Plasmid for expressing recombinant adeno-associated virus-binding protein and method for producing said protein using the same

Abstract

To provide a plasmid that can efficiently produce adeno-associated virus binding protein by genetic transformation, and a method for efficiently producing the protein by using the same.SOLUTION: The present invention discloses a plasmid for expression of adeno-associated virus binding protein, wherein: as a polynucleotide encoding a signal peptide for secreting of the protein to the periplasm, used is a polynucleotide encoding MalE signal peptide, or a polynucleotide encoding an oligopeptide in which one or several residues are substituted, deleted or inserted in the MalE signal peptide.SELECTED DRAWING: Figure 2

Description

[Technical field]

[0001] The present invention relates to a plasmid for expressing a recombinant adeno-associated virus binding protein and a method for producing the protein using the same. In particular, the present invention relates to a plasmid that can efficiently produce the protein by using a signal peptide that causes the protein to be secreted into the host periplasm, and a method for producing the protein using the same. [Background technology]

[0002] It is known that after synthesis within a cell, some proteins remain within the cell and some are released outside the cell as secreted proteins. In addition, in recombinant protein production using Escherichia coli or the like as a host, a method is known in which the protein is secreted and expressed in the periplasmic region between the intracellular membrane and the outer membrane (Patent Document 1). When a recombinant protein is transported from within the cell to the periplasmic region, the function of an oligopeptide called a signal peptide is important (Patent Document 1). The amino acid sequence that constitutes a signal peptide has the following three characteristics (Patent Document 1). (i) The N-terminal region contains at least one basic amino acid such as arginine or lysine, and the signal peptide is translocated into the cell membrane through ionic bonds between the positive charge of the side chain of the basic amino acid and the negative charge on the surface of the cell membrane. (ii) The central region contains many hydrophobic amino acids, such as alanine, leucine, isoleucine, and valine, and is involved in penetrating into the cell membrane. (iii) In the C-terminal region, a specific amino acid is present as a recognition site that is cleaved by a signal peptidase after penetration into the cell membrane, and cleavage at this recognition site allows the mature protein to be released into the periplasmic space or outside the cell.

[0003] In order to express and secrete a recombinant protein into the periplasm of a host, it is necessary to express the protein in a state in which a signal peptide that promotes secretory expression into the periplasm is added to the N-terminus of the protein. However, when using the above method, there is a problem that the productivity of the active protein is low. There are also reports of improving the productivity by modifying the signal peptide (Patent Documents 1 to 4), but these are not sufficient for industrial production. In particular, there are no known cases in which an adeno-associated virus binding protein has been mass-expressed as an active recombinant protein. [Prior art documents] [Patent documents]

[0004] [Patent Document 1] JP 2000-175686 A [Patent Document 2] JP 2008-073044 A [Patent Document 3] WO2008 / 032659 issue [Patent Document 4] JP 2014-223064 A Summary of the Invention [Problem to be solved by the invention]

[0005] An object of the present invention is to provide a plasmid capable of efficiently producing an adeno-associated virus binding protein using gene recombination technology, and a method for efficiently producing said protein using the same. [Means for solving the problem]

[0006] In order to solve the above problems, the present inventors conducted intensive research and found that the production yield of adeno-associated virus (AAV) binding protein by genetic recombination technology can be improved by optimizing a signal peptide for secreting a protein into the host periplasm, thereby completing the present invention.

[0007] That is, the present invention includes the following inventions: (A) a plasmid for expressing an AAV binding protein, the plasmid comprising a polynucleotide encoding the protein and a polynucleotide encoding a signal peptide for secreting the protein into the periplasm, The above-mentioned plasmid, wherein the signal peptide is an oligopeptide consisting of the amino acid sequence set forth in SEQ ID NO: 1, or an oligopeptide in which one or several residues of the oligopeptide have been substituted, deleted or inserted.

[0008] (B) A transformant obtained by transforming a host with the plasmid described in (A).

[0009] (C) The transformant according to (B), wherein the host is Escherichia coli.

[0010] (D) A method for producing the protein, comprising the steps of: culturing the transformant described in (B) or (C) to express the AAV binding protein from the transformant; and isolating the protein from the transformant.

