C. novyi for the treatment of solid tumors in humans

Abstract

To provide C. novyi for treating of a solid tumor in a human.SOLUTION: The present invention provides particularly a method for treating or ameliorating the effect of a solid tumor present in a human. These methods comprise intratumorally administering the human with C. novyi colony forming unit (CFU), preferably C. novyi NT CFU unit dose, which contains about 1×103 to about 1×107 CFUs suspended in a pharmaceutically acceptable carrier or solution. The invention also provides a method for debulking a solid tumor present in a human, a method for ablating a solid tumor present in a human, a method for microscopically precise excision of tumor cells in a human, a method for treating or ameliorating the effect of a solid tumor that has metastasized to one or more sites in a human, C. novyi CFU, preferably C. novyi NT CFU unit dose, and a kit for treating or ameliorating an effect of a solid tumor present in a human.SELECTED DRAWING: None

Description

[Technical Field]

[0001] FIELD OF THE INVENTION The present invention provides, inter alia, methods for treating or ameliorating the effects of solid tumors in humans, for debulking solid tumors in humans, for microscopically precise resection of tumor cells in humans, and for ablating solid tumors in humans. Also provided are C. novyi CFU unit doses and kits.

[0002] Citation of Related Applications This invention claims priority to U.S. Provisional Application No. 61 / 806,497, filed March 29, 2013, the entire contents of which are incorporated by reference. [Background technology]

[0003] Background of the Invention Successful strategies to target and destroy human cancers recognize differences between normal and malignant tissue (Dang et al., 2001). Such differences can be seen at a molecular level, as in the case of genetic abnormalities, or more holistically, as in the case of physiological abnormalities in tumors.

[0004] Malignant solid tumors are known to typically consist of a necrotic core and a viable rim. Previous therapeutic interventions have focused on the well-vascularized tumor shell, but rarely targeted the inner, hypoxic core (Jain et al., 2001). The inner core of a tumor has unique characteristics that distinguish it from normal tissue. This core is poorly vascularized and therefore deprived of nutrients and oxygen. As a site of active cell necrosis, the lack of a functional vascular supply limits the clearance of toxic cellular debris and results in a low pH. While this environment is inhospitable to the growth of most human cells, it is fertile for the proliferation of certain anaerobic bacteria. Sixty years ago or earlier, this concept led investigators to inject Clostridium histolyticus spores into tumor-bearing animals (Parker et al., 1947). Remarkably, the bacteria germinate exclusively within the necrotic tumor core, causing tumor liquefaction. In the 1950s and 1960s, Clostridium butyricum spores were injected into patients with a variety of highly advanced solid malignancies (Mose, 1967; Mose, 1972). Although many patients had significant germination and substantial tumor destruction, their health status was very poor, the advanced stage of disease in these patients made clinical management difficult, and the lack of complete clinical response inhibited further pursuit of this approach. The successful treatment of solid tumors remains an unmet medical goal. Thus, there is a need to find treatments for solid tumors. The present invention is directed to meeting this and other needs. [Prior art documents] [Patent documents]

[0005] [Patent Document 1] DANG, LH et al., U.S. Patent No. 7,344,710 [Non-patent literature]

[0006] [Non-Patent Document 1] JAIN, RK et al., Can engineered bacteria help control cancer? Proc Natl Acad Sci USA 98, 14748-50(2001) [Non-patent document 2] PARKER, RC et al., Effect of histolyticus infection and toxin on transplantable mouse tumors. Proc. Soc. Exp. Biol. Med. 66, 461 (1947) [Non-patent document 3] MOSE, JR Clostridium Strain M55 and its effect on Malignant Tumors. in Bacteries anaerobies 1st edn (ed. Fredette, V.) 229-247 (Montreal: Institut de Microbiologie et I'Hygiene de Universite de Montreal, 1967) [Non-patent document 4] MOSE, JR Onkolyse durch Clostridien. in 3rd International Congress of Chemotherapy (ed. Thieme, G.) 1972 (Stuttgart, Germany, 1963) Summary of the Invention [Means for solving the problem]

[0007] Summary of the Invention One embodiment of the present invention is a method for treating or ameliorating the effects of a solid tumor in a human, comprising administering to the human approximately 1×10 6 cells / ml of the tumor-modifying agent suspended in a pharmaceutically acceptable carrier or solution. 3 ~Approx. 1×10 7 This involves intratumoral administration of a unit dose of C. novyi colony-forming units (CFUs) containing CFUs.

[0008] Another embodiment of the present invention is a method for debulking a solid tumor in a human, comprising administering to the human approximately 1 x 10 6 cells suspended in a pharmaceutically acceptable carrier or solution. 3 ~Approx. 1×10 7 This involves intratumoral administration of a C. novyi CFU unit dose containing CFU.

[0009] A further embodiment of the invention is a method for debulking a solid tumor in a human, the method comprising administering to the human about 1 x 10 per cycle. 4 Spore-containing C. novyi It involves intratumoral administration of unit doses of NT spores in one to four cycles, with each unit dose of C. novyi NT suspended in a pharmaceutically acceptable carrier or solution.

[0010] A further embodiment of the present invention is a method for treating or ameliorating the effects of a solid tumor in a human, the method comprising administering to the human about 1 x 10 per cycle 4 The method involves intratumoral administration of unit doses of C. novyi NT spores containing spores in one to four cycles, each unit dose of C. novyi NT spores being suspended in a pharmaceutically acceptable carrier or solution.

[0011] Another embodiment of the present invention is a method for removing a solid tumor present in a human, comprising administering to the human approximately 1 x 10 cells suspended in a pharmaceutically acceptable carrier or solution. 3 ~Approx. 1×10 7 The method comprises administering a C. novyi CFU unit dose containing CFU into the tumor, and removing the tumor leaving a margin of normal tissue.

[0012] A further embodiment of the present invention is a C. novyi CFU unit dose, which comprises about 1 x 10 CFU in a pharmaceutically acceptable carrier or solution effective to treat or ameliorate the effects of solid tumors in humans. 3 ~Approx. 1×10 7 Contains CFU.

[0013] A further embodiment of the present invention is a kit for treating or ameliorating the effects of a solid tumor in a human. The kit comprises about 1 x 10 mAb in a pharmaceutically acceptable carrier or solution. 3 ~Approx. 1×10 7 It comes with a C. novyi CFU unit dose containing CFU and instructions for use of the kit.

