Method and kit for promoting proliferation of pancreatic endoderm cells
By employing FOXO1 inhibitors and Wnt signal activators to promote PDX1-positive, NKX6.1-positive pancreatic endoderm cell proliferation, and subsequent Notch signal inhibition, the method enhances the production of pancreatic endocrine precursor cells, overcoming the limitations of existing techniques.
Patent Information
- Application Number
- JP2021005958
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2020-01-17
- Filing Date
- 2021-01-18
- Publication Date
- 2025-08-12
- Estimated Expiration
- 2041-01-18
AI Technical Summary
Current methods fail to effectively increase the number of pancreatic endocrine precursor cells, which are crucial for producing insulin-secreting cells, as they do not address the inhibitory effect of Notch signaling and lack techniques to enhance the proliferation of PDX1-positive, NKX6.1-positive pancreatic endoderm cells.
A method involving the use of FOXO1 inhibitors, such as AS1842856, and Wnt signal activators, like CHIR99021, to promote the proliferation of PDX1-positive, NKX6.1-positive pancreatic endoderm cells, followed by Notch signal inhibition with DAPT to induce NGN3-positive pancreatic endocrine precursor cells.
This approach significantly increases the number of pancreatic endocrine precursor cells by 1.2 to 6 times, enabling the production of a larger number of insulin-secreting cells from pluripotent stem cells.
Smart Images

Figure 0007721105000010 
Figure 0007721105000011 
Figure 0007721105000012
Abstract
Description
[Technical Field]
[0001] The present invention relates to a method and a kit for promoting the proliferation of pancreatic endoderm cells. More specifically, the present invention relates to a method and a kit for promoting the proliferation of pancreatic endoderm cells, which are PDX1-positive, NKX6.1-positive (hereinafter referred to as "PDX1 + NKX6.1 + ") a method for promoting the proliferation of pancreatic endoderm cells, NGN3-positive (hereinafter referred to as "NGN3 + ") Method for producing pancreatic endocrine progenitor cells, PDX1 + NKX6.1 + The present invention relates to a cell proliferation promoter and a kit for producing pancreatic endocrine precursor cells. [Background technology]
[0002] Pancreatic endocrine cells, such as insulin-secreting cells, express PDX1 + NKX6.1 + Derived from pancreatic endoderm cells. PDX1 + NKX6.1 + PDX1 cells reside in the trunk region of the pancreatic duct, which branches during development. + NKX6.1 + Cells migrate from the pancreatic duct structures and express NGN3 + They give rise to pancreatic endocrine progenitor cells, which then give rise to pancreatic endocrine cells that form pancreatic islets.
[0003] So far, NGN3 + It is known that Notch signaling has an inhibitory effect on differentiation into pancreatic endocrine progenitor cells. + Conventional protocols for differentiating into pancreatic endocrine progenitor cells also involve the inhibition of Notch signaling (see, for example, Non-Patent Documents 1 and 2).
[0004] It is also known that during pancreatic development, the number of mature cells is determined by the number of progenitor cells. + It is believed that the number of pancreatic islet cells is ultimately controlled by regulating the number of pancreatic endocrine precursor cells. [Prior art documents] [Non-patent literature]
[0005] [Non-Patent Document 1] Pagliuca, FW, et al., Generation of functional human pancreatic beta cells in vitro, Cell, 159 (2), 428-439, 2014. [Non-patent document 2] Rezania, A., et al., Reversal of diabetes with insulin-producing cells derived in vitro from human pluripotent stem cells. Nature Biotechnol, 32 (11), 1121-1133, 2014. Summary of the Invention [Problem to be solved by the invention]
[0006] Therefore, NGN3 is essential for differentiation of pluripotent stem cells. + It is believed that if the number of endocrine precursor cells can be increased, it will be possible to more efficiently produce pancreatic endocrine cells, such as insulin-secreting cells. + PDX1, a precursor stage of pancreatic endocrine progenitor cells + NKX6.1 + Increasing the number of cells is effective, but PDX1 + NKX6.1 + There is no known technique to increase the number of cells.
[0007] Therefore, the present invention provides PDX1 + NKX6.1 + The object is to provide a technology for promoting cell proliferation. [Means for solving the problem]
[0008] The present invention includes the following aspects. [1]PDX1 + NKX6.1 + A method for promoting proliferation of pancreatic endoderm cells, comprising: + NKX6.1 + A method comprising step 1 of contacting a cell with a FOXO1 inhibitor and / or a Wnt signal activator. [2] The method according to [1], wherein in step 1, the FOXO1 inhibitor and / or the Wnt signal activator is contacted for 12 to 36 hours. [3] The method according to [1] or [2], wherein the FOXO1 inhibitor is AS1842856. [4] The method according to any one of [1] to [3], wherein the Wnt signal activator is CHIR99021. [5] The method according to any one of [1] to [4], wherein the PDX1-positive, NKX6.1-positive pancreatic endoderm cells are derived from pluripotent stem cells. [6]NGN3 + A method for producing pancreatic endocrine precursor cells, comprising: + NKX6.1 + A manufacturing method comprising step 2 of culturing cells. [7] In step 2, the PDX1 + NKX6.1 + The production method described in [6], which comprises contacting a cell with a Notch signal inhibitor. [8] The method of producing according to [7], wherein the Notch signal inhibitor is DAPT. [9] PDX1, which contains a FOXO1 inhibitor and / or a Wnt signal activator as an active ingredient. + NKX6.1 + Cell proliferation promoter.
[10] The PDX1 according to [9], wherein the FOXO1 inhibitor is AS1842856. + NKX6.1 + Cell proliferation promoter.
[11] The PDX1 according to [9] or
[10] , wherein the Wnt signal activator is CHIR99021. + NKX6.1 +Cell proliferation promoter.
[12] PDX1 according to any one of [9] to
[11] + NKX6.1 + A kit for producing pancreatic endocrine precursor cells, comprising a cell proliferation promoter and a Notch signal inhibitor.
[13] The kit for producing pancreatic endocrine precursor cells according to
[12] , wherein the Notch signal inhibitor is DAPT.
