Analyte measurement system
The system uses microstructures with aptamers to non-invasively measure biomarkers in interstitial fluid, addressing the limitations of existing methods by providing comfortable and cost-effective continuous monitoring.
Patent Information
- Application Number
- JP2022520117
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2019-10-01
- Filing Date
- 2020-10-01
- Publication Date
- 2025-07-23
- Estimated Expiration
- 2040-10-01
AI Technical Summary
Existing methods for measuring biomarkers in interstitial fluid are invasive, painful, costly, and unsuitable for continuous monitoring, and existing devices for extracting fluid samples often cause discomfort and are complex to manufacture.
A system comprising microstructures with aptamers for binding to analytes, sensors for measuring response signals, and electronic processing devices for analyzing these signals to determine the presence, level, or concentration of biomarkers, which can be worn on the skin and penetrate the stratum corneum without entering the dermis.
Enables non-invasive, comfortable, and cost-effective continuous monitoring of biomarkers, reducing discomfort and complexity in device manufacturing while providing accurate and reliable measurements.
Smart Images

Figure 0007712266000008 
Figure 0007712266000009 
Figure 0007712266000010
Abstract
Description
Technical Field
[0001] This application claims priority to Australian Provisional Patent Application No. 201903696, entitled "Analyte Measurement System", filed on October 1, 2019, the entire content of which is incorporated herein by reference.
[0002] Background of the Invention The present invention relates to systems and methods for performing measurements on a subject, and in one particular example, to performing measurements of analytes in a subject by using microstructures to breach the subject's functional barriers.
Background Art
[0003] Any reference in this specification to any prior publication (or information derived therefrom) or to any matter which is known is not, and should not be taken as, an admission or any form of suggestion that such prior publication (or information derived therefrom) or known matter forms part of the common general knowledge in the field of endeavour to which this specification relates.
[0004] Biomarkers, such as proteins, antibodies, cells, small chemicals, hormones and nucleic acids, whose abundance, either excessive or sub - normal, may indicate a disease state, are found in serum and their levels are routinely measured for research and clinical diagnosis. Standard tests include antibody assays for detecting infections, allergic reactions and blood - derived cancer markers (e.g., prostate - specific antigen assay for detecting prostate cancer). Biomarkers can be derived from many organ systems in the body but are extracted from a single compartment, venous blood.
[0005] However, since blood often does not contain important biomarkers for diseases originating from solid tissues, this is not suitable for all symptoms, and this problem has been partially overcome by adopting tissue biopsies, but this is time-consuming, painful, dangerous, costly, and may require highly skilled personnel such as surgeons. Furthermore, these methods only provide an indication of the level of biomarkers at a single point in time.
[0006] Another fluid rich in serum is interstitial fluid (ISF) that fills the intercellular spaces in solid tissues and facilitates the passage of nutrients, biomarkers, and waste products through the bloodstream.
[0007] Patent Document 1 describes various uses of a device for delivering bioactive materials and other stimuli to living cells, a method for manufacturing the device, and the device for a plurality of medical applications. The device includes a plurality of structures that can penetrate the body surface to deliver the bioactive material or stimulus to the required site. The structures are typically solid, and the delivery end portion of the structure is sized such that it can be inserted into the target cells without such damage to deliver the bioactive material or stimulus to the target cells or a specific site therein.
[0008] The use of a micro-needle version of such an array in the collection of fluid samples is also known. However, these techniques focus on the use of microfluidic techniques such as capillary action or liquid delivery action for extracting fluids, as described in, for example, Patent Documents 2, 3, 4, 5, 6, 7, 8, 9, 10, and 11.
[0009] However, these systems have several drawbacks. First, the use of capillary action or liquid delivery typically requires a relatively large structure that can only be achieved using structures that penetrate the dermis and thus may collect a sample of blood rather than interstitial fluid. This can also cause discomfort and frustration to the subject from whom the sample is being taken. Second, the need for capillary action or liquid delivery makes the array complex in structure, difficult and expensive to manufacture due to the need for power, resulting in arrays that are prone to infection and unsuitable for general use.
[0010] For performing detection, other in vitro diagnostic devices such as the use of arrays comprising silicon nanowires, or other complex detection mechanisms such as the direct high-frequency detection of nucleotide hybridization are known. Again, the fabrication of such systems is complex and expensive, and again these are unsuitable for practical use.
[0011] Patent Document 12 describes devices and systems for measuring and / or monitoring analytes present in the skin. The system includes a skin-wearable device that can be attached to the outer epidermal skin surface and a reader device. The skin-wearable device includes a substrate, a plurality of microneedles, and nanosensors. The microneedles are attached to the substrate such that attachment of the substrate to the outer epidermal skin surface causes the microneedles to penetrate into the epidermis, intradermis, or dermis. The nanosensors include a detectable label and are configured to interact with a target analyte present in interstitial fluid in the epidermis, intradermis, or dermis. The reader device is configured to detect the analyte in the interstitial fluid via interaction with the skin-wearable device.
[0012] Patent Document 13 describes a system and method for regenerating aged skin using electromagnetic energy delivered using a plurality of needles that can penetrate the skin to a desired depth. A particular aspect of this invention is the ability to shield tissue regions from thermal exposure. This shielding of the tissue allows new tissue to regenerate while the heat treatment can contract collagen and tighten underlying structures. Further, this system can deliver therapeutically beneficial substances through the penetrating needles or through channels created by needle penetration.
[0013] Patent Document 14 describes a method for using an electric field to deliver a therapeutic agent or an immunological treatment to a subject by applying a non-invasive, user-friendly electrode to the surface of the skin. Thus, a therapeutic agent or an immunizing agent can be delivered into the skin cells for local and systemic treatments or for immunization with optimal gene expression and minimal tissue damage. Specifically, the therapeutic agent includes naked or formulated nucleic acids, polypeptides, and chemotherapeutic agents.
[0014] Patent Document 15 describes a monitoring device comprising a sensor device and an I / O device that communicates with the sensor device and generates data obtained using data from the sensor device. The data obtained cannot be directly detected by the associated sensor. Alternatively, a device comprising a wearable sensor device and an I / O device that communicates with the sensor device and includes means for displaying information and a dial for inputting information. Alternatively, a device for tracking calorie consumption data and calorie expenditure data comprising a sensor device and an I / O device that communicates with the sensor device. The sensor device comprises a processor programmed to generate data regarding calorie expenditure from the sensor data. Alternatively, a device for tracking calorie information for an individual that utilizes a plurality of classification identifiers for classifying meals consumed by the individual, each having a corresponding calorie amount.
[0015] Patent Document 16 describes a method, system, and / or device for enhancing the conductivity of electrical signals through a subject's skin using one or more micro-needle electrodes. The micro-needle electrodes can be applied to the subject's skin such that the electrodes are disposed in direct contact with the subject's skin. The micro-needles of the micro-needle electrodes can be inserted into the skin such that the micro-needles pierce the stratum corneum of the skin up to or through the dermis of the skin. An electrical signal passes or is conducted through the micro-needle electrodes and the subject's skin, or between the micro-needle electrodes and the subject's skin, and the impedance of the micro-needle electrodes is minimized and greatly reduced as compared with the prior art.
[0016] Patent Document 17 describes a biological information measurement sensor including a base portion having a plurality of biomarker measurement regions and a plurality of electrodes. Each of the plurality of electrodes is disposed on each of the plurality of biomarker measurement regions, and each of the plurality of electrodes includes a working electrode and a counter electrode spaced apart from the working electrode. The biological information measurement sensor also includes a plurality of needles. Each of the needles is disposed on each of the plurality of electrodes. Two or more of the plurality of needles have different lengths.
[0017] Patent Document 18 describes an apparatus for use in detecting an analyte in a subject, the apparatus comprising a plurality of structures provided on a patch, whereby applying the patch to the subject causes at least some of the structures to be inserted into the subject and targets one or more analytes and a reagent for detecting the presence or absence of the analyte.
Prior Art Documents
Patent Documents
[0018]
Patent Document 1
Patent Document 2
Patent Document 3
[0019] On one side, a system for performing measurements on a subject, comprising at least one substrate having one or more microstructures configured to penetrate the functional barrier of the subject, wherein the one or more microstructures comprise a substrate containing an aptamer for binding to one or more analytes; at least one sensor operably connected to the at least one microstructure, the at least one sensor being configured to measure a response signal from the at least one microstructure; and one or more electronic processing devices for determining the measured response signal and for performing at least partial analysis using the measured response signal to determine at least one type of indicator that at least partially indicates the presence, level or concentration of the analyte in the subject.
[0020] In one embodiment, the aptamer is a coating on the microstructure.
[0021] In one embodiment, the aptamer selectively binds to one or more analytes.
[0022] In one embodiment, the conformation of the aptamer changes when it binds to the analyte.
[0023] In one embodiment, the aptamer has a first conformation when not bound to the analyte and a second conformation when bound to the analyte.
[0024] In one embodiment, the aptamer contains a labeling moiety.
[0025] In one embodiment, the labeling moiety is a redox moiety.
[0026] In one embodiment, the redox moiety is selected from the group consisting of methylene blue, ferrocene, vinyl ferrocene, anthraquinone, Nile blue, thionin, anthraquinone-C5, dabsyl, 2,6-dichlorophenol-indophenol, garocyanine, ROX, pentamethyl ferrocene, ferrocene-C5, neutral red, and horseradish peroxidase.
[0027] In one embodiment, the redox moiety is methylene blue.
[0028] In one embodiment, the labeling moiety is a fluorescent label.
[0029] In one embodiment, the aptamer includes a moiety for attaching or immobilizing the aptamer to the surface of the microstructure.
[0030] In one embodiment, the moiety for attaching or immobilizing the aptamer to the surface of the microstructure is thiol, amine, carboxylic acid, alcohol, carbodiimide, Nafion, avidin, biotin, or azide.
[0031] In one embodiment, the moiety for attaching or immobilizing the aptamer to the surface of the microstructure is thiol.
[0032] In one embodiment, one or more microstructures are porous.
[0033] In one embodiment, one or more analytes are selected from the group consisting of nucleic acids, antibodies or their antigen-binding fragments, allergens, chemokines, cytokines, hormones, parasites, bacteria, viruses or virus-like particles, epigenetic markers, peptides, polypeptides, proteins, and small molecules.
[0034] In one embodiment, one or more analytes are proteins.
[0035] In one embodiment, the protein is troponin or a subunit thereof.
[0036] In one embodiment, the protein is troponin I.
[0037] In one embodiment, the protein is troponin I or a complex thereof.
[0038] In one embodiment, the protein is a cardiac troponin I-C complex.
[0039] In one embodiment, one or more analytes are cytokines.
[0040] In one embodiment, the cytokine is IL-6.
[0041] In one embodiment, the system is at least partially wearable.
[0042] In one embodiment, the system includes a signal generator operably connected to at least one microstructure for applying a stimulation signal.
[0043] In one embodiment, one or more processing devices are configured to at least one of: control the signal generator to perform a measurement; and control the signal generator according to the measured response signal.
[0044] In one embodiment, the response signal and the stimulation signal include electrical signals, and the substrate includes electrical connection lines that enable the electrical signals to be applied to and / or received from respective microstructures.
[0045] In one embodiment, the response signal and the stimulation signal include optical signals, and the substrate includes optical connection lines that enable the optical signals to be applied to and / or received from respective microstructures.
[0046] In one embodiment, the system includes one or more switches for selectively connecting at least one of at least one sensor and at least one signal generator to one or more of the microstructures.
[0047] In one embodiment, one or more processing devices are configured to control the switch to enable at least one measurement to be performed and / or to control which microstructure is used to measure a response signal / apply a stimulus.
[0048] In one embodiment, at least one of the substrate and the microstructures includes at least one of metal, polymer, and silicon.
[0049] In one embodiment, the substrate is at least partially flexible, configured to conform to the outer surface of the functional barrier, and / or configured to conform to at least a portion of the shape of the subject.
[0050] In one embodiment, the plate microstructure is at least partially tapered and has a substantially rectangular cross-sectional shape with rounded corners.
[0051] In one embodiment, the microstructure includes an anchor microstructure used to fix the substrate to the subject, and the anchor microstructure changes shape, changes shape in response to at least one type of substance in the subject and an applied stimulus, expands, expands in response to at least one type of substance in the subject and an applied stimulus, includes an anchor structure, has a greater length than that of other microstructures, is thicker than other microstructures, has a higher surface friction than other microstructures, is less pointed than other microstructures, is thicker than other microstructures, and / or penetrates into the dermis.
[0052] In one embodiment, the microstructures are applied to the skin of a subject, and at least some of the microstructures penetrate the stratum corneum; enter the living epidermis but not the dermis; and / or enter the dermis.
[0053] In one embodiment, at least some of the microstructures have at least one of the following dimensions: less than 2500 μm; less than 1000 μm; less than 750 μm; less than 450 μm; less than 300 μm; less than 250 μm; about 250 μm; about 150 μm; greater than 100 μm; greater than 50 μm; and greater than 10 μm in length; less than 2500 μm; less than 1000 μm; less than 750 μm; less than 450 μm; less than 300 μm; less than 250 μm; on a scale similar to the length; greater than the length; greater than the length; approximately the same as the length; about 250 μm; about 150 μm; and greater than 50 μm in maximum width; and less than the width; significantly less than the width; on a scale smaller than the length; less than 300 μm; less than 200 μm; less than 50 μm; about 25 μm; and greater than 10 μm in maximum thickness.
[0054] In one embodiment, at least some of the microstructures include a shoulder configured to abut the stratum corneum to adjust the penetration depth; and a shaft extending from the shoulder to a tip, wherein at least one of the shafts is configured to adjust the position of the tip in the subject.
[0055] In one embodiment, the microstructures are 2 less than 5000 per cm; 2 greater than 100 per cm; and 2 about 600 per cm in density; and at least one of less than 1 mm; about 0.5 mm; about 0.2 mm; about 0.1 mm; and greater than 10 μm in spacing.
[0056] In one embodiment, at least some of the microstructures comprise electrodes.
[0057] In one embodiment, at least one electrode extends over the length of the distal portion of the microstructured body; extends over the length of a portion of the microstructured body spaced from the tip; is disposed proximate to the distal end of the microstructured body; is disposed proximate to the tip of the microstructured body; extends over at least 25% of the length of the microstructured body; extends over less than 50% of the length of the microstructured body; extends over approximately 60 μm of the microstructured body; is configured to be disposed in the living epidermis of a subject during use; and, less than 200,000 μm 2 ; approximately 22,500 μm 2 ; having a surface area of at least 2,000 μm 2 and is at least one of at least one electrode having such a surface area.
[0058] In one embodiment, at least some of the microstructured bodies include at least a portion of an active sensor.
[0059] In one embodiment, at least some of the microstructured bodies include a conductive material.
[0060] In one embodiment, at least some of the microstructured bodies include an insulating layer extending over at least one of a portion of the surface of the microstructured body; the proximal end of the microstructured body; at least half of the length of the microstructured body; approximately 90 μm of the proximal end of the microstructure; and at least a portion of at least a part of the tip portion of the microstructured body.
[0061] In one embodiment, at least some of the microstructured bodies include a plate having a substantially flat surface including at least one electrode.
[0062] In one embodiment, at least some of the microstructured bodies are arranged in groups, and a response signal is measured between microstructured bodies in separate groups; a stimulus is applied between microstructured bodies in separate groups; a response signal is measured between microstructured bodies in a group; and at least one of the microstructured bodies is such that a stimulus is applied between the microstructures in a group.
[0063] In one embodiment, there is at least one of two groups, three groups, and more than three groups; the electrodes of the microstructures within each group are electrically connected; the groups are provided on a common substrate; and at least one of those provided on separate substrates; each group is a pair of microstructures comprising spaced plate microstructures having opposing substantially flat electrodes; each group comprises a plurality of spaced plate microstructures having substantially flat electrodes; and each group is at least one of those comprising a plurality of pairs of microstructures comprising spaced plate microstructures having opposing substantially flat electrodes.
[0064] In one embodiment, the groups include an opposing group including a plurality of opposing microstructures defining opposing electrodes, a reference group including a plurality of reference microstructures defining a reference electrode, and at least one working group including a plurality of working microstructures each defining a working electrode.
[0065] In one embodiment, the reference group is smaller than the working group and the opposing group, includes fewer microstructures than the working group and the opposing group, and is at least one of the reference groups disposed adjacent to each working group.
[0066] In one embodiment, at least some of the microstructures are angularly offset; at least some of the microstructures are arranged orthogonally; adjacent microstructures are arranged orthogonally; the microstructures are arranged in rows, and the microstructures in one row are angularly offset with respect to the microstructures in another row; the microstructures are arranged in rows, and the microstructures in one row are arranged orthogonally to the microstructures in another row; at least some pairs of the microstructures are angularly offset; at least some pairs of the microstructures are arranged orthogonally; adjacent pairs of the microstructures are arranged orthogonally; the pairs of the microstructures are arranged in rows, and the pairs of the microstructures in one row are angularly offset with respect to the pairs of the microstructures in another row; the pairs of the microstructures are arranged in rows, and the pairs of the microstructures in one row are arranged orthogonally to the pairs of the microstructures in another row; at least one of the microstructures is such that.
[0067] In one embodiment, the spacing between the electrodes in each group is less than 10 mm; less than 1 mm; about 0.1 mm; and at least one of more than 10 μm; the spacing between the groups of the microstructures is less than 50 mm; more than 20 mm; less than 20 mm; less than 10 mm; more than 10 mm; less than 1 mm; more than 1 mm; about 0.5 mm; and at least one of more than 0.2 mm; at least one of them is such that.
[0068] In one embodiment, one or more of the microstructures interact with one or more target analytes such that the response signal depends on the presence, level or concentration of the target analyte.
[0069] In one embodiment, the analyte interacts with a coating on the microstructure to change the electrical and / or optical properties of the coating, thereby enabling the analyte to be detected.
[0070] In one embodiment, the microstructure includes a bioactive material; a reagent for reacting with an analyte in a subject; a binder for binding to a target analyte; a material for binding to one or more target analytes; a probe for selectively targeting a target analyte; an insulator; a material for reducing biofouling; a material for attracting at least one substance to the microstructure; a material for repelling or excluding at least one substance from the microstructure; a material for attracting at least some analytes to the microstructure; and a material including at least one of a material for repelling or excluding at least some analytes from the microstructure.
[0071] In one embodiment, the substrate includes a plurality of microstructures, and the separate microstructures are at least one of microstructures that respond separately to an analyte; respond to separate analytes; respond to separate combinations of analytes; and respond to separate levels or concentrations of an analyte.
[0072] In one embodiment, at least some of the microstructures are at least one of microstructures that attract at least one substance to the microstructure; repel or exclude at least one substance from the microstructure; attract at least one analyte to the microstructure; and repel or exclude at least one analyte from the microstructure.
[0073] In one embodiment, at least some of the microstructures are at least partially coated.
[0074] In one embodiment, at least some of the microstructures are uncoated; at least some of the microstructures are porous and have an internal coating; at least some of the microstructures are partially coated; separate microstructures have separate coatings; separate portions of the microstructure include separate coatings; and at least some of the microstructures are at least one of microstructures having multiple coatings.
[0075] In one embodiment, a stimulus is used to release a substance from a coating on a microstructure; to break the coating; to dissolve the coating; and / or to release the coating.
[0076] In one embodiment, at least some of the microstructures are coated with a selectively soluble coating.
[0077] In one embodiment, the coating modifies surface properties for at least one of: interacting with an analyte; changing properties upon exposure to an analyte; changing shape to selectively immobilize a microstructure; increasing hydrophilicity; increasing hydrophobicity; and minimizing biofouling; provides a physical structure for at least one of: attracting at least one type of substance to the microstructure; repelling or excluding at least one type of substance from the microstructure; facilitating entry into a barrier; strengthening the microstructure; and fixing the microstructure in a subject; dissolves for at least one of: exposing the microstructure; exposing yet another coating; and exposing a material; provides a stimulus to a subject; confines a material; selectively releases a material; acts as a barrier to exclude at least one type of substance from the microstructure; and is at least one of a coating comprising at least one of polyethylene; polyethylene glycol; polyethylene oxide; zwitterion; peptide; hydrogel; self-assembled monolayer.
[0078] In one embodiment, the system includes an actuator configured to apply a force to a substrate for at least one of piercing the stratum corneum and entering the stratum corneum.
[0079] In one embodiment, the actuator is at least one of an electromagnetic actuator; a vibrating motor; a piezoelectric actuator; and a mechanical actuator.
[0080] In one embodiment, the actuator is configured to apply at least one of a biasing force, an oscillating force, and a single continuous force.
[0081] In one embodiment, the force includes a continuous force that is greater than 1 N, less than 10 N, less than 20 N, and at least one of about 2.5 to 5 N; and an oscillating force that is at least one of at least 1 mN, about 200 mN, and less than 1000 mN; and at least one of the forces applied at a frequency that is at least one of at least 10 Hz, about 100 to 200 Hz, and less than 1 kHz.
[0082] In one embodiment, at least one of the force and the frequency varies; varies according to at least one of the time of application, the depth of penetration, the degree of penetration, and the insertion resistance; increases with an increase in the depth of penetration; decreases with an increase in the depth of penetration; increases up to the point of penetration; and at least one of the force and the frequency decreases after the point of penetration.
[0083] In one embodiment, one or more electronic processing devices control the actuator.
[0084] In one embodiment, the system includes a housing that houses at least one sensor and at least one electronic processing device.
[0085] In one embodiment, the housing selectively couples to a substrate.
[0086] In one embodiment, the housing couples to the substrate using at least one of electromagnetic coupling, mechanical coupling, adhesive coupling, and magnetic coupling.
[0087] In one embodiment, at least one of the housing and the substrate is fixed to a subject; fixed to the subject using an anchor microstructure; fixed to the subject using an adhesive patch; and at least one of the housing and the substrate fixed to the subject using a strap.
[0088] In one embodiment, the housing comprises a housing connector that is operably coupled to a substrate connector on the substrate to communicate with the micro-structure.
[0089] In one embodiment, the system is configured to perform repeated measurements over a period of time, and the micro-structure is configured to remain within the subject during this period.
[0090] In one embodiment, the period is at least one of at least 1 minute; at least 1 hour; at least 1 day; and at least 1 week.
[0091] In one embodiment, the system is configured to perform repeated measurements at a frequency that is at least one of substantially continuously; every second; every minute; every 5 - 10 minutes; every hour; every day; and every week.
[0092] In one embodiment, one or more electronic processing devices analyze the measured response signal to determine at least one type of metric that at least partially indicates the physiological state of the subject.
[0093] In one embodiment, one or more electronic device processing devices analyze the measured response signal to determine at least one type of metric; and use at least one type of metric to determine at least one type of indicator, where at least one indicator at least partially indicates the physiological state of the subject.
[0094] In one embodiment, one or more electronic devices apply at least one type of metric to at least one computational model to determine an indicator, where at least one computational model represents the relationship between the health state and at least one type of metric.
[0095] In one embodiment, at least one computational model is obtained by applying machine learning to reference metrics derived from subject data measured for one or more reference subjects.
[0096] In one embodiment, one or more electronic devices are configured to determine an indicator by performing at least one of pattern matching; cross-sectional analysis; and comparison with a threshold value.
[0097] In one embodiment, one or more processing devices are configured to determine a physiological state indicative of at least one of the presence or absence or degree of a medical symptom; prognosis associated with a medical symptom; presence, level or concentration of a biomarker; presence, level or concentration of an analyte; body fluid level in a subject; blood oxygen saturation; and bioelectrical activity.
[0098] In one embodiment, one or more electronic devices are configured to generate at least one output including a notification; including a warning; indicating an indicator; derived from an indicator; and including a signal based on an indicator.
[0099] In one embodiment, the system includes a transmitter that transmits at least one of subject data derived from a measured response signal; at least one metric derived from a measured response signal; a display of the measured response signal; and at least one metric derived from subject data.
[0100] In one embodiment, one or more electronic processing devices perform at least one of generating subject data indicative of a measured response signal; at least partially processing the measured response signal; at least partially processing the subject data; at least partially analyzing the subject data; and storing a display of the subject data.
[0101] In one embodiment, the system includes a monitoring device and a patch including a substrate and a microstructure.
[0102] In one embodiment, the monitoring device is at least one of inductively coupled to the patch; attached to the patch; and brought into contact with the patch when a reading is to be performed.
[0103] In one embodiment, the monitoring device is configured to cause measurements to be performed; at least partially analyze the measurement values; control the stimuli applied to at least one microstructure; generate an output; provide an output indicating an indicator; transmit a signal based on the indicator; and cause a measure to be implemented, and is at least one of the monitoring devices.
[0104] In one embodiment, the system includes a wearable monitoring device that performs measurements; and a processing system that receives subject data derived from the measured response signals and analyzes the subject data to generate at least one type of indicator, where the at least one type of indicator at least partially indicates the health state of the subject.
[0105] In one embodiment, the system includes a client device that receives measurement data from a wearable monitoring device, generates subject data using the measurement data, transfers the subject data to a processing system, receives an indicator from the processing system, and displays a representation of the indicator.
[0106] In one embodiment, the system includes a substrate coil located on a substrate and operatively coupled to one or more microstructural electrodes; and an excitation and reception coil disposed proximate to the substrate coil, where a change in a drive signal applied to the excitation and reception coil serves as a response signal.
[0107] In one embodiment, one or more microstructural electrodes interact with one or more target analytes such that the response signal depends on the presence, level, or concentration of the target analyte.
[0108] In one embodiment, the system includes a first substrate coil positioned on a substrate and operably coupled to one or more first microstructured electrodes; a second substrate coil positioned on the substrate and operably coupled to one or more second microstructured electrodes, wherein the second microstructured electrodes are configured to interact with a target analyte; and at least one excitation and reception coil disposed proximate to at least one of the first substrate coil and the second substrate coil, the at least one excitation and reception coil being configured such that a change in a drive signal applied to the at least one excitation and reception coil serves as a response. One or more electronic processing devices use the first and second response signals to determine the presence, level, or concentration of the target analyte.
[0109] In one embodiment, first and second excitation and reception coils are disposed proximate to the first and second substrate coils, respectively, such that a change in a drive signal applied to each excitation and reception coil serves as a respective response signal.
[0110] In another aspect, a system for performing measurements on a subject includes at least one sensor configured to be operably connected to one or more microstructures configured to breach a functional barrier of the subject in use, the at least one sensor being configured to measure a response signal from the one or more microstructures, the one or more microstructures comprising at least one sensor having an aptamer for binding to one or more analytes; and one or more electronic processing devices that perform at least one of: determining the measured response signal; performing at least partially an analysis using the measured response signal; and storing data at least partially indicative of the measured response signal.
[0111] In a further aspect, there is provided a method for performing measurements on a subject, the method comprising the steps of: using at least one substrate comprising one or more microstructures for breaching a functional barrier of the subject, wherein the one or more microstructures comprise aptamers for binding to one or more analytes; using at least one sensor operably connected to the at least one microstructure for measuring a response signal from the at least one microstructure; and in one or more electronic processing devices, determining the measured response signal; and performing at least partial analysis using the measured response signal; and storing data at least partially indicative of the measured response signal, including at least one of the steps.
[0112] It will be understood that the broad forms of the invention and their respective features can be used together and / or independently, and that reference to individual broad forms is not intended to be limiting. Further, it will be understood that the features of the method can be implemented using a system or apparatus, and the features of the system or apparatus can be embodied using the method. BRIEF DESCRIPTION OF THE DRAWINGS
[0113] Next, various examples and embodiments of the invention will be described with reference to the accompanying drawings.
[0114]
Figure 1
Figure 2
Figure 3A
Figure 3B
Figure 3C
Figure 3D
Figure 3E
Figure 3F
Figure 3G
Figure 3H
Figure 3I
Figure 3J
Figure 3K
Figure 3L
Figure 3M
Figure 3N
Figure 3O
Figure 4A
Figure 4B
Figure 4C
Figure 4D
Figure 5A
Figure 5B
Figure 5C
Figure 5D
Figure 5E
Figure 5F
Figure 5G
Figure 5H
Figure 5I
Figure 5J
Figure 5K
Figure 5L
Figure 5M
Figure 5N
Figure 5O
Figure 5P
Figure 5Q
Figure 5R
Figure 5S
Figure 5T
Figure 5U
Figure 5V
Figure 5W
Figure 6A
Figure 6B
Figure 7A
Figure 7B
Figure 8A
Figure 8B
Figure 8C
Figure 8D
Figure 8E
Figure 9
Figure 10
Figure 11
Figure 12A
Figure 12B
Figure 13
Figure 14A
Figure 14B
Figure 15A
Figure 15B
Figure 15C
Figure 15D
Figure 15E
Figure 15F
Figure 15G
Figure 16A
Figure 16B
Figure 16C
Figure 17A
Figure 17B
Figure 17C
Figure 17D
Figure 17E
Figure 17F
Figure 17G
Figure 17H
Figure 17I
Figure 17J
Figure 17K
Figure 17L
Figure 17M
Figure 17N
Figure 17O
Figure 17P
Figure 18A
Figure 18B
Figure 18C
Figure 18D
Figure 18E
Figure 18F
Figure 18G
Figure 19A
Figure 19B
Figure 19C
Figure 19D
Figure 19E
Figure 19F
Figure 19G
Figure 19H
Figure 19I
Figure 19J
Figure 19K
Figure 19L
Figure 20A
Figure 20B
Figure 20C
Figure 20D
Figure 20E
Figure 20F
Figure 21A
Figure 21B
Figure 21C
Figure 21D
Figure 22A
Figure 22B
Figure 23
Figure 24A
Figure 24B
Figure 25A
Figure 25B
Figure 26A
Figure 26B
Figure 27A
Figure 27B
Figure 27C
Figure 27D
Figure 27E
Figure 27F
Figure 28A
Figure 28B
Figure 28C
Figure 29A
Figure 29B
Figure 30
Mode for Carrying Out the Invention
[0115] Definition Unless otherwise specified, all technical and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described. In the present invention, the following terms are defined below.