[0011] The present invention will be described in detail below.

[0012] The present invention relates to a polynucleotide encoding a signal peptide for secreting a protein into the periplasm, which is contained in a plasmid expressing an AAV binding protein, (I) a polynucleotide encoding a native MalE signal peptide consisting of the amino acid sequence set forth in SEQ ID NO: 1 (the region from base 1 to base 30 of UniProt No. P0AEX9); or (II) a polynucleotide encoding an oligopeptide in which one or several residues of the signal peptide described in (I) have been substituted, deleted or inserted (hereinafter, these are also collectively referred to as "modified"); The present invention is characterized by its efficient production of AAV binding proteins by using the above. In the above (II), the number of amino acid residues to be modified (modification of one or several residues) is not particularly limited as long as the recombinant protein expressed in a host can be efficiently transferred to the periplasmic region, which is the object of the present invention, and means, for example, any of 1 to 5 residues, 1 to 4 residues, 1 to 3 residues, 1 or 2 residues, and 1 residue. When modifying two or more residues, multiple modifications of one amino acid residue may be made, two or more amino acid residues may be modified consecutively, or a combination thereof may be used.

[0013] The plasmid of the present invention can be obtained by inserting a polynucleotide (polynucleotide C) in which a polynucleotide (polynucleotide B) encoding the above-mentioned signal peptide has been added to the 5'-end of a polynucleotide (polynucleotide A) encoding an AAV binding protein, into an appropriate position of the plasmid. When the polynucleotide B is added to the polynucleotide A, an oligonucleotide encoding an arbitrary oligopeptide consisting of one to several amino acid residues may be inserted as a linker between the polynucleotide A and the polynucleotide B. The plasmid into which the polynucleotide C is inserted is not particularly limited as long as it is stable and can be replicated in the host to be transformed. When the host is Escherichia coli, examples of the plasmid include pET plasmid, pUC plasmid, pTrc plasmid, pCDF plasmid, and pBBR plasmid. The appropriate position means a position that does not destroy the replication function of the expression vector, the desired antibiotic marker, and the region related to transmissibility. The host can be transformed using the plasmid of the present invention by a method commonly used by those skilled in the art.

[0014] The AAV binding protein produced using the transformant obtained by transforming a host with the plasmid of the present invention (hereinafter simply referred to as the transformant of the present invention) is not particularly limited, and examples thereof include laminin receptors such as integrins, anti-AAV antibodies, and AAV receptors (AAVR). When the AAV binding protein is AAVR, preferred embodiments include polypeptides shown in any of (i) to (iii) below; (i) a polypeptide comprising at least the amino acid residues from serine at position 312 to aspartic acid at position 500 of the amino acid sequence set forth in SEQ ID NO: 2; (ii) A polypeptide having an amino acid sequence including at least the amino acid residues from serine at position 312 to aspartic acid at position 500 of the amino acid sequence set forth in SEQ ID NO: 2, provided that the amino acid sequence includes one or more substitutions, deletions, insertions, or additions of amino acid residues at one or more positions in the amino acid residues at positions 312 to 500, and having AAV-binding activity; (iii) A polypeptide comprising at least the amino acid residues from serine at position 312 to aspartic acid at position 500 of the amino acid sequence set forth in SEQ ID NO:2, and having 70% or more identity to the amino acid sequence from amino acid 312 to amino acid 500, and having AAV-binding activity.

[0015] The amino acid sequence described in SEQ ID NO:2 is the amino acid sequence of KIAA0319L (official database: UniProt No. Q8IZA0), which is one embodiment of AAVR, and the amino acid residues from serine (Ser) at position 312 to aspartic acid (Asp) at position 500 in the amino acid sequence described in SEQ ID NO:2 correspond to the extracellular domain 1 (PKD1) and domain 2 (PKD2) of KIAA0319L.

