Nematode detection and quantification method

A common primer set and species-specific probes for real-time PCR allow simultaneous detection and quantification of multiple nematode species, addressing inefficiencies in existing methods and enhancing detection sensitivity.

JP7745939B1Active Publication Date: 2025-09-30NAT AGRI & FOOD RES ORG
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
JP2025009919
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2024-07-24
Filing Date
2025-01-23
Publication Date
2025-09-30
Estimated Expiration
2045-01-23

AI Technical Summary

Technical Problem

Existing methods for detecting and quantifying northern root-leach nematodes, sawtooth root-lesion nematodes, and northern root-knot nematodes are inefficient as they require separate reactions for each species, and there is a need for a method to simultaneously detect and quantify these nematodes in a single reaction.

Method used

Designing a common primer set and species-specific probes for the 28S region of the ribosomal RNA gene, allowing real-time PCR to detect and quantify multiple nematode species simultaneously using a single reaction.

Benefits of technology

Enables simultaneous, specific, and efficient detection and quantification of multiple nematode species, reducing the effort and expertise required, and improving detection sensitivity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007745939000006
    Figure 0007745939000006
  • Figure 0007745939000007
    Figure 0007745939000007
  • Figure 0007745939000008
    Figure 0007745939000008
Patent Text Reader

Abstract

The object of the present invention is to provide a method for specifically and efficiently detecting the northern root-leach nematode, the sawtooth root-leach nematode, the northern root-knot nematode, the southern root-leach nematode and the sweet potato root-knot nematode group, which are important pests of vegetables. [Solution] A method for quantitatively detecting one or more nematode species or groups selected from the group consisting of N. norvegicus, N. sawtooth root-leach nematode, N. northern root-knot nematode, N. southern root-leach nematode, and N. incognita group, comprising a step of performing real-time PCR using a primer set common to these nematode species and nematode groups, designed on the sequence of the 28S region of the ribosomal RNA gene of these nematode species and nematode groups, and a probe specific to each nematode species or nematode group.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a method for detecting, for example, Pratylenchus penetrans, Pratylenchus crenatus, Meloidogyne hapla, Pratylenchus coffeae and Meloidogyne incognita groups. [Background technology]

[0002] The northern root-leach nematode, the sawtooth root-leach nematode, and the northern root-knot nematode are nematodes that mainly attack vegetables, and are particularly problematic in areas where root vegetables are grown, as they are susceptible to damage even at low densities.

[0003] In order to predict the damage caused by these nematodes and implement appropriate control measures, it is necessary to clarify the actual occurrence of these nematodes in fields. Conventionally, tests for the northern root-leach nematode, the saw-leach nematode, and the northern root-knot nematode have been conducted by observing nematode populations isolated from soil under a microscope and identifying and counting these nematodes. However, this test requires a great deal of effort and a high level of expertise, which is a problem. Therefore, there is a need to develop a method for efficiently detecting and quantifying the northern root-leach nematode, the saw-leach nematode, and the northern root-knot nematode using simple manual operations, for example, using real-time PCR.

[0004] Meanwhile, several methods for individually detecting and quantifying the root-lesion nematode, the sawtooth root-lesion nematode, and the northern root-knot nematode by real-time PCR have been reported (Non-Patent Documents 1 to 4).

[0005] In Non-Patent Document 1, primer sets and probes were designed for the ITS regions of the ribosomal RNA genes of the northern root-lesion nematode and the sawtooth root-lesion nematode, respectively, and these nematode species were detected and quantified by real-time PCR using the probe method.

[0006] In Non-Patent Document 2, a primer set and probe were designed for the 28S region of the ribosomal RNA gene of the Pratylenchus penetroides, and the Pratylenchus penetroides were detected and quantified by real-time PCR using the probe method.

[0007] In Non-Patent Document 3, primer sets and probes were designed for the 28S region of the ribosomal RNA gene of the root-lesion nematode and the sawtooth root-lesion nematode, respectively, and these nematode species were detected and quantified by real-time PCR using the probe method.

[0008] In Non-Patent Document 4, a primer set and probe were designed for the ITS region of the ribosomal RNA gene of Meloidogyne northernis, and Meloidogyne northernis was detected and quantified by real-time PCR using the probe method.

[0009] As described above, as shown in Non-Patent Documents 1 to 4, it is possible to detect and quantify the northern root-lesion nematode, the saw-leaf root-lesion nematode, and the northern root-knot nematode by real-time PCR. However, all of the above-mentioned methods described in Non-Patent Documents 1 to 4 are inefficient because they can only detect and quantify one species in a single reaction. It would be more efficient if the northern root-lesion nematode, the saw-leaf root-lesion nematode, and the northern root-knot nematode could each be specifically detected and quantified in a single reaction, but such a method has not yet been established.

[0010] Additionally, in areas south of Honshu, the sweet potato root-knot nematode group (Meloidogyne incognita, Meloidogyne arenaria (there are two types of this species, Honshu type and Okinawa type), and Java root-knot nematode (Meloidogyne javanica)) and the southern root-lesion nematode are distributed, and these nematodes are also a problem, mainly in vegetables, so there is a need to develop methods for their efficient detection and quantification.

[0011] Several methods for detecting and quantifying the root-knot nematode and the sweet potato root-knot nematode group by real-time PCR have been reported (Non-Patent Documents 5 to 8).

[0012] In Non-Patent Document 5, primer sets and probes were designed for the ITS regions of the ribosomal RNA genes of the root-knot nematode and the sweet potato root-knot nematode group, and these nematode species were detected and quantified by real-time PCR using the probe method.

[0013] In Non-Patent Document 6, a primer set was designed for the endoglucanase gene sequence of Pratylenchus rotundifolia, and Pratylenchus rotundifolia was detected and quantified by real-time PCR using the intercalator method.

[0014] In Non-Patent Document 7, a primer set was designed for the ITS region of the ribosomal RNA gene of the root-knot nematode group, and the root-knot nematode group was detected and quantified by real-time PCR using the intercalator method.

[0015] In Non-Patent Document 8, a primer set was designed for the mitochondrial gene sequence of the root-knot nematode group, and the root-knot nematode group was detected and quantified by real-time PCR using the intercalator method.

