood that the shielding layer 114 may have openings at least partially adjacent to the input regions 110 of each optical waveguide 100. The shielding layer 114 may extend continuously between adjacent openings.

[0116] Shielding layer 114 may include any material capable of blocking, reflecting, and / or significantly attenuating optical signals propagating through flow channel 12. The optical signals may be excitation light 104 and / or optical emissions from reaction region(s) 29A, 29B. By way of example, shielding layer 114 may be tungsten (W).

[0117] It should be understood that the flow cell 10' can also be used for optical detection.

[0118] 1B and 1C, which each illustrate different examples of structures within flow channel 12 of flow cell 10. In FIG. 1B, recesses 22 are defined within substrate 16 or within layer 28 of substrate 18. In FIG. 1C, protrusions 24 are defined on substrate 16 or within layer 28 of substrate 18.

[0119] Many different layouts of the recesses 22 or protrusions 24 are contemplated, including regular, repeating, and irregular patterns. In one example, the recesses 22 or protrusions 24 are arranged in a hexagonal lattice for close packing and increased density. Other layouts may include, for example, rectangular layouts, triangular layouts, etc. In some examples, the layout or pattern may be in an xy format with rows and columns. In some other examples, the layout or pattern may be a repeating arrangement of the recesses 22 or protrusions 24 and void regions 30. In yet other examples, the layout or pattern may be a random arrangement of the recesses 22 or protrusions 24 and void regions 30.

[0120] The layout or pattern may be characterized in terms of the density (number) of depressions 22 or protrusions 24 within a defined area. For example, the depressions 22 or protrusions 24 may be spaced apart by 1 mm 2 They may be present at a density of about 2 million per mm. 2 Approximately 100, 1mm per 2 Approximately 1,000 per 1mm 2 Approximately 100,000 per 1mm 2 Approximately 1 million per 1mm 2 Approximately 2 million per 1mm 2 Approximately 5 million per 1mm 2 Approximately 10 million per mm 2The density can be adjusted to different densities, including densities of about 50 million per unit area, or higher or lower. It should be further understood that the density can be between one of the lower limit values ​​and one of the upper limit values ​​selected from the ranges above, or other densities (outside of the given ranges) can be used. By way of example, a high-density array can be characterized as having depressions 22 or protrusions 24 separated by less than about 100 nm, a medium-density array can be characterized as having depressions 22 or protrusions 24 separated by about 400 nm to about 1 μm, and a low-density array can be characterized as having depressions 22 or protrusions 24 separated by more than about 1 μm.

[0121] The layout or pattern of the depressions 22 or protrusions 24 may also, or alternatively, be characterized in terms of the average pitch, or the spacing from the center of one depression 22 or protrusion 24 to the center of an adjacent depression 22 or protrusion 24 (center-to-center spacing), or the spacing from the right edge of one depression 22 or protrusion 24 to the left edge of an adjacent depression 22 or protrusion 24. The pattern may be regular so that the coefficient of variation around the average pitch is small, or the pattern may be irregular, in which case the coefficient of variation may be relatively large. In either case, the average pitch may be, for example, about 50 nm, about 0.15 μm, about 0.5 μm, about 1 μm, about 5 μm, about 10 μm, or about 100 μm, or more or less. The average pitch of a particular pattern of depressions 22 or protrusions 24 may be between one of the lower values ​​and one of the upper values ​​selected from the ranges herein. In one example, the depressions 22 or protrusions 24 have a pitch (center-to-center spacing) of about 1.5 μm. Although examples of average pitch values ​​have been provided, it should be understood that other average pitch values ​​may also be used.

[0122] The size of each recess 22 may be characterized by its volume, opening area, depth, and / or diameter or length and width. For example, the volume may be about 1×10 -3 μm 3 ~about 100μm 3 ranges from about 1 × 10 -2 μm 3 , about 0.1μm 3, about 1μm 3 , about 10μm 3 In another example, the opening area is about 1×10 -3 μm 2 ~about 100μm 2 ranges from about 1 × 10 -2 μm 2 , about 0.1μm 2 , about 1μm 2 , at least about 10 μm 2 In yet another example, the depth may range from about 0.1 μm to about 100 μm, for example, about 0.5 μm, about 1 μm, about 10 μm, or more or less. In another example, the depth may range from about 0.1 μm to about 100 μm, for example, about 0.5 μm, about 1 μm, about 10 μm, or more or less. In yet another example, the diameter or each of the length and width may range from about 0.1 μm to about 100 μm, for example, about 0.5 μm, about 1 μm, about 10 μm, or more or less.

[0123] The size of each protrusion 24 can be characterized by its upper surface area, height, and / or diameter or length and width. The upper surface area is about 1×10 -3 μm 2 ~about 100μm 2 ranges from about 1 × 10 -2 μm 2 , about 0.1μm 2 , about 1μm 2 , at least about 10 μm 2 The height may range from about 0.1 μm to about 100 μm, for example, about 0.5 μm, about 1 μm, about 10 μm, or more or less. The diameter or each of the length and width may range from about 0.1 μm to about 100 μm, for example, about 0.5 μm, about 1 μm, about 10 μm, or more or less.

[0124] Each of the constructs also includes a reactive region 29A or 29B. In the example shown in Figure 1B, reactive region 29A includes a polymer hydrogel 32 applied within recess 22 and a reactive entity 34 attached to polymer hydrogel 32. In the example shown in Figure 1C, reactive region 29B includes a polymer hydrogel 32 in the form of protrusion 24 applied on substrate 16 or layer 28 and a reactive entity 34 attached to polymer hydrogel 32.

[0125] The polymer hydrogel 32 can be any gel material that can swell when fluid is taken up and shrink when the fluid is removed, for example, by drying. In one example, the gel material is an acrylamide copolymer. Some examples of acrylamide copolymers are represented by the following structure (I):

[0126] [ka] During the ceremony, R A is selected from the group consisting of azide, optionally substituted amino, optionally substituted alkenyl, optionally substituted alkyne, halogen, optionally substituted hydrazone, optionally substituted hydrazine, carboxyl, hydroxy, optionally substituted tetrazole, optionally substituted tetrazine, nitrile oxide, nitrone, sulfate, and thiol; R B is H or optionally substituted alkyl; R C , R D , and R E are each independently selected from the group consisting of H and optionally substituted alkyl; -(CH2) p - may be optionally substituted, p is an integer ranging from 1 to 50; n is an integer ranging from 1 to 50,000, and m is an integer ranging from 1 to 100,000.

[0127] One specific example of an acrylamide copolymer represented by structure (I) is poly(N-(5-azidoacetamidylpentyl)acrylamide-co-acrylamide), PAZAM.

[0128] Those skilled in the art will recognize that the arrangement of the "n" and "m" repeating features in structure (I) is representative, and that the monomer subunits can be present in any order in the polymer structure (e.g., random, block, patterned, or combinations thereof). The molecular weight of the acrylamide copolymer can range from about 5 kDa to about 1500 kDa, or from about 10 kDa to about 1000 kDa, or in a specific example, can be about 312 kDa.

[0129] In some instances, the acrylamide copolymer is a linear polymer. In other instances, the acrylamide copolymer is a lightly crosslinked polymer.

[0130] In another example, the gel material can be a variation of structure (I). In one example, the acrylamide unit is N,N-dimethylacrylamide.

[0131] [ka] In this example, the acrylamide unit of structure (I) can be replaced by

[0132] [ka] where R D , R E , and R F are each H or C1-C6 alkyl, and R G and R Hare each C1-C6 alkyl (rather than H as in acrylamide). In this example, q may be an integer ranging from 1 to 100,000. In another example, in addition to the acrylamide units, N,N-dimethylacrylamide may be used. In this example, structure (I) contains, in addition to the repeated "n" and "m" features,

[0133] [ka] wherein R D , R E , and R F are each H or C1-C6 alkyl, and R G and R H are each C1-C6 alkyl. In this example, q can be an integer ranging from 1 to 100,000.

[0134] As another example of a gel material, the repeating "n" feature in structure (I) can be replaced with a heterocyclic azide group-containing monomer having structure (II):

[0135] [ka] In the formula, R 1 is H or C1-C6 alkyl, R2 is H or C1-C6 alkyl, L is a linker comprising a linear chain of 2-20 atoms selected from the group consisting of carbon, oxygen, and nitrogen, and including 10 optional substituents on the carbon and any nitrogen atoms in the chain, E is a linear chain of 1-4 atoms selected from the group consisting of carbon, oxygen, and nitrogen, and including optional substituents on the carbon and any nitrogen atoms in the chain, A is an N-substituted amide with H or C1-C4 alkyl attached to the N, and Z is a nitrogen-containing heterocycle. Examples of Z include 5-10 carbon-containing ring members present as single ring structures or fused structures. Some specific examples of Z include pyrrolidinyl, pyridinyl, or pyrimidinyl.

[0136] As yet another example, the gel material may include repeat units of each of structures (III) and (IV):

[0137] [ka] In the formula, R 1a , R 2a , R 1b and R 2b each independently selected from hydrogen, optionally substituted alkyl, or optionally substituted phenyl; R 3a and R 3b each is independently selected from hydrogen, optionally substituted alkyl, optionally substituted phenyl, or optionally substituted C7-C14 aralkyl; 1 and L 2 are each independently selected from an optionally substituted alkylene linker or an optionally substituted heteroalkylene linker.