[0016] The polypeptides described in any of (i) to (iii) above need only contain at least the regions corresponding to PKD1 and PKD2 of the above-mentioned KIAA0319L, and may, for example, contain all or a part of the regions corresponding to other extracellular region domains (domain 3 (PKD3), domain 4 (PKD4) and domain 5 (PKD5)) located on the C-terminal side of PKD2, or may contain all or a part of the region corresponding to a signal sequence or cysteine-rich region such as the MANSC (Motif At N terminus with Seven Cysteines) domain located on the N-terminal side of PKD1, or may contain all or a part of the transmembrane region and intracellular region located on the N-terminal and / or C-terminal side of the extracellular region.

[0017] In (ii), "one or several" varies depending on the position of the amino acid substitution in the three-dimensional structure of AAVR and the type of amino acid residue, but as an example, it means any of the following: 1 to 50, 1 to 30, 1 to 20, 1 to 10, 1 to 9, 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 1 to 2, or 1.

[0018] As an example of the (ii) above, there is provided a peptide comprising at least the amino acid residues from the 312th serine to the 500th aspartic acid of the amino acid sequence set forth in SEQ ID NO: 2, with the proviso that the amino acid residues from the 312th to the 500th are selected from the group consisting of Gly390Ser (this notation indicates that the 390th glycine in SEQ ID NO: 2 is substituted with serine, and the same applies below), Ile319Phe, Leu321Pro, Pro322Leu, Asn324Asp, Asn324Ser, Gln327Arg, Asn329Asp, Asn329Tyr, Ala330Gly, Tyr331Cys, Val332Gln, Leu333Val, Leu333Pro, Gln334Arg, Pro337Leu, Lys338Arg, Lys338Glu, Glu340Gly, Thr341Ala, Tyr342Cys, Tyr342His, Tyr34 2Asn, Thr343Met, Tyr344His, Asp345Asn, Trp346Leu, Trp346Arg, Gln347Leu, Gln347Pro, Leu348Pro, Ile349Thr, Thr350Met, His351Leu, Pro352Leu, Arg353Cys, Asp354Gly, Tyr355His, Tyr355Asn, Tyr355Cys, Ser356Cys, Gly357Cys, His363Arg, His363Leu, Ser364Pro, Gln365Arg, Ile366Thr, Leu36 7Pro, Lys368Arg, Leu369Gln, Leu369Pro, Ser370Ala, Lys371Glu, Thr373Ala, Leu376Pro, Tyr377Cys, Phe379Ser, Val381Ala, Glu384Gly, Asn387Ser, His389Gln, His389Leu, His389Arg, Glu391Lys, Tyr393Cys, Val396Ala, Lys399Glu, Lys399Arg, Arg406Ser, Val412Ala, Gln415Leu, Phe416Ser, Gln44 1Leu, Tyr442Phe, Lys448Arg, Glu453Gly, Lys455Arg, Glu458Gly, Ala461Ser, Ser476Arg, Leu477Pro, Asn487Asp, Asn492Asp, Ile319Asn, Ile319Ser,Thr320Ile, Lys323Glu, Leu328Gln, Leu328Pro, Tyr331His, Val332Ala, Val332Glu, Pro336Gln, Pro337Gln, Lys338Asn, Tyr342 Arg, Thr350Ser, Ile366Phe, Val383Ala, Gln386Arg, His389Asp, Gly392Cys, Val394Ala, Ile409Val, Ser476Gly, Thr490Ser, Se r312Pro, Ala313Ser, Val317Asp, Gln318Pro, Thr320Ala, Lys323Arg, Val326Ala, Val326Glu, Gln327His, Gln327Leu, Asn329Hi s, Asn329Ile, Val332Ala, Glu335Gly, Glu335Val, Glu340Val, Thr341Pro, Thr343Ser, Tyr344Phe, Trp346Cys, Met359Leu, Glu3 60Lys, Glu360Val, Gly361Cys, Lys362Glu, Lys362Asn, Lys362Gly, Ser364Leu, Lys371Asn, Lys371Asp, Leu372Pro, Leu372Gln, Pro374Leu, Glu378Gly, Glu378Val, Phe379Tyr, Phe379Cys, Lys380Glu, Val381Asp, Ile382Val, Glu384Val, Val394Asp, Val394 Examples of such polypeptides include polypeptides in which at least one of the amino acid substitutions of Ile, Asn395Ser, Thr397Ser, Glu401Val, Arg403His, Arg406His, Gln415Arg, Thr426Ala, Gln432Leu, Gln432Arg, Gln441Arg, His443Leu, Lys448Glu, Ile456Val, Asp483Asn, Ser488Leu, Val499Glu, and Val499Ile has occurred. Among these, Gly390Ser is an amino acid substitution that particularly improves stability against heat and acid. Thus, the polypeptides include at least the amino acid residues from the 312th serine to the 500th aspartic acid in the amino acid sequence set forth in SEQ ID NO:2, provided that in the amino acid residues from the 312th to the 500thThe polypeptide in which at least the amino acid substitution Gly390Ser has occurred is a preferred embodiment of (ii) above.