[0016] As described above, it is possible to detect and quantify the root-knot nematode and the root-knot nematode group separately by real-time PCR, as shown in Non-Patent Documents 5 to 8. However, there is no method for simultaneously detecting and quantifying the root-knot nematode, the root-knot nematode, and the root-knot nematode group in a single real-time PCR reaction. [Prior art documents] [Non-patent literature]

[0017] [Non-Patent Document 1] Oliveira CM et al. (2017) Nematology 19:81-91 [Non-patent document 2] Dauphinais and Vandal (2018) Plant disease 102:970-976 [Non-patent document 3] Orlando (2021) The prevalence, detection and impact of root lesion nematodes (Pratylenchus spp.) found in potato growing land in Great Britain. Doctoral thesis, Harper Adams University. [Non-patent document 4] Sapkota et al. (2016) Nematology 18:147-15 [Non-patent document 5] Goto et al. (2011) Nematology 19:713-720 [Non-patent document 6] Bell et al. (2018) Phytopathology 108:641-650 [Non-Patent Document 7] Toyota et al. (2008) Soil Science and Plant Nutrition 54:72-76 [Non-patent document 8] Hodson et al. (2023) Plant Disease 107:2169-2176 Summary of the Invention [Problem to be solved by the invention]

[0018] In view of the above-mentioned circumstances, an object of the present invention is to provide a method for simultaneously and specifically detecting and quantifying each of the root-lesion nematodes, the sawtooth root-lesion nematode, and the northern root-knot nematode.

[0019] In view of the above-mentioned circumstances, another object of the present invention is to provide a method for simultaneously and specifically detecting and quantifying each of the root-knot nematodes, the root-leach nematode, and the sweet potato root-knot nematode group. [Means for solving the problem]

[0020] As a result of intensive research conducted to solve the above problems, the inventors designed a primer set common to all three species and probes specific to each species in the 28S region of the ribosomal RNA gene of the northern root-lesion nematode, the sawtooth root-lesion nematode, and the northern root-knot nematode. They then performed real-time PCR using this pair of primers and three probes specific to each species, which enabled specific detection of each nematode in a single real-time PCR reaction. Furthermore, they found that a strong negative correlation was observed between DNA concentration and Ct value, making quantification possible, and thus completed the present invention.

[0021] Furthermore, the present inventors designed a primer set common to the two species and one group, the southern root-leach nematode, and the sweet potato root-knot nematode group, and probes specific to each species or group, in the 28S region of the ribosomal RNA gene. Real-time PCR using this pair of primers and three probes specific to each species or group enabled specific detection of each nematode in a single real-time PCR reaction. Furthermore, a strong negative correlation was observed between DNA concentration and Ct value, demonstrating that quantification was possible, leading to the completion of the present invention.

[0022] That is, the present invention includes the following. [1] A probe for specifically detecting Pratylenchus pentaerythrorhizae, comprising the base sequence set forth in SEQ ID NO: 6. [2] A probe for specifically detecting the root-lesion nematode, comprising the base sequence set forth in SEQ ID NO: 7. [3] A probe for specifically detecting Meloidogyne nigra, comprising the base sequence set forth in SEQ ID NO: 8. [4] A probe and primer set comprising one or more probes (a) to (c) below and the primers (1) and (2) below, for amplifying by real-time PCR a base sequence specific to one or more nematode species selected from the group consisting of Meloidogyne nigra, Meloidogyne serrata, and Meloidogyne nigra, and for specifically detecting said one or more nematode species. (a) a probe for specifically detecting Pratylenchus pentaerythroderma, comprising the nucleotide sequence set forth in SEQ ID NO: 6; (b) a probe for specifically detecting Sawtooth-lesion nematode, comprising the nucleotide sequence set forth in SEQ ID NO: 7; (c) a probe for specifically detecting Meloidogyne nematode, comprising the nucleotide sequence set forth in SEQ ID NO: 8; (1) a primer containing the nucleotide sequence set forth in SEQ ID NO: 1; (2) A primer containing the base sequence set forth in SEQ ID NO: 2. [5] A kit for specifically detecting one or more nematode species selected from the group consisting of Meloidogyne nematode, Meloidogyne serrata, and Meloidogyne nigra, by amplifying a base sequence specific to the one or more nematode species by real-time PCR, the kit comprising the probe and primer set described in [4]. [6] A method for quantitatively detecting one or more nematode species selected from the group consisting of N. norvegicus, N. cerevisiae, and N. northern root-knot nematode, comprising a step of carrying out a real-time PCR amplification reaction of a target nucleic acid region of one or more nematode species selected from the group consisting of N. norvegicus, N. cerevisiae, and N. northern root-knot nematode, using the set of probes and primers described in [4] or the kit described in [5].

[0023] [7] A probe for specifically detecting Pratylenchus penicillium, comprising the base sequence set forth in SEQ ID NO: 13. [8] A probe for specifically detecting the root-knot nematode group, comprising the base sequence set forth in SEQ ID NO: 14. [9] A probe and primer set comprising one or more probes (a), (d), and (e) below and primers (1) and (2) below, for amplifying by real-time PCR a base sequence specific to one or more nematode species or groups selected from the group consisting of Pratylenchus norvegicus, Pratylenchus incognita, and Meloidogyne incognita, and for specifically detecting said one or more nematode species or groups. (a) a probe for specifically detecting Pratylenchus pentaerythroderma, comprising the nucleotide sequence set forth in SEQ ID NO: 6; (d) a probe for specifically detecting Pratylenchus oryzae, comprising the nucleotide sequence set forth in SEQ ID NO: 13; (e) a probe for specifically detecting the Meloidogyne incognita group, comprising the nucleotide sequence set forth in SEQ ID NO: 14; (1) a primer containing the nucleotide sequence set forth in SEQ ID NO: 1; (2) A primer containing the base sequence set forth in SEQ ID NO: 2.

[10] [9] A kit for specifically detecting one or more nematode species or groups by amplifying a base sequence specific to one or more nematode species or groups selected from the group consisting of the northern root-leach nematode, the southern root-leach nematode, and the sweet potato root-knot nematode group, using real-time PCR, the kit comprising the set of probes and primers described in

[10] and [9].