[0138] In yet another example, an acrylamide copolymer is formed using nitroxide-mediated polymerization, whereby at least a portion of the copolymer chain has an alkoxyamine end group. In the copolymer chain, the term "alkoxyamine end group" refers to a dormant species -ONR1R2, where each of R1 and R2 can be the same or different and independently can be a straight or branched chain alkyl or cyclic structure, and the oxygen atom is attached to the remainder of the copolymer chain. In some examples, the alkoxyamine also is attached to some of the repeating acrylamide monomers, such as R in structure (I). A Thus, in one example, structure (I) includes an alkoxyamine end group, and in another example, structure (I) includes an alkoxyamine end group and an alkoxyamine group on at least a portion of the side chain.

[0139] It should be understood that other molecules can be used to form the polymer hydrogel 32, provided they can be functionalized with a desired chemical, such as the primer set(s) or another desired reactive entity 34. Some examples of materials suitable for the polymer hydrogel 32 include functionalized silanes, such as norbornene silanes, azido silanes, alkyne-functionalized silanes, amine-functionalized silanes, maleimide silanes, or any other silanes with functional groups to which a desired chemical can be attached. Still other examples of materials suitable for the polymer hydrogel 32 include those with colloidal structures, such as agarose, or polymer mesh structures, such as gelatin, or those with crosslinked polymer structures, such as polyacrylamide polymers and copolymers, silane-free acrylamide (SFA), or azide-decomposed versions of SFA. Examples of suitable polyacrylamide polymers can be synthesized from acrylamide and acrylic acid or vinyl-containing acrylic acid, or from monomers that form a [2+2] photocycloaddition reaction. Yet other examples of suitable materials for the polymer hydrogel 32 include mixed copolymers of acrylamide and acrylate. Various polymer constructs containing acrylic monomers (e.g., acrylamide, acrylate, etc.), such as branched polymers (e.g., multi-arm or star polymers or star-block polymers), including dendrimers, can be utilized in the examples disclosed herein. For example, monomers (e.g., acrylamide, acrylamide containing a catalyst, etc.) can be incorporated into the branches (arms) of the dendrimer, either randomly or in blocks.

[0140] The gel material of the polymer hydrogel 32 may be formed using any suitable copolymerization process, such as nitroxide-mediated polymerization (NMP), reversible addition-fragmentation chain transfer (RAFT) polymerization, or the like.

[0141] Attachment of the polymer hydrogel 32 to the underlying component (e.g., substrate 16 or layer 28) can be by covalent bonding. In some cases, the underlying substrate 16 or layer 28 can be first activated, for example, by silanization or plasma ashing. The covalent bonding helps maintain the primer set in the desired region throughout the life of the flow cell 10 during various uses.

[0142] In each example, the polymer hydrogel 32 has a reactive entity 34 attached thereto. In some examples of the flow cell 10, the reactive entity 34 in each of the plurality of reaction regions 29A, 29B is a primer set. In one of these examples, the primer set is the same in each of the plurality of reaction regions 29A, 29B. In another of these examples, the primer set in at least one of the plurality of reaction regions 29A, 29B is different from the primer set in at least one other of the plurality of reaction regions 29B, 29A.

[0143] A primer set that can be used as the reactive entity 34 includes two different primers used in continuous paired-end sequencing. In another example, the reactive entity 34 is an enzyme tag, such as a transposome complex, that enables tagmentation. Thus, in one example, the reactive entity 34 in each of the multiple reaction regions 29A, 29B is independently selected from the group consisting of a primer set and an enzyme tag.

[0144] As described above, when the reactive entity 34 is a primer set, the primer set includes two different primers used in continuous paired-end sequencing. For example, the primer set may include P5 and P7 primers, P15 and P7 primers, or any combination of PA primers, PB primers, PC primers, and PD primers described herein. For example, the primer set may include any two of PA primers, PB primers, PC primers, and PD primers, or any combination of one PA primer and one PB primer, PC primer, or PD primer, or any combination of one PB primer and one PC primer or PD primer, or any combination of one PC primer and one PD primer.

[0145] Examples of P5 and P7 primers are used on the surface of commercially available flow cells sold by Illumina Inc. for sequencing on, for example, HiSeq™, HiSeqX™, MiSeq™, MiSeqDX™, MiNISeq™, NextSeq™, NextSeqDX™, NovaSeq™, iSEQ™, Genome Analyzer™ and other instrument platforms. The P5 primer (denoted as a cleavable primer due to the cleavable nucleobase uracil or "n") is P5#1:5'→3' AATGATACGGCGACCACCGAGAUCTACAC (SEQ ID NO: 1), P5#2:5'→3' AATGATACGGCGACCACCGAGAnCTACAC (SEQ ID NO: 2) where "n" is inosine in SEQ ID NO: 2, or number 2, or P5#3:5'→3' AATGATACGGCGACCACCGAGAnCTACAC (SEQ ID NO: 3), where "n" is the alkene-thymidine (i.e., alkene-dT) in SEQ ID NO: 3.

[0146] The P7 primer (shown as a cleavable primer) may be either: P7#1:5'→3' CAAGCAGAAGACGGCATACGAnAT (SEQ ID NO: 4) wherein "n" is 8-oxoguanine in SEQ ID NO: 4; P7#2:5'→3' CAAGCAGAAGACGGCATACnAGAT (SEQ ID NO: 5), wherein "n" is 8-oxoguanine in SEQ ID NO:5. P7#3:5'→3' CAAGCAGAAGACGGCATACnAnAT (SEQ ID NO: 6) wherein "n" in both cases is 8-oxoguanine in SEQ ID NO:6; P7#4:5'→3' CAAGCAGAAGACGGCATACGAUAT (SEQ ID NO: 7), or P7#5:5'→3' CAAGCAGAAGACGGCATACUAGAT (SEQ ID NO: 8).

[0147] The P15 primer (shown as the cleavable primer) is as follows: P15:5'→3' AATGATACGGCGACCACCGAGAnCTACAC (SEQ ID NO: 9) where "n" is allyl-T (i.e., a thymine nucleotide analogue bearing an allyl functional group).

[0148] Other primers mentioned above (PA-PD, shown as non-cleavable primers) include: PA 5'→3' GCTGGCACGTCCGAACGCTTCGTTAATCCGTTGAG (SEQ ID NO: 10) PB 5'→3' CGTCGTCTGCCATGGCGCTTCGGTGGATATGAACT (SEQ ID NO: 11) PC 5'→3' ACGGCCGCTAATATCAACGCGTCGAATCCGCAACT (SEQ ID NO: 12), and PD 5'→3' GCCGCGTTACGTTAGCCGGACTATTCGATGCAGC (SEQ ID NO: 13).

[0149] Although not shown in the exemplary sequence for PA-PD, it should be understood that any of these primers may contain a cleavage site (e.g., uracil, 8-oxoguanine, allyl-T, etc.) at any point in the strand.

[0150] Each of the primers disclosed herein may also include a poly-T sequence at the 5' end of the primer sequence. In some examples, the poly-T region includes 2 to 20 T bases. As specific examples, the poly-T region may include 3, 4, 5, 6, 7, or 10 T bases.

[0151] The 5' end of each primer may also include a linker. Any linker containing a terminal alkyne group or another suitable terminal functional group capable of attaching to a surface functional group of the polymer hydrogel 32 may be used. In one example, the primer is terminated with a hexynyl functional group.

[0152] As described, in some examples, the same reactive entity 34 (e.g., a primer set) is attached to the polymer hydrogel 32 present in each of the recesses 22 or to the polymer hydrogel 32 forming each of the protrusions 24. For example, the primer set is the same in each of the plurality of reaction regions 29A, 29B. In other examples, one reactive entity 34 (e.g., a primer set including P5 primers and P7 primers) is attached to a subset of the recesses 22 or a subset of the protrusions 24, and a different reactive entity 34 (e.g., another primer set including PA primers and PB primers) is attached to a subset of the recesses 22 or a subset of the protrusions 24. Thus, as described above, the primer set in at least one of the plurality of reaction regions 29A, 29B is different from the primer set in at least one other of the plurality of reaction regions 29A, 29B.

[0153] The construct shown in FIG. 1B can be produced by forming recesses 22 in layer 28 of substrate 16 or substrate 18, introducing polymer hydrogel 32 into recesses 22, and attaching reactive entities 34 (e.g., primers of a primer set) to polymer hydrogel 32.

[0154] The recesses 22 may be formed using etching or nanoimprint lithography.

[0155] A mixture of polymer hydrogels 32 may be produced. In one example, the polymer hydrogel 32 may be in a mixture (e.g., with water, or with ethanol and water). The polymer hydrogel 32 may be blanket deposited on the substrate 16 or on the layer 28 of the substrate 18 and then removed from the interstitial regions 30 using abrasive techniques.

[0156] The reactive entity 34 may then be attached to the polymer hydrogel 32. As one example, a primer or transposome complex may be grafted to the polymer hydrogel 32. Grafting may be achieved by flow-through deposition (e.g., using a temporarily attached lid), dunk coating, spray coating, droplet dispensing, or another suitable method. Each of these exemplary techniques may utilize a solution or mixture that may include the reactive entity 34, water, a buffer, and a catalyst. With either grafting method, the reactive entity 34 attaches to a reactive group on the polymer hydrogel 32 and does not react with the interstitial region 30. As another example, an enzyme tag may be attached via oligonucleotide hybridization or via biotin / streptavidin interaction. In oligonucleotide hybridization, the enzyme tag may include an oligonucleotide sequence that can hybridize to the polymer hydrogel-bound primer. In biotin / streptavidin interaction, the polymer hydrogel 32 may be biotinylated, and the enzyme tag may include streptavidin.