[0014] Another embodiment of the present invention is a method for microscopically precise excision of tumor cells in a human, the method comprising administering to the human approximately 1 x 10 cells suspended in a pharmaceutically acceptable carrier or solution. 3 ~Approx. 1×10 7 This involves intratumoral administration of a unit dose of C. novyi NT colony-forming units (CFUs) containing CFUs.

[0015] A further embodiment of the present invention is a method for treating or ameliorating the effects of a solid tumor that has metastasized to one or more sites in a human, comprising administering to the human at least about 1 x 10 6 cells / ml of the tumor suspended in a pharmaceutically acceptable carrier or solution. 3 ~Approx. 1×10 7 This involves intratumoral administration of a unit dose of C. novyi NT colony-forming units (CFUs) containing CFUs. In certain embodiments, for example, the following are provided: (Item 1) 1. A method for treating or ameliorating the effects of a solid tumor present in a human, comprising administering to said human approximately 1×10 6 cells / ml of a solid tumor suspended in a pharmaceutically acceptable carrier or solution. 3 ~Approx. 1×10 7 The method comprises intratumoral administration of a unit dose of C. novyi colony forming units (CFUs) comprising CFUs. (Item 2) Item 10. The method of item 1, wherein the solid tumor is selected from the group consisting of soft tissue sarcoma, hepatocellular carcinoma, breast cancer, pancreatic cancer and melanoma. (Item 3) 2. The method of claim 1, wherein the solid tumor is a leiomyosarcoma. (Item 4) 4. The method of item 3, wherein the solid tumor is retroperitoneal leiomyosarcoma. (Item 5) The unit dose is about 1×10 6 ~Approx. 1×10 7 The method of item 1, comprising C. novyi CFU. (Item 6) The unit dose is about 1×10 4 The method of item 1, comprising C. novyi CFU. (Item 7) 2. The method of claim 1, wherein the C. novyi CFU is selected from the group consisting of vegetative and spore forms. (Item 8) Item 2. The method of item 1, wherein the C. novyi is C. novyi NT. (Item 9) The unit dose is about 1×10 4 ~Approx. 1×10 7 9. The method of item 8, comprising C. novyi NT spores. (Item 10) The unit dose is about 1×10 6 ~Approx. 1×10 7 9. The method of item 8, comprising C. novyi NT spores. (Item 11) The unit dose is about 1×10 4 The method according to item 8, comprising C. novyi NT spores. (Item 12) 2. The method of claim 1, wherein the administering step comprises injecting the unit dose into the tumor at a single site. (Item 13) 10. The method of claim 1, wherein the administering step comprises injecting the unit dose into the tumor at multiple unique locations. (Item 14) 2. The method of claim 1, wherein the administering step comprises injecting the unit dose into the tumor at 1 to 5 unique sites. (Item 15) 2. The method of claim 1, wherein the administering step comprises injecting the unit dose into the tumor at five or more unique sites. (Item 16) 10. The method of claim 1, further comprising administering multiple treatment cycles to the human, each treatment cycle comprising injecting one unit dose of the C. novyi CFU into the solid tumor. (Item 17) 17. The method of item 16, wherein 1 to 10 treatment cycles are administered. (Item 18) 17. The method of item 16, wherein 2 to 4 treatment cycles are administered. (Item 19) Item 17. The method according to item 16, wherein the interval between each treatment cycle is about 5 to about 100 days. (Item 20) 17. The method of item 16, wherein the interval between each treatment cycle is about 7 days. (Item 21) 10. The method of claim 9, further comprising administering an IV infusion to the human before, during, and / or after each dose of the C. novyi NT spores. (Item 22) 10. The method of claim 9, further comprising administering multiple treatment cycles to the human, each treatment cycle comprising injecting one unit dose of the C. novyi NT spores into the solid tumor. (Item 23) 23. The method of item 22, wherein 2 to 4 treatment cycles are administered. (Item 24) 10. The method of claim 1, further comprising administering an IV infusion to the human before, during and / or after each dose of the C. novyi. (Item 25) 10. The method of claim 1, further comprising administering to the human a first course of antibiotics for a duration and in a dosage effective to treat or alleviate adverse side effects caused by the C. novyi. (Item 26) 26. The method of claim 25, wherein the antibiotic is administered for two weeks after administration of C. novyi. (Item 27) 26. The method of claim 25, wherein the antibiotic is selected from the group consisting of amoxicillin, clavulanate, metronidazole, and combinations thereof. (Item 28) 26. The method of claim 25, further comprising administering to the human a second course of antibiotics for a duration and in a dosage effective to treat or alleviate adverse side effects caused by the C. novyi. (Item 29) 29. The method according to item 28, wherein the second course of antibiotics is initiated after completion of the first course of antibiotics and is administered for 1 to 6 months. (Item 30) 29. The method of claim 28, wherein the second course of antibiotics is initiated after the first course of antibiotics has ended and is administered for three months. (Item 31) 29. The method of item 28, wherein the antibiotic used in the second course is doxycycline. (Item 32) 2. The method of claim 1, further comprising administering to said human a treatment selected from the group consisting of chemotherapy, radiation therapy, immunotherapy, and combinations thereof. (Item 33) 33. The method of claim 32, wherein the immunotherapy comprises administering to the human an immune checkpoint inhibitor. (Item 34) Item 10. The method of item 1, wherein the solid tumor is resistant to a treatment selected from the group consisting of chemotherapy, radiation therapy, immunotherapy, and combinations thereof. (Item 35) 33. The method of claim 32, wherein the chemotherapy comprises administering to the human an agent selected from the group consisting of antimetabolites, microtubule inhibitors, DNA damaging agents, antibiotics, anti-angiogenic agents, vascular disrupting agents, molecular targeted agents, and combinations thereof. (Item 36) 33. The method of item 32, wherein the chemotherapy comprises administering to the human an agent selected from the group consisting of gemcitabine, taxol, adriamycin, ifosfamide, trabectedin, pazopanib, abraxane, avastin, everolimus, and combinations thereof. (Item 37) 2. The method of item 1, wherein the solid tumor is refractory to standard treatment or there is no standard treatment available for the solid tumor. (Item 38) 2. The method of item 1, wherein the method induces a strong local inflammatory and adaptive immune response in the human. (Item 39) 1. A method for microscopically precise excision of human tumor cells, comprising administering to said human approximately 1×10 6 cells suspended in a pharmaceutically acceptable carrier or solution. 3 ~Approx. 1×10 7 A method comprising intratumoral administration of a unit dose of C. novyi NT colony forming units (CFUs) comprising CFUs. (Item 40) 1. A method for treating or ameliorating the effects of a solid tumor that has metastasized to one or more sites in a human, comprising administering to said human at least about 1 x 10 cells / ml of tumor cells suspended in a pharmaceutically acceptable carrier or solution. 3 ~Approx. 1×10 7 A method comprising intratumoral administration of a unit dose of C. novyi NT colony forming units (CFUs) comprising CFUs. (Item 41) 41. The method of claim 40, wherein at least one site is distal to the original solid tumor. (Item 42) 1. A method for debulking a solid tumor present in a human, comprising administering to said human approximately 1×10 6 cells suspended in a pharmaceutically acceptable carrier or solution. 3 ~Approx. 1×10 7 The method comprises administering intratumorally a unit dose of C. novyi CFUs comprising the CFUs. (Item 43) 43. The method of claim 42, wherein the solid tumor is selected from the group consisting of soft tissue sarcoma, hepatocellular carcinoma, breast cancer, pancreatic cancer, and melanoma. (Item 44) 1. A method for debulking a solid tumor present in a human, comprising administering to the human about 1×10 per cycle. 4A method comprising intratumoral administration of one to four cycles of unit doses of C. novyi NT spores, each unit dose of C. novyi NT spores being suspended in a pharmaceutically acceptable carrier or solution. (Item 45) 1. A method for treating or ameliorating the effects of a solid tumor in a human, comprising administering to the human about 1×10 per cycle 4 The method comprises intratumoral administration of one to four cycles of unit doses of C. novyi NT spores containing spores, wherein each unit dose of C. novyi NT spores is suspended in a pharmaceutically acceptable carrier or solution. (Item 46) 1. A method for removing a solid tumor present in a human, comprising administering to said human approximately 1×10 6 cells suspended in a pharmaceutically acceptable carrier or solution. 3 ~Approx. 1×10 7 2. A method comprising administering intratumorally a unit dose of C. novyi CFUs containing CFUs, wherein the tumor is removed leaving a margin of normal tissue. (Item 47) 47. The method of claim 46, wherein the tumor is a sarcoma. (Item 48) about 1 x 10 in a pharmaceutically acceptable carrier or solution effective in treating or ameliorating the effects of solid tumors present in humans 3 ~Approx. 1×10 7 C. novyi CFU unit dose containing CFU. (Item 49) 49. The unit dose of item 48, wherein the C. novyi CFU is selected from the group consisting of vegetative and spore forms. (Item 50) 49. The unit dose of item 48, wherein the C. novyi is C. novyi NT. (Item 51) The unit dose is about 1 x 10 in a pharmaceutically acceptable carrier or solution. 4 ~Approx. 1×10 7 51. The unit dose according to item 50, comprising C. novyi NT spores. (Item 52) The unit dose is about 1 x 10 in a pharmaceutically acceptable carrier or solution. 6 ~Approx. 1×10 7 51. The unit dose according to item 50, comprising C. novyi NT spores. (Item 53) The unit dose is about 1 x 10 in a pharmaceutically acceptable carrier or solution. 4 51. The unit dose according to item 50, comprising C. novyi NT spores. (Item 54) A kit for treating or ameliorating the effects of a solid tumor in a human, comprising: 3 ~Approx. 1×10 7 A kit comprising a C. novyi CFU unit dose containing CFUs and instructions for use of said kit. (Item 55) 55. The kit of item 54, further comprising one or more antibiotics effective in treating or alleviating adverse side effects caused by the C. novyi CFU. (Item 56) 55. The kit of item 54, wherein the C. novyi CFU is selected from the group consisting of vegetative and spore forms. (Item 57) Item 55. The kit according to item 54, wherein the C. novyi is C. novyi NT. (Item 58) The unit dose is about 1 x 10 in a pharmaceutically acceptable carrier or solution. 4 ~Approx. 1×10 7 58. The kit of item 57, comprising C. novyi NT spores. (Item 59) The unit dose is about 1 x 10 in a pharmaceutically acceptable carrier or solution. 6 ~Approx. 1×10 7 58. The kit dose of item 57, comprising C. novyi NT spores. (Item 60) The unit dose is about 1 x 10 in a pharmaceutically acceptable carrier or solution. 458. The unit dose of item 57 containing C. novyi NT spores. (Item 61) 55. The kit of item 54, further comprising 1 to 4 unit doses of the C. novyi for performing 1 to 4 treatment cycles. (Item 62) 59. The kit of item 58, further comprising 1 to 4 unit doses of the C. novyi NT spores for 1 to 4 treatment cycles. [Brief explanation of the drawings]