[11] A method for quantitatively detecting one or more nematode species or groups selected from the group consisting of the northern root-leach nematode, the southern root-leach nematode, and the sweet potato root-knot nematode group, comprising a step of carrying out a real-time PCR amplification reaction of a target nucleic acid region of one or more nematode species or groups selected from the group consisting of the northern root-leach nematode, the southern root-leach nematode, and the sweet potato root-knot nematode group, using the probe and primer set described in [9] or the kit described in

[10] . [Effects of the Invention]

[0024] According to the present invention, it is possible to simultaneously, specifically and efficiently detect the root-lesion nematode, the sawtooth root-lesion nematode and the northern root-knot nematode, which are important pests of vegetables.

[0025] Furthermore, according to the present invention, it is possible to simultaneously, specifically and efficiently detect the root-leach nematode, the root-leach nematode, and the root-knot nematode group, which are important pests of vegetables. [Brief explanation of the drawings]

[0026] [Figure 1-1] This figure shows the positions of the primer set and probe according to the present invention in an alignment of partial sequences of the 28S region of ribosomal RNA, focusing on Pratylenchus penetratus. "." indicates that the base is the same as Pratylenchus penetratus, and "-" indicates that the base is deleted. [Figure 1-2]This is a diagram showing the positions of the primer set and probe according to the present invention in an alignment of partial sequences of the 28S region of ribosomal RNA, focusing on the root-lesion nematode. "." indicates that the base is the same as that of the root-lesion nematode, and "-" indicates that the base is deleted. [Figure 1-3] This is a diagram showing the positions of the primer set and probe according to the present invention in an alignment of partial sequences of the 28S region of ribosomal RNA, focusing on Meloidogyne northernis. "." indicates that the base is the same as that of Meloidogyne northernis, and "-" indicates that the base is missing. [Figure 2] 1 is a graph showing the relationship between DNA concentration and Ct value in Example 1. The DNA concentration indicates the number of each nematode species contained in the sample. [Figure 3] 1 is a graph showing the relationship between DNA concentration and Ct value in Example 2. The DNA concentration indicates the number of each nematode species contained in the sample. [Figure 4-1] This is a diagram showing the positions of the primer set and probe (SEQ ID NO: 9) according to the present invention in an alignment of partial sequences of the 28S region of ribosomal RNA, focusing on Pratylenchus pratense. "." indicates that the base is the same as Pratylenchus pratense, and "-" indicates that the base is deleted. [Figure 4-2] This figure shows the positions of the primer set and probe (SEQ ID NO: 11) according to the present invention in an alignment of partial sequences of the 28S region of ribosomal RNA, focusing on Pratylenchus pratylenchus. "." indicates that the base is the same as Pratylenchus pratylenchus, and "-" indicates that the base is deleted. [Figure 4-3] This is a diagram showing the positions of the primer set and probe (SEQ ID NO: 10) according to the present invention in an alignment of partial sequences of the 28S region of ribosomal RNA, focusing on the Meloidogyne incognita group. "." indicates that the base is the same as that of the Meloidogyne incognita group, and "-" indicates that the base is deleted. [Figure 4-4]This is a diagram showing the positions of the primer set and probe (SEQ ID NO: 12) according to the present invention in an alignment of partial sequences of the 28S region of ribosomal RNA, focusing on the Meloidogyne incognita group. "." indicates that the base is the same as that of the Meloidogyne incognita group, and "-" indicates that the base is deleted. [Figure 5-1] 1 is a graph showing the relationship between DNA concentration and Ct value in Example 3. The DNA concentration indicates the number of each nematode species contained in the sample. [Figure 5-2] This is a continuation of Figure 5-1. [Figure 6-1] 1 is a graph showing the relationship between DNA concentration and Ct value in Example 4. The DNA concentration indicates the number of each nematode species contained in the sample. [Figure 6-2] This is a continuation of Figure 6-1. DETAILED DESCRIPTION OF THE INVENTION

[0027] The present invention will be described in detail below. <First aspect of the present invention> A probe and primer set according to a first aspect of the present invention includes one or more probes specific to each of Meloidogyne phillyraeoides, Meloidogyne sericeae, and Meloidogyne rhizomeliads, and a pair of primers common to these three species, and is used to amplify by real-time PCR a base sequence specific to one or more nematode species selected from the group consisting of Meloidogyne phillyraeoides, Meloidogyne sericeae, and Meloidogyne rhizomeliads, and to specifically detect the one or more nematode species.

[0028] FIG. 1 shows the positions of the primer set and probe according to the first aspect of the present invention in an alignment of partial sequences of the 28S region of the ribosomal RNA gene between Meloidogyne pratense, Meloidogyne sericea, and Meloidogyne northernis and other nematodes.

[0029] The probes specific to each of the root-leach nematode, the saw-leach nematode, and the northern root-knot nematode according to the present invention can specifically detect each nematode among nematode species including these three nematodes, and the probe and primer set according to the first aspect of the present invention can contain two or all three of the probes specific to each of the root-leach nematode, the saw-leach nematode, and the northern root-knot nematode. Real-time PCR using the probe and primer set according to the first aspect of the present invention, which contains these two or all three probes, can simultaneously detect two or all three species of the root-leach nematode, the saw-leach nematode, and the northern root-knot nematode in a single real-time PCR run.

[0030] Specifically, the probe according to the first aspect of the present invention is the following probe: (a) Pratylenchus penetrocarcinoma-specific probe: a probe for specifically detecting Pratylenchus penetrocarcinoma, comprising or consisting of the nucleotide sequence set forth in SEQ ID NO: 6; (b) a root-lesion nematode-specific probe: a probe for specifically detecting a root-lesion nematode, comprising or consisting of the nucleotide sequence set forth in SEQ ID NO: 7; (c) Meloidogyne specific probe: a probe for specifically detecting Meloidogyne, comprising or consisting of the base sequence set forth in SEQ ID NO:8.