[0157] If a single type of reactive entity 34 is used, the reactive entity 34 may be pre-grafted to the polymeric hydrogel 32, and the pre-grafted hydrogel may be deposited and polished, or may be selectively deposited.

[0158] When multiple reactive entities 34 are used, some recesses 22 can be masked (e.g., with a photoresist or other suitable mask) while other recesses 22 have one type of reactive entity 34 grafted thereto. Alternatively, the reactive entities 34 can be pre-grafted to different samples of polymer hydrogel 32, and each pre-grafted hydrogel can be selectively deposited into the desired recesses 22. High-precision coating techniques can be used for selective deposition. In one example, a precision gantry tool is used.

[0159] 1C can be produced by forming protrusions 24 on a layer 28 of substrate 16 or substrate 18 using polymer hydrogel 32 and attaching reactive entities 34 to polymer hydrogel 32. The polymer hydrogel 32 mixture can be produced as described herein.

[0160] In one example, photoresist may first be deposited on substrate 16 or layer 28 and developed to remove the soluble photoresist portions desired to form protrusions 24 and leave the insoluble photoresist portions desired to form gap regions 30. A mixture including polymer hydrogel 32 may be blanket deposited and cured over the insoluble photoresist portions and exposed portions of substrate 16 or layer 28. The polymer hydrogel 32 applied to the exposed portions of substrate 16 or layer 28 becomes protrusions 24. The insoluble photoresist portions and the polymer hydrogel 32 thereon may be removed using an appropriate photoresist remover to expose gap regions 30.

[0161] Alternatively, a mixture containing polymer hydrogel 32 may be selectively deposited (using a mask that covers the gap regions 30, controlled printing techniques, etc.) to specifically deposit polymer hydrogel 32 in areas where it is desired to form protrusions 24.

[0162] The reactive entities 34 may then be grafted onto the protrusions 24. By way of example, grafting may be accomplished by flow-through deposition (e.g., using a temporarily bonded lid), dunk coating, spray coating, droplet dispensing, or another suitable method. Each of these exemplary techniques may utilize a solution or mixture of the reactive entities 34, which may include the reactive entities 34, water, a buffer, and / or a catalyst. With either grafting method, the reactive entities 34 attach to reactive groups on the polymer hydrogel 32 / protrusions 24 and do not react with the interstitial regions 30.

[0163] If a single reactive entity 34 is used, the reactive entity 34 may be pre-grafted onto the polymeric hydrogel 32, and the pre-grafted hydrogel may be deposited to form the protrusions 24 according to the examples described herein.

[0164] When multiple reactive entities 34 are used, some of the protrusions 24 can be masked (e.g., with a photoresist or other suitable mask) and other protrusions 24 have one type of reactive entity 34 grafted thereto. Alternatively, the reactive entities 34 can be pre-grafted to different samples of polymer hydrogel 32, and the pre-grafted hydrogels can be individually and selectively deposited to form the protrusions 24.

[0165] Each of the flow cell constructs includes an independently removable coating 36 disposed on the reaction area(s) 29A, 29B. For clarity, one independently removable coating 36 is shown in each of FIGS. 1B and 1C. The independently removable coating(s) 36 render the reaction area(s) 29A, 29B inactive (e.g., unable to participate in a designated chemical reaction) until the independently removable coating(s) 36 covering the particular reaction area(s) 29A, 29B are removed to expose the reaction area(s) 29A, 29B. Thus, the coating(s) 36 can be designed so that the particular reaction area(s) 29A, 29B are exposed for analysis or for a designated reaction at a specific time.

[0166] In some examples, substrate 16, 18 includes a plurality of recesses 22, each of a plurality of reaction regions 29A, 29B is disposed within a respective one of the plurality of recesses 22, and each of a plurality of independently removable coatings 36 covers a respective one of the plurality of reaction regions 29A, 29B. One of these examples is shown in FIG. 1B.

[0167] In some other examples, the substrate 16, 18 includes a plurality of protrusions 24, each of the plurality of reaction regions 29A, 29B is disposed on a respective one of the plurality of protrusions 24, and each of the plurality of independently removable coatings 36 covers a respective one of the plurality of protrusions 24. One of these examples is shown in FIG. 1C.

[0168] Several different examples of removable coatings 36 will now be described with reference to Figures 2A-2C and 3A-3E.

[0169] In some exemplary flow cells 10, at least one of the plurality of independently removable coatings 36 has different removal characteristics than at least one other coating of the plurality of independently removable coatings 36. Some examples of these independently removable coatings 36A, 36B, 36C are shown in Figures 2A and 3A.

[0170] In these examples, the independently removable coatings 36A, 36B, 36C are disposed directly over reaction areas 29A, 29B, but not over the gap areas 30 separating the reaction areas 29A, 29B. While individual coatings 36A, 36B, 36C are shown covering individual reaction areas 29A, 29B, it should be understood that each coating 36A, 36B, 36C may cover a subset of reaction areas 29A, 29B, with each subset including two or more reaction areas 29A, 29B. In these examples, coatings 36A, 36B, 36C may cover each of the reaction areas 29A, 29B within the subset, as well as the gap areas 30 separating particular reaction areas 29A, 29B. In one example, coatings 36A, 36B, 36C each cover approximately 1 mm of the substrate surface area. 2 ~approx. 500mm 2 may be coated.

[0171] Each coating 36A, 36B, 36C can be applied within recessed portion 22 ( FIG. 2A ) or onto protruding portion 24 ( FIG. 3A ) using a selective deposition technique, such as inkjet printing, aerosol printing, screen printing, or a precision dispensing method (such as slot-die coating). In one example, a slot-die coating manifold can coat rectangular stripes onto a web of material at a predetermined thickness. Using a vision system to align the web position, the coatings can be switched on and off to create the individual coatings 36A, 36B, 36C. Each coating 36A, 36B, 36C can alternatively be applied within recessed portion 22 ( FIG. 2A ) or onto protruding portion 24 ( FIG. 3A ) using a blanket deposition technique (e.g., spray coating) with a removable mask (e.g., photoresist) covering areas that do not receive the particular coating 36A, 36B, or 36C being deposited. In yet another example, roll-to-roll deposition may be used to transfer the coating from a source to the desired locations on the patterned structures 14A, 14B.

[0172] 2A and 3A, each of the plurality of independently removable coatings 36A, 36B, 36C has different removal characteristics relative to each of the plurality of independently removable coatings 36A, 36B, 36C. However, it should be understood that many combinations and arrangements of coatings 36A, 36B, 36C are possible. Thus, in an array of recesses 22 or protrusions 24, each recess 22 or protrusion 24 in the array can have a different independently removable coating 36A, 36B, 36C thereon, or a subset of recesses 22 or protrusions 24 in the array can have a different independently removable coating 36A, 36B, 36C thereon. Each subset can include two or more recesses 22 or protrusions 24.

[0173] One example of a removal characteristic that the coatings 36A, 36B, and 36C may exhibit is solubility. In the example shown in Figures 2A and 3A, the solubility of one coating 36A is orthogonal to each of the other coatings 36B and 36C. In this context, the term "orthogonal" means that the dissolution condition(s) to which one coating 36A is susceptible are at least partially different from the dissolution condition(s) to which each of the other coatings 36B and 36C is susceptible. The coatings 36A, 36B, and 36C may be soluble in a variety of solvents and may be soluble in a variety of aqueous solutions having different pH values.

[0174] Table 1 shows examples of fully orthogonal solvents.

[0175] Table 1 TIFF2026502023000017.tif44158

[0176] In this example, three different polymers (forming each of coatings 36A, 36B, and 36C, respectively) are susceptible to removal by three different solvents. It should be understood that any number of polymers may be used for coatings 36A, 36B, and 36C, so long as the desired number of reaction areas 29A and 29B are exposed for the desired time. For example, half of the reaction areas 29A and 29B along flow cell channel 12 may be coated with coating 36A, and the other half of the reaction areas 29A and 29B may be coated with coating 36B. In this manner, half of the reaction areas 29A and 29B may be analyzed (or used for a designated reaction) at one time, and the other half of the reaction areas 29A and 29B may be analyzed (or used for a designated reaction) at another time.

[0177] It should be understood that polymers with partial orthogonality can be used for coatings 36A, 36B, and 36C, as long as the removal of each coating 36A, 36B, and 36C is performed in a specific order to avoid premature exposure of reaction regions 29A and 29B. Table 2 shows an example of a partially orthogonal solvent.

[0178] Table 2 TIFF2026502023000018.tif44153

[0179] Examples of polymers with partial orthogonal solvent solubility that can be used as coatings 36A, 36B, and 36C, respectively, include acrylic polymers such as poly(dimethylsiloxane) (PDMS), which is soluble in hexane and toluene; poly(methyl methacrylate) (PMMA), which is insoluble in hexane but toluene; and poly(vinyl alcohol) (PVA), which is soluble in water but insoluble in hexane or toluene. In this particular example, coating 36A can be removed first with solvent 1 because solvent 1 does not remove either of the other coatings 36B and 36C. In this particular example, solvent 2 is not used before solvent 1 because solvent 2 removes both coatings 36A and 36B unless it is desired to expose reaction regions 29A and 29B covered by coatings 36A and 36B, respectively.