[0116] The articles "a" and "an" are used herein to refer to one or more than one (i.e., at least one) of the grammatical objects of the article. By way of example, "an element" means one element or more than one element.
[0117] The terms "about" and "approximately" are used herein to refer to a state that is about 20% (i.e., ±20%), particularly about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1% different from a particular state (e.g., amount, level, concentration, time, etc.).
[0118] As used herein, the term "analyte" refers to a natural and / or synthetic compound that is a marker of a symptom (e.g., drug abuse), a disease state (e.g., an infectious disease), a disorder (e.g., a neuropathy), or a normal or pathological process (e.g., drug metabolism) occurring in a subject, or a substance administered or ingested in a subject, such as a pharmaceutical (a substance that treats, prevents and / or alleviates the symptoms of a disease, disorder or condition, such as a drug, a vaccine, etc.), an illegal substance (e.g., an illegal drug), a non-illegal substance of abuse (e.g., alcohol or a prescription drug taken for non-medical reasons), a poison or a toxin (including environmental pollutants), a chemical weapon (e.g., a nerve gas, etc.) or a metabolite thereof, which can be used to monitor the level of the same. The term "analyte" can refer to any substance, including chemical and / or biological agents that can be measured in an analytical procedure, including nucleic acids, proteins, illegal drugs, explosives, toxins, pharmaceuticals, carcinogens, poisons, allergens and infectious agents that can be measured in an analytical procedure. An analyte may be a compound found directly in a sample such as a biological tissue, including a body fluid (e.g., interstitial fluid) from a subject, particularly in the dermis and / or epidermis. In certain embodiments, the analyte is a compound found in interstitial fluid. In some embodiments, the analyte is a compound having a molecular weight in the range of about 30 Da to about 100 kDa, particularly about 50 Da to about 40 kDa. Other suitable analytes are as described herein.
[0119] As used herein, the term "and / or" shall be taken to mean any and all combinations of one or more of the listed items and shall be construed accordingly when the alternative (or) is used, and shall include the lack of a combination when interpreted in this way.
[0120] As used herein, the term "aptamer" refers to a single-stranded oligonucleotide (e.g., DNA or RNA) that binds to a specific target molecule, such as an analyte. An aptamer can be of any size suitable for binding to such a target molecule, such as having a length of about 10 to about 200 nucleotides, particularly a length of about 30 to about 100 nucleotides.
[0121] Variations such as the terms "bind" and "binding" are used herein to refer to the interaction between two substances, such as an analyte and an aptamer. The interaction can be a covalent interaction or a non-covalent interaction, particularly a non-covalent interaction.
[0122] Throughout this specification and the appended claims, unless otherwise specified, variations such as the terms "comprise", "comprises", and "comprising" implicitly imply the inclusion of the stated integers or steps or groups of integers or steps, but do not implicitly imply the exclusion of any other integers or steps or groups of integers or steps. Thus, the use of terms such as "comprising" indicates that the listed integers are necessary or essential, but other integers are optional and may or may not be present. "Consisting of" means including and being limited to whatever follows the phrase "consisting of". Thus, the phrase "consisting of" indicates that the listed elements are necessary or essential and no other elements may be present. "Consisting essentially of" means including any elements listed after this phrase and being limited to other elements that do not interfere with or contribute to the function or action specified in the disclosure of the listed elements. Thus, the phrase "consisting essentially of" indicates that the listed elements are necessary or essential, but other elements are optional and may or may not be present depending on whether they affect the function or action of the listed elements.
[0123] The term "plurality" herein means two or more, such as from 2 to 1 × 10 15is used to refer to (or any integer in between) and includes 2, 10, 100, 1000, 10000, 1×10 6 、1×10 7 、1×10 8 、1×10 9 、1×10 10 、1×10 11 、1×10 12 、1×10 13 、1×10 14 、1×10 15 etc. (and all integers in between).
[0124] As used herein, the term "predetermined threshold value" refers to a value above or below which the presence or absence or progression of a disease, disorder or symptom; the presence or absence of an illegal substance or non - illegal abused substance; or the presence or absence of a chemical weapon, poison and / or toxin is indicated. For example, in the present invention, the predetermined threshold value may represent the level or concentration of a particular analyte in a corresponding sample from a suitable control subject, e.g., a healthy subject, or in a pooled sample from a plurality of control subjects, or the median or average value of a plurality of control subjects. Thus, a level or concentration above or below the threshold value indicates the presence or absence or progression of a disease, disorder or symptom; the presence or absence of an illegal substance or non - illegal substance; or the presence or absence of a chemical weapon, poison and / or toxin taught herein. In other examples, a level or ratio above or below the predetermined threshold value may represent a value greater than or less than the level or ratio determined for the control subject in order to incorporate a further degree of confidence in indicating the presence or absence or progression of a disease, disorder or symptom; the presence or absence of an illegal substance or non - illegal abused substance; or the presence or absence of a chemical weapon, poison and / or toxin. One of ordinary skill in the art can readily determine an appropriate predetermined threshold value based on the analysis of samples from suitable control subjects.
[0125] As used herein, the terms "selective" and "selectivity" refer to an aptamer that binds to a target analyte without substantial binding to one or more other analytes. Thus, an aptamer that is selective for an analyte, such as troponin or a subunit or complex thereof, exhibits a selectivity that is about 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold greater, or greater than about 500-fold greater than binding to one or more other analytes.
[0126] As used herein, the term "subject" refers to a subject vertebrate, particularly a subject mammal, for which monitoring and / or diagnosis of a disease, disorder or condition is desired. Suitable subjects include, but are not limited to, primates; birds; domestic animals such as sheep, cows, horses, deer, donkeys and pigs; laboratory test animals such as rabbits, mice, rats, guinea pigs and hamsters; companion animals such as cats and dogs; bats; and captured wild animals such as foxes, deer and dingos. In particular, the subject is a human.
[0127] System for performing measurements Next, an example of a system for performing measurements on a subject will be described with reference to FIG. 1.
[0128] In this example, the system includes at least one substrate 111 having one or more microstructures 112. In use, the microstructures are configured to penetrate a functional barrier belonging to the subject. In the present example, the functional barrier is the stratum corneum (SC), and the microstructures are configured to penetrate the stratum corneum SC by penetrating at least the viable epidermis (VE). In one particular example, the microstructures are configured not to penetrate the boundary between the viable epidermis VE and the dermis D, but this is not essential and a structure that penetrates the dermis may be used as described in more detail below.
[0129] This example describes the penetration of the stratum corneum SC, but this is not essential and it will be understood that these techniques may be equally applicable to other functional barriers. In this regard, a functional barrier is understood to include any structure, boundary or feature that impedes the passage of signals and / or analytes, such as biomarkers, whether physical or not. For example, a functional barrier may include one or more layers, mechanical discontinuities, such as discrete changes in the mechanical properties of tissues, tissue discontinuities, cell discontinuities, nerve barriers, sensory organ barriers, cell layers, skin layers, mucosal layers, internal or external barriers, internal barriers within organs, the skin, external barriers of organs other than epithelial or endothelial layers, etc. Functional barriers may include other internal layers or boundaries, such as light barriers, such as the melanin layer, electrical barriers, molecular weight barriers that impede the passage of biomarkers having a specific molecular weight, the basal layer boundary between the living epidermis and dermis, etc.
[0130] The nature of the microstructure varies according to the preferred embodiment. In one example, the microstructure may include a needle, but this is not essential, and more typical structures, such as plates, blades, etc., are used as described in more detail below.
[0131] The substrate and the microstructure may be made from any suitable material, and the material used depends on the intended application, for example, whether the structure needs to be optically and / or electrically conductive. The substrate can form part of the patch 110 that can be applied to the subject, but other arrangements may be used, for example, forming the substrate as part of a housing that houses other components.
[0132] In one example, at least one sensor 121 is provided that is operably connected to at least one microstructure 112, thereby enabling the measurement of response signals from each microstructure 112. In this regard, the term response signal is understood to include signals that are intrinsic within the subject, such as ECG (electrocardiogram) signals, etc., or signals induced as a result of the application of a stimulus, such as bioimpedance signals, etc.
[0133] The properties of the sensor vary according to the preferred embodiment and the nature of the detection being carried out. For example, the detection may include the detection of an electrical signal, in which case the sensor may be a voltage sensor or a current sensor, etc. Alternatively, an optical signal may be detected, in which case the sensor may be an optical sensor, such as a photodiode, a CCD (charge-coupled device) array, etc., while a temperature signal may be detected using a thermistor, etc.
[0134] The method by which the sensor 121 is connected to the microstructure 112 also varies according to the preferred embodiment. In one example, this is realized using a connection line between the microstructure 112 and the sensor, and the nature of the connection line varies according to the signal being detected, so the connection line may include an electrical conduction element that conducts an electrical signal, a waveguide, an optical fiber or other conductor that conducts an electromagnetic signal, or a heat conductor that conducts a heat signal. The connection line may also include a wireless connection line that enables the sensor to be remotely located. An ion connection may also be used. Further, the connection line may be provided as discrete elements, but in other examples, for example, when the substrate is fabricated from a conductive plate and then the conductive plate is electrically connected to all of the microstructures, the substrate provides the connection. As yet another alternative, the sensor may be embedded within the microstructure or formed from a part of the microstructure, in which case a connection line is not necessary.
[0135] The sensor 121 is operably connected to all of the microstructures 112, and the connection lines may be collective and / or independent. For example, as described in more detail below, one or more sensors may be connected to separate microstructures so as to enable separate response signals measured, for example, to define a reference electrode, a counter electrode, and one or more working electrodes, to be measured from separate groups of microstructures 112. However, this is not essential and any suitable configuration may be used.
[0136] Furthermore and / or alternatively, in some examples, the microstructure 112 may be configured to provide a stimulus in addition to providing detection. For example, the microstructure may be coupled to a signal generator that generates a stimulus signal, as described in more detail below. Such stimuli may here include electrical stimuli using a voltage or current source, optical stimuli using a visible or non-visible radiation source, such as an LED or a laser, thermal stimuli, etc., and may be emitted by the same microstructure or a different microstructure used to measure the response signal depending on the preferred embodiment. Furthermore and / or alternatively, other techniques may be used, such as exposing the subject to the microstructure and the materials thereon or therein to effect the stimulus. For example, a coating may be applied to the microstructure to enable the material to be delivered into the subject beyond a barrier, thereby stimulating a response within the subject.
[0137] These options enable a range of different types of detection to be carried out, including detecting electrical signals in the body, such as ECG signals, plethysmography signals, electromagnetic signals, or potentials generated by muscle, nerve tissue, blood, etc., detecting the photo-plethysmography effect, electromagnetic effects, such as fluorescence, detecting mechanical properties, such as stress or strain, etc. Detection may include detecting the body's response to an applied electrical signal, for example, to measure bio-impedance, bio-conductance or bio-capacitance, and may include detecting the presence, level or concentration of an analyte by detecting electrical or optical properties, etc.
[0138] The system further includes one or more electronic processing devices 122 that can form part of the measurement device and / or electronic processing devices that form part of one or more processing systems, such as computer systems, servers, client devices, etc., as described in more detail below. In use, the processing device 122 is adapted to receive signals from the sensor 121 and store or process the signals. For ease of illustration, the remainder of the description generally refers to a processing device, although multiple processing devices may be used, processing may be distributed among the devices as necessary, and it will be understood that a reference to a single arrangement may encompass multiple arrangements and vice versa.
[0139] Next, an example of how this is implemented is described with reference to FIG. 2.
[0140] Specifically, in step 200 of this example, the substrate is applied to the subject such that one or more microstructures penetrate the functional barrier and, in one example, enter the functional barrier. For example, when applied to the skin, the microstructures may penetrate the stratum corneum and enter the living epidermis as shown in FIG. 1. This may be achieved manually and / or by use of an actuator to help ensure successful penetration.
[0141] In step 210, a response signal within the subject is measured and a signal indicative of the measured response signal is provided to the electronic processing device 121. This is typically performed after application of the stimulus, although this is not essential and may vary depending on the nature of the detection being performed.
[0142] Next, one or more processing devices may analyze the obtained measurement data in step 220 and / or store data for subsequent analysis in step 230 based on the measurement data, or alternatively provide an output based on the measured response signal. For example, the processing device may display an indicator indicative of the measured response signal and / or a value derived therefrom. Alternatively, the processing device may generate a signal for intervention and initiate a measure, such as warning a clinician, trainer, or caregiver.
[0143] The analysis can be performed in any suitable manner, which will vary depending on the nature of the measurements being made. For example, this may involve examining the measured response signal values and using them to calculate an indicator indicative of the presence, degree, or prognosis of one or more medical conditions, the prognosis of a medical condition, the presence, level, or concentration of a biomarker, the presence, level, or concentration of an analyte, the presence or grade of cancer, the level of body fluid in a subject, blood oxygen saturation, tissue inflammatory state, bioelectrical activity, such as nerve, brain, muscle, or heart activity, or a range of other health states. This may be achieved by monitoring changes in the values over time and may include a comparison with values measured for a reference subject having a known medical condition. Further, and / or alternatively, the indicator may indicate a measured parameter related to the subject, such as the measured level or concentration of an analyte or other biomarker.
[0144] In any case, it will be understood that the system described above operates by providing microstructures configured to penetrate barriers, such as the stratum corneum, which enables them to be used to measure response signals within the subject, particularly within the epidermis and / or dermis. These response signals are then processed and subsequently analyzed to enable the derivation of various values that can indicate a particular measured value or one or more aspects of the subject's health state.
[0145] For example, the system can be configured to measure an analyte level or concentration, such as the level or concentration of a particular biomarker. Response signals may also be used to generate visualizations, one-dimensional, two-dimensional, or three-dimensional spatial mappings, mechanical properties, forces, pressures, muscle movements, details of blood pulse waves, presence, level, or concentration of an analyte such as analyte concentration, blood oxygen saturation, bioimpedance within the body, biocapacitance, bioconductance, or electrical signals such as ECG (electrocardiography) signals.
[0146] In one example, the system can be configured such that the measurement is performed at a particular location within a subject, such as within only the epidermis, only the dermis, etc. This enables detection of the targeted analyte to be performed with a high level of accuracy, providing higher quality data for more precise measurement of the analyte. Further, restricting the location at which the measurement is performed ensures that these measurements are repeatable, enabling more accurate long-term monitoring.
[0147] In contrast to conventional techniques, breaching and / or at least partially penetrating a functional barrier, such as the stratum corneum, enables the measurement to be performed inside or under the barrier, and particularly inside the epidermis and / or dermis, resulting in a significant improvement in the quality and magnitude of the detected response signal. In particular, this ensures that the response signal accurately reflects the state inside the human body, and particularly inside the epidermis and / or dermis, such as the presence, level, or concentration of a biomarker, the impedance of interstitial fluid, etc., as opposed to conventional in vitro measurements that are significantly affected by the environment outside the barrier, such as the physical properties of the skin surface, such as surface substance properties, presence of hair, sweat, mechanical movement of an attached sensor, etc.
[0148] For example, this enables the accurate measurement of high molecular weight biomarkers that would otherwise only poorly penetrate the skin. A good example of this is glucose, which is present outside the body, for example in sweat, but typically only at low concentrations, often takes a long time to measure, and the concentration in sweat does not necessarily reflect the current glucose level in the body. In contrast, this enables much more accurate measurements to be carried out by breaking through a barrier, in this case the stratum corneum. It will be understood that the same concept applies to a wide variety of different biomarkers or signals and the associated barriers that would otherwise prevent accurate measurement of the biomarker or signal.
[0149] For example, in the case of impedance measurements, microstructured electrodes tend to measure different impedances compared to standard surface electrodes, which indicates the fact that microstructured electrodes do not measure skin impedance and that the measured impedance is more indicative of the state inside the body. Since the contribution of skin surface impedance is significant in magnitude, this can result in the changes in impedance inside the body being hidden, meaning that skin-type measurements are less likely to be able to detect meaningful changes.
[0150] Yet another problem associated with skin-type impedance measurements is that the generated electric field tends to pass through the stratum corneum and the dermis and does not stay in the epidermis. An example of this is shown in Figure 16C.
[0151] In this example, the skin-type electrode 1601 results in an electric field 1602 that spreads into the stratum corneum SC, the viable epidermis VEPiD, and the dermis D. In contrast, the microstructured patch 1603 results in an electric field 1604 that stays within the viable epidermis VEPiD.
[0152] Examples of equivalent circuits obtained from skin-type measurements and epidermal measurements are shown in FIGS. 16A and 16B, respectively. In this regard, each equivalent circuit includes three circuits that represent the contribution of the flow of current in the orthogonal direction through the tissue for each layer. Thus, in the skin-type measurement shown in FIG. 16A, the impedance of the stratum corneum is represented by circuits C SC1 , R SC1 , C SC2 , R SC2 , C SC3 , R SC3 , the epidermis is represented by circuits C VE1 , R VE1 , C VE2 , R VE2 , C VE3 , R VE3 , and the dermis is represented by circuits C D1 , R D1 , C D2 , R D2 , C D3 , R D3 . In this example, R SC1 >> R VE1 , R SC2 >> R VE2 and R SC3 >> R VE3 , and the contribution of the impedance in the epidermal layer is minimal compared to the contribution of the impedance in the stratum corneum, meaning that the skin-type measurement reflects more of the impedance in the stratum corneum.
[0153] In contrast, in the case of epidermal detection alone shown in FIG. 16B, the impedance is represented only by circuits C VE1 , R VE1 , C VE2 , R VE2 , C VE3 , R VE3 , and thus the epidermal measurement reflects more of the fluid level in the epidermis.
[0154] Furthermore, in some instances, the microstructure penetrates into the barrier by a distance sufficient to enable measurements to be taken. For example, in the case of the skin, the microstructure is typically configured to enter the living epidermis but not the dermis. This results in a number of improvements including avoiding problems associated with penetration into the dermis, such as pain, erythema, petechiae, etc. caused by nerve exposure, compared to other invasive techniques. Avoiding penetration into the dermal boundary also significantly reduces the risk of infection, allowing the microstructure to remain implanted for an extended period, e.g., for several days, which in turn is used to perform long-term monitoring over an extended period. However, in some embodiments, penetration into the dermal barrier may be required, for example, when detecting troponin or its subunits or complexes.
[0155] The ability of the microstructure to remain in-situ ensures that measurements are taken at the same site within the subject, reducing the inherent variability resulting from the inaccuracies of transducer replacement that can occur with conventional techniques, and is thus particularly beneficial. Nevertheless, it will be appreciated that this system can be used in other ways, for example, to perform single-point monitoring.
[0156] In one example, this enables this arrangement to be provided as part of a wearable device, for example, while providing access to signals or biomarkers that cannot otherwise pass through a barrier, enabling measurements to be taken while the subject is engaged in normal activities and / or over a long period of time, which enables measurements to be carried out that are significantly better than existing surface-type measurement techniques. This in turn enables measurements that more accurately reflect the subject's health or other condition to be incorporated. For example, this enables fluctuations in the subject's symptoms to be measured over the course of a day, avoiding the situation where measurements are taken in an artificial setting, for example, typically within a clinic that does not represent the subject's actual symptoms. This enables monitoring to be carried out substantially continuously, which enables, for example, detection when symptoms occur in cases such as myocardial infarction, cardiovascular disease, vomiting, diarrhea, enabling more rapid intervention to be pursued.
[0157] The system described above can be applied to any part of the body and can thus be used with a wide range of different functional barriers. For example, the functional barrier can be an internal or external barrier, a skin layer, a mucosal layer, an internal barrier within an organ, an external barrier of an organ, an epithelial layer, an endothelial layer, a melanin layer, a light barrier, an electrical barrier, a molecular weight barrier, a basal layer or a stratum corneum. Thus, the microstructures can be applied to the buccal mucosa, the eye, or another epithelial layer, endothelial layer, etc. The following examples specifically focus on application to the skin, with the functional barrier including some or all of the stratum corneum, but it will be understood that this is for illustrative purposes and not limiting.
[0158] Further variations will become apparent from the following description.
[0159] In one example, the system typically includes a signal generator operably connected to at least one microstructure to apply a stimulus, typically by applying a stimulus signal to the microstructure. Here too, the way the signal generator is connected varies according to the preferred embodiment, which may be realized by connection lines, such as wired or wireless connection lines and / or by integrating the signal generator into the substrate and / or the microstructure. Examples of types of connection lines include mechanical, magnetic, thermal, electrical, electromagnetic, optical, etc.
[0160] The nature of the stimulus signal and the way it is applied varies according to the preferred embodiment, which may include any one or more of biochemical signals, chemical signals, mechanical signals, magnetic signals, electromagnetic signals, electrical signals, optical signals, thermal signals, or other signals. The stimulus signal may be used to enable a response signal to be measured and / or to initiate a biological response, and the signal is then measured. For example, this can be used to cause electroporation, to induce local inflammatory mediators, which in turn release biomarkers and enable their levels or concentrations to be measured. In this regard, electroporation or electroosmosis involves applying an electric field to cells to increase the permeability of the cell membrane and enable chemicals, drugs, or DNA to be introduced into the cells. In another example, a stimulus is used to disrupt a boundary within a subject, for example, disrupting the dermal boundary enables biomarkers within the dermal layer to be detected in the live epidermis without the need for penetration of the dermal layer by the microstructure. In yet another example, a stimulus can be used to initiate yet another effect. Thus, for example, an electrical or mechanical signal may be used to disrupt a coating on a microstructure and release a substance, and the released substance can then be a chemical stimulus or other stimulus.
[0161] Stimulating signals may also be applied to the microstructure to change its shape or function. For example, while the polymer microstructure is induced to elongate or contract along its length or width by an applied electric field or temperature, the microstructure may be configured to move between a folded flat position and an extended upright position in order to penetrate the skin or other barrier and then retreat from the skin or other barrier.
[0162] In one example, the operation of the signal generator is controlled by a processing device, and the processing device controls the signal generator, thereby enabling measurements to be carried out, for example, by sending an electrical signal so that impedance measurements are performed. Further, and / or alternatively, the processing device may be able to control the signal generator according to the measured response signal, for example, if certain criteria are met, enabling a stimulus to be applied to the subject and / or the microstructure. For example, in a theranostic application, the signal applied to the microstructure is used to release a therapeutic substance. In this example, the processing device can monitor the response signals, use them to evaluate when intervention is necessary, and then control the signal generator to initiate the release. In one example, such control may be carried out according to an administration plan, for example, specifying the dose and the timing of dose delivery, if it is determined that treatment is required. In this example, the administration plan may be pre-determined and stored internally, or may be manually entered by a clinician or other individual as needed.
[0163] As described above, the signal generator and / or sensor can be connected to the microstructure via a connection line. The nature of the connection line varies according to the preferred embodiment and the nature of the signal. For example, when the signal is an optical signal or other electromagnetic signal, a waveguide, an optical fiber cable, or other electromagnetic conductor can be used. In the case of an electrical signal, the connection line may be a conductive connection line on the substrate, such as a fine wire or a conductive track, or may be formed by a conductive substrate. The connection line may also include a wireless connection line, such as a short-range high-frequency wireless connection line, an inductive connection line, etc. The connection line may also be mechanical, magnetic, thermal, etc.
[0164] In one example, an inductive connection can be used to transmit signals and power, and thus, for example, inductive coupling may be used to supply power to an electronic circuit mounted on a substrate. This may be used to enable internal implementation on the substrate to amplify and process impedance changes using basic processing, such as a simple integrated circuit that does not require an embedded power supply on the substrate.
[0165] In one example, the system can include a response microstructure used to measure a response signal and / or a stimulus microstructure used to apply a stimulus signal to a subject. Thus, the stimulus and the response may be measured by separate microstructures, in which case the substrate typically incorporates a response signal line to enable measurement of the response signal and a stimulus wiring to enable application of the stimulus signal. In some examples, a plurality of stimulus connection lines and response connection lines are provided to enable separate measurements to be performed via separate connection lines. For example, separate types of measurements may be performed by separate microstructures or separate parts of a given microstructure to enable multimode detection. Additionally and / or alternatively, for example, the same type of measurement may be performed at different positions and / or depths to identify the presence of a localized problem, such as skin cancer. In other cases, for example, when performing bipolar impedance measurements, the stimulus and the measurement may be performed via the same connection line.
[0166] Signals may be applied to individual microstructures or signals from individual microstructures may be measured, and / or signals may be applied to separate portions of the microstructures, which may be useful for identifying features at separate locations and / or depths within the body. This may be used, for example, to perform mapping or tomography, for example, to create an image whose image contrast or color is proportional to the level or concentration of one or more analytes or a change in a physical property such as bioimpedance. Further, and / or alternatively, signals may be applied to a plurality of microstructures as a whole or signals from a plurality of microstructures as a whole may be measured. This may be used to improve signal quality or to perform measurements, such as bipolar, quadrupole or other multipole impedance measurements. Further and / or alternatively, microstructures may be used for both measurement and stimulation, for example, to apply a signal to a microstructure and subsequently measure a response.
[0167] In one particular example, one or more switching devices, such as a multiplexer, can be used to connect sensors and / or signal generators to the microstructures, enabling signals to be selectively communicated between the sensors or signal generators and separate microstructures. The processing device is typically configured to control the switches, enabling various separate sensing and stimulation to be realized under the control of the processing device. In one example, this enables at least some electrodes to be used independently of at least some other electrodes. This ability to selectively interrogate separate electrodes provides advantages.
[0168] For example, this enables separate electrodes to have separate functional groups by, for example, functionalizing the separate electrodes with separate coatings and then examining or stimulating as necessary, such that separate measurements can be carried out as desired. Further, and / or alternatively, this enables separate measurements to be carried out by separate microstructures, for example, for spatial differentiation and thus mapping. For example, examining electrodes at separate locations on a patch enables a map of the measurement values at the separate locations to be constructed, which can in turn be used to localize an effect, and the same is true for the presence of an analyte or a particular object, such as a lesion or cancer. Further, this enables stimulation to be delivered to separate microstructures. For example, in a theranostic embodiment, separate therapeutic substances or dosages may be associated with separate microstructures, such that selective stimulation of the separate microstructures enables separate interventions within a range to be carried out. In some examples, separate microstructures may be used for separate purposes, such that some microstructures are used for sensing while others are used for delivering stimulation and / or therapeutic agents.
[0169] In another example, described in more detail below, when electrodes are provided as pairs, this enables some pairs of electrodes to be used independently of other pairs. In one particular example, the electrodes and / or pairs of electrodes can be arranged in rows, which can enable measurements to be carried out row by row, although this is not essential and other grouping methods may be used.
[0170] The properties of the substrate and / or the microstructure vary according to the preferred embodiment. For example, the substrate and / or the microstructure may be made of or include cloth, woven fabric, electronic cloth, natural fiber, silk, organic material, natural composite, artificial composite, ceramics, stainless steel, ceramics, metal such as stainless steel, titanium or platinum, polymer such as a hard or semi-hard plastic including a doped polymer, silicon or other semiconductor including a doped semiconductor, organosilicate, gold, silver, carbon, carbon nanomaterial, etc. The substrate and the microstructure may be made of similar or dissimilar materials, formed integrally or made separately and bonded together. The microstructure may be provided on one or more substrates, so that, for example, signals may be measured or applied between the microstructures on separate substrates.
[0171] The particular materials used depend on the intended application, so that, for example, different materials are used if the microstructure needs to be conductive as opposed to being insulating. To provide the required conductivity, insulating materials such as polymers and plastics may be doped, for example by doping with metal particles of micro or nano size, or conductive composite polymers such as PEDOT:PSS (poly(3,4-ethylenedioxythiophene) polystyrene) may be used. If doping is used, this includes using graphite or graphite derivatives including 2D materials such as graphene and carbon nanotubes, which materials can also be used as stand-alone materials or as dopants in blends with polymers or plastics.
[0172] The substrate and the microstructure can be manufactured using any suitable technique. For example, in the case of a silicon-based structure, this may be carried out using etching techniques. A polymer or plastic structure may be manufactured using additive manufacturing, such as 3D printing or molding methods. In one particular example, a suitable filling material, such as an active compound and / or a sugar-based excipient, for example a solution containing a material such as carboxymethyl cellulose (CMC), or one or more polymers, etc., fills the mold, and then the filling material is cured and removed. As will be discussed in more detail below, it will be understood that the filling material may contain any necessary probes, reagents, etc. that are to be included within the structure. A photosensitive polymer, such as a photoresist containing SU8 or polyimide, may be used for direct patterning of electrodes on the substrate or for fabricating the microstructure. Continuous layers of photosensitive resist, polymer, metal, etc. can be deposited and / or selectively removed to produce the required 3D microstructure geometry.
[0173] In one example, the substrate may be at least partially flexible in order to enable the substrate to conform to the shape of the subject, thereby ensuring the penetration of the microstructure into the living epidermis and / or dermis, or other functional barriers. In this example, the substrate may potentially be a fabric or cloth, with electrodes and circuits woven in, or a plurality of substrates may be attached onto a flexible backing to provide a segmented substrate arrangement. Alternatively, the substrate may be shaped to conform to the shape of the subject, so that the substrate is rigid but still ensures the penetration of the microstructure.