[0031] Alternatively, the probes according to the first aspect of the present invention may alternatively include probes having the same nucleotide sequence as the SEQ ID NO of each probe, but with one or more (e.g., 1 to 10, 1 to 5, 1 to 3, and preferably 1 or 2) bases deleted, substituted, inserted, or added, and having the respective probe functions (i.e., probes that hybridize to DNA derived from the 28S region of the ribosomal RNA gene of each nematode under stringent conditions (preferably highly stringent conditions)). Here, "stringent conditions" refers to, for example, hybridization conditions of "5x SSPE, 5x Denhardt's solution, 0.5% SDS, 50% formamide, 200 μg / mL salmon sperm DNA, overnight at 42°C," and washing conditions of "0.5x SSC, 0.1% SDS, 42°C." "Highly stringent conditions" refers to, for example, hybridization conditions of "5x SSPE, 5x Denhardt's solution, 0.5% SDS, 50% formamide, 200 μg / mL salmon sperm DNA, overnight at 42°C" and washing conditions of "0.2x SSC, 0.1% SDS, 65°C."

[0032] For example, a probe specific to the northern root-lesion nematode may be a probe containing or consisting of the base sequence set forth in SEQ ID NO: 3, a probe specific to the sawtooth root-lesion nematode may be a probe containing or consisting of the base sequence set forth in SEQ ID NO: 4, and a probe specific to the northern root-knot nematode may be a probe containing or consisting of the base sequence set forth in SEQ ID NO: 5 (Table 1).

[0033] The probe according to the first aspect of the present invention is used in real-time PCR. That is, the probe is a fluorescent dye probe that complementarily binds within the amplification region (having a base sequence that can specifically anneal to a sequence present between the regions to which the primers used anneal, and for example, a fluorescent dye probe labeled with a reporter dye (e.g., FAM, Yakima yellow, TAMRA, NED, etc.) at the 5' end and a quencher (e.g., IABkFQ, IAbRQSp, MGB Eclipse, MGB-NFQ, etc.) at the 3' end). When real-time PCR is performed using two or all three types of probes simultaneously (multiplex), each probe will be labeled with a reporter dye (fluorescent dye) with a different spectrum at the 5' end.

[0034] On the other hand, the primer set according to the first aspect of the present invention comprises the following pair of primers: (1) a primer containing or consisting of the nucleotide sequence set forth in SEQ ID NO: 1 (forward primer, Table 1); and (2) A primer containing or consisting of the nucleotide sequence set forth in SEQ ID NO: 2 (reverse primer, Table 1).

[0035] Alternatively, similar to the probes, the primer set according to the first aspect of the present invention may alternatively include primers having a base sequence in which one or several (e.g., 1 to 10, 1 to 5, 1 to 3, preferably 1 or 2) bases have been deleted, substituted, inserted or added in the base sequence indicated by the sequence number of each primer, and which have the respective primer functions (primers that hybridize under stringent conditions (preferably under highly stringent conditions) to DNA derived from the 28S region of the ribosomal RNA gene of each nematode).

[0036] Furthermore, a first aspect of the present invention relates to a kit for detecting one or more nematode species selected from the group consisting of Pratylenchus norvegicus, Pratylenchus serrata, and Pratylenchus northern root-knot nematode by real-time PCR, which kit includes the probe and primer set according to the first aspect of the present invention. The kit may further include, for example, a DNA polymerase, a nucleic acid synthesis substrate (dNTP), a buffer solution, salts, a container, an instruction manual, etc.

[0037] Furthermore, a first aspect of the present invention relates to a method for quantitatively detecting one or more nematode species (preferably two or all three species) selected from the group consisting of P. norvegicus, P. sawtoothii, and N. northern root-knot nematode, comprising the step of carrying out a real-time PCR amplification reaction of a target nucleic acid region of one or more nematode species (preferably two or all three species) selected from the group consisting of P. norvegicus, P. sawtoothii, and N. northern root-knot nematode, using the probe and primer set according to the first aspect of the present invention described above, or the kit according to the first aspect of the present invention (hereinafter referred to as "the first aspect of the present method"). Real-time PCR in the first aspect of the present method enables quantitative detection of amplification products using a fluorescent signal from a fluorescent dye probe as an indicator.

[0038] In a first aspect of this method, DNA is first extracted and purified from nematode individuals or nematode communities isolated from a field soil sample containing or suspected of containing, for example, the northern root-lesion nematode, the sawtooth root-lesion nematode, and / or the northern root-knot nematode (e.g., a field soil sample with a history of growing vegetables such as radish, carrot, or burdock). Examples of DNA extraction methods include those using commercially available DNA extraction reagents.

[0039] The purified DNA is then used as a template for real-time PCR using the probe and primer set according to the first aspect of the present invention. The PCR reaction solution is prepared so that, for example, per 10 μL of reaction solution, it contains each primer included in the probe and primer set according to the first aspect of the present invention at a final concentration of 200 to 300 nM (preferably 200 nM), a Pratylenchus penetrovirens-specific probe at a final concentration of 100 to 200 nM (preferably 200 nM), a Pratylenchus serrata-specific probe at a final concentration of 200 to 300 nM (preferably 200 nM) and / or a Pratylenchus northern root-knot nematode-specific probe at a final concentration of 200 to 300 nM (preferably 200 nM), 1 to 2 μL (preferably 1 μL) of template DNA, and the respective volumes of DNA polymerase and dNTPs according to the manufacturer's instructions. Furthermore, PCR thermal cycling conditions include, for example, initial denaturation: 95°C for 30 seconds → (denaturation: 95°C for 5 seconds → annealing and extension: 59 to 61°C (preferably 60°C) for 30 to 45 seconds (preferably 45 seconds)) for 30 to 40 cycles (preferably 40 cycles).

[0040] Furthermore, the amplification product is quantified using the fluorescent signal from the probe as an index. For example, real-time PCR is performed using serially diluted DNA derived from known amounts of Pratylenchus oryzae, Pratylenchus oryzae, and / or Pratylenchus oryzae as a standard, and a calibration curve is created by plotting the threshold cycle (Ct value) at which a certain amount of amplification product is obtained on the horizontal axis (or vertical axis) and the amount of DNA added on the vertical axis (or horizontal axis). Meanwhile, real-time PCR is performed on a sample to be detected, the Ct value is determined, and the amount of DNA in the sample to be detected can be determined from the calibration curve created.

