Fully humanized anti-B cell maturation antigen (BCMA) single chain antibody and its applications

Abstract

To provide fully humanized anti-BCMA antibodies, coding genes and application thereof.SOLUTION: In one aspect, the invention provides an antibody or antigen-binding fragment thereof that specifically binds to a BCMA, preferably human BCMA protein. In one embodiment, the antibody of the invention is a single chain scFv antibody. In another embodiment, the antibody of the invention is a scFv-Fc antibody.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to novel antibodies and antibody fragments, in particular single chain antibodies (e.g. single chain scFvs), that specifically bind to B cell maturation antigen (BCMA). The present invention further relates to nucleic acids encoding these antibodies and antibody fragments, vectors and host cells expressing said nucleic acids. Additionally, the present invention relates to compositions comprising the antibodies of the invention and their therapeutic and diagnostic uses. [Background technology]

[0002] B-cell maturation antigen (BCMA), also known as CD269 or TNFRS17, is a member of the tumor necrosis factor receptor family. BCMA is a type III transmembrane protein that contains the characteristic cysteine-rich domain (CRD) of TNFR family members in its extracellular domain (ECD), which forms a ligand-binding motif. BCMA is functionally related to TNFR family members, transmembrane activator CMAL interactor (TACI) and BAFF receptor (BAFF-R). BCMA expresses a certain degree of similarity to TACI in the CRD at the N-terminus of the transmembrane domain. In addition, human BCMA shares approximately 65% ​​and 85% amino acid sequence identity with mouse and rhesus macaque BCMA, respectively, in the extracellular domain ECD.

[0003] Studies have shown that BCMA can bind to B cell-activating factor receptor (BAFF) and B cell proliferation-inducing ligand (APRIL) and promote the survival of B cells at different developmental stages. However, abnormal signaling can promote B cells to proliferate abnormally, leading to autoimmune diseases and tumor formation. See Rickert et al., Immunological Reviews 2011, Vol. 244:115-133.

[0004] APRIL, also known as G70, is a member of the TNF ligand family. Literature reports that APRIL is associated with prostate cancer, breast cancer, Alzheimer's disease, immune disorders, inflammation, and gastrointestinal disorders. See Hahne et al. (1998), T. Exp. Med. 188:1185-90. Binding of soluble APRIL to BCMA can promote survival of plasma cells and plasmablast cells in the bone marrow (BM) (BLOOD, May 2014, Vol. 123, No. 20, p3128-3138), and binding to TACI can trigger T cell-independent antibody responses, B cell regulation, and class switch recombination (Vincent et al., Nature Reviews Rheumotogy, 2014 Vol. 10:365-373).

[0005] BAFF is another member of the TNF ligand family. BAFF binding to BCMA can promote plasma cell survival. BAFF can bind to the BAFF receptor (BAFF-R) expressed on the surface of B cells, plasmablasts and plasma cells, and promote the survival and maturation of immature B cells. In addition, BAFF can bind to TACI, which induces T cell-independent antibody responses, B cell regulation and class switch recombination (see Vincent et al., Nature Reviews Rheumotogy, 2014 Vol. 10:365-373).

[0006] In non-tumor cells, BCMA is expressed primarily on plasma cells and mature B cell subpopulations. In 60-70% of multiple myeloma (MM) patients, BCMA is also expressed on the surface of cancerous plasma cells. Levels of BCMA are elevated in the serum of MM patients, and elevated levels correlate with disease status, treatment response, and overall survival. Mice defective in the BCMA gene have normal B cell levels but a significantly shortened survival of their plasma cells. Therefore, BCMA is a desirable target for immunotherapy of multiple myeloma.

[0007] A single-chain scFv antibody is a small molecule genetically engineered antibody, which is a small molecule recombinant antibody that is formed by connecting the heavy chain variable region (VH) of a natural antibody to the light chain variable region (VL) of the natural antibody at the DNA level using genetic engineering methods (usually connected by an artificially synthesized connecting peptide (or "linker"). Compared with a complete antibody molecule, a single-chain scFv antibody contains a complete antibody variable region, retains the antigen specificity and binding activity of the original antibody, and does not contain the Fc region of the antibody molecule, so it has weak immunogenicity and is less likely to cause an immune reaction when used in the human body, has a small molecular weight, is highly permeable, and is easy to penetrate into tissues, and can enter the inside of tissues that cannot be reached by general complete antibodies when used in imaging diagnosis or treatment. It can form a functional antibody molecule without glycosylation modification, is convenient for mass production in prokaryotic expression systems, is easy to operate, and can be applied to produce other antigen-specific binding molecules with new properties as a genetic engineering structure, such as full-length antibodies, scFv-Fc, etc.

[0008] In view of the efficacy of BCMA as a therapeutic target in B-cell malignancies, particularly multiple myeloma, there remains a need in the art for new molecules that specifically bind to BCMA. The present invention satisfies this need by providing fully human single chain antibodies that bind to BCMA with high targeting specificity and high affinity, particularly to BCMA expressed on the surface of tumor cells, and have low side effects. The fully human single chain antibodies of the present invention can be used alone in the diagnosis and treatment of tumors and carcinomas, but are more advantageously applied to the manufacture of other diagnostic and therapeutic molecules with high BCMA targeting as genetic engineering constructs, such as various types of antibodies, scFv-Fc, and antibody-based fusions and complexes. Summary of the Invention

[0009] The present invention provides a fully humanized anti-human BCMA antibody and its coding gene and application. By using genetic engineering means and yeast surface display technology, the present inventors select a fully humanized anti-human BCMA antibody from a human antibody library displayed on the yeast surface, obtain the gene sequence of its variable region, and based on this, construct a fully human single-chain scFv antibody and its fusion construct with a human Fc region, and obtain a scFv-hFc recombinant single-chain antibody molecule through mammalian cell expression and purification. The recombinant single-chain antibody molecule of the present invention not only binds with high affinity to non-membrane-bound human BCMA, but also binds with high affinity to BCMA expressed on the cell surface.

[0010] Thus, the present invention provides antibodies, particularly single chain antibodies, that specifically bind to BCMA and nucleic acid molecules encoding same, and their therapeutic and diagnostic uses.

[0011] In one aspect, the invention provides an antibody or antigen-binding fragment thereof that specifically binds to BCMA, preferably human BCMA protein. In a preferred embodiment, the antibody of the invention is a single chain antibody. In a preferred embodiment, the antibody of the invention is a single chain scFv antibody. In another preferred embodiment, the antibody of the invention is a scFv-Fc antibody. In some embodiments, the antibody of the invention binds to human BCMA protein with a KD of about 100 nM to 5 nM, where the KD value is measured, for example, according to biofilm layer optical interference techniques (e.g., Fortebio detection). In some embodiments, the antibody of the invention binds to human BCMA protein expressed on the cell surface with an EC50 of about 40 nM to 4 nM, where the EC50 value is measured, for example, according to flow cytometry (e.g., FACS). In some embodiments of the invention, there is provided the use of an anti-BCMA antibody or fragment thereof of the invention in the treatment of a BCMA-associated condition.

[0012] In some embodiments, the antibody of the present invention comprises a VH region sequence of any one of the antibodies shown in Table 1 or a variant thereof. In some other embodiments, the antibody of the present invention comprises a VL region sequence of any one of the antibodies shown in Table 1 or a variant thereof. In some other embodiments, the antibody of the present invention comprises a VH and VL sequence pair of any one of the antibodies shown in Table 1 or a variant thereof. In some other embodiments, the antibody of the present invention comprises one, two or three CDRs (preferably three CDRs) or a variant thereof of the VH region sequence of any one of the antibodies shown in Table 1. In some other embodiments, the antibody of the present invention comprises one, two or three CDRs (preferably three CDRs) or a variant thereof of the VL region sequence of any one of the antibodies shown in Table 1. In some embodiments, the antibody of the present invention comprises six CDR region sequences of any one of the antibodies shown in Table 1 or a variant thereof. In one embodiment, the CDR sequences of the antibody are the CDR sequences shown in Table 2.

[0013] In some embodiments, the antibody of the present invention is a single chain scFv antibody. Preferably, the scFv antibody comprises a VH sequence, a VL sequence and a linker. Preferably, the scFv antibody comprises, from N-terminus to C-terminus, VL domain-linker-VH domain, or VH domain-linker-VL domain.

[0014] In some embodiments, there is further provided an scFv-Fc antibody formed by fusion of a single chain scFv antibody of the invention with a wild type or altered Fc region. In some embodiments, the Fc region of the antibody of the invention is hypofucosylated or afucosylated. In some embodiments, the scFv antibody is fused to the Fc region by a hinge region.

[0015] In another aspect, the invention relates to fusions and conjugates constructed based on the antibodies of the invention, in particular single chain antibodies.

[0016] In another aspect, the invention relates to methods and compositions for treating a B cell associated condition, comprising administering to the subject an effective amount of an antibody or antigen-binding fragment thereof of the invention, or a fusion or conjugate of the invention. In some embodiments, the B cell associated disease is selected from B cell malignancies, plasma cell malignancies, autoimmune diseases, and preferably selected from multiple myeloma, non-Hodgkin's lymphoma, B cell proliferation of undetermined grade, lymphomatoid granulomatosis, post-transplant lymphoproliferative disease, immunomodulatory diseases, rheumatoid arthritis, myasthenia gravis, idiopathic thrombocytopenic purpura, antiphospholipid syndrome, Chagas disease, Graves' disease, Wegener's granulomatosis, polyarteritis nodosa, Sjogren's syndrome, pemphigus vulgaris, scleroderma, multiple sclerosis, ANCA-associated vasculitis, Goodpasture's disease, Kawasaki disease, autoimmune hemolytic anemia and rapidly progressive glomerulonephritis, heavy chain disease, primary or immune cell-associated amyloid degeneration, or monoclonal gammopathy of undetermined significance. In some preferred embodiments, the B cell related disease is a B cell malignancy, preferably multiple myeloma (MM) or non-Hodgkin's lymphoma (NHL). In some embodiments, the antibody molecules, fusions or conjugates of the invention are used in combination with other therapeutic agents.

[0017] In another aspect, the present invention relates to a method and kit for detecting BCMA in a sample, the method comprising: (a) contacting the sample with an antibody or antigen-binding fragment thereof, fusion or conjugate of the present invention; and (b) detecting the formation of a complex between the antibody or antigen-binding fragment thereof, fusion or conjugate and a BCMA protein. In some embodiments, the sample is from a multiple myeloma (MM) patient. The detection may be in vitro or in vivo. [Brief description of the drawings]

[0018] [Figure 1] FIG. 1 shows the affinity of exemplary anti-BCMA antibodies of the invention selected from a yeast display library to multiple myeloma cell line NCI-H929 cells as measured by flow cytometry. [Diagram 2]FIG. 2 shows a schematic diagram of an expression vector cloning strategy for an exemplary scFv-hFc recombinant single chain antibody of the present invention. [Diagram 3] FIG. 3 shows the affinity of an exemplary scFv-hFc recombinant single chain antibody of the invention to NCI-H929 cells as measured by flow cytometry. [Figure 4] FIG. 4 shows exemplary CDR sequences of the antibodies of the invention. [Diagram 5] FIG. 5 shows exemplary VH sequences of antibodies of the invention. [Figure 6] FIG. 6 shows exemplary VL sequences of antibodies of the invention. [Figure 7] FIG. 7 shows an exemplary amino acid sequence of a human BCMA antigen and its extracellular domain (ECD). [Figure 8] FIG. 8 shows the amino acid and nucleotide sequences of the linker, hinge region and Fc region used in the construction of exemplary scFv-Fc constructs of the invention and used as a reference for the scFv-Fc construct construction. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0019] Unless expressly indicated to the contrary, the practice of the present invention employs methods of routine chemistry, biochemistry, organic chemistry, molecular biology, microbiology, recombinant DNA techniques, genetics, immunology and cell biology within the skill of the art.Descriptions of these methods can be found, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual (3rd ed., 2001); Sambrook et al., Molecular Cloning: A Laboratory Manual (2nd ed., 1989); Maniatis et al., Molecular Cloning: A Laboratory Manual (1982); Ausubel et al., Current Protocols in Molecular Biology (John Wiley and Sons, updated July 2008); Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience; Glover, DNA Cloning: A Practical Approach, vol. I & II (IRL Press, Oxford, 1985); Anand, Techniques for the Analysis of Complex Genomes, (Academic Press, New York, 1992); Transcription and Reference is made to periodicals and specialist volumes such as: A Practical Guide to Molecular Cloning (B. Hames & S. Higgins, Eds., 1984); Perbal, A Practical Guide to Molecular Cloning (1984); Harlow and Lane, Antibodies, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1998); Current Protocols in Immunology QE Coligan, A. M. Kruisbeek, D. H. Margulies, E. M. Shevach and W. Strober, eds., 1991); Annual Review of Immunology; and Advances in Immunology.

[0020] definition Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. For purposes of the present invention, the following terms are defined:

[0021] The term "about" when used in conjunction with numerical values ​​is meant to include numerical values ​​in a range from 5% below the stated numerical value as a lower limit to 5% above the stated numerical value as an upper limit.

[0022] When the term "and / or" is used in conjunction with two or more selectable options, it should be understood to refer to any one of the selectable options or any two or more of the selectable options.

[0023] As used in this application, the term "comprise" or "comprising" means including the element, integer or step, but not excluding other elements, integers or steps. In this application, when the term "comprise" or "comprise" is used, it must include the stated element, integer or step, unless otherwise specified. For example, when referring to "comprising" an antibody variable region of a certain sequence, it refers to including an antibody variable region consisting of that sequence.

[0024] In the present application, the term "antigen-binding molecule" includes molecules, such as proteins or polypeptides, of antigen-binding regions or antigen-binding portions that bind to a target antigen. In the present invention, when the target antigen is B-cell maturation antigen (BCMA), the antigen-binding molecule that binds to BCMA is also referred to as a BCMA-binding molecule. Antigen-binding molecules include, for example, antibodies and antigen-binding fragments thereof, various fusions and complexes based on scFv, such as single-chain scFv antibodies and scFv-Fc antibodies. As will be clear to those skilled in the art, the antigen-binding portion of an antibody typically includes amino acid residues derived from the "complementarity determining region" or "CDR". In some cases, depending on the context, "BCMA-binding molecule" can be used interchangeably with "antibody of the present invention" or "anti-BCMA antibody".

[0025] In this application, the term "antibody" refers to a polypeptide comprising at least a light or heavy chain immunoglobulin variable region that specifically recognizes and binds to an antigen. The term encompasses a variety of antibody structures, including, but not limited to, monoclonal, polyclonal, single-chain or multi-heavy-chain antibodies, monospecific or multispecific antibodies (e.g., bispecific antibodies), fully humanized or chimeric or humanized antibodies, full-length antibodies and antibody fragments, as long as they express the desired antigen-binding activity.

[0026] Those skilled in the art will appreciate that a "whole antibody" (which may be used interchangeably in this application as "full length antibody", "complete antibody", or "complete antibody") comprises at least two heavy chains (H) and two light chains (L). Each heavy chain consists of a heavy chain variable region (abbreviated as VH in this application) and a heavy chain constant region. The heavy chain constant region consists of three domains CH1, CH2, and CH3. Each light chain consists of a light chain variable region (abbreviated as VL in this application) and a light chain constant region. The light chain constant region consists of one domain CL. The variable region is the domain that participates in the binding of the antibody to its antigen in the heavy or light chain of the antibody. The constant region is not directly involved in the binding of the antibody to the antigen, but exhibits several effector functions. The light chain of an antibody can be classified into one of two types, called kappa (κ) and lambda (λ), based on the amino acid sequence of its constant domain. Based on the amino acid sequence of the heavy chain constant region, the heavy chain of an antibody can be divided into five different types, mainly IgA, IgD, IgE, IgG and IgM, and some of these types can be further divided into subtypes, IgG1, IgG2, IgG3 and IgG4, IgA1 and IgA2. The heavy chain constant regions corresponding to the different antibody types are called α, δ, ε, γ and μ, respectively. See, for example, Fundamental Immunology, Ch. 7 (Paul, W., ed., 2nd ed., Raven Press, NY (1989)) (hereby incorporated by reference in its entirety for all purposes).

[0027] The term "antibody fragment" refers to a molecule that is not a complete antibody and includes a portion of a complete antibody that binds to an antigen bound by the complete antibody. Antigen-binding fragments can be produced by recombinant DNA technology, or by enzymatic or chemical cleavage of a complete antibody. Antigen-binding fragments include, but are not limited to, Fab, scFab, Fab', F(ab')2, Fab'-SH, Fv, single-chain Fv, diabody, triabody, tetrabody, minibody, single domain antibody (sdAb), and multispecific antibodies formed from antibody fragments. Fab fragments are monovalent fragments consisting of VL, VH, CL, and CH1 domains, and can be obtained, for example, by digesting a complete antibody with papain. The light chain (L chain) and heavy chain (H chain) of Fab can be fused by a linker to form a single polypeptide chain, i.e., single-chain Fab (scFab) (see, for example, US20070274985A1). In addition, pepsin can digest a complete antibody under the disulfide bond in the hinge region to generate F(ab')2, which is a dimer of Fab' and is a bivalent antibody fragment. F(ab')2 is reduced under neutral conditions by destroying the disulfide bond in the hinge region, converting the F(ab')2 dimer into a Fab' monomer. The Fab' monomer is essentially a Fab fragment with a hinge region. An Fv fragment consists of a single arm of an antibody, the VL and VH domains. Alternatively, using recombinant techniques, the genes of the two domains VL and VH that independently code for an Fv fragment are connected by a nucleic acid sequence that codes for a connecting peptide (linker), and expressed recombinantly to form a single-chain Fv, and the VH and VL regions are paired in the single protein chain to provide an antigen-binding site. A double-chain antibody is an antibody fragment with two antigen-binding sites, which includes VL and VH connected by a short linker on the same polypeptide chain. In double-chain antibodies, the linker is too short to allow pairing between the two domains, VH and VL, in the same chain, but they are forced to pair with the complementary domains of another chain to create two antigen-binding sites.Double-chain antibodies can be bivalent or bispecific. For further details of double-chain antibodies, see, for example, EP404,097; WO1993 / 01161; Hudson et al., Nat.Med.9:129-134(2003); and Hollinger et al., PNAS USA 90:6444-6448(1993). Triplex antibodies, quadruplex antibodies and miniantibodies are described in Hudson et al., Nat.Med.9:129-134(2003) and Shao Rong et al. (eds.), Antibody Drug Research and Application, People's Health Press (2013). Single domain antibodies (sdAbs) generally refer to antibodies that do not need to interact with another variable region to recognize a target antigen, and can confer antigen binding with only one variable domain (e.g., a heavy chain variable domain (VH) or a light chain variable domain (VL), a heavy chain variable domain derived from a camelid heavy chain antibody, or a VH-like single domain (v-NAR) derived from a fish IgNAR). (For a more detailed explanation of antibody fragments, see Fundamental Immunology, edited by WE Paul, Raven Press, NY (1993).

[0028] The term "monoclonal antibody" as used in this application refers to an antibody obtained from a substantially homogeneous antibody population, i.e., each antibody in the population binds to the same and / or the same epitope, except for possible variant antibodies that are typically present in very small amounts (e.g., including natural mutations or variant antibodies that arise during production of the monoclonal antibody). Monoclonal antibodies can be produced by several techniques, including, but not limited to, hybridoma methods, recombinant DNA methods, yeast display methods, and methods using transgenic animals that include all or part of the human immunoglobulin loci.

[0029] The terms "human antibody" or "fully humanized antibody" may be used interchangeably in this application and refer to an antibody that comprises a variable region, both of which are derived from human germline immunoglobulin sequences, both of which are framework and CDR regions. And, if the antibody comprises a constant region, the constant region is also derived from human germline immunoglobulin sequences. The human antibodies of the invention may contain amino acids (e.g., mutated by in vitro random or spot specific mutagenesis or in vivo somatic mutation) that are not encoded by human germline immunoglobulin sequences, for example in the CDRs, particularly CDR3. However, as used in this application, the term "human antibody" is not intended to include antibodies in which the CDR sequences are derived from the germline of other mammalian species (e.g., mouse) and grafted onto human framework sequences.

[0030] As used in this application, the term "recombinant human antibody" includes all human antibodies that are produced, expressed, developed or isolated by recombinant methods, including, for example, (a) antibodies isolated from animals (e.g., mice) that are transgenic or transchromosomal with human immunoglobulin genes or hybridomas produced thereby, (b) antibodies isolated from transgenic cells that are autotransformed into host cells that express human antibodies, for example, (c) antibodies isolated from recombinant human antibody libraries, combinatorial human antibody libraries, such as yeast display libraries, and (d) antibodies produced, expressed, developed or isolated by any other method, including joining human immunoglobulin genes to other DNA sequences. These recombinant human antibodies have variable regions derived from human germline immunoglobulin sequences in the framework and CDR regions. However, in some embodiments, recombinant human antibodies can be mutagenized in vitro (or in vivo somatic mutagenesis when transgenic animals are used with human Ig sequences) such that the amino acid sequences of the VH and VL regions of the resulting recombinant antibodies, although derived from and related to human germline VH and VL sequences, do not naturally occur in endogenous human antibody germline libraries.

[0031] The term "chimeric antibody" refers to an antibody in which the variable region sequences are derived from one species and the constant region sequences are derived from another species, e.g., the variable region sequences are derived from a murine antibody and the constant region sequences are derived from a human antibody.

[0032] The term "humanized antibody" refers to an antibody in which CDR sequences derived from the germline of another mammalian species, such as a mouse, are joined to human framework sequences, in which additional framework region modifications can be made.

[0033] An "isolated" antibody is an antibody that is already isolated from components in its natural environment. In some embodiments, the antibody is purified to a purity of 95% or more than 99%, as determined, for example, by electrophoresis (e.g., SDS-PAGE, isoelectric focusing (IEF), capillary electrophoresis) or chromatography (e.g., ion exchange or reverse phase HPLC). For a review of methods for assessing antibody purity, see, for example, Flatman, S. et al., J.Chrom.B 848(2007)79-87.