[0019] In addition, the "substitution of one or several amino acid residues" in (ii) may include, in addition to the amino acid substitution at the specific position described above, conservative substitution in which a substitution occurs between amino acids having similar physical and / or chemical properties. Conservative substitution is generally known to those skilled in the art to maintain the function of a protein between a substituted and unsubstituted protein. Examples of conservative substitutions include substitution between glycine and alanine, between serine and proline, or between glutamic acid and alanine (Protein Structure and Function, Medical Science International, 9, 2005). In addition, the "substitution, deletion, insertion, or addition of one or several amino acid residues" in (ii) also includes naturally occurring mutations (mutants or variants) based on differences in the origin of AAVR or differences in species.

[0020] The homology of the amino acid sequence in (iii) above may be 70% or more, and may be higher (e.g., 80% or more, 85% or more, 90% or more, or 95% or more). In this specification, "homology" may mean similarity or identity, and may particularly mean identity. "Homology of amino acid sequence" means homology with respect to the entire amino acid sequence. "Identity" between amino acid sequences means the ratio of amino acid residues of the same type in those amino acid sequences (Experimental Medicine, 31(3), Yodosha). "Similarity" between amino acid sequences means the sum of the ratio of amino acid residues of the same type in those amino acid sequences and the ratio of amino acid residues with similar side chain properties (Experimental Medicine, 31(3), Yodosha). The homology of amino acid sequences can be determined using alignment programs such as BLAST (Basic Local Alignment Search Tool) and FASTA.

[0021] Examples of hosts used in producing the transformant of the present invention include animal cells such as COS (CV-1 Origin, SV40) cells and CHO (Chinese Hamster Ovary) cells, bacteria such as the genus Bacillus (including bacteria of the genus Bacillus in a broad sense, such as bacteria of the genus Brevibacillus and Paenibacillus) and Escherichia coli, yeasts such as the genus Saccharomyces, Pichia, and Schizosaccharomyces, and filamentous fungi such as Aspergillus oryzae, among which Escherichia coli, which is easy to handle, is preferably used as the host.

[0022] To recover the expressed protein from the culture medium of the transformant of the present invention, a suitable method may be selected depending on the form of expression. For example, when the expressed protein is expressed in the periplasm of the host, the culture medium is centrifuged, the host obtained is suspended in an appropriate buffer, and the cells are disrupted (physically, chemically, etc.), and then the disruption residue is removed by centrifugation to obtain a cell-free extract containing the expressed protein. When the expressed protein leaks from the periplasm of the host into the culture supernatant, the culture medium is centrifuged to recover the expressed protein from the culture supernatant. When disrupting host cells with a drug, for example, disruption can be performed using a commercially available extraction reagent such as 50 mM Tris-HCl (pH 8.0) containing 150 mM NaCl, 1 mM EDTA, 6 mM MgSO4, 250 U / L Benzonase (trade name), 0.3 g / L Lysozyme, 0.4% (w / v) Triton X-100 (trade name), 0.5% (w / v) CTAB (hexadecyltrimethylammonium bromide) and 50 mM CaCl2 (JP Patent Publication No. 2013-252099), or BugBuster Protein extraction kit (manufactured by Takara Bio Inc.).