[0180] Some examples of polymers that can be used for coatings 36A, 36B, and 36C, and their solubilities in three different solvents, are shown in Table 3. Any combination of these polymers can be used for coatings 36A, 36B, and 36C, and two or more of coatings 36A, 36B, and 36C can be used in any channel 12 of flow cell 10. Furthermore, the polymers selected for coatings 36A, 36B, and 36C can be partially orthogonal, and the order in which the solvents are used can be selected so that one or more coatings are not prematurely removed while other coatings are being removed.

[0181] Table 3 TIFF2026502023000019.tif125155

[0182] Examples of polymers that are soluble in aqueous solutions with different pH levels include chitosan, which is soluble under acidic conditions, and copolymers of water-insoluble monomers and amine-functional monomers, which can be adjusted to dissolve at various pH values ​​depending on the content of the amino-functional monomer. One example of a copolymer is dimethylaminoethyl methacrylate, which is soluble under basic conditions.

[0183] Another example of a removal characteristic that the coatings 36A, 36B, 36C may exhibit is differential heat release in aqueous conditions. In these examples, various lower critical solution temperature (LCST) polymers, upper critical solution temperature (UCST) polymers, and / or waxes with various melting temperatures may be selected for the coatings 36A, 36B, 36C. LCST polymers, such as poly(N-isopropylacrylamide), become water-soluble when exposed to temperatures below their critical temperature; conversely, UCST polymers, such as poly(N-acryloylglycinamide) and poly(acrylamide-co-acrylonitrile), become water-soluble when exposed to temperatures above their critical temperature (which may be specific to each polymer). Examples of suitable waxes include beeswax (T m Approximately 62℃ to 65℃), paraffin wax (T m about 46°C to about 61°C), and petroleum waxes of various molecular weights (T m is about 37℃ to about 95℃, and T m increases with the number of carbon atoms).

[0184] In another example, one or more removable coatings 36D or 36D' (see FIGS. 4A, 4B, 4C, and 4D) coat the reactive regions 29A, 29B, and the removal properties of these coatings 36D, 36D' are photoreactive. The coatings 36D and 36D' can be identical and therefore responsive to the same wavelength, or the coatings 36D, 36D' can include materials that respond to different ranges of light wavelengths (e.g., L1 and L2, shown in FIGS. 4A and 4C). Furthermore, although not shown in FIG. 4, additional coatings, each with individual photoremoval properties, can be used in embodiments where additional selectivity is desired. Similar to the coatings 36A, 36B, and 36C shown in FIGS. 2A and 3A, the photoreactive protective layers 36D, 36D' can be disposed within each of the recesses 22 or on each of the protrusions 24. As described herein, in a photoreactive coating, the removal mechanism can be light itself or heat generated by light.

[0185] Alternatively, although not shown in FIG. 4 , either coating 36D or 36D′ can be in the form of a single layer extending over all of reaction regions 29A, 29B (including over gap region 30). In such an example, no other coating 36D′ or 36D is included. Individual photoreactive protective layers 36D or 36D′ can be used in these examples because the photoreactivity renders layer 36D or 36D′ selectively removable by exposure to light. Light allows for both spatial and temporal control. Thus, specific portions of photoreactive protective layer 36D or 36D′ (e.g., covering specific reaction regions 29A, 29B or specific subsets of reaction regions 29A, 29B that will be involved in subsequent reaction(s)) can be removed by exposing the specific portions to light.

[0186] In one example, the photoreactive protective layer 36D or 36D' is a hydrophilic polymer crosslinked with a photocleavable crosslinker. In this example, the high degree of crosslinking within the polymer structurally stabilizes the coating 36D, 36D', thereby minimizing the release or exposure of the reactive entities 34A or 34B (underlying the photoreactive protective layer 36D, 36D') to the external environment. Upon exposure to specific wavelengths, the photocleavable crosslinker cleaves and spatially decomposes to generate soluble chemical structures. Thus, controlled exposure allows the layer 36D, 36D' to be removed (e.g., washed off) using an appropriate aqueous solvent, such as water.

[0187] Examples of hydrophilic polymers that can be used in these examples of layers 36D, 36D' include PAZAM copolymerized or substituted with photocleavable groups such as N-hydroxyalkylacrylamide, polyethylene glycol (PEG), poly(hydroxyethyl acrylate), hydroxypropyl methylcellulose, poly(vinylpyrrolidone), and polyvinyl alcohol (PVA). Examples of photocleavable crosslinkers for these examples of layers 36D, 36D' include o-nitrobenzyl and coumarin moieties.

[0188] To enable crosslinking upon curing, the hydrophilic polymers described herein can be chemically modified with reactive groups such as acrylates or reactive esters. Radical polymerization (via acrylate or methacrylate groups) can be used to crosslink the hydrophilic polymer and the photocleavable crosslinker, or crosslinking can be achieved by other methods of chemical curing, such as thiol-ene coupling, amine-reactive ester (via p-nitrophenyl ester or N-hydroxy-succinimide ester) coupling, or amine-epoxy coupling.

[0189] In one specific example, the hydrophilic polymer is a polyvinyl alcohol / polyethylene glycol graft copolymer, and the photocleavable crosslinker is a coumarin or o-nitrobenzyl moiety. The coumarin or o-nitrobenzyl moiety can be covalently conjugated to the poly(ethylene glycol) of the polyvinyl alcohol / polyethylene glycol graft copolymer. An example is shown in Figure 5A. The coumarin or o-nitrobenzyl can be cleaved upon exposure to ultraviolet (UV) light (100 nm to 400 nm) or blue light (450 nm to 495 nm), resulting in a decrease in the crosslink density of the polymer coating. Thus, upon exposure, the cleaved polymer coating becomes hydrophilic and can be washed away with an aqueous solution.

[0190] In another example, the photoreactive protective layer 36D or 36D' is a hydrophilic polymer crosslinked with an acid-labile crosslinker. The acid-labile crosslinker can generate acid species in the presence of a photoacid generator (PAG) and upon exposure to UV / visible light, which changes the pH and cleaves the crosslinker, making the polymer coating 36D or 36D' more soluble (and more easily removable by rinsing). This allows the layer 36D, 36D' to be washed away, for example, using an aqueous solvent.

[0191] Any suitable hydrophilic polymer described herein may be crosslinked using an acid-labile crosslinker, such as an aldehyde crosslinker, a carboxylic acid crosslinker, a terephthalic acid crosslinker, a suberic acid crosslinker, a sulfosuccinic acid crosslinker, a glutaraldehyde crosslinker, or a glyoxal crosslinker.

[0192] In a particular example, the hydrophilic polymer is a polyvinyl alcohol / polyethylene glycol graft copolymer and the acid labile crosslinker comprises an acetal group.

[0193] A further example of a hydrophilic polymer crosslinked with an acid-labile crosslinker is shown in Figure 5B. This example shows the crosslinking of polyvinyl alcohol (PVA) using glutaraldehyde (GA) via an acid-labile acetal group. Yet another example is shown in Figure 5C. This example shows the crosslinking of PVA with sulfosuccinic acid via an ester group.

[0194] As mentioned above, the photoacid generator used may be responsive to UV light or visible light. One example of a suitable photoacid generator (responsive to UV light) is a sulfonium-based photoacid generator. One example of a suitable photoacid generator (responsive to visible light) is an aryl azosulfone-based photoacid generator.

[0195] In yet another example, the photoreactive protective layer 36D or 36D' is a polymer capped with photocleavable hydrophobic or acid-labile groups. Crosslinking is not utilized in this example. The photocleavable hydrophobic or acid-labile protecting groups on the polymer side chains make the polymer more hydrophobic. These examples of the photoreactive protective layer 36D or 36D' undergo a hydrophobic-to-hydrophilic phase transition upon exposure to light. In one example, the polymer is polymethacrylic acid, polyphenol, polyvinyl alcohol, or polyvinyl alcohol / polyethylene glycol graft copolymer functionalized with photocleavable hydrophobic groups, such as coumarin or o-nitrobenzyl moieties. These photocleavable groups are generally hydrophobic, preventing the photoreactive protective layer 36D from being removed and washed away by aqueous solutions. Upon exposure to UV or visible light, these hydrophobic groups are cleaved, returning the polymer coating to its hydrophilic form. An example is shown in Figure 6A. Cleavage of the o-nitrobenzyl group shown in Figure 6A renders the coating 36D, 36D' more hydrophilic, allowing it to be removed / washed using aqueous solutions. In another example, the hydrophilic polymer is polymethacrylic acid, polyphenol, polyvinyl alcohol, or polyvinyl alcohol / polyethylene glycol graft copolymer functionalized with acid labile groups. A specific example is shown in Figure 6B. Acid species can be generated in the presence of a photoacid generator (PAG), and upon exposure to UV / visible light, the acid labile groups are cleaved. In the example shown in Figure 6B, cleavage of the tert-butyl carbonate group results in a hydrophilic polyphenol coating that is washable and removable with aqueous solutions.

[0196] In yet another example, at least one of the independently removable photoreactive coatings 36D or 36D' (disposed over the reaction regions 29A, 29B) is a composite material including a thermoresponsive polymer and a photothermal additive (or photothermal filler). In this example, each one of the removable coating(s) 36D or 36D' can be disposed in each of the recessed portions 22 or on each of the protrusions 24 in a manner similar to the coatings 36A, 36B, 36C shown in Figures 2A and 3A, or one removable coating 36D or 36D' can be a single layer extending over all of the reaction regions 29A, 29B (including over the gap regions 30).