[0016] [Figure 1A] Figures 1A-B show various images of canine osteosarcomas in the distal right radius / ulna of test subjects "Sasha" (Figure 1A) and "Sampson" (Figure 1B) after radiation treatment and intravenous (IV) injection of C. novyi NT. [Figure 1B] Figures 1A-B show various images of canine osteosarcomas in the distal right radius / ulna of test subjects "Sasha" (Figure 1A) and "Sampson" (Figure 1B) after radiation treatment and intravenous (IV) injection of C. novyi NT.

[0017] [Figure 2A] Figure 2A shows Kaplan-Meier curves showing survival in F433 Fisher rats after orthotopic implantation of a syngeneic glioma cell line (F98). Outer line: C. novyi-NT spores injected intratumorally 12–15 days after tumor implantation. Inner line: control. [Figure 2B] Figure 2B shows bioluminescence (Xenogen imaging system) after orthotopic implantation of the F98 glioma cell line in three representative F433 Fisher rats. Images were acquired on day 0 (pretreatment - day of C. novyi-NT spore injection), day 1 after IT injection of C. novyi-NT spores, and day 2 after IT injection of C. novyi-NT spores. [Figure 2C] Figure 2C shows luciferase activity (counts in millions) on day 0 (pretreatment), day 1 after IT injection of C. novyi-NT spores, and day 2 after IT injection of C. novyi-NT spores.

