Improvement of nicking enzyme or improvement related to nicking enzyme

Abstract

Disclosed are compositions comprising a nicking enzyme and a water-soluble rubidium salt, and methods for carrying out a reaction catalyzed by a nicking enzyme, the reaction including the presence of a water-soluble rubidium salt.

Description

Technical Field

[0001] The present invention relates to a composition useful for carrying out a reaction catalyzed by a nicking enzyme, and a method for carrying out a reaction catalyzed by a nicking enzyme.

Background Art

[0002] Many nicking enzymes are well known to those skilled in the art. Similar to restriction endonucleases, nicking enzymes recognize short specific DNA sequences and cleave the DNA strand at a defined position relative to the recognition sequence. However, unlike restriction endonucleases, nicking enzymes cleave only one strand of a double-stranded polynucleotide. A non-limiting list of examples of nicking enzymes includes: Nb.BsmI, Nb.BtsI, Nt.AlwI, Nt.BbvC, Nt.BstNBI, and Nt.Bpu10I. The latter enzyme is commercially available from ThermoFischer Scientific; the others are available, for example, from New England Biolabs. The lowercase "b" or "t" in the name of a nicking enzyme indicates whether the enzyme makes a nick in the lower or upper strand, respectively (the generally accepted convention is that the upper strand extends from the free 5' end on the left to the free 3' end on the right, and the lower strand is in the opposite orientation).

[0003] Nicking enzymes are useful in the laboratory as search tools, but are also applicable in certain nucleic acid amplification techniques, and these enzymes can be used (inter alia) for the detection of a target nucleic acid and / or the diagnosis of a disease or health condition. Examples thereof are disclosed in WO 2018 / 002649 pamphlet and EP 2181196 specification.

[0004] It is known that in order for any enzyme to catalyze a reaction at an optimally close rate, the reaction conditions need to be made suitable for that enzyme. This includes parameters such as temperature, pH, and salts / metals. For example, in the case of many nicking enzymes, typically at a concentration of 5 to 20 mM, Mg 2+It is common to provide reaction conditions that include metal cations such as etc.

[0005] WO 2017 / 093326 discloses a method of transducing cells using a transduction buffer. The transduction buffer includes a "transduction compound", one or more salts, and a further osmolality-inducing factor. The one or more salts can include rubidium salts such as rubidium chloride or rubidium gluconate. The "transduction compound" is "any compound that enhances the transduction of a molecule of interest into a cell". SUMMARY OF THE INVENTION MEANS FOR SOLVING THE PROBLEM

[0006] In a first aspect, the invention provides a composition comprising a nicking enzyme and a water-soluble rubidium salt.

[0007] The composition may be provided in a container as a dried (e.g., lyophilized) solid and dissolved in a defined volume of distilled water or an aqueous solution, or may already be provided as an aqueous solution containing a nicking enzyme and one or more rubidium salts. The dried solid is understood to mean a solid composition having less than 5% w / w, preferably less than 3% w / w, more preferably less than 1% w / w moisture. The solution is typically useful as a material or component to be included in a reaction mixture to carry out a reaction to be catalyzed by the nicking enzyme, which reaction may be, for example, a nucleic acid amplification reaction as described below.

[0008] It is common to provide reaction mixture components in a concentrated form such that upon dilution (e.g., by mixing with other components into the reaction mixture), the desired concentration of the components is achieved.

[0009] Typically, for example, a concentrated enzyme-containing component is provided at a 10× concentration and is diluted 10-fold in the complete reaction mixture. However, the solution of the present invention can be provided at a concentration of 1× to about 100×.

[0010] The final concentration of the nicking enzyme in the complete reaction mixture is typically in the range of 0.001 - 5 U / μl, while the final concentration of rubidium ions in the complete reaction mixture can typically be 5 - 50 mM, preferably 10 - 50 mM, more preferably 10 - 30 mM. Thus, for example, in a 10× concentration solution of the composition of the present invention, the concentration of the nicking enzyme can be in the range of 0.01 - 50 U / μl, and the concentration of Rb ions can be in the range of 5 - 500 mM, preferably 100 - 500 mM, more preferably 100 - 300 mM.

[0011] The co-pending application by the inventors (PCT / GB2019 / 050005; WO 2019 / 135074), not published as of the priority date of this application, incidentally discloses a specific example of a composition comprising a nicking enzyme reaction mixture containing, inter alia, rubidium sulfate. Thus, in one preferred embodiment, the composition is other than a composition or aqueous solution consisting of the following components: 12.5 mM MgSO4, 90 mM Tris HCl (pH 8.5), 15 mM NH4CH3CO2, 15 mM Na2SO4, 5 mM DTT, 0.2 mg / ml BSA, 0.02% Triton X-100, 20 mM Rb2SO4, 10 mM L-threonine, and 0.008 U / μl of nicking endonuclease.

[0012] In one embodiment, the composition is other than a composition or aqueous solution consisting of the components described immediately above in the same relative ratios but present at absolute concentrations different from those described.

[0013] In other embodiments, the composition is other than a composition comprising 12.5 mM MgSO4, 90 mM Tris HCl (pH 8.5), 15 mM NH4CH3CO2, 15 mM Na2SO4, 5 mM DTT, 0.2 mg / ml BSA, 0.02% Triton X-100, 20 mM Rb2SO4, 10 mM L-threonine, and 0.008 U / μl of nicking endonuclease in combination with one or more other components.

[0014] One of ordinary skill in the art will understand that the foregoing disclaimed matter encompasses compositions in which, for example, due to lack of precision in the preparation of the composition, the indicated concentrations of the various reagents may vary from the concentrations indicated in the disclaimed composition by only a small amount (e.g., a numerical value of + / - 0.5%).