[0197] The thermoresponsive polymer used in the composite material forming the protective layer 36D or 36D' may be any suitable polymeric material that undergoes a phase transition when exposed to a predetermined temperature change. For example, the thermoresponsive polymer may be a polymer that melts at a specific temperature. For another example, the thermoresponsive polymer may be a polymer that transitions from a hydrophobic state to a hydrophilic state at a specific temperature, such as a UCST (upper critical solution temperature) polymer, such as poly(acrylamide-co-acrylonitrile). For yet another example, the thermoresponsive polymer may be a polymer that transitions from a hydrophilic state to a hydrophobic state at a specific temperature, such as a LCST (lower critical solution temperature) polymer, such as poly(N-isopropylacrylamide) or PNIPAAm.

[0198] Thus, the thermoresponsive polymer may be selected from the group consisting of polylactic acid, lactic-co-glycolic acid copolymer, polycaprolactone, agarose, wax, poly(acrylamide-co-acrylonitrile), poly(N-isopropylacrylamide), cyclodextrin, polyethylene glycol homopolymer, polyethylene glycol graft copolymer, polyethylene block copolymer, and combinations thereof.

[0199] The photothermal additive or photothermal filler contained in the composite material of the protective layer 36D or 36D′ can be nano-sized or any micro-sized structure that absorbs light (e.g., photonic) energy within a specific wavelength range and converts the absorbed energy into heat. In one example, the structure is a spherical nanoparticle or microparticle. In another example, the structure is a non-spherical nanoparticle or microparticle, such as a cube, triangular prism, rod-shaped, platelet, cage-like (e.g., non-spherical hollow particle with a porous shell), or tube. In yet another example, the structure is an irregularly shaped nanoparticle or microparticle. The dimensions of the structure can vary depending on their shape. In the examples disclosed herein, the maximum dimension (e.g., diameter, length, median, etc.) of the structure can be nanoscale, i.e., in the range of about 1 nm to less than 1000 nm, or microscale, i.e., in the range of about 1 μm to less than 1000 μm. In some examples, the structures are nanoparticles having a diameter of 1 nm or more, 2 nm or more, 3 nm or more, 4 nm or more, 5 nm or more, 6 nm or more, 7 nm or more, 8 nm or more, 9 nm or more, 10 nm or more, 20 nm or more, 30 nm or more, 40 nm or more, 50 nm or more, 60 nm or more, 70 nm or more, 80 nm or more, 90 nm or more, or 100 nm or more.

[0200] The absorption and conversion are due, in part, to the plasmonic properties of the structures (e.g., gold particles, silver particles, polypyrrole, graphene, etc.). Alternatively, the photothermal filler can be a photoisomerizable dopant with a thermally activated barrier, such as azobenzene. In one example, the photothermal filler (or photothermal additive) can be selected from the group consisting of gold nanoparticles, silver nanoparticles, iron oxide nanoparticles, polypyrrole particles, graphene sheets, carbon nanotubes, carbon nanodots, black phosphorus particles, azobenzene particles, and combinations thereof. It should be understood that the morphology of the photothermal additive(s) / filler(s) can be tailored or otherwise manipulated depending on the desired wavelength used to remove the coating 36D, 36D'. For example, gold nanostructures (e.g., gold nanorods) with higher aspect ratios absorb longer wavelengths of light (e.g., red to NIR light) compared to gold nanoparticles (e.g., which absorb blue light).

[0201] The photothermal additive(s) / filler(s) can be combined with the thermoresponsive polymer(s) and distributed in a polymer matrix (i.e., a composite) to form a removable coating 36D or 36D'. Upon exposure to UV or visible light, the energy absorbed by the photothermal additive is converted to heat, which causes a phase transition in the polymer matrix (due to the presence of the thermoresponsive polymer). This phase transition softens or melts the composite-based photoreactive coating 36D or 36D'. The softened or melted coating 36D or 36D' can then be removed using an aqueous solvent.

[0202] As described, in some cases, two different light-reactive protective layers 36D, 36D' are utilized. In these examples, layers 36D, 36D' are reactive (cleaved) with different ranges of light wavelengths L1 and L2, and layers 36D, 36D' can be any of the light-reactive coating materials described herein, provided that coatings 36D, 36D' are reactive to different ranges of light wavelengths L1, L2. As an example, one layer 36D, 36D' can be reactive to light wavelengths L1 in the range of 220 nm to 370 nm, and the other layer 36D', 36D' can be reactive to light wavelengths L2 in the range of 440 nm to 800 nm.

[0203] Any of the exemplary coatings described herein (e.g., 36A, 36B, 36C, 36D, or 36D') can be used in combination to obtain a multilayer coating. Examples of several multilayer removable coatings 38A, 38B are shown in FIGS. 2B and 3B. In this example, at least one of the multiple independently removable coatings includes multiple sublayers (i.e., multilayer removable coatings 38A, 38B), and the multiple sublayers define the removal characteristics of at least one of the multiple independently removable coatings. When multiple light-triggered removable materials are included in the multilayer removable coatings 38A, 38B, wavelengths should be selected to avoid overlap and prevent premature removal of certain coatings.

[0204] The sublayers of the multi-layer removable coatings 38A, 38B can be any of the materials described herein for coatings 36A, 36B, 36C, 36D, and 36D'. Incorporating coatings 36A, 36B, 36C, 36D, and / or 36D' into a stack allows the same coatings 36A, 36B, 36C, 36D, and / or 36D' to be used in different orders, thereby imparting different removal properties to the multi-layer removable coatings 38A, 38B overall. The overall removal properties of each multi-layer removable coating 38A, 38B depend on the coatings 36A, 36B, 36C, 36D, and 36D' and the order of the coatings 36A, 36B, 36C, 36D, and 36D' within a particular stack.

[0205] 2B and 3B, the multi-layer removable coatings 38A, 38B require sequential processing to expose the underlying reacted regions 29A, 29B. The sequential processing depends on the sublayers, such as coatings 36A, 36B, 36C, 36D, and / or 36D', included in the stack. The sublayers in each of the multi-layer removable coatings 38A, 38B can be selected so that a portion of the reacted regions 29A, 29B remains coated with at least some sublayers of the multi-layer removable coating 38A or 38B, even when other sublayers of the multi-layer removable coating 38A or 38B are removed, or even when another multi-layer removable coating 38B or 38A is completely removed.

[0206] In the example shown in Figures 2B and 3B, removal of multi-layer coating 38A involves sequential dissolution of coating 36B and then coating 36A, while removal of multi-layer coating 38B involves sequential dissolution of coatings 36C, 36A, then 36B.

[0207] According to Table 2, in some examples, coatings 36A and 36C can be selected so that they are not dissolved in the same solvent (or are not subject to the same removal characteristics). In these examples, removal of single layer coating 36A does not affect either of multi-layer coatings 38A, 38B. In these examples, multi-layer coatings 38A, 38B can then be removed in any order desired to expose the respective underlying reaction regions 29A, 29B. For example, multi-layer coating 38A can be dissolved before multi-layer coating 38B, or multi-layer coating 38B can be dissolved before multi-layer coating 38A.

[0208] Also, according to Table 2, in other examples where solubility-based removable coatings 36A, 36B, and / or 36C are utilized, coatings 36A and 36C can be selected so that they are soluble in the same solvent (or are subject to the same removal characteristics). In some of these examples, removal of single-layer coating 36A also removes the first two coatings (sublayers) 36C, 36A of multi-layer coating 38B, as long as the solvent exposure time is long enough for such removal. In these particular examples, removal of coatings (sublayers) 36C, 36A of multi-layer coating 38B exposes coating 36B. Each coating (sublayer) 36B of multi-layer coatings 38A, 38B can then be removed simultaneously. Thus, in these particular examples, multi-layer coating 38B can be removed before multi-layer coating 38A. Alternatively, removal of the single-layer coating 36A can be performed such that the first coating (sublayer) 36C of the multi-layer coating 38B is removed, but the second coating (sublayer) 36A of the multi-layer coating 38B remains intact. In these particular examples, the remaining portions of the multi-layer coating 38A or multi-layer coating 38B (i.e., the sublayers / coatings 36A, 36B) can then be removed in any order desired to expose the respective underlying reaction regions 29A, 29B. For example, the multi-layer coating 38A can be dissolved before the remaining sublayers of the multi-layer coating 38B, or the remaining sublayers of the multi-layer coating 38B can be dissolved before the multi-layer coating 38A.

[0209] In multi-layer coatings 38A, 38B, sub-layers can be selected to provide a barrier to reagents (e.g., sequencing reagents, tagmentation buffers, etc.) used to react with exposed reaction regions 29A, 29B. As a barrier to reaction reagents, the sub-layer minimizes or prevents these reagents from penetrating into the remaining sub-layers.

[0210] Any of the methods disclosed herein can be used to produce the multi-layer coatings 38A, 38B. For example, in a roll-to-roll coating system, multiple sequential coating heads (each coating a unique set of rectangular patches or stripes) can build up different layers (of the multi-layer coating 38A or 38B) on separate areas of the substrate (note, however, that each coating layer need not be deposited in each pass, as shown in Figures 2B and 2C). In a wafer coating system, inkjet, screen, stencil, or precision dispense coating may be used to build up the layers (of the multi-layer coating 38A or 38B), with each material printing a unique 2D coating area.

[0211] A curing step may be performed after each sub-layer is deposited, depending on the materials used.