[0034] An epitope is a region of an antigen to which an antibody binds. Epitopes can be formed from contiguous amino acids or non-contiguous amino acids juxtaposed by tertiary folding of a protein.

[0035] The terms "BCMA" and "B-cell maturation antigen" may be used interchangeably and include human BCMA variants, isotypes, species homologs and analogs that have at least one common epitope as BCMA (e.g., human BCMA). Figure 7 shows an exemplary human BCMA sequence (SEQ ID NO: 74). BCMA proteins can also include fragments of BCMA, such as the extracellular domain and fragments of the extracellular domain, e.g., fragments that retain the ability to bind to any antibody of the invention.

[0036] The term "specifically binds" indicates that an antibody selectively or preferentially binds to an antigen. In biophotonic interferometry, an antibody binds to an antigen at approximately 5×10-7 M or lower, approximately 1×10 -7 M or lower, approximately 5 x 10 -8 M or lower, approximately 1×10 -8 M or lower, approximately 5 x 10 -9 M or lower K D If the antibody binds to human BCMA, then the antibody "specifically binds to human BCMA."

[0037] "Affinity" or "binding affinity" refers to the affinity of intrinsic binding that reflects the interaction between members of a binding pair. The affinity of a molecule X for its gamete Y is usually expressed as the equilibrium dissociation constant (K D ), and the equilibrium dissociation constant is given by the dissociation rate constant and the association rate constant (k dis and k on Affinity is measured by routine methods known in the art. A specific method for measuring affinity is the ForteBio kinetic binding assay in this application.

[0038] A "competitively binding antibody" refers to an antibody that inhibits the binding of a reference antibody to an antigen (e.g., BCMA) by 50% or more in a competitive assay, and conversely, the reference antibody also inhibits the binding of the antibody to an antigen (e.g., BCMA) by 50% or more in a competitive assay. Exemplary competitive assays are described in "Antibodies," Harlow and Lane (Cold Spring Harbor Press, Cold Spring Harbor, NY). A competitively binding antibody can bind to the same epitopic region as the reference antibody, e.g., the same epitope, an adjacent epitope, or an overlapping epitope.

[0039] The term "Fc region" in this application is used to define the C-terminal region of an immunoglobulin heavy chain that contains at least a portion of the constant region. The term includes native sequence Fc-regions and variant Fc-regions. In one embodiment, the human IgG heavy chain Fc-region extends from Cys226 or from Pro230 to the carboxyl terminus of the heavy chain. However, the C-terminal lysine (Lys447) of the Fc-region may or may not be present. Unless otherwise stated in this application, the numbering of amino acid residues in the Fc-region or constant region is according to the EU numbering system, also referred to as the EU index. For example, see Kabat, EA et al., Sequences of Proteins of Immunological Interest, 5th ed., Public Health Service, National Institutes of Health, Bethesda, MD (1991), NIH Publication 91-3242.

[0040] The term "variant" in relation to an antibody, in the present application, refers to an antibody that already contains a target antibody region (e.g., heavy or light chain variable region, or heavy or light chain CDR region) in which amino acid mutations have been caused by substitution, deletion and / or insertion of at least one, e.g., 1-30, 1-20 or 1-10, e.g., 1 or 2 or 3 or 4 or 5 amino acids, where the variant essentially retains the biological properties of the antibody molecule before the mutation. In one aspect, the present invention includes any antibody variant mentioned in the present application. In one embodiment, the antibody variant retains at least 60%, 70%, 80%, 90% or 100% of the biological activity (e.g., antigen binding ability) of the antibody before the mutation. In some embodiments, the mutations do not cause the antibody variant to lose binding to the antigen, but can optionally confer properties such as increased antigen affinity and different effector functions. It should be understood that the antibody heavy or light chain variable region, or each CDR region, can be modified alone or in combination. In some embodiments, the amino acid mutations in one or more or all three heavy chain CDRs do not exceed 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10. In some embodiments, the amino acid mutations in one or more or all three light chain CDRs do not exceed 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10. In some embodiments, the amino acid mutations in one or more or all six CDRs do not exceed 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10. Preferably, the amino acid mutations are amino acid substitutions, preferably conservative substitutions. In some embodiments, the antibody variant and parent antibody have at least 80%, 85%, 90% or 95% or 99% or even higher amino acid identity to the target antibody sequence regions. For example, in one embodiment, an antibody of the present invention has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more sequence identity in the heavy chain variable region to any of the antibodies shown in Table 1.In another embodiment, an antibody of the invention has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more sequence identity in its light chain variable region to any of the antibodies shown in Table 1. In another embodiment, an antibody of the invention has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more sequence identity in its heavy and light chain variable regions to any of the antibodies shown in Table 1.

[0041] In this application, "sequence identity" refers to the percentage of sequences that are the same when comparing nucleotides or amino acids one by one in a comparison window. The "percent sequence identity" can be calculated by the following method: comparing two best-matching sequences in a comparison window, determining the number of positions in the two sequences where the same nucleobase (e.g., A, T, C, G, I) or the same amino acid residue (e.g., Ala, Pro, Ser, Thr, Gly, Val, Leu, Ile, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gln, Cys and Met) exists to obtain the number of marching positions, dividing the number of marching positions by the total number of positions in the comparison window (i.e., the size of the window), and multiplying the result by 100 to generate the percent sequence identity. The best-matching to determine the percent sequence identity can be achieved according to various methods known in the art, for example, using publicly available personal computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for matching sequences, including any algorithms required for maximal matching within the full length sequences or target sequence regions being compared.

[0042] In the present invention, for antibody sequences, the amino acid sequence identity percentage is determined after optimal matching of the sequence of the candidate antibody with that of the reference antibody, preferably according to the Kabat numbering convention. After matching, the target antibody region (e.g., the entire variable region of the heavy or light chain, or a part thereof, e.g., one or more CDR regions) is compared with the same region of the reference antibody. The sequence identity percentage between the target antibody region and the reference antibody region is the percentage obtained by dividing the number of positions occupied by the same amino acid in both the target antibody region and the reference antibody region by the total number of matching positions of the two regions (no blanks are filled in) and multiplying by 100. In the present application, if the target antibody region is not specified, it applies to matching the entire length of the reference antibody sequence. In some embodiments, for antibodies, the sequence identity can be distributed throughout the heavy chain variable region and / or the light chain variable region, or the sequence identity percentage is limited to the framework regions only, and the sequences corresponding to the CDR regions are kept to be 100% identical.

[0043] A. BCMA Binding Molecules and Compositions of the Invention I. Anti-BCMA Antibodies of the Invention In one aspect of the invention, there are provided antibodies, particularly single chain antibodies (e.g. single chain scFv antibodies), that bind BCMA (particularly membrane-bound BCMA) with high target specificity and high affinity.

[0044] The antibodies of the present invention may have one or more of the following properties: (i) binds to BCMA (e.g., human BCMA) with high affinity, e.g., with a K value of less than 100 nM, e.g., less than 50 nM, e.g., between 5 and 30 nM, preferably less than 10 nM; (ii) binds to BCMA (e.g., human BCMA) expressed on the surface of a cell with high affinity, e.g., with an EC50 value of less than 100 nM, e.g., less than 50 nM, e.g., 1-40 nM, preferably less than 20 nM, more preferably less than 10 or 5 nM; (iii) specifically binds to an epitope in BCMA, particularly in the extracellular domain ECD of BCMA (e.g., identifies the same or a similar epitope as any one of the antibodies shown in Table 1); (iv) exhibits the same or similar binding affinity and / or specificity as any one of the antibodies shown in Table 1; (v) inhibits (e.g., competitively inhibits) the binding of an antibody molecule described herein, e.g., any one of the antibody molecules shown in Table 1, to BCMA; (vi) binds to the same or an overlapping epitope as any one of the antibodies shown in Table 1; (vii) competes for binding to BCMA and / or binds to the same epitope on BCMA as any one of the antibodies shown in Table 1; (viii) binds human BCMA and cross-reacts with monkey BCMA; (ix) has one or more biological properties of an antibody molecule described herein, e.g., any one of the antibody molecules shown in Table 1; (x) has one or more pharmacokinetic properties of an antibody molecule described herein, e.g., any one of the antibodies shown in Table 1; (xi) inhibiting one or more activities of BCMA, e.g., causing one or more of a reduction in the number and inhibition of the survival or proliferation of B cells or plasma cells that express BCMA; (xii) essentially does not bind to BAFF-R or TACI; (xiii) inhibiting or reducing binding of BCMA to its ligand, such as BAFF or APRIL, or both.

[0045] In some embodiments, the anti-BCMA antibody molecules of the invention have high affinity, e.g., a dissociation equilibrium constant (K D ) which binds to human BCMA (e.g., the polypeptide of SEQ ID NO: 74) and Dis less than about 100 nM, and is not more than about 80 nM, 70 nM, 60 nM or 50 nM, and more preferably is not more than about 40 nM, 30 nM or 20 nM, and more preferably is not more than about 10 nM, 9 nM, 8 nM, 7 nM, 6 nM, 5 nM, 4 nM, 3 nM or 2 nM, as measured, for example, by optical interference bioassays (e.g., Fortebio affinity assays).

[0046] In some embodiments, the dissociation rate constant (K dis ) is 3 × 10 -2 , 1.5×10 -2 , 5×10 -3 or 3×10 -3 s -1 For example, about 1.46 x 10 -3 s -1 In some embodiments, the association rate constant (K on ) is 1 × 10 4 , 5×10 4 , 1×10 5 , 5×10 5 or 8×10 5 M -1 s -1 Larger, for example, about 7.29 x 10 5 M -1 s -1 K a It binds to BCMA.

[0047] In some embodiments, the anti-BCMA antibody molecules of the invention bind with high affinity to cells expressing BCMA, preferably a multiple myeloma cell line expressing human BCMA on the cell surface (e.g. NCI-H929), and preferably have an EC50 value for binding of the antibody to the cells of less than about 200nM, 150nM or 100nM, preferably about 80nM, 70nM, 60nM or 50nM or less, more preferably about 40nM, 30nM or 20nM or less, and even more preferably about 10nM, 9nM, 8nM, 7nM, 6nM, 5nM, 4nM, 3nM or 2nM or less, as measured by flow cytometry (e.g. FACS).

[0048] In one embodiment, the antibody molecule binds to human BCMA comprising the amino acid sequence of SEQ ID NO: 74. In some embodiments, the antibody molecule binds to BCMA, preferably to an epitope in the extracellular region of BCMA.

[0049] In some embodiments, the antibody molecule is a full-length antibody. In other embodiments, the antibody molecule is an antibody fragment. For example, the antibody molecule of the present invention may comprise or be a Fab, scFab, Fab', F(ab')2, Fab'-SH, Fv, single-chain scFv antibody, double-chain antibody (diabody), triple-chain antibody, quadruplex antibody, mini-antibody, or single-domain antibody (sdAb). In a preferred embodiment, the antibody molecule of the present invention is a single-chain scFv antibody. In a preferred embodiment, the antibody molecule of the present invention comprises an scFv and an Fc region connected thereto. In a preferred embodiment, the antibody molecule of the present invention is fully humanized.

[0050] Antibody variable region A "variable region" or "variable domain" is a domain in an antibody's heavy or light chain that participates in binding the antibody to its antigen. The heavy chain variable region (VH) and light chain variable region (VL) are further divided into hypervariable regions (HVRs, also called complementarity determining regions (CDRs)) and more conserved regions (i.e., framework regions (FRs)) that are inserted between them. Each VH and VL consists of three CDRs and four FRs, arranged from the amino terminus to the carboxyl terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. In some circumstances, a single VH or VL domain is sufficient to confer antigen-binding specificity. Alternatively, antibodies that bind to a specified antigen can be isolated by screening a complementary VL or VH domain library using a VH or VL domain derived from an antibody that binds to the antigen (see, for example, Portolano, S. et al., J. Immunol. 150 (1993) 880-887; Clackson, T. et al., Nature 352 (1991) 624-628). In the present application, "VH" or "VH domain" includes the heavy chain variable region VH of a full-length antibody, Fv, scFv, dsFv, Fab, scFab, or other antibody fragment disclosed in the present application. In the present application, "VL" or "VL domain" includes the light chain variable region VL of a full-length antibody, Fv, scFv, dsFv, Fab, scFab, or other antibody fragment disclosed in the present application.

[0051] In one embodiment, an anti-BCMA antibody molecule of the invention comprises (i) an antigen-binding region that is identical to the antigen-binding region (e.g. a heavy chain variable region and light chain variable region pair) of any one of the antibodies shown in Table 1, or (ii) an antigen-binding region that has, e.g. at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99% or even higher amino acid sequence identity to the antigen-binding region of (i).

[0052] In another embodiment, an anti-BCMA antibody molecule of the invention comprises (i) a heavy chain variable region that is the same as the heavy chain variable region of any one of the antibodies shown in Table 1; or (ii) a heavy chain variable region that has an amino acid sequence identity, e.g., at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99% or even higher, to the heavy chain variable region of (i); or (iii) a variant of the heavy chain variable region of (i), wherein the variant comprises at least one and not more than 30, 20 or 10 amino acid mutations (preferably amino acid substitutions, preferably conservative substitutions), and preferably the variant comprises not more than 10 amino acid mutations in total, preferably 5 to 0 amino acid mutations (preferably amino acid substitutions), in the three heavy chain complementarity determining regions (CDRs).

[0053] In another embodiment, an anti-BCMA antibody molecule of the invention comprises (i) a light chain variable region that is the same as the light chain variable region of any one of the antibodies shown in Table 1; or (ii) a light chain variable region that has, e.g., at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99% or even higher identity in amino acid sequence to the light chain variable region of (i); or (iii) a variant of the light chain variable region of (i), said variant comprising at least one and not more than 30, 20 or 10 amino acid mutations (preferably amino acid substitutions, preferably conservative substitutions), and preferably said variant comprises not more than 10 amino acid mutations in total, preferably 5 to 0 amino acid mutations (preferably amino acid substitutions), in the three light chain complementarity determining regions (CDRs).

[0054] In another embodiment, the anti-BCMA antibody molecule of the invention comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises: (i) a heavy chain variable region that is the same as the heavy chain variable region of any one of the antibodies shown in Table 1; or (ii) a heavy chain variable region having an amino acid sequence identity, e.g., at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99% or even higher, to the heavy chain variable region of (i); or (iii) (i) a heavy chain variable region mutant, said mutant containing at least one and not more than 30, 20 or 10 amino acid mutations (preferably amino acid substitutions, preferably conservative substitutions), and preferably said mutant containing not more than 10 amino acid mutations in total, preferably 5 to 0 amino acid mutations (preferably amino acid substitutions), in the three heavy chain complementarity determining regions (CDRs).

[0055] And the light chain variable region is (i) a light chain variable region that is the same as the light chain variable region of any one of the antibodies shown in Table 1; or (ii) a light chain variable region having an amino acid sequence identity, e.g., at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99% or higher, to the light chain variable region of (i); or (iii) (i) a variant of the light chain variable region, said variant containing at least one and not more than 30, 20 or 10 amino acid mutations (preferably amino acid substitutions, preferably conservative substitutions), and preferably said variant containing not more than 10 amino acid mutations in total, preferably 5 to 0 amino acid mutations (preferably amino acid substitutions), in the three light chain complementarity determining regions (CDRs).

[0056] In some embodiments, the invention provides an anti-BCMA antibody or variant thereof comprising the amino acid sequence of the heavy chain variable region and light chain variable region pair of any one of the antibodies shown in Table 1. In a preferred embodiment, the antibody comprises an amino acid sequence pair selected from SEQ ID NOs: 4 / 31, 5 / 41, 5 / 42, 10 / 46, 16 / 50, 17 / 58, 23 / 64, 27 / 59, 27 / 71 and 27 / 72. In a preferred embodiment, the variant has at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99% or even higher identity to the VH and / or VL amino acid sequence, or comprises at least one, and not more than 30, 20 or 10 amino acid mutations (preferably amino acid substitutions, preferably conservative substitutions) in the VH and / or VL amino acid sequence.

[0057] In some embodiments, the invention provides an anti-BCMA antibody comprising a heavy chain variable region, VH, and a light chain variable region, VL, wherein the VH comprises an amino acid sequence selected from SEQ ID NOs: 4, 5, and 6, and the VL comprises an amino acid sequence selected from SEQ ID NOs: 31, 41, 42, and 43. In some embodiments, in the amino acid sequence of SEQ ID NO: 6, X represents any amino acid, preferably an amino acid residue at the corresponding position in SEQ ID NO: 4 or 5, or a conservative replacement thereof. In some embodiments, in the amino acid sequence of SEQ ID NO: 43, X represents any amino acid, preferably an amino acid residue at the corresponding position in SEQ ID NO: 41 or 42, or a conservative replacement thereof.

[0058] In some embodiments, the invention provides anti-BCMA antibodies comprising a heavy chain variable region, VH, and a light chain variable region, VL, wherein the VH comprises the amino acid sequence of SEQ ID NO: 4, and the VL comprises the amino acid sequence of SEQ ID NO: 31. The invention also provides variants of the antibodies, for example variants having at least 95-99% identity to the VH and / or VL, or comprising no more than 10 amino acid mutations.

[0059] In some embodiments, the anti-BCMA antibodies of the invention comprise a heavy chain variable region, VH, and a light chain variable region, VL, wherein the VH comprises the amino acid sequence of SEQ ID NO: 5, and the VL comprises an amino acid sequence selected from SEQ ID NOs: 41 and 42. The invention also provides variants of such antibodies, for example variants having at least 95-99% identity to the VH and / or VL, or containing no more than 10 amino acid mutations.

[0060] In some embodiments, the invention provides anti-BCMA antibodies comprising a heavy chain variable region, VH, and a light chain variable region, VL, wherein the VH comprises the amino acid sequence of SEQ ID NO: 10, and the VL comprises the amino acid sequence of SEQ ID NO: 46. The invention also provides variants of the antibodies, for example variants having at least 95-99% identity to the VH and / or VL, or comprising no more than 10 amino acid mutations.

[0061] In some embodiments, the anti-BCMA antibodies of the invention comprise a heavy chain variable region, VH, and a light chain variable region, VL, wherein the VH comprises an amino acid sequence selected from SEQ ID NO: 16, 17 or 19, and the VL comprises an amino acid sequence selected from SEQ ID NO: 50 and 58. In some embodiments, in the amino acid sequence of SEQ ID NO: 19, X represents any amino acid, preferably the amino acid residue at the corresponding position in SEQ ID NO: 16 or 17, or a conservative replacement thereof.

[0062] In some embodiments, the invention provides anti-BCMA antibodies comprising a heavy chain variable region, VH, and a light chain variable region, VL, wherein the VH comprises the amino acid sequence of SEQ ID NO: 16, and the VL comprises the amino acid sequence of SEQ ID NO: 50. The invention also provides variants of the antibodies, for example variants having at least 95-99% identity to the VH and / or VL, or comprising no more than 10 amino acid mutations.

[0063] In some embodiments, the invention provides anti-BCMA antibodies comprising a heavy chain variable region, VH, and a light chain variable region, VL, wherein the VH comprises the amino acid sequence of SEQ ID NO: 17, and the VL comprises the amino acid sequence of SEQ ID NO: 58. The invention also provides variants of the antibodies, for example variants having at least 95-99% identity to the VH and / or VL, or comprising no more than 10 amino acid mutations.

[0064] In some embodiments, the invention provides anti-BCMA antibodies comprising a heavy chain variable region, VH, and a light chain variable region, VL, wherein the VH comprises the amino acid sequence of SEQ ID NO: 23, and the VL comprises the amino acid sequence of SEQ ID NO: 64. The invention also provides variants of the antibodies, for example variants having at least 95-99% identity to the VH and / or VL, or comprising no more than 10 amino acid mutations.

[0065] In some embodiments, the invention provides an anti-BCMA antibody comprising a heavy chain variable region, VH, and a light chain variable region, VL, wherein the VH comprises the amino acid sequence of SEQ ID NO: 27, and the VL comprises an amino acid sequence selected from SEQ ID NOs: 59, 71, 72, and 73. In some embodiments, in the amino acid sequence of SEQ ID NO: 73, X represents any amino acid, preferably the amino acid residue at the corresponding position in SEQ ID NO: 71 or 72, or a conservative replacement thereof.

[0066] In some embodiments, the invention provides anti-BCMA antibodies comprising a heavy chain variable region, VH, and a light chain variable region, VL, wherein the VH comprises the amino acid sequence of SEQ ID NO: 27, and the VL comprises the amino acid sequence of SEQ ID NO: 59. The invention also provides variants of the antibodies, for example variants having at least 95-99% identity to the VH and / or VL, or comprising no more than 10 amino acid mutations.

[0067] In some embodiments, the invention provides anti-BCMA antibodies comprising a heavy chain variable region, VH, and a light chain variable region, VL, wherein the VH comprises the amino acid sequence of SEQ ID NO: 27, and the VL comprises the amino acid sequence of SEQ ID NO: 71 or 72. The invention also provides variants of the antibodies, for example variants having at least 95-99% identity to the VH and / or VL, or comprising no more than 10 amino acid mutations.

[0068] In any one of the above embodiments, preferably, the heavy chain variable region of the antibody of the present invention contains not more than 10, preferably not more than 5 (e.g., 3, 2, 1 or 0) amino acid mutations (preferably amino acid substitutions, preferably conservative substitutions) in one or more CDR regions (preferably all three CDRs) relative to the amino acid sequence of the reference heavy chain variable region.

[0069] In any one of the above embodiments, preferably, the light chain variable region VL of the antibody of the present invention contains not more than 10, preferably not more than 5 (e.g., 3, 2, 1 or 0) amino acid mutations (preferably amino acid substitutions, preferably conservative substitutions) in one or more CDR regions (preferably all three CDRs) relative to the reference light chain variable region amino acid sequence.

[0070] Antibody CDR Regions "Complementarity determining regions" or "CDR regions" or "CDRs" (interchangeably used in this application as hypervariable regions "HVR") are amino acid regions in an antibody variable region that are primarily responsible for binding to an antigen epitope. The CDRs of the heavy and light chains are usually referred to as CDR1, CDR2 and CDR3, numbered sequentially from the N-terminus. The CDRs located in the heavy chain variable domain of an antibody are referred to as HCDR1, HCDR2 and HCDR3, while the CDRs located in the light chain variable domain of an antibody are referred to as LCDR1, LCDR2 and LCDR3.