[0174] In a preferred example, the substrate and the microstructure are formed from one or more of metal, polymer or silicon.
[0175] The microstructures may have a range of different shapes and may include ridges, needles, plates, blades, etc. In this regard, the terms plate and blade are used interchangeably to refer to microstructures that have a width that is on the order of the same size as the length but are significantly thin. The microstructures can be tapered to facilitate insertion into a subject and can have various cross-sectional shapes, for example, depending on the intended purpose. The microstructures typically have a rectangular shape with corners and may include shape variations along the length of the microstructures. For example, the microstructures may include a shoulder configured to abut the stratum corneum to control the depth of penetration and / or a shaft extending to a tip, and the shaft may be configured to control the position of the tip portion in the subject and / or to provide a surface for an electrode.
[0176] Examples of other shapes can enable an increase in surface area and are useful when coating the microstructures to maximize the coating volume and thus the amount of payload delivered per microstructure, and include circular, rectangular, cross-shaped, square, square with corners, rectangular with corners, oval, etc., although it will be understood that a range of other shapes may be used.
[0177] The microstructure can have a rough or smooth surface, or surface features such as pores, protrusions, serrations, etc. that increase the surface area and / or assist in penetrating or engaging with tissue, thereby securing the microstructure within the subject. This can also assist in reducing biofouling, for example, by inhibiting the attachment and thus growth of biofilms. The microstructure can also be hollow or porous and can include internal structures such as holes, in which case the cross-sectional shape can also be at least partially hollow. In certain embodiments, the microstructure is porous, which can increase the effective surface area of the microstructure. The pores can be of any suitable size depending on the size of the target analyte, such that the target analyte can enter the pores but one or more other analytes or substances are excluded. In some embodiments, the pores can have a diameter of less than about 10 μm, preferably less than about 1 μm.
[0178] In one example, the microstructure has a rectangular shape with corners when viewed in a cross-section that extends laterally through the microstructure and passes through a plane parallel to but offset from the substrate. The microstructure can include shape variations along the length of the microstructure. For example, the microstructure can include a shoulder and / or an axis that extends to a tip configured to abut the stratum corneum to control the depth of penetration, where the axis is configured to control the position of the tip within the subject and / or provide a surface for an electrode.
[0179] Separate microstructures are provided on a common substrate to achieve separate functions, for example, microstructures of different shapes may be provided. In one example, this may include performing different types of measurements. In other examples, microstructures are provided on separate substrates, for example, enabling detection to be performed by microstructures on one patch and delivery of a therapeutic agent to be performed by microstructures on another patch. In this example, this may allow the detection patch to remain in-situ while the treatment patch is replaced when it becomes ineffective. Further, measurements may be performed between patches, for example, whole body impedance measurements may be performed between patches provided at different locations on a subject.
[0180] Furthermore and / or alternatively, anchor microstructures may be provided that can be used to fix the substrate to the subject. In this regard, the anchor microstructures typically have a greater length than those of the microstructures, which helps to hold the substrate in a fixed position on the subject, prevents the substrate from moving during measurement, or ensures that it is not accidentally removed. The anchor microstructures can comprise fixation structures, such as protrusions, that assist in engaging with the tissue, and these may be formed by the shape of the microstructures and / or the shape of the coating. Further, the coating may include a hydrogel or other similar material that swells when exposed to moisture in the subject, thereby facilitating engagement with the subject. Similarly, the microstructures may expand in response to a change in shape, for example, in response to exposure to a substance, such as water or moisture in the subject, or in response to an applied stimulus. When applied to the skin, the anchor microstructures enter the dermis to help hold the substrate in place, and thus are longer than other microstructures, although this is not essential and depends on the preferred embodiment. In other examples, the anchor microstructures are coarser than other microstructures, have a higher surface friction than other microstructures, are less pointed than other microstructures, or are thicker than other microstructures.
[0181] In yet another example, at least a portion of the substrate may be coated with an adhesive coating to enable the substrate and thus the patch to adhere to the subject.
[0182] As described above, when applied to the skin, the microstructures typically enter the living epidermis and, in one example, do not enter the dermis, although in other examples they may enter the dermis. However, this is not essential and in some applications, primarily depending on the nature of the sensing being performed, it may be necessary for the microstructures to enter the dermis, for example, to protrude briefly through the living epidermis / dermis boundary or to enter a significant distance into the dermis. In one example, in the case of the skin, the microstructures have a length that is less than 2500 μm, less than 1000 μm, less than 750 μm, less than 600 μm, less than 500 μm, less than 400 μm, less than 300 μm, less than 250 μm, greater than 100 μm; greater than 50 μm and greater than 10 μm, although it will be understood that other lengths may be used. More generally, when applied to a functional barrier, the microstructures typically have a length that is greater than the thickness of the functional barrier, at least 10% greater than the thickness of the functional barrier, at least 20% greater than the thickness of the functional barrier, at least 50% greater than the thickness of the functional barrier, at least 75% greater than the thickness of the functional barrier, and at least 100% greater than the thickness of the functional barrier.
[0183] In another example, the microstructure has a length that is 2000% or less greater than the thickness of the functional barrier, 1000% or less greater than the thickness of the functional barrier, 500% or less greater than the thickness of the functional barrier, 100% or less greater than the thickness of the functional barrier, 75% or less greater than the thickness of the functional barrier, or 50% or less greater than the thickness of the functional barrier. This can avoid deep penetration into the underlying layers in the body, which may become unfavorable this time. The length of the microstructure used varies according to the intended use, and in particular, the nature of the barrier to be breached and / or the signal applied or measured. The length of the microstructure may also be uneven. For example, it allows the blade to be higher at one end than the other, which can facilitate penetration into the subject or the functional barrier.
[0184] Similarly, the microstructure has various widths according to the preferred embodiment. Typically, the width is at least one of less than 25% of the length, less than 20% of the length, less than 15% of the length, less than 10% of the length, or less than 5% of the length. Thus, for example, when applied to the skin, the microstructure may have a width of less than 50 μm, less than 40 μm, less than 30 μm, less than 20 μm, or less than 10 μm. However, alternatively, the microstructure may comprise a blade and may be wider than the length of the microstructure. In one example, the microstructure may have a width of less than 50000 μm, less than 40000 μm, less than 30000 μm, less than 20000 μm, less than 10000 μm, less than 5000 μm, less than 2500 μm, less than 1000 μm, less than 500 μm, or less than 100 μm. In the example of a blade, it may be possible to use a microstructure having a width up to substantially the width of the substrate.
[0185] Generally, the thickness of the microstructure is significantly reduced to facilitate penetration, typically less than 1000 μm, less than 500 μm, less than 200 μm, less than 100 μm, less than 50 μm, less than 20 μm, less than 10 μm, at least 1 μm, at least 0.5 μm or at least 0.1 μm. Generally, the thickness of the microstructure is governed by mechanical requirements, in particular the need to ensure that the microstructure does not break, bend or deform when penetrated. However, this problem is alleviated by the use of a coating that adds additional mechanical strength to the microstructure.
[0186] In one particular example, for epidermal sensing, the microstructure has a length of less than 300 μm, greater than 50 μm, greater than 100 μm, and about 150 μm, and a width that is generally equal to or greater than the length of the microstructure, typically less than 300 μ, greater than 50 μm, and about 150 μm. In another example, for dermal sensing, the microstructure has a length of greater than 450 μm, greater than 100 μm, and about 250 μm, and a width that is greater than or approximately equal to the length of the microstructure, and at least on the same scale as the length, and typically less than 450 μm, greater than 100 μm, and about 250 μm. In other examples, longer microstructures may be used, so that for example for subdermal sensing, the microstructure will have a greater length. The microstructure typically has a thickness that is less than the width, significantly less than the width, and one order of magnitude less than the width. In one example, the thickness is less than 50 μm, greater than 10 μm, and about 25 μm, while the microstructure typically comprises a flare-type base for additional strength, and thus has a base thickness proximate to the substrate that is about three times the thickness, typically less than 150 μm, greater than 30 μm, and 75 μm. The microstructure typically has a tip that has a length that is less than 50% of the length of the microstructure, at least 10% of the length of the microstructure, and more typically about 30% of the length of the microstructure. The tip further has a sharpness of at least 0.1 μm, less than 5 μm, and typically about 1 μm.
[0187] In one example, the microstructure is relatively low, e.g., cm 2Less than 10,000 per, for example cm 2 Less than 1,000 per, cm 2 Less than 500 per, cm 2 Less than 100 per, cm 2 Less than 10 per, or cm 2 Has a density of even less than 5 per. Using a relatively low density facilitates the penetration of the microstructures through the stratum corneum, and in particular, it avoids problems related to the penetration of high-density arrays into the skin, which now requires high-power actuators for the array to be correctly applied. However, this is not essential, cm 2 Less than 50,000 microstructures per, cm 2 Higher-density microstructural configurations may be used, including less than 30,000 microstructures per, etc. As a result, the microstructures typically have a spacing between less than 20 mm, less than 10 mm, less than 1 mm, less than 0.1 mm or less than 10 μm. In some situations, the microstructures are arranged in pairs, each pair of microstructures having a small spacing, for example less than 10 μm, while the pairs have a large spacing, for example greater than 1 mm, to ensure that a low overall density is maintained. However, this is not essential, and it will be understood that higher densities may be used in some situations.
[0188] In one particular example, the microstructures are, cm 2 Less than 5,000 per, cm 2 Greater than 100 per, cm 2 Has a density of approximately 600 per, resulting in a spacing of less than 1 mm, greater than 10 μm, approximately 0.5 mm, 0.2 mm or 0.1 mm.
[0189] In one example, when optical sensing is performed, the wiring in the substrate includes an optical fiber that extends through a waveguide or other electromagnetically conductive path, such as a microstructure, to one or more ports of the microstructure, enabling electromagnetic radiation to be emitted from or received by the ports. In one example, this is achieved by fabricating or incorporating the microstructure from a polymer or other similar material that is at least partially transparent to the frequency of the applied or received electromagnetic radiation and may include visible radiation, ultraviolet radiation, infrared radiation, etc., depending on the preferred application.
[0190] In one example, a core that is at least partially electromagnetically transparent is surrounded by an electromagnetically opaque outer layer, and the ports can extend through the opaque layer to enable electromagnetic radiation to be emitted from or received by the ports. In this example, it will be understood that proper positioning of the ports enables the radiation to be emitted or received and, in a targeted manner, for example, enables it to be directed to a specific depth within a living epidermis or elsewhere. In one example, the transparent core may be fabricated from a waveguide, such as an optical fiber cable or a portion thereof. For example, the outer layer and / or reflective layer may be removed to enable the transparent core of the microstructure to be fabricated from an optical fiber core. In yet another example, the microstructure includes an electromagnetically reflective layer to enable electromagnetic radiation to be directed to and from a designated port.
[0191] A similar arrangement may be provided for electrical signals, where the microstructure includes an electrically conductive core material and optionally an electrically insulating layer with ports to enable electrical signals to be emitted from or received by the ports, where again the ports are optionally at different depths to enable electrical signals to be measured at different positions and / or depths.
[0192] Accordingly, the microstructures may include an electrically conductive material covered by a non-conductive (insulating) layer, with openings providing access to the conductive material and enabling conduction of electrical signals through the openings, thereby defining electrodes. In one example, the insulating layer extends over a portion of the surface of the microstructure including the proximal end portion of the microstructure adjacent to the substrate. The insulating layer may extend over at least half of the length of the microstructure and / or from about 60 μm, 90 μm or 150 μm from the proximal end of the microstructure and optionally over at least a portion of the distal portion of the microstructure. In one particular example, this is implemented such that a non-insulated portion is provided in the epidermis and / or dermis, and a stimulation signal is applied to and / or a response signal is received from the epidermis and / or dermis. The insulating layer may extend over a part or all of the surface of the substrate. In this regard, in some examples, connection lines are formed on the surface of the substrate, and in that case, a coating may be used to insulate them from the subject. For example, electrical pathways on the surface of the substrate may be used to provide electrical connection lines to the electrodes, and an insulating layer is provided over the connection lines to ensure that the connection lines do not make electrical contact with the skin of the subject, which may otherwise affect the measured response signal.
[0193] In another example, at least some of the microstructures comprise electrodes. The microstructures may be fabricated from a metal or other conductive material, so that the entire microstructure constructs an electrode, or alternatively, the electrode may be coated or deposited on the microstructure, for example, by depositing a layer of gold to form the electrode. In yet another example, the microstructure may include a conductive core covered by a non-conductive layer, with openings providing access to the core and enabling conduction of electrical signals through the openings. The electrode material may include any one or more of gold, silver, silver colloid, gold colloid, carbon colloid, carbon nanomaterials, platinum, titanium, stainless steel or other metals, or any other biocompatible conductive material.
[0194] The electrodes may be used to apply an electrical signal to a subject and measure an endogenous or exogenous response electrical signal, for example, to measure an ECG or impedance. In another example, one or more microstructured electrodes interact with one or more target analytes such that the response signal depends on the presence, level or concentration of the one or more target analytes, thereby enabling the level or concentration of the one or more analytes to be quantified.
[0195] In one example, the microstructure comprises a plate having a substantially flat surface with an electrode thereon. Using a plate shape maximizes the surface area of the electrode while minimizing the cross-sectional area of the microstructure, thereby facilitating the penetration of the microstructure into the subject. This enables the electrode to act as a capacitive plate and enables capacitive sensing to be performed. In one example, the electrode is at least 10 mm 2 at least 1 mm 2 at least 100,000 μm 2 10,000 μm 2 at least 7,500 μm 2 at least 5,000 μm 2 at least 2,000 μm 2 at least 1,000 μm 2 at least 500 μm 2 at least 100 μm 2 or at least 10 μm 2 in surface area. In one example, the electrode has a width or height that is at most 2500 μm, at least 500 μm, at least 200 μm, at least 100 μm, at least 75 μm, at least 50 μm, at least 20 μm, at least 10 μm or at least 1 μm. In the case of an electrode provided on a blade, the electrode width may be less than 50000 μm, less than 40000 μm, less than 30000 μm, less than 20000 μm, less than 10000 μm or less than 1000 μm and may also include the widths schematically shown previously. In this regard, these dimensions apply to individual electrodes and it should be noted that in some examples each microstructure may include a plurality of electrodes.
[0196] In one particular example, the electrode has a surface area of less than 200,000 μm 2 and at least 2,000 μm 2 and about 22,500 μm 2 and is optionally spaced from the tip and optionally disposed proximate to the distal end of the microstructure over the length of the distal portion of the microstructure, and here also extends proximate to the tip of the microstructure. The electrode extends over at least 25% and less than 50% of the length of the microstructure, and thus the electrode can typically extend over about 60 μm, 90 μm or 150 μm of the microstructure and is thus disposed in the living epidermis and / or dermis of the subject during use.
[0197] In one example, at least some of the microstructures are arranged in groups, such as pairs, and a response signal or stimulus is measured from or applied to the microstructures within the group. The microstructures within the group can have a particular configuration to enable a particular measurement to be carried out. For example, when arranged in pairs, a separation distance can be used to affect the nature of the measurement being carried out. For example, when performing bioimpedance measurements, if the distance between the microstructures is greater than 2,3 millimeters, then there is a tendency to measure the properties of the interstitial fluid disposed between the electrodes, but if the distance between the microstructures is reduced, the measured value is more affected by surface properties, such as the presence of material bound to the surface of the microstructure. The measurement is also affected by the nature of the applied stimulus, and thus, for example, a low-frequency current tends to flow through the extracellular fluid, but a higher-frequency current is more affected by the intracellular fluid.
[0198] In one particular example, plate microstructures are provided in pairs, each pair comprising spaced-apart plate microstructures having substantially flat electrodes facing each other. This can be used to generate a highly uniform electric field in a subject within the region between the electrodes and / or to perform capacitive or conductivity sensing of substances between the electrodes. However, this is not essential and other configurations, for example using a plurality of electrodes spaced circumferentially around a central electrode, can be used. Typically, the spacing between the electrodes in each group is typically less than 50 mm; less than 20 mm, less than 10 mm, less than 1 mm, less than 0.1 mm or less than 10 μm, although it will be understood that larger spacings can be used, up to and including the dimensions of the substrate and / or larger spacings if the microstructures are distributed across a plurality of substrates.
[0199] Thus, in one particular example, at least some of the microstructures are arranged in pairs and response signals are measured between the microstructures in a set and / or a stimulus is applied between the microstructures in a pair. Each pair of microstructures typically includes spaced-apart plate microstructures having substantially flat electrodes facing each other and / or spaced-apart substantially parallel plate microstructures. This arrangement allows each pair to function as an individual sensor and can be used to perform sensing independently through each pair using a signal generator and appropriate connection lines to the sensor.
[0200] However, this is not essential and instead, response signals can be measured between microstructures in separate groups and / or a stimulus can be applied between microstructures in separate groups. In this example, each group can include a plurality of microstructures or a plurality of pairs of microstructures. For example, each group can include a plurality of separate spaced-apart plate microstructures having substantially flat electrodes or a plurality of pairs of microstructures including separate spaced-apart plate microstructures having substantially flat electrodes facing each other.
[0201] Furthermore, the microstructures or pairs of microstructures within each group are electrically connected, such that each group can function collectively as a single electrode. In this example, a plurality of separate groups, such as two groups, three groups or four or more groups, are provided depending on the type of measurement to be performed. For example, the groups can include a counter group including a plurality of counter microstructures defining a counter electrode, a reference group including a plurality of reference microstructures defining a reference electrode, and one or more working groups, each working group including a plurality of working microstructures defining a respective working electrode. This enables measurements, such as cyclic voltammetry measurements, to be performed.
[0202] Generally, when a reference group, a counter group and a working group are provided, the reference group includes fewer microstructures than the working group and the counter group, or less microstructures than the working group and the counter group, and can be arranged adjacent to each working group.
[0203] In these examples, the groups can be provided on a common substrate, but this is not essential and instead one or more groups can be provided on separate substrates.
[0204] In one example, at least some of the microstructures or pairs of microstructures are angularly offset, and in one particular example, are orthogonally arranged. Thus, in the case of plate microstructures, at least some pairs of microstructures extend in separate and optionally orthogonal directions. In this regard, the terms angularly offset and orthogonal refer to the orientation of the plate-like microstructures about an axis extending perpendicularly from the substrate, and it will be understood that generally each microstructure extends perpendicularly from the substrate. This serves to distribute the stresses associated with the insertion of patches in various directions and also to reduce lateral slippage of the patch by ensuring that the plate faces at least partially in the direction of any horizontal force. Reducing slippage either during or after insertion helps to reduce discomfort, erythema, etc. and aids in making the patch comfortable for long-term wear. Further, this can also help to incorporate any electrical anisotropy within the tissue, for example as a result of fibrin structures, cell anisotropy, etc. within the skin.
[0205] In one particular example, adjacent microstructures or pairs of microstructures are angularly offset and / or orthogonally arranged, and further, and / or alternatively, the microstructures or pairs of microstructures are arranged in rows, and the microstructures or pairs of microstructures within one row are arranged orthogonally or angularly offset with respect to the microstructures or pairs of microstructures within another row.
[0206] In one particular example, when pairs of microstructures are used, the spacing between the microstructures within each pair is typically less than 0.25 mm, greater than 10 μm and about 0.1 mm, while the spacing between groups of microstructures is typically less than 1 mm, greater than 0.2 mm and about 0.5 mm. Such an arrangement helps to ensure that electrical signals are primarily applied and measured within the pairs, reduces crosstalk between the pairs, and enables independent measurements to be recorded for each pair of microstructures / electrodes.
[0207] The microstructure is configured to interact, and in particular bind, with one or more target analytes, enabling their detection. Specifically, in one example, when one or more analytes bind to the microstructure, it can change the charging ability, which in turn results in a change in the capacitance of the electrode pair, which is then monitored, enabling the analyte level or concentration to be derived. The binding of the analyte can be achieved using various techniques that affect the microstructure properties, such as the mechanical properties of the microstructure, e.g., the presence of pores or other physical structures, the original material from which the microstructure was fabricated, the choice of using coatings, or other methods, e.g., by using magnetic microstructures.
[0208] Furthermore, the microstructure and / or the substrate can incorporate one or more materials or other additives either within the body of the microstructure or by the addition of a coating containing the additives. The nature of the material or additive varies according to the preferred embodiment and can include bioactive materials, reagents for reacting with analytes in a subject, binders for binding to the target analyte, materials for binding to one or more target analytes, probes for selectively targeting the target analyte, materials for reducing biofouling, materials for attracting at least one substance to the microstructure, materials for repelling or excluding at least one substance from the microstructure, materials for attracting at least some analytes to the microstructure, or materials for repelling or excluding analytes. Examples of materials can include polyethylene, polyethylene glycol, polyethylene oxide, zwitterions, peptides, hydrogels, and self-assembled monolayers.
[0209] The material can be incorporated into the microstructure itself, for example, by impregnating the microstructure during manufacture, or can be provided in the original material or coating from which the microstructure is formed. Thus, at least a portion of the microstructure can be coated with a coating such as a material for binding one or more analytes or materials of interest, which enables targeting of specific analytes of interest and allows these to bind to or otherwise attach to the microstructure, and is therefore used to enable in-situ detection of these, for example, by detecting changes in optical or electrical properties using a suitable detection mechanism.
[0210] In some embodiments, the material or additive is a material for binding one or more analytes of interest. In certain embodiments, the material is an aptamer, particularly a plurality of aptamers. In certain embodiments, the aptamer is a coating on the microstructure.
[0211] The nature of the aptamer depends on the specific analyte of interest and the detection method. One of ordinary skill in the art can identify and use an appropriate aptamer and detection method for each analyte of interest. An aptamer is one that interacts with or binds to the analyte of interest and undergoes a conformational change upon analyte binding. For example, in some embodiments, the aptamer has a first conformation when analyte binding is absent and a second conformation when analyte binding occurs.
[0212] In some embodiments, the second conformation results in a portion of the aptamer (e.g., the first end of the aptamer, e.g., the 3' or 5' end) being closer to the nanostructure (and the electrode) than during the first interrogation (i.e., the distance between this portion of the aptamer and the nanostructure during the second conformation decreases). In alternative embodiments, the second interrogation results in a portion of the aptamer being farther from the nanostructure (and the electrode) than during the first conformation (i.e., the distance between this portion of the aptamer and the nanostructure during the second interrogation increases). Such a change in the proximity between a portion of the aptamer and the nanostructure can then be detected, for example, using a labeled portion such as a redox moiety or a fluorescent label attached to a relevant portion of the aptamer, e.g., the first end or near it. In certain examples, the portion of the aptamer is preferably the first end (e.g., the 5' end) of the aptamer when the second end (e.g., the 3' end) of the aptamer is either directly or indirectly bound to or otherwise attached to the nanostructure. Thus, in some embodiments, the second conformation results in the first end of the aptamer being closer to the nanostructure than during the first conformation or, alternatively, the first end of the aptamer being farther from the nanostructure than during the first conformation. This can result, for example, in a first signal when the aptamer is in the first conformation and a second signal when the aptamer is in the second conformation, where the first signal is other than (i.e., different from) the second signal.
[0213] Aptamers of all structures are contemplated, but in certain embodiments, the aptamer comprises or consists of a stem-loop hairpin structure.
[0214] Suitable aptamers are well known in the art or can be identified using various methods well known in the field of aptamer selection.
[0215] For example, suitable aptamers may include, but are not limited to, those described in Negahdary et al., Journal of Biomedical Physics and Engineering (J Biomed Phys Eng) 8(2):167-178 (2018), the contents of which are incorporated herein by reference in their entirety; Jo et al., Analytical Chemistry (Anal Chem) 87:9869-9875 (2015); US Patent Application Publication No. 2012 / 0316326 (A1); Chinese Patent Application Publication No. 102703455 (A); Korean Patent Application Publication No. 20160021488 (A); US Patent Application Publication No. 2019 / 0219595 (A1); Pfeiffer and Mayer, Frontiers in Chemistry (Front Chem) 4:25 (2016); International Publication No. 2017 / 210683 (A1); Chinese Patent Application Publication No. 102660547 (A); International Publication No. 2017 / 210683 (A1); Chinese Patent Application Publication No. 105136754 (A); International Publication No. 2012 / 130948 (A1); US Patent No. 5582981 (A); US Patent No. 5595877 (A); US Patent Application Publication No. 2018 / 0327746 (A1); European Patent No. 2532749 (B1); US Patent Application Publication No. 2012 / 0135540 (A1); Chinese Patent Application Publication No. 105349545 (A); US Patent Application Publication No. 2011 / 0318846 (A1); Chinese Patent Application Publication No. 104745585 (A); Stojanovic et al., Journal of the American Chemical Society (J Am Chem Soc) 122:11547-11548 (2000); International Publication No. 2015 / 197706 (A1); International Publication No. 2019 / 094315 (A1); or US Patent Application Publication No. 2017 / 0233738 (A1).
[0216] In some embodiments, the aptamer is a troponin-selective aptamer, representative examples of which are described in Negdar et al., Journal of Biomedical Physics and Engineering 8(2):167-178 (2018); Qiao et al., Analytical Chemistry 87:9869-9875 (2015); US Patent Application Publication No. 2012 / 0316326 (A1); Chinese Patent Application Publication No. 102703455 (A); Korean Patent Application Publication No. 20160021488 (A); and US Patent Application Publication No. 2019 / 0219595 (A1), which are incorporated herein by reference in their entireties. The troponin-selective aptamer may bind to troponin or a subunit or complex thereof, such as cardiac troponin I, cardiac troponin C, cardiac troponin T, cardiac troponin I-C complex and / or cardiac troponin I-C-T, including troponin I, troponin C, troponin T, troponin I-C complex and / or troponin I-C-T complex. Such aptamers may bind to the subunit alone (e.g., troponin I) and / or the subunit as part of a complex (e.g., troponin I as part of a troponin I-C complex or I-C-T complex).
[0217] In some embodiments, the aptamer is, AGTCTCCGCTGTCCTCCCGATGCACTTGACGTATGTCTCACTTTCTTTTCATTGACATGGGATGACGCCGTGACTG [SEQ ID NO: 1]; CGTGCAGTACGCCAACCTTTCTCATGCGCTGCCCCTCTTA [SEQ ID NO: 2]; AGTCTCCGCTGTCCTCCCGATGCACTTGACGTATGTCTCACTTTCTTTTCATTGACATGGGATGACGCCGTGACTG [SEQ ID NO: 3]; CGTGCAGTACGCCAACCTTTCTCATGCGCTGCCCCTCTTA [SEQ ID NO: 4]; CGCATGCCAAACGTTGCCTCATAGTTCCCTCCCCGTGTCC [SEQ ID NO: 5]; TCACACCCTCCCTCCCACATACCGCATACACTTTCTGATT [SEQ ID NO: 6]; CCCGACCACGTCCCTGCCCTTTCCTAACCTGTTTGTTGAT [SEQ ID NO: 7]; ATGCGTTGAACCCTCCTGACCGTTTATCACATACTCCAGA [SEQ ID NO: 8]; CGTGCAGTACGCCAACCTTTCTCATGCGCTGCCCCTCTTA [SEQ ID NO: 9]; CAACTGTAATGTACCCTCCTCGATCACGCACCACTTGCAT [SEQ ID NO: 10]; CGCATGCCAAACGTTGCCTCATAGTTCCCTCCCCGTGTCC [SEQ ID NO: 11]; AGTCTCCGCTGTCCTCCCGATGCACTTGACGTATGTCTCACTTTCTTTTCATTGACATGGGATGACGCCGTGACTG [SEQ ID NO: 12]; TCACACCCTCCCTCCCACATACCGCATACACTTTCTGATT [SEQ ID NO: 13]; CCCGACCACGTCCCTGCCCTTTCCTAACCTGTTTGTTGAT [SEQ ID NO: 14]; ATGCGTTGAACCCTCCTGACCGTTTATCACATACTCCAGA [SEQ ID NO: 15]; CGTGCAGTACGCCAACCTTTCTCATGCGCTGCCCCTCTTA [SEQ ID NO: 16]; CAACTGTAATGTACCCTCCTCGATCACGCACCACTTGCAT [SEQ ID NO: 17]; CGCATGCCAAACGTTGCCTCATAGTTCCCTCCCCGTGTCC [SEQ ID NO: 18]; TCACACCCTCCCTCCCACATACCGCATACACTTTCTGATT [SEQ ID NO: 19]; CCCGACCACGTCCCTGCCCTTTCCTAACCTGTTTGTTGAT [SEQ ID NO: 20]; ATGCGTTGAACCCTCCTGACCGTTTATCACATACTCCAGA [SEQ ID NO: 21]; CAACTGTAATGTACCCTCCTCGATCACGCACCACTTGCAT [SEQ ID NO: 22]; CGTGCAGTACGCCAACCTTTCTCATGCGCTGCCCCTCTTA [SEQ ID NO: 23]; CGCATGCCAAACGTTGCCTCATAGTTCCCTCCCCGTGTCC [SEQ ID NO: 24]; GGGATGGGGTGGGTGGCCAGCGATT [SEQ ID NO: 25]; and and TTAGGGGTGGTGTGGTTGGCAATTC [SEQ ID NO: 26]; especially SEQ ID NO: 1. comprises, consists of, or consists essentially of a nucleotide sequence selected from the group consisting of.