[0009] The present invention can also be said to include the following aspects. [P1] At least PDX1 + NKX6.1 + A cell population containing PDX1 cells (pancreatic endoderm cells) is contacted in vitro with a FoxO1 inhibitor and / or a Wnt signal activator, + NKX6.1 + Step 1: Propagating cells; + NKX6.1 + Cells were exposed to a Notch signaling inhibitor to induce NGN3 + A method for producing pancreatic endocrine precursor cells, comprising step 2 of obtaining endocrine precursor cells. [P2] In step 1, at least PDX1 + NKX6.1 + The method according to [P1], wherein a cell population containing cells (pancreatic endoderm cells) is contacted in vitro with a FoxO1 inhibitor and / or a Wnt signal activator for 15 to 30 hours before step 2. [P3] The method according to [P1] or [P2], wherein the FoxO1 signal inhibitor is AS1842856. [P4] The method of any one of [P1] to [P3], wherein the Wnt signal activator is CHIR99021. [P5] The method for production according to any one of [P1] to [P4], wherein the Notch inhibitor is DAPT. [P6] A pancreatic endocrine progenitor cell production kit comprising a FoxO1 signal inhibitor and a Notch inhibitor. [P7] The kit for producing pancreatic endocrine precursor cells according to [P6], wherein the FoxO1 signal inhibitor is AS1842856. [P8] The kit for producing pancreatic endocrine precursor cells according to [P6] or [P7], wherein the Notch inhibitor is DAPT. [Effects of the Invention]
[0010] According to the present invention, PDX1 + NKX6.1 + It is possible to provide a technology for promoting cell proliferation. [Brief explanation of the drawings]
[0011] In Figures 9 to 18, 21 to 25, 27 to 36, and 39, "AS" indicates that AS1842856 treatment was performed, and "DMSO" indicates that dimethyl sulfoxide treatment was performed as a negative control. [Figure 1] FIG. 1 shows an outline of a multi-step differentiation induction method for inducing differentiation of pluripotent stem cells into pancreatic organoids. [Figure 2] 1 shows representative results of FACS analysis at the end of stage 1 in Experimental Example 1. [Figure 3] 1 shows representative results of FACS analysis at the end of stage 2 in Experimental Example 1. [Figure 4] 1 shows micrographs of cells at each differentiation stage in Experimental Example 1. [Figure 5] 1 shows the results of a representative FACS analysis of stage 4, day 2 (S4D2; hereinafter, stage m, day n may be abbreviated as "SmDn") in Experimental Example 1. [Figure 6] 1 shows a microscopic photograph of pancreatic organoids at stage 4, day 5 (S4D5) in Experimental Example 1. [Figure 7] 1 shows representative results of FACS analysis on stage 4, day 5 (S4D5) in Experimental Example 1. [Figure 8] 1 is a graph showing the results of FACS analysis on day 5 of stage 4 (S4D5) in Experimental Example 1. [Figure 9]1 is a graph showing the results of quantitative real-time PCR analysis in Experimental Example 2. [Figure 10] 1 is a graph showing the results of quantitative real-time PCR analysis in Experimental Example 2. [Figure 11] 1 shows a microscopic photograph of pancreatic organoids at stage 5, day 3 (S5D3) in Experimental Example 2. [Figure 12] 1 is a graph showing the results of quantitative real-time PCR analysis in Experimental Example 2. The gray period on the horizontal axis (S4D5 to S4D6) indicates the period during which AS1842856 was added to the medium. [Figure 13] 1 is a graph showing the results of quantitative real-time PCR analysis in Experimental Example 2. [Figure 14] 1 is a graph showing the results of FACS analysis on day 3 of stage 5 (S5D3) in Experimental Example 2. [Figure 15] 1 is a graph showing the results of FACS analysis on day 3 of stage 5 (S5D3) in Experimental Example 2. [Figure 16] 1 shows a microscopic photograph of pancreatic organoids at stage 5, day 3 (S5D3) in Experimental Example 2. [Figure 17] 1 shows micrographs showing the results of inducing differentiation of NGN3-EGFP reporter cells and treating them with AS1842856 in Experimental Example 2. [Figure 18] 1 is a graph showing the amount of NGN3 mRNA per EGFP+ cell in Experimental Example 2. [Figure 19] 1 shows the results of FACS analysis showing the percentage of GP2+ cells on day 5 of stage 4 (S4D5) in Experimental Example 2. [Figure 20] 1 shows the results of FACS analysis showing the percentage of PDX1+NKX6.1+ cells on day 5 of stage 4 (S4D5) in Experimental Example 2. [Figure 21] 1 shows micrographs of cell clusters of GP2+ cells and GP2- cells at stage 4, day 6 (S4D6) in Experimental Example 2. [Figure 22]10 is a graph showing the results of quantitative real-time PCR analysis in Experimental Example 2, measuring the expression level of the NGN3 gene in each pancreatic organoid on day 3 of stage 5 (S5D3). [Figure 23] 1 shows microscopic photographs and FACS analysis results of EGFP+ cells in each pancreatic organoid on day 3 of stage 5 (S5D3) in Experimental Example 2. [Figure 24] 10 is a graph showing the percentage of EGFP+ cells in each pancreatic organoid on day 3 of stage 5 (S5D3) in Experimental Example 2. [Figure 25] 10 is a graph showing changes in the proportion of EGFP+ cells in Experimental Example 3. The gray period on the horizontal axis (S4D5 to S4D6) indicates the period during which AS1842856 or dimethyl sulfoxide was added to the medium. [Figure 26] 1 is a graph showing the results of immunostaining NGN3 and FACS analysis in Experimental Example 3. [Figure 27] 1 is a graph showing the results of FACS analysis in Experimental Example 3. [Figure 28] 1 is a graph showing the results of FACS analysis in Experimental Example 3. [Figure 29] 1 is a graph showing the results of quantitative real-time PCR in Experimental Example 4. [Figure 30] 1 is a graph showing the results of quantitative real-time PCR in Experimental Example 4. [Figure 31] 1 is a graph showing the results of quantitative real-time PCR in Experimental Example 4. [Figure 32] 10 is a graph showing the results of inducing differentiation of NGN3-EGFP reporter cells in Experimental Example 4, and measuring the percentage of EGFP+ cells by FACS analysis on day 3 of stage 5 (S5D3). [Figure 33] 1 is a graph showing the results of quantitative real-time PCR in Experimental Example 4. [Figure 34] 1 is a graph showing the results of quantitative real-time PCR analysis of in vitro cultured pancreatic tissue derived from a mouse embryo at embryonic day 11.5 in Experimental Example 4. [Figure 35] 10 is a graph showing the results of measuring the proportion of EdU+ cells by FACS analysis in Experimental Example 4. [Figure 36] 10 is a graph showing the results of measuring the percentages of insulin (INS) + glucagon (GCG) − cells, INS + GCG + cells, and INS − GCG + cells by FACS analysis of pancreatic organoids in Experimental Example 5. [Figure 37] In Experimental Example 5, this is a photograph showing the results of immunohistochemical staining 2 months after transplantation of stage 6 (S6) organoids into NRG mice. [Figure 38] In Experimental Example 5, this is a photograph showing the results of immunohistochemical staining 2 months after transplantation of stage 6 (S6) organoids into NRG mice. [Figure 39] 1 is a graph showing the results of quantitative real-time PCR in Experimental Example 6. DETAILED DESCRIPTION OF THE INVENTION
[0012] [PDX1 + NKX6.1 + Methods for promoting cell proliferation In one embodiment, the present invention provides a method for the detection of PDX1 + NKX6.1 + A method for promoting proliferation of pancreatic endoderm cells, comprising: + NKX6.1 + The method includes step 1 of contacting a cell with a FOXO1 inhibitor and / or a Wnt signal activator.
[0013] As described below in the Examples, the inventors have found that PDX1 + NKX6.1 + By applying a FOXO1 inhibitor to cells, PDX1 + NKX6.1 + They found that FOXO1 can promote cell proliferation. FOXO1 is a protein encoded by the FOXO1 (Forkhead box protein O1) gene.
[0014] Here, PDX1 + NKX6.1 + Promoting cell proliferation is related to PDX1 + NKX6.1 + This means promoting cell division and increasing cell number. More specifically, the PDX1 inhibitors increase cell numbers compared to cells without FOXO1 inhibitors. + NKX6.1 + It means that the number of cells increases by 1.2 times or more, preferably 1.3 times or more, more preferably 1.4 times or more, and most preferably 1.5 times or more. Cell proliferation can be evaluated using a conventionally known method, for example, in the case of PDX1. + NKX6.1 + The cells were cultured in the presence of EdU (5-ethynyl-2'-deoxyuridine) for a certain period of time, and the cells or cells derived from the cells (e.g., NGN3 + The proportion of EdU-labeled cells among the total number of cells may be analyzed and evaluated as a percentage increase compared to the proportion in a negative control.
[0015] The inventors further demonstrated that FOXO1 inhibitors activate Wnt signaling, and that equivalent effects can be achieved by using Wnt signaling activators instead of FOXO1 inhibitors.
[0016] In the method of this embodiment, PDX1 + NKX6.1 + The method for preparing the cells is not particularly limited, and for example, the cells can be produced by the multi-stage differentiation induction method of pluripotent stem cells, which will be described later in the Examples.
[0017] Examples of pluripotent stem cells include embryonic stem cells (ES cells), induced pluripotent stem cells (iPS cells), etc. The pluripotent stem cells are preferably human cells.
[0018] Examples of FOXO1 inhibitors that can be used include AS1842856 (CAS number: 836620-48-5), AS1708727 (CAS number: 1253226-93-5), etc. These may be used alone or in combination of two or more.
[0019] Examples of Wnt signal activators that can be used include CHIR99021 (CAS number: 252917-06-9), IQ-1 (CAS number: 331001-62-8), and BML284 (CAS number: 853220-52-7). These may be used alone or in combination of two or more.
[0020] In step 1, PDX1 + NKX6.1 + A cell population containing PDX1 cells may be contacted with a FOXO1 inhibitor, a Wnt signaling activator, or both a FOXO1 inhibitor and a Wnt signaling activator. + NKX6.1 + The percentage of cells is not particularly limited, and may be, for example, 5% or more, preferably 10% or more, more preferably 20% or more, even more preferably 40% or more, and most preferably 50% or more. + NKX6.1 + The higher the percentage of PDX1 cells, the greater the absolute number of cells obtained by treatment with a FOXO1 inhibitor and / or a Wnt signal activator, and therefore the greater the percentage of PDX1 cells in the cell population upon contact with the agent. + NKX6.1 + A higher percentage of cells is preferred.