[0071] Several methods for defining the CDR sequences for a given VH or VL amino acid sequence are well known in the art. For example, Kabat complementarity determining regions (CDRs) are defined based on sequence variability and are the most commonly used (Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991)). Chothia refers to the location of the structural rings (Chothia and Lesk, J. Mol. Biol. 196:901-917 (1987)). AbM HVRs are a compromise between Kabat HVRs and Chothia structural rings and are used by Oxford Molecular's AbM antibody modeling software. The "Contact" HVRs are based on the analysis of available complex crystal structures. According to the different CDR definition methods, the residues of each HVR / CDR in these HVRs are as follows:

[0072] [Table 1]

[0073] The HVRs are HVR sequences that map to Kabat residue positions based on the Kabat numbering system as follows:

[0074] in VL at positions 24-36 or 24-34 (LCDR1), 46-56 or 50-56 (LCDR2) and 89-97 or 89-96 (LCDR3); and in VH at positions 26-35 or 27-35B (HCDR1), 50-65 or 49-65 (HCDR2) and 93-102, 94-102 or 95-102 (HCDR3).

[0075] In one embodiment, the HVRs of an antibody of the invention are HVR sequences that map to Kabat residue positions according to the Kabat numbering system as follows:

[0076] in VL positions 24-34 (LCDR1), 50-56 (LCDR2), and 89-97 (LCDR3) and in VH positions 27-35B (HCDR1), 50-65 (HCDR2), and 93-102 (HCDR3).

[0077] HVRs can be defined based on having the same Kabat numbering position as a reference CDR sequence (eg, any one of the exemplary CDRs of the invention).

[0078] Unless otherwise specified, in the present invention, the term "CDR" or "CDR sequence" or "HVR" or "HVR sequence" includes HVR or CDR sequences defined in any one of the above ways.

[0079] Unless otherwise specified, in the present invention, when referring to a residue position in an antibody variable region (including heavy chain variable region residues and light chain variable region residues), it refers to a numbered position based on the Kabat numbering system (Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991)).

[0080] In one preferred embodiment, HCDR1 of the antibody of the present invention is a CDR sequence defined according to the AbM proposal, while the remaining CDRs are CDR sequences defined according to the Kabat proposal. In another preferred embodiment, the CDR sequences of the present invention are as shown in Table 2.

[0081] Antibodies with different specificities (i.e., different binding sites for different antigens) have different CDRs. However, despite the differences in CDRs between antibodies, only a limited number of amino acid positions in the CDRs directly participate in binding to the antigen. By using at least two of the Kabat, Chothia, AbM and Contact methods, the minimum overlapping region can be determined, thereby providing a "minimum binding unit" for binding to the antigen. The minimum binding unit can be a subpart of a CDR. As will be appreciated by those skilled in the art, the residues of the remaining part of the CDR sequence can be determined depending on the antibody structure and protein folding. Thus, the present invention contemplates any CDR variants provided in the present application. For example, in a variant of one CDR, the amino acid residues of the minimum binding unit can be retained as they are, and the remaining CDR residues defined according to Kabat or Chothia can be replaced with conservative amino acid residues.

[0082] In some embodiments, the antibody of the present invention comprises at least one, two, three, four, five or six CDRs or variants thereof that are identical to the CDRs corresponding to any one of the antibodies shown in Table 1. In some embodiments, the antibody of the present invention comprises at least one, two or three HCDRs or variants thereof that are identical to the heavy chain CDRs corresponding to any one of the antibodies shown in Table 1. In some embodiments, the antibody of the present invention comprises at least one, two or three HCDRs or variants thereof that are identical to the light chain CDRs corresponding to any one of the antibodies shown in Table 1. In the present application, a CDR variant is a CDR that is already modified by substitution, deletion and / or insertion of at least one, e.g., one or two or three amino acids, and an antigen-binding molecule comprising a CDR variant essentially retains the biological properties of the antigen-binding molecule of the unmodified CDR, e.g., retains at least 60%, 70%, 80%, 90% or 100% of the biological activity (e.g., antigen-binding ability). It can be understood that each CDR may be modified alone or in combination. Preferably, the amino acid modification is an amino acid substitution, in particular a conservative amino acid substitution, such as the preferred conservative amino acid substitutions shown in Table A.

[0083] In some embodiments, an antibody of the invention comprises a heavy chain variable region comprising a heavy chain complementarity determining region 3 (HCDR3), said HCDR3 comprising: (i) the same as the HCDR3 of the heavy chain variable region of any one of the antibodies shown in Table 1; or (ii) (i) contains at least one and not more than five (preferably 1 to 3, or more preferably 1 to 2) amino acid mutations (preferably substitutions, more preferably conservative substitutions) relative to the HCDR3.

[0084] In some embodiments, the antibody or antigen-binding fragment thereof of the invention comprises a heavy chain variable region and a light chain variable region, and the heavy chain complementarity determining region 3 (HCDR3) and the light chain complementarity determining region 3 (LCDR3) of the antibody are (i) the HCDR3 and LCDR3 of the heavy and light chain variable region sequences of any one of the antibodies shown in Table 1 are identical; or (ii) (i) HCDR3 and LCDR3 contain a total of at least one and not more than five (preferably 1 to 3, more preferably 1 to 2) amino acid mutations (preferably substitutions, more preferably conservative substitutions).

[0085] In some embodiments, the antibody or antigen-binding fragment thereof of the present invention comprises a heavy chain variable region, wherein HCDR1, HCDR2 and HCDR3 of the heavy chain variable region are (i) the HCDR1, HCDR2, and HCDR3 of the heavy chain variable region of any one of the antibodies shown in Table 1 are identical to each other, or (ii) (i) HCDR1, HCDR2 and HCDR3 contain at least one and not more than 10 amino acid mutations in total, preferably not more than 5 (preferably 1, 2 or 3) amino acid mutations (preferably substitutions, more preferably conservative substitutions), and preferably contain not more than 3 amino acid mutations in the HCDR3 region (e.g., 2, 1 or 0).

[0086] In some embodiments, the antibody or antigen-binding fragment thereof of the invention comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3, and the light chain variable region comprises light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein HCDR1, HCDR2, HCDR3, and LCDR3 are (i) the HCDR1, HCDR2, HCDR3 and LCDR3 of the heavy and light chain variable regions of any one of the antibodies shown in Table 1 are identical, respectively; or (ii) (i) HCDR1, HCDR2, HCDR3 and LCDR3 contain at least one and not more than 10 (preferably 1 to 5, preferably 1, 2 or 3) amino acid mutations (preferably substitutions, more preferably conservative substitutions) in total.

[0087] In some embodiments, the antibody or antigen-binding fragment thereof of the invention comprises a light chain variable region, said light chain variable region comprising light chain complementarity determining regions LCDR1, LCDR2 and LCDR3, said LCDR1, LCDR2 and LCDR3 being (i) the LCDR1, LCDR2, and LCDR3 of the light chain variable region of any one of the antibodies shown in Table 1 are identical, respectively; or (ii) (i) contains at least one and not more than 10 (preferably 1 to 5, preferably 1, 2 or 3) amino acid mutations (preferably substitutions, more preferably conservative substitutions) in total for LCDR1, LCDR2 and LCDR3.

[0088] In some embodiments, the antibody or antigen-binding fragment thereof of the invention comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3, and the light chain variable region comprises light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the LCDR1, LCDR2, LCDR3, and HCDR3 are (i) the LCDR1, LCDR2, LCDR3 and HCDR3 of the light chain and heavy chain variable regions of any one of the antibodies shown in Table 1 are identical, respectively; or (ii) (i) contains at least one and not more than 10 (preferably 1 to 5, preferably 1, 2 or 3) amino acid mutations (preferably substitutions, more preferably conservative substitutions) in total in LCDR1, LCDR2, LCDR3 and HCDR3.

[0089] In some embodiments, the antibody or antigen-binding fragment thereof of the invention comprises a heavy chain variable region and a light chain variable region, the heavy chain variable region comprising heavy chain complementarity determining regions HCDR1, HCDR2 and HCDR3, and the light chain variable region comprising light chain complementarity determining regions LCDR1, LCDR2 and LCDR3, and the antibody comprises: (i) comprising the sequences of all six CDR regions of the heavy and light chain variable regions of any one of the antibodies shown in Table 1; or (ii) Contains no more than 10, preferably no more than 5 (e.g., 3, 2, 1 or 0) amino acid mutations (preferably amino acid substitutions, preferably conservative substitutions) in all six CDR regions relative to any one of the antibodies shown in Table 1.

[0090] In one embodiment, the antibody or antigen-binding fragment thereof of the present invention comprises: (i) the HCDR1, HCDR2 and HCDR3 sequences of a heavy chain variable region shown in SEQ ID NO: 4 or 5, and the LCDR1, LCDR2 and LCDR3 sequences of a light chain variable region shown in SEQ ID NO: 31, 41 or 42; (ii) the HCDR1, HCDR2 and HCDR3 sequences of the heavy chain variable region shown in SEQ ID NO: 10, and the LCDR1, LCDR2 and LCDR3 sequences of the light chain variable region shown in SEQ ID NO: 46; (iii) the HCDR1, HCDR2 and HCDR3 sequences of a heavy chain variable region as set forth in SEQ ID NO: 16 or 17, and the LCDR1, LCDR2 and LCDR3 sequences of a light chain variable region as set forth in SEQ ID NO: 50 or 58; (iv) the HCDR1, HCDR2 and HCDR3 sequences of the heavy chain variable region set forth in SEQ ID NO: 23 and the LCDR1, LCDR2 and LCDR3 sequences of the light chain variable region set forth in SEQ ID NO: 64; or (v) comprises the HCDR1, HCDR2 and HCDR3 sequences of a heavy chain variable region as shown in SEQ ID NO: 27, and the LCDR1, LCDR2 and LCDR3 sequences of a light chain variable region as shown in SEQ ID NO: 59, 71 or 72.

[0091] In one preferred embodiment, the antibody or antigen-binding fragment of the invention comprises selected HCDR1, 2 and 3 sequences and LCDR1, 2 and 3 sequences selected from the following heavy chain variable region (VH) and light chain variable region (VL): (i) a VH of SEQ ID NO: 4 and a VL of SEQ ID NO: 31; (ii) a VH of SEQ ID NO:5 and a VL of SEQ ID NO:41; (iii) a VH of SEQ ID NO: 5 and a VL of SEQ ID NO: 42; (iv) a VH of SEQ ID NO: 10 and a VL of SEQ ID NO: 46; (v) a VH of SEQ ID NO: 16 and a VL of SEQ ID NO: 50; (vi) a VH of SEQ ID NO: 17 and a VL of SEQ ID NO: 58; (vii) a VH of SEQ ID NO: 23 and a VL of SEQ ID NO: 64; (viii) a VH of SEQ ID NO: 27 and a VL of SEQ ID NO: 59; (ix) a VH of SEQ ID NO: 27 and a VL of SEQ ID NO: 71; (x) VH of sequence number 27 and VL of sequence number 72.

[0092] In some embodiments, the invention provides HCDR3s of SEQ ID NOs: 3, 9, 13, 14, 15, 22 and 26, and antibodies or antigen-binding fragments comprising said HCDR3s.

[0093] In some embodiments, the invention provides combinations of HCDR3 and LCDR3 sequences selected from (i) an HCDR3 of SEQ ID NO: 3 and an LCDR3 selected from SEQ ID NOs: 30, 38, 39 and 40, or (ii) an HCDR3 of SEQ ID NO: 9 and an LCDR3 of SEQ ID NO: 45, or (iii) an HCDR3 of SEQ ID NOs: 13, 14 and 15 and an LCDR3 selected from SEQ ID NOs: 49 and 55, or (iv) an HCDR3 of SEQ ID NO: 22 and an LCDR3 of SEQ ID NO: 63, or (v) an HCDR3 of SEQ ID NO: 26 and an LCDR3 selected from SEQ ID NOs: 56, 68, 69 and 70, and antibodies or antigen-binding fragments comprising said combinations. The invention also provides variants of said CDR combinations, for example variants comprising a total of at least one and no more than 20, 10 or 5 amino acid mutations (preferably amino acid substitutions, preferably conservative substitutions) in said CDRs. The invention also provides anti-BCMA antibodies or antigen-binding fragments comprising said variants.

[0094] In some other embodiments, the invention provides combinations of CDR sequences selected from: (i) HCDR1 of SEQ ID NO: 1, HCDR2 of SEQ ID NO: 2 and HCDR3 of SEQ ID NO: 3, (ii) HCDR1 of SEQ ID NO: 7, HCDR2 of SEQ ID NO: 8 and HCDR3 of SEQ ID NO: 9, (iii) HCDR1 of SEQ ID NO: 11, HCDR2 of SEQ ID NO: 12 and HCDR3 of SEQ ID NO: 13 or 14 or 15, (iv) HCDR1 of SEQ ID NO: 20, HCDR2 of SEQ ID NO: 21 and HCDR3 of SEQ ID NO: 22, (v) HCDR1 of SEQ ID NO: 24, HCDR2 of SEQ ID NO: 25 and HCDR3 of SEQ ID NO: 26, and antibodies or antigen-binding fragments comprising such combinations. In some embodiments, the antibodies or antigen-binding fragments of the invention comprise HCDR1 of SEQ ID NO: 11, HCDR2 of SEQ ID NO: 12 and HCDR3 of SEQ ID NO: 13 or 14.

[0095] In another embodiment, the invention provides a heavy chain CDR combination selected from the amino acid sequence combinations SEQ ID NOs: 1 / 2 / 3, 7 / 8 / 9, 11 / 12 / 13, 11 / 12 / 14, 20 / 21 / 22 and 24 / 25 / 26 (HCDR1, HCDR2 and HCDR3, respectively, in that order). The invention also provides variants of said heavy chain CDR combinations, which in a preferred embodiment contain a total of at least one and no more than 20, 10 or 5 amino acid mutations (preferably amino acid substitutions, preferably conservative substitutions) in said three CDR regions. The invention also provides anti-BCMA antibodies comprising said heavy chain CDR combinations or said variants.

[0096] In some embodiments, the present invention provides a method for the production of a liquid crystalline nucleic acid molecule comprising: (i) an LCDR1 of SEQ ID NO:28, an LCDR2 of SEQ ID NO:29, and an LCDR3 of SEQ ID NO:30; (ii) an LCDR1 of SEQ ID NO:32 or 33 or 34, an LCDR2 of SEQ ID NO:35 or 36 or 37, and an LCDR3 of SEQ ID NO:38 or 39 or 40; (iii) an LCDR1 of SEQ ID NO:32, an LCDR2 of SEQ ID NO:44, and an LCDR3 of SEQ ID NO:45; (iv) an LCDR1 of SEQ ID NO:47, an LCDR2 of SEQ ID NO:48, and an LCDR3 of SEQ ID NO:49; (v) an LCDR1 of SEQ ID NO:51 and an LCDR1 of SEQ ID NO: 54 and an LCDR3 of SEQ ID NO: 55; (vi) an LCDR1 of SEQ ID NO: 61, an LCDR2 of SEQ ID NO: 62 and an LCDR3 of SEQ ID NO: 63; (vii) an LCDR1 of SEQ ID NO: 52, an LCDR2 of SEQ ID NO: 62 and an LCDR3 of SEQ ID NO: 56; and (viii) an LCDR1 of SEQ ID NO: 65, 66 or 67, an LCDR2 of SEQ ID NO: 62 and an LCDR3 of SEQ ID NO: 68, 69 or 70, and antibodies or antigen-binding fragments comprising such combinations.

[0097] In another embodiment, the invention provides a light chain CDR combination selected from the amino acid sequence combinations of SEQ ID NOs: 28 / 29 / 30, 32 / 35 / 38, 33 / 36 / 39, 32 / 44 / 45, 47 / 48 / 49, 51 / 54 / 55, 61 / 62 / 63, 52 / 62 / 56, 65 / 62 / 68, and 66 / 62 / 69 (LCDR1, LCDR2 and LCDR3, respectively, in that order). The invention also provides variants of said light chain CDR combinations, which in a preferred embodiment contain at least one and no more than 20, 10 or 5 amino acid mutations (preferably amino acid substitutions, preferably conservative substitutions) in total in the three CDR regions. The invention also provides an anti-BCMA antibody or antigen-binding fragment comprising said light chain CDR combination or said variant.

[0098] In some embodiments, the present invention relates to an HCDR1 of SEQ ID NO: 1, an HCDR2 of SEQ ID NO: 2 and an HCDR3 of SEQ ID NO: 3, an LCDR1 of SEQ ID NO: 28, an LCDR2 of SEQ ID NO: 29 and an LCDR3 of SEQ ID NO: 30, (ii) an HCDR1 of SEQ ID NO: 1, an HCDR2 of SEQ ID NO: 2 and an HCDR3 of SEQ ID NO: 3, an LCDR1 of SEQ ID NO: 32 or 33 or 34, an LCDR2 of SEQ ID NO: 35 or 36 or 37 and an LCDR3 of SEQ ID NO: 38 or 39 or 40, (iii) an HCDR1 of SEQ ID NO: 7, an HCDR2 of SEQ ID NO: 8 and an HCDR3 of SEQ ID NO: 9, an LCDR1 of SEQ ID NO: 32, an LCDR2 of SEQ ID NO: 44 and an LCDR3 of SEQ ID NO: 45, (iv) an HCDR1 of SEQ ID NO: 11, an HCDR2 of SEQ ID NO: 12 and an HCDR3 of SEQ ID NO: 13 or 14 or 15, an LCDR1 of SEQ ID NO: 47, an LCDR2 of SEQ ID NO: 48 and an LCDR3 of SEQ ID NO: 49, (v) an HCDR1 of SEQ ID NO: 11 1. CDR combinations selected from HCDR2 of SEQ ID NO: 12 and HCDR3 of SEQ ID NO: 13, 14 or 15, LCDR1 of SEQ ID NO: 51, LCDR2 of SEQ ID NO: 54 and LCDR3 of SEQ ID NO: 55, (vi) HCDR1 of SEQ ID NO: 20, HCDR2 of SEQ ID NO: 21 and HCDR3 of SEQ ID NO: 22, LCDR1 of SEQ ID NO: 61, LCDR2 of SEQ ID NO: 62 and LCDR3 of SEQ ID NO: 63, (vii) HCDR1 of SEQ ID NO: 24, HCDR2 of SEQ ID NO: 25 and HCDR3 of SEQ ID NO: 26, LCDR1 of SEQ ID NO: 52, LCDR2 of SEQ ID NO: 62 and LCDR3 of SEQ ID NO: 56, (viii) HCDR1 of SEQ ID NO: 24, HCDR2 of SEQ ID NO: 25 and HCDR3 of SEQ ID NO: 26, LCDR1 of SEQ ID NO: 65, 66 or 67, LCDR2 of SEQ ID NO: 62 and LCDR3 of SEQ ID NO: 68, 69 or 70, and antibodies or antigen-binding fragments comprising such combinations.

[0099] In another embodiment, the invention provides heavy and light chain CDR combinations (HCDR1, HCDR2 and HCDR3, LCDR1, LCDR2 and LCDR3, respectively, in that order) selected from the following amino acid sequence combinations: SEQ ID NOs: 1 / 2 / 3 / 28 / 29 / 30, 1 / 2 / 3 / 32 / 35 / 38, 1 / 2 / 3 / 33 / 36 / 39, 7 / 8 / 9 / 32 / 44 / 45, 11 / 12 / 13 / 47 / 48 / 49, 11 / 12 / 14 / 51 / 54 / 55, 20 / 21 / 22 / 61 / 62 / 63, 24 / 25 / 26 / 52 / 62 / 56, 24 / 25 / 26 / 65 / 62 / 68, and 24 / 25 / 26 / 66 / 62 / 69. The invention also provides variants of said CDR combinations, which in a preferred embodiment comprise a total of at least one and no more than 20, 10 or 5 amino acid mutations (preferably amino acid substitutions, preferably conservative substitutions) in said six CDR regions.The invention also provides an anti-BCMA antibody or antigen-binding fragment comprising said heavy and light chain CDR combinations or said variants.

[0100] In some embodiments, an antibody or antigen-binding fragment thereof of the invention comprises an HCDR1 of SEQ ID NO:1, an HCDR2 of SEQ ID NO:2 and an HCDR3 of SEQ ID NO:3, an LCDR1 of SEQ ID NO:28, an LCDR2 of SEQ ID NO:29 and an LCDR3 of SEQ ID NO:30.

[0101] In some embodiments, an antibody or antigen-binding fragment thereof of the invention comprises an HCDR1 of SEQ ID NO:1, an HCDR2 of SEQ ID NO:2 and an HCDR3 of SEQ ID NO:3, an LCDR1 of SEQ ID NO:32, an LCDR2 of SEQ ID NO:35 and an LCDR3 of SEQ ID NO:38.

[0102] In some embodiments, an antibody or antigen-binding fragment thereof of the invention comprises an HCDR1 of SEQ ID NO:1, an HCDR2 of SEQ ID NO:2 and an HCDR3 of SEQ ID NO:3, an LCDR1 of SEQ ID NO:33, an LCDR2 of SEQ ID NO:36 and an LCDR3 of SEQ ID NO:39.

[0103] In some embodiments, an antibody or antigen-binding fragment thereof of the invention comprises an HCDR1 of SEQ ID NO:7, an HCDR2 of SEQ ID NO:8 and an HCDR3 of SEQ ID NO:9, an LCDR1 of SEQ ID NO:32, an LCDR2 of SEQ ID NO:44 and an LCDR3 of SEQ ID NO:45.

[0104] In some embodiments, an antibody or antigen-binding fragment thereof of the invention comprises an HCDR1 of SEQ ID NO:11, an HCDR2 of SEQ ID NO:12 and an HCDR3 of SEQ ID NO:13, an LCDR1 of SEQ ID NO:47, an LCDR2 of SEQ ID NO:48 and an LCDR3 of SEQ ID NO:49.