[0218] In some embodiments, the aptamer is an IL-6 selective aptamer, representative examples of which include, but are not limited to, the aptamers described in Hirota et al., Nucleic Acid Therapeutics 26(1):10-19 (2016), which is incorporated herein by reference in its entirety; International Publication No. 2014 / 159669 (A1); Gupta et al., J Biol Chem 289(12):8706-8719 (2014); Kumar et al., Anal Methods 8(17):3440-3444 (2016).
[0219] In an exemplary embodiment, the aptamer is GG-ZZZ-GG-Qa-GG-Qb-GG [SEQ ID NO: 27]; GG-Qa-GG-ZZZ-GG-Qb-GG [SEQ ID NO: 28]; GG-Qa-GG-Qb-GG-ZZZ-GG [SEQ ID NO: 29]; wherein each Z is independently selected from U, T, and modified pyrimidines; each Q is independently selected from linkers, modified nucleotides, and unmodified nucleotides; a is from 1 to 50; and / or b is from 1 to 50; or GGCAGGZZZGGZQaGZGG[SEQ ID NO: 30]; GGGYXAXGYAGCLbGZGCGYAAGGCGGY [SEQ ID NO: 31]; wherein each Z is independently selected from U, T, and modified pyrimidines (e.g., 5'-modified pyrimidines), each Q is independently selected from linkers, modified nucleotides, and unmodified nucleotides; a is from 1 to 50; each Y is independently selected from modified pyrimidines (e.g., 5'-modified pyrimidines); each X is independently selected from modified pyrimidines (e.g., 5'-modified pyrimidines); each L is independently selected from linkers, modified nucleotides, and unmodified nucleotides; b is from 1 to 20; or YXAXGYARQaMGYAAGSCGRY [SEQ ID NO: 32]; MGYAAGSCGRYQbYXAXGYAR [SEQ ID NO: 33]; wherein each Y is independently selected from modified pyrimidines (e.g., 5'-modified pyrimidines); each X is independently selected from modified pyrimidines (e.g., 5'-modified pyrimidines); M is selected from C and A; S is selected from C and G; each R is independently selected from G and A; each Q is independently selected from linkers, modified nucleotides, and unmodified nucleotides; a is from 1 to 30; and / or b is from 1 to 30; or GG[mC]AG[mG]Z1Z1EGGPAZ1Z1[mA]AC[mA][mC]GZ1Z1AAGZ1[mC]GZ1GG-idT [SEQ ID NO: 34]; In the formula, Z1 is benzyl-modified 5-dU, P is naphthyl-modified 5dU, E is phenethyl-modified 5-dU, mC is 2'-OMe C, mG is 2'-OMe G, mA is 2'-OMe A; or GGCAGGZ1Z1Z1GGZ1AZ1Z1AACACGZ1Z1AAGZ1CGZ1GG [SEQ ID NO: 35]; GGGGZ1Z1AZ1GZ1AGCGAGZ1GCGZ1AAGGCGGZ1GGGCGAGGGA [SEQ ID NO: 36]; or LGGGZ1Z1AZ1GZ1AGCLLGZ1GCGZ1AAGGCGGZ1G [SEQ ID NO: 37]; In the formula, Z1 is benzyl-modified 5-dU; L is a C3-spacer (3-carbon alkyl linker), and it includes, consists of, or consists essentially of a nucleotide sequence selected from the group consisting of
[0220] The present invention also contemplates variant forms of the sequences provided herein. Thus, in some embodiments, the aptamer is at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with the nucleic acid sequence of any one of SEQ ID NOs: 1 to 37, particularly any one of SEQ ID NOs: 1 to 26, and most particularly SEQ ID NO: 1, and includes, consists of, or consists essentially of a nucleic acid sequence having such sequence identity.
[0221] To determine the percent sequence identity between two nucleic acid sequences, the sequences are aligned for optimal comparison (e.g., gaps can be introduced into one or both of the first and second nucleic acid sequences for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). In some embodiments, the length of the reference sequence aligned for comparison is at least 40% of the length of the reference sequence, more typically at least 50% or 60%, even more typically at least 70%, 80%, 90% or 100%. Next, the nucleotides at corresponding nucleotide positions are compared. The molecules are identical at that position when the position in the first sequence is occupied by the same nucleotide as at the corresponding position in the second sequence.
[0222] The comparison of sequences and determination of percent identity between sequences can be accomplished using a mathematical algorithm. In certain embodiments, the percent identity between nucleic acid sequences is determined using the algorithm of Needleman and Wunsch (J Mol Biol 48:444-453 (1970)) incorporated into the GAP program in the GCG software package (Devereaux et al., Nucleic Acids Res 12:387-395 (1984)), using either a Blosum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6 or 4 and a length weight of 1, 2, 3, 4, 5 or 6. In some embodiments, the percent identity between nucleic acid sequences is determined using the algorithm of Myers and Miller (1989, Cabios, 4:11-17) incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.
[0223] Alternatively, various methods known in the field of aptamer selection, including the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) technique (described, for example, in U.S. Patent No. 5,475,096 (A) and U.S. Patent No. 5,270,163 (A)), and the methods described in International Publication No. 2019 / 067383 (A1), U.S. Patent No. 5,582,981 (A), U.S. Patent No. 5,595,877 (A), and U.S. Patent No. 5,637,459, the entire contents of which are incorporated herein by reference, may be used to identify and prepare suitable aptamers. In certain embodiments, aptamers may be identified and prepared using the SELEX technique. Briefly, this method may involve systematically subjecting a large random pool of oligonucleotides to positive and negative selection rounds against a target, such as an analyte like a protein, to filter out low affinity or non-specific binders. The remaining aptamers are collected, grown, for example, by PCR amplification, and used in the next selection round.
[0224] In some embodiments, it may be desirable to improve the stability of the aptamer. Capping the terminal ends of the aptamer, replacing natural nucleotides with unnatural nucleotides (e.g., 2'-fluorinated pyrimidines, 2'-aminopyrimidines, and 2'-F, 2'-OCH3, 2'-H, 2'-OH or 2'-NH2 modified nucleotides such as 2'-O-methyl ribose purines and pyrimidines), using unnatural internucleotide linking groups such as phosphorothioates, methylphosphonate or triazole linking groups, using modified sugar moieties, attaching a molecule such as biotin to the 3' end, capping the 3' end with inverted thymidine (dT), attaching protein-like side chains to nucleotides such as at the 5-position of deoxyuridine (dU) (e.g., 5-(N-benzylcarboxamido)-2-deoxyuridine), developing "Spiegelmers" consisting entirely of unnatural L-ribonucleic acid backbones, and the like. Several techniques are known in the art. For example, additional techniques are discussed in Shuaijian et al., International Journal of Molecular Sciences (Int J Mol Sci) 18(8):1683 (2017), the contents of which are hereby incorporated by reference in their entirety.
[0225] Aptamers may be modified to increase the sensitivity and binding rate of the aptamer for the target analyte. One or more techniques for improving the stability of the aptamer may, as a result, involve conjugating protein-like side chains to nucleotides, such as at the 5-position of deoxyuridine (dU) (e.g., 5-(N-benzylcarboxamide)-2-deoxyuridine). Using the methods described by Ricci et al., Accounts of Chemical Research, 49(9):1884-1892 (2016), further modifications to increase the sensitivity and binding rate of the aptamer for the target analyte may be realized, including population shift, allosterism, receptor sets, sequestration, and cooperativity. Further techniques contemplated by the present invention include a holding structure that holds the aptamer in a second configuration to increase the aptamer recovery time, such as a complementary primer attached to the ends of the aptamer that binds together to hold the aptamer in the second configuration beyond the recovery interval upon analyte binding, and at least one blocker attached to the aptamer that prevents the primers from binding together prior to analyte binding, or attaching functional groups that interact with each other to hold the aptamer in the second configuration beyond the recovery interval upon analyte binding. Such techniques are discussed in International Publication No. WO 2018 / 031559 (A1), which is hereby incorporated by reference in its entirety.
[0226] In some embodiments, the aptamer includes a moiety, such as a functional group or compound, for preferably covalently attaching or immobilizing the aptamer to the surface of the microstructure. Suitable moieties for attaching or immobilizing the aptamer to the surface of the microstructure include thiol, amine, carboxylic acid, alcohol, carbodiimide, Nafion, avidin, biotin, azide, etc.; particularly including but not limited to thiol. This moiety may be directly attached to the aptamer, although in some embodiments this moiety is a linker, such as a C1-C 20Alkyl, especially C6 or C 11 An alkyl chain, polymer, such as polyethylene glycol (PEG); or a nucleic acid sequence containing DNA and RNA sequences, containing an alkyl, most particularly a C6 alkyl linker (i.e., a (CH2)6 linker), is attached to the aptamer via. In certain embodiments, C1-C 20 Alkyl, especially C6 or C 11 The linker, such as an alkyl, most particularly a C6 alkyl linker (i.e., a (CH2)6 linker), is an alkyl chain. Suitable linkers and synthetic routes for producing such linkers are known in the art, such as Lai et al., Langmuir 22:10796-10800 (2006), the entire contents of which are incorporated herein by reference.
[0227] Aptamers may be prepared using standard oligonucleotide synthesis techniques in the art, such as chemical synthesis (see, e.g., Itakura et al., Ann Rev Biochem 53:323-356 (1984)). Aptamers may also be prepared by amplification (e.g., PCR) of aptamers prepared using the SELEX techniques described in U.S. Patent No. 5,475,096 (A) and U.S. Patent No. 5,270,163 (A), and the methods described in International Publication No. 2019 / 067383 (A1), U.S. Patent No. 5,582,981 (A), U.S. Patent No. 5,595,877 (A), and U.S. Patent No. 5,637,459 (A). Aptamers are also commercially available from a number of sources, including Bioneer Pacific, Biosynthesis Inc., Base Pair Biotechnologies, Inc., and TriLink Biotechnologies.
[0228] The aptamer is selective for binding to one or more target analytes or subunits thereof. The aptamer is preferably selective for binding to one or more target analytes, such as troponin or a subunit or complex thereof, particularly troponin I or the cardiac troponin I-C complex, over at least one other substance present in the sample, preferably over the majority of other substances present in the sample.
[0229] In some embodiments, the aptamer includes a label or labeled moiety, such as a redox moiety, a fluorescent label, and the like. Such moieties are useful for detecting conformational changes of the aptamer upon analyte binding, as discussed herein.
[0230] In some embodiments, the aptamer includes a redox moiety. Suitable redox moieties include any redox-capable chemical moiety that can be attached to or otherwise incorporated into the aptamer. For example, suitable redox moieties include methylene blue, ferrocene, vinyl ferrocene, anthraquinone, Nile blue, thionin, anthraquinone-C5, dabsyl, 2,6-dichlorophenol-indophenol, galocyanin, ROX, pentamethyl ferrocene, ferrocene-C5, neutral red, and horseradish peroxidase; particularly methylene blue, ferrocene, anthraquinone, or Nile blue; most particularly, but not limited to, methylene blue.
[0231] The redox moiety may be attached at any suitable location on the aptamer, provided that the conformational change that occurs when the analyte binds to the aptamer results in a detectable change in the distance between the redox moiety and the electrode of the nanostructure to which the aptamer is immobilized. In some embodiments, the redox moiety moves closer to the electrode of the nanostructure to which the aptamer is immobilized (i.e., the distance decreases) in the second conformation (i.e., upon binding to the analyte) compared to the first conformation. In alternative embodiments, the redox moiety moves farther from the electrode of the nanostructure to which the aptamer is immobilized (i.e., the distance increases) in the second conformation (i.e., upon binding to the analyte) compared to the first conformation. For example, in some embodiments, the redox moiety is attached to the 3' or 5' end of the aptamer; particularly to the 3' end of the aptamer, and the aptamer is attached to the nanostructure via the opposite end, e.g., the 5' end, although the reverse may also be the case, preferably the 5' end. Without wishing to be bound by theory, it is proposed that a decrease in the distance between the redox moiety and the electrode results in an increase in electron transfer from the redox moiety to the electrode of the nanostructure to which the aptamer is immobilized, and vice versa, resulting in a detectable change that can be correlated with the presence, level, or concentration of the analyte.
[0232] In some embodiments, the aptamer comprises a fluorescent label. Suitable fluorescent labels include fluorescein, 6-carboxyfluorescein (FAM), coumarin, rhodamine, 5-TMRIA (tetramethylrhodamine-5-iodoacetamide), (9-(2(or 4)-(N-(2-maleimidylethyl)-sulfonamidyl)-4(or 2)-sulfophenyl)-2,3,6,7,12,13,16,17-octahydro-(1-H,5H,11H,15H-xantheno(2,-3,4-ij:5,6,7-i’j’)diquinolidine-18-ium salt) (Texas Red), 2-(5-(1-(6-(N-(2-maleimidylethyl)-amino)-6-oxohexyl)-1,3-dihydro-3,3-dimethyl-5-sulfo-2H-indole-2-ylidene)-1,3-propylidenyl))-1-ethyl-3,3-dimethyl-5-sulfo-3H-indolium salt (Cy3), N,N’-dimethyl-N-(iodoacetyl)-N’-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)ethylenediamine (IANBD amide), N-((2-(iodoacetoxy)ethyl)-N-methyl)amino-7-nitrobenz-2-oxa-1,3-diazole (IANBD ester), 6-acryloyl-2-dimethylaminonaphthalene (acrylodan), pyrene, 6-amino-2,3-dihydro-2-(2-((iodoacetyl)amino)ethyl)-1,3-dioxo-1H-benz(de)isoquinoline-5,8-disulfonate (lucifer yellow), 2-(5-(1-(6-(N-(2-maleimidylethyl)-amino)-6-oxohexyl)-1,3-dihydro-3,3-dimethyl-5-sulfo-2H-indole-2-ylidene)-1,3-pentadienyl)-1-ethyl-3,3-dimethyl-5-sulfo-3H-indolium salt (Cy5), 4-(5-(4-dimethylaminophenyl)oxazol-2-yl)phenyl-N-(2-bromoacetamidoethyl)sulfonamide (Dapoxyl (registered trademark)(2-bromoacetamidoethyl)sulfonamide), (N-(4,4-difluoro-1,3,5,7-tetramethyl-4-bora-3a,(4a-Diaza-s-indacen-2-yl)iodoacetamide (BODIPY 507 / 545 IA), (N-(4,4-difluoro-5,7-diphenyl-4-bora-3a,4a-diaza-s-indacen-3-propionyl)-N’-iodoacetyl ethylenediamine (BODIPY 530 / 550 IA), 5-((((2-iodoacetyl)amino)ethyl)amino)naphthalene-1-sulfonic acid (1,5-IAEDANS), carboxy-X-rhodamine, 5 / 6 iodoacetamide (XRIA 5,6), BODIPY-FL-hydrazide, 6-carboxytetramethylrhodamine (TAMRA), cyan fluorescent protein, green fluorescent protein and yellow fluorescent protein, including but not limited to these. Fluorescent quantum dots are also envisioned. Other suitable fluorescent labels include those described in the ThermoFischer Scientific (2019) Molecular Probes Handbook - A Guide to Fluorescent Probes and Labeling Technologies, accessed on 29 September 2019 at <https: / / www.thermofisher.com / au / en / home / references / molecular-probes-the-handbook.html>.,
[0233] The fluorescent label can be attached at any suitable location on the aptamer. For example, in some embodiments, the fluorescent label is attached at the 3’ or 5’ end of the aptamer; particularly at the 3’ end of the aptamer.
[0234] Those skilled in the art are familiar with suitable methods for attaching the labeling moiety to the aptamer, including chemical means such as reduction reactions, oxidation reactions, conjugation reactions, and condensation reactions. For example, a thiol reaction group is used to attach a labeling moiety, such as a fluorescent label or a redox moiety, to a natural thiol group or an artificial thiol group present in the aptamer. In yet another example, the reactive groups present in the aptamer can be labeled using a succinimide ester derivative of a fluorescent label. For instance, an amine may be introduced at a desired position of the aptamer for attachment of the labeling moiety, and an NHS-labeled redox moiety (such as NHS-labeled methylene blue) may be conjugated to the aptamer using, for example, succinimide ester coupling. Appropriate methods such as Liu et al., Analytical Chemistry, 82(19):8131-8136 (2010); Xiao et al., Angew Chem Int Ed 44(5456-5459) (2005) and US Patent Application Publication No. 2016 / 0278638 (A1), which are incorporated herein by reference in their entirety, are well-known in the art.
[0235] The labeling moiety is also a self-fluorescent label or a luminescence label.
[0236] The labeling moiety may be directed to be attached to the aptamer, but in some embodiments, the labeling moiety is attached to the aptamer via a linker. For example, in some embodiments, this moiety is attached to the aptamer via a linker, such as a C1-C 20 alkyl, particularly C6 or C 11 alkyl, especially an alkyl chain containing a C6 alkyl linker (i.e., a (CH2)6 linker); a polymer such as polyethylene glycol (PEG); or a nucleic acid sequence containing DNA and RNA sequences.
[0237] In some embodiments, the fluorescent label may be the only labeling moiety attached to the aptamer. Without wishing to be bound by theory, in such embodiments, analyte binding results in a conformational change in the aptamer, which is proposed to cause a detectable change in the fluorescence of the fluorescent label, such as an increase in fluorescence, a wavelength shift, and / or an increase in fluorescence lifetime (e.g., by altering the conjugation of the fluorescent label). Alternatively, the fluorescent label may interact with the bound analyte and result in a decrease in the fluorescence of the fluorescent label.
[0238] In alternative embodiments, the aptamer includes two labeling moieties, for example two fluorescent labels. Such embodiments are particularly suitable when generating a light output, for example Förster resonance energy transfer (FRET). Such embodiments utilize pairs of labeling moieties (for example pairs of fluorescent labels) that are attached at separate locations on the aptamer, where one label acts as a donor molecule (the first labeling moiety) and the other acts as an acceptor molecule (i.e., a quencher) (the second labeling moiety), and the absorption spectrum of the acceptor molecule overlaps the fluorescence emission spectrum of the donor molecule. Without wishing to be bound by theory, it is proposed that analyte binding results in a conformational change in the aptamer, which changes the proximity of the first and second labeling moieties, and thus changes the fluorescence intensity of the first labeling moiety and the emission intensity of the second labeling moiety. In some embodiments, the first and second labeling moieties may be closer to each other in a second conformation (i.e., when the analyte binds) compared to a first conformation (i.e., the spacing is decreased in the second conformation). In such embodiments, the fluorescence intensity of the first labeling moiety decreases and the emission intensity of the second labeling moiety increases in the second conformation compared to the first conformation. In alternative embodiments, the first and second labeling moieties may be farther from each other in a second conformation (i.e., when binding to the analyte) compared to a first conformation (i.e., the spacing is increased in the second conformation). In such embodiments, the fluorescence intensity of the first labeling moiety increases and the emission intensity of the second labeling moiety decreases in the second conformation compared to the first conformation.
[0239] In certain embodiments, both labeling moieties are preferably fluorescent labels, examples of which are described above. Examples of such combinations include cyan fluorescent protein and yellow fluorescent protein, Cy3 and Cy5, FAM and TAMRA, and the like. In certain embodiments, both labeling moieties are preferably fluorescent labels, and suitable examples of fluorescent labels are described above. Non-limiting examples of suitable moieties that are not fluorescent types include 4-([4-(dimethylamino)phenyl]-azo)-benzoic acid (DABCYL), Iowa Black RQ, 4-(4-dimethylaminophenylazo)benzenesulfonic acid (DABSYL), Iowa Black FQ, IR Dye QC-1, QSY Quencher, black hole quenchers including BHQ-1, BHQ-2 and BHQ-3, etc., including the moieties described in Le Reste et al., Biophysical Journal 11(6):2658-2668 (2012) and Crisalli and Kool, Bioconj Chem 22(11):2345-2354 (2011), the entire contents of which are incorporated herein by reference.
[0240] The first labeling portion and the second labeling portion may be attached to any location on the aptamer, and the distance between the first labeling portion and the second labeling portion is different in the first aptamer conformation and the second aptamer conformation. In some embodiments, the distance between the first labeling portion and the second labeling portion is 10 nm or less in the first conformation and greater than 10 nm in the second conformation. In other embodiments, the distance between the first labeling portion and the second labeling portion is greater than 10 nm in the first conformation and 10 nm or less in the second conformation. For example, the first labeling portion and the second labeling portion may be attached to each end of the aptamer, or near each end, such as at the 3' end and the 5' end, or near the 3' end and the 5' end. In some embodiments, the first labeling portion is attached to the 3' end and the second labeling portion is attached to the 5' end, or alternatively, the second labeling portion is attached to the 3' end and the first labeling portion is attached to the 5' end.
[0241] The present invention also contemplates embodiments in which the acceptor molecule is the original material on which the microstructure is formed, or a coating on the microstructure, such as graphene, graphene oxide, etc.
[0242] In a preferred embodiment, the aptamer is a coating on the microstructure (also referred to herein as an aptamer coating). The number and / or density of aptamers in the coating depends on the target analyte (including analyte size and the predicted level or concentration to be detected), the use of the system of the present invention, and the detection method. The aptamer density in the coating should be such that when binding to the analyte, particularly at the target analyte concentration or level, it results in a measurable response, such as a change in impedance or fluorescence. In some embodiments, the aptamer density in the coating is from about 1×10 10 ~ about 1×10 14 aptamer molecules / cm 2 、 about 5×10 10 ~ about 5×1013 aptamer molecules / cm 2 , about 1×10 11 ~ about 1×10 13 aptamer molecules / cm 2 , about 5×10 11 ~ about 5×10 12 aptamer molecules / cm 2 (and all integers therebetween).
[0243] When administered as a coating on a microstructured body, the aptamer may be administered using any suitable technique routine in the art, such as chemisorption or chemical crosslinking. For example, this technique may involve contacting the surface of the microstructured body with the aptamer for a period of time sufficient for a moiety for attaching or immobilizing the aptamer to the surface of the microstructured body to adhere to the surface of the microstructured body, for example via a covalent bond. Suitable, non-limiting methods include chemisorption of thiolated aptamers on gold microstructured bodies; attachment of biotinylated aptamers to avidin-modified microstructured bodies; immobilization of azide-terminated aptamers to alkyne-modified microstructured bodies; covalent immobilization of amine-terminated aptamers by amine bonding to carboxyl groups in functionalized microstructured bodies; covalent immobilization of amine-terminated aptamers containing amine groups to functionalized microstructured bodies using, for example, glutaraldehyde. Examples of methods are described in Xiao et al., Nature Protocols 2(11):2875-2880 (2007), the contents of which are incorporated herein by reference; Negadali et al., Journal of Biomedical Physics and Engineering, 8(2):167-178 (2018); and Mishra et al., Biosensors 8(2):28 (2018). The aptamer may be attached to the microstructured body via any suitable site of the aptamer, particularly the 3’-end or 5’-end of the aptamer, especially the 5’-end.
[0244] Microstructures, such as gold-coated microstructures, may be prepared for aptamer functionalization using standard methods in the art, such as cleaning using cyclic voltammetry in H2SO4; dipping in acetone and sonicating for more than 5 minutes, dipping in isopropanol and sonicating for 5 minutes, drying using a stream of nitrogen gas, dipping in deionized water and sonicating for 5 minutes, and drying using a stream of nitrogen gas; or cleaning using oxygen plasma cleaning. Without wishing to be bound by theory, plasma cleaning removes organic contaminants by chemical reaction or physical ablation of hydrocarbons on the surface of the gold-coated electrode, creating a protective gold oxide layer without creating defects on the gold surface. Chemical cleaning of the surface is thought to occur by reactive oxygen ions and change the surface energy by introduction of polar functional groups.
[0245] An analyte can be any compound that can be detected in the epidermis and / or dermis. In certain embodiments, the analyte is a compound used to monitor the symptoms, diseases, disorders, or markers of normal or pathological processes occurring in a subject, or the level of an administered substance in a subject, such as pharmaceuticals (e.g., drugs, vaccines), illegal substances (e.g., illegal drugs), non-illegal abused substances (e.g., alcohol or prescription drugs taken for non-medical reasons), poisons or toxins, chemical weapons (e.g., nerve gas, etc.) or their metabolites. Suitable analytes include · Nucleic acids, including DNA and RNA, including short RNA chemical species such as microRNA, siRNA, snRNA, shRNA; · Antibodies, or antigen-binding fragments thereof, allergens, antigens or adjuvants; · Chemokines; · Cytokines; · Hormones; · Parasites, bacteria, viruses, or virus-like particles, or compounds derived therefrom, such as surface proteins, endotoxins, etc.; · Epigenetic markers, such as the methylation state of DNA, or chromatin chemical modifications of specific genes / regions; · Peptide; · Polysaccharide (glycan); · Polypeptide; · Protein; and · Small molecule including but not limited to these.
[0246] In certain embodiments, the analyte of interest is selected from the group consisting of nucleic acids, antibodies, peptides, polypeptides, proteins and small molecules; particularly polypeptides and proteins; most particularly proteins.
[0247] In certain embodiments, the analyte is a cytokine such as IL-6, IL-10 or TNF-α; particularly IL-6 or TNF-α; most particularly IL-6.
[0248] The analyte may be a biomarker, which is a biochemical characteristic or aspect that can be used to measure the progression of a disease, disorder or condition or the effect of treatment of a disease, disorder or condition. Biomarkers can be, for example, a virus or a compound derived therefrom, a bacterium or a compound derived therefrom, a parasite or a compound derived therefrom, a cancer antigen, a heart disease indicator, a stroke indicator, an Alzheimer's disease indicator, an antibody, a mental health indicator, an inflammatory marker, etc.
[0249] Alternatively, the analyte may be a compound that can be used to monitor the level of a substance administered or ingested in a subject, such as a pharmaceutical (e.g., a drug, a vaccine), an illegal substance (e.g., an illegal drug), a non-illegal substance of abuse (e.g., alcohol or a prescription drug inoculated for non-medical reasons), a poison or toxin, a chemical weapon (e.g., a nerve gas, etc.) or a metabolite thereof.
[0250] In some embodiments, the analyte is troponin or a subunit thereof, an enzyme (e.g., amylase, creatine kinase, lactate dehydrogenase, angiotensin II converting enzyme), a hormone (e.g., follicle stimulating hormone or luteinizing hormone), cystatin C, C-reactive protein, TNFα, IL-6, ICAM1, TLR2, TLR4, presepsin, D-dimer, a viral protein (e.g., non-structural protein 1 (NS1)), a bacterial protein, a parasitic protein (e.g., histidine-rich protein 2 (HRP2)), an antibody (e.g., an antibody produced in response to an infection, such as a bacterial or viral infection including influenza infection) and botulinum toxin or a metabolite or subunit thereof; particularly a protein selected from the group consisting of troponin or a subunit thereof, amylase, creatine kinase, lactate dehydrogenase, angiotensin II converting enzyme, follicle stimulating hormone, luteinizing hormone, cystatin C, C-reactive protein, TNFα, IL-6, ICAM1, TLR2, TLR4, presepsin, D-dimer, botulinum toxin or a metabolite or subunit thereof. In certain embodiments, the analyte is troponin or a subunit thereof; particularly troponin I, troponin C or troponin T; most particularly troponin I.
[0251] In certain embodiments, the analyte is troponin or a subunit or complex thereof; particularly cardiac troponin or a subunit or complex thereof. In some embodiments, the analyte is troponin I, troponin C, troponin T, troponin I-C complex or troponin I-T-C complex; particularly cardiac troponin I (cTnI), cardiac troponin I-C (cTnIC) complex or cardiac troponin I-T-C (cTnITC) complex; most particularly cTnI or cTnIC.
[0252] In some embodiments, the analyte is an inflammatory marker selected from the group consisting of C-reactive protein, TNFα, IL-6, ICAM1, TLR2, TLR4, presepsin, IL-10 and procalcitonin.