[0021] The contact of the FOXO1 inhibitor and / or the Wnt signaling activator with the cells can be achieved by adding the FOXO1 inhibitor and / or the Wnt signaling activator to the medium. The concentration of the FOXO1 inhibitor in the medium is adjusted to 100% by weight based on the amount of PDX1. + NKX6.1 +The concentration is not particularly limited as long as it is sufficient to achieve a cell proliferation-promoting effect, and may be, for example, 0.1 μM to 10 μM, for example, about 1 μM. Furthermore, the cells to be contacted with the agent may have formed pancreatic organoids, may simply form cell clusters, or may be in a state of being dispersed into single cells.
[0022] The concentration of Wnt signaling activators in the culture medium was + NKX6.1 + There are no particular limitations as long as the cell proliferation promoting effect is obtained, and the concentration may be, for example, 0.1 μM to 10 μM, for example, about 5 μM.
[0023] In step 1, PDX1 + NKX6.1 + The cell population containing PDX1 cells is preferably contacted with the FOXO1 inhibitor and / or the Wnt signaling activator for 12 to 36 hours, more preferably for 18 to 30 hours, even more preferably for 20 to 28 hours, even more preferably for 22 to 26 hours, and particularly preferably for about 24 hours. When the contact time with the FOXO1 inhibitor and / or the Wnt signaling activator is within the above range, PDX1 cells can be obtained. + NKX6.1 + The cell proliferation promoting effect increases the number of cells, resulting in more NGN3 + Pancreatic endocrine precursor cells can be obtained.
[0024] As will be described later in the Examples, treatment with a FOXO1 inhibitor and / or a Wnt signal activator also reduces the expression levels of PDX1 and NKX6.1 (i.e., inhibits differentiation into pancreatic endocrine cells), so treatment for longer than 36 hours is not recommended. The number of cells that develop into pancreatic endocrine cells may decrease, resulting in a decrease in the number of NGN3 cells obtained. + The number of pancreatic endocrine precursor cells may decrease.
[0025] Thus, continuous treatment with a FOXO1 inhibitor and / or a Wnt signal activator for more than 36 hours is not preferred, but short-term treatment may be performed in several divided sessions. In this case, the guidelines for short-term treatment are as described above. For example, PDX1 + NKX6.1 + When the cell ratio was about 20-30%, the treatment was carried out for 12-36 hours, and then the cells were cultured in a medium that did not contain the agent, and PDX1 + NKX6.1 + When the proportion of cells reaches about 40 to 50%, the above treatment may be carried out again.
[0026] [PDX1 + NKX6.1 + Cell production method] In one embodiment, the present invention relates to the above-mentioned PDX1 + NKX6.1 + PDX1, including methods for promoting cell proliferation + NKX6.1 + A method for producing cells is provided.
[0027] The production method of this embodiment is + NKX6.1 + A method for producing PDX1, comprising contacting a cell with a FOXO1 inhibitor and / or a Wnt signal activator. + NKX6.1 + Alternatively, the production method of this embodiment can be said to be a method for producing PDX1 cells by a multi-step differentiation induction method of pluripotent stem cells. + NKX6.1 + Obtaining cells and PDX1 + NKX6.1 + A method for producing PDX1, comprising contacting a cell with a FOXO1 inhibitor and / or a Wnt signal activator. + NKX6.1 + This can also be called a method for producing cells.
[0028] [NGN3 + Method for producing pancreatic endocrine precursor cells] In one embodiment, the present invention provides an NGN3 +A method for producing pancreatic endocrine precursor cells, comprising: + NKX6.1 + A production method is provided which includes a step 2 of culturing cells.
[0029] As will be described later in the Examples, PDX1 + NKX6.1 + PDX1 + NKX6.1 + The cells are NGN3 + In step 2, PDX1 + NKX6.1 + Preferably, the cells are contacted with a Notch signal inhibitor. + NKX6.1 + By exposing cells to a Notch signaling inhibitor, more NGN3 + Pancreatic endocrine precursor cells can be obtained.
[0030] The production method of this embodiment is + NKX6.1 + The cells are contacted with a FOXO1 inhibitor and / or a Wnt signal activator to induce PDX1 + NKX6.1 + Step 1: Promoting cell proliferation and proliferating PDX1 + NKX6.1 + It can also be said that this is a production method including step 2 of contacting cells with a Notch signal inhibitor.
[0031] Alternatively, the production method of this embodiment can be carried out by inducing PDX1 through a multi-step differentiation method of pluripotent stem cells. + NKX6.1 + Obtaining cells and PDX1 + NKX6.1 + The cells are contacted with a FOXO1 inhibitor and / or a Wnt signal activator to induce PDX1 + NKX6.1 + A step of promoting cell proliferation and proliferating PDX1 + NKX6.1 +It can also be said that this is a production method comprising the step of contacting cells with a Notch signal inhibitor.
[0032] As will be described later in the Examples, the inventors have investigated the effects of FOXO1 inhibitors on a cell population containing pancreatic endoderm cells, followed by the use of Notch signal inhibitors, to induce NGN3 + The researchers found that pancreatic endocrine progenitor cells can be efficiently produced. Compared with the case without FOXO1 inhibitor, the resulting NGN3 + The number of pancreatic endocrine progenitor cells increased 2.8-6 fold.
[0033] Furthermore, the inventors have demonstrated that the effect of FOXO1 inhibitors is independent of NGN3 transcriptional regulation by Notch signaling, and that the effect of FOXO1 inhibitors on NGN3 precursor cells, PDX1 + NKX6.1 + By promoting cell proliferation, NGN3 + We found that the number of pancreatic endocrine progenitor cells increases.
[0034] Therefore, the production method of this embodiment allows for the production of a larger number of NGN3s from pluripotent stem cells than conventional methods. + It is possible to produce pancreatic endocrine precursor cells, and in turn, it is possible to obtain a larger number of pancreatic endocrine cells than ever before.
[0035] Examples of Notch signal inhibitors that can be used include DAPT (CAS number: 208255-80-5), γ-Secretase Inhibitor XXI (Compound E) (CAS number: 209986-17-4), γ-Secretase Inhibitor I (CAS number: 133407-83-7), Dibenzazepine (CAS number: 209984-56-5), LY411575 (CAS number: 209984-57-6), and RO4929097 (CAS number: 847925-91-1). These may be used alone or in combination of two or more.
[0036] The Notch signal inhibitor can be contacted with cells by adding the Notch signal inhibitor to the medium. The concentration of the Notch signal inhibitor in the medium is adjusted to the + There are no particular limitations as long as the concentration is at a level that can achieve the effect of inducing pancreatic endocrine precursor cells, and it may be, for example, 0.1 μM to 10 μM, for example, about 10 μM.
[0037] In step 2, PDX1 + NKX6.1 + The cells are preferably contacted with the Notch signal inhibitor for 1 to 7 days, more preferably for about 3 days. + Pancreatic endocrine precursor cells can be produced efficiently.
[0038] Step 1 is preferably carried out before step 2. Step 2 may be carried out immediately after step 1, or an interval may exist between steps 1 and 2. For example, PDX1 expanded in step 1 + NKX6.1 + The cells may be cryopreserved and thawed at any time to carry out step 2. Alternatively, the PDX1 cells expanded in step 1 may be used. + NKX6.1 + Step 2 may be carried out after removing the FOXO1 inhibitor and / or the Wnt signal activator from the cell culture medium and culturing for any period of time.
[0039] [PDX1 + NKX6.1 + Cell proliferation promoter] In one embodiment, the present invention provides a PDX1 inhibitor containing a FOXO1 inhibitor and / or a Wnt signal activator as an active ingredient. + NKX6.1 + A cell proliferation promoter is provided.
[0040] As will be described later in the Examples, the inventors have investigated the effects of FOXO1 inhibitors and / or Wnt signal activators on PDX1 + NKX6.1 + By contacting cells with PDX1+ NKX6.1 + It was revealed that the FOXO1 inhibitor and / or Wnt signaling activator can promote cell proliferation. + NKX6.1 + It can be used to promote cell proliferation.
[0041] PDX1 of this embodiment + NKX6.1 + Among the cell proliferation promoters, the FOXO1 inhibitor and the Wnt signal activator are the same as those described above.