[0015] The compositions of the present invention are other than those disclosed in WO 2017 / 093326 pamphlet. The prior art documents do not explicitly disclose compositions containing nicking enzymes. Further, an essential requirement of WO 2017 / 093326 pamphlet is that the buffer composition disclosed therein contains a transfection compound. In contrast, in a preferred embodiment of the present invention, the composition does not contain a transfection compound as defined in WO 2017 / 093326 pamphlet. WO 2017 / 093326 pamphlet shows the β-lactamase assay (as described therein) as being suitable for determining whether a substance is a "transfection compound".

[0016] Examples of transfection compounds disclosed in WO 2017 / 093326 pamphlet include non-surfactant sulfobetaine (NDSB), non-surfactant carbobetaine (NDCB), pentanoic acid, n-butylamine, and compounds according to general formula I disclosed on page 11 of WO 2017 / 093326 pamphlet.

[0017] Since the inventors have found that many different rubidium salts have a beneficial effect on the activity of nicking enzymes, the present invention is not limited to the use of any one particular rubidium salt (it will be understood that the rubidium salt has moderate water solubility and otherwise would not be acceptable for use in combination with nicking enzymes). Rubidium salts having excellent water solubility include the following: rubidium bromide, rubidium chloride, rubidium fluoride and rubidium iodide; rubidium acetate, rubidium chromate, rubidium formate, rubidium hydroxide, rubidium hydrogen carbonate, rubidium nitrate, rubidium selenite and rubidium sulfate. Nevertheless, certain rubidium salts have been found to be particularly advantageous, and such include the following: rubidium sulfate; rubidium nitrate; and rubidium halides (in particular, rubidium chloride).

[0018] The composition can be formed in situ as part of the reaction mixture (for example, for the purpose of performing a polynucleotide cleavage reaction, which reaction itself can form part of a DNA amplification reaction such as NEAR or STAR), or the composition may already be formed as a component within a kit. "NEAR" is the acronym for "Nicking Enzyme Amplification Reaction". "STAR" is the acronym for "Selective Temperature Amplification Reaction".

[0019] In "NEAR" (for example, as disclosed in U.S. Patent Application Publication No. 2009 / 0017453 and European Patent No. 2,181,196), forward and reverse primers (referred to as "templates" in U.S. Patent Application Publication No. 2009 / 0017453 and European Patent No. 2,181,196) hybridize to each strand of the double-stranded target and are extended. Further copies of the forward and reverse primers (present in excess) hybridize to the extension products of the primers in the opposite direction and are themselves extended to generate "amplified double strands". Each amplified double strand thus formed contains a nicking site towards the 5' end of each strand, and this end is cleaved by a nicking enzyme to allow the synthesis of further extension products. Meanwhile, the pre-synthesized extension products hybridize to another copy of the complementary primer and extend the primer, thereby generating further copies of the "amplified double strands". In this way, logarithmic amplification can be achieved.

[0020] The initial primer / target hybridization event necessary to trigger the amplification process occurs, but the target remains substantially double-stranded: The initial primer / target hybridization is thought to utilize the localized dissociation of the target strand (a phenomenon known as "breathing") (see the papers of Alesandrov et al., 2012 Nucl. Acids res. and Von Hippel et al., 2013 Biopolymers 99(12), 923-954). Breathing is the localization of base pairing between DNA strands and a transient relaxation. The melting temperature (Tm) of the initial primer / target heteroduplex is much lower than the reaction temperature, so the primer tends to dissociate, but the transient hybridization persists long enough for the polymerase to extend the primer, increasing the Tm of the heteroduplex and stabilizing the heteroduplex.

[0021] The amplification step of NEAR is carried out isothermally, i.e., at a constant temperature. In practice, it is customary to carry out both the initial target / primer hybridization and the subsequent amplification rounds at the same constant temperature, usually 54 - 56 °C.

[0022] Similar to NEAR, STAR is also an amplification reaction that requires the use of a nicking enzyme. However, unlike NEAR, STAR is not carried out isothermally and requires a programmed drop in the reaction temperature from a (relatively high) initial temperature, resulting in a higher yield of specific amplification products. This technique is described in detail in WO 2018 / 002649.

[0023] The compositions of the present invention can be provided, if desired, as an aliquot or aliquots in any form (e.g., dried; ready-to-use solution; concentrated solution). The aliquot or aliquots can be provided, for example, in Eppendorf (trademark) tubes, or other stoppered vials or containers.

[0024] Conveniently, the compositions of the present invention can be provided as part of a kit (e.g., a kit for performing a nucleic acid amplification reaction involving a cleavage step catalyzed by a nicking enzyme). The kit may include one or more aliquots of the composition, each aliquot being provided in a stoppered vial or other container. The kit typically includes a package such as a cardboard or plastic package, such a package including one or more aliquots of the composition of the present invention and typically also written instructions regarding the use of the kit.

[0025] The compositions of the present invention may generally include additional components that may be useful, for example, for optimizing and / or preserving the enzymatic activity of the nicking enzyme. Such additional components may include one or more buffers, amino acids, reducing agents, protective excipients, and carbohydrates.