[0023] The recovered protein-containing solution can be subjected to cation exchange chromatography, hydrophobic chromatography, or the like to purify and isolate the protein. The cation exchange chromatography carrier is one in which a cation exchange group such as a carboxymethyl group or a sulfopropyl group is bound to the carrier, and examples thereof include TOYOPEARL CM-650, TOYOPEARL SP-650 (both manufactured by Tosoh Corporation), and CM Sepharose FastFlow (manufactured by Cytiva Corporation). The hydrophobic chromatography carrier is one in which a hydrophobic functional group such as an ether group, a phenyl group, or a butyl group is bound to the carrier, and examples thereof include TOYOPEARL Ether-650, TOYOPEARL Phenyl-650, and TOYOPEARL Butyl-650 (both manufactured by Tosoh Corporation). When performing purification using various chromatography carriers, the carrier may be packed in an appropriate open column or the like in an amount determined by the amount of application solution introduced and the protein adsorption performance of the carrier.

[0024] In addition, the chromatography carrier is equilibrated in advance with an appropriate buffer (Tris / Tris hydrochloride buffer, glycine / sodium hydroxide buffer, phosphate buffer, etc.) before the application solution is introduced. The solution containing the protein recovered by the above-mentioned method is introduced into the equilibrated chromatography carrier to adsorb the protein onto the carrier, and the carrier is washed with the same buffer as that used for equilibration. The adsorbed protein is then eluted using an elution buffer to obtain a solution containing the purified protein. Effect of the Invention

[0025] In the present invention, a polynucleotide encoding a MalE signal peptide or a polynucleotide encoding an oligopeptide in which one or several residues of the MalE signal peptide have been substituted, deleted or inserted is used as a polynucleotide encoding a signal peptide for secreting the protein into the periplasm, which is contained in a plasmid expressing an adeno-associated virus binding protein. This allows the production amount of the protein to be significantly improved compared to when the PelB signal peptide is used, and therefore the efficiency of producing industrially useful recombinant proteins can be significantly improved. [Brief description of the drawings]

[0026] [Figure 1] FIG. 1 shows the structure of an adeno-associated virus (AAV) binding protein consisting of the amino acid sequence set forth in SEQ ID NO:16. [Diagram 2] FIG. 1 shows a comparison of the productivity of AAV-binding protein when a PelB signal peptide was added to the N-terminus of the AAV-binding protein (Comparative Example 1) and when a MalE signal peptide was added to the N-terminus of the AAV-binding protein (Example 4). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS EXAMPLES

[0027] The present invention will be described in detail below using examples and comparative examples, but the present invention is not limited to these examples.

[0028] Example 1 Construction of an Expression Vector An expression vector pTrcpel was prepared by inserting a polynucleotide encoding the native PelB signal peptide (amino acid sequence: MKYLLPTAAAGLLLLAAQPAMA, SEQ ID NO: 3) into the plasmid pTrc99a (Cytiva) using the method described below.

[0029] (1) Equal amounts of oligonucleotides consisting of the sequences described in SEQ ID NO: 4 (5'-CATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGC-3') and SEQ ID NO: 5 (5'-CATGGCCATCGCCGGCTGGGCAGCGAGGAGCAGCAGACCAGCAGCAGCGGTCGGCAGCAGGTATTT-3') were mixed and heated at 95°C for 5 minutes, and then the temperature was lowered at 1°C intervals over 1 minute until it reached 15°C, to prepare double-stranded oligonucleotide PelBp1. PelBp1 was kept at 15°C until use.

[0030] (2) The PelBp1 prepared in (1) was ligated to the plasmid pTrc99a, which had been digested with the restriction enzyme NcoI, using a DNA Ligation kit (Takara Bio Inc.), and the ligation product was used to transform Escherichia coli JM109 strain (Takara Bio Inc.).

[0031] (3) The obtained transformant was cultured in LB (Luria-Bertani) medium containing 100 μg / mL carbenicillin sodium (Fujifilm Wako Pure Chemical Industries, Ltd.), and the expression vector pTrcpel was extracted using a QIAprep Spin Miniprep kit (Qiagen).