[0042] [Pancreatic endocrine progenitor cell production kit] In one embodiment, the present invention relates to the above-mentioned PDX1 + NKX6.1 + The present invention provides a kit for producing pancreatic endocrine precursor cells, comprising a cell proliferation promoter and a Notch signal inhibitor. The kit of the present embodiment can be suitably used in the above-described method for producing pancreatic endocrine precursor cells.
[0043] The kit of this embodiment may contain a Wnt signaling activator instead of a FOXO1 inhibitor, or may contain a FOXO1 inhibitor, a Wnt signaling activator, and a Notch signaling inhibitor.
[0044] The FOXO1 inhibitor, Wnt signal activator, and Notch signal inhibitor are the same as those described above. [Example]
[0045] The present invention will now be described in more detail with reference to examples, but the present invention is not limited to the following examples.
[0046] Materials and Methods (Protocol for proliferation and differentiation of iPSCs) Human iPSC (hiPSC) lines 585A1, 604B1, and NGN3-EGFP reporter cells derived from 604B1 were cultured on a feeder layer of mitomycin C-treated SNL cells. Primate ES Cell Medium (ReproCELL) supplemented with 500 U / mL penicillin / streptomycin (Thermo Fisher Scientific) and 4 ng / mL recombinant human bFGF (Fujifilm Wako Pure Chemical Industries, Ltd.) was used. hiPSC colonies were dissociated with CTK solution and split at a ratio of 1:4–1:10. Experiments using hiPSCs were approved by the Kyoto University Graduate School of Medicine and Faculty of Medicine Ethics Committee.
[0047] The composition of the differentiation medium is shown in Table 1. Stages 3 and 4 were cultured in a 5% CO2, 5% O2 environment, and the other stages were cultured in a 5% CO2, 20% O2 environment.
[0048] [Table 1]
[0049] Stage 1 The feeder cells were removed with CTK solution, and the pluripotent cells were dissociated into single cells using Accutase (Innovative Cell Technologies) and seeded as a monolayer on a 12-well plate pre-coated with Matrigel (registered trademark, Corning Inc.) diluted 1:30. 5.0 × 10 5 Cells were cultured at 1 / well in S1D0 (stage 1, day 0) medium for 1 day, followed by culture in S1D1 medium for 1 day and S1D2 medium for 2 days.
[0050] Stages 2 and 3 The medium was replaced with S2 medium and cultured for 4 days. On S2D4, the cells were dissociated into single cells using Accutase, seeded onto 60-mm dishes, and cultured in S3 medium for 3 days.
[0051] Stage 4 The medium was replaced with S4D0 medium. At D4D1, differentiated cells were scraped, dissociated into cell clumps by pipetting, suspended in S4D1 medium, and seeded onto an ultra-low-attachment 6-well plate for 1 day. Subsequently, they were cultured in S4D2 medium for 4 days. At S4D5, dimethyl sulfoxide (DMSO) or 1 μM of the FOXO1 inhibitor AS1842856 (CAS number: 836620-48-5, FOXO1 inhibitor) was added to the medium and cultured for 24 hours.
[0052] Stages 5 and 6 Organoids were rinsed with DMEM and cultured in S5 medium for 3 days, followed by S6D0 medium for 2 days, and then S6D2 medium, which was changed every 5 days.
[0053] (Immunocytochemical and immunohistochemical staining) Tables 2 to 5 below show the antibodies and reaction conditions used. 2D cultured cells were fixed with 4% paraformaldehyde (PFA) for 20 minutes, incubated in 2.5% horse serum (Vector Laboratories), and incubated with primary antibodies overnight at 4°C. 3D organoids were embedded in iPGel (GenoStaff), and kidney grafts were fixed in 4% PFA overnight at 4°C.
[0054] For paraffin sections, fixed samples were dehydrated in alcohol, immersed in Histo-Clear (National Diagnostics), paraffin-embedded, and sliced to a thickness of 3 μm. After deparaffinization and hydration, antigen retrieval was performed using Target Retrieval Solution pH 6.0 (Dako). Sections were blocked in 2.5% horse serum at room temperature for 30 minutes and then incubated with primary antibodies overnight at 4°C.
[0055] 2D cultured cells and paraffin-embedded sections were washed with phosphate-buffered saline (PBS) and incubated with secondary antibodies for 1 hour. Images were captured using an HS All-in-one Fluorescence Microscope (Cat. No. BZ-9000E, Keyence Corporation).
[0056] [Table 2]
[0057] [Table 3]
[0058] [Table 4]
[0059] [Table 5]
[0060] (Quantitative real-time PCR analysis) RNA was extracted from the cells using the RNeasy micro kit (Qiagen), and cDNA was synthesized using ReverTra Ace qPCR RT Master Mix (Toyobo).
[0061] Quantitative real-time PCR analysis was performed using StepOne (Thermo Fisher Scientific) with FastStart Universal SYBR Green Master with Rox (Roche).
[0062] The expression of the target gene was normalized using the expression level of β2-microglobulin. The relative expression level was calculated by comparison with the DMSO control group. The sequences of the primers used are shown in Tables 6 and 7 below.
[0063] [Table 6]
[0064] [Table 7]
[0065] (Wnt activation / inhibition experiments and mouse organ culture) 5 μM CHIR99021 (CAS No.: 252917-06-9) was used to activate Wnt signaling, and 20 μM XAV939 (CAS No.: 284028-89-3) and 500 nM PKF118-310 (CAS No.: 84-82-2) were used to inhibit Wnt signaling. These compounds were added to the culture medium of S4D5 organoids or mouse pancreatic primordia for 24 hours.
[0066] For in vitro culture of mouse pancreas, the dorsal pancreatic bud was excised from an 11.5-day-old embryo and cultured at the air-medium interface using Millicell culture plate inserts (Merck Millipore) in DMEM / F12 medium supplemented with 10% fetal bovine serum and 500 U / mL penicillin / streptomycin. Cells were cultured at 37°C in a humidified atmosphere with 5% CO2.
[0067] (Establishment of NGN3-EGFP reporter cells using the CRISPR / Cas9 system) A gRNA (GAGGGAGCCGGGAGCCGTAGAGG, SEQ ID NO: 39) was designed using CRISPRdirect (https: / / crispr.dbcls.jp / ) and cloned into the pX330-U6-Chimeric_BB-CBh-hSpCas9 vector. Genomic DNA was isolated from hiPSCs (604B1) and used as a template to amplify homologous DNA 882 bp upstream and 914 bp downstream from the target site by PCR.
[0068] Using the In-Fusion kit (Clontech), two homologous DNA fragments, the self-cleaving 2A peptide and EGFP, a geneticin selection cassette, were subcloned into the linearized pENTR-Donor-MCS2 vector.
[0069] Target iPSCs (604B1) were pretreated with 10 μM Y-27623 for 1 hour. Cells were washed with PBS, treated with CTK solution at 37°C for 1 minute to remove feeder cells, and then washed again with PBS. iPSCs were then treated with Accutase at 37°C for 5 minutes to dissociate into single cells.
[0070] 10 μg of pX330-U6-Chimeric_BB-CBh-hSpCas9 vector and 10 μg of pENTR-Donor-MCS2 vector were electroporated at 1 × 10 6 The cells were electroporated under the following pulse conditions: pulse voltage: 125 V, pulse width: 5 ms, number of pulses: 2.
[0071] Cells were seeded into wells of a 6-well plate along with feeder cells and treated with 10 μM Y-27623 for 2 days. After iPSC colonies recovered, they were selected with 100 μg / mL Geneticin. Geneticin-resistant colonies were then dissociated into single cells, and 1,000 cells were seeded into a 10 cm dish along with feeder cells. Subclones were then screened by genomic PCR, and clone #19, which contained a homozygous introduction of the self-cleaving 2A peptide, EGFP, and Geneticin selection cassette at the NGN3 locus, was selected.
[0072] Subsequently, the Geneticin selection cassette was removed by electroporating 10 μg of the pCXW-Cre-puro vector using a NEPA21 electroporator. Removal of the Geneticin selection cassette was confirmed by PCR screening. The sequences of the primers used are shown in Tables 8 and 9 below. All DNA sequences were confirmed using an Applied Biosystems 3500xL (Thermo Fisher Scientific).