[0018] [Figure 3A] Figures 3A-B show germinating C. novyi-NT bacteria within brain tumor lesions under a microscope. In these figures, Gram staining revealed vegetative C. novyi-NT bacteria (white or black arrows) localized in the tumor (T) and stellate microinvasions (S), but not in normal brain tissue (Br). Figure 3A shows a 100x magnification of the tumor-normal brain boundary. Figure 3B shows a 400x magnification of the tumor-normal brain boundary. [Figure 3B] Figures 3A-B show germinating C. novyi-NT bacteria within brain tumor lesions under a microscope. In these figures, Gram staining revealed vegetative C. novyi-NT bacteria (white or black arrows) localized in the tumor (T) and stellate microinvasions (S), but not in normal brain tissue (Br). Figure 3A shows a 100x magnification of the tumor-normal brain boundary. Figure 3B shows a 400x magnification of the tumor-normal brain boundary. [Figure 4A] Figures 4A-B show germinating C. novyi-NT bacteria within brain tumor lesions under a microscope. In these figures, Gram staining revealed vegetative C. novyi-NT bacteria (white or black arrows) localized in the tumor (T) and stellate microinvasions (S), but not in normal brain tissue (Br). Figure 4A is a 100x magnification showing the borders of the stellate microinvasion in normal brain, tumor, and neoplastic tissue. Figure 4B is a 400x magnification showing C. novyi-NT germination in the stellate microinvasion lesion. [Figure 4B] Figures 4A-B show germinating C. novyi-NT bacteria within brain tumor lesions under a microscope. In these figures, Gram staining revealed vegetative C. novyi-NT bacteria (white or black arrows) localized in the tumor (T) and stellate microinvasions (S), but not in normal brain tissue (Br). Figure 4A is a 100x magnification showing the borders of the stellate microinvasion in normal brain, tumor, and neoplastic tissue. Figure 4B is a 400x magnification showing C. novyi-NT germination in the stellate microinvasion lesion.

[0019] [Figure 5-1] FIG. 5 is a table of summary data for the sequenced samples. [Figure 5-2] FIG. 5 is a table of summary data for the sequenced samples.

[0020] [Figure 6] FIG. 6 is a table of copy number alterations in canine sarcomas.

[0021] [Figure 7A] Figures 7A-F show photographic and CT images of dog 11-R01 demonstrating a partial response to C. novyi-NT therapy. Images range from pretreatment to 70 days after the first IT dose of C. novyi-NT spores. Figure 7A shows a pretreatment image of a peripheral nerve sheath tumor. Figure 7B shows abscess formation limited to the tumor on study day 3. Figure 7C shows debridement of the lesion after spontaneous abscess rupture and secretion of necrotic purulent material, which allowed for secondary healing. Figure 7D shows that the wound was completely healed by study day 70, with a 77.6% reduction in the maximum diameter of the tumor. Figure 7E shows a pretreatment CT image taken 4 days before the first treatment, showing the extent of the tumor (circled) at the intersection of the pinna and skull. Figure 7F shows a posttreatment CT image on study day 10 demonstrating near-complete tumor debulking. [Figure 7B]Figures 7A-F show photographic and CT images of dog 11-R01 demonstrating a partial response to C. novyi-NT therapy. Images range from pretreatment to 70 days after the first IT dose of C. novyi-NT spores. Figure 7A shows a pretreatment image of a peripheral nerve sheath tumor. Figure 7B shows abscess formation limited to the tumor on study day 3. Figure 7C shows debridement of the lesion after spontaneous abscess rupture and secretion of necrotic purulent material, which allowed for secondary healing. Figure 7D shows that the wound was completely healed by study day 70, with a 77.6% reduction in the maximum diameter of the tumor. Figure 7E shows a pretreatment CT image taken 4 days before the first treatment, showing the extent of the tumor (circled) at the intersection of the pinna and skull. Figure 7F shows a posttreatment CT image on study day 10 demonstrating near-complete tumor debulking. [Figure 7C] Figures 7A-F show photographic and CT images of dog 11-R01 demonstrating a partial response to C. novyi-NT therapy. Images range from pretreatment to 70 days after the first IT dose of C. novyi-NT spores. Figure 7A shows a pretreatment image of a peripheral nerve sheath tumor. Figure 7B shows abscess formation limited to the tumor on study day 3. Figure 7C shows debridement of the lesion after spontaneous abscess rupture and secretion of necrotic purulent material, which allowed for secondary healing. Figure 7D shows that the wound was completely healed by study day 70, with a 77.6% reduction in the maximum diameter of the tumor. Figure 7E shows a pretreatment CT image taken 4 days before the first treatment, showing the extent of the tumor (circled) at the intersection of the pinna and skull. Figure 7F shows a posttreatment CT image on study day 10 demonstrating near-complete tumor debulking. [Figure 7D]Figures 7A-F show photographic and CT images of dog 11-R01 demonstrating a partial response to C. novyi-NT therapy. Images range from pretreatment to 70 days after the first IT dose of C. novyi-NT spores. Figure 7A shows a pretreatment image of a peripheral nerve sheath tumor. Figure 7B shows abscess formation limited to the tumor on study day 3. Figure 7C shows debridement of the lesion after spontaneous abscess rupture and secretion of necrotic purulent material, which allowed for secondary healing. Figure 7D shows that the wound was completely healed by study day 70, with a 77.6% reduction in the maximum diameter of the tumor. Figure 7E shows a pretreatment CT image taken 4 days before the first treatment, showing the extent of the tumor (circled) at the intersection of the pinna and skull. Figure 7F shows a posttreatment CT image on study day 10 demonstrating near-complete tumor debulking. [Figure 7E] Figures 7A-F show photographic and CT images of dog 11-R01 demonstrating a partial response to C. novyi-NT therapy. Images range from pretreatment to 70 days after the first IT dose of C. novyi-NT spores. Figure 7A shows a pretreatment image of a peripheral nerve sheath tumor. Figure 7B shows abscess formation limited to the tumor on study day 3. Figure 7C shows debridement of the lesion after spontaneous abscess rupture and secretion of necrotic purulent material, which allowed for secondary healing. Figure 7D shows that the wound was completely healed by study day 70, with a 77.6% reduction in the maximum diameter of the tumor. Figure 7E shows a pretreatment CT image taken 4 days before the first treatment, showing the extent of the tumor (circled) at the intersection of the pinna and skull. Figure 7F shows a posttreatment CT image on study day 10 demonstrating near-complete tumor debulking. [Figure 7F]Figures 7A-F show photographic and CT images of dog 11-R01 demonstrating a partial response to C. novyi-NT therapy. Images range from pretreatment to 70 days after the first IT dose of C. novyi-NT spores. Figure 7A shows a pretreatment image of a peripheral nerve sheath tumor. Figure 7B shows abscess formation limited to the tumor on study day 3. Figure 7C shows debridement of the lesion after spontaneous abscess rupture and secretion of necrotic purulent material, which allowed for secondary healing. Figure 7D shows that the wound was completely healed by study day 70, with a 77.6% reduction in the maximum diameter of the tumor. Figure 7E shows a pretreatment CT image taken 4 days before the first treatment, showing the extent of the tumor (circled) at the intersection of the pinna and skull. Figure 7F shows a posttreatment CT image on study day 10 demonstrating near-complete tumor debulking.