[0212] 2C and 3C-3E, further examples of independently removable coatings 36, 36', 36", 36'" are shown. In these examples, coating 36, or coatings 36', 36", 36'" are formed from the same material (and may be any of the materials described herein for coatings 36A, 36B, 36C, 36D, 36D'), but coating 36 has a variable thickness, or each of multiple coatings 36', 36", 36'" has a different thickness. Thus, although coating 36, or coatings 36', 36", 36'" are subject to the same removal characteristics, the rate at which coating 36, or coatings 36', 36", 36'", are removed (e.g., by dissolution, exposure to light, etc.) is different due to the different thicknesses T1, T2, T3.

[0213] In the example shown in FIG. 2C , each of the recesses 22 has a removable coating 36′, 36″, 36′″ having a different thickness disposed over the reaction region 29A, 29B associated with the recess 22. In one example, thickness T1<thickness T2<thickness T3, where T1 ranges from about 10 nm to about 500 nm, T2 ranges from about 100 nm to about 1 μm, and T3 ranges from about 500 nm to about 10 μm. It should be understood that in an array of recesses 22, each recess 22 can have a removable coating 36′, 36″, 36′″ having a different thickness, or a subset of recesses 22 in the array can have a coating 36′, 36″, 36′″ having a different thickness. Each subset can include two or more recesses 22.

[0214] In the example shown in FIG. 3C, each of the protrusions 24 has removable coatings 36', 36'', 36''' having different thicknesses disposed on the reaction regions 29A, 29B associated with the protrusion 24. As in FIG. 2C, thickness T1 < thickness T2 < thickness T3, where T1 ranges from about 10 nm to about 500 nm, T2 ranges from about 100 nm to about 1 μm, and T3 ranges from about 500 nm to about 10 μm. It should be understood that in an array of protrusions 24, each protrusion 24 can have a removable coating 36', 36'', 36''' having a different thickness, or a subset of the protrusions 24 in the array can have a coating 36', 36'', 36''' having a different thickness. Each subset can include two or more protrusions 24.

[0215] In the examples shown in FIGS. 3D and 3E, a single removable coating 36 is disposed on each of the protrusions 24 (and reaction regions 29A, 29B), but the removable coating 36 has a variable thickness. Thus, the thickness T1, T2, or T3 of the removable coating 36 is thinner on some of the protrusions 24 (and reaction regions 29A, 29B) and thicker on some of the protrusions 24 (and reaction regions 29A, 29B). In the example shown in FIG. 3D, the removable coating 36 has a step-like gradient that increases from T1 to T2 to T3 across, e.g., the width of, the patterned structure 14B. In the example shown in FIG. 3E, the removable coating 36 has a substantially linear gradient that increases from T1 to T2 to T3 across, e.g., the width of the patterned structure 14B. In both examples, each protrusion 24 or a subset of protrusions 24 is disposed under a removable coating 36 of a different thickness T1, T2, or T3.

[0216] 2C, 3C, 3D, and 3E show three different thicknesses, it should be understood that any number of different coating thicknesses (e.g., two or more than three) can be used. The number of different coating thicknesses depends on the number of recesses 22 or protrusions 24 in the channel 12 and the number of subsets of recesses 22 or protrusions 24 (if any). The number of subsets, in turn, is based on the desired number of reactions to be performed in a single flow cell channel 12.

[0217] How to use the flow cell The example flow cell 10 described herein can be used in analytical methods, including nucleic acid sequencing. The independently removable coatings 36 (36A, 36B, 36C, 36D, 36D', 36', 36", or 36'") described herein allow selected reaction areas 29A, 29B to be exposed and ready for analytical / chemical reactions, while other reaction areas 29A, 29B remain covered so that they are not currently involved in analytical / chemical reactions.

[0218] An example method for using some examples of flow cell 10 includes: i) selectively removing at least one of a plurality of independently removable coatings 36A, 36B, 36C, 36D, 36D' or 36', 36", 36"' disposed on each of a plurality of spatially separated reaction regions 29A, 29B across substrate 16 or 18, thereby exposing at least one of the plurality of reaction regions 29A, 29B and at least one reactive entity 34 in the plurality of reaction regions 29A, 29B, wherein each of the plurality of reaction regions 29A, 29B includes a polymeric hydrogel layer 32 and a reactive entity 34 attached to the polymeric hydrogel layer 32; and ii) initiating a reaction involving the reactive entity 34. In some examples of this method, at least one of the independently removable coatings 36 is a composite material including a thermoresponsive polymer and a photothermal additive (thus, at least one of the removable coatings 36 is a photoreactive coating 36D or 36D').

[0219] Another example of a method for using another example of flow cell 10 includes the steps of: i) selectively removing independently removable portions of coating 36 disposed on each of a plurality of reaction regions 29A, 29B spatially separated from one another across substrate 16 or 18, thereby exposing at least one of the plurality of reaction regions 29A, 29B and reactive entity 34 in at least one of the plurality of reaction regions 29A, 29B, while leaving at least one other independently removable portion unaffected; and ii) initiating a reaction involving reactive entity 34.

[0220] Some exemplary methods utilize independently removable coatings 36A, 36B, 36C, where the removal characteristic of each coating is solubility. In these examples, selectively removing at least one of the multiple independently removable coatings 36A, 36B, 36C includes exposing the multiple independently removable coatings 36A, 36B, 36C to a predetermined solvent that dissolves at least one of the multiple independently removable coatings 36A, 36B, 36C but does not dissolve at least one other of the independently removable coatings. The solvent or aqueous solution used depends on the material of each of the coatings 36A, 36B, 36C. In some examples of this method, at least one of the multiple independently removable coatings includes multiple sublayers (i.e., a multi-layer coating 38A or 38B), and selectively removing at least one of the multiple independently removable coatings includes exposing at least one of the multiple independently removable coatings to a sequential removal process that sequentially dissolves each of the multiple sublayers. The combination of solvents or aqueous solutions used will depend on the materials of each of the sub-layers of the multi-layer coating 38A or 38B.

[0221] In examples where the plurality of removable coatings 36′, 36″, 36′″ each have a different thickness T1, T2, T3, selectively removing at least one of the plurality of independently removable coatings 36′, 36″, 36′″ includes exposing the plurality of independently removable coatings 36′, 36″, 36′″ to a solvent for a predetermined time. The predetermined time is selected so that the thinnest independently removable coating 36′ or 36″ present on the flow cell 10 is removed while leaving the thicker independently removable coating(s) 36″ and / or 36′″ partially intact. It should be understood that during exposure to the solvent, a portion of the thicker independently removable coating(s) 36″ and / or 36′″ is removed (because the coatings 36′, 36″, 36′″ are formed of the same material), but the presence of additional material in the thicker coating(s) 36″ and / or 36′″ prevents the coating from being completely removed. To the extent that a coating (e.g., 36" and / or 36'") thicker than the coating being removed (e.g., 36' or 36") is present, at least one of the thicker independently removable coatings 36" and / or 36'" will remain partially intact after the currently targeted coating(s) 36 or 36" is removed and exposure to the solvent has ceased. In these instances, the duration of exposure to the solvent will depend on the dissolution rate of the material of coating 36', 36", 36'".

[0222] In yet another example, selectively removing the independently removable portions of the coating 36 includes exposing the coating 36 to a predetermined solvent for a predetermined time to remove the independently removable portions and leave the remaining portions of the coating 36 intact. This method may be used in the examples shown in FIGS. 3D and 3E. In these examples, the exposure time to the solvent depends on the dissolution rate of the material of the coating 36. At the selected exposure time, the thinnest portions of the coating 36 present on the flow cell 10 (e.g., having thicknesses T1 or T2) are removed, while any thicker portions (e.g., having thicknesses T2 or T3) remain partially intact. It should be understood that during solvent exposure, portions of the thicker portions (e.g., having thicknesses T2 or T3) are removed, but the presence of additional material within the thicker portions (e.g., having thicknesses T2 or T3) prevents these portions from being completely removed. To the extent that a thicker portion of coating 36 is present on flow cell 10 when the targeted (thin) portion is removed, this thicker portion will remain partially intact after the currently targeted portion of coating 36 is removed and solvent exposure ceases.

[0223] After selectively removing the individually removable coatings 36A, 36B, 36C, 36', 36", or 36'", a reaction can be performed in the exposed reaction area(s) 29A, 29B. The reaction(s) performed depend on the reactive entities 34A, 34B in the reaction areas 29A, 29B. In one example, the reactive entities 34A, 34B are immobilized transposome complexes, and the reaction involves tagmentation of an introduced DNA sample. In another example, the reactive entities 34A, 34B are primer sets, and the reaction involves seeding with library template strands, amplifying the library template strands to form amplicons, and then sequencing the amplicons.

[0224] Other examples of this method include applying / removing a photoreactive protective layer 36D or 36D'. In some of these examples, the substrate 16, 18 includes a plurality of recesses 22, each of the plurality of reaction areas 29A or 29B is located within a respective one of the plurality of recesses 22, and each of the independently removable coatings 36D or 36D' coats a respective one of the plurality of reaction areas 29A or 29B (similar to FIG. 1B). In other of these examples, the substrate 16, 18 includes a plurality of protrusions 24, each of the plurality of reaction areas 29A or 29B is located within a respective one of the plurality of protrusions 24, and each of the independently removable coatings 36D or 36D' coats a respective one of the plurality of protrusions 24 (similar to FIG. 1C).

[0225] Selectively removing at least one of the plurality of independently removable coatings 36D or 36D' may include exposing at least one of the plurality of independently removable coatings 36D or 36D' to light and not exposing at least one other of the plurality of independently removable coatings 36D' or 36D' to light, thereby rendering at least one of the plurality of independently removable coatings 36D or 36D' removable using an aqueous solvent.