[0073] [Table 8]
[0074] [Table 9]
[0075] (Flow cytometry) Organoids were dissociated into single cells using Accumax (Innovative Cell Technologies) at 37°C for 30 minutes, and then washed twice with FACS buffer (PBS(-) containing 10 μM Y-27632 and 0.2% FBS).
[0076] Subsequently, the cells were treated with the LIVE / DEAD Fixable Blue dead cell stain kit (Thermo Fisher Scientific) at 4°C for 15 minutes, and the cells were distinguished as live or dead during analysis.
[0077] For GP2 staining, labeled primary antibodies were added to the cells and incubated. The stained cells were washed twice with FACS buffer and analyzed using a BD FACS Aria II (BD Biosciences). The reaction conditions for the labeled antibodies are shown in Table 4 above.
[0078] For intracellular protein staining, cells were fixed with 350 μL of Cytofix / Cytoperm Buffer (BD Biosciences) at 4°C for 30 minutes and then washed twice with Perm / Wash Buffer Solution (BD Biosciences). The cells were then suspended in 2.5% horse serum and incubated at room temperature for 10 minutes. The cells were then incubated with primary antibodies or isotype control IgG antibodies for 1 hour at room temperature and washed twice with Perm / Wash Buffer Solution (BD Biosciences). The cells were then incubated with secondary antibodies for 30 minutes at room temperature, washed twice, and analyzed using a BD FACS Aria II (BD Biosciences). The concentrations of the primary and secondary antibodies are shown in Tables 2 to 5.
[0079] After acquiring data for at least 10,000 events, the data was analyzed using BD FACS Diva software (BD Biosciences).
[0080] (EdU incorporation) Cells were incubated in medium containing 10 μM EdU (5-ethynyl-2'-deoxyuridine) for 12 hours and then treated with the Click-iT EdU Alexa Fluor 647 Imaging Kit (Thermo Fisher Scientific). Labeled cells were analyzed using BD FACS Aria II (BD Biosciences) with at least 10,000 events acquired and then analyzed with BD FACS Diva software (BD Biosciences).
[0081] (transplantation experiment) All animal experiments were conducted in accordance with the Kyoto University Guidelines for Animal Experiments. 15- to 28-week-old female normoglycemic NOD.Cg-Rag1 mice were used. tm1Mom Il2rg tm1Wjl / SzJ mice (NRG, Charles River) were housed under a 12-hour light / dark cycle with free access to standard sterile diet. Mice were anesthetized with isoflurane inhalation. Approximately 3.0 × 10 6Stage 6 organoids containing 100 cells were transplanted under the left kidney capsule. After 2 months, the mice were euthanized and serial sections of the transplants were analyzed by immunohistochemistry.
[0082] (statistical analysis) All results are expressed as mean ± standard deviation. Data between two groups were analyzed using Student's t-test, and data between multiple groups were analyzed using one-way ANOVA and Tukey's test. P < 0.05 was considered statistically significant. Statistical analysis was performed using JMP Pro 14 software (SAS Institute).
[0083] [Experimental Example 1] (Human iPSC PDX1 + NKX6.1 + Differentiation into cell-containing pancreatic organoids Human iPSC lines 585A1 and 604B1 were differentiated into PDX1 cells by a six-stage multi-step differentiation induction method. + NKX6.1 + The cells were induced to differentiate into pancreatic organoids.
[0084] An overview of the multi-step differentiation induction method is shown in Figure 1. In Figure 1, "iPSC" indicates iPS cells, "DE" indicates definitive endoderm, "PGT" indicates primitive gut cells, "PFG" indicates posterior foregut, "PP" indicates pancreatic progenitor cells, "EP" indicates pancreatic endocrine precursor cells, and "EN" indicates pancreatic endocrine cells.
[0085] At the end of stage 1, approximately 70% of cells express SOX17 + FOXA2 + The 585A1 cells differentiated into definitive endoderm cells. Figure 2 shows the results of a representative FACS analysis. As shown in Figure 2, 71.1±0.9% of the 585A1 cells expressed SOX17 + FOXA2 + In 604B1 cells, 72.4±1.9% were SOX17 + FOXA2 + It was.
[0086] At the end of stage 2, approximately 80% of cells express HNF1B+ FOXA2 + Figure 3 shows the results of a representative FACS analysis. As shown in Figure 3, 75.6±3.2% of 585A1 cells expressed HNF1B. + FOXA2 + In 604B1 cells, 81.8±0.9% was HNF1B + FOXA2 + It was.
[0087] The cells were then dissociated into single cells and seeded onto new dishes. Figure 4 shows micrographs of cells at each stage. The scale bar indicates 200 μm. After approximately 24 hours (stage 3, day 1: S3D1), the cells formed small clumps, as shown in Figure 4.
[0088] On day 1 of stage 4 (D4D1), cell clusters were scraped, dispersed by gentle pipetting, and transferred to low-adhesion plates. Subsequent differentiation induction was performed using 3D culture. As shown in Figure 4, by S4D2, the cell clusters formed 3D cell clusters.
[0089] Figure 5 shows the results of a representative FACS analysis. As shown in Figure 5, at this stage, the cell clusters were mainly composed of PDX1 + In 585A1 cells, 53.3±8.0% were PDX1 cells. + In 604B1 cells, 87.1% were PDX1 + However, NKX6.1 + In 585A1 cells, 1.2±0.3% of the cells were NKX6.1. + In 604B1 cells, 0.9% was NKX6.1 + It was.
[0090] Figure 6 shows a micrograph of pancreatic organoids at S4D5. The scale bar is 200 μm. As shown in Figure 6, by S4D5, the cell clusters were nearly uniform in appearance and size.
[0091] Immunohistochemical staining and FACS analysis revealed that approximately 90% of cells expressed PDX1, and 50-60% co-expressed NKX6.1. Figure 7 shows representative FACS analysis results, with 89.0 ± 0.65% of 585A1 cells expressing PDX1. + In 604B1 cells, 97.2±1.3% were PDX1 + FIG. 8 is a graph showing the results of FACS analysis, and shows that 48.9±3.1% of 585A1 cells were PDX1 + NKX6.1 + In 604B1 cells, 60.2±6.3% were PDX1 + NKX6.1 + It was.
[0092] Therefore, PDX1 + NKX6.1 + Pancreatic organoids were obtained, with more than half of the cells comprising pancreatic endoderm.
[0093] [Experimental Example 2] Transient inhibition of FOXO1 inhibits NGN3 + Increase in pancreatic endocrine progenitor cells Long-term inhibition of FOXO1 The FOXO1 inhibitor AS1842856 (CAS number: 836620-48-5) was added to the culture medium for the S4D5 pancreatic organoids obtained in Experimental Example 1.
[0094] After 24 hours, the γ-secretase inhibitor DAPT (CAS No.: 208255-80-5) was added to the medium to stimulate NGN3 gene expression, and the cells were cultured for 3 days. DAPT (CAS No.: 208255-80-5) is also a Notch signaling inhibitor.
[0095] 9 and 10 are graphs showing the results of quantitative real-time PCR analysis. In Figures 9 and 10, "*" indicates that a significant difference exists at p<0.05 in the Student's t-test, and "**" indicates that a significant difference exists at p<0.01.
[0096] As a result, it was revealed that the expression level of NGN3 gene mRNA was reduced, as shown in Figure 9. Furthermore, it was revealed that the expression levels of PDX1, NKX6.1, and SOX9 mRNA, which are genes expressed in the pancreas, were also significantly reduced, as shown in Figure 10.
[0097] Figure 11 shows micrographs of pancreatic organoids. In Figure 11, "AS" indicates the results of AS1842856 treatment, and "DMSO" indicates the results of dimethyl sulfoxide treatment as a control. The scale bar is 100 μm. As shown in Figure 11, pancreatic organoids treated with AS1842856 for 4 days were found to be larger than controls at S5D3. This result indicates that inhibition of FOXO1 induces cell proliferation.
[0098] Therefore, in the differentiation induction process into pancreatic endocrine cells, PDX1 + NKX6.1 + When FOXO1 was inhibited for four days at the cell-containing stage, the total number of cells increased compared to the untreated group, but the expression level of NGN3 actually decreased.