[0253] The analyte can be a small molecule, and non-limiting examples thereof include hormones (e.g., cortisol or testosterone), neurotransmitters (e.g., dopamine), amino acids, creatinine, aminoglycosides (e.g., kanamycin, gentamicin, and streptomycin), antispasmodics (e.g., carbamazepine and clonazepam), illicit substances (e.g., methamphetamine, amphetamine, 3,4-methylenedioxymethamphetamine (MDMA), N-ethyl-3,4-methylenedioxyamphetamine (MDEA), 3,4-methylenedioxyamphetamine (MDA), cannabinoids (e.g., δ-9-tetrahydrocannabinol, 11-hydroxy-δ-9-tetrahydrocannabinol, 11-nor-9-carboxy-δ-9-tetrahydrocannabinol), cocaine, benzoylecgonine, ecgonine methyl ester, cocaethylene, ketamine, and opioids (e.g., heroin, 6-monoacetylmorphine, morphine, codeine, methadone, and dihydrocodeine), anticoagulants (e.g., warfarin), chemical weapons, poisons or toxins such as vesicants (e.g., cantharidin, furanocoumarin, sulfur mustard (e.g., 1,2-bis(2-chloroethylthio)ethane, 1,3-bis(2-chloroethylthio)-n-propane, 1,4-bis(2-chloroethylthio)-n-butane, 1,5-bis(2-chloroethylthio)-n-pentane, 2-chloroethyl chloromethyl sulfide, bis(2-chloroethyl)sulfide, bis(2-chloroethylthio)methane, bis(2-chloroethylthiomethyl)ether, bis(2-chloroethylthioethyl)ether), nitrogen mustard (e.g., bis(2-chloroethyl)ethylamine, bis(2-chloroethyl)methylamine, and tri(2-chloroethyl)amine) and phosgene oxime), arsenic agents (e.g., ethyldichloroarsine, methyldichloroarsine, phenyldichloroarsine, and 2-chlorovinyldichloroarsine) and urticating agents, such as phosgene oxime), blood agents (e.g., cyanogen chloride, hydrogen cyanide, and arsine), choking agents (e.g., chlorine, chloropicrin, diphosgene, and phosgene), nerve gases (e.g., tabun, sarin, soman, cyclosarin, novichok agents, 2-(dimethylamino)ethyl-N,N-dimethylphosphoramidofluoridate (GV), (S)-(ethyl{[2-(diethylamino)ethyl]sulfanyl}(ethyl)phosphinate) (VE), O,O-diethyl-S-[2-(diethylamino)ethyl]phosphorothioate (VG), S-[2-(diethylamino)ethyl]-O-ethylmethylphosphonothioate (VM), ethyl({2-[bis(propan-2-yl)amino]ethyl}sulfanyl)(methyl)phosphinate (VX),), tetrodotoxin and saxitoxin), animal venom components (such as tetrodotoxin and saxitoxin), cyanide, arsenic, tropane alkaloids (such as atropine, scopolamine and hyoscyamine), piperidine alkaloids (such as coniine, N-methylconiine, conhydrine, pseudoconhydrine and γ-coniceine), curare alkaloids (such as tubocurarine), nicotine, caffeine, quinine, strychnine, brucine, aflatoxin), etc. or their metabolites. In some embodiments, the small molecule is cortisol, testosterone, creatinine, dopamine, kanamycin, gentamicin, streptomycin, carbamazepine, clonazepam, methamphetamine, amphetamine, MDMA, MDEA, MDA, δ-9-tetrahydrocannabinol, 11-hydroxy-δ-9-tetrahydrocannabinol, 11-nor-9-carboxyδ-9-tetrahydrocannabinol, cocaine, benzoylecgonine, ecgonine methyl ester, cocaethylene, ketamine, heroin, 6-monoacetylmorphine, morphine, codeine, methadone, dihydrocodeine, warfarin, cantharidin, furanocoumarin, 1,2-bis(2-chloroethylthio)ethane, 1,3-bis(2-chloroethylthio)-n-propane, 1,4-bis(2-chloroethylthio)-n-butane, 1,Selected from the group consisting of 5-bis(2-chloroethylthio)-n-pentane, 2-chloroethyl chloromethyl sulfide, bis(2-chloroethyl) sulfide, bis(2-chloroethylthio) methane, bis(2-chloroethylthiomethyl) ether, bis(2-chloroethylthioethyl) ether), bis(2-chloroethyl) ethylamine, bis(2-chloroethyl) methylamine and tris(2-chloroethyl)amine), phosgene oxime, ethyldichloroarsine, methyldichloroarsine, phenyldichloroarsine, 2-chlorovinyldichloroarsine, phosgene oxime, cyanogen chloride, hydrogen cyanide, arsine, chlorine, chloropicrin, diphosgene, phosgene, tabun, sarin, soman, cyclosarin, novichok agents, 2-(dimethylamino)ethyl-N,N-dimethylphosphoramidofluoridate (GV), (S)-(ethyl{[2-(diethylamino)ethyl]sulfanyl}(ethyl)phosphinate) (VE), O,O-diethyl-S-[2-(diethylamino)ethyl] phosphorothioate (VG), S-[2-(diethylamino)ethyl]-O-ethylmethylphosphonothioate (VM), ethyl({2-[bis(propan-2-yl)amino]ethyl}sulfanyl)(methyl)phosphinate (VX), tetrodotoxin, saxitoxin, cyanides, arsenic, atropine, scopolamine, hyoscyamine, coniine, N-methylconiine, conhydrine, pseudoconhydrine, γ-coniceine, tubocurarine, nicotine, caffeine, quinine, strychnine, brucine, aflatoxin and their metabolites.,
[0254] In some embodiments, the analyte is a peptide, non-limiting examples of which include hormones (such as oxytocin, gonadotropin-releasing hormone, and adrenocorticotropic hormone), B-type natriuretic peptide, N-terminal pro-B-type natriuretic peptide (NT-proBNP), and animal venom components (such as spider, snake, scorpion, bee, wasp, ant, mite, clam, octopus, fish (such as catfish), and the peptide components of jellyfish venom) or their metabolites. In certain embodiments, the peptide is oxytocin, gonadotropin-releasing hormone, adrenocorticotropic hormone, B-type natriuretic peptide, or NT-proBNP.
[0255] In some embodiments, the analyte is a polysaccharide (glycan), suitable non-limiting examples of which include inulin, endotoxin (lipopolysaccharide), anticoagulants (such as heparin), and their metabolites.
[0256] In some embodiments, the analyte is an illicit substance or a non-illicit abused substance or a metabolite thereof. Suitable illicit substances include, but are not limited to, methamphetamine, amphetamine, 3,4-methylenedioxymethamphetamine (MDMA), N-ethyl-3,4-methylenedioxyamphetamine (MDEA), 3,4-methylenedioxy-amphetamine (MDA), cannabinoids (e.g., δ-9-tetrahydrocannabinol, 11-hydroxy-δ-9-tetrahydrocannabinol, 11-nor-9-carboxy-δ-9-tetrahydrocannabinol), cocaine, benzoylecgonine, ecgonine methyl ester, cocaethylene, ketamine, and opioids (e.g., heroin, 6-monoacetylmorphine, morphine, codeine, methadone, and dihydrocodeine) or metabolites thereof. Non-limiting non-illicit abused substances include alcohol, nicotine, prescription or over-the-counter (OTC) medications taken for non-medical reasons, substances taken for therapeutic effects that were consumed in excess or inappropriately (e.g., analgesics such as opioids, sleep aids, anti-anxiety medications, methylphenidate, erectile dysfunction medications), etc. or metabolites thereof.
[0257] In some embodiments, the analyte is a pharmaceutical or a component or metabolite thereof. A wide variety of pharmaceuticals are suitable analytes, including, but not limited to, cancer therapeutics, vaccines, analgesics, antipsychotics, antibiotics, anticoagulants, antidepressants, antivirals, sedatives, antidiabetic agents, contraceptives, immunosuppressants, antifungals, anthelmintics, stimulants, biologic response modifiers, non-steroidal anti-inflammatory drugs (NSAIDs), corticosteroids, disease-modifying antirheumatic drugs (DMARDs), muscle builders, antacids, antiarrhythmics, thrombolytics, anticonvulsants, antidiarrheals, antiemetics, antihistamines, antihypertensives, anti-inflammatories, antineoplastics, antipyretics, barbiturates, β-blockers, bronchodilators, cough suppressants, cytotoxic agents, venodilators, diuretics, expectorants, hormones, laxatives, muscle relaxants, vasodilators, sedatives, vitamins, and metabolites thereof. Various examples of these pharmaceuticals are described herein and are well known in the art.
[0258] In some embodiments, the analyte is a poison, toxin, chemical weapon, or a metabolite thereof. Suitable poisons, toxins, and chemical weapons include vesicants (e.g., cantharidin, furocoumarin, sulfur mustard (e.g., 1,2-bis(2-chloroethylthio)ethane, 1,3-bis(2-chloroethylthio)-n-propane, 1,4-bis(2-chloroethylthio)-n-butane, 1,5-bis(2-chloroethylthio)-n-pentane, 2-chloroethyl chloromethyl sulfide, bis(2-chloroethylthio)methane, bis(2-chloroethylthio)methane, bis(2-chloroethylthiomethyl) ether, bis(2-chloroethylthioethyl) ether), nitrogen mustard (e.g., bis(2-chloroethyl)ethylamine, bis(2-chloroethyl)methylamine, and tris(2-chloroethyl)amine) and phosgene oxime), arsenic agents (e.g., ethyldichloroarsine, methyldichloroarsine, phenyldichloroarsine, and 2-chlorovinyldichloroarsine) and urticants, (e.g., phosgene oxime), blood agents (e.g., cyanogen chloride, hydrogen cyanide, and arsine), choking agents (e.g., chlorine, chloropicrin, diphosgene, and phosgene), nerve agents (e.g., tabun, sarin, soman, cyclosarin, novichok agents, 2-(dimethylamino)ethyl-N,N-dimethylphosphoramidofluoridate (GV), (S)-(ethyl{[2-(diethylamino)ethyl]sulfanyl}(ethyl)phosphinate) (VE), O,O-diethyl-S-[2-(diethylamino)ethyl] phosphorothioate (VG), S-[2-(diethylamino)ethyl]-O-ethylmethylphosphonothioate (VM), ethyl ({2-[bis(propan-2-yl)amino]ethyl}sulfanyl)(methyl)phosphinate (VX), tetrodotoxin, saxitoxin and botulinum toxin), animal venom components (e.g., tetrodotoxin, saxitoxin or other components of spider, snake, scorpion, honey bee, wasp, ant, tick, abalone, octopus, fish (e.g., stonefish) and jellyfish venom), cyanide, arsenic, components of Atropa Belladonna (belladonna) such as tropane alkaloids (e.g., atropine, scopolamine and hyoscyamine), components of Conium maculatum such as piperidine alkaloids (e.g., coniine, N-methylconiine, conhydrine, pseudoconhydrine and γ-coniceine), curare alkaloids (e.g., tubocurarine), nicotine, caffeine, alcohol, quinine, atropine, strychnine, brucine, aflatoxin and their metabolites, including but not limited to these. In some embodiments, the analyte is a blistering agent (e.g., cantharidin, furocoumarin, sulfur mustard (e.g., 1,2-bis(2-chloroethylthio)ethane, 1,3-bis(2-chloroethylthio)-n-propane, 1,4-bis(2-chloroethylthio)-n-butane, 1,5-bis(2-chloroethylthio)-n-pentane, 2-chloroethyl chloromethyl sulfide, bis(2-chloroethyl) sulfide, bis(2-chloroethylthio) methane, bis(2-chloroethylthiomethyl) ether or bis(2-chloroethylthioethyl) ether), nitrogen mustard (e.g., bis(2-chloroethyl) ethylamine, bis(2-chloroethyl) methylamine or tris(2-chloroethyl) amine) or phosgene oxime), arsenic agent (e.g., ethyldichloroarsine, methyldichloroarsine, phenyldichloroarsine or 2-chlorovinyldichloroarsine) or urticant agent, e.g., phosgene oxime), blood agent (e.g., cyanogen chloride, hydrogen cyanide or arsine), choking agent (e.g., chlorine, chloropicrin, diphosgene or phosgene), nerve agent (e.g., tabun, sarin, soman, cyclosarin, novichok agent, 2-(dimethylamino)ethyl-N,N-dimethylphosphoramidofluoridate (GV), (S)-(ethyl{[2-(diethylamino)ethyl]sulfanyl}(ethyl)phosphinate) (VE), O,O-diethyl-S-[2-(diethylamino)ethyl] phosphorothioate (VG), methylphosphonothioic acid S-[2-(diethylamino)ethyl]-O-ethyl (VM), ethyl({2-[bis(propan-2-yl)amino]ethyl}sulfanyl)(methyl)phosphinate (VX), tetrodotoxin, saxitoxin or botulinum toxin) and the like, or their metabolites.,
[0259] Examples of suitable analytes, diseases, disorders or symptoms, or related indications, and the known minimum clinically relevant blood concentration ranges are provided in Tables 1-3.
[0260] [Table 1]
[0261] [Table 2]
[0262]
Table 3
[0263] In some embodiments, the analyte is a metabolite of any one of the exemplary analytes above.
[0264] In some embodiments, the analyte is a part of a complex, for example, cTnI as a part of the cTnIC complex. Thus, in certain embodiments, the analyte is a complex comprising any one of the above analytes. The binding agent (e.g., aptamer) may interact with all components of the complex or may interact with a part of the complex, for example, a subunit.
[0265] The analyte preferably binds directly to the binding agent, but the present invention also intends to detect an agent that serves as evidence of the target analyte, such as one that constitutes a specific binding pair complementary to the target analyte, whose presence is detected only when the specific target analyte is present in the sample. Thus, the analyte is one for which an agent serving as evidence of the analyte is detected.
[0266] In some embodiments, the microstructure is coated with a material that reduces the absorption of non-target analytes. Examples of materials include those coated with BSA (bovine serum albumin), a bifunctional polyethylene glycol (PEG) polymer, and the like and containing an alkyl group. Such materials have the effect of reducing the adsorption of non-specific analytes, and non-specific analytes are effectively repelled from the microstructure.
[0267] For example, it will be understood that multiple coatings may be used together to avoid or exclude non-specific analytes, bind to the target analyte, thereby enabling the selective capture of the specific target analyte while leaving the non-specific analytes uncaptured.
[0268] Polymer coatings may be applied using a variety of techniques commonly used in the art. For example, the microstructures can be coated with a polymer using a variety of techniques such as dip coating, spray coating, deposition coating, electropolymerization, drop casting, electrospinning, inkjet coating, spin coating, etc.; especially including a variety of techniques including electropolymerization. In one example, a coating solution is applied to the microstructure and dried in-situ optionally using a gas jet. When the coating is a polymer coating, the polymer may be synthesized prior to coating using, for example, bulk polymerization in some embodiments. In alternative embodiments, the polymer is synthesized and coated simultaneously, such as when using electropolymerization for synthesis and coating. Those skilled in the art are familiar with suitable techniques.
[0269] Furthermore, to optimize the coating, the properties of the coating can be controlled by adding one or more other agents such as thickeners, detergents or other surfactants and adjuvants. These components can be provided in a variety of concentration ranges. For example, a thickener or surfactant can form between 0% and 90% of the coating solution.
[0270] A variety of types of thickeners can be used, including, for example, methylcellulose, carboxymethylcellulose (CMC), gelatin, agar, and agarose, as well as any other viscosity modifiers. The solution typically has a viscosity between 10 -3 Pa·s and 10 -1 Pa·s. In one example, using a coating solution containing 1-2% methylcellulose, a viscosity in the range of 0.011 (1%) to 0.055 (2%) Pa·s is obtained, which results in a suitable uniform coating.
[0271] Similarly, to adjust the surface tension of the coating solution, various types of surfactants can be used, such as any detergent or any suitable agent that reduces surface tension and is biocompatible at low concentrations. Solution properties are typically also controlled by the addition of one or more other agents such as thickeners, detergents, other surfactants, and any other suitable materials. These components can be provided at various concentrations. For example, the thickener or surfactant can form between 0% and 90% of the coating solution.
[0272] Alternatively, instead of using a coating technique, the reagent can be embedded within the microstructure. Thus, for example, in the case of a molded patch made of a polymeric material, the reagent is introduced into the mold such that with the polymeric material, the reagent is distributed throughout the structure. In this example, the polymer can be arranged such that pores are formed within the structure during the curing process.
[0273] The use of an affinity surface coating on each structure can also reduce non-specific adsorption of ISF and / or blood components while facilitating specific extraction of the target molecule.
[0274] Thus, in one example, one or more microstructures interact with one or more target analytes such that the response signal depends on the presence, level, or concentration of the target analyte. In one particular example, the analyte interacts with a coating on the microstructure such that it changes the electrical and / or optical properties of the coating, thereby enabling the analyte to be detected.
[0275] For example, measurements can be carried out by passing a current between electrodes, and the measurement of the resulting signal between the electrodes can be used to detect changes in electrical properties and thus the presence, level, or concentration of the analyte. In this regard, the electrical output signal can indicate one or more of voltage, current, resistance, capacitance, conductance, or impedance, or a change in any of these variables. Thus, the signal can be a potential measurement, a current measurement, a voltage measurement, an impedance measurement, etc.
[0276] For example, impedance measurements such as those in electrochemical impedance spectroscopy (EIS) examine the dynamics of the bound analyte or charge transfer in the bulk or interfacial regions of the aptamer. In this regard, when the aptamer captures the target analyte, the captured analyte can change the structure of the aptamer and its electrical properties. The measurement only requires ions in the sample and can be performed without a redox moiety.
[0277] In this example, the electrodes can be arranged as pairs, but the system may alternatively measure the impedance between different groups of electrodes where, for example, one group acts as the working electrode, another group acts as the counter electrode, and optionally yet another group acts as the reference electrode. In this example, the microstructure operating as part of the working electrode is functionalized using a coating that includes, for example, an aptamer, MIP, etc.
[0278] In yet another example, voltage measurement / current measurement techniques including cyclic voltammetry (CV), linear sweep voltammetry (LSV), differential pulse voltammetry (DPV), square wave voltammetry (SWV), alternating current voltammetry (ACV), or chronoamperometry (CA) can be used.
[0279] In this example, a current output is generated from the redox reaction of electroactive chemical species (redox moiety) occurring on a conductive material (e.g., a gold microstructure). When the target analyte is captured in the aptamer, the aptamer structure changes, and as a result, the redox moiety moves relative to the microstructure surface, thereby changing the current output.
[0280] Since a redox reaction is required for this type of conversion, some researchers attach a redox moiety to the aptamer.
[0281] In this example, a reference electrode may also be provided, in which case the electrodes may be arranged as three groups including a working electrode, a counter electrode, and a reference electrode. The reference electrode only needs to be near the working electrode and the counter electrode. Therefore, for example, the electrodes may be arranged as a pair of a working electrode and a counter electrode, and a row of pairs of electrodes may be used as the reference electrode. Suitable reference electrode materials are known in the art and may include, for example, Ag / AgCl, iridium oxide (IrOx), platinum, graphite / AgI, and Ag / AgI.
[0282] In yet another example, potentiometric measurements can be performed in which an electrical output is generated in response to the binding of a target analyte in an aptamer. Here, a change in voltage corresponding to the amount of analyte bound in the aptamer is measured. Potentiometric measurement techniques can be found in sensors such as ion-selective electrodes (ISEs) and field-effect transistors (FETs).
[0283] Other measurement techniques include mass-sensitive acoustic transducers such as surface acoustic wave (SAW) oscillators, Love wave oscillators, or quartz crystal microbalances (QCMs). The binding of the analyte may be quantified by a change in the oscillation frequency resulting from a change in mass on the oscillator surface.
[0284] In yet another example, one or more microstructures contain a therapeutic material, and at least one therapeutic drug delivery mechanism for controlling the release of the therapeutic material is provided. In one preferred example, the release of the therapeutic material is controlled by applying a stimulus to the microstructure, for example, by applying light, heat, or electrical stimulation to release the therapeutic material.
[0285] In one preferred example, the therapeutic material is housed in a coating on at least one microstructure, and a stimulus is used to dissolve the coating on the microstructure, thereby delivering the therapeutic material. It will be appreciated that this technique can be incorporated into coatings and applied to any therapeutic material that can be selectively released using a stimulus, such as a mechanical stimulus, a magnetic stimulus, a thermal stimulus, an electrical stimulus, an electromagnetic stimulus, or an optical stimulus.
[0286] The nature of the therapeutic material will vary depending on the nature of the treatment being attempted, including the preferred embodiment and / or whether the treatment is cosmetic or therapeutic. Examples of therapeutic materials include, but are not limited to, nanoparticles, nucleic acids, antigens or allergens, parasites, bacteria, viruses or virus-like particles, metals or metal compounds, molecules, elements or compounds, DNA, proteins, RNA, siRNA, sfRNA, iRNA, synthetic biomaterials, polymers, drugs, and the like.
[0287] However, it will be appreciated that the use of a coating is not essential, and further and / or alternatively, the therapeutic material can be incorporated within the microstructure itself.
[0288] Regardless of how the therapeutic material is provided, the substrate comprises a plurality of microstructures, and the separate microstructures have separate therapeutic materials and / or separate therapeutic dosages. In this case, the treatment device can control the therapeutic delivery mechanism to release the therapeutic material from the selected microstructure, thereby enabling separate treatment agents to be administered and / or enabling separate dosings depending on the results of measurements performed on the subject. In particular, as described in more detail below, the treatment device typically performs an analysis using at least in part the measured response signal; controls at least one therapeutic delivery mechanism, and uses the results of the analysis to enable individualized therapeutic agents to be administered substantially in real time.
[0289] For example, it will be appreciated that the microstructures may be variously coated by coating separate microstructures with separate coatings and / or by coating separate portions of the microstructures with separate coatings. This may be used to enable different analytes to be detected at different depths, such that, for example, separate coatings may be used for portions of the microstructure that penetrate into the dermis as opposed to the living epidermis. This may also be used to enable the detection of different analytes, or different levels or concentrations of the same analyte. Further, at least some of the microstructures may be left uncoated, for example so that they can be used as controls, and some may include a porous structure that is partially coated or has an internal coating. It will also be appreciated that multiple coatings may be provided. For example, an external coating may be provided that gives mechanical strength upon insertion and dissolves when in-situ, enabling the underlying functionalized coating to be exposed, for example to enable an analyte to be detected.
[0290] The nature of the coating and the method by which it is applied will vary according to the preferred embodiment, and techniques such as dip coating, spray coating, jet coating, etc. may be used as described above. The thickness of the coating will also vary according to the circumstances and the intended function provided by the coating. For example, a thicker coating may be used if the coating is used to provide mechanical strength or to contain a payload material to be delivered to a subject, whereas a thinner coating may be required if the coating is used for other sensing applications.
[0291] In one example, stimuli such as chemical, biochemical, electrical, optical or mechanical stimuli can be used to release a substance from the coating on the microstructure, break the coating, dissolve the coating or otherwise release the coating.
[0292] In another example, the microstructures can be coated with a selectively dissolvable coating. The coating can be adapted to dissolve after a defined period, e.g., after the microstructures have been present in the subject for a set time, in response to the presence, level or concentration of one or more analytes in the subject, if the functional barrier is breached or penetrated, or in response to the application of a stimulus signal, such as an electrical signal, an optical signal, etc. For example, the dissolution of the coating can be used to initiate the measurement process by exposing a binder or other functional feature, so that the analyte is detected only after the coating has dissolved.
[0293] In yet another example, the dissolution of the coating can be detected, for example, by a change in optical or electrical properties, and the measurement can be carried out after the coating has dissolved. Thus, the dissolution of the coating can be detected based on a change in the response signal.
[0294] In one example, the coating can be used to provide mechanical properties. For example, the coating can provide a physical structure that can be used to facilitate entry into the barrier, e.g., by providing microstructures with an outer contour having a smooth tapered shape. The coating can be used to strengthen the microstructures to prevent them from breaking, bending, deforming or otherwise being damaged during insertion, or to help fix the microstructures in the subject. For example, the coating can include a hydrogel that swells when exposed to moisture, so that the dimensions of the microstructures and the coating increase when inserted into the subject, thereby making it difficult to remove the microstructures.
[0295] The coating can also be used, for example, to adjust the surface properties of the microstructure to increase or decrease hydrophilicity, increase or decrease hydrophobicity, and / or minimize biofouling. The coating can also be used to attract, repel or exclude at least one type of substance, such as an analyte, cell, body fluid, etc. The coating may dissolve to expose the microstructure, yet another coating or material, which can be used to control the detection process. For example, a time-release coating may be used to enable measurements to be taken after a set time when the patch has been applied. This may also be used, for example, to provide a stimulus to a subject by releasing a therapeutic agent or therapeutic material.
[0296] Thus, in one example, the system includes a plurality of microstructures, and separate microstructures respond separately to an analyte. For example, separate microstructures may respond to separate analytes, to separate combinations of analytes, to separate levels or concentrations of analytes, etc.
[0297] In one example, at least some of the microstructures attract at least one type of substance to the microstructure and / or repel or exclude at least one type of substance from the microstructure. The nature of the substance may vary depending on the preferred embodiment and may include one or more analytes or other substances containing analytes, such as ISF, blood, etc. This can be used, for example, to attract control analytes, enable them to be concentrated and / or detected, and / or to repel or exclude non-target analytes in order to attract or repel or exclude the analyte.
[0298] The ability to repel or exclude substances can also assist in preventing biofouling. For example, the microstructures may generally contain a material that repels substances from the surface of the microstructures, such as polyethylene glycol (PEG), or may be provided with a coating. Reduction of biofouling can be achieved by selection of the microstructure material or the structure of the microstructure, such as applying a binder into the pores of a porous microstructure, a surface coating that is released to expose the sensing surface when sensing is to be carried out, a permeable coating such as a porous polymer, e.g., a nylon membrane, a polyvinylidene fluoride coating, a polyphenylenediamine coating, a polyethersulfone coating, or a hydrogel coating such as poly(hydroxyethyl methacrylate) or a PEG coating; a porous silica micelle membrane; a protein membrane, e.g., a fibroin membrane; a polysaccharide membrane, e.g., a cellulose membrane or a chitosan membrane; or a diol or silane membrane; a removable coating that impedes biofouling substances, and / or a porous coating may also be utilized. In certain embodiments, the microstructure is porous and the binder is applied into the pores of the microstructure.
[0299] In another example, biofouling can be incorporated using a control. For example, the patch may comprise a functionalized microstructure for analyte detection and a non-functionalized microstructure that serves as a control. Assuming that both sets of microstructures are exposed to a similar level of biofouling, the change in the response signal measured via the non-functionalized microstructure can be used to quantify the extent of biofouling that has occurred. This can then be incorporated when processing the signal from the functionalized microstructure, e.g., by removing any change in the response signal resulting from biofouling.
[0300] In one example, the system includes an actuator configured to apply a force to a substrate to assist a micro-structure in breaching a barrier in one example. The actuator may be used for additional and / or alternative purposes.
[0301] For example, the movement of the micro-structure may be used to detect mechanical properties of tissue. For example, the response of the actuator, such as the amount of current required to induce movement of the micro-structure, may be used to detect mechanical properties, such as the degree of elasticity, etc., and the mechanical properties may in turn indicate health problems, such as diseases, etc. This may be used in conjunction with a mechanical response signal, for example, to measure stress or strain on the micro-structure using a suitable detection modality and also to enable monitoring of the transmission of the actuator movement. Other external mechanical stimuli, such as a ring or other structure that generates a pressure wave within the tissue, may be provided around the patch to enable measurement of the response.
[0302] The actuator can be used to provide a mechanical stimulus to initiate a biological response, such as inflammation, or to attract, repel, or eliminate a substance. Further, physical movement can be used to release material from a coating on at least some of the micro-structures, or to break, dissolve, remove, or otherwise release a coating on at least some of the micro-structures. This can be used to initiate a measurement process, for example, to initiate a reaction with an analyte and release a coating or material to enable detection of the analyte.
[0303] The actuator can also be used to cause a barrier to penetrate a microstructure or to retract the microstructure from the barrier and / or the subject. In one example, this enables the microstructure to be inserted and, if necessary, removed from the subject, so that the microstructure can be removed when no measurement is being carried out. This can be used, for example, to make it more comfortable, to reduce the chance of infection, to reduce biofouling, and so on.
[0304] Since the microstructure is provided in a low-density configuration, the force required is typically minimal, in which case this can be achieved using an actuator that provides a small force, such as a piezoelectric actuator or a mechanical actuator, such as an offset motor, a vibration motor, etc. However, other actuators may be used, including any one or more of an electric actuator, a magnetic actuator, a polymer actuator, a cloth or textile actuator, a pneumatic actuator, a thermal actuator, a hydraulic actuator, a chemical actuator, etc. For example, a chemical reaction or a biochemical reaction, including exposure to air, light, water, or other substances, may initiate an exothermic release of energy that can be used to provide a mechanical force to push the substrate, and thus the microstructure, into the subject. It will be understood that actuation may also be achieved manually, by applying a force to the patch or by pressing the patch against the subject using a strap or the like.
[0305] In one particular example, this is achieved by using an actuating force, a periodic force, or a repetitive force that can assist in penetration by rocking the microstructure together with a biasing force provided, for example, by a spring actuator or an electromagnetic actuator, to overcome the elasticity of the stratum corneum and / or to reduce the friction required to penetrate the epidermis and / or the dermis, as well as to reduce the force required to pierce the barrier. This reduces the overall force required to penetrate the stratum corneum. However, this is not essential and a single continuous force or an instantaneous force may be used.
[0306] The frequency of vibration used varies according to the preferred embodiment and potentially the type of skin to which the microstructures are applied, and may include any one or more of at least 0.01 Hz, 0.1 Hz, 1 Hz, at least 10 Hz, at least 50 Hz, at least 100 Hz, at least 1 kHz, at least 1 kHz, or at least 100 kHz, and potentially up to several MHz. In one example, a varying frequency may be used. The frequency may vary according to various factors such as the time of application, particularly the length of time the application process is carried out, the depth or degree of penetration, the degree of resistance to insertion, etc. In one example, the system uses the response signal measured through the microstructures to detect when the barrier was breached, e.g., when the microstructures penetrated the stratum corneum. Thus, the frequency can be continuously changed, either increased or decreased, until the success of the penetration is achieved or until the actuator can be stopped at that location according to the depth of penetration that can be detected using the response signal. In another example, the frequency starts high and gradually decreases as the microstructures penetrate the barrier, particularly the stratum corneum.
[0307] In another example, the magnitude of the applied force can also be controlled. The force used varies depending on a range of factors such as the structure of the patch, the way the patch is applied, the location of application, the depth of penetration, etc. For example, a patch with a large number of microstructures typically requires a higher overall force to ensure penetration, but in the case of a minimal number, e.g., around 10 microstructures, a larger force may be required to incorporate attenuation or loss from the substrate / skin. Similarly, the force required to penetrate the stratum corneum is typically higher than that required to penetrate the buccal mucosa. In one example, the applied force can be at least 0.1 μN, at least 1 μN, at least 5 μN, at least 10 μN, at least 20 μN, at least 50 μN, at least 100 μN, at least 500 μN, at least 1000 μN, at least 10 mN, or at least 100 mN per microstructure and / or overall. For example, if there are 1000 microstructures, the force is 100 mN in total or 100 mN per protrusion, resulting in a total force of 100 N.