[0041] <Second Aspect of the Present Invention> A probe and primer set according to a second aspect of the present invention includes one or more probes specific to each of the northern root-leach nematode, southern root-leach nematode, and sweet potato root-knot nematode groups distributed south of Honshu, and a pair of primers common to these two species and one group, and is used to amplify by real-time PCR a base sequence specific to one or more nematode species or nematode groups selected from the group consisting of the northern root-leach nematode, southern root-leach nematode, and sweet potato root-knot nematode groups, and to specifically detect the one or more nematode species or nematode groups.

[0042] Here, the Meloidogyne incognita group (or group or species) refers to a species group of root-knot nematodes that are closely related to Meloidogyne incognita, such as Meloidogyne incognita, Meloidogyne arenaria (Honshu type and Okinawa type), and Meloidogyne javanica.

[0043] FIG. 4 shows the positions of the primer set and probe according to the second embodiment of the present invention in an alignment of partial sequences of the 28S region of the ribosomal RNA gene between the root-knot nematode and Meloidogyne incognita group and other nematodes.

[0044] The probes specific to each of the northern root-leach nematode, southern root-leach nematode, and sweet potato root-knot nematode groups according to the second aspect of the present invention can specifically detect each nematode among nematode species including these two and one group of nematodes, and the probe and primer set according to the second aspect of the present invention can contain two or all three of the probes specific to each of the northern root-leach nematode, southern root-leach nematode, and sweet potato root-knot nematode groups. Real-time PCR using the probe and primer set according to the second aspect of the present invention, which contains these two or all three probes, can simultaneously detect two species (or one species and one group) or two species and one group of the northern root-leach nematode, southern root-leach nematode, and sweet potato root-knot nematode groups in a single real-time PCR run.

[0045] Specifically, the probe according to the second aspect of the present invention is the following probe: (a) Pratylenchus penetra-specific probe (identical to the probe in the first aspect of the present invention): a probe for specifically detecting Pratylenchus penetra, comprising or consisting of the nucleotide sequence set forth in SEQ ID NO: 6; (d) Pratylenchus nematode-specific probe: a probe for specifically detecting Pratylenchus nematode, comprising or consisting of the nucleotide sequence set forth in SEQ ID NO: 13; (e) Meloidogyne incognita group-specific probe: a probe for specifically detecting Meloidogyne incognita group, comprising or consisting of the base sequence set forth in SEQ ID NO: 14.

[0046] Alternatively, the probes according to the second aspect of the present invention may alternatively include probes having a base sequence in which one or several (e.g., 1 to 10, 1 to 5, 1 to 3, preferably 1 or 2) bases have been deleted, substituted, inserted or added in the base sequence indicated by the sequence number of each probe, and which have the respective probe functions (probes that hybridize under stringent conditions (preferably under highly stringent conditions) to DNA derived from the 28S region of the ribosomal RNA gene of each nematode).

[0047] For example, the root-knot nematode-specific probe may be a probe containing or consisting of the nucleotide sequence set forth in SEQ ID NO: 9 (the nucleotide sequence from the 1st base to the 14th base in this nucleotide sequence corresponds to the nucleotide sequence set forth in SEQ ID NO: 13) or the nucleotide sequence set forth in SEQ ID NO: 11 (the nucleotide sequence from the 2nd base to the 15th base in this nucleotide sequence corresponds to the nucleotide sequence set forth in SEQ ID NO: 13).Furthermore, the root-knot nematode group-specific probe may be a probe containing or consisting of the nucleotide sequence set forth in SEQ ID NO: 10 (the nucleotide sequence from the 1st base to the 11th base in this nucleotide sequence corresponds to the nucleotide sequence set forth in SEQ ID NO: 14) or the nucleotide sequence set forth in SEQ ID NO: 12 (the nucleotide sequence from the 6th base to the 16th base in this nucleotide sequence corresponds to the nucleotide sequence set forth in SEQ ID NO: 14).

[0048] The probe according to the second aspect of the present invention is used in real-time PCR, similarly to the first aspect of the present invention. That is, the probe is a fluorescent dye probe that complementarily binds within the amplification region (having a base sequence that can specifically anneal to a sequence present between the regions to which the primers used anneal, and for example, a fluorescent dye probe labeled with a reporter dye (e.g., FAM, Yakima yellow, TAMRA, NED, etc.) at the 5' end and a quencher (e.g., IABkFQ, IAbRQSp, MGB Eclipse, MGB-NFQ, etc.) at the 3' end). When real-time PCR is performed using two or all three types of probes simultaneously (multiplex), each probe will be labeled with a reporter dye (fluorescent dye) with a different spectrum at the 5' end.

[0049] On the other hand, the primer set according to the second aspect of the present invention is identical to the primer set comprising a pair of primers according to the first aspect of the present invention.

[0050] A second aspect of the present invention relates to a kit for detecting one or more nematode species or groups selected from the group consisting of Pratylenchus pentaerythrorhizae, Pratylenchus incognita, and Meloidogyne incognita by real-time PCR, comprising the set of probes and primers according to the second aspect of the present invention. As with the kit according to the first aspect of the present invention, the kit may further comprise, for example, a DNA polymerase, a nucleic acid synthesis substrate (dNTP), a buffer solution, salts, a container, instructions for use, etc.

[0051] Furthermore, a second aspect of the present invention relates to a method for quantitatively detecting one or more nematode species or groups (preferably two species (or one species and one group), or all of the two species and one group) selected from the group consisting of P. norvegicus, P. incognita, and P. incognita (hereinafter referred to as "the second aspect of the method"), comprising the step of carrying out a real-time PCR amplification reaction of target nucleic acid regions of one or more nematode species or groups (preferably two species (or one species and one group), or all of the two species and one group) selected from the group consisting of P. norvegicus, P. incognita, and P. incognita (hereinafter referred to as "the second aspect of the method"). Real-time PCR in the second aspect of the method enables quantitative detection of amplification products using a fluorescent signal from a fluorescent dye probe as an indicator.

[0052] In the second embodiment of the present method, similar to the first embodiment, DNA is first extracted and purified from nematode individuals or nematode communities isolated from a field soil sample containing or suspected of containing, for example, Pratylenchus oryzae, Pratylenchus incognita, and / or the Meloidogyne incognita group (e.g., a field soil sample previously grown in a field where vegetables such as radish, carrot, burdock, taro, sweet potato, eggplant, and tomato have been cultivated). Examples of DNA extraction methods include those using commercially available DNA extraction reagents.