[0022] [Figure 8A] Figures 8A-D show photographic and CT images of dog 04-R03 demonstrating a complete response to C. novyi-NT therapy. Images range from pretreatment to day 60 after the first IT dose of C. novyi-NT spores. Figure 8A shows a pretreatment image of the soft tissue sarcoma. Figure 8B shows a tumor-localized abscess that formed on study day 15, one day after the third dose of C. novyi-NT spores. Figure 8C shows that tumor debulking was complete by study day 27, with healthy granulation tissue forming. Figure 8D shows that the wound had completely healed by study day 60, with no residual tumor (complete response). Figure 8E shows a pretreatment CT image taken 5 days before the first treatment, showing the extent of the tumor (circled) on the forearm. Figure 8F shows a posttreatment CT image on study day 62, demonstrating complete disappearance of the tumor mass. [Figure 8B]Figures 8A-D show photographic and CT images of dog 04-R03 demonstrating a complete response to C. novyi-NT therapy. Images range from pretreatment to day 60 after the first IT dose of C. novyi-NT spores. Figure 8A shows a pretreatment image of the soft tissue sarcoma. Figure 8B shows a tumor-localized abscess that formed on study day 15, one day after the third dose of C. novyi-NT spores. Figure 8C shows that tumor debulking was complete by study day 27, with healthy granulation tissue forming. Figure 8D shows that the wound had completely healed by study day 60, with no residual tumor (complete response). Figure 8E shows a pretreatment CT image taken 5 days before the first treatment, showing the extent of the tumor (circled) on the forearm. Figure 8F shows a posttreatment CT image on study day 62, demonstrating complete disappearance of the tumor mass. [Figure 8C] Figures 8A-D show photographic and CT images of dog 04-R03 demonstrating a complete response to C. novyi-NT therapy. Images range from pretreatment to day 60 after the first IT dose of C. novyi-NT spores. Figure 8A shows a pretreatment image of the soft tissue sarcoma. Figure 8B shows a tumor-localized abscess that formed on study day 15, one day after the third dose of C. novyi-NT spores. Figure 8C shows that tumor debulking was complete by study day 27, with healthy granulation tissue forming. Figure 8D shows that the wound had completely healed by study day 60, with no residual tumor (complete response). Figure 8E shows a pretreatment CT image taken 5 days before the first treatment, showing the extent of the tumor (circled) on the forearm. Figure 8F shows a posttreatment CT image on study day 62, demonstrating complete disappearance of the tumor mass. [Figure 8D]Figures 8A-D show photographic and CT images of dog 04-R03 demonstrating a complete response to C. novyi-NT therapy. Images range from pretreatment to day 60 after the first IT dose of C. novyi-NT spores. Figure 8A shows a pretreatment image of the soft tissue sarcoma. Figure 8B shows a tumor-localized abscess that formed on study day 15, one day after the third dose of C. novyi-NT spores. Figure 8C shows that tumor debulking was complete by study day 27, with healthy granulation tissue forming. Figure 8D shows that the wound had completely healed by study day 60, with no residual tumor (complete response). Figure 8E shows a pretreatment CT image taken 5 days before the first treatment, showing the extent of the tumor (circled) on the forearm. Figure 8F shows a posttreatment CT image on study day 62, demonstrating complete disappearance of the tumor mass. [Figure 8E] Figures 8A-D show photographic and CT images of dog 04-R03 demonstrating a complete response to C. novyi-NT therapy. Images range from pretreatment to day 60 after the first IT dose of C. novyi-NT spores. Figure 8A shows a pretreatment image of the soft tissue sarcoma. Figure 8B shows a tumor-localized abscess that formed on study day 15, one day after the third dose of C. novyi-NT spores. Figure 8C shows that tumor debulking was complete by study day 27, with healthy granulation tissue forming. Figure 8D shows that the wound had completely healed by study day 60, with no residual tumor (complete response). Figure 8E shows a pretreatment CT image taken 5 days before the first treatment, showing the extent of the tumor (circled) on the forearm. Figure 8F shows a posttreatment CT image on study day 62, demonstrating complete disappearance of the tumor mass. [Figure 8F]Figures 8A-D show photographic and CT images of dog 04-R03 demonstrating a complete response to C. novyi-NT therapy. Images range from pretreatment to day 60 after the first IT dose of C. novyi-NT spores. Figure 8A shows a pretreatment image of the soft tissue sarcoma. Figure 8B shows a tumor-localized abscess that formed on study day 15, one day after the third dose of C. novyi-NT spores. Figure 8C shows that tumor debulking was complete by study day 27, with healthy granulation tissue forming. Figure 8D shows that the wound had completely healed by study day 60, with no residual tumor (complete response). Figure 8E shows a pretreatment CT image taken 5 days before the first treatment, showing the extent of the tumor (circled) on the forearm. Figure 8F shows a posttreatment CT image on study day 62, demonstrating complete disappearance of the tumor mass.

[0023] [Figure 9] FIG. 9 shows tumor size in dog 11-R01 from the first IT dose of C. novyi NT spores to the end of the clinical course.

[0024] [Figure 10A] Figure 10A shows photographic images (upper panel) and CT images (lower panel) of a canine soft tissue sarcoma from test subject "Drake" (04-R01) after IT administration of C. novyi NT spores. The circled area in the CT image indicates the tumor location. [Figure 10B] FIG. 10B shows Drake's tumor size from the first IT dose of C. novyi NT through three subsequent doses to the end of his clinical course.

[0025] [Figure 11] FIG. 11 shows tumor size in dog 04-R03 from the first IT dose of C. novyi NT spores through two subsequent cycles to the end of the clinical course.