[0308] Here too, the force can vary depending on the depth or degree of penetration, increasing or decreasing, and can be determined based on a response signal for examining changes such as the time of application, the measured impedance, or the insertion resistance. In one particular example, the force gradually increases up to the point of entry and then decreases at that point.
[0309] As described above, the force can be applied as a single continuous force or an instantaneous force. However, more typically, the force is periodic. In this case, the nature of the periodic motion can vary and can have any waveform, including, for example, a square wave, a sine wave, a triangular wave, a variable waveform, etc. In this case, the force can be an absolute magnitude or peak-to-peak or root mean square (RMS).
[0310] Similarly, the magnitude of the movement of the microstructure can also be controlled. The degree of magnitude depends on factors such as the length of the microstructure and the degree of penetration required. The magnitude may include any one or more of more than 0.001 times the length of the microstructure, more than 0.01 times the length of the microstructure, more than 0.1 times the length of the microstructure, more than the length of the microstructure, more than 10 times the length of the microstructure, more than 100 times the length of the microstructure, or more than 1000 times the length of the microstructure. The magnitude may also vary according to the application time, the depth of penetration, the degree of penetration, or the insertion resistance, and may either increase or decrease. Here too, the magnitude may increase up to the penetration point and then decrease after the penetration point.
[0311] In the above example, the system can be configured to detect the stages of the insertion process. In one example, this can be achieved by monitoring the actuator, for example, monitoring the current required by the actuator to achieve a specific movement, which is then used to detect the depth of penetration, the degree of penetration, the insertion resistance, etc., and then using this to control the actuator.
[0312] The actuator can also be used to apply mechanical stimuli that may be used for various purposes. For example, the actuator can be configured to physically break or remove a coating on the microstructure, physically stimulate the subject, penetrate the microstructure into the barrier, retract the microstructure from the barrier, or retract the microstructure from the subject.
[0313] The actuator is typically operably coupled to a substrate, which may be realized using any suitable mechanism such as mechanical, electromechanical, etc.
[0314] In one particular example, the actuator comprises a spring actuator or an electromagnetic actuator to provide a constant biasing force, and at least one of a piezoelectric actuator and a vibration motor to apply an oscillating force. The oscillating force is applied at a frequency that is at least 10 Hz, less than 1 kHz, and about 100 - 200 Hz. The continuous force is typically greater than 1 N, less than 10 N, less than 20 N, or about 5 N, while the oscillating force is at least 1 mN, less than 1000 mN, and about 200 mN. The actuator is typically configured to cause movement of a microstructure that is at least 10 μm, less than 300 μm, and about 50 - 100 μm.
[0315] In one example, the system includes a housing that houses at least a sensor and one or more electronic processing devices, and optionally other components such as a signal generator, an actuator, a power source, a wireless transceiver, etc. In one particular example, the housing can be used to examine the microstructure, can be provided within an integrated device or provided separate from the substrate and engaged or provided in proximity to the substrate when a reading is to be performed to provide a reader function.
[0316] In an integrated configuration, the reader is typically mechanically coupled / integrated with the patch during normal use, enabling measurements to be automatically performed. For example, continuous monitoring can be performed, allowing readings to be taken every second to daily or weekly, typically every 2 minutes to 60 minutes, more typically every 5 - 10 minutes. The timing of the readings can vary depending on the nature of the measurements being performed and the particular situation. Thus, for example, an athlete may wish to perform more frequent monitoring while competing in a game and then less frequent monitoring while recovering after the game. Similarly, in the case of a person undergoing medical monitoring, the frequency of monitoring may vary depending on the nature and / or severity of the symptoms. In one example, the frequency of monitoring can be selected based on user input and / or based on a defined user profile, etc.
[0317] In an integrated configuration, the reader is connected to the patch using a conventional resistive bridge circuit and can use analog-to-digital conversion to perform measurements.
[0318] Alternatively, the reader can be separated, which would then allow the reader to be removed when not in use, enabling the user to wear the patch without any integrated electronic device and reducing discomfort. This is particularly useful for applications where the presence of a bulkier device can affect activities, such as sports, geriatric medicine, and pediatric medicine. In this situation, the reader is typically arranged to contact or approach the patch and enables reading to be performed upon demand. It will be understood that this requires the user / individual to drive the interrogation. However, the reader may be equipped with a warning function to transmit a signal.
[0319] Reading may be performed wirelessly using inductive coupling for both powering the patch and performing the reading, as described in more detail below as an option, or alternatively direct physical contact may be used. In this example, the microstructures and tissues form part of a resonant circuit having discrete inductance or capacitance, enabling the frequency to be used to determine the impedance and hence the analyte level or concentration. Further, and / or alternatively, ohmic contacts may be used where the reader makes electrical contact with connectors on the patch.
[0320] In any case, some analysis and interpretation of the analyte level or concentration is carried out among the leaders, and optionally, indicators may be displayed on the leader using an output, such as an LED indicator, an LCD screen, etc. Further, and / or alternatively, an acoustic alarm may be provided, for example, when the subject has an analyte level or concentration outside the acceptable range. The leader also incorporates wireless communication means, such as Bluetooth®, Wi-Fi, etc., enabling a reading event to be remotely initiated and / or data, such as impedance values, analyte level or concentration indicators, etc., to be transmitted to a remote device, such as a client device, a computer system or a cloud-based computing configuration.
[0321] In use, the housing typically selectively couples to the substrate, allowing the housing and substrate to be attached and removed as needed. In one example, this may be achieved using any suitable mechanism, such as electromagnetic coupling, mechanical coupling, adhesive bonding, magnetic coupling, etc. This allows the housing, and particularly the sensing device, to be connected to the substrate only when needed. Thus, the sensing system may be attached to the substrate only when the substrate is applied to and fixed on the subject and measurements are to be carried out. However, this is not essential, or alternatively, it will be understood that the housing and substrate may be collectively fixed to the subject using, for example, an adhesive patch, an adhesive coating on the patch / substrate, a strap, an anchor microstructure, etc. In yet another example, the substrate may form part of the housing, so that the substrate and the microstructure are integrated into the housing.
[0322] When the housing is configured to be attached to the substrate, the housing typically operably connects to a substrate connector on the substrate, thereby comprising a connector that communicates signals between the signal generator and / or sensor and the microstructure. The nature of the connector and the connection line vary according to the preferred embodiment and the nature of the signal, and may comprise a conductive contact surface that engages a corresponding surface on the substrate, or may comprise a wireless connection line, such as an adjusted induction coil, a wireless communication antenna, etc.
[0323] In one example, the system is configured to perform repeated measurements over a period, such as 2 or 3 hours, 2 or 3 days, 2 or 3 weeks, etc. To achieve this, the microstructure is configured to remain within the subject during that period, or may be removed when measurements are not being taken. In one example, the actuator is configured to initiate insertion of the microstructure into the skin and also enable removal of the microstructure once the measurement has been performed. Then, the microstructure can be inserted and retracted as needed to enable measurements to be performed over a long period without continuous skin penetration. However, this is not essential, or measurements over a short period can be performed, in which case the period can be less than 0.01 seconds, less than 0.1 seconds, less than 1 second or less than 10 seconds. It will be understood that other intermediate time frames may also be used.
[0324] In one example, once the measurement has been performed, one or more electronic processing devices analyze the measured response signal to determine an indicator indicative of the subject's health and / or physiological state.
[0325] In one example, this is achieved by deriving at least one metric value, which is then used to determine the indicator. For example, the system may be configured to perform impedance measurements, and the metric value corresponds to impedance parameters, such as impedance at a specific frequency, phase angle, etc. The metric value can then be used to derive an indication of an indicator, such as analyte level or concentration.
[0326] The way this is implemented varies according to the preferred embodiment. For example, an electronic processing device may apply a measured value to at least one computer model to determine an indicator, and the computer model embodies the relationship between a health state and one or more measured values. In this case, the computer model may be obtained by applying machine learning to reference measured values derived from subject data measured for one or more reference subjects having a known health state. In this specific example, the health state may indicate an organ function, a tissue function, or a cell function, may include the presence, degree, or severity of a medical condition, or may include measurements of one or more metrics related to the health state in other respects, such as the presence, level, or concentration of one or more analytes, such as one or more biomarkers.
[0327] The nature of the model and the training performed can be in any suitable form and may include any one or more of decision tree learning, random forest, logistic regression, association rule learning, artificial neural network, deep learning, inductive logic programming, support vector machine, clustering, Bayesian network, reinforcement learning, representation learning, similarity and distance learning, genetic algorithms, rule-based machine learning, learning classification systems, etc. Since such systems are well-known, they will not be described in further detail here. In one example, this includes training a single model to determine an indicator using measured values from reference subjects having various combinations of health states, etc., but this is not essential and other techniques may be used.
[0328] The measured signal can also be used in other ways. For example, to track changes in the health state or medical condition of a subject, changes in the measured value over time can be used. The measured signal can also be analyzed to generate an image or perform a mapping. For example, tomography may be used to determine a 2D or 3D image of a subject's site based on impedance measurements, etc. The signal may also be used in contrast imaging, etc.
[0329] In one example, the system can include a transmitter that sends measurement data, such as measured subject data, metrics or response signals, or values derived from the measured response signals, and enables these to be remotely analyzed.
[0330] In one particular example, the system includes a wearable patch that comprises a substrate and a microstructure, and a monitoring device (also referred to as a "reader") that performs measurements. The monitoring device can be attached to the patch or integrally formed with the patch, and for example, any necessary electronics can be mounted on the back of the substrate. Alternatively, the reader can be brought into contact with the patch when measurements are to be performed. In any case, the connection to the monitoring device can be a conductive (ohmic) contact, but alternatively can be a snap-fit engagement that enables the patch to be wirelessly interrogated and / or powered by the reader.
[0331] The monitoring device can be configured to perform measurements and / or at least partially process and / or analyze the measurement values. The monitoring device can, for example, control a signal generator and / or switch to control the stimulus applied to at least one microstructure as needed. This enables the monitoring device to selectively interrogate separate microstructures, enables separate measurements to be performed, and / or enables measurements to be performed at separate locations. This also enables the microstructures to be selectively stimulated, for example, enabling separate therapeutic agents to be applied to the subject. Thus, by selectively stimulating the microstructures and thereby selectively releasing therapeutic materials, this can be used to provide dose control or deliver separate therapeutic materials.
[0332] The monitoring device may also be used to generate an output, e.g., an output indicating a metric or a signal based on a metric, and / or to cause an action to be taken. Thus, the monitoring device may be configured to generate an output including a notification or a warning. This can be used to initiate an intervention, e.g., to indicate to the user that an action is required. This can simply be an indication of a problem, which may inform the user that they are dehydrated or that their troponin level is high, and / or may include a signal, e.g., to inform the user to replenish fluids or seek treatment, etc. The output may further and / or alternatively include a display of a metric, e.g., a measured value or information derived from a metric. Thus, a moisture level or an analyte level or concentration may be indicated to the user.
[0333] The monitoring device may also be configured to initiate other actions.
[0334] The output may be used to alert a caregiver that assistance is required, e.g., to transfer a notification to a client device and / or a caregiver's computer. In another example, this may be used to control a remote device. For example, this may be used to activate a drug delivery system, e.g., an electronically controlled syringe infusion pump, to allow caregiving to be automatically initiated. In yet another example, a semi-automatic system may be used, e.g., to provide a clinician with a notification including a metric and a recommended caregiving, allowing the clinician to approve the caregiving, in which case the approval is automatically implemented.
[0335] In one example, the monitoring device is configured to interface with a separate processing system, such as a client device and / or a computer system. In this example, this enables the processing and analysis tasks to be distributed between the monitoring device and the client device and / or the computer system. For example, the monitoring device may perform partial processing of the measured response signals, such as filtering and / or digitizing these signals, and provide the processed signals for display to a remote processing system for analysis. In one example, this is achieved by generating subject data including the processed response signals and transferring this to the client device and / or the computer system for analysis. Thus, this enables the monitoring device to communicate with a computer system that generates, analyzes, or stores subject data derived from the measurement data. This can then be used to generate an indicator that at least partially indicates the health state of the subject.
[0336] It will also be understood that this enables additional functionality to be implemented, including forwarding notifications to a clinician or other caregiver, and also enables remote storage of the data and / or indicators. In one example, this enables the recorded measurements and other information, such as derived indicators, details of applied stimuli or treatments, and / or details of other actions taken, to be directly incorporated into an electronic record, such as an electronic medical record.
[0337] In one example, this enables the system to provide data that underpins the growing telehealth sector by enhancing the capabilities of the telehealth system with high-fidelity and accurate clinical data that enables clinicians in remote locations to obtain the information they need. The telehealth system will be highly evaluated both at central hospitals and centralized research institutes and in villages remote from regional hospitals. For the time to treatment, if there are strong signs of improved clinical outcomes in heart attack patients, the geographically dispersed population cannot rely solely on access to traditional large hospitals. Thus, this system provides a very simple, low-cost, reliable, and accurate monitoring system that can be provided by any local medical institution, even though it has the ability to diagnose, for example, heart attacks, and only requires the application of a patch device. In this example, supplies can be quickly rushed to patients showing a positive reaction to troponin I, and there is no delay in the cardiac troponin laboratory blood test. Similarly, patients determined to be at low risk may be discharged early with fewer invasive tests or diverted to another system via their attending physician.
[0338] In yet another example, client devices such as smartphones, tablets, etc. are used to receive measurement data from wearable monitoring devices, generate subject data, and then transfer this to a processing system, which returns metrics that are then displayed on the client device and / or the monitoring device depending on the preferred embodiment.
[0339] However, this is not essential, and it will be understood that some or all of the steps of analyzing the measurements, generating the metrics, and / or presenting the metrics for display may be performed on the monitoring device.
[0340] Here too, similar outputs may be provided to or by a remote processing system or client device, for example to alert a clinician or trainer that a subject or athlete requires attention and that an intervention should be performed, and it will be understood that the device, such as a drug delivery device, etc., may be controlled.
[0341] The reader may be configured to automatically perform measurements when integrated into the patch or permanently / semi-permanently attached thereto, or may perform measurements when brought into contact with the patch in the case where the reader is separate. In this latter example, the reader may be inductively coupled to the patch.
[0342] Thus, functions such as processing the measured response signal, analyzing the results, generating the output, and controlling the measurement procedure and / or therapeutic agent delivery may be performed by the built-in monitoring device and / or by a remote computer system, and it will be understood that the specific distribution of tasks and functions as a result will vary depending on the preferred embodiment.
[0343] In one example, the system includes a substrate coil disposed on a substrate and operatively coupled to one or more microstructured electrodes. The one or more microstructured electrodes may comprise a microstructure that is an electrode or a microstructure having an electrode thereon. Typically, excitation and reception coils are provided in the housing of the measurement device, and the excitation and reception coils are disposed in proximity to the substrate coil during use. This is implemented such that the excitation and reception coils are inductively coupled to the substrate coil, so that when an excitation signal is applied to the drive coil, this induces a signal in the substrate coil, which can form a resonant circuit in conjunction with the electrodes and other reactive components on the substrate. As a result, the signal frequency, amplitude, and attenuation ratio (Q) of the resonant circuit on the substrate are reflected in the signal observed in the excitation and reception coils, which in turn can change the drive signal applied to the excitation and reception coils, for example by changing the frequency, phase, or magnitude of the signal, enabling this to act as a response signal and allowing, for example, bioimpedance or biocapacitance to be measured.
[0344] This can be used in various ways. In one example, the one or more microstructured electrodes are configured to bind to one or more target analytes, whereby the response signal depends on the presence, level, or concentration of the target analyte. This can be achieved in various ways as discussed above, for example by coating the microstructure with a binder or forming the microstructure from a material containing a binder, so that the analyte interacts with the microstructure electrodes and thus changes their electrical properties, thereby changing the properties of the response signal. For example, this may include binding the analyte to a coating or a material forming the microstructure, such as an aptamer.
[0345] The detection of the analyte may be carried out by any method, which may include, for example, examining the change in the response signal over time as the level or concentration of the analyte in the vicinity of the microstructural electrode changes. Alternatively, in another example, two sets of microstructural electrodes are used, these electrodes are driven independently, one serves as a control, and the other selectively responds to one or more analytes, so that the difference in the measured signals indicates the change in the analyte level or concentration.
[0346] In this example, the system typically includes a first substrate coil located on the substrate and operably coupled to one or more first microstructural electrodes, and a second substrate coil located on the substrate and operably coupled to one or more second microstructural electrodes, and the second microstructural electrodes are configured to interact with the analyte of interest. At least one drive coil is positioned in proximity to at least one of the first substrate coil and the second substrate coil such that a change, such as attenuation of an applied drive signal or a change in phase or frequency, acts as a response signal. In this case, one or more electronic processing devices use the first response signal and the second response signal, particularly the difference between the first response signal and the second response signal, to determine the presence, level or concentration of one or more analytes of interest.
[0347] When multiple combinations of substrate coils and electrodes form resonant circuits, each having a different resonant frequency by selection of either inductive or capacitive fixed reactive components, and thereby are intentionally designed to enable frequency multiplexing means for the entire array using a single excitation and reception coil.
[0348] Next, yet another example of a system for performing measurements in a subject is described with reference to FIGS. 3A - 3K.
[0349] In this example, the system includes a monitoring device 320 comprising a sensor 321 and one or more electronic processing devices 322. The system further includes a signal generator 323, a memory 324, an external interface 325, such as a wireless transceiver, an actuator 326, and an input / output device 327 connected to the electronic processing device 322, such as a touch screen or a display and input buttons. These components are typically provided in a housing 330 described below.
[0350] The nature of the signal generator 323 and the sensor 321 depends on the measurement to be performed and may comprise a current source and a voltage sensor, a laser or other electromagnetic radiation source, such as an LED and a photodiode or a CCD sensor. The actuator 326 is typically a piezoelectric actuator or a spring actuator or an electromagnetic actuator combined with a vibration motor coupled to the housing in order to bias and vibrate the substrate against the lower side of the housing, thereby pushing the microstructure into the skin, while the transceiver is typically a short-range wireless transceiver, such as a Bluetooth® system on a chip (SoC).
[0351] The processing device 322 executes software instructions stored in the memory 324 to enable various processes including controlling the signal generator 323, receiving and interpreting signals from the sensor 321, generating measurement data, and transmitting this to a client device or other processing system via the transceiver 325. Thus, the electronic processing device is typically a microprocessor, a microcontroller, a microchip processor, a logic gate configuration, firmware or any other kind of electronic device, system or configuration associated with implementing logic such as an FPGA (field programmable gate array) optionally.
[0352] In use, the monitoring device 320 is coupled to a patch 310 that includes a substrate 311 and a microstructure 312 coupled to a sensor 321 and / or a signal generator 323 via a wiring 313. The wiring may include physical conductive wiring, such as conductive tracks, but this is not essential and instead wireless wiring, such as inductive coupling or high-frequency wireless wiring, may be provided. In this example, the patch further includes an anchor microstructure 314 configured to penetrate the dermis and thereby assist in fixing the patch within the subject.
[0353] Examples of the patch 310 are shown in more detail in FIGS. 3B and 3C. Specifically, in this example, the substrate 311 is generally rectangular and has rounded corners to avoid discomfort when the substrate is applied to the subject's skin. The substrate 311 includes anchor microstructures 314 provided proximate the corners of the substrate 311 to assist in fixing the substrate, while the measurement microstructures 312 are arranged on the substrate as an array. In this example, the array has a regular grid arrangement and the microstructures 312 are provided as equally spaced rows and columns, but this is not essential and alternative spacing configurations may be used as described in more detail below.
[0354] For example, in the arrangements of FIGS. 3D and 3E, three anchor microstructures 314.1, 314.2, 314.3 are provided, each surrounded by circumferentially spaced microstructures 312.1, 312.2, 312.3. This can be utilized to maximize the effect of the anchors, specifically by providing microstructures 312 in close proximity to the anchor microstructures 314 to avoid movement of the microstructures 312 within the subject. Further, in this example, the anchor microstructures 314 may be used when measuring or applying signals, for example by acting as a ground connection or the like.
[0355] In this example, the substrate is also formed from a plurality of substrate layers 311.1, 311.2 that can assist in creating internal structures, such as wiring to a microstructure, a coil, etc., as described in more detail below. In a manner similar to that described below for the backing material, the substrate may also comprise separate regions or layers having separate material properties, etc.
[0356] In this example, the anchor microstructure 314.1 is circular and includes a single peripheral group of spaced-apart microstructures 312.1 in the circumferential direction. However, this is not essential, and in the case of the anchor microstructure 314.2, it will be understood that the anchor microstructure 314.2 is surrounded by two or more concentric groups of microstructures 312.2, with the outer group containing a greater number of microstructures. This allows for a larger range of measurements to be carried out. It will also be understood that other arrangements, such as yet another concentric group, providing a different number of microstructures in each group, are also possible. Further, although a circular group is shown, this is not intended to be limiting, and other shapes or distributions, including oval, square, etc., may be used.
[0357] In the case of the anchor microstructure 314.3, this is hexagonal, and the six plate microstructures 312.3 are each arranged radially outward from each respective face of the hexagonal anchor microstructure 314.3. In this way, measurements can be carried out between each face of the anchor microstructure 314.23 and the respective microstructures 312.3, which can be utilized to maximize the surface area of the electrodes on each face and plate while maintaining an equidistant spacing between the anchor microstructure and the surrounding microstructures.
[0358] While the above configuration has been described with respect to the anchor microstructure, it is not essential, and it will be understood that a similar arrangement may be used with any drive microstructure or sensing microstructure. Thus, in one example, a single drive microstructure may be used with a plurality of surrounding sensing microstructures, or alternatively a single sensing microstructure may be used with a plurality of surrounding drive microstructures. This provides an effective master-slave arrangement in which a single master drive / sensing microstructure is used with a plurality of sensing / drive microstructures.
[0359] Such master / slave relationships can be used in a wide range of applications, for example to induce a response in a plurality of sensing microstructures using a single drive signal. In this example, this can be used to identify separate responses at separate locations, for example for mapping, and thus to determine the location of an effect, and also for the presence of an analyte or a particular object, such as damage or cancer. Alternatively, this can be used to detect separate analytes, for example using separate coatings, such that a single stimulus signal can initiate the detection of separate analytes, and thus can be used with sensing microstructures.
[0360] In the examples of FIGS. 3B and 3C, four connectors 315 are provided that are connected to respective microstructures 312 via wiring 313 to enable a stimulus signal and a response signal to be applied to and measured from each of the two sets of microstructures. This can be used to enable symmetric or differential application and detection of signals, typically implemented with respect to a ground reference and contrasted with the generally noisy asymmetric or single-ended application or detection of the signal itself. However, it will be understood that this is not appropriate for some detection modalities, such as optical sensing, and a single connection 315 is provided.
[0361] In the examples of FIGS. 3F and 3G, the housing 330 is a rectangular housing as a whole. This measuring device can optionally have a form factor similar to a wristwatch or other wearable device, in which case it includes a strap 331 that enables the housing to be fixed to the user. However, this is not essential and other securing mechanisms may be used. Alternatively, the housing may simply be engaged with the patch each time a measurement is performed and held in place. In this example, the housing comprises a coupling member 332, such as a magnet, etc., that engages with a corresponding coupling member 316 on the substrate and enables the substrate to be fixed to the housing. Any form of coupling member may be used, but the use of magnets is particularly advantageous as they can be housed within the housing 330, enabling the housing to be sealed, and can also ensure the correct positioning of the substrate 310, for example, by inducing the mutual orientation of the substrate 310 and the housing 330 according to the polarity of the magnet.
[0362] Alternative examples of the patch 310 are shown in more detail in FIGS. 3N and 3O. In this example, the substrate 311 comprises three rows 312A, 312B, 312C of microstructures disposed thereon, and each group of microstructures 312A, 312B, 312C is connected to respective contacts 315A, 315B, 315C via respective connection lines 313A, 313B, 313C. This can be used, for example, to enable each row 312A, 312B, 312C of microstructures to function as a respective group and provide opposing, reference, and working electrode functions, as described in more detail below.
[0363] However, it will be understood that this configuration is for illustrative purposes only and other configurations may be used. For example, the substrate may form part of an adhesive patch that is applied to and held in place on the subject. In that case, the housing 330 may be selectively attached to the patch, for example using magnetic coupling, thereby enabling measurements to be performed as required.
[0364] In this example, the substrate can be realized using a woven fabric, a non-woven fabric, or other suitable materials, and can be a flexible substrate to which the microstructure is directly attached. However, more typically, as shown in FIG. 3H, flexibility is achieved using a plurality of individual substrates 311 attached to a flexible backing 319 to form a segmented substrate. It will be understood that such an arrangement can be used in a wide variety of situations, including attaching the substrate to a strap or the like for attachment to a subject.
[0365] A plurality of further alternative variations are shown in FIGS. 3I - 3K.
[0366] Specifically, in the example of FIG. 3I, the backing 319 is formed from a plurality of support layers 319.1, 319.2, and two are shown in this example for illustrative purposes only. The use of multiple layers can be utilized in achieving desired properties, such as providing an adhesive layer, a waterproof layer, etc.
[0367] In the example of FIG. 3J, the backing layer has a plurality of scattered regions 319.3 that can be used for specific purposes, such as to enable easier attachment of the substrate 311, to provide connectivity to the measurement device 320, to allow for increased flexibility between the substrates 311, etc. In this example, the scattered regions are substantially aligned with the substrates, but it will be understood that this is not essential and they may be provided in other orientations.
[0368] Yet another example shown in FIG. 3K includes a plurality of shape modifications including thinner regions 319.4 located between the substrates and used to improve flexibility, and thicker regions 319.5 between the substrates that may increase strength. Similarly, thinner or thicker regions 319.5, 319.6 may be provided along the substrate to improve, for example, strength, flexibility, connection to the measurement device, etc.
[0369] It will be understood that although these features have been described with respect to the backing layer, a similar approach may be used for the substrate itself.
[0370] Next, an example of an actuator configuration that assists in applying the patch will be described with reference to FIG. 3L.
[0371] In this example, the housing 330 includes a base 333 to which an actuator 326, such as a piezoelectric actuator or a vibration motor, is attached. The actuator 326 is aligned with an opening 334 on the lower side of the housing 330, and an arm 326.1 is coupled to the actuator 326 and extends through the opening 334 that may be sealed using an O-ring 334.1 or other similar arrangement.
[0372] The patch substrate 311 is disposed adjacent to the lower surface of the housing 330, and magnets 316, 332 are arranged to press the substrate 311 toward the housing 330. The arm 326.1 engages the substrate, thereby transmitting the force from the actuator 326 to the substrate 311 and enabling the substrate, and thus the microstructures 312, 314, to vibrate to assist in inserting the microstructures into the subject. Specifically, this arrangement enables direct transmission of the force to the substrate 311 while minimizing vibration of the housing 330 where the force in the substrate is maximized.
[0373] In the example of FIG. 3L, the substrate also includes a coupling member 316, such as a magnet, that can be used to attach the substrate to the housing 330.
[0374] Next, yet another example of an actuator arrangement will be described with reference to FIG. 3M.
[0375] In this example, the actuator arrangement includes an actuator housing 335 having a base 335.1 with an opening 335.2. The housing houses a spring 336 and a base 337 that supports the patch 310 (and optionally an integrated reader) during use. The base optionally also houses a piezoelectric actuator or an offset motor 338.
[0376] In use, the actuator housing 335 is positioned such that the base 335.1 of the housing 335 abuts against the subject's skin and the patch protrudes at least partially through the opening 335.2. In one example, this is achieved by having the housing operator hold the actuator. However, this is not essential and, additionally and / or alternatively, the actuator housing may be integrated with and / or form part of the monitoring device as described above.
[0377] In use, the spring 336 is configured to apply a continuous biasing force to the stage 337 such that the patch 310 is pressed against the subject's skin. Further, the piezoelectric actuator or offset motor 338 vibrates the attachment 337 and thus the patch 310, thereby facilitating the piercing and / or entry of the stratum corneum by the microstructures.
[0378] Examples of microstructure arrangements are described in more detail below with reference to FIGS. 4 - 8.
[0379] In the example of FIG. 4A, microstructures of different lengths are shown. The first microstructure 412.1 penetrates the stratum corneum and the living epidermis but does not invade the dermis. The second microstructure 412.2 enters the dermis but has just passed the dermal boundary. The third microstructure 412.3 penetrates a greater distance into the dermal layer. It will be understood that the length of the structures used will vary depending on the intended use of the device, specifically the nature of the barrier to be breached.
[0380] In the example of FIG. 4B, pairs of microstructures are provided. The first pair of microstructures 412.4 has a closer spacing, and the second pair of microstructures 412.5 has a relatively large spacing used to enable different characteristics to be detected or different forms of stimulation to be applied.
[0381] For example, a larger electrode spacing is used to perform impedance measurements between the interstitial fluid between electrodes and other tissues and liquids, while more closely spaced electrodes are more suitable for performing capacitive sensing to detect various analytes present on the surface of the electrodes.