[0026] Preferred buffers for inclusion in the compositions of the present invention include the following: Tris hydrochloride, Tris hemisulfate, Tris EDTA, Tris base, Tris EGTA, N,N-bis(2-hydroxyethyl)glycine, N,N-bis(2-hydroxyethyl)-3-amino-2-hydroxypropanesulfonic acid, 4-(2-hydroxyethyl)-1-piperazinepropanesulfonic acid, N-(2-hydroxyethyl)piperazine-N'-(4-butanesulfonic acid), 4-(2-hydroxyethyl)piperazine-1-ethanesulfonic acid, orthoboric acid, 3-(N-morpholino)propanesulfonic acid hemisodium salt, 3-(N-morpholino)propanesulfonic acid sodium salt, 3-(N-morpholino)propanesulfonic acid, piperazine-1,4-bis(2-hydroxypropanesulfonic acid) dihydrate, N-[tris(hydroxymethyl)methyl]-3-aminopropanesulfonic acid, 3-(N-tris[hydroxymethyl]methylamino)-2-hydroxypropanesulfonic acid, N-[tris(hydroxymethyl)methyl]glycine, sodium chloride, sodium sulfate, sodium acetate, sodium hydride, sodium nitrite, sodium nitrate, sodium borate, boric acid, potassium sulfate, potassium acetate, potassium borate, potassium chloride, potassium nitrite, potassium nitrate, magnesium sulfate, magnesium chloride, magnesium acetate, ammonium chloride, ammonium sulfate, ammonium acetate, ethylenediaminetetraacetic acid, ethylene glycol-bis(2-aminoethyl ether)-N,N,N',N'-tetraacetic acid, citric acid, or combinations thereof.

[0027] Preferred carbohydrates include fructose, ficoll (registered trademark), hydroxyethyl (heta) starch, pentosan polysulfate, polyphosphoric acid, poly-L-glutamic acid, sucrose, trehalose, maltotriose, dextran, mannitol, sorbitol, glucose, mannose, galactose, lactose, maltose, lactulose, raffinose, melezitose, 1,6-anhydroglucose, k-carrageenan, microcrystalline cellulose, polyethylene glycol, polyvinylpyrrolidone, leucrose, kestose, stachyose, verbascose, nystose, maltodextrin, cyclodextrin, isomaltooligosaccharide, fructooligosaccharide, inulin, or a combination thereof.

[0028] Preferred amino acids include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, serine, threonine, glutamine, citrulline, lysine, histidine, taurine, arginine, or a combination thereof.

[0029] Preferred reducing agents include 1,4-dithioerythritol, DL-dithiothreitol, tributylphosphine, tris(2-carboxyethyl)phosphine hydrochloride, or a combination thereof.

[0030] Preferred protective excipients include bovine serum albumin, α-casein, globulin, α-lactalbumin, human serum albumin, heat shock protein, valosin-containing protein, α- Crystalline, gelatin, lactate dehydrogenase, lysozyme, myoglobin, fibroin, ovalbumin, resveratrol, hydroxybutyric acid, octanoic acid, quinone-tryptophan derivative, chitosan, CHAPS, n-octyl glucoside, polysorbate 20, polysorbate 80, oleic acid, sodium glycolate, Triton x-100, Tween® 20, Tween® 80, Thesit® (polyoxyethylene lauryl ether), decanoyl-n-methyl glucamide, octanoyl-n-methyl glucamide, IGEPAL® CA-630 (octylphenoxypoly(ethylenoxy)ethanol), Tergitol, and hydrophobic salts are included.

[0031] Conveniently, when the composition is diluted with a suitable amount of distilled water and / or mixed with distilled water, the composition has a buffer concentration in the range of 1 mM to 150 mM (typically 5 to 100 mM) and a typical pH in the range of 7.0 to 9.0, more preferably 7.5 to 8.0.

[0032] Various aspects of the present invention preferably relate to nicking enzymes whose official names include the prefix "N". This indicates that this enzyme is a "true" nicking endonuclease, as opposed to nicking enzymes that are associated with DNA methyltransferase inside cells. The latter group of nicking enzymes introduce a nick near the unpaired base of a G-T mismatch pair (which is recognized by DNA methyltransferase) that occurs after the deamination reaction of cytosine bases in the sequence. This second type of nicking enzyme is represented by the prefix "V" (derived from the name of the most well-characterized enzyme of this type, "Vsr" (very short patch repair)). In a preferred embodiment of the present invention, the nicking enzyme is not a "V" type nicking enzyme.

[0033] In a second aspect, the present invention provides a method of performing a reaction catalyzed by a nicking enzyme, the method comprising contacting, under aqueous conditions compatible with the nicking enzyme and in the presence of a water-soluble rubidium salt, a double-stranded oligonucleotide or polynucleotide substrate having a recognition site for the nicking enzyme with the nicking enzyme, thereby effecting at least one single-strand nick or cut in the double-stranded oligonucleotide or polynucleotide substrate. Typically, the method further comprises extension of the free 3'-end of the cleaved strand by a DNA polymerase (especially a strand-displacing polymerase) that adds nucleotides to the free 3'-end. The oligonucleotide preferably comprises at least 17 nucleotides, more preferably at least 19 nucleotides. For this purpose, any sequence longer than 30 nucleotides is contemplated as a polynucleotide. The polynucleotide may be as long as 1 kb, or 10 or 20 kb.

[0034] In one embodiment, the method of the invention is carried out in the absence of cells, in particular in the absence of the cells to be transfected.

[0035] Nicking enzymes are used in several contexts. For example, there are nucleic acid amplification techniques that use nicking enzymes. Such techniques include "NEAR" (e.g., "Nicking Enzyme Amplification Reaction" as described in US Patent Application Publication No. 2009 / 0017453 and European Patent No. 2181196) and "STAR" (e.g., "Selective Temperature Amplification Reaction" as described in International Publication No. 2018 / 002649 Pamphlet). Thus, in a preferred embodiment of the second aspect of the present invention, the reaction is part of or included in a nucleic acid amplification reaction such as NEAR or STAR.

[0036] In particular, the inventors have found that when rubidium is included in the reaction mixture of an amplification reaction such as NEAR or STAR, the sensitivity of the reaction is improved and the reproducibility is enhanced (reducing the variance of results obtained from replicate samples) in a manner not observed with other metal cations.