[0053] The purified DNA is then used as a template for real-time PCR using the probe and primer set according to the second aspect of the present invention. The PCR reaction solution is prepared so that, for example, per 10 μL of reaction solution, it contains each primer included in the probe and primer set according to the second aspect of the present invention at a final concentration of 200 to 300 nM (preferably 200 nM), a Pratylenchus penetrovus-specific probe at a final concentration of 100 to 200 nM, a Pratylenchus incognita-specific probe at a final concentration of 100 to 150 nM (preferably 100 nM) and / or a Meloidogyne incognita group-specific probe at a final concentration of 100 to 300 nM, 1 to 2 μL (preferably 1 μL) of template DNA, and the respective volumes of DNA polymerase and dNTPs according to the manufacturer's instructions. Furthermore, PCR thermal cycling conditions include, for example, initial denaturation: 95°C for 30 seconds → (denaturation: 95°C for 5 seconds → annealing and extension: 59 to 61°C (preferably 60°C) for 30 to 45 seconds (preferably 45 seconds)) for 30 to 40 cycles (preferably 40 cycles).

[0054] Furthermore, as in the first embodiment of this method, the amplification product is quantified using the fluorescent signal from the probe as an index. For example, real-time PCR is performed using serially diluted DNA from known amounts of Pratylenchus penicillium, Pratylenchus spp., and / or Meloidogyne incognita group as a standard, and a calibration curve is created by plotting the cycle number (Ct value) at which a certain amount of amplification product is obtained on the horizontal axis (or vertical axis) and the amount of DNA added on the vertical axis (or horizontal axis). Meanwhile, real-time PCR is performed on a sample to be detected to determine the Ct value, and the amount of DNA in the sample to be detected can be determined from the created calibration curve. [Example]

[0055] The present invention will be described in more detail below using examples, but the technical scope of the present invention is not limited to these examples.

[0056] Example 1: Detection and quantification method 1 for Pratylenchus oryzae, Pratylenchus serrata, and Pratylenchus nigricans Primer sets common to the three species and probes specific to each species were designed in the 28S region of the ribosomal RNA gene of the root-lesion nematode, the sawtooth root-lesion nematode, and the northern root-knot nematode (Table 1).

[0057] Figure 1-1 is a diagram showing the positions of the primer set and probes according to the present invention in an alignment of partial sequences of the 28S region of ribosomal RNA, focusing on the root-lesion nematode. Figure 1-2 is a diagram showing the positions of the primer set and probes according to the present invention in an alignment of partial sequences of the 28S region of ribosomal RNA, focusing on the root-lesion nematode. Figure 1-3 is a diagram showing the positions of the primer set and probes according to the present invention in an alignment of partial sequences of the 28S region of ribosomal RNA, focusing on the northern root-knot nematode.

[0058] [Table 1]

[0059] Real-time PCR was carried out using these two primers and three probes. Real-time PCR was carried out using a reaction solution with the following composition: Probe qPCR Mix (Takara): 5.0 μl Common forward primer: 0.2 to 0.3 μM (preferably 0.2 μM) Common reverse primer: 0.2 to 0.3 μM (preferably 0.2 μM) Probe for Pratylenchus penetroides: 0.1 to 0.15 μM (preferably 0.1 μM) Probe for Sawtooth nematode: 0.2 to 0.3 μM (preferably 0.2 μM) Probe for Meloidogyne: 0.2-0.3 μM (preferably 0.2 μM) Rox dye II (Takara): 0.2 μl Template DNA: 1.0 μl The final volume was adjusted to 10 μl with nuclease-free water.

[0060] In this example, all primers, the probe for Meloidogyne serrata, and the probe for Meloidogyne northernis were used at 0.2 μM, and the probe for Meloidogyne northernis was used at 0.1 μM.

[0061] The PCR reaction was carried out under the following temperature conditions: Initial denaturation: 95°C for 30 seconds → (denaturation: 95°C for 5 seconds → annealing and extension: 59 to 61°C (preferably 60°C) for 30 to 45 seconds (preferably 45 seconds)) for 30 to 40 cycles (preferably 40 cycles).

[0062] In this example, the annealing and extension reactions were all carried out at 60° C. for 45 seconds, with 40 cycles. PCR was performed using QuantStudio 3 (Applied Biosystems).

[0063] The results are shown in Table 2 and FIG. Each nematode species could be specifically detected in a single real-time PCR reaction using the primer set and probe according to the present invention (Table 2).

[0064] [Table 2]

[0065] Furthermore, a strong negative correlation was observed between DNA concentration and Ct value (Figure 2), demonstrating the feasibility of quantification. The lowest-concentration DNA solution used in this study contained DNA from one individual of each nematode species, and this could also be detected by real-time PCR. Therefore, the detection sensitivity was sufficiently high.

[0066] Example 2: Detection and quantification method 2 for Pratylenchus oryzae, Pratylenchus oryzae, and Pratylenchus oryzae Real-time PCR was carried out by replacing the probe described in Example 1 with the following modified probe. The same primers as in Example 1 were used.

[0067] Modified probe for Pratylenchus penetrovirgilis: FAM / ACGATTGCCTGGA / MGB Eclipse (SEQ ID NO: 6; corresponding to the 3rd to 15th nucleotide sequence of SEQ ID NO: 3); Modified probe for root-lesion nematode: Yakima yellow / AAGAAGGCGGCTT / MGB Eclipse (SEQ ID NO: 7; corresponding to the 2nd to 14th nucleotide sequence of SEQ ID NO: 4); Modified probe for Meloidogyne nematode: NED / TTCAGAAAAGTGCATCA / MGB-NFQ (SEQ ID NO: 8; corresponding to the 2nd to 18th bases of SEQ ID NO: 5) (The sequence directions are all 5'=>3'. NED is a fluorescent dye, and MGB Eclipse and MGB-NFQ are quenchers).