[0105] In some embodiments, an antibody or antigen-binding fragment thereof of the invention comprises an HCDR1 of SEQ ID NO:11, an HCDR2 of SEQ ID NO:12 and an HCDR3 of SEQ ID NO:14, an LCDR1 of SEQ ID NO:51, an LCDR2 of SEQ ID NO:54 and an LCDR3 of SEQ ID NO:55.

[0106] In some embodiments, an antibody or antigen-binding fragment thereof of the invention comprises an HCDR1 of SEQ ID NO:20, an HCDR2 of SEQ ID NO:21 and an HCDR3 of SEQ ID NO:22, an LCDR1 of SEQ ID NO:61, an LCDR2 of SEQ ID NO:62 and an LCDR3 of SEQ ID NO:63.

[0107] In some embodiments, an antibody or antigen-binding fragment thereof of the invention comprises an HCDR1 of SEQ ID NO:24, an HCDR2 of SEQ ID NO:25 and an HCDR3 of SEQ ID NO:26, an LCDR1 of SEQ ID NO:52, an LCDR2 of SEQ ID NO:62 and an LCDR3 of SEQ ID NO:56.

[0108] In some embodiments, an antibody or antigen-binding fragment thereof of the invention comprises an HCDR1 of SEQ ID NO:24, an HCDR2 of SEQ ID NO:25 and an HCDR3 of SEQ ID NO:26, an LCDR1 of SEQ ID NO:65, an LCDR2 of SEQ ID NO:62 and an LCDR3 of SEQ ID NO:68.

[0109] In some embodiments, an antibody or antigen-binding fragment thereof of the invention comprises an HCDR1 of SEQ ID NO:24, an HCDR2 of SEQ ID NO:25 and an HCDR3 of SEQ ID NO:26, an LCDR1 of SEQ ID NO:66, an LCDR2 of SEQ ID NO:62 and an LCDR3 of SEQ ID NO:69.

[0110] In some embodiments, X in SEQ ID NO: 15 represents any amino acid residue, preferably an amino acid residue at the corresponding position of SEQ ID NO: 13 or 14, or a conservative replacement thereof, preferably S or R or a conservative replacement thereof. In some embodiments, X in SEQ ID NO: 34 represents any amino acid residue, preferably an amino acid residue at the corresponding position of SEQ ID NO: 32 or 33, or a conservative replacement thereof. In some embodiments, X in SEQ ID NO: 37 represents any amino acid residue, preferably an amino acid residue at the corresponding position of SEQ ID NO: 35 or 36, or a conservative replacement thereof. In some embodiments, X in SEQ ID NO: 40 represents any amino acid residue, preferably an amino acid residue at the corresponding position of SEQ ID NO: 38 or 39, or a conservative replacement thereof. In some embodiments, X in SEQ ID NO: 67 represents any amino acid residue, preferably an amino acid residue at the corresponding position of SEQ ID NO: 65 or 66, or a conservative replacement thereof. In some embodiments, X in SEQ ID NO: 70 represents any amino acid residue, preferably an amino acid residue at the corresponding position of SEQ ID NO: 68 or 69, or a conservative replacement thereof.

[0111] In the above-mentioned embodiments of the antibody of the present invention, "conservative substitution" refers to an amino acid mutation that causes a certain amino acid to be replaced with a chemically similar amino acid. Conservative substitution tables of functionally similar amino acids are well known in the art. In one preferred embodiment of any one of the present invention, the conservative substitution residue is taken from the following conservative substitution table A, and preferably is the preferred substitution residue shown in table A.

[0112] [Table 2]

[0113] Exemplary Antibody Sequences The present invention provides fully humanized antibodies that specifically bind BCMA (e.g., human BCMA), which have been isolated and characterized as in the Examples. Table 1 below provides the variable region sequences of these exemplary antibodies of the invention. Table 2 below provides exemplary CDR sequences for these antibodies (also shown in Figure 4).

[0114] [Table 3]

[0115] [Table 4]

[0116] The invention also provides variants of the above antibodies. In one embodiment, the amino acid sequence of the antibody or the nucleic acid encoding the amino acid sequence has been mutated but has at least 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% or higher identity to a sequence set forth in Table 1. In some embodiments, the antibody comprises a mutated variable region amino acid sequence, where no more than 1, 2, 3, 4, 5 or 10 amino acids have been mutated in the variable region when compared to the variable region sequence set forth in Table 1, but retains essentially the same antigen binding activity.

[0117] It should be noted that, since all of the above antibodies can bind to BCMA, the VH and VL (which are amino acid sequences and nucleotide sequences encoding said amino acid sequences) can be "mixed and matched" to generate other antibodies of the invention that bind to BCMA. Binding assays known in the art (e.g., ELISA and other assays described in the Examples section) can be used to measure the binding of such "mixed and matched" antibodies to BCMA. When mixing and matching the chains, the VH sequence from a particular VH / VL pair is preferably replaced with a structurally similar VH sequence. Similarly, the VL sequence from a given VH / VL pair is preferably replaced with a structurally similar VL sequence.

[0118] In another aspect, the present invention also provides variants of the above antibodies. In one embodiment, the antibody has already been mutated in the amino acid sequence or nucleic acid encoding the amino acid sequence in one or more or all six CDR regions. In some embodiments, the amino acid sequence of the mutated CDR region has already been mutated by 1, 2, 3, 4 or 5 amino acids or less when compared to the corresponding CDR region in Table 1, but retains essentially the same antigen-binding activity.

[0119] Additionally, because each of the antibodies in Table 1 can bind BCMA and antigen binding specificity is provided primarily by the CDR1, 2 and 3 regions, it is possible to "mix and match" VH CDR1, 2 and 3 sequences with VL CDR1, 2 and 3 sequences (i.e., CDRs from different antibodies can be mixed and matched, preferably where each antibody contains a VH CDR1, 2 and 3 and a VL CDR1, 2 and 3) to generate other molecules of the invention that bind BCMA. Binding assays known in the art (e.g., ELISA, SET, Biacore) and those assays described in the Examples can be used to measure binding of these "mixed and matched" antibodies to BCMA. When mixing and matching VH CDR sequences, it is preferred that the CDR1, CDR2 and / or CDR3 sequences from a given VH sequence are replaced with structurally similar CDR sequences. Similarly, when mixing and matching VL CDR sequences, it is preferred that the CDR1, CDR2 and / or CDR3 sequences from a given VL sequence be replaced with structurally similar CDR sequences. One of skill in the art will appreciate that one or more VH and / or VL CDR region sequences can be replaced with structurally similar CDR sequences of the antibodies described in this application to generate other antibodies of the invention. Further to the above, in one embodiment, an antigen-binding fragment of an antibody described in this application can comprise VH CDR1, 2 and 3, or VL CDR1, 2 and 3, which fragment binds BCMA in a single domain fashion.

[0120] II. Single chain scFv antibody In a preferred embodiment, the antibody according to the invention is a single chain scFv antibody.

[0121] As used herein, a "single-chain scFv antibody" or "scFv" or "single-chain scFv" refers to a single polypeptide chain comprising a variable region of a heavy chain (VH) and a variable region of a light chain (VL) of an immunoglobulin or antibody, where the VH and VL domains pair together in the single protein chain to provide an antigen-binding site.

[0122] In a preferred embodiment, the VH and VL regions of the single-chain scFv antibody of the present invention are covalently connected by a linker, such as a flexible linker. The term "flexible linker" refers to a peptide linker consisting of amino acids. Such a peptide linker can connect each variable domain in an antibody, such as the VH and VL regions. Peptide linkers are usually rich in glycine, which imparts flexibility, and serine or threonine, which imparts solubility. For example, glycine and / or serine residues may be used alone or in combination. Non-limiting examples of flexible linkers or peptide linkers are disclosed in Shen et al., Anal.Chem.80(6):1910-1917(2008), WO2012 / 138475 and WO2014 / 087010, the entire contents of which are incorporated by reference. As is known in the art, in constructing scFvs, preferably the linker serves to facilitate the pairing of the VH and VL and does not interfere with the VH and VL pair forming a functional, efficient antigen-binding site.

[0123] In some embodiments, the scFv single chain antibody of the present invention comprises a flexible linker or peptide linker consisting of amino acid residues connected by peptide bonds. In some embodiments, the amino acids are selected from the 20 naturally occurring amino acids. In some other embodiments, the one or more amino acids are selected from glycine, serine, threonine, alanine, proline, asparagine, glutamine and lysine. In a preferred embodiment, the one or more amino acids are selected from Gly, Ser, Thr, Lys, Pro and Glu.

[0124] In some embodiments, the linker is about 1 to 30 amino acids in length, or about 10 to about 25 amino acids, or about 15 to about 20 amino acids, or about 10 to about 20 amino acids or any intermediate amino acid in length. In preferred embodiments, the linker is 15 to 25 amino acid residues in length, and in more preferred embodiments, 15 to 18 amino acid residues in length. In some embodiments, the linker is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more amino acids in length.

[0125] Examples of peptide linkers that may be used in the present invention include glycine polymers (G), glycine-serine polymers (G 1-5 S 1-5 )n, glycine-alanine polymers, alanine-serine polymers, and other flexible linkers known in the art, where n is an integer of at least 1, 2, 3, 4, or 5. One of skill in the art will appreciate that in some embodiments, the linker between VH and VL consists entirely of a flexible linker, or consists of a flexible linker portion and one or more portions that impart small flexible structure.

[0126] In a preferred embodiment, the peptide linker is GSTSGSGKPGSGEGSTKG (SEQ ID NO: 93). In one embodiment, the nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 93 is set forth in SEQ ID NO: 94. In one embodiment, the nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 93 is set forth in SEQ ID NO: 97.

[0127] In one embodiment, the peptide linker is a Gly / Ser connecting peptide. In one embodiment, the peptide linker is a (GxS)n linker, where G=glycine, S=serine (x=3, n=8, 9 or 10) or (x=4 and n=6, 7 or 8), in one embodiment, x=4, n=6 or 7. In some embodiments, the linker can comprise an amino acid sequence (G4S)n, where n is an integer equal to or greater than 1, e.g., n is an integer between 1 and 7. In a preferred embodiment, x=4 and n=7. In one embodiment, the linker is (G4S)3. In one embodiment, the linker is (G4S)4. In one embodiment, the linker is (G4S)6G2.

[0128] Other exemplary linkers include GGG, DGGGS, TGEKP (see, e.g., Liu et al., PNAS 5525-5530 (1997)), GGRR (Pomerantz et al., 1995, as above), (GGGGS)n, where n=1, 2, 3, 4 or 5 (Kim et al., PNAS 93, 1156-1160 (1996), EGKSSGSGSESKVD (Chaudhary et al., 1990, Proc. Natl. Acad. Sci. USA 87:1066-1070), KESGSVSSEQLAQFRSLD (Bird et al. al., 1988, Science 242:423-426), GGRRGGGS, LRCRDGERP, LRQKDGGGSERP, LRQKD(GGGS)2ERP. Alternatively, one can use computer programs capable of modeling the DNA-binding site and the peptide itself (Desjarlais & Berg, PNAS 90:2256-2260 (1993), PNAS 91:11099-11103 (1994)), or one can rationally design flexible linkers by bacteriophage or yeast display methods.

[0129] The VH and VL in the single chain scFv antibody of the present invention can be in any one of two orientations. In some embodiments, the scFv comprises, from the N-terminus to the C-terminus, VH-linker-VL or VL-linker-VH. In a preferred embodiment, the single chain scFv antibody of the present invention comprises, from the N-terminus to the C-terminus, VL-linker-VH. In a preferred embodiment, the C-terminus of the VL is covalently linked to the N-terminus of the VH by a linker.

[0130] In some embodiments, in addition to the linker, other polypeptide fragments having a certain function can be inserted between the VL and VH domains, for example, polypeptide fragments having the function of modulating an immune response or causing cell lysis or cell killing.

[0131] In some embodiments, disulfide bonds can be introduced into scFv to stabilize single chain antibodies. For example, intrachain or interchain disulfide bonds can be introduced to connect the VH and VL framework regions of scFv. In one embodiment, one amino acid residue each of antibody VH and VL, for example, position 44 of VH and position 100 of VL, or position 105 of VH and position 43 of VL based on the Kabat numbering system, can be mutated to cysteine.

[0132] The single chain scFv polypeptide antibodies of the invention can be expressed by a nucleic acid comprising VH- and VL-encoding sequences as described by Huston et al. (Proc. Nat. Acad. Sci. USA, 85:5879-5883, 1988). See also U.S. Patent Nos. 5,091,513, 5,132,405 and 4,956,778 and U.S. Patent Publication Nos. 20050196754 and 20050196754. In some embodiments, the single chain scFv antibodies of the invention are expressed in eukaryotic cells, e.g., mammalian cells such as yeast cells, H293 cells or CHO cells. In some embodiments, the antibodies of the invention are anti-BCMA scFvs or antigen-binding fragments thereof, comprising an antigen-binding region of the amino acid sequence of SEQ ID NO:99 or a variant thereof, and specifically bind to a BCMA polypeptide (e.g., a BCMA polypeptide having the amino acid sequence of SEQ ID NO:74 or a fragment thereof). In some embodiments, the variant has at least 90%, 92%, 95%, 97%, 98%, 99% or even higher identity with SEQ ID NO: 99. In one embodiment, the anti-BCMA scFv is encoded by the nucleotides of SEQ ID NO: 100.

[0133] In some embodiments, the anti-BCMA scFv antibody comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO:4, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity thereto, a light chain variable region comprising the amino acid sequence of SEQ ID NO:31, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity thereto, and an optional linker, e.g., a linker peptide, between the heavy and light chain variable regions. In some embodiments, the linker comprises the amino acid sequence of SEQ ID NO:93.

[0134] In some embodiments, the anti-BCMA scFv comprises a VH having the amino acid sequence of SEQ ID NO: 4. In some embodiments, the anti-BCMA scFv comprises a VL having the amino acid sequence of SEQ ID NO: 31. In some embodiments, the anti-BCMA scFv comprises a VH having the sequence shown in SEQ ID NO: 4 and a VL having the sequence shown in SEQ ID NO: 31. In some embodiments, the anti-BCMA scFv comprises three HCDR sequences of the VH of the sequence shown in SEQ ID NO: 4 and / or three LCDR sequences of the VL of the sequence shown in SEQ ID NO: 31. In some embodiments, the anti-BCMA scFv comprises an HCDR3 of SEQ ID NO: 3 and an LCDR3 of SEQ ID NO: 30. In some embodiments, the anti-BCMA scFv comprises a VH CDR1 of SEQ ID NO: 1, a VH CDR2 of SEQ ID NO: 2 and a VH CDR3 of SEQ ID NO: 3. In some embodiments, the anti-BCMA scFv comprises a VL CDR1 of SEQ ID NO: 28, a VL CDR2 of SEQ ID NO: 29 and a VL CDR3 of SEQ ID NO: 30. In some embodiments, the anti-BCMA scFv comprises a VH CDR1 of SEQ ID NO: 1, a VH CDR2 of SEQ ID NO: 2 and a VH CDR3 of SEQ ID NO: 3, and a VL CDR1 of SEQ ID NO: 28, a VL CDR2 of SEQ ID NO: 29 and a VL CDR3 of SEQ ID NO: 30.

[0135] In some embodiments, an antibody of the invention is an anti-BCMA scFv or antigen-binding fragment thereof, which comprises an antigen-binding region of the amino acid sequence of SEQ ID NO: 102 or a variant thereof and specifically binds to a BCMA polypeptide (e.g. a BCMA polypeptide having the amino acid sequence of SEQ ID NO: 74 or a fragment thereof). In some embodiments, the variant has at least 90%, 92%, 95%, 97%, 98%, 99% or even higher identity with SEQ ID NO: 102. In one embodiment, the anti-BCMA scFv is encoded by the nucleotides of SEQ ID NO: 103.

[0136] In some embodiments, the anti-BCMA scFv antibody comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO:5, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity thereto, a light chain variable region comprising the amino acid sequence of SEQ ID NO:41, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity thereto, and an optional linker, e.g., a linker peptide, between the heavy and light chain variable regions. In some embodiments, the linker comprises the amino acid sequence of SEQ ID NO:93.

[0137] In some embodiments, the anti-BCMA scFv comprises a VH having the amino acid sequence of SEQ ID NO: 5. In some embodiments, the anti-BCMA scFv comprises a VL having the amino acid sequence of SEQ ID NO: 41. In some embodiments, the anti-BCMA scFv comprises a VH having the sequence shown in SEQ ID NO: 5 and a VL having the sequence shown in SEQ ID NO: 41. In some embodiments, the anti-BCMA scFv comprises three HCDR sequences of the VH of the sequence shown in SEQ ID NO: 5 and / or three LCDR sequences of the VL of the sequence shown in SEQ ID NO: 41. In some embodiments, the anti-BCMA scFv comprises an HCDR3 of SEQ ID NO: 3 and an LCDR3 of SEQ ID NO: 38. In some embodiments, the anti-BCMA scFv comprises a VH CDR1 of SEQ ID NO: 1, a VH CDR2 of SEQ ID NO: 2 and a VH CDR3 of SEQ ID NO: 3. In some embodiments, the anti-BCMA scFv comprises a VL CDR1 of SEQ ID NO: 32, a VL CDR2 of SEQ ID NO: 35 and a VL CDR3 of SEQ ID NO: 38. In some embodiments, the anti-BCMA scFv comprises a VH CDR1 of SEQ ID NO: 1, a VH CDR2 of SEQ ID NO: 2 and a VH CDR3 of SEQ ID NO: 3, and a VL CDR1 of SEQ ID NO: 32, a VL CDR2 of SEQ ID NO: 35 and a VL CDR3 of SEQ ID NO: 38.

[0138] In some embodiments, an antibody of the invention is an anti-BCMA scFv or antigen-binding fragment thereof, which comprises an antigen-binding region of the amino acid sequence of SEQ ID NO: 105 or a variant thereof and specifically binds to a BCMA polypeptide (e.g. a BCMA polypeptide having the amino acid sequence of SEQ ID NO: 74 or a fragment thereof). In some embodiments, the variant has at least 90%, 92%, 95%, 97%, 98%, 99% or even higher identity with SEQ ID NO: 105. In one embodiment, the anti-BCMA scFv is encoded by the nucleotides of SEQ ID NO: 106.

[0139] In some embodiments, the anti-BCMA scFv antibody comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO:5, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity thereto, a light chain variable region comprising the amino acid sequence of SEQ ID NO:42, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity thereto, and an optional linker, e.g., a linker peptide, between the heavy and light chain variable regions. In some embodiments, the linker comprises the amino acid sequence of SEQ ID NO:93.

[0140] In some embodiments, the anti-BCMA scFv comprises a VH having the amino acid sequence of SEQ ID NO: 5. In some embodiments, the anti-BCMA scFv comprises a VL having the amino acid sequence of SEQ ID NO: 42. In some embodiments, the anti-BCMA scFv comprises a VH having the sequence shown in SEQ ID NO: 5 and a VL having the sequence shown in SEQ ID NO: 42. In some embodiments, the anti-BCMA scFv comprises three HCDR sequences of the VH of the sequence shown in SEQ ID NO: 5 and / or three LCDR sequences of the VL of the sequence shown in SEQ ID NO: 42. In some embodiments, the anti-BCMA scFv comprises an HCDR3 of SEQ ID NO: 3 and an LCDR3 of SEQ ID NO: 39. In some embodiments, the anti-BCMA scFv comprises a VH CDR1 of SEQ ID NO: 1, a VH CDR2 of SEQ ID NO: 2 and a VH CDR3 of SEQ ID NO: 3. In some embodiments, the anti-BCMA scFv comprises a VL CDR1 of SEQ ID NO: 33, a VL CDR2 of SEQ ID NO: 36 and a VL CDR3 of SEQ ID NO: 39. In some embodiments, the anti-BCMA scFv comprises a VH CDR1 of SEQ ID NO: 1, a VH CDR2 of SEQ ID NO: 2 and a VH CDR3 of SEQ ID NO: 3, and a VL CDR1 of SEQ ID NO: 33, a VL CDR2 of SEQ ID NO: 36 and a VL CDR3 of SEQ ID NO: 39.

[0141] In some embodiments, an antibody of the invention is an anti-BCMA scFv or antigen-binding fragment thereof, which comprises an antigen-binding region of the amino acid sequence of SEQ ID NO: 108 or a variant thereof and specifically binds to a BCMA polypeptide (e.g. a BCMA polypeptide having the amino acid sequence of SEQ ID NO: 74 or a fragment thereof). In some embodiments, the variant has at least 90%, 92%, 95%, 97%, 98%, 99% or even higher identity with SEQ ID NO: 108. In one embodiment, the anti-BCMA scFv is encoded by the nucleotides of SEQ ID NO: 109.

[0142] In some embodiments, the anti-BCMA scFv antibody comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 10, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity thereto, a light chain variable region comprising the amino acid sequence of SEQ ID NO: 46, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity thereto, and an optional linker, e.g., a linker peptide, between the heavy and light chain variable regions. In some embodiments, the linker comprises the amino acid sequence of SEQ ID NO: 93.

[0143] In some embodiments, the anti-BCMA scFv comprises a VH having the amino acid sequence of SEQ ID NO: 10. In some embodiments, the anti-BCMA scFv comprises a VL having the amino acid sequence of SEQ ID NO: 46. In some embodiments, the anti-BCMA scFv comprises a VH having the sequence set forth in SEQ ID NO: 10 and a VL having the sequence set forth in SEQ ID NO: 46. In some embodiments, the anti-BCMA scFv comprises three HCDR sequences of the VH of the sequence set forth in SEQ ID NO: 10 and / or three LCDR sequences of the VL of the sequence set forth in SEQ ID NO: 46. In some embodiments, the anti-BCMA scFv comprises an HCDR3 of SEQ ID NO: 9 and an LCDR3 of SEQ ID NO: 45. In some embodiments, the anti-BCMA scFv comprises a VH CDR1 of SEQ ID NO: 7, a VH CDR2 of SEQ ID NO: 8 and a VH CDR3 of SEQ ID NO: 9. In some embodiments, the anti-BCMA scFv comprises a VL CDR1 of SEQ ID NO: 32, a VL CDR2 of SEQ ID NO: 44 and a VL CDR3 of SEQ ID NO: 45. In some embodiments, the anti-BCMA scFv comprises a VH CDR1 of SEQ ID NO:7, a VH CDR2 of SEQ ID NO:8 and a VH CDR3 of SEQ ID NO:9, and a VL CDR1 of SEQ ID NO:32, a VL CDR2 of SEQ ID NO:44 and a VL CDR3 of SEQ ID NO:45.