[0037] In addition, it has also been found that these results are exerted not through the action on other enzyme components (especially DNA polymerase) of the nucleic acid amplification reaction mixture, but through the action on the activity of the nicking enzyme.

[0038] As described above, other components that may be usefully incorporated into the compositions of the present invention assist in the preservation of the activity of the nicking enzyme, or the optimization of the conditions for the nicking enzyme, and / or may serve to optimize the conditions for carrying out the nucleic acid amplification reaction, including the use of the compositions of the present invention.

[0039] Such components are as follows: (a) A magnesium salt typically at a concentration of 10 - 15 mM (acting as a cofactor for the polymerase used in the amplification reaction), in particular magnesium sulfate; (b) A buffer typically at a concentration of 1 - 100 mM and at a pH of 7.0 - 9.0 (e.g., Tris HCl); (c) A reducing agent / antioxidant typically at a concentration of 1 - 15 mM, such as dithiothreitol (DTT); other reducing agents are also suitable (see above); (d) A detergent typically present at about 0.01% v / v, such as Triton X - 100; (e) A sodium salt typically at a concentration of 1 - 20 mM, such as sodium sulfate; (f) An ammonium salt typically at a concentration of 1 - 25 mM, such as ammonium sulfate; (g) An acetate typically at a concentration of 1 - 25 mM, such as sodium acetate; and (h) A protective excipient and / or a carbohydrate may include one or more of these, preferably two or more, more preferably three or more, and most preferably four or more.

[0040] Optionally, it will be apparent that a single component may perform multiple roles in the composition. For example, ammonium acetate may act as both the ammonium salt (f) and the acetate (g).

[0041] The exemplary concentration values described above refer to the "1x" concentration, i.e., the concentration of the final reaction mixture. It will be understood that the concentration of the components may be increased, for example, to produce a "stock" solution of 5x or 10x.

[0042] Various aspects of the present invention will be described in more detail, by way of example, with reference to the accompanying drawings.

Brief Description of the Drawings

[0043]

Figure 1

Figure 2a

Figure 2b

Figure 3

Figure 4a

Figure 4b

Figure 5

Figure 6a

Figure 6b

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12A

Figure 12B

Figure 13

Figure 14

Figure 15

Mode for Carrying Out the Invention

[0044] <Example> Example 1: Enhancement of Amplification Reaction by Rubidium Sulfate Through the study of various STAR buffer components, an enhancement in the quality of rubidium compounds was found that demonstrated an improvement in the assay speed and consistency of all reactants in the STAR method (WO 2018 / 002649 pamphlet).

[0045] Enzyme, Oligonucleotide, and Target Chlamydia trachomatis (Ct) was used as the target for the rubidium test. Chlamydia trachomatis serotype J (ATCC VR-886) genomic DNA was obtained from the American Type Culture Collection (Manassas, VA). The open reading frame 6 region of the cryptic plasmid was amplified using primers STARctF61a2 (SEQ ID NO: 1: 5’-CGACTCCATATGGAGTCGATTTCCCCGAATTAmG-3’) and STARctR61c2 (SEQ ID NO: 2: 5’-GGACTCCACACGGAGTCCTTTTTCCTTGTTTAmC-3’). The resulting DNA template was detected using the molecular beacon STARctMB1 (SEQ ID NO: 3, 5’-FAM / ccattCCTTGTTTACTCGTATTTTTAGGaatgg / BHQ1-3’) as described in European Patent No. 0728218 specification. Bst X DNA polymerase was purchased from Qiagen (Beberly, MA). Nt.BstNBI nicking endonuclease was purchased from New England Biolabs (Ipswich, MA) described in U.S. Patent No. 6,191,297 specification. Rubidium sulfate was purchased from Sigma Aldrich (St. Louis, MO).

[0046] The oligonucleotides and molecular beacons were synthesized by Integrated DNA Technologies (Coralville, IA). General characteristics of the primers used in the STAR reaction are described in WO 2018 / 002649 pamphlet.

[0047] Amplification conditions and procedures General methods for the STAR reaction are described in WO 2018 / 002649 pamphlet. The STAR mixture contained two primers, polymerase, and a nicking enzyme (described above). The reaction was carried out in a final volume of 25 μl containing 1.0 μM forward primer, 0.5 μM reverse primer, 0.25 μM molecular beacon, 10 μl of STAR Master Mix and 5 μl of DNA sample. The STAR Master Mix contained the following reagents: 12.5 mM MgSO4, 90 mM Tris HCl (pH 8.5), 300 μM dNTPs each, 20 mM (NH4)2SO4, 15 mM Na2SO4, 2 mM DTT, 0.01% Triton X-100, 15 U nicking endonuclease, 60 U polymerase. Rubidium sulfate was added at 10, 20 or 50 mM to the STAR Master Mix for test samples and not added to the control group ("control" in Figure 1). Each reaction mixture contained 100 copies of the target primer. The temperature of the reaction was controlled and gradually decreased over time for optimal STAR activity after an initial relatively high temperature. The initial stage mainly involving polymerase activity was at a high temperature of 60 °C for 15 seconds. The logarithmic amplification phase where both polymerase and nicking enzyme were highly active was achieved by decreasing the temperature by 0.4 °C every 15 seconds over a total of 10 minutes. Amplification and STAR product detection were carried out using an Agilent Mx3005P qPCR instrument (Agilent).

[0048] To allow the reagents to reach the reaction temperature and to test the effect of salts on amplification kinetics, enzyme performance, and signal fluorescence, all reactions had pre-incubation.