[0382] Furthermore, the electric field strengths generated by applying signals to the first pair of microstructures and the second pair of microstructures are shown in FIGS. 4C and 4D, and it is clearly shown that the electric field strength between the electrodes decreases as the spacing increases, which in turn affects the ability to perform stimulation. For example, by providing an array of closely spaced microstructures, this can be used to generate a highly uniform electric field within a subject without the need for a large applied electric field. This can be used to enable the electric field to be used for performing, for example, electroporation for stimulation.
[0383] The microstructures have a range of different shapes. Specifically, these are exemplified by circular, rectangular, octagonal, cross-shaped, and star-shaped. The shape used will vary depending on the intended application. For example, a larger number of microstructures may be useful for providing a plurality of different electrode surfaces, while a larger total surface area may be useful for maximizing the amount of coating. Similarly, surfaces with sharp angles can be created, for example, cross arrangements and star arrangements can enable coatings to be used at different coating depths around the microstructures to provide an overall circular profile.
[0384] Specific examples of plate microstructures are shown in FIGS. 5A - 5C.
[0385] In this example, the microstructure is a plate having a main body portion 512.1 and a tip portion 512.2 that is tapered to facilitate entry of the microstructure 512 into the stratum corneum. In this example, electrode plates 517 are provided on both sides of the microstructure, and these are coupled to a connector 515 via a single connection line 513 for connection to the previous sensor 321 and / or signal generator 323. This enables both measurement of signals from the electrode plates and application of signals to the electrode plates. However, this is not essential, and it will be understood that independent connection lines may be provided to allow each of the electrodes to be driven or sensed independently. Further, each electrode 517 may be subdivided into a plurality of independent segments 517.1, 517.2, 517.3, 517.4, such that each face comprises a plurality of electrodes.
[0386] As shown in FIGS. 5C and 5D, various arrangements may be used, but generally, a pair of microstructures is formed, with the microstructures facing each other to allow a signal to be applied between or measured between the microstructures. Again, various spacings between the electrodes in the pair of electrodes can be used to enable various measurements to be carried out and / or to vary the profile of tissue stimulation between the electrodes.
[0387] Even another example of a blade microstructure is shown in FIGS. 5E and 5F.
[0388] In this example, the microstructure is an elongated body portion 512.1 and a tip portion 512.2 that is tapered to facilitate the entry of the microstructure 512. This is similar overall to the plate arrangement and profile described above, but in this example it is considerably wider and, in one particular example, can extend across substantially the entire distance of the substrate. In this example, the microstructure comprises a plurality of electrode plates 517 on each side of the microstructure. In this case, the substrate comprises a plurality of spaced parallel blades, enabling signals to be applied across electrodes on separate blades or measured between electrodes on separate blades. However, it will be understood that other configurations, such as providing a single electrode, segmental electrodes or making the entire microstructure act as an electrode, may be used.
[0389] In this example, the blade tip is shown to be parallel to the substrate, but this is not essential and other configurations may be used where the tip is inclined, thereby causing the blade to gradually penetrate along the length of the blade as it is inserted, which in turn can facilitate entry. The tip may also include a serrated edge or the like to further enhance entry.
[0390] As described above, in one example, the microstructures are provided in a regular lattice arrangement. However, in another example, the microstructures are provided in a hexagonal lattice arrangement as shown in FIG. 5G. This is particularly advantageous as it means that, as indicated by the arrows, each microstructure is equidistant from all of its nearest neighbouring microstructures, enabling measurements to be carried out without the need to modify the response or stimulation signals to incorporate different spacings for any of the adjacent microstructures.
[0391] In FIGS. 5H - 5K, another arrangement example is shown where the microstructures 512 are arranged as pairs 512.3 and are arranged as pairs with respect to the shifted rows 512.4, 512.5. In this example, the sets of separate rows are arranged orthogonally, and thus the microstructures extend in separate directions. This avoids all the microstructures being aligned, which in turn could make the patch vulnerable to in - plane displacement in the same direction as the microstructures. Further, arranging the pairs orthogonally reduces interference, e.g., crosstalk, between separate pairs of electrodes, especially when measurements are carried out simultaneously through multiple pairs of microstructures, improves measurement accuracy, and incorporates tissue anisotropy.
[0392] In one example, connection lines 513.41, 513.42; 513.51, 513.52 are provided for each pair of microstructures in each row, enabling the entire rows of pairs of microstructures to be massed and / or stimulated simultaneously, while allowing separate rows to be massed and / or stimulated independently.
[0393] A scanning electron microscopy (SEM) image showing an array of offset pairs of microstructures is shown in FIG. 5K.
[0394] Specific examples of microstructures for performing measurements in the epidermis are shown in FIGS. 5L and 5M.
[0395] In this example, the microstructure is a plate or blade having a body portion 512.1 and a flare - shaped base 512.11 where the body portion is joined to the substrate to enhance the strength of the microstructure. The body portion narrows to define a shoulder 512.13 at the waist 512.12 and then extends to a tapered tip 512.2 via a non - tapered shaft 512.14 in this example. Typical dimensions are shown in Table 4 below.
[0396]
Table 4
[0397] An example of a pair of the microstructures of FIGS. 5L and 5M inserted into a subject is shown in FIG. 5N.
[0398] In this example, the microstructure is configured such that the tip 512.2 penetrates the stratum corneum SC and enters the viable epidermis VE. The waist 512.12, and especially the shoulder 512.13, abut against the stratum corneum SC so that the microstructure does not penetrate further into the subject and the tip does not enter the dermis. This helps to avoid contact with nerves that could cause pain.
[0399] In this configuration, the main body portion 512.1 of the microstructure is coated with a layer of insulating material (not shown), and only the tip is exposed. As a result, the current signal applied between the microstructures generates an electric field E within the subject, particularly within the viable epidermis VE, and thus the measured value reflects the analyte level or concentration within the viable epidermis VE.
[0400] However, it will be understood that other configurations can be used. For example, in the arrangement of FIG. 5O, the shaft 512.14 is lengthened, so that the tip 512.2 enters the dermis, enabling dermal (optional epidermis) measurements to be performed.
[0401] In this example, typical dimensions are shown in Table 5 below.
[0402]
Table 5
[0403] Examples of the inter-pair and intra-pair spacings for these configurations are shown in Table 6 below.
[0404]
Table 6
[0405] The microstructure 512 is arranged within groups 512A, 512B, 512C, and examples of further arrangements where each group acts as a working electrode, a reference electrode, and a counter electrode respectively are shown in FIGS. 5P - 5U. In each case, the microstructure of each group provides the respective electrodes that are electrically connected, so that the group acts as a single electrode that penetrates the stratum corneum (or other functional barrier) at multiple positions, thereby improving the electrical connection between the working electrode, the reference electrode, and the counter electrode and the subject. Further, using aptamers, MIPs, etc., the microstructures within the working group are typically functionalized.
[0406] In the example of FIG. 5P, the microstructures 512 are arranged as parallel rows of plate microstructures, and the microstructures have the same orientation within each row. In contrast, in the example of FIG. 5Q, the microstructures within each group are arranged in pairs, and the pairs of adjacent microstructures are orthogonally oriented. In these examples, the groups are shown as adjacent rectangular regions, and the reference group 512B is located between the working group 512A and the counter group 512C. However, this is not essential, and other configurations can be used.
[0407] Generally, the groups are arranged according to some basic guiding principles. For example, the counter electrode defined by the counter group 513C is used as a current reservoir for the three-electrode system, and thus needs to be as large as possible to ensure that the working electrode defined by the working group 512A is never electron-deficient. However, since the size of the signal in the electrochemical aptamer-based sensor is related to the surface area of the working electrode provided by the working group 513A, the counter electrode typically needs to be approximately the same size as the working electrode. Conversely, the reference electrode defined by the reference group 513B only needs to maintain a stable potential beyond the bias voltage range of the sensor, and thus does not need to be so large. The effective sizes of the working electrode, reference electrode, and counter electrode are governed by the size and number of microstructures in each region. Thus, the reference group 513B typically contains fewer microstructures than the working group or counter groups 513A, 513C, and due to a certain microstructure spacing, the physical size on the substrate is smaller than that of the working group or counter groups 513A, 513C, while the working group or counter groups 513A, 513C have similar sizes and contain a similar number of microstructures.
[0408] The potential applied to the working electrode is with respect to this reference electrode, and therefore the reference group 513B is typically placed close to, preferably adjacent to, the working group 513A so that the potential can be controlled without an intermediate potential drop.
[0409] It will be appreciated that this provides some flexibility in the physical layout of the groups. Alternative examples showing adjacent rectangular working and reference groups 512A, 512B, with the counter group 512C extending around three sides of the working group 512A and along either side of the reference group 512B are shown in FIGS. 5R and 5S.
[0410] In the examples shown in FIGS. 5T and 5U, three adjacent rectangular working groups 512A1, 512A2, 512A3 are provided, a single reference group 512B is arranged along one end of the working groups 512A1, 512A2, 512A3, and a counter group 513C extends around three sides of the working groups 512A1, 512A2, 512A3 and the reference group 512B. This arrangement may provide a plurality of working electrodes, each of which is separately functionalized, allowing separate measurements to be carried out. For example, the working groups 512A1, 512A2, 512A3 may be functionalized with different aptamers, allowing different analytes to be detected. In this example, typically, separate measurements are carried out at different times using, for example, a multiplexer or other switching device to selectively measure the potential and / or current at the working electrodes.
[0411] In the above example, the patch is substantially rectangular, but it will be understood that this is not essential and any configuration of the patch may be used. Examples of this are shown in FIGS. 5V and 5W, where circular patches are used and the groups include a central circular working electrode group 512A and a partial annular reference electrode group and counter electrode groups 512B, 512C arranged radially outward from the working electrode group 512A.
[0412] Similarly, it will be understood that the microstructures may be of different shapes and may include microneedles, or other shapes, or combinations thereof.
[0413] Yet another example of an arrangement is shown in FIGS. 6A and 6B, where the microstructure also includes a generally similar plate-like arrangement overall, the microstructure comprises spaced prongs 612.2, each of which has an electrode 617 thereon, so that the electrodes are on the surface between the prongs 612.2, again allowing a highly uniform electric field to be applied or allowing capacitive detection to be carried out.
[0414] Yet another example of a microstructure is shown in FIGS. 7A and 7B and includes a body portion 512.1 that includes a conductive core 513 covered by an insulating layer 512.1 that may be a polymer or other material in one example. In this case, the core 513 terminates at an opening 513.2, allowing an electrical signal to be communicated through the outlet. Further, and / or alternatively, a port 513.3 extending through the insulating layer is also provided, allowing an electrical signal to be communicated mid-way along this structure as shown in FIG. 7B and potentially allowing measurements to be taken at a target depth within the living epidermis and / or dermis.
[0415] It will also be appreciated that when pairs of microstructures are used, electrodes may be provided only on the inner surfaces of the pairs, for example by insulating the outer surfaces of the pairs, thereby reducing electrical interference between separate pairs of microstructures.
[0416] Next, alternative techniques for manufacturing microstructures are described with reference to FIGS. 8A - 8C.
[0417] In this example, a carrier wafer 891 is provided and a photopolymer layer 892 is spin-coated. The photopolymer layer 892 is selectively exposed to ultraviolet light and cross-linked in this example to create a structural region 892.1 that forms a substrate. A second photopolymer layer 893 is spin-coated over the first layer 891 and exposed to ultraviolet light and cross-linked to form a second structural region 893.1 that forms microstructures extending from the substrate in this example. The carrier wafer and uncross-linked polymer are removed to create the microstructure shown in FIG. 8D.
[0418] It will be appreciated that this layer formation technique can be used to create a wide variety of different microstructure configurations. An alternative design is shown in FIG. 8E.
[0419] In one example, the monitoring device operates as part of a distributed architecture. An example thereof is described next with reference to FIG. 9.
[0420] In this example, one or more processing systems 910 and / or one or more local area networks (LANs) are coupled to a plurality of client devices 930 and monitoring devices 920 via a communication network 940. The monitoring device 920 may be directly connected to the network or may be configured to connect to the client device 930, which may then provide a connection function to the subsequent network 940. The configuration of the network 940 is for illustrative purposes only, and in practice, any suitable mechanism, such as a mobile network, a private network, such as an 802.11 network, the Internet, a LAN, a WAN, etc., including but not limited to wired or wireless connections, as well as direct connections or point-to-point connections, such as Bluetooth (registered trademark), etc., may be used for the processing system 910, the client device 930, and the monitoring device 930 to communicate.
[0421] In one example, each processing system 910 is configured to receive subject data from the monitoring device 920 or the client device 930 and analyze the subject data to generate one or more health status indicators. The health status indicators can then be provided to the client device 930 or the monitoring device 920 for display. Although the processing system 910 is shown as a single entity, it will be understood that the processing system 910 can be geographically dispersed across multiple locations by using, for example, a processing system 910 and / or a database provided as part of a cloud-based environment. However, the above-described arrangement is not essential, and other suitable configurations may be used.
[0422] An example of a suitable processing system 910 is shown in FIG. 10.
[0423] In this example, the processing system 910 includes at least one microprocessor 1000, a memory 1001, an optional input / output device 1002, such as a keyboard and / or a display, and an external interface 1003, which are interconnected via a bus 1004 as shown. In this example, the external interface 1003 can be used to connect the processing system 910 to peripheral devices, such as a communication network 940, a database 1011, other storage devices, etc. Although a single external interface 1003 is shown, this is for illustrative purposes only, and in practice, multiple interfaces using various methods (e.g., Ethernet, serial, USB, wireless, etc.) may be provided.
[0424] In use, the microprocessor 1000 executes instructions in the form of application software stored in the memory 1001 to enable the necessary processes to be carried out. The application software may include one or more software modules and may be executed in a suitable execution environment, such as an operating system environment.
[0425] Thus, it will be understood that the processing system 910 may be formed from any suitable processing system, such as a suitably programmed client device, a PC, a web server, a network server, etc. In one particular example, the processing system 910 is a standard processing system, such as an Intel architecture-based processing system that executes a software application stored in a non-volatile (e.g., hard disk) storage device, but this is not essential. However, it will be understood that the processing system may be any electronic processing device related to implementing logic such as a microprocessor, a microchip processor, a logic gate configuration, optionally an FPGA (field programmable gate array), or any other electronic device, system, or arrangement.
[0426] An example of a suitable client device 930 is shown in FIG. 11.
[0427] In one example, the client device 930 includes at least one microprocessor 1100, a memory 1101, an input / output device 1102, such as a keyboard and / or a display, and an external interface 1103 interconnected via a bus 1104 as shown. In this example, the external interface 1103 can be used to connect the client device 930 to peripheral devices such as a communication network 940, a database, other storage devices, and the like. Although a single external interface 1103 is shown, this is for illustrative purposes only, and in practice, multiple interfaces using various methods such as Ethernet, serial, USB, wireless, etc. may be provided.
[0428] In use, the microprocessor 1100 executes instructions in the form of application software stored in the memory 1101 to enable communication with the processing system 910 and / or the monitoring device 920.
[0429] Thus, the client device 1130 may be formed from any suitable processing system, such as a suitably programmed PC, Internet terminal, laptop, or handheld PC, and in one preferred example may be either a tablet or a smartphone. Thus, in one example the client device 1130 is a standard processing system, such as an Intel architecture processing system that executes software applications stored in a non-volatile (e.g., hard disk) storage device, although this is not essential. However, it will be understood that the client device 1130 may be any electronic processing device, such as a microprocessor, microchip processor, logic gate configuration, firmware associated with implementation logic such as an FPGA (field programmable gate array) optionally, or any other electronic device, system, or arrangement.
[0430] Next, examples of processes for performing measurements and generating metrics are described in more detail. In these examples, it is assumed that one or more processing systems 910 play a role in analyzing the received subject data and generating the resulting metrics. Measurements are performed by the monitoring device 920, and the subject data is transferred to the processing system 910 via the client device 230. In one example, this is provided in a platform-independent manner, such that input data and instructions are received via a web page from the client device 930, and the resulting visual representation is drawn locally by a browser application or other similar application executed by the client device 930, to enable easy access using client devices 930 that use different operating systems and have different processing capabilities. Thus, the processing system 910 is typically a server (hereinafter referred to as the server) that communicates with the client device 930 and / or the monitoring device 920 according to the particular network infrastructure available, such as via the communication network 940.
[0431] To achieve this, server 910 typically runs application software to operate web pages and perform other necessary operations including data storage, retrieval, and processing. The operations performed by processing system 910 are carried out by processor 1000 according to instructions stored in memory 1001 as application software and / or input commands received from the user via I / O device 1002, or commands received from client device 1030.
[0432] It will also be understood that the user interacts with server 910 via a GUI (Graphical User Interface) presented on client device 930, and in a particular example, via a browser application that displays a web page operated by server 910, or an app that displays data supplied by server 910. The operations performed by client device 930 are carried out by processor 1100 according to input commands received from the user via instructions stored in memory 1101 as application software and / or via I / O device 1102.
[0433] However, it will be understood that the above-described configuration assumed in the following examples is not essential, and many other configurations may be used. It will also be understood that the distribution of functions among monitoring device 920, client device 930, and server 910 may vary depending on a particular implementation.
[0434] Next, an example of a process for performing measurements on a subject will be described in more detail with reference to FIGS. 12A and 12B.
[0435] In this example, a process for applying a patch including a substrate and a microstructure to steps 1200 - 1230 is shown, while a measurement process is shown for steps 1235 - 1260. In this regard, for a patch used to perform multiple measurements over a period of time, it is understood that steps 1200 - 1230 are performed only once, and steps 1235 - 1260 are repeated as necessary.
[0436] Furthermore, in this example, the system is assumed to include a leader formed by the housing 330 and associated signal generators, sensors, and processing electronics. The leader may be integral with the patch 310 and / or separate from the patch 310 depending on the preferred embodiment.
[0437] In step 1200, the substrate is provided at the desired location, and the substrate and the microstructure are in an appropriate position relative to the subject. In step 1205, assuming the leader is not integrated with the patch 310, the housing 330 is attached to the substrate 311, for example, by magnetically or otherwise coupling the housing and the substrate, or by holding the housing in contact with the patch 310.
[0438] In step 1210, the processing device 322 selects a frequency / magnitude for the actuator. This may be a standard value and / or may depend on the barrier to be breached, so different values may be selected for separate sites of a subject and / or for separate subjects.
[0439] In step 1215, the actuator 326 is controlled, thereby initiating the vibration of the microstructure and thus facilitating the movement of the microstructure within the subject.
[0440] In step 1220, a stimulus is optionally applied, and in step 1225, a response signal is measured, enabling the processing device 322 to monitor the breakthrough of the functional barrier and / or the depth of penetration. The mechanism for achieving this depends on the nature of the response signal and the optional stimulus. For example, a stimulus and a response may be used to derive impedance, and the impedance value changes as the microstructure enters the stratum corneum and penetrates into the living epidermis.
[0441] In step 1230, the processing device 322 optionally determines whether the breakthrough or penetration is complete, and if not, the process returns to step 1210 to select another frequency and / or magnitude. Thus, this process enables the frequency and / or magnitude of any applied force to be continuously adjusted when the substrate and the microstructure are applied, particularly when the microstructure breaks through the functional barrier and optionally penetrates. In one example, this is used such that the frequency decreases upon insertion, while the force gradually increases until the barrier is broken through, at which point the force decreases. In this regard, it has been found to facilitate the penetration of the barrier.
[0442] Measurements may be started once the patch is applied. In this regard, if a reader is integrated into the patch, the measurements can be performed as needed. Alternatively, if the reader is separate, this may require bringing the reader close to and / or into contact with the patch to enable the measurements to be performed.
[0443] In this example, at step 1235, the monitoring device 920 applies one or more stimulus signals to the subject, and then at step 1240, the response signal is measured. The response signal is measured by the sensor 321, and the sensor 321 generates measurement data that is provided to the processing device 322 at step 1245.
[0444] In one example, the monitoring device 920 then transfers the measurement data to the client device 930 for further processing. Specifically, the client device 930 may perform preliminary preprocessing of the data, for example, adding additional information derived from built-in sensors such as GPS, thereby adding time or location information, etc. This information may be useful in situations such as tracking the spread of infectious diseases.
[0445] The resulting data can be collated, for example, by creating subject data, and then transferred to the server 910, enabling it to be analyzed in step 1250. However, it should also be understood that the analysis may be performed by the built-in reader, and the indicators derived from performing the analysis may be displayed on the reader.
[0446] The nature of the analysis varies according to the preferred implementation, and a wide range of options are envisioned.
[0447] When performing an analyte level or concentration measurement, an alternating current signal is applied to the subject through a pair of microstructures, and the resulting voltage signal is measured through the same microstructures. Next, the magnitude and phase of the applied current and the resulting voltage can be used to calculate an impedance value or capacitance value that depends on the analyte level or concentration within the subject. Thus, it is possible to determine the relationship between the measured impedance value and the analyte level or concentration, monitor the progression of a disease, disorder, or symptom, diagnose a disease, disorder, or symptom, or determine the presence, absence, level, or concentration of a pharmaceutical, illegal substance, or non-illegal abuse substance, or a chemical weapon, poison, or toxin. For example, the subject data may be used together with previously collected subject data to perform longitudinal analysis and examine changes in the measured values over time. Additionally and / or alternatively, the subject data may be analyzed using a machine learning model or the like.
[0448] In step 1255, one or more metrics are generated, and the nature of the metrics and how they are generated will vary depending on the preferred embodiment and the nature of the analysis being performed.
[0449] In step 1260, data, such as subject data, metrics or measurement data, is recorded to enable the data to be accessed later as needed. The metrics may be provided to and / or displayed on client device 930 and / or monitoring device 920.
[0450] In one example, a monitoring device is assigned to each user and this assignment is used to track measurements about the subject. An example of a process for assigning monitoring device 920 to a subject will now be described with reference to FIG. 13.
[0451] In this example, the subject first undergoes an assessment in step 1300, which process is performed by a clinician. The clinician uses this assessment to guide the type of monitoring that needs to be performed, for example to identify specific biomarkers to be measured, which may in turn depend on any signs or medical conditions, disorders or symptoms the subject is suffering from. As part of this process, the clinician typically obtains subject attributes, such as measurements of weight, height, age, gender, details of medical interventions, etc. in step 1310. This is performed using combinations or techniques, such as querying the medical record, asking questions, taking measurements, etc.
[0452] Once the assessment is complete, at 1320 a monitoring device type is selected, which is carried out based on the required measurements. In this regard, various combinations of the microstructure arrangement and the detection modality are used to enable a range of separate measurements to be carried out, and thus it is understood that it is important that the correct selection is made to enable measurements to be collected. Next, at step 1330 a particular monitoring device 920 is assigned to the subject. In this regard, each device typically includes a unique identifier, such as a MAC (Media Access Control) address or other identifier, that can be used to uniquely associate the monitoring device with the subject.
[0453] At step 1340, the monitoring device 920 can optionally be configured to update, for example, the firmware or instruction set required to carry out each measurement. At step 1350, a subject record is newly created for use in storing details regarding the subject, including subject attributes, subject data, metrics, or any other relevant information. Further, the subject record typically also includes a display of the monitoring device identifier, thereby associating the monitoring device with the subject.
[0454] Next, an example of a process for using the device to carry out measurements is described with reference to FIGS. 14A and 14B.
[0455] In this example, one or more measurements are performed at step 1400. The measurements are performed by using the process described above, for example, by applying a stimulation signal to a monitoring device and measuring a response signal. Measurement data is recorded based on the response signal, and this is uploaded to the client device 930 at step 1405, enabling the client device 930 to generate subject data at step 1410. The subject data may be only the measurement data, but may also include additional information provided by the client device 930. This enables user input items, such as details of symptoms, changes in attributes, etc., to be provided via the client device 930. The subject data is then uploaded to the server 910 at step 1415. The server 910 then reads out one or more subject attributes from, for example, the subject record at step 1420, and the server 910 then calculates one or more metric values at step 1425.
[0456] At step 1430, the server 910 analyzes the metric values. The way this is done varies according to the preferred implementation. For example, this may be achieved by applying the metric values to a computer model that embodies the relationship between the relevant health state and one or more metric values. Alternatively, the metric values can be determined from a population of reference subjects and compared with thresholds defined and used to represent the presence or absence of a particular disease or symptom, such as the presence or absence of a medical condition. As yet another option, the metric values may be compared with previous metric values for the subject, for example, to examine changes in the metric values. This time, it may represent a change in the health state. The result of the analysis is used at step 1435 to generate one or more indicators. In one example, the indicator may be in the form of a score representing the health state, or may indicate the presence or degree of a disease, disorder or symptom.
[0457] In step 1440, the metric can be stored, and in step 1445, the display of the metric is transferred to the client device 930, enabling the metric to be displayed by either the client device 930 or the monitoring device 920 in step 1450.
[0458] Furthermore, and / or alternatively, in step 1455, the metric can be used to determine whether an action is required, such as whether to perform an intervention. The assessment of whether an action is required may be performed in any one of a plurality of ways, but typically involves comparing the metric to an assessment criterion that defines a predetermined threshold or range of acceptable metric values. For example, comparing a moisture metric to a range indicating normal moisture, or comparing an analyte metric indicating a normal level or concentration of an analyte.
[0459] The assessment criterion can also specify the actions required when the metric is outside the acceptable range, and all the steps necessary to perform the actions, enabling the actions to be performed in step 1460. For example, if a particular analyte is detected, this may indicate a medical condition, in which case the processing system or monitoring device generates a notification that is provided to a clinician or other designated person or system, enabling them to be alerted. The notification may include any determined metric and / or measured response signal, enabling the clinician to quickly identify any necessary interventions. In a therapeutic diagnostic application, the action may include causing an application monitoring device to apply a stimulation signal to an electrode, thereby enabling the release of one or more therapeutic agents. This may be performed according to a dosing schedule, which may be specified as part of the assessment criterion or may be manually determined by the clinician in response to a notification provided as described above. Alternatively, the action may include notifying the user, so that, for example, if the subject is in a dehydrated state, the action may include causing the monitoring device to signal the user to replenish fluids.
[0460] Therefore, it will be understood that this enables measures to be activated as necessary.
[0461] The above process describes the transfer of data to a remote system for analysis, which can have several advantages. For example, this enables more complex analysis to be performed with existing processing capabilities than would be possible with other approaches. This enables remote monitoring, for example allowing a clinician to access in real time records related to multiple patients and enabling the clinician to respond promptly as needed. For example, if the measurement data indicates a harmful health condition, the clinician may receive a warning or notification and be enabled to initiate an intervention. Further, population monitoring provides benefits to public health, for example enabling the tracking of infectious diseases. Further, centralised analysis enables the analysis process to be refined and data mining to be used to make it more accurate as more data is collected.
[0462] However, decentralised instantiation is not essential and it will be understood that alternatively or additionally the analysis may be performed in-situ, for example causing steps 1425 - 1460 to be performed on the monitoring device 920 and / or the client device 930, and the result information being presented locally, for example using the client device 930 or an embedded display.
[0463] Next, with reference to FIGS. 15A - 15F, yet another example of a microstructure arrangement and analysis technique is described.
[0464] In this example, a patch 1510 is provided comprising a substrate 1511 having a plurality of microstructures 512 thereon. In this example, the shape and configuration of the microstructures are not critical and it will be understood that a range of various configurations may be used as described above.
[0465] In this example, the substrate 1511 comprises a substrate coil 1515 disposed on the substrate 1511, typically on the back surface. This coil is operatively coupled to one or more microstructured electrodes, which may be electrodes provided on the microstructure or the conductive microstructure itself. Typically, the substrate coil includes two ends, each end being coupled to a separate microstructured electrode as indicated by the dotted lines, so that a signal in the substrate coil 1511 is applied between the microstructured electrodes. Typically, an excitation and reception coil (not shown) is provided in the housing of the measuring device, so that when the housing is attached to the substrate, for example, the excitation and reception coils are aligned with and disposed proximate to the substrate coil when the measurement is performed. This is done to inductively couple the excitation and reception coils to the substrate coil, so that when an excitation signal is applied to the excitation and reception coils by a signal generator, this induces a corresponding signal in the substrate coil 1515, which is then applied between the microstructured electrodes.
[0466] The tissue and / or body fluid around the microstructured electrodes and the electrodes act as a capacitor as shown. As a result, the excitation and reception coils and the substrate coil act as a tuned circuit, and an example of the circuit configuration is shown in FIG. 15B. This includes a fixed inductance 1561, a capacitance 1562, and a resistance 1563, representing the intrinsic responsiveness of the excitation coil and the substrate coil. The circuit includes variable capacitances and variable resistances 1565, 1564, representing the responsiveness of the microstructured electrodes and the tissue or other material between the electrodes. Thus, it will be understood that the frequency response and attenuation (Q) of the tuned circuit vary according to the values of the variable capacitance and the variable resistance, and these values depend on the environment in which the microstructured electrodes are present.
[0467] Generally, when signals are applied to the excitation and reception coils, the overall response is a constant amplitude signal in the excitation and reception coils as shown in FIG. 15C. When the drive signal is stopped, the circuit continues to resonate and the resulting signal decays over time as shown to the right of the dotted line. The rate and / or frequency of decay depends on the values of the variable capacitance and variable resistance, and thus different responses 1581, 1582 occur depending on the state of the subject, which in turn enables information regarding the state within the subject to be derived. For example, this can be affected by the binding of an analyte to the microstructured electrode, the body fluid level, etc., and thus the examination of changes in the decay rate and frequency can be used to derive information regarding the presence of an analyte, the body fluid level, etc.