[0068] Real-time PCR was carried out using a reaction solution with the following composition: Probe qPCR Mix (Takara): 5.0 μl Common forward primer: 0.2 μM Common reverse primer: 0.2 μM Modified probe for Pratylenchus penetrovirens: 0.2 μM Modified probe for Sawtooth nematode: 0.2 μM Modified Meloidogyne probe: 0.2 μM Rox dye II (Takara): 0.2 μl Template DNA: 1.0 μl The final volume was adjusted to 10 μl with nuclease-free water.

[0069] The PCR reaction was carried out under the following temperature conditions: Initial denaturation: 95°C for 30 seconds → (denaturation: 95°C for 5 seconds → annealing and extension: 60°C for 45 seconds) for 40 cycles.

[0070] The results are shown in Table 3 and FIG. As with the use of the probes described in Example 1, each target nematode species could be specifically detected in a single real-time PCR run (Table 3).

[0071] [Table 3]

[0072] Furthermore, a strong negative correlation was observed between DNA concentration and Ct value (Figure 3), demonstrating that quantification is possible.

[0073] [Example 3] Detection and quantification method 1 for the northern root-lesion nematode, southern root-lesion nematode, and sweet potato root-knot nematode group First, we designed the following probes in the 28S region of the ribosomal RNA gene of the root-knot nematode and the sweet potato root-knot nematode group.

[0074] Probe for Pratylenchus oryzae: Yakima Yellow / TCACCACGGTGGCCGGGC / IABkFQ (SEQ ID NO: 9); Probe for the sweet potato root-knot nematode group: TAMRA / TCTTGTAAAAAAGTGTAGCATGGCCCCA / IAbRQSp (SEQ ID NO: 10) (All sequences are 5'=>3' oriented).

[0075] FIG. 4-1 shows the positions of the primer set and probe (SEQ ID NO: 9) according to the present invention in the alignment of partial sequences of the 28S region of ribosomal RNA, focusing on Pratylenchus chinensis.

[0076] FIG. 4-3 shows the positions of the primer set and probe (SEQ ID NO: 10) according to the present invention in an alignment of partial sequences of the 28S region of ribosomal RNA, focusing on the Meloidogyne incognita group.

[0077] In addition to these, the following primer set and probe for Pratylenchus penetrocarides were also prepared.

[0078] Common forward primer: CAAGGAGTTTATCGTGTGCG (SEQ ID NO: 1); Common reverse primer: TGCTCAGGAATAGTCACCA (SEQ ID NO: 2); Probe for Pratylenchus penetrovirgilis: FAM / TCACGATTGCCTGGAGCAACATGG / IABkFQ (SEQ ID NO: 3).

[0079] Real-time PCR was performed using these two primers and three probes. The composition of the reaction solution is as follows: Probe qPCR Mix (Takara): 5.0 μl Common forward primer: 0.2 to 0.3 μM (preferably 0.2 μM) Common reverse primer: 0.2 to 0.3 μM (preferably 0.2 μM) Probe for Pratylenchus penetroides: 0.1 to 0.15 μM (preferably 0.1 μM) Probe for Pratylenchus oryzae: 0.1 to 0.15 μM (preferably 0.1 μM) Probe for the Meloidogyne group: 0.2-0.3 μM (preferably 0.2 μM) Rox dye II (Takara): 0.2 μl Template DNA: 1.0 μl The final volume was adjusted to 10 μl with nuclease-free water.

[0080] In this example, the primers and probe for the Meloidogyne incognita group were used at 0.2 μM, and the probes for the Pratylenchus norvegicus and Pratylenchus indicus were used at 0.1 μM.

[0081] The PCR reaction was carried out under the following temperature conditions: Initial denaturation: 95°C for 30 seconds → (denaturation: 95°C for 5 seconds → annealing and extension: 59 to 61°C (preferably 60°C) for 30 to 45 seconds (preferably 45 seconds)) for 30 to 40 cycles (preferably 40 cycles).

[0082] In this example, all annealing and extension reactions were carried out at 60°C for 45 seconds, and the number of cycles was 40. PCR was performed using QuantStudio 3 (Applied Biosystems).

[0083] When real-time PCR was performed as described above using the DNA of various nematode species as templates, each nematode could be specifically detected in a single real-time PCR reaction using the primer set and probe of the present invention (Table 4).

[0084] [Table 4]

[0085] Furthermore, a strong negative correlation was observed between DNA concentration and Ct value (Figure 5), demonstrating the feasibility of quantification. The lowest-concentration DNA solution used in this study contained the DNA of one individual of each nematode species, and this was also detectable by real-time PCR. Therefore, the detection sensitivity was sufficiently high.

[0086] [Example 4] Detection and quantification method 2 for the northern root-lesion nematode, southern root-lesion nematode, and sweet potato root-knot nematode group Real-time PCR was carried out by replacing the probe described in Example 3 with the following modified probe. The same primers as in Example 3 were used.

[0087] Modified probe for Pratylenchus penetrovirgilis: FAM / ACGATTGCCTGGA / MGB Eclipse (SEQ ID NO: 6); Modified probe for Pratylenchus alkane: Yakima Yellow / GTCACCACGGTGGCC / MGB Eclipse (SEQ ID NO: 11) (the second to fifteenth bases of this probe correspond to the first to fourteenth bases of the Pratylenchus alkane probe (SEQ ID NO: 9) of Example 3); Modified probe for the Meloidogyne incognita group: NED / TGCGATCTTGTAAAAA / MGB-NFQ (SEQ ID NO: 12) (the 6th to 16th bases of this probe correspond to the 1st to 11th bases of the Meloidogyne incognita group probe (SEQ ID NO: 10) of Example 3) (All sequences are 5'=>3' oriented).

[0088] FIG. 4-2 is a diagram showing the positions of the primer set and probe (SEQ ID NO: 11) according to the present invention in the alignment of partial sequences of the 28S region of ribosomal RNA, focusing on Pratylenchus chinensis.

[0089] FIG. 4-4 is a diagram showing the positions of the primer set and probe (SEQ ID NO: 12) according to the present invention in an alignment of partial sequences of the 28S region of ribosomal RNA, focusing on the Meloidogyne incognita group.