[0144] In some embodiments, an antibody of the invention is an anti-BCMA scFv or antigen-binding fragment thereof, which comprises an antigen-binding region of the amino acid sequence of SEQ ID NO: 111 or a variant thereof and specifically binds to a BCMA polypeptide (e.g. a BCMA polypeptide having the amino acid sequence of SEQ ID NO: 74 or a fragment thereof). In some embodiments, the variant has at least 90%, 92%, 95%, 97%, 98%, 99% or even higher identity with SEQ ID NO: 111. In one embodiment, the anti-BCMA scFv is encoded by the nucleotides of SEQ ID NO: 112.

[0145] In some embodiments, the anti-BCMA scFv antibody comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 16, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity thereto, a light chain variable region comprising the amino acid sequence of SEQ ID NO: 50, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity thereto, and an optional linker, e.g., a linker peptide, between the heavy and light chain variable regions. In some embodiments, the linker comprises the amino acid sequence of SEQ ID NO:93.

[0146] In some embodiments, the anti-BCMA scFv comprises a VH having the amino acid sequence of SEQ ID NO: 16. In some embodiments, the anti-BCMA scFv comprises a VL having the amino acid sequence of SEQ ID NO: 50. In some embodiments, the anti-BCMA scFv comprises a VH having the sequence set forth in SEQ ID NO: 16 and a VL having the sequence set forth in SEQ ID NO: 50. In some embodiments, the anti-BCMA scFv comprises three HCDR sequences of the VH of the sequence set forth in SEQ ID NO: 16 and / or three LCDR sequences of the VL of the sequence set forth in SEQ ID NO: 50. In some embodiments, the anti-BCMA scFv comprises an HCDR3 of SEQ ID NO: 13 and an LCDR3 of SEQ ID NO: 49. In some embodiments, the anti-BCMA scFv comprises a VH CDR1 of SEQ ID NO: 11, a VH CDR2 of SEQ ID NO: 12 and a VH CDR3 of SEQ ID NO: 13. In some embodiments, the anti-BCMA scFv comprises a VL CDR1 of SEQ ID NO: 47, a VL CDR2 of SEQ ID NO: 48 and a VL CDR3 of SEQ ID NO: 49. In some embodiments, the anti-BCMA scFv comprises a VH CDR1 of SEQ ID NO: 11, a VH CDR2 of SEQ ID NO: 12 and a VH CDR3 of SEQ ID NO: 13, and a VL CDR1 of SEQ ID NO: 47, a VL CDR2 of SEQ ID NO: 48 and a VL CDR3 of SEQ ID NO: 49.

[0147] In some embodiments, an antibody of the invention is an anti-BCMA scFv or antigen-binding fragment thereof, which comprises an antigen-binding region of the amino acid sequence of SEQ ID NO: 114 or a variant thereof and specifically binds to a BCMA polypeptide (e.g. a BCMA polypeptide having the amino acid sequence of SEQ ID NO: 74 or a fragment thereof). In some embodiments, the variant has at least 90%, 92%, 95%, 97%, 98%, 99% or even higher identity with SEQ ID NO: 114. In one embodiment, the anti-BCMA scFv is encoded by the nucleotides of SEQ ID NO: 115.

[0148] In some embodiments, the anti-BCMA scFv antibody comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 17, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity thereto, a light chain variable region comprising the amino acid sequence of SEQ ID NO: 58, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity thereto, and an optional linker, e.g., a linker peptide, between the heavy and light chain variable regions. In some embodiments, the linker comprises the amino acid sequence of SEQ ID NO: 93.

[0149] In some embodiments, the anti-BCMA scFv comprises a VH having the amino acid sequence of SEQ ID NO: 17. In some embodiments, the anti-BCMA scFv comprises a VL having the amino acid sequence of SEQ ID NO: 58. In some embodiments, the anti-BCMA scFv comprises a VH having the sequence shown in SEQ ID NO: 17 and a VL having the sequence shown in SEQ ID NO: 58. In some embodiments, the anti-BCMA scFv comprises three HCDR sequences of the VH of the sequence shown in SEQ ID NO: 17 and / or three LCDR sequences of the VL of the sequence shown in SEQ ID NO: 58. In some embodiments, the anti-BCMA scFv comprises an HCDR3 of SEQ ID NO: 14 and an LCDR3 of SEQ ID NO: 55. In some embodiments, the anti-BCMA scFv comprises a VH CDR1 of SEQ ID NO: 11, a VH CDR2 of SEQ ID NO: 12 and a VH CDR3 of SEQ ID NO: 14. In some embodiments, the anti-BCMA scFv comprises a VL CDR1 of SEQ ID NO: 51, a VL CDR2 of SEQ ID NO: 54 and a VL CDR3 of SEQ ID NO: 55. In some embodiments, the anti-BCMA scFv comprises a VH CDR1 of SEQ ID NO: 11, a VH CDR2 of SEQ ID NO: 12 and a VH CDR3 of SEQ ID NO: 14, and a VL CDR1 of SEQ ID NO: 51, a VL CDR2 of SEQ ID NO: 54 and a VL CDR3 of SEQ ID NO: 55.

[0150] In some embodiments, an antibody of the invention is an anti-BCMA scFv or antigen-binding fragment thereof, which comprises an antigen-binding region of the amino acid sequence of SEQ ID NO: 120 or a variant thereof and specifically binds to a BCMA polypeptide (e.g. a BCMA polypeptide having the amino acid sequence of SEQ ID NO: 74 or a fragment thereof). In some embodiments, the variant has at least 90%, 92%, 95%, 97%, 98%, 99% or even higher identity with SEQ ID NO: 120. In one embodiment, the anti-BCMA scFv is encoded by the nucleotides of SEQ ID NO: 121.

[0151] In some embodiments, the anti-BCMA scFv antibody comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO:23, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity thereto, a light chain variable region comprising the amino acid sequence of SEQ ID NO:64, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity thereto, and an optional linker, e.g., a linker peptide, between the heavy and light chain variable regions. In some embodiments, the linker comprises the amino acid sequence of SEQ ID NO:93.

[0152] In some embodiments, the anti-BCMA scFv comprises a VH having the amino acid sequence of SEQ ID NO: 23. In some embodiments, the anti-BCMA scFv comprises a VL having the amino acid sequence of SEQ ID NO: 64. In some embodiments, the anti-BCMA scFv comprises a VH having the sequence set forth in SEQ ID NO: 23 and a VL having the sequence set forth in SEQ ID NO: 64. In some embodiments, the anti-BCMA scFv comprises three HCDR sequences of the VH of the sequence set forth in SEQ ID NO: 23 and / or three LCDR sequences of the VL of the sequence set forth in SEQ ID NO: 64. In some embodiments, the anti-BCMA scFv comprises an HCDR3 of SEQ ID NO: 22 and an LCDR3 of SEQ ID NO: 63. In some embodiments, the anti-BCMA scFv comprises a VH CDR1 of SEQ ID NO: 20, a VH CDR2 of SEQ ID NO: 21 and a VH CDR3 of SEQ ID NO: 22. In some embodiments, the anti-BCMA scFv comprises a VL CDR1 of SEQ ID NO: 61, a VL CDR2 of SEQ ID NO: 62 and a VL CDR3 of SEQ ID NO: 63. In some embodiments, the anti-BCMA scFv comprises a VH CDR1 of SEQ ID NO: 20, a VH CDR2 of SEQ ID NO: 21 and a VH CDR3 of SEQ ID NO: 22, and a VL CDR1 of SEQ ID NO: 61, a VL CDR2 of SEQ ID NO: 62 and a VL CDR3 of SEQ ID NO: 63.

[0153] In some embodiments, an antibody of the invention is an anti-BCMA scFv or antigen-binding fragment thereof, which comprises an antigen-binding region of the amino acid sequence of SEQ ID NO: 117 or a variant thereof and specifically binds to a BCMA polypeptide (e.g. a BCMA polypeptide having the amino acid sequence of SEQ ID NO: 74 or a fragment thereof). In some embodiments, the variant has at least 90%, 92%, 95%, 97%, 98%, 99% or even higher identity with SEQ ID NO: 117. In one embodiment, the anti-BCMA scFv is encoded by the nucleotides of SEQ ID NO: 118.

[0154] In some embodiments, the anti-BCMA scFv antibody comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO:27, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity thereto, a light chain variable region comprising the amino acid sequence of SEQ ID NO:59, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity thereto, and an optional linker, e.g., a linker peptide, between the heavy and light chain variable regions. In some embodiments, the linker comprises the amino acid sequence of SEQ ID NO:93.

[0155] In some embodiments, the anti-BCMA scFv comprises a VH having the amino acid sequence of SEQ ID NO: 27. In some embodiments, the anti-BCMA scFv comprises a VL having the amino acid sequence of SEQ ID NO: 59. In some embodiments, the anti-BCMA scFv comprises a VH having the sequence shown in SEQ ID NO: 27 and a VL having the sequence shown in SEQ ID NO: 59. In some embodiments, the anti-BCMA scFv comprises three HCDR sequences of the VH of the sequence shown in SEQ ID NO: 27 and / or three LCDR sequences of the VL of the sequence shown in SEQ ID NO: 59. In some embodiments, the anti-BCMA scFv comprises an HCDR3 of SEQ ID NO: 26 and an LCDR3 of SEQ ID NO: 56. In some embodiments, the anti-BCMA scFv comprises a VH CDR1 of SEQ ID NO: 24, a VH CDR2 of SEQ ID NO: 25 and a VH CDR3 of SEQ ID NO: 26. In some embodiments, the anti-BCMA scFv comprises a VL CDR1 of SEQ ID NO: 52, a VL CDR2 of SEQ ID NO: 62 and a VL CDR3 of SEQ ID NO: 56. In some embodiments, the anti-BCMA scFv comprises a VH CDR1 of SEQ ID NO: 24, a VH CDR2 of SEQ ID NO: 25 and a VH CDR3 of SEQ ID NO: 26, and a VL CDR1 of SEQ ID NO: 52, a VL CDR2 of SEQ ID NO: 62 and a VL CDR3 of SEQ ID NO: 56.

[0156] In some embodiments, an antibody of the invention is an anti-BCMA scFv or antigen-binding fragment thereof, which comprises an antigen-binding region of the amino acid sequence of SEQ ID NO: 123 or a variant thereof and specifically binds to a BCMA polypeptide (e.g. a BCMA polypeptide having the amino acid sequence of SEQ ID NO: 74 or a fragment thereof). In some embodiments, the variant has at least 90%, 92%, 95%, 97%, 98%, 99% or even higher identity with SEQ ID NO: 123. In one embodiment, the anti-BCMA scFv is encoded by the nucleotides of SEQ ID NO: 124.

[0157] In some embodiments, the anti-BCMA scFv antibody comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO:27, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity thereto, a light chain variable region comprising the amino acid sequence of SEQ ID NO:71, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity thereto, and an optional linker, e.g., a linker peptide, between the heavy and light chain variable regions. In some embodiments, the linker comprises the amino acid sequence of SEQ ID NO:93.

[0158] In some embodiments, the anti-BCMA scFv comprises a VH having the amino acid sequence of SEQ ID NO: 27. In some embodiments, the anti-BCMA scFv comprises a VL having the amino acid sequence of SEQ ID NO: 71. In some embodiments, the anti-BCMA scFv comprises a VH having the sequence set forth in SEQ ID NO: 27 and a VL having the sequence set forth in SEQ ID NO: 71. In some embodiments, the anti-BCMA scFv comprises three HCDR sequences of the VH of the sequence set forth in SEQ ID NO: 27 and / or three LCDR sequences of the VL of the sequence set forth in SEQ ID NO: 71. In some embodiments, the anti-BCMA scFv comprises an HCDR3 of SEQ ID NO: 26 and an LCDR3 of SEQ ID NO: 68. In some embodiments, the anti-BCMA scFv comprises a VH CDR1 of SEQ ID NO: 24, a VH CDR2 of SEQ ID NO: 25 and a VH CDR3 of SEQ ID NO: 26. In some embodiments, the anti-BCMA scFv comprises a VL CDR1 of SEQ ID NO: 65, a VL CDR2 of SEQ ID NO: 62 and a VL CDR3 of SEQ ID NO: 68. In some embodiments, the anti-BCMA scFv comprises a VH CDR1 of SEQ ID NO: 24, a VH CDR2 of SEQ ID NO: 25 and a VH CDR3 of SEQ ID NO: 26, and a VL CDR1 of SEQ ID NO: 65, a VL CDR2 of SEQ ID NO: 62 and a VL CDR3 of SEQ ID NO: 68.

[0159] In some embodiments, an antibody of the invention is an anti-BCMA scFv or antigen-binding fragment thereof, which comprises an antigen-binding region of the amino acid sequence of SEQ ID NO: 126 or a variant thereof and specifically binds to a BCMA polypeptide (e.g. a BCMA polypeptide having the amino acid sequence of SEQ ID NO: 74 or a fragment thereof). In some embodiments, the variant has at least 90%, 92%, 95%, 97%, 98%, 99% or even higher identity with SEQ ID NO: 126. In one embodiment, the anti-BCMA scFv is encoded by the nucleotides of SEQ ID NO: 127.

[0160] In some embodiments, the anti-BCMA scFv antibody comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO:27, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity thereto, a light chain variable region comprising the amino acid sequence of SEQ ID NO:72, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity thereto, and an optional linker, e.g., a linker peptide, between the heavy and light chain variable regions. In some embodiments, the linker comprises the amino acid sequence of SEQ ID NO:93.

[0161] In some embodiments, the anti-BCMA scFv comprises a VH having the amino acid sequence of SEQ ID NO: 27. In some embodiments, the anti-BCMA scFv comprises a VL having the amino acid sequence of SEQ ID NO: 72. In some embodiments, the anti-BCMA scFv comprises a VH having the sequence set forth in SEQ ID NO: 27 and a VL having the sequence set forth in SEQ ID NO: 72. In some embodiments, the anti-BCMA scFv comprises three HCDR sequences of the VH of the sequence set forth in SEQ ID NO: 27 and / or three LCDR sequences of the VL of the sequence set forth in SEQ ID NO: 72. In some embodiments, the anti-BCMA scFv comprises an HCDR3 of SEQ ID NO: 26 and an LCDR3 of SEQ ID NO: 69. In some embodiments, the anti-BCMA scFv comprises a VH CDR1 of SEQ ID NO: 24, a VH CDR2 of SEQ ID NO: 25 and a VH CDR3 of SEQ ID NO: 26. In some embodiments, the anti-BCMA scFv comprises a VL CDR1 of SEQ ID NO: 66, a VL CDR2 of SEQ ID NO: 62 and a VL CDR3 of SEQ ID NO: 69. In some embodiments, the anti-BCMA scFv comprises a VH CDR1 of SEQ ID NO: 24, a VH CDR2 of SEQ ID NO: 25 and a VH CDR3 of SEQ ID NO: 26, and a VL CDR1 of SEQ ID NO: 66, a VL CDR2 of SEQ ID NO: 62 and a VL CDR3 of SEQ ID NO: 69.

[0162] III.scFv-Fc antibody Antibodies with Fc regions have several advantages, including, but not limited to, the ability of the Fc region to mediate effector functions, such as CDC and ADCC immunological activity, the dimerization function of the Fc region to form bivalent antibodies that provide high antigen binding affinity and / or alter plasma half-life and renal clearance rates, and the ability of bivalent antibodies to internalize at different rates than monovalent FaB or scFv antibodies, altering immune or vector functions. For example, alpha emitters do not need to be internalized to kill target cells, but many drugs and toxins benefit from internalization of immune complexes.

[0163] Thus, in a preferred embodiment, there is provided an scFv-Fc antibody formed by fusing a single chain scFv antibody of the invention with an antibody Fc region. In some embodiments, the antibody comprises a single chain scFv antibody of the invention and a wild type or altered Fc region. In a preferred embodiment, the antibody comprises, from N-terminus to C-terminus, Fc-VH-linker-VL or Fc-VL-linker-VH, or preferably VH-linker-VL-Fc or VL-linker-VH-Fc. In a preferred embodiment, the Fc is connected to the variable region (VH or VL) by a hinge region. In some embodiments, the Fc is derived from a human immunoglobulin Fc region, preferably from a human IgG1 or IgG4 Fc region. In a preferred embodiment, the Fc region has the amino acid sequence shown in SEQ ID NO: 132, or an amino acid sequence containing at least 1, 2 or 3 amino acid mutations relative to the amino acid sequence of SEQ ID NO: 132 and not more than 20, 10 or 5 amino acid mutations, or a sequence having at least 95-99% identity to the amino acid sequence of SEQ ID NO: 132. In some embodiments, the single-chain scFv antibody of the present invention is connected to the Fc region by a hinge region. In one embodiment, the hinge region is a C8 hinge region, and comprises, for example, the amino acid sequence shown in SEQ ID NO: 95, or an amino acid sequence containing at least 1, 2 or 3 amino acid mutations relative to the amino acid sequence of SEQ ID NO: 95 and not more than 5 amino acid mutations.

[0164] In some preferred embodiments, the invention provides antibodies that specifically bind to a BCMA polypeptide (e.g. a BCMA polypeptide having the amino acid sequence of SEQ ID NO: 74 or a fragment thereof) and comprise an amino acid sequence selected from SEQ ID NOs: 101, 104, 107, 110, 113, 116, 119, 122, 125 and 128, or an amino acid sequence which contains at least 1, 2 or 3 amino acid mutations thereto and not more than 20, not more than 10 or not more than 5 amino acid mutations thereto, or an amino acid sequence which has at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99% or more identity thereto.

[0165] Table 3 below shows the amino acid sequences of some exemplary ScFv-Fc antibodies of the present invention, as well as the amino acid and nucleotide sequences for constructing the single-chain scFvs. Table 3 also shows the amino acid and nucleotide sequences for the scFv-Fc recombinant single-chain antibodies constructed based on the description in US20170226216A1. The amino acid and nucleotide sequences of the linker and hinge used in these scFv-Fc antibodies are shown in FIG.

[0166] [Table 5]

[0167] In some embodiments, the scFv-Fc antibodies of the invention have effector functions. The term "effector function" refers to those biological activities attributable to the Fc-region of antibodies and varies with the type of antibody. There are five main antibody types: IgA, IgD, IgE, IgG, and IgM, some of which can be further divided into subclasses (isotypes), e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2. The heavy chain constant domains corresponding to the different types of immunoglobulins are called α, δ, ε, γ, and μ, respectively. Antibody effector functions include, but are not limited to, e.g., C1q binding and complement-dependent cytotoxicity (CDC), Fc receptor binding, antibody-dependent cell-mediated cytotoxicity (ADCC), phagocytosis, down-regulation of cell surface receptors (e.g., B cell receptors), and B-cell activation. In some embodiments, the scFv-Fc antibodies of the invention inhibit, suppress the growth of and / or kill cells expressing BCMA, particularly MM cells, through effector cell-mediated cytotoxicity (ADCC) activity.

[0168] In some embodiments, the Fc region comprises an Fc-region having one or more ADCC activity enhancing amino acid substitutions, e.g., substitutions at Fc-region positions 298, 333 and / or 334 (EU numbering of residues). In some embodiments, the Fc-region can be altered to result in altered (i.e., improved or decreased) C1q binding and / or complement dependent cytotoxicity (CDC) (see, e.g., US 6,194,551, WO 99 / 51642 and Idusogie, EE et al., J. Immunol. 164 (2000) 4178-4184).

[0169] In some other embodiments, the Fc can be altered to increase or decrease its degree of glycosylation and / or change its glycosylation mode. Addition or absence of glycosylation sites in the Fc can be easily achieved by altering the amino acid sequence to create or remove one or more glycosylation sites. For example, one or more amino acid substitutions can be made to eliminate one or more glycosylation sites, thereby eliminating glycosylation at said sites. Antibodies with altered glycosylation can be produced, for example, low or no fucosylated antibodies with reduced amounts of fucosyl residues or antibodies with added bisecting GlcNac structures. Such altered glycosylation models have already been shown to improve the ADCC ability of antibodies.