[0226] Two examples of this method are shown in A.-E. and A., B., F., G., and E. of FIG. 4 . In each of these methods, a photoreactive protective layer 36D is shown applied over reaction region 29A in one of the recesses 22, and a different photoreactive protective layer 36D′ is shown applied over reaction region 29B in a different recess 22. In this particular example, the reactive entity 34A in one of the recesses 22 is different from the reactive entity 34B in the other recess 22. As an example, the reactive entities 34A, 34B can be two different primer sets. However, it should be understood that in some examples, the same photoreactive protective layer 36D or 36D′ can be applied over each of reaction regions 29A and 29B, and the same or different reactive entities 34A or 34B can be applied to two adjacent recesses 22.

[0227] In A., light (within a first range of light wavelengths L1, represented by the arrow in A.) is used to selectively remove the photoreactive protective layer 36D covering the reactive entity 34A. It should be understood that the range of light wavelengths L1 used to remove the photoreactive protective layer 36D depends in part on the material(s) used for the photoreactive protective layer 36D. For example, if the layer 36D includes a material that absorbs blue to near-infrared light, L1 may range from 500 nm to 1200 nm. As a specific example, if the layer 36D includes spherical gold nanoparticles (e.g., if the layer 36D is a composite material described herein), L1 may range from 500 nm to 600 nm. As another specific example, if the layer 36D includes gold nanorods, L1 may range from 600 nm to 1200 nm. As yet another specific example, if the layer 36D includes carbon nanodots, L1 may range from 400 nm to 800 nm. As yet another example, when layer 36D includes silver nanoparticles, L1 may range from 400 nm to 550 nm.

[0228] At B, a template strand 40 of a first library of template strands is introduced and seeded onto reactive entities 34A.

[0229] As the method continues at C, the seeded template strands 40 occupy a consistent density of reactive entities 34A. Once seeding has occurred, light (within a second range of light wavelengths L2, represented by the arrows at C and F) is used to selectively remove the photoreactive protective layer 36D' covering the reactive entities 34B. The second range of light wavelengths L2 depends in part on the material used for layer 36D'. For example, if layer 36D' includes a material that absorbs blue to near-infrared light, L2 may range from 500 nm to 1200 nm. As a specific example, if layer 36D' includes spherical gold nanoparticles (e.g., if layer 36D' is a composite material described herein), L2 may range from 500 nm to 600 nm. As another specific example, if layer 36D' includes gold nanorods, L2 may range from 600 nm to 1200 nm. As yet another specific example, when layer 36D' contains carbon nanodots, L2 may be in the range of 400 nm to 800 nm.As yet another specific example, when layer 36D' contains silver nanoparticles, L2 may be in the range of 400 nm to 550 nm.

[0230] At D, another template strand 40' of the second library of template strands is introduced and seeded onto reactive entity 34B. In one example, template strand 40' does not contain an adapter for hybridizing to reactive entity 34A and therefore is not seeded into recess(es) 22 containing reactive entity 34A. In this example, different recesses 22 may individually contain different reactive entities 34A, 34B (e.g., different primer sets). In another example, the recesses 22 exposed during seeding of template strand 40 may be smaller than the recesses 22 exposed during seeding of template strand 40'. In these examples, template strand 40' may be sterically blocked from seeding into recesses 22 containing template strand 40.

[0231] If the same type of coating, e.g., 36D, is used with each reaction region 29A, 29B, the same wavelength of light is used to remove the coating, and the removal selectivity is controlled by the exposure (i.e., where the light is directed). Alternatively, if two different types of coatings 36D, 36D' are used to coat each reaction region 29A, 29B, different wavelengths of light L1, L2 within distinct (and non-overlapping) ranges are used to remove the coatings 36D, 36D', and the removal selectivity is controlled by the reactivity of the coatings 36D, 36D' to the different wavelengths of light.

[0232] Each of the seeded template strands 40, 40' is then amplified and clustered across the respective reactive entities 34A, 34B, respectively, as shown in E. This produces a first library template amplicon 42 in at least one of the recesses 22 and a second library template amplicon 42' in at least one other of the recesses 22.

[0233] As the method continues (B. through F.), the seeded template strands 40 are amplified and clustered across each reactive entity 34A to generate first library template amplicons 42. Once the clusters of amplicons 42 have been generated using reactive entities 34A, light is used to selectively remove the photoreactive protective layer 36D' covering reactive entities 34B (also shown in F.). If a different coating 36D' is used, the light is in a second light wavelength range L2; if the same coating 36D is used, the light is in the same light wavelength range L1.

[0234] At G, another template strand 40' of a second library of template strands is introduced and seeded onto reactive entity 34B. The seeded template strand 40' is then amplified and clustered across reactive entity 34B, as shown at E, thereby producing a second library template amplicon 42' in at least one other of recesses 22.

[0235] In yet another example, if the substrate 16, 18 includes a plurality of protrusions 24, each of the plurality of reaction regions 29B is formed by a respective one of the plurality of protrusions 22, and each of the independently removable coatings is a light-reactive protective layer 36D or 36D', selectively removing at least one of the plurality of independently removable coatings 36D or 36D' includes exposing at least one of the plurality of independently removable coatings 36D or 36D' to light and not exposing at least one other of the independently removable coatings 36D' or 36D' to light, thereby rendering at least one of the plurality of independently removable coatings 36D or 36D' removable using an aqueous solvent.

[0236] In another example, when the photoreactive protective layer 36D is a single layer disposed over multiple reaction regions 29A or 29B, the method includes rendering at least a portion of the coating 36D removable using an aqueous solvent by selectively removing the portion(s) of the coating 36D by exposing the portion(s) of the coating 36D to light, without exposing other portion(s) of the coating 36D to light.

[0237] 4 shows a specific example of the type of reaction performed, it should be understood that different reactions may be performed when different reactive entities 34 are utilized. As an example, tagmentation may be performed when the reactive entity 34 is a transposome complex.

[0238] Digital Fluidic Cartridge Another exemplary device that allows controlled access to the reaction region 29C is a digital fluidic cartridge 50 shown in FIG. 7, which includes a laminate film 44, a resin 46 disposed on the laminate film 44, the resin 46 patterned with a plurality of spatially separated reaction regions 29C, a lid 48 attached to the binding region 20 of the resin 46, a fluidic channel 12′ defined between the lid 48 and the resin 46, and a ground electrode 52 disposed on the surface of the lid 48 facing the fluidic channel 12′.

[0239] The digital fluidics cartridge 50 can be used in a digital fluidics system 54 that includes a digital fluidics device 56. The digital fluidics device 56 includes a plurality of individually addressable control electrodes 58A, 58B, 58C.

[0240] In the example shown in Figure 7, the laminate film 44 can be poly(ethylene terephthalate) or another thin plastic material. The thickness of the laminate film 44 can range from about 30 μm to about 200 μm. The laminate film 44 can serve as a support for the resin 46. The resin 46 can be any example of the resin material described herein (e.g., for layer 28), and the reactive area(s) include a recess 22 containing a polymer hydrogel 32 and an example of a reactive entity 34 attached to the polymer hydrogel 32 (the polymer hydrogel and reactive entity are not shown in Figure 7).

[0241] The lid 48 may be any of the exemplary materials described herein and may be attached to the bonding region 20 via any of the spacer layer materials described herein. The spacer layer is represented by the reference numeral 60.

[0242] Ground electrode 52 can be any conductive material that can transmit the light used in the reaction(s) occurring in reaction region 29 C. By way of example, ground electrode 52 can be poly(3,4-ethylenedioxythiophene) (PEDOT) or indium tin oxide (ITO).

[0243] A plurality of individually addressable control electrodes 58A, 58B, 58C may be defined in a non-conductive (i.e., non-conductive) substrate 62 of device 56. Examples of non-conductive substrates 62 include glass, rubber, porcelain, ceramic, and some polymeric materials.

[0244] A plurality of individually addressable control electrodes 58A, 58B, 58C in device 56 allows for the site-selective movement of droplets along the surface of resin 46. As shown in Figure 7, recess 22 (containing reaction region 29A) is positioned over the portion of laminate film 44 that covers individually addressable control electrodes 58A, 58B, 58C. This positioning creates selective functionalization regions.

[0245] 8A-8C each show a top view of resin 46 of cartridge 50, with A) having reaction regions 29C, 29D, and 29E defined in three specific areas; B) having an array of individually addressable control electrodes (e.g., including electrodes 58A, 58B, 58C, etc.) on device 56; and C) having cartridge 50 in a predetermined position on device 56. Electronic circuitry electrically connected to each of electrodes 58A, 58B, 58C, etc. allows one or more of electrodes 58A, 58B, 58C, etc. to be addressed at a particular time. Thus, electrically responsive fluid can be directed to one of reaction regions 29C, 29D, and 29E, but not the others, depending on which of electrodes 58A, 58B, and 58C is addressed.