[0026] [Figure 12A]Figure 12A shows tumor size in eight study subjects (11-R02, 04-R02, 26-R01, 16-R02, 04-R05, 16-R03, 11-R04, and 04-R06) during the clinical course of four cycles of IT C. novyi NT spores. [Figure 12B] Figure 12B shows tumor size for three study subjects (04-R08, 01-R02, and 10-R02) for whom data were unavailable for the entire clinical course due to required amputation or data cutoffs.

[0027] [Figure 13] FIG. 13 shows the injection scheme for tumors treated in the IT study disclosed in Examples 6 and 7.

[0028] [Figure 14A] Figures 14A-D show CT and MRI images of a human patient. Figure 14A shows a post-treatment CT with contrast on day 3 showing evidence of intramedullary and extramedullary air collections. The tumor is highlighted by an arrow. [Figure 14B] Figures 14A-D show CT and MRI images of a human patient. Figure 14B shows a pre-treatment MRI (T1 with gadolinium contrast) of the right upper arm showing mass enhancement with soft tissue and possibly adjacent bone. The tumor is highlighted by an arrow. [Figure 14C] Figures 14A-D show CT and MRI images of a human patient. Figure 14C shows a post-treatment MRI on day 4 showing reduced tumor mass enhancement compared to baseline. The tumor is highlighted by an arrow. [Figure 14D] Figures 14A-D show CT and MRI images of a human patient. Figure 14D shows a post-treatment MRI on day 29 showing a homogeneous, non-enhancing mass consistent with continuing necrosis. The tumor is highlighted by an arrow.

[0029] [Figure 15A]Figures 15A-D show extensive tumor necrosis in a human patient treated with C. novyi-NT spores. Figures 15A and 15B show 40x (A) and 100x (B) magnifications, respectively, of a pre-treatment tumor biopsy of viable tumor (leiomyosarcoma) cells. [Figure 15B] Figures 15A-D show extensive tumor necrosis in a human patient treated with C. novyi-NT spores. Figures 15A and 15B show 40x (A) and 100x (B) magnifications, respectively, of a pre-treatment tumor biopsy of viable tumor (leiomyosarcoma) cells. [Figure 15C] Figures 15A-D show extensive tumor necrosis in a human patient treated with C. novyi-NT spores. Figures 15C and 15D show 40x (A) and 100x (B) magnifications, respectively, of a post-treatment tumor biopsy 4 days after IT injection of C. novyi-NT spores showing extensive necrosis of tumor cells. [Figure 15D] Figures 15A-D show extensive tumor necrosis in a human patient treated with C. novyi-NT spores. Figures 15C and 15D show 40x (A) and 100x (B) magnifications, respectively, of a post-treatment tumor biopsy 4 days after IT injection of C. novyi-NT spores showing extensive necrosis of tumor cells.

[0030] [Figure 16A] Figures 16A-D show various aspects of the IT injection procedure using a tripolar needle. Figure 16A shows a photograph of a tripolar needle. [Figure 16B] Figures 16A-D show various aspects of the IT injection procedure using a tripolar needle, and Figures 16B and 16C show computed tomography (CT) images of the target injection area before and after needle insertion. [Figure 16C] Figures 16A-D show various aspects of the IT injection procedure using a tripolar needle, and Figures 16B and 16C show computed tomography (CT) images of the target injection area before and after needle insertion. [Figure 16D] Figures 16A-D show various aspects of an IT injection procedure using a tripolar needle. Figure 16A shows a photograph of the tripolar needle. Figure 16D shows a magnified image of the three prongs of the needle. [Figure 16E] FIG. 16E shows a CT image with overlaid measurements to determine the needle insertion point. DETAILED DESCRIPTION OF THE INVENTION

[0031] Detailed Description of the Invention One embodiment of the present invention is a method for treating or ameliorating the effects of a solid tumor in a human, comprising administering to the human approximately 1×10 6 cells / ml of the tumor-modifying agent suspended in a pharmaceutically acceptable carrier or solution. 3 ~Approx. 1×10 7 This involves intratumoral administration of a unit dose of C. novyi colony-forming units (CFUs) containing CFUs.

[0032] As used herein, the terms "treat," "treating," "treatment," and grammatical variations thereof refer to subjecting an individual subject (e.g., a human patient) to a protocol, regimen, method, or remedial action, where it is desired to obtain a physiological response or outcome in the subject, e.g., patient. In particular, the methods and compositions of the present invention can be used to delay the onset of disease symptoms, or to delay the onset of a disease or condition, or to halt the progression of disease pathology. However, treatment does not require that the desired physiological response or outcome be obtained in every single subject or subject, e.g., patient, population, because not every subject treated will respond to a particular treatment protocol, regimen, method, or remedial action. Thus, a given subject or subject, e.g., patient, population, may not respond to treatment or may respond inadequately to treatment.

[0033] As used herein, the terms "ameliorate," "ameliorating," and grammatical variations thereof, refer to a decrease in the severity of symptoms of a disease in a subject.

[0034] As used herein, "solid tumor" refers to an abnormal mass of cell growth. Solid tumors can occur anywhere in the body. Solid tumors can be cancerous (malignant) or non-cancerous (benign). Examples of solid tumors according to the present invention include adrenocortical carcinoma, anal tumor / cancer, bladder tumor / cancer, bone tumor / cancer (such as osteosarcoma), brain tumor, breast tumor / cancer, carcinoid tumor, cancer, cervical tumor / cancer, colon tumor / cancer, endometrial tumor / cancer, esophageal tumor / cancer, extrahepatic bile duct tumor / cancer, Ewing's sarcoma family of tumors, extracranial germ cell tumor, eye tumor / cancer, gallbladder tumor / cancer, stomach tumor / cancer, germ cell tumor, gestational trophoblastic tumor, head and neck tumor / cancer, hypopharyngeal tumor / cancer, islet cell carcinoma, kidney tumor / cancer, laryngeal tumor / cancer, leiomyosarcoma, leukemia, lip and oral cavity tumor / cancer, liver tumor / cancer (such as hepatocellular carcinoma), lung tumor / cancer, lymphoma, malignant mesothelioma, Merkel cell carcinoma, mycosis fungoides, myelodysplastic syndrome, myeloproliferative disorder, These include nasopharyngeal tumors / cancers, neuroblastoma, oral cavity tumors / cancers, oropharyngeal tumors / cancers, osteosarcoma, ovarian epithelial tumors / cancers, ovarian germ cell tumors, pancreatic tumors / cancers, paranasal sinus and nasal cavity tumors / cancers, parathyroid tumors / cancers, penile tumors / cancers, pituitary tumors / cancers, plasma cell neoplasms, prostate tumors / cancers, rhabdomyosarcoma, rectal tumors / cancers, renal cell tumors / cancers, transitional cell tumors / cancers of the renal pelvis and ureter, salivary gland tumors / cancers, Sézary syndrome, skin tumors (such as cutaneous T-cell lymphoma, Kaposi's sarcoma, mast cell tumors, and melanoma), small intestine tumors / cancers, soft tissue sarcomas, gastric tumors / cancers, testicular tumors / cancers, thymoma, thyroid tumors / cancers, urethral tumors / cancers, uterine tumors / cancers, vaginal tumors / cancers, vulvar tumors / cancers, and Wilms' tumor. Preferably, the solid tumor is selected from the group consisting of soft tissue sarcoma, hepatocellular carcinoma, breast cancer, pancreatic cancer and melanoma. More preferably, the solid tumor is a leiomyosarcoma, such as a retroperitoneal leiomyosarcoma.