[0032] (4) The nucleotide sequence of the polynucleotide encoding the PelB signal peptide and its surrounding region of the expression vector pTrcpel prepared in (3) was analyzed using a fully automated DNA sequencer, Genetic Analyzer 3500 (Thermo Fisher Scientific), and it was confirmed that it was the desired sequence (i.e., the sequence of the polynucleotide encoding the oligopeptide consisting of the amino acid sequence shown in SEQ ID NO: 3). In this analysis, either the oligonucleotide shown in SEQ ID NO: 6 (5'-TGTGGTATGGCTGTGCAGG-3') or the oligonucleotide shown in SEQ ID NO: 7 (5'-TCGGCATGGGGTCAGGTG-3') was used as a sequencing primer.

[0033] Example 2: Construction of AAV binding protein expression vector (part 1) A polynucleotide encoding a polypeptide (AVR8g-CRNDTCG) in which a cysteine ​​tag (amino acid sequence: CRNDTCG) has been added to the C-terminus of the adeno-associated virus (AAV) binding protein AVR8g, which consists of the amino acid sequence set forth in SEQ ID NO:8, was inserted into the expression vector pTrcpel prepared in Example 1. AVR8g is a polypeptide consisting of amino acid residues 312 to 500 of the amino acid sequence set forth in SEQ ID NO: 2, which corresponds to the extracellular domain 1 (PKD1) and domain 2 (PKD2) regions of KIAA0319L (UniProt No. Q8IZA0), with the following amino acid substitutions occurring in the amino acid residues 312 to 500: Val317Asp (this notation indicates that the 317th valine has been replaced with aspartic acid, and the same applies below), Tyr342Cys, Lys362Glu, Lys371Asn, Gly390Ser, Lys399Glu, Ser476Arg, and Asn487Asp.

[0034] (1) PCR was performed using a plasmid pET-AVR8g (SEQ ID NO: 9) containing a polynucleotide encoding the AAV binding protein AVR8g consisting of the amino acid sequence set forth in SEQ ID NO: 8 as a template DNA, and oligonucleotides consisting of the sequences set forth in SEQ ID NO: 10 (5'-TAATACGACTCACTATAGGG-3') and SEQ ID NO: 11 (5'-TTTT[AAGCTT]CATCCGCAGGTATCGTTGCGGCAGTCTACCGCTTTGTTGACGGTAAG-3') (the brackets in SEQ ID NO: 11 indicate the restriction enzyme HindIII recognition sequence) as PCR primers. PCR was performed by preparing a reaction solution having the composition shown in Table 1, and then repeating 30 cycles of reaction with the reaction solution, in which one cycle is a first step at 98°C for 10 seconds, a second step at 50°C for 5 seconds, and a third step at 72°C for 1 minute. The resulting PCR product was purified to obtain a polynucleotide encoding AVR8g-CRNDTCG.

[0035] [Table 1]

[0036] (2) The obtained polynucleotide encoding AVR8g-CRNDTCG was digested with restriction enzymes NcoI and HindIII and then ligated into the expression vector pTrcpel prepared in Example 1 which had been previously digested with the restriction enzymes NcoI and HindIII, and the ligation product was used to transform Escherichia coli W3110 strain.

[0037] (3) The obtained transformant was cultured in LB medium containing 100 μg / mL carbenicillin sodium (Fujifilm Wako Pure Chemical Industries, Ltd.), and the expression vector pTrcAVR8g-CRNDTCG containing a polynucleotide encoding AVR8g-CRNDTCG was extracted using a QIAprep Spin Miniprep kit (Qiagen).

[0038] (4) In the expression vector pTrcAVR8g-CRNDTCG, the nucleotide sequence of the polynucleotide encoding AVR8g-CRNDTCG and its surrounding region was analyzed in the same manner as in Example 1(4) to confirm that it was the desired sequence.