[0049] The amplification system, isothermal and STAR rely on two major functional enzymes, namely, polymerase and nicking enzyme. Any or both of these enzymes can be optimized to a selected temperature that provides significant performance improvement, i.e., the advantages used in the selective temperature amplification reaction. Furthermore, the enzymes require cofactors for regulation and activity. For example, magnesium is a requirement for polymerase activity. Another study of metal ions and cofactors by the inventors led to the discovery that rubidium improved the STAR reaction compared to those without rubidium sulfate (Figure 1). The optimal concentration of rubidium is recommended for maximum performance improvement. Figure 1 shows that rubidium sulfate improved the STAR reaction at a concentration of 10 - 20 mM. A concentration of 50 mM slowed down the reaction and was harmful to amplification (however, it should be noted that for the case of 50 mM rubidium sulfate, the replicate sample results were classified more strictly than when using the control group). Although the inventors do not intend to be limited to a specific theory, it is considered that the sulfate anion was the cause of slowing down the reaction at a concentration of 50 mM rubidium sulfate (note that Mg2+ ions in the reaction mix are required for polymerase activity).

[0050] Example 2: Enhancement of Amplification Reaction by Other Rubidium Salts To further demonstrate that it was the rubidium cation that particularly improved STAR, other rubidiums were tested. The experiment was carried out as described in Example 1 above, but rubidium nitrate or rubidium chloride was used instead of rubidium sulfate. The results are shown in Figure 2. Rubidium nitrate and rubidium chloride showed performance improvements similar to those of rubidium sulfate. Naturally, various tolerances were revealed for the anions of the salts, but all three rubidium salts showed improvement in assay performance in the range of 10 - 50 mM.

[0051] While not intending to limit the inventors to any particular theory, the improvement in amplification is believed to be attributable to at least one property. In most nucleic acid amplification reactions, polymerase initiates strand elongation during the reaction. Polymerase is known to require catalytic ions to assist in the induction of polymerase selection of the correct nucleotides for incorporation into the growing nucleic acid strand during strand elongation, which emphasizes the importance of precise conformational changes for polymerase efficiency and fidelity. If rubidium can act as a catalytic ion superior to those currently known in the art for polymerase activity, an improved fidelity that would likely result in an improvement in assay sensitivity can be expected. However, this was not observed even when rubidium was added to the STAR reactant. What was revealed was (i) an improved reaction rate and (ii) significantly more stringent replication (i.e., higher reproducibility and lower variability). This observed improvement was thought to be due to an improvement in the logarithmic phase of the reaction. The logarithmic phase of the reaction depends on a nicking endonuclease for the turnover of the product. The faster the turnover, the more consistently the product is produced, so increasing the rate and making the copies more exact. This suggests that rubidium regulates or improves the nicking endonuclease. This is surprising and, to the best of the inventors' knowledge, has not been known in the art heretofore.

[0052] Example 3: Results Using a Polymerase Activity Assay The hypothesis outlined above was verified by performing a polymerase activity assay (Example 3) and a nicking enzyme activity assay (Example 4) in the presence of rubidium.

[0053] Polymerase Activity Assay Design, Enzymes, and Oligonucleotides: Synthetic oligonucleotides for polymerase activity assay (PAA) were synthesized by Integrated DNA Technologies (Coralville, IA). The design consists of three oligonucleotides: a template oligo (NEF), (SEQ ID NO: 4: 5'- / 56-FAM / ACCGCGCGCACCGAGTCTGTCGGCAGCACCGCT-3'), a priming oligo (PO), (SEQ ID NO: 5: 5'-AGCGGTGCTGCCGACA-3'), and a quenching oligo (POQ), (SEQ ID NO: 6: 5'-GGTGCGCGCGGT / 3BHQ_1 / -3'). As shown in Figure 3, these three oligonucleotides together form a solution complex with their respective unique functions. NEF has a 5' fluorescent dye, and POQ has a 3' quenching moiety that absorbs photons emitted by the 5' template oligo fluorescent dye. PO acts as the starting site for strand displacement polymerase to extend and displace the quenching oligo, enabling fluorescence to occur because the quenching oligo is no longer in the vicinity of the template oligo. A highly active strand displacement polymerase generates a fluorescent signal at a higher rate compared to a polymerase with lower activity or lacking strand displacement activity.

[0054] Polymerase Activity Assay Conditions The basic PAA mixture includes a template oligo with 5'-FAM modification (NEF), a priming oligo (PO) that anneals to the 3'-end of the template, a quenching oligo with 3'-BHQ1 modification (POQ) that anneals to the 5'-end of the template, and a polymerase (as described above). The reaction was carried out in a final volume of 25 μl containing 0.2 μM NEF, 0.3 μM PO, 0.7 μM POQ, and 1× PAA master mix. At 1× concentration, the PAA master mix contained the following reagents: 12.5 mM MgSO4, 90 mM Tris HCl (pH 8.5), 300 μM each of dNTP, 15 mM NH4CH3CO2, 15 mM Na2SO4, 5 mM DTT, 0.2 mg / ml BSA, 0.02% Triton X-100, 15 mM Rb2SO4, 10 mM L-threonine, and 0.03 U / μl of polymerase. The reaction was run using the STAR temperature profile described above (Example 1). PAA was performed using an Agilent Mx3005P qPCR instrument (Agilent). All reactions had a pre-reaction incubation so that the reagents could reach the temperature of the selected temperature profile and any variations associated with heating the reactants could be eliminated. In each reaction, amplification kinetics, enzyme performance, and signal fluorescence were evaluated.

[0055] Figure 4a shows the average polymerase activity assays with and without rubidium sulfate. This figure shows that rubidium sulfate does not significantly change polymerase activity: the results of the control (without added rubidium) are very similar to those obtained in the presence of 15 mM rubidium. Figure 4b shows six replicate samples with / - rubidium. None of the replicate samples show a significant difference, indicating that the improvement observed in the STAR reaction is not due to rubidium acting on the polymerase.