[0468] However, since the decay signal is transient, in another example, the response of the circuit at various frequencies is analyzed and used to determine the resonant frequency and Q factor of the tuning circuit, which in turn indicates the resistance value and capacitance value. In this regard, changes in the electrical state within the subject result in changes in the frequency response as shown in FIG. 15D. For example, the response in the absence of an analyte may be as shown by the solid line, but the presence of an analyte may result in an increase or decrease in the resonant frequency and / or Q factor as shown by the dotted line.
[0469] In one particular example, it is preferable to provide a control reference value in order to be able to interpret the response more accurately. An example of this is shown in FIG. 15E where two patches 1510.1, 1510.2 are provided, each having its own substrate 1511, microstructures 1512, and substrate coils 1515. In this example, patch 1510.2 is coated with a binder to attract the target analyte, and patch 1510.1 is uncoated and serves as a control.
[0470] In this case, each substrate coil is driven and changes including signal attenuation and / or frequency or phase changes are measured, and the changes are dependent on the resonance frequency and the Q factor. An example of the change in the drive signal is shown in FIG. 15F, where signal 1571 represents a control obtained at patch 1510.2, and signals 1571.11, 1571.12 and 1571.21, 1571.22 represent separate responses obtained at patch 1510.2, respectively. In this regard, signals 1571.11, 1571.21 represent signals applied without analyte, emphasizing how separate patches can have separate tuning frequency responses, and signals 1571.12, 1571.22 show changes in frequencies δ1, δ2, which emphasizes how separate responses can be measured, which in turn can be used to derive information regarding the level or concentration of analyte in the vicinity of the microstructure of the second patch 1510.2.
[0471] Measurement of the change in frequency resulting from reaction to different analyte levels or concentrations may also be performed in this frequency region using a return loss bridge circuit in the excitation coil. In so doing, the absorption of the rf electromagnetic signal while being swept over a range of frequencies exhibits a signal loss in decibels (dB) at the resonance frequency of the substrate coil. The frequency and depth of this absorption indicate the analyte level or concentration.
[0472] It will be appreciated that this technique uses patches that do not have electronically active sensing elements, while enabling measurements to be made regarding the state within a subject, e.g., the presence, level or concentration of an analyte to be readily determined. It will also be appreciated that by appropriately adapting the coating, it becomes possible to detect a variety of analytes within a range and that this can also be adapted for performing other suitable measurements.
[0473] However, this is not essential and in some examples, the sensing electronics may be incorporated into the patch partially or wholly.
[0474] Next, an example of a driving and detection arrangement for a working electrode / reference electrode / counter electrode configuration will be described with reference to FIG. 15G.
[0475] In this example, the circuit includes a signal generator A1, a reference amplifier A2, and a signal amplifier A3 that serves as a detector for a cyclic voltammetry system. In use, the lamp oscillator input Vin sweeps a desired voltage range to examine the redox moiety used in the aptamer sensor. This conditioned signal is applied to the counter electrode CE formed from each opposing group of the microstructure. To correct for the impedance of the medium, the reference electrode RE formed from each opposing group of the microstructure senses the error, buffers this signal using the reference amplifier A2, and applies negative feedback to the input drive signal. This is determined by the loop gain of this feedback system, the ratio of the resistor input to the inverting input of the signal generator A1. The output current of the sensor obtained through the working group of the microstructure is converted to a voltage by the transimpedance amplifier stage A3, and the resulting voltage Vout is used with the input to derive the current-voltage characteristics. The current amplitude at a predetermined voltage is proportional to the aptamer-target binding activity.
[0476] Next, further details showing an example of the arrangement described above will be described.
[0477] Manufacturing Next, an example of a process for manufacturing a substrate with a microstructure will be described in more detail.
[0478] In a first example shown in FIGS. 17A - 17P, the microstructure is fabricated from an insulating polymer coated on the substrate, and the electrodes patterned on the substrate by selective etching serve as electrical connection lines for the polymer microstructure. It will also be understood that a conductive polymer may be used, for example, by appropriate doping of the insulating polymer.
[0479] In this example, the first step shown in FIGS. 17A - 17G is to selectively pattern an electrode structure on a flexible polyethylene terephthalate (PET) substrate 1701. The electrode design from which the microstructure is to be defined is patterned onto the PET. In this case, an indium tin oxide (ITO) 1702 layer is deposited on the flexible PET substrate and the electrode pattern is selectively etched from the ITO layer. After the substrate is prepared (FIG. 17A), a positive photoresist AZ1518 (MicroChemicals) is patterned and soft baked (FIG. 17C) on the ITO by photolithography (FIG. 17B). The photoresist is selectively exposed to ultraviolet light (FIG. 17D) to define the electrode pattern, after which the photoresist is baked and developed using a developer AZ 726MIF (MicroChemicals) (FIG. 17E), and the exposed ITO regions are wet acid etched (FIG. 17F). The photoresist is removed (FIG. 17G) to reveal the final etched ITO pattern that provides the conductive electrodes for the device.
[0480] In the second step shown in FIGS. 17H - 17P, a 3D microstructure was fabricated on the ITO electrode from a photosensitive polymer. The patterned PET substrate with the ITO electrode was treated with oxygen plasma to improve wetting and resist adhesion (FIG. 17H), and a seed adhesion layer 1704 of SU - 8 3005 (Microchemicals) was spin - coated on the ITO - PET substrate (FIG. 17I). After baking the seed SU - 8 layer lamination (FIG. 17J), a SUEX SU - 8 film resist 1705 (DJ MicroLaminates) was bonded to the substrate by thermal lamination (FIG. 17K). After positioning with a mask aligner and exposure to ultraviolet light (FIG. 17L), the exposed areas of the SU - 8 were cross - linked to form rows 1706 of rectangular microstructures with a vertical wall profile along the conductive ITO fingers 1702 (FIG. 17M). The structures were baked, and after SU - 8 1704 and SUEX 1705 were developed in PGMEA (propylene glycol monomethyl ether acetate) (Sigma Aldrich), they were then hard - baked (FIG. 17N). A shadow mask 1708 was applied to the substrate 1701, and after the microstructures 1706 were coated with gold 1707 by selective deposition (FIG. 17O), the mask was removed (FIG. 17P), leaving the selectively metallized microstructures that function as electrodes.
[0481] In this example, the microstructures have flat tips, but it will be understood that other ultraviolet lithography techniques such as gray - scale lithography, back - diffraction lithography, two - photon lithography, etc. may be used to define tapered - shaped microstructures.
[0482] The resulting microstructures are shown in FIGS. 18A - 18D, and yet another example is shown in FIGS. 18E - 18G.
[0483] In the second example shown in FIGS. 19A - 18L, microstructures are fabricated by molding.
[0484] In this example, a 90 nm nitride layer 1902 was deposited on a silicon wafer 1901 (FIG. 19A). Next, an AZ1505 (Microchemicals) positive resist 1903 was spun at 4000 rpm (FIG. 19B). A rectangular pattern defining the blade contour was directly written using a mask writer 1904 (FIG. 19C). The written pattern was developed for 30 seconds using AZ 726 MIF (Microchemicals) (FIG. 19D). After removing the nitride layer 1902 using reactive ion etching (FIG. 19F), the photoresist 1913 was removed (FIG. 19E). Next, the wafer was held vertically in a potassium hydroxide bath at 80° C. for 40 minutes along the crystal axis of the silicon wafer to etch the silicon wafer (FIG. 19G). The etching stopped at axis 111, thus defining the required sharp tip, which serves as a mold for the device to be fabricated next.
[0485] Omni-Coat is used as a lift-off resist and coated on the wafer at a thickness of approximately 20 nm using a rotation recipe of 3000 RPM for 1 minute and then baking at 200° C. for 1 minute. Subsequently, a 5 μm layer 1905 of SU8 3005 was spun onto the wafer at 3000 RPM, followed by baking at 65° C. for 1 minute, then at 95° C. for 20 seconds, and then again at 65° C. for 1 minute (FIG. 19H). The thinner the formulation of SU8 3005, the more easily it can flow into the sharp-angled crevices etched into the mold of the silicon wafer. Next, a layer 2016 of SU8 1900 was spun onto this layer to a thickness of 200 μm using a rotation recipe of 2000 RPM for 60 seconds (FIG. 19I). Subsequently, the wafer was baked at 65° C. for 5 minutes, then at 95° C. for 35 minutes, and then again at 65° C. for 5 minutes. This SU8 layer 1900 enables a sharp tip to stand on top of the hard layer.
[0486] Finally, the wafer was at 15 mW / cm 2It is flood-exposed for 40 seconds using an ultraviolet light source 1907 that emits power (Fig. 19J). The structure is removed by immersing the wafer in an AZ726 developer solution overnight (Fig. 19K), and the wafer is exposed to a thermal shock at 120 °C for 15 seconds. The structure is removed from the inverted mold and dried using nitrogen gas (Fig. 19L).
[0487] The resulting microstructures are shown in Figs. 20A, 20B, 20C, and 20D, and additional examples are shown in Figs. 20E - 20F.
[0488] Figs. 21A and 21B show silicon blades fabricated by etching. Fig. 21A shows a blade coated with a layer of SU8 3005 approximately 1 μm thick, diluted at a ratio of 3:2 using an SU8 thinner and spun at 5000 RPM for 40 seconds. Fig. 21B shows the appearance of a blade whose base is selectively coated with a polymer coating. The tip of the blade is exposed, and only this area is available for sensing purposes. This selective coating is achieved by pressing the coated blade in Fig. 21A into a thin layer of aluminum foil, extracting it, which mechanically removes the resist from the tip of the blade. This enables the blade to be partially coated with an insulating coating, so that only the tip portion functions as an electrode, thereby enabling measurements to be carried out in the epidermis and / or dermis as described above with reference to Figs. 5L and 5M.
[0489] Even another example of a microstructure is shown in Figs. 21C and 21D. In this example, the microstructure is such that the base of the microstructure is selectively coated with a dielectric coating, leaving the electrically conductive microstructure body exposed away from the base, enabling the body of the microstructure to function as an electrode.
[0490] Analyte Detection Example - Aptamer Analyte detection was demonstrated using an aptamer.
[0491] To demonstrate the effectiveness of the aptamer, an experiment for detecting troponin was conducted. All chemicals and reagents used were commercially available from, for example, Sigma-Aldrich Co. LLC, unless otherwise specified.
[0492] As already described by Negdar et al., Journal of Biomedical and Physical Engineering, Vol. 8, No. 2, pp. 167 (2018), a troponin-specific aptamer (Bioneer Pacific) having the following sequence: 5’-(SH)-(CH2)6-AGT CTC CGC TGT CCT CCC GAT GCA CTT GAC GTA TGT CTC ACT TTC TTT TCA TTG ACA TGG GAT GAC GCC GTG ACT G-[methylene blue]-3’ was obtained. Standard techniques, such as those described by Liu et al., Analytical Chemistry, Vol. 82, No. 19, pp. 8131 - 8136 (2010), the content of which is incorporated herein by reference, were used to covalently bond methylene blue (MB) and thiol groups to the 3’ and 5’ ends of the aptamer. The aptamer was also immobilized on the gold electrode by forming a thiol self-assembled monolayer. This was achieved by drop-casting 10 μM aptamer in 150 mM PBS onto the electrode for 80 minutes and removing the excess solution. After washing the electrode with deionized water and drying with nitrogen, this process was repeated for 40 minutes with 1 mM 6-mercaptohexanol in 150 mM PBS, and then rinsed and dried as described above. The electrode was stored at 4 °C in PBS for up to 7 days in the dark before use.
[0493] As shown in FIGS. 22A and 22B, this aptamer is composed of three distinct elements. In this example, the aptamer includes a thiol group 2202 for adhesion to the gold electrode 2201, a central DNA segment 2203 that interacts to specifically bind to troponin I 2205, and a methylene blue (MB) moiety 2204 attached to the 3'-end. MB is electrochemically active and thus oxidizes or reduces when it comes near an electrode having a specific potential, generating a measurable current. In the presence of troponin I, as shown in FIG. 22B, the aptamer adopts a significantly different spatial conformation to the released aptamer shown in FIG. 22A. As a result, the ability of the MB moiety to interact with the electrode is reduced, and thus the measurable redox current is decreased.
[0494] Experiments were conducted using cyclic voltammetry to detect electrical changes in microstructures coated with aptamers provided in perfused porcine skin. The following steps were used. · Coat the microstructure with gold on the front (protrusion side) and one of the patch edges, and further coat the protrusion side in a layer of aptamer as described above. · Solder a copper wire to the gold-coated edge to provide an electrical contact. Use a silver foil coated in AgCl as a pseudo-reference / counter electrode and place it under the skin near the microstructure. · Push the microstructure into the skin using a pressure of 40 N and hold it in place with a surgical clip during measurement. · Measure the data using alternating current voltammetry to amplify the signal obtained from the redox of the MB group. · Start at 25 minutes, introduce 5 mL of perfusate containing 600 ng recombinant troponin I / mL over 10 minutes, and massage the vein during the measurement to assist diffusion into the surrounding tissue.
[0495] The results in Figure 23 show the effect of adding troponin I to the perfusion fluid into the vein in the pig's ear on the aptamer-functionalized microstructure. The curves at 0 and 20 minutes define the baseline for the size of the MB redox peak, and then troponin I was introduced into the vein at 25 minutes. The voltammograms measured at 30, 60, and 120 minutes show a decrease in the current response of MB associated with troponin I exposure, indicating that the patch responds rapidly to the analyte and maintains a constant signal.
[0496] This consistency of the signal over the course of the experiment is due to the saturation of the aptamer layer by troponin I and thus may not indicate the changing levels of troponin in the system when more perfusion fluid is injected.
[0497] To establish the specificity of the aptamer-functionalized electrode to troponin I compared to non-specific proteins, another experiment was carried out using aptamer-functionalized disk electrodes. These data were measured in vitro, increasing the amount of recombinant troponin I added to the solution in phosphate buffered saline (PBS), and measuring the current response of the aptamer-functionalized gold disk electrode. The response to bovine serum albumin (BSA) was also measured to evaluate the selectivity due to exposure to possible interfering compounds. The following steps were carried out. · A gold disk electrode (4 mm diameter) was coated in a layer of aptamer (prepared as described above). A coiled platinum wire was used as the counter electrode and an Ag / AgCl wire was used as the quasi-reference electrode. · Data were measured by alternating current voltammetry to enhance the signal obtained from the MB-based redox. · 150 mM PBS (pH 7.4) was used as a substitute for the interstitial fluid.
[0498] The results are shown in FIGS. 24A and 24B. FIG. 24A shows the current response of MB in PBS as a baseline measurement, and the response decreases with increasing concentration of troponin I. The concentration range encompasses 0.03 - 50 ng / mL of troponin I in a clinically relevant solution and is differentiable. Concentration curve data were measured and then averaged 5, 10, and 15 minutes after spiking the solution with troponin I. Since there was no systematic change in the voltammogram between 5, 10, and 15 minutes, it was assumed that the aptamer - troponin I equilibrium was established within the first few minutes. FIG. 24B shows the current response of a solution of MB and 50 ng / mL BSA in PBS. There was no change in the signal upon exposure to BSA, indicating that the troponin I aptamer - functionalized electrode selectively detects troponin I.
[0499] Yet another in vitro experiment was performed to generate a response curve for troponin I detection. The current response of an aptamer - functionalized gold disk electrode in phosphate - buffered saline (PBS) was measured while increasing the amount of recombinant troponin I added to the solution (10 ng / mL - 1000 ng / mL). The following steps were carried out. · The gold disk electrode (4 mm diameter) was cleaned using sequential ultrasonic irradiation for 5 minutes each in acetone, isopropanol, and deionized water, followed by blow - drying in a nitrogen stream. · 5 μL of the 50 μM aptamer described above was mixed with 10 μL of 1 mM reducing agent (DTT or TCEP) and left to stand at room temperature for 20 minutes. · 150 μL of pure ethyl acetate was added, and the solution was inverted 10 times and left to separate for 3 minutes. · The ethyl acetate layer was discarded. The ethyl acetate addition step and removal step were repeated 4 times. · 235 μL of PBS was added (resulting in a 1 μM aptamer solution), and the solution was mixed. · 30 μL was dropped onto the gold electrode surface, covering both the working electrode and the counter electrode, and the electrode was incubated at 4 °C for 80 minutes in the dark. · The electrode was washed with PBS and excess liquid was shaken off. · 1 mM 6-mercaptohexanol (MCH) in 50 μL of PBS was dropped onto the aptamer-functionalized electrode, covering both the working electrode and the counter electrode. The electrode was incubated at room temperature for 40 minutes in the dark. · The aptamer-functionalized electrode was rinsed with PBS and stored in PBS at 4 °C in the dark until use. · A gold plate was used as the counter electrode, and Ag / AgCl (3 M KCl) was used as the pseudo-reference electrode. · Data was measured by square wave voltammetry to obtain signals from the redox of the MB group. 10 mM PBS (pH 7.4) containing 5 mM NaCl, 2 mM KCl, and 1 mM MgCl2 was used as a substitute for interstitial fluid.
[0500] Detection of troponin I was performed by three-electrode measurement where the functionalized gold disk served as the working electrode, the gold plate served as the counter electrode, and Ag / AgCl (3 M KCl) served as the reference electrode. After spiking troponin I into the solution, data was measured after 5, 10, and 15 minutes had elapsed, and the three traces were averaged at each time point. To evaluate the selectivity due to exposure to possible interfering compounds, the response to human serum albumin (HSA) was also measured using this method. The concentration of HSA was in the range of 10 - 1000 ng / mL, which is the same range as the troponin I protein spiked into PBS.
[0501] The results are shown in Figures 28A, B, and C, demonstrating a concentration-dependent change in the signal for troponin I (Figures 28A and 28B). No significant change in the signal was observed upon addition of HSA (Figures 28A and 28C).
[0502] Another experiment was conducted to show an example of IL-6 detection. A gold electrode (disk electrode, 4 mm diameter) was cleaned using sequential ultrasonic irradiation for 5 minutes each in acetone, isopropanol, and deionized water, followed by blow-drying in a nitrogen stream.
[0503] The human IL-6 aptamer (Catalog number ATW0035; https: / / www.basepairbio.com / il-6-aptamer-atw0035 / ) was purchased from Base Pair Biotechnologies, Inc. (Pearland, Texas, USA). The following general sequence, 5’-SH-(CH2)6-[human IL-6 aptamer]-C 16 H 18 To obtain an aptamer having ClN3S-3’, a methylene blue group (C 16 H 18 ClN3S) was covalently attached to the 3’ end and a thiol linker was attached to the 5’ end. The thiol linker and methylene blue (MB) group were covalently attached to the 5’ and 3’ ends of the aptamer by Integrated DNA Technologies, Inc. (Coralville, Iowa, USA). For example, the thiol linker and MB group may be attached using standard techniques such as those described in Liu et al., Analytical Chemistry, 82(19):8131 - 8136 (2010), which is hereby incorporated by reference in its entirety.
[0504] The aptamer was immobilized on the gold electrode by forming a thiol self-assembled monolayer. Briefly, a certain sample of the IL-6 aptamer (5 μL of a 50 μM aptamer solution) was mixed with 20 μL of folding buffer (provided by Base Pair Biotechnologies, Inc. with the purchase of the aptamer) and left to equilibrate for 5 minutes. Next, the mixture was placed in a water bath at 90 - 95 °C for 5 minutes and then cooled to room temperature for 15 minutes. 25 μL of reducing buffer (provided by Base Pair Biotechnologies, Inc. with the purchase of the aptamer) was added to the mixture and the mixture was left to stand at room temperature for 1 hour in the dark. The solution was diluted to an aptamer concentration of 1 μM by adding 200 μL of PBS with 1 mM MgCl2, followed by brief vortex mixing.
[0505] Approximately 30 μL of the aptamer solution was dropped onto the electrode surface, covering both the working electrode and the counter electrode, and then the aptamer was attached to the gold electrode by incubating for 2 hours at room temperature in the dark. Next, the electrode was washed with PBS containing 1 mM MgCl2, and the excess liquid was flicked off. Approximately 50 μL of 1 mM MCH in PBS was dropped onto the aptamer-functionalized electrode, covering both the working electrode and the counter electrode, and le...
Claims
1. A system for performing measurements on a subject, comprising: (a) at least one substrate comprising one or more microstructures configured to penetrate the functional barrier of the subject, wherein the one or more microstructures comprise aptamers for binding to one or more analytes, the one or more microstructures comprising a conductive material and an insulating layer extending at least over an end portion in the vicinity of the substrate in the microstructure; a substrate; (b) at least one sensor operably connected to at least one of the microstructures, the at least one sensor being configured to measure a response signal from the at least one microstructure; (c) (i) determining the measured response signal; (ii) performing at least partial analysis using the measured response signal to determine at least one type of indicator that at least partially indicates the presence, level or concentration of an analyte in the subject one or more electronic processing devices A system comprising.
2. The aptamer undergoes a conformational change upon binding to the analyte The system according to claim 1.
3. The aptamer comprises a labeling moiety The system according to claim 1 or claim 2.
4. The labeling moiety is a redox moiety or a fluorescent label The system according to claim 3.
5. The labeling moiety is a redox moiety, and the redox moiety is selected from the group consisting of methylene blue, ferrocene, vinyl ferrocene, anthraquinone, nile blue, thionine, anthraquinone-C5, dabsyl, 2,6-dichlorophenol-indophenol, galocyanin, ROX, pentamethylferrocene, ferrocene-C5, neutral red, and horseradish peroxidase The system according to claim 4.
6. The one or more analytes are selected from the group consisting of nucleic acids, antibodies or antigen-binding regions thereof, allergens, chemokines, cytokines, hormones, parasites, bacteria, viruses or virus-like particles, epigenetic markers, peptides, polypeptides, proteins, and small molecules The system according to any one of claims 1 to 5.
7. The system includes a signal generator operably connected to at least one of the microstructures for applying a stimulation signal The system according to any one of claims 1 to 6.
8. The response signal and the stimulation signal include electrical signals, and the substrate includes electrical connection lines that enable the electrical signals to be applied to and / or received from the respective microstructures. The system according to any one of claims 1 to 7.
9. The system includes one or more switches for selectively connecting at least one of the at least one sensor and at least one signal generator to one or more of the microstructures. The one or more processing devices are configured to control the switch so as to enable at least one measurement to be performed. The system according to any one of claims 1 to 8.
10. The microstructure is at least partially tapered, and is a plate-like microstructure having a substantially rectangular shape with corners when viewed in a cross-section that extends laterally through the microstructure and passes through a plane parallel to but offset from the substrate. The system according to any one of claims 1 to 9.
11. The microstructure is applied to the skin of the subject. (a) At least some of the microstructures (i) Microstructures that penetrate the stratum corneum. (ii) Microstructures that enter the living epidermis but do not enter the dermis, and (iii) Microstructures that enter the dermis are at least one of them. (b) At least some of the microstructures (i) (1) A length less than 2500 μm. (2) A length less than 1000 μm. (3) A length less than 750 μm. (4) A length less than 450 μm. (5) A length less than 300 μm. (6) A length less than 250 μm. (7) A length of about 250 μm. (8) A length of about 150 μm. (9) A length greater than 100 μm. (10) A length greater than 50 μm, and (11) A length greater than 10 μm are at least one of the lengths. (ii) (1) A maximum width less than 2500 μm. (2) A maximum width less than 1000 μm. (3) A maximum width less than 750 μm. (4) A maximum width less than 450 μm. (5) A maximum width less than 300 μm. (6) A maximum width less than 250 μm. (7) A maximum width on the same scale as the length. (8) A maximum width greater than the length. (9) A maximum width approximately the same as the length. (10) A maximum width of about 250 μm. (11) A maximum width of about 150 μm, and (12) A maximum width greater than 50 μm are at least one of the maximum widths, and (iii) (1) a maximum thickness less than the width, (2) a maximum thickness on a scale smaller than the length, (3) a maximum thickness of less than 300 μm, (4) a maximum thickness of less than 200 μm, (5) a maximum thickness of less than 50 μm, (6) a maximum thickness of about 25 μm, and (7) a maximum thickness greater than 10 μm of at least one maximum thickness having at least one of The system according to any one of claims 1 to 10.
12. At least some of the microstructures include electrodes, The at least one electrode is (a) an electrode extending over the length of the distal portion of the microstructures, (b) an electrode extending over the length of a portion of the microstructures spaced from the tip of the microstructures, (c) an electrode disposed proximate to the distal end of the microstructures, (d) an electrode disposed proximate to the tip of the microstructures, (e) an electrode extending over at least 25% of the length of the microstructures, (f) an electrode extending over less than 50% of the length of the microstructures, (g) an electrode extending over about 60 μm of the microstructures, (h) an electrode configured to be disposed in the living epidermis of the subject during use, and (i) (i) a surface area of less than 200,000 μm2, (ii) a surface area of about 22,500 μm2, and (iii) a surface area of at least 2,000 μm2 of at least one surface area being at least one of The system according to any one of claims 1 to 11.
13. At least some of the microstructures are arranged as a group, (a) a response signal is measured between the microstructures in separate groups, (b) a stimulus is applied between the microstructures in separate groups, (c) a response signal is measured between the microstructures in a certain group, (d) a stimulus is applied between the microstructures in a certain group, and (e) the group is a pair of microstructures including spaced plate microstructures having substantially flat electrodes facing each other being at least one of The system according to any one of claims 1 to 12.
14. One or more of the microstructures interact with one or more target analytes such that a response signal depends on the presence, level, or concentration of the one or more target analytes The system according to any one of claims 1 to 13.
15. At least some of the microstructures are at least partially coated with a coating, (a) at least some of the microstructures are uncoated microstructures, (b) at least some of the microstructures are porous and have an internal coating, (c) at least some of the microstructures are partially coated microstructures, (d) separate microstructures have separate coatings, (e) separate parts of the microstructure contain different coatings, (f) at least some of the microstructures contain multiple coatings, (g) at least some of the microstructures are coated with a selectively soluble coating, and, (h) the coating is, (i) a coating that interacts with one or more of the analytes, (ii) a coating whose properties change when exposed to one or more of the analytes, (iii) a coating that changes shape to selectively immobilize the microstructure, (iv) (1) an increase in hydrophilicity, (2) an increase in hydrophobicity, and, (3) a coating that modifies surface properties to minimize biofouling of at least one of, (v) a coating that attracts at least one substance to the microstructure, (vi) a coating that repels or excludes at least one substance from the microstructure, (vii) (1) facilitating entry of the barrier, (2) strengthening the microstructure, and (3) fixing the microstructure to the subject of a coating that provides a physical structure for performing at least one of, (viii) (1) exposing the microstructure, and (2) exposing a further coating of a coating that dissolves to perform at least one of, (ix) a coating that provides a stimulus to the subject, (x) a coating that confines a material, (xi) a coating that selectively releases a material, (xii) a coating that acts as a barrier to exclude at least one substance from the microstructure, and (xiii) (1) polyethylene, (2) polyethylene glycol, (3) polyethylene oxide, (4) zwitterions, (5) peptides, (6) hydrogels, and, (7) self-assembled monolayers of a coating containing at least one of, being at least one of being at least one of The system according to any one of claims 1 to 14.
16. The one or more electronic processing devices (a) analyze the measured response signal to determine at least one type of metric indicative, at least in part, of a physiological state associated with the subject; (b) analyze the measured response signal to determine at least one type of measurement value; use at least one of the at least one type of measurement value to determine at least one type of metric, the at least one type of metric indicative, at least in part, of a physiological state associated with the subject; (c) (i) pattern matching, (ii) longitudinal analysis, and (iii) comparison with a threshold configured to determine a metric by performing at least one of; and (d) one or more of the processing devices (i) the presence or degree of a medical symptom, (ii) the prognosis associated with a medical symptom, (iii) the presence, level, or concentration of a biomarker, (iv) the presence, level, or concentration of an analyte, (v) the body fluid level in the subject, (vi) blood oxygen saturation, and (vii) bioelectrical activity configured to determine a physiological state indicative of at least one of is at least one of The system according to any one of claims 1 to 15.
17. The system comprises a monitoring device and a patch comprising the substrate and the microstructure, (a) the monitoring device (i) a monitoring device inductively coupled to the patch, (ii) a monitoring device attached to the patch, and (iii) a monitoring device brought into contact with the patch when a reading is taken is at least one of; and (b) the monitoring device (i) performing a measurement, (ii) analyzing at least part of the measurement values, (iii) controlling a stimulus applied to at least one of the microstructures, (iv) generating an output, (v) providing an output indicative of the metric, (vi) transmitting a signal based on the metric, and (vii) implementing a measure configured to perform at least one of is at least one of The system according to any one of claims 1 to 16.
18. The system (a) a wearable monitoring device that performs the measurement, and (b) (i) receives subject data derived from the measured response signal, A processing system that analyzes the subject data to generate at least one type of indicator, and at least one of the indicators at least partially indicates a health state related to the subject comprising at least one of The system according to any one of claims 1 to 17.
Citation Information
Patent Citations
Microneedle devices and production thereof
US20020082543A1
High-Aspect-Ratio Microdevices and Methods for Transdermal Delivery and Sampling of Active Substances
US20050261632A1
Point-of-care fluidic systems and uses thereof
US20060264782A1
Method and Apparatus for Micro-Needle Array Electrode Treatment of Tissue
US20070142885A1
Gold-plated screen-printed electrodes and their use as electrochemical sensors
US20110139636A1