[0099] Transient inhibition of FOXO1 Next, the FOXO1 inhibitor AS1842856 (CAS number: 836620-48-5) was added to the culture medium of the S4D5 pancreatic organoids obtained in Experimental Example 1 for only one day, and then DAPT (CAS number: 208255-80-5) was added and the organoids were cultured for three days.
[0100] Figure 12 shows the results of quantitative real-time PCR analysis of the expression levels (mRNA) of PDX1, NKX6.1, and SOX9. The gray period (S4D5–S4D6) on the horizontal axis in Figure 12 indicates the period during which AS1842856 was added to the culture medium. Also, "**" indicates a significant difference (p<0.01) in the Student's t-test. Results showed that one day after the addition of AS1842856 (S4D6), the expression levels of PDX1, NKX6.1, and SOX9 mRNA were significantly reduced, but then recovered three days after removing AS1842856 (S5D3). Similar results were observed in in vitro cultures of pancreatic tissue derived from embryonic day 11.5 mouse embryos. These results indicate that FOXO1 inhibitors such as AS1842856 have the effect of reducing the expression levels of genes essential for maintaining pancreatic cell identity, such as PDX1, NKX6.1, and SOX9, but that their expression naturally recovers when the inhibitor is removed.
[0101] Figure 13 shows the results of quantitative real-time PCR analysis of NGN3 mRNA expression in S5D3 cells. In Figure 13, "*" indicates a significant difference (p<0.05) based on the Student's t-test, and "**" indicates a significant difference (p<0.01). Surprisingly, the group treated with the FOXO1 inhibitor for only one day (AS) showed a 4- to 11-fold increase in NGN3 expression compared to the negative control (DMSO). Specifically, the increase was 3.9±1.2-fold in 585A1 cells and 10.7±4.2-fold in 604B1 cells.
[0102] Next, FACS analysis was performed on the S5D3 pancreatic organoids to identify NGN3 + The percentage of NGN3 cells was analyzed. The results of FACS analysis and the quantification graphs are shown in Figures 14 and 15, respectively. In Figure 15, "**" indicates that there was a significant difference at p<0.01 as a result of the Student's t-test. As a result, in 585A1 cells, the percentage of NGN3 cells in the negative control group was significantly higher than that in the negative control group. +The percentage of NGN3 cells in the AS1842856-treated group was 3.1±0.25%, while in the AS1842856-treated group it was 8.8±0.74%, indicating that + The percentage of cells with NGN3 expression increased 2.8-fold in 604B1 cells compared with the negative control. + The percentage of NGN3 cells in the AS1842856-treated group was 2.9±0.37%, while in the AS1842856-treated group it was 16.3±2.6%. + The percentage of cells increased 5.8-fold.
[0103] Therefore, during the differentiation process into pancreatic endocrine cells, PDX1 + NKX6.1 + When pancreatic endoderm cells are generated, transient treatment with FOXO1 inhibitors such as AS1842856 results in increased NGN3 expression compared to the untreated group. + It was revealed that the proportion of cells increased significantly.
[0104] Figure 16 shows micrographs of pancreatic organoids in S5D3. In Figure 16, "DMSO" indicates the results of control cells treated with DMSO, and "Transient AS" indicates the results of transient AS1842856 treatment. The scale bar indicates 100 μm. As a result, no significant difference was observed in the size of cell clusters between the control and cells treated with AS1842856 for only one day. There was also no difference in the proportion of dead cells.
[0105] Therefore, in the differentiation induction process into pancreatic endocrine cells, PDX1 + NKX6.1 + Transient inhibition of FOXO1 at the cell-generating stage suppresses the subsequent production of NGN3. + It was suggested that the number of cells increased significantly.
[0106] Next, to examine whether AS1842856 treatment stimulated NGN3 expression, we generated NGN3-EGFP reporter cells from 604B1 cells and examined them. Figure 17 shows micrographs of NGN3-EGFP reporter cells induced to differentiate and treated with AS1842856.
[0107] As a result, transient inhibition of FOXO1 suppressed EGFP expression in S5D3. + It was clear that the number of cells increased significantly. + The amount of NGN3 mRNA per cell was identical between DMSO-treated control cells and AS1842856-treated cells. + Figure 1 shows a graph of NGN3 mRNA levels per cell, indicating that FOXO1 inhibition does not promote NGN3 transcription.
[0108] Therefore, in the differentiation induction process into pancreatic endocrine cells, PDX1 + NKX6.1 + Transient inhibition of FOXO1 in cells containing NGN3 + It was confirmed that it caused an increase in cell number.
[0109] The NGN3 gene is known to be expressed not only in pancreatic endocrine progenitor cells but also in enteroendocrine progenitor cells. + We decided to examine whether the cells were pancreatic endocrine precursor cells or enteroendocrine precursor cells.
[0110] S4D5 pancreatic organoids derived from 585A1 cells were sorted to detect glycoprotein 2 (GP2) + Pancreatic endoderm cells and GP2 - Figure 19 shows the GP2 expression in S4D5 cells. + Figure 20 shows the results of FACS analysis showing the percentage of PDX1 cells in S4D5. + NKX6.1 + The results of FACS analysis show the percentage of GP2 cells. + The proportion of cells that are PDX1 + NKX6.1 + The proportion of cells was similar.
[0111] GP2 + Cells and GP2- After separating the cells by sorting, each type of cell was seeded onto a low-adherence V-bottom well plate and treated with DMSO or AS1842856 for 24 hours. + Cells and GP2 - All the cells formed cell clusters. Figure 21 shows micrographs of each cell cluster. + cells, GP2 - In both cells, the AS1842856-treated group had larger cell clusters than the DMSO-treated group (Fig. 21, upper panel). + Cells and GP2 - It was revealed that the proliferation of both cells was promoted.
[0112] However, EGFP + The number of cells and the upregulation of NGN3 gene expression were significantly higher in S5D3 GP2 cells. + GP2, a non-pancreatic cell cluster, was observed only in the cell cluster. - This was not observed in cell clusters (Fig. 21, bottom panel).
[0113] Figure 22 is a graph showing the results of quantitative real-time PCR analysis measuring the expression level of the NGN3 gene in each pancreatic organoid. In Figure 22, "*" indicates that there is a significant difference at p<0.05 as a result of One-way ANOVA and Tukey's test, and "**" indicates that there is a significant difference at p<0.01. From the graph, GP2 - Unlike cells, GP2 + In cells, transient treatment with AS1842856 significantly increased NGN3 expression.
[0114] Furthermore, FACS analysis was performed to confirm NGN3 + The number of cells was counted. Figure 23 shows the EGFP expression in each pancreatic organoid. + The results of cell observation and FACS analysis are shown in microscopic photographs. The scale bar is 100 μm. Figure 24 shows the EGFP expression in each pancreatic organoid. +24 is a graph showing the proportion of cells. In FIG. 24, "**" indicates that there is a significant difference at p<0.01 as a result of One-way ANOVA and Tukey's test. From the graph, it can be seen that GP2 + Transient treatment of cells with AS1842856 produces NGN3 + It has become clear that the number of - Transient treatment of cells with AS1842856 did not produce NGN3 + It was also shown that the number of cells hardly increased.
[0115] These results suggest that transient inhibition of FOXO1 increases NGN3 + The cells were shown to be pancreatic endocrine progenitor cells, rather than enteroendocrine progenitor cells.
[0116] Therefore, in the differentiation induction process into pancreatic endocrine cells, PDX1 + NKX6.1 + Transient inhibition of FOXO1 in cells containing NGN3 + It has been shown to induce an increase in the number of pancreatic endocrine progenitor cells.
[0117] [Experimental Example 3] Transient inhibition of FOXO1 inhibits NGN3 expression in cells (PDX1 + NKX6.1 + Promoting cell proliferation NGN3 in the differentiation process from pluripotent stem cells to pancreatic organoids + The reasons for the increase in the number of pancreatic endocrine progenitor cells are: (1) NGN3 + (2) promoting the proliferation of pancreatic endocrine progenitor cells themselves, or (3) NGN3 + This may be due to the fact that FOXO1 transient inhibition (1) stimulates the proliferation of cells at a stage before they become pancreatic endocrine progenitor cells, or (2) promotes the proliferation of cells at a stage before they become pancreatic endocrine progenitor cells. + The effects on proliferation of pancreatic endocrine progenitor cells were analyzed.