[0170] Thus, in some preferred embodiments, the present invention provides an antibody in which the Fc region is low or non-fucosylated, which can significantly improve the binding affinity of the antibody Fc domain to an Fcγ receptor (e.g., FcγRIIIa) expressed on an effector cell, thereby causing the antibody to have enhanced antibody-dependent cell-mediated cytotoxicity (ADCC) activity. For example, the amount of fucose in the antibody can be 1% to 80%, 1% to 65%, 5% to 65%, or 20% to 40%. The amount of fucose can be determined by calculating the average amount of fucose in the glycan at Asn297 relative to the sum of all glycan structures (e.g., complex, heterozygous, and high mannose structures) connected to Asn297, which can be measured by MALDI-TOF mass spectrometry, for example, as described in WO2008 / 077546. Asn297 refers to an asparagine residue located at about position 297 (EU numbering of Fc region residues) in the Fc region; however, due to minor sequence variations in antibodies, Asn297 may be located about ±3 amino acid positions above or below position 297, i.e., between positions 294 and 300. See, e.g., US2003 / 0157108, US2004 / 0093621. Further disclosed examples relating to "afucosylated" or "hypofucosylated" antibody variants are described in US2003 / 0157108, WO2000 / 61739, WO2001 / 29246, US2003 / 0115614, US2002 / 0164328, US2004 / 0093621, US2004 / 013214. 0, US2004 / 0110704, US2004 / 0110282, US2004 / 0109865, WO2003 / 085119, WO2003 / 084570, WO2005 / 035586, WO2005 / 035778, WO2005 / 053742, WO2002 / 031140, Okazaki, A. et al., J. Mol. Biol. 336 (2004) 1239-1249, Yamane-Ohnuki, N. et al., Biotech. Bioeng. 87:614 (2004) 614-622. Such antibody variants can be produced in cell lines of afucosylated or hypofucosylated antibodies.Examples of such cells include Lec13 CHO cells, which are deficient in protein fucosylation (Ripka, J. et al., Arch. Biochem. Biophys. 249 (1986): 533-545, US 2003 / 0157108 and WO2004 / 056312, especially Example 11), and gene knockout cell lines, such as CHO cells with the α-1,6-fucosyltransferase gene FUT8 knockout (see, for example, Yamane-Ohnuki, N. et al., Biotech. Bioeng. 87: 614 (2004) 614-622, Kanda, Y. et al., Biotechnol. Bioeng. 94 (2006) 680-688 and WO2003 / 085107). For example, the Ms704, Ms705 and Ms709 cell lines can express antibodies lacking fucose by lacking the fucosyltransferase gene FUT8 (α(1,6)-fucosyltransferase) in the cell lines Ms704, Ms705 and Ms709. Other cell lines with a functionally disrupted FUT8 gene are described in EP 1,176,195, and antibodies expressed in such cell lines exhibit hypofucosylation. Preferably, fucosidases can be used to cleave the fucosyl residues of the antibody. For example, the fucosidase α-L-fucosidase is used to remove fucosyl residues from the antibody (Tarentino et al. (1975) Biochem. 14:5516-23).

[0171] Additionally, the present invention contemplates antibody variants having bisected oligosaccharides, e.g., biantennary oligosaccharides attached to the Fc region are bisected by GlcNAc. These antibody variants can have reduced fucosylation and / or improved ADCC function. Examples of these antibody variants are described, for example, in WO2003 / 011878, US6,602,684 and US2005 / 0123546. The present invention also contemplates antibody variants having at least one hemi-lactose residue in the oligosaccharide attached to the Fc region. These antibody variants can have improved CDC function. These antibody variants are described, for example, in WO1997 / 30087, WO1998 / 58964 and WO1999 / 22764.

[0172] Non-limiting examples of in vitro assays for measuring ADCC activity to evaluate target molecules are described in US 5,500,362 (see, e.g., Hellstrom, I. et al., Proc. Nat'l Acad. Sci. USA 83 (1986) 7059-7063 and Hellstrom, I. et al., Proc. Nat'l Acad. Sci. USA 82 (1985) 1499-1502), US 5,821,337 (see, e.g., Bruggemann, M. et al., J. Exp. Med. 166 (1987) 1351-1361). Alternatively, non-radioactive assay methods (see, for example, the ACTI™ non-radioactive cytotoxicity assay (CellTechnology, Inc. Mountain View, CA) and the CytoTox96® non-radioactive cytotoxicity assay (Promega, Madison, WI) for use in flow cytometry) can be employed. Effector cells applicable to these assays include peripheral blood mononuclear cells (PBMC) and natural killer (NK) cells. Preferably, or alternatively, the ADCC activity of the target molecule can be assessed in vivo, for example in the animal model disclosed in Clynes, R. et al., Proc. Nat'l Acad. Sci. USA 95 (1998) 652-656. To assess complement activation, CDC measurements (see, for example, Gazzano-Santoro, H. et al., J. Immunol. Methods 202 (1996) 163-171; Cragg, MS et al., Blood 101 (2003) 1045-1052; and Cragg, MS and MJ Glennie, Blood 103 (2004) 2738-2743) can be performed. C1q binding can be measured to determine the C1q binding and CDC activity of the antibody. See, for example, the C1q and C3c binding ELISAs in WO2006 / 029879 and WO2005 / 100402.

[0173] In some embodiments, the present invention also contemplates antibody variants that retain some, but not all, effector functions, making them desirable candidates for certain applications in which the in vivo half-life of the antibody is important, but some effector functions (e.g., complement and ADCC) are unnecessary or detrimental. In vitro and / or in vivo assay tests, as described above, can be performed to determine the reduction / loss of CDC and / or ADCC activity. For example, Fc receptor (FcR) binding assays can be performed to ensure that the antibody lacks FcγR binding (and thus potentially lacks ADCC activity) but retains FcRn binding ability. For example, the Fc region can include mutations that eliminate or reduce effector function, such as a human IgG1 Fc region with mutations P329G and / or L234A and L235A, or a human IgG4 Fc region with mutations P329G and / or S228P and L235E.

[0174] In some embodiments, the scFv-Fc region antibodies of the present invention can form divalent antibodies by dimerization of the Fc region, thereby further having higher overall antibody affinity and stability, or can form multispecific antibodies, e.g., bispecific antibodies. For example, the Fc region can comprise i) a homodimeric Fc-region of the human IgG1 subclass, or ii) a homodimeric Fc-region of the human IgG4 subclass, or iii) an isodimeric Fc-region, where a) one Fc-region polypeptide comprises the mutation T366W while another Fc-region polypeptide comprises the mutations T366S, L368A, and Y407V, or b) one Fc-region polypeptide comprises the mutations T366W and Y349C while another Fc-region polypeptide comprises the mutations T366S, L368A, Y407V, and S354C, or c) one Fc-region polypeptide comprises the mutations T366W and S354C while another Fc-region polypeptide comprises the mutations T366S, L368A, Y407V, and Y349C.

[0175] In some embodiments, the scFv-Fc recombinant antibodies of the present invention can be directly fused or conjugated via the Fc region portion to other molecules, including but not limited to fluorochromes, cytotoxins, radioisotopes, etc., for use in, for example, antigen quantification studies, antibody immobilization for affinity measurements, targeted delivery of therapeutic agents, immune effector cell Fc-mediated cytotoxicity testing, and many other applications.

[0176] B. Polynucleotides and Hosts In one aspect, the invention provides an essentially purified nucleic acid molecule encoding a polypeptide comprising a section or domain of an antibody chain that binds BCMA as described above. In some embodiments, the nucleic acid molecule of the invention encodes an antibody chain that binds BCMA (e.g., any antibody of the invention, including single chain scFv antibodies and scFv-Fc antibodies and fragments thereof).

[0177] Some nucleic acids of the invention comprise a nucleotide sequence encoding the heavy chain variable region of any antibody shown in Table 1, or a variant thereof, and / or the nucleotide sequence of the light chain variable region of the corresponding antibody shown in Table 1, or a variant thereof. In a specific embodiment, the nucleic acid molecule is a DNA VH sequence and / or a DNA VL sequence shown in Table 1. Some other nucleic acid molecules of the invention comprise a nucleotide sequence that is essentially the same (e.g., at least 65%, 80%, 95%, or 99% identical) to the nucleotide sequence of a nucleic acid molecule shown in Table 1. When expressed in an appropriate expression vector, the polypeptides encoded by these polynucleotides can exhibit BCMA antigen-binding ability.

[0178] The invention further provides a polynucleotide encoding at least one CDR region and usually all three CDR regions of a heavy chain VH or light chain VL sequence derived from an antibody that binds BCMA as described above. In some further embodiments, the polynucleotide encodes the complete or essentially the complete variable region sequence of the heavy and / or light chain of an antibody that binds BCMA as described above.

[0179] As will be apparent to those skilled in the art, due to the degenerate nature of the genetic code, each antibody or polypeptide amino acid sequence can be encoded by multiple nucleic acid sequences.

[0180] Some nucleic acid sequences of the invention comprise a nucleotide sequence encoding a heavy chain VH, which comprises (i) a nucleotide sequence selected from SEQ ID NOs: 75-82, or a nucleotide sequence having, for example, at least 80%, 90% or 99% identity. Some other nucleic acid sequences comprise a nucleotide sequence encoding a light chain VL, which comprises a nucleotide sequence of SEQ ID NOs: 83-92, or a nucleotide sequence having, for example, at least 80%, 90% or 99% identity.

[0181] In some embodiments, a nucleic acid sequence of the invention encodes any of the above-described single chain scFv antibodies of the invention. In some embodiments, a nucleic acid sequence of the invention encoding an scFv antibody comprises a nucleotide sequence encoding a heavy chain VH sequence and a nucleotide sequence encoding a light chain VL sequence selected below.

[0182] (i) the sequence of SEQ ID NO: 75 or a sequence essentially the same thereto, and the sequence of SEQ ID NO: 83 or a sequence essentially the same thereto; (ii) the sequence of SEQ ID NO: 76 or a sequence essentially the same therein, and the sequence of SEQ ID NO: 84 or 85 or a sequence essentially the same therein; (iii) the sequence of SEQ ID NO: 77 or a sequence essentially the same thereto, and the sequence of SEQ ID NO: 86 or a sequence essentially the same thereto; (iv) the sequence of SEQ ID NO: 78 or a sequence essentially the same thereto, and the sequence of SEQ ID NO: 87 or a sequence essentially the same thereto; (v) a sequence set forth in SEQ ID NO: 79 or a sequence essentially the same thereto, and a sequence set forth in SEQ ID NO: 88 or a sequence essentially the same thereto; (vi) a sequence having the same sequence as SEQ ID NO: 80, and a sequence having the same sequence as SEQ ID NO: 89, (vii) a sequence having the same sequence as SEQ ID NO: 81, and a sequence having the same sequence as SEQ ID NO: 90, (viii) the sequence of SEQ ID NO: 82 or a sequence essentially the same thereas, and the sequence of SEQ ID NO: 91 or 92 or a sequence essentially the same thereas.

[0183] In a preferred embodiment, a nucleic acid of the invention encoding an scFv antibody further comprises a nucleotide sequence encoding a linker, for example the sequence shown in SEQ ID NO:94 or a sequence essentially the same therein.

[0184] In a further preferred embodiment, a nucleic acid of the invention encoding an scFv antibody comprises a sequence selected from SEQ ID NOs: 100, 103, 106, 109, 112, 115, 118, 121, 124, and 127, or a sequence essentially the same therein.

[0185] In any one of the above embodiments, in a preferred embodiment, "essentially the same" nucleotide sequence refers to a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity to a reference nucleotide sequence. The identity of a nucleotide sequence can be determined using any sequence matching method known in the art. For example, the BLAST sequence matching search tool can be obtained from the website of NCBI (National Center for Biotechnology Information, Bethesda, MD). Typically, the percent identity is performed with the default parameters of NCBI Blast.

[0186] These polynucleotide sequences can be generated by synthesizing immobilized DNA from scratch or by PCR mutagenesis of existing sequences encoding antibodies or binding fragments thereof that bind to BCAM (e.g., sequences shown in Tables 1-3). Direct chemical synthesis of nucleic acids can be accomplished by methods known in the art, such as the phosphotriester method of Narang et al., 1979, Meth. Enzymol. 68:90, the phosphodiester method of Brown et al., Meth. Enzymol. 68:109, 1979, the diethylphosphorimide method of Beaucage et al., Tetra. Lett., 22:1859, 1981, and the solid-phase supported method of U.S. Pat. No. 4,458,066. Mutagenesis of polynucleotide sequences by PCR can be carried out, for example, as described in PCR Technology: Principles and Applications for DNA Amplification, H.A. Erlich (ed.), Freeman Press, NY, NY, 1992, PCR Protocols: A Guide to Methods and Applications, Innis et al. (eds.), Academic Press, San Diego, CA, 1990, Mattila et al., Nucleic Acids Res. 19:967, 1991, and Eckert et al., PCR Methods and Applications 1:17, 1991.

[0187] C. Antibody Production Antibodies can be produced using recombinant methods and compositions, for example, as described in US Pat. No. 4,816,567.

[0188] In one embodiment, a vector is provided comprising an isolated nucleic acid encoding an antibody that binds BCMA as described herein. The nucleic acid can encode an amino acid sequence comprising the VL of the antibody and / or an amino acid sequence comprising the VH of the antibody. In a further embodiment, the vector is an expression vector. In a further embodiment, the invention provides a host cell comprising the nucleic acid. In one embodiment, the host cell comprises (e.g., already transformed with) (1) a vector comprising a nucleic acid encoding an amino acid sequence comprising an antibody VL and an amino acid sequence comprising an antibody VH, or (2) a first vector comprising a nucleic acid encoding an amino acid sequence comprising an antibody VL and a second vector comprising a nucleic acid encoding an amino acid sequence comprising an antibody VH. In one embodiment, the host cell is eukaryotic, e.g., a Chinese hamster ovary (CHO) cell, a HEK293 cell, or a lymphoid cell (e.g., a Y0, NS0, Sp20 cell). In one embodiment, there is provided a method of producing an anti-BCMA antibody, comprising culturing a host cell comprising nucleic acid encoding the antibody as provided above under conditions suitable for expression of the antibody, and optionally recovering the antibody from the host cell (or host cell medium).

[0189] For recombinant production of an anti-BCMA antibody, nucleic acid encoding the antibody, e.g., as described above, can be isolated and inserted into one or more vectors for further cloning and / or expression in a host cell. The nucleic acid can be readily isolated and sequenced by conventional processes (e.g., by using oligonucleotide probes capable of specifically binding to genes encoding the heavy and light chain variable regions of the antibody).

[0190] A number of expression vectors can be used to express polynucleotides encoding antibody chains that bind BCMA (e.g., any of the antibodies of the invention, including scFv antibodies and full length antibodies). Both viral-based and non-viral expression vectors can be used to produce antibodies in mammalian host cells. Non-viral vectors and systems include plasmids, free vectors and artificial chromosomes, and generally contain expression cassettes for expressing proteins or RNA (see, e.g., Harrington et al., Nat Genet 15:345, 1997). Useful viral vectors include vectors that reverse transcribe viruses, adenoviruses, adeno-associated viruses, herpes viruses, SV40, papillomaviruses, HBP EBV viruses, vaccinia virus vectors and vectors based on Semliki Forest virus (SFV). See Smith, Annu. Rev. Microbiol. 49:807, 1995 and Rosenfeld et al., Cell 68:143, 1992.

[0191] The choice of expression vector depends on the desired host cell in which it resides and in which it will be expressed. Generally, expression vectors contain a promoter operatively linked to the polynucleotide encoding the antibody chain or polypeptide that binds BCMA. In addition to the promoter, other regulatory elements may be required or necessary for efficient expression of the antibody chain or fragment that binds BCMA. These elements usually include a ribosome binding site or other sequences adjacent to the ATG initiation codon. Additionally, the efficiency of expression can be enhanced by incorporating enhancers that are applicable to the cell system used (see, e.g., Scharf et al., Results Probl. Cell Differ. 20:125, 1994 and Bittner et al., Meth. Enzymol., 153:516, 1987). For example, SV40 enhancers or CMV enhancers are used to enhance expression in mammalian host cells.

[0192] The expression vector may further provide a secretion signal sequence to form a fusion protein containing the BCMA-binding polypeptide. Alternatively, the antibody / polypeptide sequence that binds BCMA may be connected to the signal sequence prior to insertion into the vector. In a preferred embodiment, the signal peptide comprises the amino acid sequence shown in SEQ ID NO: 133. A vector for receiving sequences encoding the light and heavy chain variable domains of an antibody that binds BCMA may further encode a constant region or other moiety. Such a vector allows the variable region to be expressed in a fusion protein with the constant region, thereby resulting in the generation of a complete antibody or a fragment thereof. Typically, such a constant region is a human constant region, e.g., a human IgG1 Fc region. In a preferred embodiment, the Fc region fused to the variable region comprises the amino acid sequence shown in SEQ ID NO: 132.

[0193] Suitable host cells for cloning or expressing the vectors include prokaryotic or eukaryotic cells. For example, antibodies can be produced in bacteria, particularly if glycosylation and Fc effector functions are not required. For bacterial expression of antibody fragments and polypeptides, see, e.g., US5,648,237, US5,789,199 and US5,840,523. (See also the expression of antibody fragments in E. coli as shown in Charlton, KA, Methods in Molecular Biology, Vol. 248, Lo, BKC (ed.), Humana Press, Totowa, NJ (2003), pp. 245-254). After expression, the antibody can be isolated from the bacterial cell paste in a soluble fraction and further purified. Besides prokaryotes, eukaryotic microorganisms such as filamentous fungi or yeast are suitable cloning or expression hosts for antibody coding vectors, including fungal and yeast strains in which the glycosylation pathway has already been "humanized", resulting in the production of antibodies with a partially or completely human glycosylation mode. See Gerngross, Nat. Biotech. 22 (2004) 1409-1414 and Li, H. et al., Nat. Biotech (2006) 24: 210-215. Host cells for the expression of glycosylated antibodies can also be derived from multicellular organisms (invertebrates and vertebrates). Examples of invertebrate cells include plants and insect cells. Many baculovirus strains can be used in combination with insect cells, in particular already identified for transfection of Spodoptera frugiperda cells. Plant cell cultures can also be used as hosts. For example, US 5,959,177, US 6,040,498, US 6,420,548, US 7,125,978 and US 6,417,429 (PLANTIBODIES FOR PRODUCING ANTIBODIES IN TRANSGENIC PLANTS) TM(which describes the technique) Vertebrate cells useful as hosts include, for example, any available mammalian cell line adapted to growth in suspension. Other examples of useful mammalian host cell lines are SV40 transformed monkey kidney CV1 line (COS-7), human embryonic kidney line (293 or 293 cells as described, for example, in Graham, FL et al., J. Gen Virol. 36 (1997) 59), baby hamster kidney cells (BHK); mouse Sertoli cells (for example, TM4 cells as described, for example, in Mather, JP, Biol. Reprod. 23 (1980) 243-251), monkey kidney cells (CV1), African green monkey kidney cells (VERO-76), human cervical carcinoma cells (HELA), dog kidney cells (MDCK), Buffalo rat hepatocytes (BRL 3A), human lung cells (W138), human hepatocytes (Hep G2), mouse mammary tumor cells (MMT 060562), TRI cells, for example, in Mather, JP et al., Annals NYAcad. Sci. 383 (1982) 44-68, MRC 5 cells, and FS4 cells. Other useful mammalian host cell lines include Chinese hamster ovary (CHO) cells, - These include CHO cells (Urlaub, G. et al., Proc. Natl. Acad. Sci. USA 77 (1980) 4216-4220) and myeloma cell lines such as Y0, NS0 and Sp2 / 0. For a review of some mammalian host cell lines suitable for producing antibodies, see, e.g., Yazaki, P. and Wu, AM, Methods in Molecular Biology, Vol. 248, Lo. BKC (ed.), Humana Press, Totowa, NJ (2004) pp. 255-268. In some preferred embodiments, mammalian host cells are used to express and produce the polypeptides of the antibodies of the invention that bind BCMA.

[0194] D. Antibody Selection, Identification, and Characterization The anti-BCMA antibodies provided in the present application may be selected, identified or characterized for their physical / chemical properties and / or biological activity by various tests known in the art.

[0195] Yeast that bind with high affinity to a target antigen of interest can be selected from a yeast display library expressing a human antibody. Many methods exist for rendering or displaying antibodies or antibody fragments on the surface of yeast and screening libraries, see e.g. US20110076752A1, US9845464B2, Boder and Wittrup, 1997, Nat. Biotechnol., 15, 553-557, Blasie et al. 2004, Gene, 342, 211-218, Sazinsky et al. 2008, Proc. Natl. Acad. Sci. USA, 105, 20167-20172, Tasumi et al. 2009, Proc. Natl. Acad. Sci. USA, 106, 12891-12896, Kontermann and Dubel, 2010, Antibody Engineering, Springer Protocols, Kuroda and Ueda 2011, Biotechnol.Lett., 33, 1-9; Rakestraw et al. 2011, PEDS, 24, 525-530; Shao Rong et al. (eds.), Antibody Drug Research and Application, People's Health Press (2013). For example, yeast display library selection can be performed by the following non-limiting method, first, it can be selected by magnetic bead sorting (MACS). For example, yeast populations that render IgG or antibody fragments can be contacted with biotinylated target antigens for a while, then washed and incubated with streptavidin magnetic beads (obtained from Miltenyi, Biotec), and yeast cells that bind to the target antigens are enriched by acquiring them on LS magnetic columns (obtained from Miltenyi, Biotec). Then, it can be enriched multiple times by FACS technology.In FACS sorting, yeast colonies are contacted with decreasing concentrations of biotinylated target antigen (to select for high affinity antibodies) or antigen homologs from different species (to select for antibodies with a propensity for cross-reactivity with different species), the cells are then washed and resuspended in a binary standard solution (e.g., containing a mixture of streptavidin-PE and anti-human LC-FITC), incubated on ice, the cells are washed and resuspended in a buffer such as FACS wash buffer, and yeast cells that are LC-FITC positive (IgG rendering) and streptavidin-PE positive (target binding) are sorted into a flow cytometer such as a FACSAria (BD Bioscience) for further growth and selection. In FACS sorting, instead of the target antigen and IgG rendering yeast, a negative selection reagent, such as the multispecific reagent (PSR) described in Xu et al. (Protein Engineering, Design & Selection, 2013, Vol. 26, No. 10, pp. 663-670), can also be used for incubation, and the same two-type standard and FACS sorting as above can be used to weaken the non-specific binding of the antibody and the subsequent druggability problem.

[0196] For antibody identification, the antibodies of the present invention can be identified or characterized by their antigen-binding activity, for example, by known methods such as ELISA, αLISA, Western blotting, antibody or inverter arrays, and the like, and the methods described in the Examples.

[0197] For example, antibodies can be dropped onto a glass or nitrocellulose chip. The slide is incubated with a solution containing BCMA, washed to remove unbound antibodies, and bound antibodies are detected with corresponding fluorescently marked secondary antibodies. The fluorescent signal is measured with a fluorescent slide scanner. Analogously, for inverter arrays, recombinant BCMA, cell supernatants, cell or tissue lysates, body fluids, etc. are dropped onto a glass or nitrocellulose chip. The slide is sealed and the array is incubated with an antibody against a given epitope on BCMA. Unbound antibodies are washed, and bound antibodies are detected with corresponding fluorescently marked secondary antibodies. The fluorescent signal is measured with a fluorescent slide scanner (Dernick, G. et al., J. Lipid Res., 52 (2011) 2323-2331).