[0035] As used herein, "unit dose" means the amount of medication administered to a subject, e.g., a human, in a single dose.

[0036] As used herein, "C. novyi" refers to a bacterium belonging to or derived from the species Clostridium novyi. Clostridium novyi is commercially available, for example, from ATCC (#19402) and is a Gram-positive anaerobic bacterium. Bacteria derived from Clostridium novyi can be generated, for example, by screening for clones with specific characteristics of natural Clostridium novyi. Preferred C. novyi bacteria are non-toxic or minimally toxic to subjects (such as mammals, e.g., humans). For example, a preferred C. novyi, C. novyi NT, is a bacterium derived from natural Clostridium novyi that has lost its single systemic toxin (α-toxin) gene, for example, by a genetic engineering process or selection procedure. C. novyi NT can be generated, for example, using the procedures disclosed in Dang et al., 2001 and U.S. Patent No. 7,344,710. Thus, the present invention encompasses C. novyi as well as C. novyi NT bacteria.

[0037] Pharmacokinetic studies have shown that C. novyi NT spores, when injected intravenously, are rapidly cleared from the circulation (greater than 99% of spores are cleared within 1 hour) and sequestered within the reticuloendothelial system. Long-term distribution studies have revealed that the spores are eventually excreted from all tissues within 1 year. When delivered in spore form (dormant phase), C. novyi NT germinates (transition from spore to vegetative state) upon exposure to hypoxic regions of tumors. Therefore, the toxicity of C. novyi NT is predicted to be greater in tumor-bearing patients than in healthy patients.

[0038] In healthy mice and rabbits, intravenous injection of C. novyi NT did not produce overt clinical signs of toxicity (morbidity, mortality, or clinical symptoms) regardless of treatment dose. However, tissue examination at necropsy revealed both macroscopic and microscopic inflammatory changes that appeared to be treatment dose-dependent. These findings, primarily in the liver, spleen, and adrenal glands, were observed at 5 × 10 8 spores / kg or higher. Healthy animals receiving the low dose showed no gross or microscopic abnormalities at necropsy. In animals receiving the high dose, resolution of inflammation was already evident by day 28, and all signs of inflammation were absent in all animals by 1 year after administration. To examine whether C. novyi NT spores can germinate in nontumor-hypoxic tissue, aged mice with atherosclerotic plaques and experimental myocardial infarction were treated with C. novyi NT in studies. There was no evidence of spore localization or germination within these vascular lesions. At the end of the study, these mice showed no clinical or pathological abnormalities (other than pre-existing cardiovascular lesions). These studies demonstrated that C. novyi NT does not cause overt clinical toxicity in healthy animals and that pathological toxicity is minimal.

[0039] Intravenous (IV) injection of spores into immunocompetent tumor-bearing mice results in tumor lysis and a strong inflammatory response. One of three outcomes is typically observed in mice: a subset (25–35%) of mice are cured (no tumor recurrence after 1 year of observation) and develop long-term immunity to the original tumor (Agrawal et al., 2004). Another subset (65–75%) shows a complete clinical response but relapses with regrowth of the original tumor. Finally, the remaining subset (0–20%, depending on the experiment) experiences tumor destruction but develops significant clinical toxicity within 2–5 days of initiating treatment. Relatively simple measures, such as rehydration, are sufficient to reduce this toxicity, and in many cases, these signs resolve completely. Studies in larger animals (rabbits) show similar cure and recurrence rates with C. novyi NT therapy but lack the life-threatening clinical toxicity observed in the mouse subset. Treatment-related deaths were observed in tumor-bearing mice but not in rabbits treated with C. novyi NT spores (Diaz et al., 2005). In this study, toxicity was related to both spore dose and tumor size. No specific laboratory or pathological end-organ damage was noted in moribund mice; the only significant finding was hepatosplenomegaly. Healed mice occasionally had remnants of inflammatory changes in the liver and spleen but were otherwise not different from untreated animals. Studies such as this demonstrate that toxicity in tumor-bearing animals can be significant (death) in mice with large tumors but is minimal in larger animals (rabbits) and can be managed in mice with hydration or antibiotics.

[0040] C. novyi NT spores (1 × 10 ) injected intravenously as a single agent into tumor-bearing dogs 9 Spores / m 2 Previous studies using ) did not result in life-threatening toxicity. Dogs were maintained on fluid therapy (2-4 ml / kg / h) for several days after treatment, which may have reduced toxicity. Unfortunately, there was no measurable tumor response to treatment.

[0041] As used herein, "colony forming unit" ("CFU") refers to a viable form of bacteria that produces a bacterial aggregate (or colony). Such viable forms include vegetative and spore forms, and the present invention encompasses both forms used separately and in combination. Colony forming unit assays are known in the art. See, e.g., Breed et al., 1916. Media are commercially available to support the growth of C. novyi, such as Reinforced Clostridial Medium (RCM) from Difco (BD, Franklin Lakes, NJ). As noted above, a unit dose is approximately 1 x 10 3 ~Approx. 1×10 7 , for example, about 1 × 10 3 ~Approx. 1×10 4 , about 1×10 4 ~Approx. 1×10 5 , about 1×10 5 ~Approx. 1×10 6 or about 1 x 10 6 ~Approx. 1×10 7 Contains C. novyi CFU.