[0118] 《NGN3 + Proliferative activity of pancreatic endocrine progenitor cells To perform the above analysis, we first induced differentiation of NGN3-EGFP reporter cells, and then performed FACS analysis every 24 hours from S4D6 to S5D3. + The time course of cell emergence was analyzed. + 25 is a graph showing the change in the proportion of cells. In FIG. 25, "**" indicates that there is a significant difference at p<0.01 as a result of the Student's t-test. The graph shows that in both the AS1842856-treated group and the untreated group, EGFP + EGFP cells were barely detectable at S5D1, appeared from S5D1 to S5D2, and then increased toward S5D3. + The percentages of cells were 0.1±0.04%, 0.3±0.08%, 10.6±1.6%, and 25.3±4.2% in S4D6, S5D1, S5D2, and S5D3, respectively.
[0119] Figure 26 is a graph showing the results of immunostaining NGN3 and FACS analysis. + NGN3 in cells + The percentage of cells in the S5D2 group was 76.3±3.2%, but decreased to 56.2±6.2% in the S5D3 group, consistent with the longer half-life of EGFP than that of NGN3.
[0120] Thus, EGFP + The number of cells significantly increased between S5D1 and S5D2, suggesting that NGN3 + To evaluate the proliferation potential of the cells themselves, it was found that cells were labeled with EdU for the last 12 hours of S5D1 and the cells that incorporated EdU at S5D2 (cells in the proliferation phase) were quantified. + 1 is a graph showing the results of FACS analysis in which the proportion of cells labeled with EdU was analyzed. +The number of cells labeled with EdU was very low (less than 5%) in both the AS1842856-treated and untreated groups, and there was no statistically significant difference between the two. + The cells have low proliferation activity, and transient treatment with a FOXO1 inhibitor does not significantly alter this proliferation ability.
[0121] Therefore, transient inhibition of FOXO1 inhibits NGN3 + It was shown that there was no effect of promoting cell proliferation.
[0122] 《NGN3 + Proliferative activity of cells at a stage before they become pancreatic endocrine progenitor cells Therefore, the cells were then labeled with EdU for the last 12 hours of S4D5 and analyzed at S5D2. Figure 28 is a graph showing the results of FACS analysis. "**" indicates a significant difference at p<0.01 as a result of Student's t-test. As a result, EFGP in pancreatic organoids was + The percentage of cells labeled with EdU was 35.4±2.4% in the non-AS1842856 treated group, but increased to 61.1±11.1% in the AS1842856 transiently treated group. + It was revealed that transient inhibition of FOXO1 significantly promoted the proliferation activity of cells present in the late S4D5 stage, which give rise to pancreatic endocrine progenitor cells.
[0123] NGN3 in the pancreatic endocrine cell differentiation lineage + Pancreatic endocrine progenitor cells are PDX1 + NKX6.1 + In the multi-stage differentiation induction method consisting of six stages used in the examples, stage 4 is derived from PDX1 + NKX6.1 + This is the process that gives rise to pancreatic endoderm cells. + The cell population is PDX1 + NKX6.1 + In Experiment 2, the cell population was almost identical to GP2 +It was confirmed that cell proliferation was promoted by transient treatment with AS1842856 (FIG. 21, upper panel; FIG. 22).
[0124] These findings suggest that transient treatment with AS1842856 inhibits NGN3 + The increase in the number of pancreatic endocrine progenitor cells was due to PDX1 + NKX6.1 + This is thought to be due to the promotion of proliferation of pancreatic endoderm cells, resulting in an increase in the number of said cells.
[0125] These results suggest that PDX1 + NKX6.1 + Transient inhibition of FOXO1 at the cell-containing stage significantly promoted the proliferation of the cells, resulting in the production of NGN3 + It was revealed that the number of pancreatic endocrine progenitor cells increased significantly.
[0126] [Experimental Example 4] (Inhibition of FOXO1 activates Wnt signaling (without affecting Notch activity)) It is known that HES1 expression suppresses the expression of MyoD and NGN3, inhibiting muscle and pancreatic endocrine cell differentiation, and that FOXO1 and Notch-IC cooperate to upregulate HES1 expression during muscle differentiation.
[0127] However, 24-hour treatment with AS1842856 did not alter HES1 expression in S4D6, whereas 3 days of DAPT treatment following AS1842856 treatment significantly reduced HES1 expression in S5D3.
[0128] Figure 29 is a graph showing the results of quantitative real-time PCR. In Figure 29, "**" indicates that a significant difference was detected at p<0.01 as a result of one-way ANOVA and Tukey's test, and "NS" indicates that there was no significant difference.
[0129] Figure 30 shows the results of quantitative real-time PCR analysis of Wnt target gene expression after 24 hours of treatment with each reagent starting from S4D5. The expression of Wnt target genes examined was AXIN2, TCF-1, and LEF-1. In Figure 30, "DMSO" indicates the results of treatment with DMSO, "AS" indicates the results of treatment with AS1842856, "AS + Wnt inhibitor" indicates the results of treatment with AS1842856 and a Wnt signaling inhibitor, and "CHIR" indicates the results of treatment with CHIR99021 (CAS No.: 252917-06-9), a Wnt signaling activator. XAV939 (CAS No.: 284028-89-3) was used as a Wnt signaling inhibitor, mixed with PKF118-310 (CAS No.: 84-82-2). Furthermore, "*" indicates that a significant difference exists at p<0.05 as a result of one-way ANOVA and Tukey's test, and "**" indicates that a significant difference exists at p<0.01.
[0130] The increase in AXIN2 and LEF-1 expression was suppressed by the addition of the Wnt signaling inhibitors XAV939 and PKF118-310 to the culture medium, but the increase in TCF-1 expression was not suppressed by the addition of the Wnt signaling inhibitors to the culture medium.
[0131] Figure 31 is a graph showing the results of quantitative real-time PCR analysis of NGN3 gene expression at S5D3 after treatment with each reagent for 24 hours from S4D5. In Figure 31, "DMSO," "AS," "AS + Wnt inhibitor," and "CHIR" are the same as those in Figure 30. In addition, "*" indicates a significant difference at p<0.05 based on the results of one-way ANOVA and Tukey's test, and "**" indicates a significant difference at p<0.01.
[0132] In addition, Figure 32 shows that NGN3-EGFP reporter cells were induced to differentiate, treated with each reagent for 24 hours from S4D5, and then EGFP was detected by FACS analysis at S5D3. +32 is a graph showing the results of measuring the proportion of cells. In Figure 32, "DMSO," "AS," "AS + Wnt inhibitor," and "CHIR" are the same as in Figure 30. In addition, "*" indicates that there is a significant difference at p<0.05 as a result of One-way ANOVA and Tukey's test, and "**" indicates that there is a significant difference at p<0.01.
[0133] Notably, the increase in NGN3 expression was significantly suppressed by a Wnt signaling inhibitor. This result indicates that the effect of AS1842856 is mediated by Wnt signaling activation. This is supported by the fact that transient Wnt signaling activation by CHIR99021 followed by DAPT treatment upregulated the expression of Wnt target genes at S4D6 and NGN3 at S5D3, as shown in Figures 30 and 31. These results are consistent with FOXO proteins and TCF / LEF transcription factors acting as competitive β-catenin-binding proteins.
[0134] Figure 33 is a graph showing the results of quantitative real-time PCR analysis of the expression of PDK4 and HBP1, genes targeted by FOXO1. In Figure 33, "DMSO," "AS," "AS + Wnt inhibitor," and "CHIR" are the same as in Figure 30. In addition, "**" indicates a significant difference of p<0.01 as a result of one-way ANOVA and Tukey's test.
[0135] As a result, the expression of PDK4 and HBP1, genes targeted by FOXO1, was significantly reduced in S4D6 by both AS1842856 and CHIR99021.
[0136] Furthermore, the inventors found that similar opposing effects of FOXO1 and Wnt were observed in mouse pancreatic organogenesis. Figure 34 shows the results of quantitative real-time PCR analysis of AXIN2 and HBP1 expression in in vitro cultured pancreatic tissue from mouse embryos at embryonic day 11.5. In Figure 34, "DMSO," "AS," "AS + Wnt inhibitor," and "CHIR" are the same as in Figure 30. Furthermore, "*" indicates a significant difference at p<0.05 based on the results of one-way ANOVA and Tukey's test, and "**" indicates a significant difference at p<0.01.