[0056] Example 4: Results using the nickase activity assay Nickase activity assay (NAA) design, enzyme, and oligonucleotides: The synthetic oligonucleotides for the nicking activity assay were synthesized by Integrated DNA Technologies (Coralville, IA). The design consists of two oligonucleotides: a template oligo (NEQ), (SEQ ID NO: 7: 5’-ACCGCGCGCACCGAGTCTGTCGGCA / 3BHQ_1 / -3’) and a priming oligo (POF, SEQ ID NO: 8: 5’- / 56-FAM / CTGCCGACAGACTCGGTGCGCGCGGT-3’). Together, these oligonucleotides form a solution complex with their respective unique functions as shown in Figure 5. The template oligo has a nicking site for nicking endonuclease activity and a 3’ quencher downstream. The priming oligo has a complementary nicking site sequence and a 5’ fluorescent dye. In solution, these two form a complex that completes a nicking binding site that allows cleavage by the nicking endonuclease. The 5’ oligonucleotide quencher of the nick site has a low melting temperature after cleavage by the nicking endonuclease. Since the reaction is carried out at a temperature above this melting temperature, the shortened fragment containing the quencher is released from the complex and fluoresces. The more the nicking enzyme is activated, the faster and more abundant the fluorescent signal is generated.

[0057] Nick Activity Assay Conditions The basic NAA mixture includes a template oligo (NEQ) with a 3’-BHQ1 modification, a priming oligo (POF) with a 5’-FAM modification that anneals to the template, and a nicking endonuclease (described above). The reaction was carried out in a final volume of 25 μl containing 1.3 μM NEQ, 1.6 μM POF, and 1× NAA master mix. At 1× concentration, the NAA master mix contained the following reagents: 12.5 mM MgSO4, 90 mM Tris HCl (pH 8.5), 15 mM NH4CH3CO2, 15 mM Na2SO4, 5 mM DTT, 0.2 mg / ml BSA, 0.02% Triton X-100, 15 mM Rb2SO4, 10 mM L-threonine, and 0.008 U / μl nicking endonuclease. As described above (Example 1), the reaction was run using the STAR temperature profile. NAA was performed using an Agilent Mx3005P qPCR instrument (Agilent). All reactions had a pre-reaction incubation so that the reagents could reach the temperature of the selected temperature profile and any variations associated with heating the reaction could be eliminated. In each reaction, amplification kinetics, enzyme performance, and signal fluorescence were evaluated.

[0058] Figure 6a shows the average nicking enzyme activity with and without rubidium sulfate. This figure surprisingly shows that rubidium sulfate significantly increased the activity of the nicking enzyme. Figure 6b shows six replicate samples for each condition. All replicate samples showed significantly higher nicking enzyme activity in the presence of rubidium (replicate samples E4 - E9) compared to the results in the absence of rubidium (replicate samples D4 - D9). Since it has not been reported that rubidium can increase the activity of nicking endonuclease, this is an unexpected result. While not intending to limit the applicant to any particular theory, this further explains the improvements observed in Examples 1 and 2, showing that the logarithmic phase of amplification was improved, generating a faster product turnover.

[0059] Example 5: Results of Ion Substitution in STAR The unexpected improvement of the nicking enzyme by rubidium suggests that other readily available alkali and alkaline earth metals should be tested to determine whether they improve the activity of the nicking endonuclease. In various buffer combinations, various salts were replaced to determine their effect on STAR. The following salts were tested at various concentrations: lithium acetate, potassium acetate, lithium sulfate, strontium chloride, strontium acetate, scandium acetate, and yttrium acetate. Figure 7 shows the results obtained using lithium acetate and potassium acetate, neither of which improved STAR, and lithium probably inhibited and slowed the reaction. Figure 8 shows the results for strontium acetate: 10 mM probably slightly slowed the reaction, while 20 and 50 mM fully inhibited the reaction. Figure 9 shows the results for scandium acetate: all concentrations fully inhibited the reaction. For the sake of brevity, the results from the other salts tested are not shown, as none of them improved the STAR reaction and most fully inhibited the reaction, further supporting the surprising nature of the results obtained with rubidium.

[0060] Example 6: Results of Modified Nicking Enzyme Activity Assay (NAA) Using Other Nicking Enzymes To demonstrate that rubidium improves the activity of nicking endonucleases other than Nt.BstNBI, a modified NAA was performed using the nicking endonuclease Nb.BsmI purchased from New England Biolabs (Ipswich, MA). The modified NAA was performed with and without rubidium using the following conditions.

[0061] Nicking Activity Assay (NAA) Design, Enzyme, and Oligonucleotides: Synthetic oligonucleotides for the modified nicking activity assay were synthesized by Integrated DNA Technologies (Coralville, IA). The design consists of the following oligonucleotide: probe oligo (DLPFQ) (SEQ ID NO: 9: 5’- / 56-FAM / CACTTGGCATTCTATTACACAATAGAATGCCAAGTG / 3BHQ_1 / -3’). The Nb.BsmI recognition sequence is GAATG_CN (the underline indicates the nicking site). The oligonucleotide contains a self-complementary sequence and forms a molecular beacon-like probe in solution. The probe has a nicking site for nicking endonuclease activity and a 3’ quencher. There is a 5’ fluorescent dye upstream of the nicking binding site. In solution, a complex is formed, which completes the nicking binding site that allows cleavage by the nicking endonuclease. Since Nb.BsmI is a bottom cutter, it will cleave on the reverse strand side of the nicking binding site. The 3’ oligonucleotide quencher of the nicking site has a low melting temperature after cleavage by the nicking endonuclease. Since the reaction is carried out at a temperature above this melting temperature, the shortened fragment containing the quencher is released from the complex and emits fluorescence. The more active the nicking enzyme, the faster and more abundant the fluorescence signal is generated.