[0246] Terms 1. A flow cell comprising: A substrate; a plurality of reaction regions spatially separated from one another across the substrate, each of the plurality of reaction regions comprising: a polymer hydrogel layer, and a plurality of reactive regions comprising reactive entities attached to the polymeric hydrogel layer; a plurality of independently removable coatings respectively disposed on each of the plurality of reaction regions; The flow cell, wherein at least one of the plurality of independently removable coatings is a composite material including a thermoresponsive polymer and a photothermal additive. 2. The flow cell of clause 1, wherein the reactive entities in each of the plurality of reaction regions are primer sets. 3. The flow cell of clause 2, wherein the primer set is identical in each of the multiple reaction regions. 4. The flow cell of clause 2, wherein the primer set of at least one of the plurality of reaction regions is different from the primer set of at least one other of the plurality of reaction regions. 5. A flow cell according to any one of clauses 1 to 4, the substrate has a plurality of recesses; each of the plurality of reaction regions is disposed within a respective one of the plurality of recesses; A flow cell, wherein each of a plurality of independently removable coatings covers a respective one of a plurality of reaction regions. 6. A flow cell according to any one of clauses 1 to 4, The substrate has a plurality of protrusions, Each of the plurality of reaction regions is disposed on a respective one of the plurality of protrusions; A flow cell, wherein each of a plurality of independently removable coatings covers a respective one of a plurality of protrusions. 7. The flow cell of any one of clauses 1 to 6, wherein the thermoresponsive polymer is selected from the group consisting of polylactic acid, lactic acid-co-glycolic acid copolymer, polycaprolactone, agarose, wax, poly(acrylamide-co-acrylonitrile), poly(N-isopropylacrylamide), cyclodextrin, polyethylene glycol homopolymer, polyethylene glycol graft copolymer, polyethylene block copolymer, and combinations thereof. 8. The flow cell of any one of clauses 1 to 7, wherein the photothermal filler is selected from the group consisting of gold nanoparticles, silver nanoparticles, iron oxide nanoparticles, polypyrrole, graphene, carbon nanotubes, carbon nanodots, black phosphorus, azobenzene, and combinations thereof. 9. A method comprising: selectively removing at least one of a plurality of independently removable coatings respectively disposed on each of a plurality of reaction regions spatially separated from one another across the substrate, thereby exposing at least one of the plurality of reaction regions and a reactive entity in at least one of the plurality of reaction regions; each of the plurality of reaction regions includes a polymer hydrogel layer and a reactive entity attached to the polymer hydrogel layer; at least one of the plurality of independently removable coatings is a composite material comprising a thermoresponsive polymer and a photothermal additive; and initiating a reaction involving the reactive entity. 10. The method of clause 9, wherein selectively removing at least one of the plurality of independently removable coatings comprises: exposing at least one of the plurality of independently removable coatings to light, thereby rendering at least one of the plurality of independently removable coatings exposed to light susceptible to removal using an aqueous solvent; and removing at least one of the plurality of independently removable coatings using an aqueous solvent. 11. The method according to clause 9 or 10, the substrate has a plurality of recesses; each of the plurality of reaction regions is disposed within a respective one of the plurality of recesses; The method, wherein each of a plurality of independently removable coatings covers a respective one of a plurality of reaction regions. 12. The method according to clause 9 or 10, The substrate has a plurality of protrusions, Each of the plurality of reaction regions is disposed on a respective one of the plurality of protrusions; The method, wherein each of the plurality of independently removable coatings covers a respective one of the plurality of protrusions. 13. The method of any one of clauses 9 to 12, wherein the thermoresponsive polymer is selected from the group consisting of polylactic acid, lactic acid-co-glycolic acid copolymer, polycaprolactone, agarose, wax, poly(acrylamide-co-acrylonitrile), poly(N-isopropylacrylamide), cyclodextrin, polyethylene glycol homopolymer, polyethylene glycol graft copolymer, polyethylene block copolymer, and combinations thereof. 14. The method of any one of clauses 9 to 13, wherein the photothermal filler is selected from the group consisting of gold nanoparticles, silver nanoparticles, iron oxide nanoparticles, polypyrrole, graphene, carbon nanotubes, carbon nanodots, black phosphorus, azobenzene, and combinations thereof. 15. The method of any one of clauses 9 to 14, wherein the reactive entity in each of the plurality of reactive regions is a primer set. 16. The method of claim 15, wherein the primer set is the same in each of the multiple reaction regions. 17. The method of claim 15, wherein the primer set in at least one of the plurality of reaction regions is different from the primer set in at least one other of the plurality of reaction regions.

[0247] Additional Notes It should be understood that all combinations of the foregoing concepts and additional concepts discussed in more detail below (unless such concepts are mutually inconsistent) are contemplated as being part of the inventive subject matter disclosed herein. Specifically, all combinations of claimed subject matter appearing at the end of this disclosure are contemplated as being part of the inventive subject matter disclosed herein. It should also be understood that terms used expressly herein, and which may also appear in any disclosures incorporated by reference, should be given the meaning most consistent with the particular concepts disclosed herein.

[0248] References throughout this specification to "one example," "another example," "an example," etc. mean that particular elements (e.g., features, structures, and / or characteristics) described in connection with an example are included in at least one example described herein and may or may not be present in other examples. Additionally, unless the context clearly dictates otherwise, it should be understood that the described elements with respect to any example may be combined in any suitable manner in the various examples.

[0249] Although several embodiments have been described in detail, it should be understood that the disclosed examples may be modified, and therefore the foregoing description should be considered non-limiting.

Claims

1. A flow cell, A substrate; a plurality of reaction regions spatially separated from one another across the substrate, each of the plurality of reaction regions comprising: a polymer hydrogel layer, and a plurality of reactive regions comprising reactive entities attached to the polymer hydrogel layer; a plurality of independently removable coatings respectively disposed on each of the plurality of reaction regions; The flow cell, wherein at least one of the plurality of independently removable coatings is a composite material including a thermoresponsive polymer and a photothermal additive.

2. 2. The flow cell of claim 1, wherein the reactive entities in each of the plurality of reaction regions are primer sets.

3. The flow cell of claim 2 , wherein the primer set is the same in each of the plurality of reaction regions.

4. 3. The flow cell of claim 2, wherein the primer set in at least one of the plurality of reaction regions is different from the primer set in at least one other of the plurality of reaction regions.

5. 10. The flow cell of claim 1, the substrate has a plurality of recesses, each of the plurality of reaction regions is disposed within a respective one of the plurality of recesses; A flow cell, wherein each of the plurality of independently removable coatings covers a respective one of the plurality of reaction areas.

6. 10. The flow cell of claim 1, the substrate has a plurality of protrusions, each of the plurality of reaction regions is disposed on a respective one of the plurality of protrusions; A flow cell, wherein each of the plurality of independently removable coatings covers a respective one of the plurality of protrusions.

7. 2. The flow cell of claim 1, wherein the thermoresponsive polymer is selected from the group consisting of polylactic acid, lactic acid-co-glycolic acid copolymer, polycaprolactone, agarose, wax, poly(acrylamide-co-acrylonitrile), poly(N-isopropylacrylamide), cyclodextrin, polyethylene glycol homopolymer, polyethylene glycol graft copolymer, polyethylene block copolymer, and combinations thereof.

8. 10. The flow cell of claim 1, wherein the photothermal filler is selected from the group consisting of gold nanoparticles, silver nanoparticles, iron oxide nanoparticles, polypyrrole, graphene, carbon nanotubes, carbon nanodots, black phosphorus, azobenzene, and combinations thereof.

9. 1. A method comprising: selectively removing at least one of a plurality of independently removable coatings respectively disposed on each of a plurality of reaction regions spatially separated from one another across the substrate, thereby exposing at least one of the plurality of reaction regions and a reactive entity in at least one of the plurality of reaction regions; each of the plurality of reaction regions includes a polymer hydrogel layer and the reactive entity attached to the polymer hydrogel layer; at least one of the plurality of independently removable coatings is a composite material comprising a thermoresponsive polymer and a photothermal additive; and initiating a reaction involving said reactive entity.

10. 10. The method of claim 9, wherein selectively removing the at least one of the plurality of independently removable coatings comprises: exposing the at least one of the plurality of independently removable coatings to light, thereby rendering the at least one of the plurality of independently removable coatings exposed to light susceptible to removal using an aqueous solvent; and removing said at least one of said plurality of independently removable coatings using said aqueous solvent.

11. 10. The method of claim 9, the substrate has a plurality of recesses, each of the plurality of reaction regions is disposed within a respective one of the plurality of recesses; The method, wherein each of a plurality of independently removable coatings covers a respective one of a plurality of reaction regions.

12. 10. The method of claim 9, the substrate has a plurality of protrusions, Each of the plurality of reaction regions is disposed on a respective one of the plurality of protrusions; The method, wherein each of a plurality of independently removable coatings covers a respective one of the plurality of protrusions.

13. 10. The method of claim 9, wherein the thermoresponsive polymer is selected from the group consisting of polylactic acid, lactic acid-co-glycolic acid copolymer, polycaprolactone, agarose, wax, poly(acrylamide-co-acrylonitrile), poly(N-isopropylacrylamide), cyclodextrin, polyethylene glycol homopolymer, polyethylene glycol graft copolymer, polyethylene block copolymer, and combinations thereof.

14. 10. The method of claim 9, wherein the photothermal filler is selected from the group consisting of gold nanoparticles, silver nanoparticles, iron oxide nanoparticles, polypyrrole, graphene, carbon nanotubes, carbon nanodots, black phosphorus, azobenzene, and combinations thereof.

15. 10. The method of claim 9, wherein the reactive entity in each of the plurality of reaction regions is a primer set.

16. The method of claim 15, wherein the primer set is the same in each of the plurality of reaction regions.

17. 16. The method of claim 15, wherein the primer set in at least one of the plurality of reaction zones is different from the primer set in at least one other of the plurality of reaction zones.

Images