[0090] Real-time PCR was performed using QuantStudio 3 (Applied Biosystems) with a reaction solution having the following composition: Probe qPCR Mix (Takara) 5.0 μl Common forward primer 0.2 μM Common reverse primer 0.2 μM Modified probe for Pratylenchus penetroides 0.2 μM Modified probe for Pratylenchus oryzae 0.1 μM Modified probe for Meloidogyne incognita group 0.1 μM Rox dye II (Takara) 0.2 μl Template DNA 1.0 μl Adjust the final volume to 10 μl with nuclease-free water.

[0091] PCR reactions were carried out under the following temperature conditions: Initial denaturation: 95°C for 30 seconds → (denaturation: 95°C for 5 seconds → annealing and extension: 60°C for 45 seconds, 40 cycles).

[0092] When real-time PCR was performed as described above using the DNA of various nematode species as templates, each nematode could be specifically detected in a single real-time PCR reaction, as was the case when the probe described in Example 3 was used (Table 5).

[0093] [Table 5]

[0094] Furthermore, a strong negative correlation was observed between DNA concentration and Ct value (Figure 6), demonstrating that quantification is possible.

Claims

1. A probe for specifically detecting Pratylenchus pentaerythroderma, which comprises the base sequence set forth in SEQ ID NO: 3 or 6.

2. A probe for specifically detecting the root-lesion nematode, which comprises the base sequence set forth in SEQ ID NO: 4 or 7.

3. A probe for specifically detecting Meloidogyne nigra, comprising the base sequence set forth in SEQ ID NO: 5 or 8.

4. A probe and primer set for specifically detecting one or more nematode species selected from the group consisting of Meloidogyne nigra, Meloidogyne serrata, and Meloidogyne nigra, comprising one or more probes (a) to (c) below and primers (1) and (2) below, which amplify a base sequence specific to one or more nematode species selected from the group consisting of Meloidogyne nigra, Meloidogyne serrata, and Meloidogyne nigra by real-time PCR. (a) a probe for specifically detecting Pratylenchus penetrovus, consisting of the nucleotide sequence set forth in SEQ ID NO: 3 or 6; (b) a probe for specifically detecting the root-lesion nematode, consisting of the nucleotide sequence set forth in SEQ ID NO: 4 or 7; (c) a probe for specifically detecting Meloidogyne nematode, consisting of the nucleotide sequence set forth in SEQ ID NO: 5 or 8; (1) a primer consisting of the nucleotide sequence set forth in SEQ ID NO: 1; (2) A primer consisting of the base sequence set forth in SEQ ID NO:

2.

5. A kit for specifically detecting one or more nematode species selected from the group consisting of Meloidogyne nematode, Meloidogyne serrata, and Meloidogyne nigra, comprising the set of probes and primers described in claim 4, by amplifying a base sequence specific to said one or more nematode species by real-time PCR.

6. A method for quantitatively detecting one or more nematode species selected from the group consisting of Pratylenchus norvegicus, Pratylenchus serrata, and Pratylenchus northern root-knot nematode, comprising a step of carrying out a real-time PCR amplification reaction of a target nucleic acid region of one or more nematode species selected from the group consisting of Pratylenchus norvegicus, Pratylenchus serrata, and Pratylenchus northern root-knot nematode using the set of probe and primers described in claim 4 or the kit described in claim 5.

7. A probe for specifically detecting Pratylenchus penicillium, which comprises the base sequence set forth in SEQ ID NO: 9 or 11.

8. A probe for specifically detecting the root-knot nematode group, comprising the base sequence of SEQ ID NO: 10 or 12, The sweet potato root-knot nematode group is a group consisting of Meloidogyne incognita, Meloidogyne arenaria Honshu type and Okinawa type, and Meloidogyne javanica, The probe.

9. A probe and primer set for specifically detecting one or more nematode species or groups selected from the group consisting of Pratylenchus norvegicus, Pratylenchus incognita, and Meloidogyne incognita, comprising one or more probes (a), (d), and (e) below and primers (1) and (2) below, by real-time PCR amplifying a base sequence specific to one or more nematode species or groups selected from the group consisting of Pratylenchus norvegicus, Pratylenchus incognita, and Meloidogyne incognita, The sweet potato root-knot nematode group is a group consisting of Meloidogyne incognita, Meloidogyne arenaria Honshu type and Okinawa type, and Meloidogyne javanica, The probe and primer set. (a) a probe for specifically detecting Pratylenchus penetrovus, consisting of the nucleotide sequence set forth in SEQ ID NO: 3 or 6; (d) a probe for specifically detecting Pratylenchus oryzae, consisting of the nucleotide sequence set forth in SEQ ID NO: 9 or 11; (e) a probe for specifically detecting the root-knot nematode group, comprising the base sequence set forth in SEQ ID NO: 10 or 12; (1) a primer consisting of the nucleotide sequence set forth in SEQ ID NO: 1; (2) A primer consisting of the base sequence set forth in SEQ ID NO:

2.

10. A kit for specifically detecting one or more nematode species or groups selected from the group consisting of the northern root-knot nematode, the southern root-knot nematode, and the sweet potato root-knot nematode group, comprising the set of probes and primers described in claim 9, by amplifying a base sequence specific to said one or more nematode species or groups by real-time PCR.

11. A method for quantitatively detecting one or more nematode species or groups selected from the group consisting of N. norvegicus, N. incognita, and the Root-knot Meloidogyne group, comprising a step of carrying out an amplification reaction of a target nucleic acid region of one or more nematode species or groups selected from the group consisting of N. norvegicus, N. incognita, and the Root-knot Meloidogyne group by real-time PCR using the probe and primer set of claim 9 or the kit of claim 10.

Citation Information

Patent Citations

  • Specific primers used for PCR detection of Meloidogyne arenria and application method thereof

    CN105821118A

  • RPA primer, kit and detection method for detecting four common root-knot nematodes

    CN108559783A

  • Primers and probe for detecting southern meloidogyne through recombinase plolymerase amplification (RPA) technology

    CN110499357A

  • Primers and probe for detecting meloidogyne incognita chitwood through real-time fluorescent quantitative polymerase chain reaction (PCR) and application

    CN113355436A

  • Oligonucleotides for detection of potato cyst nematodes

    JP2023084968A