[0062] Nick-ing Activity Assay Conditions The basic NAA mixture includes a probe oligo (DLPFQ) having a 5’-FAM modification and a 3’-BHQ1 modification that folds itself, and a nicking endonuclease (described above). The primer sequences are the same as those detailed in Example 1. The reaction was carried out in a final volume of 25 μl containing different concentrations of DLPFQ depending on the nicking enzyme used and 1× NAA master mix. At 1× concentration, the NAA master mix contained the following reagents: 12.5 mM MgSO4, 90 mM Tris HCl (pH 8.5), 15 mM NH4CH3CO2, 15 mM Na2SO4, 5 mM DTT, 0.2 mg / ml BSA, 0.02% Triton X-100, 20 mM Rb2SO4, 10 mM L-threonine, and 0.01 - 0.5 U / μl of nicking endonuclease. As described above (Example 1), the reaction was run using the STAR temperature profile. Modified NAA was carried out using an Agilent Mx3005P qPCR instrument (Agilent). All reactions had a pre-reaction incubation so that the reagents could reach the temperature at which the effect of the selected temperature profile was tested and any variations associated with the heating of the reactants could be eliminated. In each reaction, kinetics, enzyme performance, and signal fluorescence were evaluated.

[0063] Figure 10 shows the results obtained from the average of six replicate samples of the nicking enzyme activity assay with and without rubidium sulfate. These data indicate that rubidium sulfate increases the activity of the other nicking endonucleases described above.

[0064] Example 7: Results of Isothermal Amplification Accordingly, rubidium can be used in any amplification technique. For example, the amplification process may be based on the amplification process used in strand displacement amplification, or on that used in NEAR, or on any other nucleic acid amplification process that relies on the formation of a single-strand nick and the extension of a partial sequence from the 3’ end of the cleaved strand. Accordingly, the prior art regarding the amplification steps of SDA or NEAR is generally equally applicable to the amplification process of the method of the present invention.

[0065] Amplification Conditions and Procedures The basic mixture contains two primers, polymerase, and a nicking enzyme (described above). The primer sequences are the same as those detailed in Example 1. The reaction was carried out in a final volume of 25 μl containing 1.0 μM forward primer, 0.5 μM reverse primer, 0.25 μM molecular beacon, 10 μl master mix, and 5 μl DNA sample. The master mix contained the following reagents: 12.5 mM MgSO4, 90 mM Tris HCl (pH 8.5), 300 μM dNTPs each, 40 mM NH4OAc, 15 mM Na2SO4, 2 mM DTT, 0.01% Triton X-100, 15 U nicking endonuclease, 60 U polymerase. As described in U.S. Patent Application Publication No. 2009 / 0017453, the temperature of the reaction was isothermal. Amplification and product detection were carried out using an Agilent Mx3005P qPCR instrument (Agilent).

[0066] To test the effect of salts on amplification kinetics, enzyme performance, and signal fluorescence by allowing the reagents to reach the reaction temperature, all reactions had a pre-reaction incubation.

[0067] Results The results in Figure 11 show the average of four replicate samples of isothermal amplification runs with 100 copies and 10 copies of template with and without 20 mM rubidium sulfate (「ntc」 = no template control). From the data shown in the figure, rubidium sulfate improved the isothermal reaction, and 15 mM rubidium sulfate allowed the 10-copy reaction to perform similarly to the 100-copy reaction without rubidium sulfate. For the sake of brevity, replicate samples for the data are not shown, but the inventors have found that replicate samples containing rubidium are more stringent than those without rubidium.

[0068] Example 8: Crystal Structure of the Nicking Enzyme After generating the data from the experiments already referenced, further analysis of the crystal structure of the nicking enzyme was performed. While not intending to limit the Applicant to a particular theory, as referenced in Kachalova et al., 2008, Figure 12 shows the domain structure of the nicking enzyme N.BspD6I (Protein Data Bank (“PDB”) ID 2EWF) modeled with the DNA-binding motif from PDB ID 2VLA. The overall structure is shown in terms of a DNA-binding domain composed of several subdomains: D1 and D2, and a linker connecting a catalytic c-terminal domain composed of subdomains CD1 and CD2. A surface fill display is overlaid on the cartoon model of Figure 12B. Figure 13 shows the putative active site showing residues E482, E418, V470, H489, and E469. The putative binding site of rubidium (shown by E418, E482, or E469) identified by the hydration radius of rubidium relative to magnesium or sodium (1.6 Å for Rb+ vs. 1.3 Å for Mg++ and 1.1 Å for Na+) can impart higher stability to the folding of the nicking enzyme within the local environment and / or stabilize the catalytic domain that allows for more efficient activity of residues critical to the function of the enzyme. Additionally, in Figure 14, on the surface of the nicking enzyme, a potential solvent-exposed pocket is composed of the CD linker and the D1 domain. Rubidium can act as a putative allosteric cofactor within this pocket. Many of the glutamic acid and aspartic acid residues within this pocket can contribute to rubidium binding (residues E364, E335, E368, D341, D357, E353, E305, E327). However, the cluster of glutamic acid residues closest to the active site may chelate rubidium (residues E364, E335, E368).

[0069] Example 9: Results of Nicking Enzyme Activity Assay (NAA) Using a Third Nicking Enzyme under Isothermal Conditions To demonstrate that rubidium improves the activity of the third nicking endonuclease, modified NAA was performed using the nicking endonuclease Nb.BbvCI purchased from New England Biolabs (Ipswich, MA). NAA was performed with and without rubidium using the following conditions.