[0137] As a result, AS1842856 treatment increased AXIN2 expression, which was suppressed by XAV939 and PKF118-310 treatment.Furthermore, activation of Wnt signaling by CHIR99021 suppressed HBP1 expression.
[0138] Next, to confirm that the cell proliferation effect of AS1842856 treatment is mediated by Wnt signal activation, S4D5 cells were labeled with EdU for 12 hours and analyzed. Figure 35 shows the EdU activity measured by FACS analysis. + 35 is a graph showing the results of measuring the proportion of cells. In Figure 35, "DMSO," "AS," "AS + Wnt inhibitor," and "CHIR" are the same as in Figure 30. In addition, "*" indicates that there is a significant difference at p<0.05 as a result of one-way ANOVA and Tukey's test, and "**" indicates that there is a significant difference at p<0.01.
[0139] The results showed that CHIR99021 treatment increased EdU-labeled cells to a similar extent as AS1842856 treatment. +The percentage of cells treated with AS1842856 was 37.5±1.7% in control cells, 51.3±2.5% in AS1842856-treated cells, and 59.4±5.9% in CHIR99021-treated cells. Furthermore, inhibition of Wnt signaling by XAV939 and PKF118-310 treatment abolished the effect of AS1842856 treatment on cell proliferation, and EdU + The percentage of cells was 24.1±7.7%.
[0140] [Experimental Example 5] (Characterization of pancreatic organoids generated via transient inhibition of FOXO1) The final pancreatic organoids obtained by transiently inhibiting FOXO1 were characterized.
[0141] Immunostaining revealed that the pancreatic organoids obtained by AS1842856 treatment mainly expressed synaptophysin + Pancreatic endocrine cells and CK19 + Duct cells, Trypsin + Few exocrine pancreatic cells were observed.
[0142] As expected, transient inhibition of FOXO1 significantly increased the number of pancreatic endocrine cells. Figure 36 shows the insulin (INS) expression levels in pancreatic organoids by FACS analysis. + Glucagon (GCG) - cells, INS + GCG + cells, INS - GCG + 36 is a graph showing the results of measuring the proportion of cells. In Fig. 36, "*" indicates that there is a significant difference at p<0.05 as a result of Student's t-test, and "**" indicates that there is a significant difference at p<0.01.
[0143] As shown in Figure 36, INS + The percentage of cells was 4.3±1.8% in 585A1 cells and increased to 12.5±2.5% in 604B1 cells. +The percentage of INS cells was 8.8±2.7% in 585A1 cells and 25.3±7.3% in 604B1 cells. Therefore, transient inhibition of FOXO1 significantly reduced INS + GCG - cells, INS + GCG + cells, INS - GCG + It was found that all endocrine cell subpopulations of cells were significantly increased.
[0144] Next, pancreatic organoids obtained by AS1842856 treatment were transplanted under the kidney capsule of NRG mice. Figures 37 and 38 show the results of immunohistochemical staining of S6 organoids 2 months after transplantation. The scale bar is 100 μm. "*" indicates the mouse kidney parenchyma.
[0145] As a result, pancreatic organoids were mainly GCG + It was revealed that the cells developed into single hormonal cells, similar to the development of the human pancreas.
[0146] Furthermore, as shown in Figure 38, CK19-expressing tubular structures and trypsin + Primitive acinar cells were observed, indicating that pancreatic organoids obtained by AS1842856 treatment contain pancreatic epithelial progenitor cells.
[0147] Therefore, in the differentiation induction process into pancreatic endocrine cells, PDX1 + NKX6.1 + It was shown that transient inhibition of FOXO1 at the cell-containing stage resulted in pancreatic endocrine cells with differentiation potential similar to that of pancreatic endocrine cells arising during normal pancreatic development.
[0148] [Experimental Example 6] (Comparison of the effects of transient FOXO1 inhibition and Notch signaling inhibition) The FOXO1 inhibitor AS1842856 (CAS number: 836620-48-5) or dimethyl sulfoxide (DMSO) was added to the culture medium for S4D5 pancreatic organoids obtained in Experimental Example 1 (culture medium for S4D2 to 6 in Table 1 above), and the organoids were cultured for one day until S4D6.
[0149] Thereafter, the cells were cultured for 2 days in media containing or not containing DAPT (CAS number: 208255-80-5) (media S5D0 to 3 in Table 1 above), and the expression level of NGN3 was analyzed by quantitative real-time PCR analysis.
[0150] Figure 39 is a graph showing the results of quantitative real-time PCR analysis. In Figure 39, "AS → DAPT" indicates the result of the group treated with AS and then DAPT, "AS → DMSO" indicates the result of the group treated with AS but not DAPT, "DMSO → DAPT" indicates the result of the group treated with DAPT without AS treatment, and "DMSO → DMSO" indicates the result of the group not treated with AS or DAPT.
[0151] As a result, NGN3 expression was highest in the group that received both AS and DAPT treatment (AS → DAPT), but was also very high in the group that received only AS treatment (AS → DMSO), increasing approximately 8-fold compared with the group that received no AS or DAPT treatment (DMSO → DMSO). Furthermore, NGN3 expression in the group that received only AS treatment increased approximately 3-fold compared with the group that received only DAPT treatment (DMSO → DAPT). These results indicate that transient AS treatment at stage 4 significantly increases NGN3 expression compared with DAPT treatment at stage 5.
[0152] In multi-stage differentiation induction methods, DAPT treatment is generally performed at stage 5, but it is surprising that transient treatment with a FOXO1 inhibitor prior to DAPT treatment resulted in such a significant increase in NGN3 expression. [Industrial Applicability]
[0153] According to the present invention, PDX1 can be isolated by a very simple procedure. + NKX6.1 + It is possible to provide a technique for significantly proliferating pancreatic endoderm cells, and by extension, a technique for easily obtaining more pancreatic endocrine cells than ever before.
Claims
1. 1. A method for promoting proliferation of PDX1-positive, NKX6.1-positive pancreatic endoderm cells, comprising: Step 1: contacting the PDX1-positive NKX6.1-positive cells with a FOXO1 inhibitor and / or a Wnt signal activator. Including, The method, wherein in step 1, the FOXO1 inhibitor and / or the Wnt signaling activator is contacted for 12 to 36 hours.
2. 2. The method of claim 1, wherein the FOXO1 inhibitor is AS1842856.
3. The method of claim 1 or 2, wherein the Wnt signal activator is CHIR99021.
4. The method of any one of claims 1 to 3, wherein the PDX1-positive, NKX6.1-positive pancreatic endoderm cells are derived from pluripotent stem cells.
5. A method for producing NGN3-positive pancreatic endocrine precursor cells, comprising: Step 2: Culturing the PDX1-positive, NKX6.1-positive cells expanded by the method according to any one of claims 1 to 4. A manufacturing method comprising:
6. The method of claim 5 , wherein in step 2, the PDX1-positive, NKX6.1-positive cells are contacted with a Notch signal inhibitor.
7. The method of claim 6 , wherein the Notch signal inhibitor is DAPT.
8. The present invention relates to a method for treating a rheumatoid arthritis (HVA) comprising administering to a patient a therapeutically effective amount of a FOXO1 inhibitor and / or a Wnt signal activator as an active ingredient, A proliferation promoter for PDX1-positive, NKX6.1-positive cells, which is used to bring PDX1-positive, NKX6.1-positive cells into contact with a FOXO1 inhibitor and / or a Wnt signal activator for 12 to 36 hours.
9. The PDX1-positive, NKX6.1-positive cell proliferation promoter according to claim 8, wherein the FOXO1 inhibitor is AS1842856.
10. The PDX1-positive, NKX6.1-positive cell proliferation promoter according to claim 8 or 9, wherein the Wnt signal activator is CHIR99021.
11. A kit for producing pancreatic endocrine precursor cells, comprising the PDX1-positive, NKX6.1-positive cell proliferation promoter according to any one of claims 8 to 10, and a Notch signal inhibitor.
12. The kit for producing pancreatic endocrine precursor cells according to claim 11 , wherein the Notch signal inhibitor is DAPT.
Citation Information
Patent Citations
In vitro differentiation of pluripotent stem cells to pancreatic endoderm cells (PEC) and endocrine cells
JP2018183142A
Differentiation of human embryonic stem cells into single hormonal insulin positive cells
JP2019047810A