[0198] Antibodies can be detected by the ForteBio measurement method. ForteBio affinity measurement can be performed according to existing methods (Estep, P et al., High throughput solution based measurement of antibody-antigen affinity and epitope binning. MAbs, 2013.5(2):p.270-8). For example, the AHQ sensor is equilibrated under the midline of the analysis buffer for 30 minutes, then detected above the midline for 60 seconds to establish a baseline. Then, the AHQ sensor with purified antibody in the midline of the analysis buffer is exposed to 100 nM antigen for 5 minutes, and the sensor is transferred to the analysis buffer and measured under the midline of the analysis buffer for 5 minutes. Kinetic analysis is performed using a 1:1 binding model.

[0199] Binding of antibodies to cells expressing BCMA on their surface can also be detected by flow cytometry. For example, BCMA-expressing H929 cells can be incubated with a series of diluted antibodies in PBS 1% BSA on ice for a period of time (e.g., 30 min). Then, the cells can be incubated with a secondary antibody (e.g., a phycobilin-marked secondary antibody) in PBS 1% BSA on ice for a period of time (e.g., 30 min). After washing the cells, the cells are analyzed by flow cytometry. Flow cytometry is performed on an Accuri C6 system (BD Biosciences) and EC50 values ​​are calculated by Graphpad software.

[0200] E. Fusions and Conjugates In another aspect, the present invention provides a fusion or conjugate comprising the antibody of the present invention. The fusion or conjugate can be generated by fusing or conjugating the antibody of the present invention to a heterologous molecule. In some embodiments, the polypeptide of the antibody of the present invention can be fused or conjugated to one or more heterologous molecules, including, but not limited to, proteins / polypeptides / peptides, markers, drugs and cytotoxic agents. Methods for fusing or conjugating proteins, polypeptides or peptides or chemical molecules to antibodies are known in the art. See, for example, U.S. Patent Nos. 5,336,603, 5,622,929 and EP 367,166.

[0201] In one embodiment, an antibody of the invention is recombinantly fused with a heterologous protein or polypeptide or peptide to form a fusion protein, hi another embodiment, an antibody of the invention is conjugated to a proteinaceous or non-proteinaceous molecule to form a complex.

[0202] In some embodiments, the antibodies of the present invention, in the form of full-length antibodies or antibody fragments, can be fused or conjugated to heterologous molecules. In a preferred embodiment, the single-chain scFv antibodies of the present invention are used for fusion or conjugation. In a further preferred embodiment, a fusion protein comprising the single-chain scFv of the present invention is provided. Such a fusion protein can be easily produced by recombinant methods known in the art. In another preferred embodiment, a complex comprising the single-chain scFv of the present invention is provided, for example a complex comprising the scFv of the present invention and a non-protein drug molecule.

[0203] Linkers are used to covalently connect different entities in the fusions and / or conjugates of the present invention. Linkers include chemical linkers or single-chain peptide linkers. In some embodiments, the single-chain antibodies of the present invention, such as scFv antibodies, are fused to other peptide fragments or proteins by peptide linkers. In some embodiments, the single-chain antibodies of the present invention, such as scFv antibodies, are joined to other molecules, such as markers or drug molecules, by chemical linkers.

[0204] The peptide linker for forming the present invention comprises a peptide consisting of amino acid residues. Such linker peptides are usually flexible, and the antigen-binding moiety connected thereto, such as scFv, can move independently. The length of the linker peptide can be easily determined by a person skilled in the art according to the actual situation, for example, the length is at least 4 to 15 amino acids, or longer, for example, about 20 to 25 amino acids.

[0205] Chemical linkers for forming the present invention include, for example, each coupling agent. Illustrative examples of coupling agents include N-succinimide-3-(2-pyridyl disulfide group) propionic acid ester (SPDP), succinimide-4-(N-maleimidomethyl) cyclohexane-1-carboxylic acid ester (SMCC), iminothiolane (IT), bifunctional derivatives of imide acid ester (e.g., hexadiimidate dimethyl HCl), activated esters (e.g., octanedioic acid disuccinimide ester), aldehydes (e.g., glutaraldehyde), diazo compounds (e.g., bis(p-azidobenzoyl)hexanediamine), bis-diazo derivatives (e.g., bis-(p-diazoniumbenzoyl)-ethylenediamine), diisocyanates (e.g., toluene 2,6-diisocyanate) and biactive fluoro compounds (e.g., 1,5-difluoro-2,4-dinitrobenzene). Alternatively, the linker can be a "cytolytic linker" that aids in the release of the polypeptide after delivery to the target site. For example, an acid-labile linker, a peptidase-sensitive linker, a photolabile linker, a dimethyl linker, or a disulfide-containing linker (Chari et al., Cancer Research 52 (1992) 127-131; US ​​5,208,020) can be used.

[0206] F. Methods and Compositions for Diagnosis and Detection In one aspect, the present invention provides diagnostic and detection uses of the anti-BCMA antibodies, fusions or conjugates of the present invention. Any of the anti-BCMA antibodies, fusions or conjugates provided in this application can be used to detect the presence of human BCMA in a biological sample. The term "detection" as used in this application includes quantitative or qualitative detection. Exemplary detection methods include, but are not limited to, immunohistochemistry, immunocytochemistry, flow cytometry (e.g., FACS), magnetic beads conjugated with antibody molecules, ELISA assays, PCR-techniques (e.g., RT-PCR). In some embodiments, the biological sample comprises a body fluid, cell or tissue. In some embodiments, the biological sample is blood, serum or other liquid sample derived from an organism.

[0207] In one embodiment, a method is provided for the diagnosis or detection of an anti-BCMA antibody, fusion or conjugate. In a further aspect, a method is provided for detecting the presence of BCMA in a biological sample. In some embodiments, the method comprises contacting the biological sample with an anti-BCMA antibody, fusion or conjugate described herein under conditions that permit the anti-BCMA antibody, fusion or conjugate to bind to BCMA, and detecting whether a complex forms between the anti-BCMA antibody, fusion or conjugate and BCMA. Such a method may be an in vitro or in vivo method. In some embodiments, the anti-BCMA antibody, fusion or conjugate is used to select subjects suitable for anti-BCMA antibody therapy, for example, where BCMA is used as the patient's biological marker of choice. Exemplary conditions that can be diagnosed using the antibodies, fusions or conjugates of the invention include B cell related diseases, e.g., multiple myeloma. In some embodiments, a method of classifying a multiple myeloma (MM) patient with an antibody, fusion or conjugate of the invention is provided, the method comprising determining whether the patient's B cells, preferably malignant B cells, express BCMA protein on the surface of the B cells, and if the B cells express BCMA protein on their surface, the patient may be treated accordingly with a therapeutic agent (e.g., an anti-BCMA antibody) that targets BCMA. In some embodiments, the anti-BCMA antibody may be conjugated to a diagnostic or detectable agent. In some embodiments, the invention provides a reagent kit for diagnosis or detection comprising any of the anti-BCMA antibodies, fusions or conjugates of the invention.

[0208] G. Treatment Methods and Compositions In another aspect, the invention relates to a method for treating a B-cell related disorder comprising administering to said subject an effective amount of an antibody or antigen-binding fragment thereof according to the invention, or a fusion or conjugate of the invention.

[0209] The terms "individual" or "subject" can be used interchangeably and refer to a mammal. Mammals include, but are not limited to, domestic animals (e.g., cows, goats, cats, dogs and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats). In particular, the subject is a human.

[0210] The term "treatment" refers to a clinical intervention that seeks to alter the natural course of a disease in the individual being treated. Desired therapeutic effects include, but are not limited to, preventing the appearance or recurrence of a disease, alleviating symptoms, reducing any direct or indirect pathological consequences of a disease, preventing metastasis, reducing the rate of disease progression, improving or ameliorating the disease state, and alleviating or improving prognosis.

[0211] B cell related disorders are conditions associated with abnormal B cell activity and include, but are not limited to, B cell malignancies, plasma cell malignancies, and autoimmune diseases. Exemplary conditions that can be treated using BCMA antibodies include, for example, multiple myeloma, non-Hodgkin's lymphoma, B-cell proliferation of undetermined grade, lymphomatoid granulomatosis, post-transplant lymphoproliferative disease, immunomodulatory diseases, rheumatoid arthritis, myasthenia gravis, idiopathic thrombocytopenic purpura, antiphospholipid syndrome, Chagas' disease, Graves' disease, Wegener's granulomatosis, polyarteritis nodosa, Sjogren's syndrome, pemphigus vulgaris, scleroderma, multiple sclerosis, ANCA-associated vasculitis, Goodpasture's disease, Kawasaki disease, autoimmune hemolytic anemia and rapidly progressive glomerulonephritis, heavy chain disease, primary or immune cell-associated amyloid degeneration, or monoclonal gammopathy of undetermined significance, systemic lupus erythematosus, and rheumatoid arthritis.

[0212] As shown in the Examples, the inventors construct the antibodies of the invention based on antibody sequences selected from a human antibody library. Thus, advantageously, in some embodiments, the antibodies of the invention are fully human antibodies comprising amino acid sequences of a fully humanized VH region and a fully humanized VL region, such as the antibodies shown in Table 1 and the scFv-Fc antibodies comprising single-chain scFvs and human hFc fragments composed thereof shown in Table 3. In some embodiments, the conjugates and fusions of the invention are fully human antibodies, such as conjugates and fusions comprising fully human single-chain scFvs. Thus, in a preferred aspect, the antibodies, fusions and conjugates of the invention are particularly adapted for human therapeutic applications. In some preferred embodiments, the antibodies, fusions and conjugates of the invention are used to treat human B-cell-related diseases, such as B-cell malignancies, preferably multiple myeloma (MM) or non-Hodgkin's lymphoma (NHL). In some embodiments, the anti-tumor effects of the anti-BCMA antibodies, fusions and conjugates of the invention include, but are not limited to, for example, a reduction in tumor volume, a reduction in tumor cell number, a reduction in tumor cell proliferation or tumor cell survival.

[0213] Multiple myeloma is a B-cell malignancy of mature plasma cells. In the bone marrow, clonal plasma cells grow abnormally and can invade neighboring bones and may invade the blood. Variant forms of multiple myeloma include overt multiple myeloma, smoldering multiple myeloma, plasma cell leukemia, nonsecretory multiple myeloma, IgD multiple myeloma, osteosclerotic myeloma, bone-isolated plasmacytoma, and extramedullary plasmacytoma. (See, for example, Braunwald et al. (eds.), Harrison's Principles of Internal Medicine, 15th ed. (McGraw-Hill 2001)).

[0214] There are several different types of non-Hodgkin's lymphoma. For example, non-Hodgkin's lymphoma can be divided into aggressive (fast growing) and indolent (slow growing). Non-Hodgkin's lymphoma (NHL) includes Burkitt's lymphoma, chronic lymphocytic leukemia / small lymphocytic lymphoma (CLL / SLL), diffuse large B-cell lymphoma, follicular lymphoma, immunoblastic large cell lymphoma, prosomal B-lymphoblastic lymphoma, and mantle cell lymphoma. Lymphomas that arise after bone marrow or stem cell transplantation are usually B-cell non-Hodgkin's lymphoma.

[0215] It should be understood that the BCMA antibodies, fusions and conjugates of the invention can be administered in combination with other therapeutic modalities to treat the above diseases, e.g., tumors, including therapeutic agents, radiation therapy, chemotherapy, transplantation, immunotherapy, etc. In some embodiments, the antibody molecules, fusions and conjugates of the invention are used in combination with other therapeutic agents. Exemplary therapeutic agents include cytokines, growth factors, steroids, NSAIDs, DMARDs, anti-inflammatory agents, chemotherapeutic agents, radiation therapy agents, therapeutic antibodies, or other active and adjuvant agents, e.g., anti-tumor drugs.

[0216] H. Compositions and Formulations The present invention further contemplates compositions comprising any one or more of the BCMA binding antibody molecules, fusions and conjugates, polynucleotides, vectors, or host cells of the present application. Compositions include, but are not limited to, pharmaceutical compositions. Pharmaceutical compositions can be administered to cells or animals alone or in combination with one or more other forms of treatment.

[0217] Pharmaceutical formulations of the antibodies, fusions and conjugates of the present invention can be prepared, for example, in the form of a lyophilized formulation or aqueous solution by mixing the antibodies, fusions and conjugates having the desired purity with one or more suitable pharma- ceutical acceptable vectors (Remington's Pharmaceutical Science, 16th ed., Osol, A. (Ed.) (1980)). Pharmaceutically acceptable vectors are generally non-toxic to recipients at the amounts and concentrations employed, and contain no additives such as buffers, such as phosphates, citrates and other organic acids; antioxidants, including ascorbic acid and methionine; preservatives (e.g., octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride; benzethonium chloride; benzenephenol, butanol or benzyl alcohol; alkyl p-hydroxybenzoates, such as methyl p-hydroxybenzoate or propyl p-hydroxybenzoate; catechol; resorcinol; cyclohexanol; 3-pentanol and m-cresol), low molecular weight (about 10 or less residues). hydrophilic polymers such as poly(vinylpyrrolidone); amino acids such as glycine, glutamine, asparaginase, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose, or sorbitol; salt-forming counterions such as sodium; metal complexes (e.g., Zn-protein complexes); and / or non-ionic surfactants such as polyethylene glycol (PEG).

[0218] Exemplary lyophilized antibody formulations are described in US 6,267,958. Aqueous antibody formulations include those described in US 6,171,586 and WO 2006 / 044908, the following formulations containing a histidine-acetate buffer.

[0219] The formulations herein may further comprise one or more active ingredients as necessary for the given indication being treated, preferably having active ingredients with complementary activities and which do not adversely affect each other, such active ingredients being present in suitable combinations in amounts effective for the intended purpose.

[0220] The following examples are set forth to aid in the understanding of the present invention, and should not be construed as limiting the scope of protection of the present invention in any manner. EXAMPLES

[0221] Example 1. Selection of anti-BCMA fully humanized antibodies using yeast display technology Yeast display technology has increased total diversity to 1 × 10 8 A fully humanized antibody that specifically binds to BCMA will be selected from six larger synthetic antibody libraries (library design and construction can be found in WO2009036379, WO2010105256, WO2012009568). In summary, the selection process was completed as follows: the first round of selection was completed by screening six different synthetic antibody libraries with recombinant human BCMA fused to Fc marked with biotin by magnetic bead separation method (MACS); the second round of selection was completed with monkey and mouse BCMA fused to Fc by flow cytometry (FACS) basically according to the method of Chao et al. Nature Protocols, 2006; in the third round of selection, the antibodies in the antibody library were negatively selected using multispecific reagents (PSR) by FACS technology basically according to the description of Xu et al. Protein Engineering, Design & Selection, 2013 to weaken the non-specific binding and subsequent druggability problems of the antibodies; the fourth round of selection was completed by FACS technology with His-labeled humanized BCMA monoclonal protein; and the last round of selection was completed by FACS technology to enrich for human, monkey and mouse BCMA-specific antibodies respectively.

[0222] Mass production optimization is a common step in the initial selection. In short, the heavy chain region of the antibody population enriched in the initial selection (the diversity at this stage is 10 3 ~10 4 The process is completed by isolating the light chain fragments (located between the 100 and 1500 bp) and recombining them with a library of natural human light chain sequences in yeast. This process is called light chain batch shuffle (LCBS), and ultimately produces a diversity of heavy / light chain pairings with humanized BCMA binding propensity of 100–1500 bp. 7 ~10 8 The antibody library is then further enriched for human, monkey and mouse BCMA specific antibodies through one round of magnetic bead selection and four rounds of flow cytometry selection as described in the above paragraph. As described above, in this process, human, monkey and mouse BCMA Fc fusion proteins and His-tagged humanized BCMA monoclonal protein are used for positive selection, and PSR is used for negative selection.

[0223] After completing the above selection process, the yeast colonies containing the enriched specific antibody sequences are spread on an agar plate to obtain yeast monoclonal colonies containing the desired antibody genes. The clones are taken and their variable regions are ranked by the Sanger method, and approximately 460 unique H3:L3 antibodies (i.e., antibodies with unique heavy chain CDR3 and light chain CDR3 region pairs) are identified. The yeast are then expressed and purified by protein A affinity chromatography to obtain some of the antibodies.

[0224] The binding ability of these antibodies to multiple recombinant BCMA proteins, BCMA stable recombinant CHO-S cell lines, and BCMA positive tumor cell line NCI-H929 was further measured, and finally 10 clones with good affinity to NCI-H929 were obtained for further analysis. These antibodies were also shown to have a certain cross-reactivity with monkey BCMA. The amino acid sequences and corresponding nucleotide sequences of the antibody molecules of these 10 clones are shown in Table 1 above.

[0225] Example 2. Verification of affinity between yeast-expressed antibodies and NCI-H929 cells Further cell binding verification will be performed by flow cytometry for the yeast-expressed antibodies with good affinity to the above 10 strains of NCI-H929 and one strain of antibody (ADI-34819) with no affinity to NCI-H929 (as a negative control). The specific method is as follows. 1. Take human NCI-H929 (ATCC, CRL-9068) cells and dilute them to a density of 2 × 10 6 / ml, 100 μl of the solution is placed in each well of a 96-mesh microplate, centrifuged at 400 G for 5 minutes, and the supernatant is removed. 2. Continue diluting the anti-BCMA antibody from 400 nM concentration into PBS containing 0.1% bovine serum albumin (BSA) in a 3-fold gradient until a total of 12 spots are achieved, and 100 μl of diluted antibody is placed on each mesh and incubated at 4°C for 30 min. 3. Centrifuge at 400G for 5 minutes, wash twice with PBS, and then add secondary antibody (sheep anti-human IgG antibody marked with phycoerythrin (PE), SouthernBiotech, final concentration 5μg / ml) diluted in 100μl of PBS (1% BSA) to each mesh and incubate at 4℃ for 30 minutes (avoid light). 4. Centrifuge at 400G for 5 min, wash twice with PBS, and resuspend the cells in 100 μl PBS for each mesh. Perform flow cytometry on Accuri C6 system (BD Bioscience) to detect PE positive signals, and calculate MFI based on C6 software. Calculate EC50 value with GraphPad software.

[0226] The detection results are shown in Figure 1 and Table 4 below. The experimental results confirmed that the 10 antibodies all had strong affinity with NCI-H929 cells at a concentration of 400nM, and the affinity between the antibodies and NCI-H929 gradually weakened with the dilution of the antibody concentration.

[0227] [Table 6]

[0228] Example 3. Construction of expression vector for scFv-hFc recombinant single-chain antibody To verify the affinity of the candidate antibodies in the form of scFv to the target, expression vectors of recombinant proteins of the single chain antibody variable region (scFv) and human Fc fragment of each of the above 10 antibody strains are constructed. At the same time, expression vectors of recombinant single chain antibody of ADI-34819 antibody (as negative control) and expression vectors of recombinant single chain antibody of huBCMA-10 sequence published in US20170226216 A1 (as standard control) are also constructed. The amino acid sequences of these constructed scFv-Fc recombinant proteins and their corresponding coding nucleotide sequences are shown in Table 3 above.

[0229] An expression vector is constructed to express the scFv-Fc recombinant protein shown in Table 3. In short, the pDD1-hFc vector (pDD1-hFc vector is based on pTT5 vector and constructed by inserting the signal peptide and hFc coding gene) with mouse kappa light chain signal peptide (METDTLLLWVLLLWVPGSTG, SEQ ID NO: 133, number sequence ATGGAGACCGACACCCTGCTGCTCTGGGTCCTGCTGC TGTGGGT GCCCG GATCCACAGGA, SEQ ID NO: 134) and human IgG1 Fc number sequence (SEQ ID NO: 132) is restricted by endonuclease, and the scFv sequence synthesized by the method of homologous recombination is cloned between the light chain signal peptide and the hFc coding gene to form a fusion expression. Figure 2 is a schematic diagram showing the construction of the vector.

[0230] Example 4. Expression of scFv-hFc recombinant single chain antibody Culture HEK293 cells according to the required transfection volume and adjust the cell density to 1.2 x 10 on the day before transfection. 6 Adjust to / ml. Take 1.3 mL OptiMEM medium (Gibco, 31985-070) as a transfection buffer, mix 30 μg of the plasmid carrying the coding gene of the corresponding scFv-hFc recombinant single chain antibody to homogeneity, filter and leave for 5 minutes. 2. Add 90 μL of 1 mg / mL polyethyleneimine (PEI) (Polysciences, 23966) to the plasmid-OptiMEM mixture, mix until homogenous, and incubate at room temperature for 15 min. Gently add the mixture to the cells and incubate at 36.5°C and 8% CO2. After 3.20 h, add 0.6 mL of 200 g / L FEED (soy peptone Phytone Peptone (BD, 211906) and plant peptone Phytone (BD, 210931) in equal proportions), 0.3 mL of 200 g / L glucose mother solution, and 30 μL of 2.2 M valproic acid sodium salt (VPA) (Sigma, P4543). 4. Continue culturing until the vitality is lower than 60%, collect the supernatant, filter and purify by affinity chromatography.

[0231] Example 5. Purification of scFv-hFc recombinant single-chain antibody by Protein A method 1. Wash the filler and gravity column with ultrapure water to remove the filler protection solution. 2. Permeabilize the gravity columns and fillers with 0.1 M NaOH for 2 h. Add 300 μL Protein A Affinity Chromatography Media (Mabselect sure) (GE Healthcare, 17-5438-03) filler to each gravity column. 3. The cell component solution is centrifuged at 8000 r / min for 40 minutes, filtered again through a 0.45 μm filter, and stored at 4° C. until ready for use. 4. Wash the gravity column and filler with a large amount of ultrapure water to remove the alkaline solution. 5. Prior to purification, equilibrate the filler with 10 ml binding / wash buffer (20 mM Tris + 150 mM NaCl, pH 7.2). 6. The sample is loaded and the supernatant to be purified passes through the column. 7. Wash the filler with 5-10 ml binding / wash buffer (20 mM Tris + 150 mM NaCl (pH 7.2)) to remove non-specifically bound proteins. 8. Wash the filler with 1 mL of Lease Buffer (100 mM sodium citrate / citric acid buffer, pH 3.5) to collect specific bound proteins. 9. Add neutralization buffer (2M Tris) to the harvested fluid at a ratio of 85 μl / ml and adjust the pH to 6-7.