[0070] Nickase Activity Assay (NAA) Design, Enzyme, and Oligonucleotides: Synthetic oligonucleotides for the nickase activity assay were synthesized by Integrated DNA Technologies (Coralville, IA). The assay involves the use of the following oligonucleotide probe (DLPFQ) (SEQ ID NO: 10: 5’- / 56-FAM / CATGCTGAGGAATATTACACAATATTCCTCAGCATG / 3BHQ_1 / -3’). The oligonucleotide forms a molecular beacon-like probe in solution. The probe has a nicking site for nickase activity and a 3’ quencher. Upstream of the nickase binding site is a 5’ fluorescent dye. In solution, a complex is formed, which achieves a nicking binding site that allows cleavage by the nickase endonuclease. Since this nickase is a bottom cutter, it will cleave on the reverse strand side of the nicking binding site. The 3’ oligonucleotide quencher of the nick site has a low melting temperature after cleavage by the nickase endonuclease. Since the reaction is carried out at a temperature above this melting temperature, the shortened fragment containing the quencher is released from the complex and emits fluorescence. The more active the nickase, the faster and more abundant the fluorescence signal is generated.

[0071] Nickase Activity Assay Conditions The basic (NAA) mixture includes a probe oligo (DLPFQ) with a 5’-FAM modification and a 3’-BHQ1 modification that folds on itself, and a nicking endonuclease (described above). The reaction was carried out in a final volume of 25 μl containing different concentrations of POFQ depending on the nicking enzyme used, and 1× NAA master mix. At 1× concentration, the NAA master mix contained the following reagents: 40 mM RbCl, 1× CutSmart buffer purchased from New England Biolabs (Ipswich, MA), and 0.01 - 0.5 U / μl of nicking endonuclease. The reaction was run using an isothermal temperature profile of 50 °C. NAA was carried out using an Agilent Mx3005P qPCR instrument (Agilent). All reactions had a pre-reaction incubation so that the reagents could reach the temperature of the selected temperature profile and any variations associated with heating the reactants could be eliminated. In each reaction, the kinetics, enzyme performance, and signal fluorescence were evaluated.

[0072] Figure 15 is a graph of the average relative fluorescence units (a measure of the nicking enzyme of NAA) versus time (minutes). The graph shows the results of four replicate samples in an NA assay with (solid line) or without (dotted line, control) rubidium. From the data, it can be seen that rubidium chloride increases the activity of Nb.BbvCI under isothermal conditions.

Claims

1. A method for carrying out a reaction catalyzed by a nicking enzyme, said method comprising contacting a double-stranded oligonucleotide or double-stranded polynucleotide substrate having a recognition site for said nicking enzyme with the nicking enzyme in an aqueous condition compatible with said nicking enzyme and in the presence of a water-soluble rubidium salt containing rubidium ions, whereby at least one single-strand nick is introduced into said double-stranded oligonucleotide or polynucleotide substrate. A method wherein the reaction catalyzed by the nicking enzyme is part of or included in a nucleic acid amplification reaction.

2. The method according to claim 1, wherein the rubidium ions are present at a concentration of 10 to 50 mM.

3. The method according to claim 1 or 2, wherein the rubidium salt is selected from the group consisting of rubidium sulfate, rubidium halide and rubidium nitrate.

4. The method according to claim 3, wherein the rubidium halide is rubidium chloride.

5. The method according to any one of claims 1 to 4, wherein the nicking enzyme is selected from the group consisting of Nb.BsmI, Nb.Bts, Nt.AlwI, Nt.BstNBI and Nt.Bpu101.

6. A reaction mixture for carrying out a reaction involving cleavage of a double-stranded oligonucleotide or double-stranded polynucleotide substrate, said reaction mixture comprising: a nicking enzyme; a double-stranded oligonucleotide or polynucleotide substrate; a water-soluble rubidium salt containing rubidium ions; and a reaction mixture containing nucleotide triphosphates and a DNA polymerase.

7. The reaction mixture according to claim 6, wherein the rubidium ions are present at a concentration of 10 to 50 mM.

8. (a) a magnesium salt; (b) a buffer; (c) a reducing agent; (d) detergent; (e) sodium salt; (f) ammonium salt; (g) acetate; and (h) a protective excipient and / or carbohydrate selected from bovine serum albumin, α-casein, globulin, α-lactalbumin, human serum albumin, heat shock protein, valosin-containing protein, α-crystallin, gelatin, lactate dehydrogenase, lysozyme, myoglobin, fibroin, ovalbumin, resveratrol, hydroxybutyric acid, octanoic acid, chitosan, CHAPS, n-octyl glucoside, polysorbate 20, polysorbate 80, oleic acid, sodium glycolate, polyoxyethylene lauryl ether, decanoyl-n-methyl glucamide, octanoyl-n-methyl glucamide, octylphenoxypoly(ethylenoxy)ethanol, and hydrophobic salts The reaction mixture according to claim 6 or 7, further comprising four or more of the above.

9. A kit for performing a nucleic acid amplification reaction, the kit comprising a package, a nickase and a water-soluble rubidium salt within the package, and (a) magnesium salt; (b) buffer; (c) reducing agent; (d) detergent; (e) sodium salt; (f) ammonium salt; (g) acetate; and (h) A protective excipient and / or a carbohydrate selected from bovine serum albumin, α-casein, globulin, α-lactalbumin, human serum albumin, heat shock protein, valosin-containing protein, α-crystallin, gelatin, lactate dehydrogenase, lysozyme, myoglobin, fibroin, ovalbumin, resveratrol, hydroxybutyric acid, octanoic acid, chitosan, CHAPS, n-octyl glucoside, polysorbate 20, polysorbate 80, oleic acid, sodium glycolate, polyoxyethylene lauryl ether, decanoyl-n-methyl glucamide, octanoyl-n-methyl glucamide, octylphenoxypoly(ethylenoxy)ethanol, and a hydrophobic salt One or more aliquots of a composition containing four or more thereof, and a kit.

Images