[0039] The amino acid sequence of the polypeptide expressed by the expression vector pTrcAVR8g-CRNDTCG is shown in SEQ ID NO: 12, and the sequence of the polynucleotide encoding the polypeptide is shown in SEQ ID NO: 13. In SEQ ID NO: 12, the amino acid sequence from the 1st methionine to the 22nd alanine is the PelB signal peptide (SEQ ID NO: 3), the sequence from the 25th serine to the 213th aspartic acid is the AAV binding protein AVR8g (SEQ ID NO: 8, corresponding to the region from the 312th to the 500th amino acid sequence (PKD1 and PKD2 of KIAA0319L) in the amino acid sequence described in SEQ ID NO: 2), and the sequence from the 214th cysteine ​​to the 220th glycine is a cysteine ​​tag. In addition, in SEQ ID NO:12, the aspartic acid of Val317Asp is at the 30th position, the cysteine ​​of Tyr342Cys is at the 55th position, the glutamic acid of Lys362Glu is at the 75th position, the asparagine of Lys371Asn is at the 84th position, the serine of Gly390Ser is at the 103rd position, the glutamic acid of Lys399Glu is at the 112th position, the arginine of Ser476Arg is at the 189th position, and the aspartic acid of Asn487Asp is at the 200th position.

[0040] Example 3: Construction of AAV binding protein expression vector (part 2) A polypeptide (sequence number 16) was designed from a polypeptide consisting of the amino acid sequence set forth in sequence number 12, in which the signal peptide was replaced from PelB (sequence number 3) to the MalE signal peptide (amino acid sequence: MKIKTGARILALSALTTMMFSASALAKIEE, sequence number 1), and a vector capable of expressing the polypeptide was constructed.

[0041] (1) Using the expression vector pTrcAVR8g-CRNDTCG prepared in Example 2 as a template, and oligonucleotides consisting of the sequences described in SEQ ID NO: 14 (5'-TTTT[GGTCTC]ACGACGATGATGTTTTCCGCCTCGGCTCTCGCCAAAATCGAAGAAGCCATGGGCTCTGCAGGCG-3') and SEQ ID NO: 15 (5'-TTTT[GGTCTC]AGTCGTTAATGCGGATAATGCGAGGATGCGTGCACCTGTTTTTATTTTCATGGTCTGTTTCCTGTG-3') as PCR primers (the brackets in SEQ ID NOs: 14 and 15 indicate the restriction enzyme BsaI recognition sequence), a reaction solution having the composition shown in Table 1 was prepared. The reaction solution was heat-treated at 98°C for 5 minutes, and 30 cycles of reaction were performed, each cycle consisting of a first step at 98°C for 10 seconds, a second step at 55°C for 5 seconds, and a third step at 72°C for 6 minutes, and finally heat-treated at 72°C for 5 minutes, to perform PCR.

[0042] (2) The amplified PCR product was subjected to agarose gel electrophoresis and purified from the gel using a QIAquick Gel Extraction kit (Qiagen). The purified PCR product was named V2p.

[0043] (3) The obtained V2p was treated with the restriction enzyme DpnI (NEB) at 37° C. for 1.5 hours, and then at 80° C. for 20 minutes. The obtained polynucleotide was subjected to agarose gel electrophoresis and purified from the gel using a QIAquick Gel Extraction kit (Qiagen).

[0044] (4) A reaction solution having the composition shown in Table 2 was prepared, and the DpnI-treated PCR product purified in (3) was digested with the restriction enzyme BsaI (NEB) while a ligation reaction was carried out at 25°C for 1.0 hour using T4 DNA ligase (NEB).

[0045] [Table 2]

[0046] (5) The ligation product was used to transform E. coli W3110 strain. The resulting transformant was cultured in LB medium supplemented with 50 μg / mL kanamycin. A plasmid was extracted from the recovered bacterial cells (transformant) to obtain plasmid AVR8g-CRNDTCG-V2, which contains a polynucleotide encoding a polypeptide in which the signal peptide in the AAV binding protein consisting of the amino acid sequence set forth in SEQ ID NO: 12 was replaced with the MalE signal peptide (SEQ ID NO: 1).

[0047] (6) The nucleotide sequence of pTrcAVR8g-CRNDTCG-V2 was analyzed in the same manner as in Example 1(4) and was confirmed to be the desired sequence.