[0232] Example 6. Fortebio detection of scFv-hFc recombinant single chain antibodies Based on the biofilm layer optical interference technique (BLI) of optical fiber biosensor, the kinetic constants of antibody molecules are measured.

[0233] The basic principle of BLI is that when a biological molecule binds to the surface of the sensor, it forms a biological film, which causes interference in the waveform of the light passing through the sensor. The interference is detected in the form of phase shift, thereby detecting the change in the number of molecules bound to the sensor. The kinetic curve is fitted according to the change in the real-time response value, and the binding constant (Kon), dissociation constant (Kdis), and affinity (KD) are calculated.

[0234] The Fortebio equipment number used in the experiment is Octet Red96, and the ForteBio affinity measurement is performed according to the conventional method (Estep, P et al., High throughput solution Based measurement of antibody-antigen affinity and epitope binning. MAbs, 2013.5(2):p.270-8). The specific flow is as follows:

[0235] 1. 30 minutes before the experiment begins, take an appropriate amount of AHC Sensor depending on the amount of sample, and soak it in SD buffer (50 ml PBS + 0.1% BSA + 0.05% Tween-20). 2. Take 100 μl of SD buffer, scFv-hFc antibody, and human BCMA-His antigen (ACRO BIOSYSTEMS, BCA-H522Y) and place them into a 96-mesh black polystyrene half microplate. 3. Arrange the microplate according to the position of the sample, select the sensor position, set the operating steps and time, and set the baseline, loading ~ 1 nm, baseline, association and dissociation times according to the binding and dissociation rates of the sample. The rotation speed is 1000 rpm, and the temperature is 30 ° C. 4. Table 5 shows the results of detecting the affinity of 10 scFv-hFc recombinant single chain antibodies with human BCMA-His.

[0236] [Table 7] Reference scFv-Fc* is the affinity level of scFv-hFc recombinant protein (see Example 3, SEQ ID NO: 131) composed of scFv in the BCMA-10 sequence of US20170226216A1.

[0237] From the data in the above table, the affinities (KD values) of the 10 single chain antibodies and monovalent humanized BCMA (BCMA-His) are all equivalent to the affinities of the reference single chain antibodies and BCMA-His. Among them, the affinities of the two single chain antibodies, ADI-34857 and ADI-34860, between BCMA-His and the antibody are closest to that of the reference single chain antibody.

[0238] Example 7. Detection of affinity between scFv-hFc recombinant single chain antibody and NCI-H929 After the production of the scFv-hFc fusion antibody is completed, the affinity of the antibody with NCI-H929 is verified as follows. 1. Take human NCI-H929 (ATCC, CRL-9068) cells and dilute them to a density of 2 × 10 6 / ml, 100 μl of the solution is placed on each mesh of a 96-mesh microplate, centrifuged at 400 G for 5 minutes, and the supernatant is removed. 2. The scFv-hFc antibody is diluted in a 3-fold gradient from a concentration of 400 nM into PBS containing 0.1% bovine serum albumin (BSA) until a total of 12 spots are formed, and 100 μl of the diluted antibody is added to each mesh and incubated at 4° C. for 30 minutes. 3. Centrifuge at 400G for 5 minutes, wash twice with PBS, and then add secondary antibody (phycoerythrin (PE)-marked sheep anti-human IgG antibody, SoutherBiotech, final concentration 5μg / ml) diluted in 100μl of PBS (1% BSA) to each mesh and incubate at 4℃ for 30 minutes (avoid light). 4. Centrifuge at 400G for 5 min, wash twice with PBS, and resuspend the cells in 100 μl PBS for each mesh. Perform flow cytometry on Accuri C6 system (BD Bioscience) to detect PE positive signals, and calculate MFI based on C6 software. Calculate EC50 value with GraphPad software.

[0239] The detection results are shown in Figure 3 and Table 6 below. The results in the figure show that in addition to the ADI-34846 single chain antibody, the affinity (EC50 value) of other single chain antibodies with NCI-H929 cells is superior to that of the reference single chain antibody with NCI-H929 cells.

[0240] [Table 8]

Claims

1. 1. An isolated antibody or antigen-binding fragment thereof that specifically binds to B-cell maturation antigen (BCMA), comprising: (i) the HCDR1, HCDR2 and HCDR3 sequences of a heavy chain variable region as set forth in SEQ ID NO: 27, and the LCDR1, LCDR2 and LCDR3 sequences of a light chain variable region as set forth in SEQ ID NO: 71; (ii) the HCDR1, HCDR2 and HCDR3 sequences of the heavy chain variable region set forth in SEQ ID NO: 27, and the LCDR1, LCDR2 and LCDR3 sequences of the light chain variable region set forth in SEQ ID NO: 72; (iii) the HCDR1, HCDR2 and HCDR3 sequences of the heavy chain variable region set forth in SEQ ID NO: 27, and the LCDR1, LCDR2 and LCDR3 sequences of the light chain variable region set forth in SEQ ID NO: 59; (iv) the HCDR1, HCDR2 and HCDR3 sequences of the heavy chain variable region as set forth in SEQ ID NO:5, and the LCDR1, LCDR2 and LCDR3 sequences of the light chain variable region as set forth in SEQ ID NO:41; (v) the HCDR1, HCDR2 and HCDR3 sequences of a heavy chain variable region as set forth in SEQ ID NO:5, and the LCDR1, LCDR2 and LCDR3 sequences of a light chain variable region as set forth in SEQ ID NO:42; (vi) the HCDR1, HCDR2 and HCDR3 sequences of the heavy chain variable region as set forth in SEQ ID NO: 4, and the LCDR1, LCDR2 and LCDR3 sequences of the light chain variable region as set forth in SEQ ID NO: 31; (vii) the HCDR1, HCDR2 and HCDR3 sequences of the heavy chain variable region as set forth in SEQ ID NO: 10, and the LCDR1, LCDR2 and LCDR3 sequences of the light chain variable region as set forth in SEQ ID NO: 46; (viii) the HCDR1, HCDR2 and HCDR3 sequences of the heavy chain variable region set forth in SEQ ID NO: 17, and the LCDR1, LCDR2 and LCDR3 sequences of the light chain variable region set forth in SEQ ID NO: 58; or (ix) the HCDR1, HCDR2 and HCDR3 sequences of the heavy chain variable region set forth in SEQ ID NO: 23, and the LCDR1, LCDR2 and LCDR3 sequences of the light chain variable region set forth in SEQ ID NO: 64; The antibody or antigen-binding fragment thereof.

2. 1. An isolated antibody or antigen-binding fragment thereof that specifically binds to B-cell maturation antigen (BCMA), wherein the antibody comprises the following three heavy chain complementarity determining regions (HCDRs) and three light chain complementarity determining regions (LCDRs): (a) an HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:24, an HCDR2 comprising the amino acid sequence set forth in SEQ ID NO:25, an HCDR3 comprising the amino acid sequence set forth in SEQ ID NO:26, an LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:65, an LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:62, and an LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:68; (b) an HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:24, an HCDR2 comprising the amino acid sequence set forth in SEQ ID NO:25, an HCDR3 comprising the amino acid sequence set forth in SEQ ID NO:26, an LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:66, an LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:62, and an LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:69; (c) an HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:24, an HCDR2 comprising the amino acid sequence set forth in SEQ ID NO:25, an HCDR3 comprising the amino acid sequence set forth in SEQ ID NO:26, an LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:52, an LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:62, and an LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:56; (d) an HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:1, an HCDR2 comprising the amino acid sequence set forth in SEQ ID NO:2, an HCDR3 comprising the amino acid sequence set forth in SEQ ID NO:3, an LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:32, an LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:35, and an LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:38; (e) an HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:1, an HCDR2 comprising the amino acid sequence set forth in SEQ ID NO:2, an HCDR3 comprising the amino acid sequence set forth in SEQ ID NO:3, an LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:33, an LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:36, and an LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:39; (f) an HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:1, an HCDR2 comprising the amino acid sequence set forth in SEQ ID NO:2, an HCDR3 comprising the amino acid sequence set forth in SEQ ID NO:3, an LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:28, an LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:29, and an LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:30; (g) HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:7, HCDR2 comprising the amino acid sequence set forth in SEQ ID NO:8, HCDR3 comprising the amino acid sequence set forth in SEQ ID NO:9, LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:32, LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:44, and LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:45; (h) an HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 11, an HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 12, an HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 14, an LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 51, an LCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 54, and an LCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 55, or (i) HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 20, HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 21, HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 22, LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 61, LCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 62, and LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:

63. The antibody or antigen-binding fragment thereof.

3. The antibody, (a) a VH comprising an amino acid sequence of SEQ ID NO:27, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity to SEQ ID NO:27, or an amino acid sequence having 10 or less or 5 or less amino acid mutations relative to SEQ ID NO:27; (b) a VH comprising an amino acid sequence of SEQ ID NO:5, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity to SEQ ID NO:5, or an amino acid sequence having 10 or less or 5 or less amino acid mutations relative to SEQ ID NO:5; (c) a VH comprising an amino acid sequence of SEQ ID NO: 4, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity to SEQ ID NO: 4, or an amino acid sequence having 10 or less or 5 or less amino acid mutations relative to SEQ ID NO: 4; (d) a VH comprising an amino acid sequence of SEQ ID NO: 10, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity to SEQ ID NO: 10, or an amino acid sequence having 10 or less or 5 or less amino acid mutations relative to SEQ ID NO: 10; (e) a VH comprising an amino acid sequence of SEQ ID NO: 17, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity to SEQ ID NO: 17, or an amino acid sequence having 10 or less or 5 or less amino acid mutations relative to SEQ ID NO: 17; and (f) a VH comprising an amino acid sequence of SEQ ID NO:23, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity to SEQ ID NO:23, or an amino acid sequence having 10 or less or 5 or less amino acid mutations relative to SEQ ID NO:

23. The antibody or antigen-binding fragment thereof according to claim 1 or 2, comprising a heavy chain variable region VH selected from the group consisting of:

4. The antibody, (a) a VL comprising an amino acid sequence of SEQ ID NO: 71, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity to SEQ ID NO: 71, or an amino acid sequence having 10 or less or 5 or less amino acid mutations relative to SEQ ID NO: 71; (b) a VL comprising an amino acid sequence of SEQ ID NO: 72, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity to SEQ ID NO: 72, or an amino acid sequence having 10 or less or 5 or less amino acid mutations relative to SEQ ID NO: 72; (c) a VL comprising an amino acid sequence of SEQ ID NO:59, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity to SEQ ID NO:59, or an amino acid sequence having 10 or less or 5 or less amino acid mutations relative to SEQ ID NO:59; (d) a VL comprising an amino acid sequence of SEQ ID NO: 41, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity to SEQ ID NO: 41, or an amino acid sequence having 10 or fewer or 5 or fewer amino acid mutations relative to SEQ ID NO: 41; and (e) a VL of an amino acid sequence of SEQ ID NO: 42, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity to SEQ ID NO: 42, or an amino acid sequence having 10 or less or 5 or less amino acid mutations relative to SEQ ID NO: 42; (f) a light chain variable region VL selected from the VL of an amino acid sequence of SEQ ID NO: 31, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity to SEQ ID NO: 31, or an amino acid sequence having 10 or less or 5 or less amino acid mutations relative to SEQ ID NO: 31; (g) a VL of an amino acid sequence of SEQ ID NO: 46, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity to SEQ ID NO: 46, or an amino acid sequence having 10 or less or 5 or less amino acid mutations relative to SEQ ID NO: 46; (h) a VL of an amino acid sequence of SEQ ID NO:58, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity to SEQ ID NO:58, or an amino acid sequence having 10 or less or 5 or less amino acid mutations relative to SEQ ID NO:58; and (i) a VL of an amino acid sequence of SEQ ID NO: 64, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity to SEQ ID NO: 64, or an amino acid sequence having 10 or less or 5 or less amino acid mutations relative to SEQ ID NO: 64 The antibody or antigen-binding fragment thereof according to claim 1 or 2, comprising a light chain variable region VL selected from:

5. The antibody comprises a heavy chain variable region VH and a light chain variable region VL, the VH and VL comprising: (a) a VH comprising the amino acid sequence of SEQ ID NO: 27, and a VL comprising the amino acid sequence of SEQ ID NO: 71; (b) a VH comprising the amino acid sequence of SEQ ID NO: 27, and a VL comprising the amino acid sequence of SEQ ID NO: 72; (c) a VH comprising the amino acid sequence of SEQ ID NO: 27, and a VL comprising the amino acid sequence of SEQ ID NO: 59; (d) a VH comprising the amino acid sequence of SEQ ID NO:5, and a VL comprising the amino acid sequence of SEQ ID NO:41; (e) a VH comprising the amino acid sequence of SEQ ID NO:5, and a VL comprising the amino acid sequence of SEQ ID NO:42; (g) a VH having the amino acid sequence of SEQ ID NO: 10, and a VL having the amino acid sequence of SEQ ID NO: 46; (h) a VH having the amino acid sequence of SEQ ID NO: 17, and a VL having the amino acid sequence of SEQ ID NO: 58; and (i) a VH having the amino acid sequence of SEQ ID NO: 23, and a VL having the amino acid sequence of SEQ ID NO: 64; The isolated antibody or antigen-binding fragment thereof according to any one of claims 1 to 4, selected from:

6. The antibody has one or more of the following characteristics: (i) exhibits the same or similar binding affinity and / or specificity as any one of the antibodies shown in Table 1; (ii) inhibits the binding of any one of the antibodies shown in Table 1 to BCMA; (iii) binds to the same or an overlapping epitope as any one of the antibodies shown in Table 1; (iv) binds to BCMA competitively with any one of the antibodies shown in Table 1; and (v) has one or more biological properties of any one of the antibodies shown in Table 1. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 5, having the following structure:

7. The antibody has one or more of the following characteristics: (i) binds to human BCMA with a K value of less than 50 nM, less than 30 nM, or less than 10 nM; (ii) binds to human BCMA expressed on the surface of cells with an EC50 value of less than 50 nM, less than 40 nM, or less than 20 nM; (iii) 3 × 10 －２ s －１ Less than 1.5 x 10 －２ s －１ Less than 5 x 10 －３ s －１ Less than or 3 x 10 －３ s －１ binds to human BCMA with a dissociation rate constant (Kd) of less than (iv) specifically binds to an epitope in the extracellular domain (ECD) of human BCMA; and (v) inhibiting and suppressing the growth of and / or killing multiple myeloma cells expressing human BCMA. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 6, comprising:

8. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 7, wherein the antibody is a fully humanized antibody.

9. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 8, wherein the antibody is a single chain antibody.

10. The antibody according to any one of claims 1 to 9, wherein the antibody is a single-chain scFv antibody, and the single-chain scFv comprises, from the N-terminus to the C-terminus, a VL domain-linker-VH domain or a VH domain-linker-VL domain.

11. The antibody of claim 10, wherein the linker comprises from 1 to about 25 amino acids, from about 5 to about 20 amino acids, or from about 10 to about 20 amino acids.

12. The antibody of claim 11 , wherein the linker comprises the amino acid sequence of SEQ ID NO:

93.

13. The single chain scFv antibody, (a) an amino acid sequence of SEQ ID NO: 123, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity to SEQ ID NO: 123, or an amino acid sequence having at least 1, 2 or 3 and no more than 10 amino acid mutations relative to SEQ ID NO: 123; (b) an amino acid sequence of SEQ ID NO: 126, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity to SEQ ID NO: 126, or an amino acid sequence having at least 1, 2 or 3 and no more than 10 amino acid mutations relative to SEQ ID NO: 126; (c) an amino acid sequence of SEQ ID NO: 117, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity to SEQ ID NO: 117, or an amino acid sequence having at least 1, 2 or 3 and no more than 10 amino acid mutations relative to SEQ ID NO: 117; (d) an amino acid sequence of SEQ ID NO: 102, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity to SEQ ID NO: 102, or an amino acid sequence having at least 1, 2 or 3 and no more than 10 amino acid mutations relative to SEQ ID NO: 102; (e) an amino acid sequence of SEQ ID NO: 105, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity to SEQ ID NO: 105, or an amino acid sequence having at least 1, 2 or 3 and no more than 10 amino acid mutations relative to SEQ ID NO: 105; (g) an amino acid sequence of SEQ ID NO: 108, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity to SEQ ID NO: 108, or an amino acid sequence having at least 1, 2 or 3 and no more than 10 amino acid mutations relative to SEQ ID NO: 108; (h) the amino acid sequence of SEQ ID NO: 114, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity to SEQ ID NO: 114, or an amino acid sequence having at least 1, 2 or 3 and no more than 10 amino acid mutations relative to SEQ ID NO: 114; or (i) the amino acid sequence of SEQ ID NO: 120, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity to SEQ ID NO: 120, or an amino acid sequence having at least 1, 2 or 3 and no more than 10 amino acid mutations relative to SEQ ID NO: 120 The antibody according to any one of claims 10 to 12, comprising:

14. An isolated antibody that specifically binds to B-cell maturation antigen (BCMA), the antibody comprising a single chain scFv antibody and an Fc region according to any one of claims 10 to 13.

15. The antibody of claim 14, wherein the single chain scFv antibody is connected to the Fc region by a hinge region.

16. The antibody of claim 15, wherein the hinge region comprises an amino acid sequence set forth in SEQ ID NO:95, or an amino acid sequence having at least one, two or three amino acid mutations relative to the amino acid sequence of SEQ ID NO:95 and no more than five amino acid mutations.

17. The antibody of any one of claims 14 to 15, wherein the Fc region is a human IgG1 or IgG4 Fc region.

18. The antibody of claim 17, wherein the Fc region is hypo- or afucosylated.

19. The antibody, (a) an amino acid sequence of SEQ ID NO: 125, or an amino acid sequence having at least one, two or three and no more than ten or no more than five amino acid mutations relative to SEQ ID NO: 125, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity to SEQ ID NO: 125; (b) an amino acid sequence of SEQ ID NO: 128, or an amino acid sequence having at least one, two or three and no more than ten or no more than five amino acid mutations relative to SEQ ID NO: 128, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or more identity to SEQ ID NO: 128; (c) an amino acid sequence of SEQ ID NO: 119, or an amino acid sequence having at least one, two or three and no more than ten or no more than five amino acid mutations relative to SEQ ID NO: 119, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or more identity to SEQ ID NO: 119; (d) an amino acid sequence of SEQ ID NO: 104, or an amino acid sequence having at least one, two or three and no more than ten or no more than five amino acid mutations relative to SEQ ID NO: 104, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or more identity to SEQ ID NO: 104; (e) an amino acid sequence of SEQ ID NO: 107, or an amino acid sequence having at least one, two or three and no more than ten or no more than five amino acid mutations relative to SEQ ID NO: 107, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or more identity to SEQ ID NO: 107; (g) an amino acid sequence of SEQ ID NO: 110, or an amino acid sequence having at least one, two or three amino acid mutations and no more than ten or no more than five amino acid mutations relative to SEQ ID NO: 110, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or more identity to SEQ ID NO: 110; (h) an amino acid sequence of SEQ ID NO: 116, or an amino acid sequence having at least one, two or three and no more than ten or no more than five amino acid mutations relative to SEQ ID NO: 116, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity to SEQ ID NO: 116; or (i) an amino acid sequence of SEQ ID NO: 122, or an amino acid sequence having at least one, two or three amino acid mutations relative to SEQ ID NO: 122 and no more than ten or no more than five amino acid mutations, or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or more identity to SEQ ID NO: 122 The antibody according to any one of claims 14 to 18, comprising:

20. An isolated nucleic acid encoding the isolated antibody or antigen-binding fragment thereof of any one of claims 1 to 19.

21. A vector comprising the nucleic acid of claim 20.

22. A host cell comprising the vector of claim 21.

23. 23. A method for producing the isolated antibody or antigen-binding fragment thereof of any one of claims 1 to 19, comprising culturing a host cell of claim 22 under conditions suitable for expressing the antibody or antigen-binding fragment thereof.

24. A conjugate or fusion comprising an antibody according to any one of claims 1 to 19.

25. A pharmaceutical composition comprising an isolated antibody or antigen-binding fragment thereof according to any one of claims 1 to 19, or a conjugate or fusion according to claim 24, and optionally a pharma- ceutically acceptable carrier.

26. 1. A method for detecting BCMA in a sample, comprising: (a) contacting the sample with the isolated antibody or antigen-binding fragment thereof of any one of claims 1 to 19, or the complex or fusion of claim 24; and (b) detecting the formation of a complex between the antibody or antigen-binding fragment thereof, or a complex or fusion with a BCMA protein. The method comprising:

27. 26. The pharmaceutical composition of claim 25 for use as a medicament in the treatment of a B cell related disorder.

28. 28. The pharmaceutical composition of claim 27, wherein the B cell related disease is selected from a B cell malignancy, a plasma cell malignancy, and an autoimmune disease.

29. 28. The pharmaceutical composition of claim 27, wherein the B cell related disorder is selected from multiple myeloma, non-Hodgkin's lymphoma, B cell proliferation of undetermined grade, lymphomatoid granulomatosis, post-transplant lymphoproliferative disorder, immunomodulatory disorders, rheumatoid arthritis, myasthenia gravis, idiopathic thrombocytopenic purpura, antiphospholipid syndrome, Chagas disease, Graves' disease, Wegener's granulomatosis, polyarteritis nodosa, Sjogren's syndrome, pemphigus vulgaris, scleroderma, multiple sclerosis, ANCA-associated vasculitis, Goodpasture's disease, Kawasaki disease, autoimmune hemolytic anemia, rapidly progressive glomerulonephritis, heavy chain disease, primary or immune cell-associated amyloid degeneration, and monoclonal gammopathy of undetermined significance.

30. 28. The pharmaceutical composition of claim 27, wherein the B cell related disease is multiple myeloma (MM) or non-Hodgkin's lymphoma (NHL).

Images