[0048] The amino acid sequence of the polypeptide expressed by the expression vector pTrcAVR8g-CRNDTCG-V2 is shown in SEQ ID NO: 16, and the sequence of the polynucleotide encoding the polypeptide is shown in SEQ ID NO: 17. In SEQ ID NO:16, the portion from the 1st methionine to the 30th glutamic acid is the MalE signal peptide (SEQ ID NO:1), the portion from the 34th serine to the 222nd aspartic acid is the AAV binding protein AVR8g (SEQ ID NO:8, corresponding to the region from the 312th to the 500th amino acid of the amino acid sequence described in SEQ ID NO:2 (PKD1 and PKD2 of KIAA0319L)), and the portion from the 223rd cysteine ​​to the 229th glycine is a cysteine ​​tag. In addition, in SEQ ID NO:16, the aspartic acid of Val317Asp is at the 39th position, the cysteine ​​of Tyr342Cys is at the 64th position, the glutamic acid of Lys362Glu is at the 84th position, the asparagine of Lys371Asn is at the 93rd position, the serine of Gly390Ser is at the 112th position, the glutamic acid of Lys399Glu is at the 121st position, the arginine of Ser476Arg is at the 198th position, and the aspartic acid of Asn487Asp is at the 209th position.

[0049] Example 4 Expression of AAV binding proteins (part 1) (1) The E. coli W3110 strain was transformed with the plasmid pTrcAVR8g-CRNDTCG-V2, which contains a polynucleotide (SEQ ID NO: 17) encoding an AAV-binding protein consisting of the amino acid sequence set forth in SEQ ID NO: 16. The resulting transformant capable of expressing the AAV-binding protein was inoculated into 3 mL of 2YT liquid medium containing 50 μg / mL kanamycin and pre-cultured overnight at 37° C. under aerobic shaking.

[0050] (2) 0.2 mL of the preculture solution from (1) was inoculated into 20 mL of 2YT liquid medium containing 50 μg / mL kanamycin in a 200 mL baffled flask, and cultured aerobically at 37°C with shaking.

[0051] (3) 2.0 hours after the start of culture, the medium was cooled on ice, IPTG (IsoPropyl β-D-1-ThioGalactopyranoside) was added to a final concentration of 0.1 mM, and the medium was subsequently cultured aerobically with shaking at 25°C overnight.

[0052] (4) After the cultivation was completed, the culture medium was centrifuged at 8,000 rpm at 4° C. for 20 minutes to collect the bacterial cells, and a protein extract was prepared using a BugBuster Protein extraction kit (manufactured by Takara Bio Inc.).

[0053] (5) The obtained protein extract was subjected to SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) and stained with CBB (Coomassie Brilliant Blue) staining solution (manufactured by Fujifilm Wako Pure Chemical Industries, Ltd.).

[0054] Comparative Example 1 Expression of AAV binding proteins (part 2) The AAV-binding protein was expressed in the same manner as in Example 4, except that a transformant capable of expressing the AAV-binding protein obtained by transforming the E. coli W3110 strain with the expression vector pTrcAVR8g-CRNDTCG prepared in Example 2 was used as the transformant, and the obtained protein extract was subjected to SDS-PAGE.

[0055] The results of Example 4 and Comparative Example 1 are shown in Figure 2. By using the MalE signal peptide (SEQ ID NO: 1) (Example 4), the band (about 24 kDa) corresponding to the AAV binding protein became stronger than when PelB (SEQ ID NO: 3) was used as the signal peptide (Comparative Example 1), indicating that the expression level was significantly improved.

Claims

1. A plasmid for expressing an adeno-associated virus (AAV) binding protein, comprising a polynucleotide encoding said protein and a polynucleotide encoding a signal peptide for secreting said protein into the periplasm, The signal peptide is an oligopeptide consisting of the amino acid sequence set forth in SEQ ID NO:1, A plasmid, wherein the AAV binding protein is a polypeptide comprising at least the amino acid sequence set forth in SEQ ID NO:

8.

2. A transformant obtained by transforming a host with the plasmid according to claim 1.

3. The transformant according to claim 2 , wherein the host is Escherichia coli.

4. A method for producing the protein, comprising the steps of: culturing the transformant described in claim 2 or 3 to express the adeno-associated virus binding protein from the transformant; and isolating the protein from the transformant.

Images