[0042] In one aspect of this embodiment, the unit dose is about 1 x 10 6 ~Approx. 1×10 7 In another aspect of this embodiment, the unit dose comprises about 1 x 10 CFU of C. novyi. 4 Surprisingly, the doses disclosed herein for human treatment are unexpectedly lower than what might be predicted by simple extrapolation from our non-rodent models, which used one-sixth the maximum non-rodent dose (HNSTD) typical of starting treatment doses for oncology indications. See, e.g., Senderowicz, AM, "Information needed to conduct first-in human oncology trials in the United States: a view from a former FDA See medical reviewer.” Clin. Cane. Res., 2010, 16:1719-25.

[0043] Preferably, in the present invention, C. novyi is C. novyi NT.

[0044] In another aspect of this embodiment, the unit dose is about 1 x 10 6 ~Approx. 1×10 7 In a further aspect of this embodiment, the unit dose comprises about 1 x 10 C. novyi NT spores. 4 Contains C. novyi NT spores.

[0045] In a further aspect of this embodiment, the administering step comprises injecting the unit dose into the tumor at a single site. In another aspect of this embodiment, the administering step comprises injecting the unit dose into the tumor at multiple unique sites, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 unique sites. Preferably, the administering step comprises injecting the unit dose into the tumor at 1 to 5 unique sites, e.g., in the configuration shown in FIG. 13. In another preferred embodiment, the administering step comprises injecting the unit dose into the tumor at 5 or more unique sites. Multiple site injections may be performed as disclosed herein, preferably using a multi-tined needle, e.g., Quadra-Fuse® (Rex-Medical, Conshohocken, PA). In the present invention, the administering step comprises direct injection into the tumor, as described above, although other methods for administering an active agent, e.g., C. novyi or C. novyi NT, to a tumor are also contemplated. Such methods include implantation, transdermal delivery and transmucosal delivery.

[0046] In another aspect of this embodiment, the method further comprises administering to the human multiple treatment cycles, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, or more than 30 cycles, each treatment cycle comprising injecting one unit dose of C. novyi CFU, e.g., one unit dose of C. novyi NT spores, into the solid tumor. Preferably, 1 to 10 treatment cycles are administered. More preferably, 2 to 4 treatment cycles are administered. The interval between each treatment cycle can vary. In a preferred embodiment, the interval between each treatment cycle is about 5 to about 100 days. In another preferred embodiment, the interval between each treatment cycle is about 7 days.

[0047] In a further aspect of this embodiment, the method further comprises administering an intravenous (IV) fluid to the human before, during, and / or after each dose of C. novyi CFU, e.g., C. novyi NT spores. IV fluids for hydrating patients are disclosed herein and are well known in the art. Such fluids can be fluids that are isotonic with blood, such as 0.9% sodium chloride solution or lactated Ringer's solution.

[0048] In another aspect of this embodiment, the method further includes administering to the human a first course of antibiotics for a duration and in an amount effective to treat or alleviate adverse side effects caused by C. novyi CFU, e.g., C. novyi NT spores. In the present invention, adverse side effects (or adverse events, which are used interchangeably with adverse side effects) can include, but are not limited to, infections (such as those caused by open wounds), vomiting, bloody stools, and fever.

[0049] In a preferred embodiment, the antibiotic is administered for two weeks after administration of C. novyi. Non-limiting examples of such antibiotics include amoxicillin, clavulanate, metronidazole, and combinations thereof.

[0050] In another preferred embodiment, the method further comprises administering a second course of antibiotics to the human for a duration and in an amount effective to treat or alleviate adverse side effects caused by C. novyi. The second course of antibiotics can be initiated after the first course of antibiotics has ended and lasts for 1 to 6 months, e.g., 3 months. Preferably, the antibiotic used in the second course is doxycycline, although any antibiotic approved by a medical professional can be used.

[0051] In a further aspect of this embodiment, the method further comprises using a co-treatment protocol, e.g., by administering to the human a therapy selected from the group consisting of chemotherapy, radiation therapy, immunotherapy, and combinations thereof.

[0052] The C. novyi, e.g., C. novyi NT spores, and the anti-cancer drug(s) used in the co-treatment therapy can be administered to the human at the same time or at different times, as determined by the physician as most appropriate. When the C. novyi, e.g., C. novyi NT spores, and the other anti-cancer drug(s) are administered at different times, e.g., by sequential administration, the C. novyi, e.g., C. novyi NT spores, can be administered to the human before the other anti-cancer drug(s). Alternatively, the other anti-cancer drug(s) can be administered to the human before the C. novyi, e.g., C. novyi NT spores.

[0053] As used herein, "chemotherapy" refers to any therapeutic regimen that is compatible with treatment with the C. novyi of the present invention, e.g., C. novyi NT, and that uses cytotoxic and / or cytostatic agents against cancer cells or cells associated with or supporting cancer cells. In a preferred embodiment, chemotherapy comprises administering to the human an agent selected from the group consisting of antimetabolites, microtubule inhibitors, DNA damaging agents, antibiotics, antiangiogenic agents, vascular disrupting agents, molecular targeted agents, and combinations thereof.

[0054] As used herein, an "anti-metabolite" is a substance that reduces or inhibits cellular use of a chemical that is part of normal metabolism. Non-limiting examples of antimetabolites or analogs thereof according to the present invention include antifolates, purine inhibitors, pyrimidine inhibitors, and combinations thereof.

[0055] As used herein, an "antifolate" is a substance that alters, reduces, or inhibits cellular use of folic acid (vitamin B9). Non-limiting examples of antifolates include methotrexate (DuraMed Pharmaceuticals, Inc.), pemetrexed (Eli Lilly), pralatrexate (Spectrum Pharmaceuticals), aminopterin (Sigma Aldrich), pharmaceutically acceptable salts thereof, and combinations thereof.

[0056] As used herein, a "purine" is a compound containing a condensation product of a six-membered nitrogen-containing ring and a five-membered nitrogen-containing ring. Non-limiting examples of purines important to intracellular metabolism include adenine, guanine, hypoxanthine, and xanthine. A "purine inhibitor" is a substance that alters, reduces, or prevents the production or use of purines by cells. Non-limiting examples of purine inhibitors include methotrexate (DuraMed Pharmaceuticals, Inc.), pemetrexed (Eli Lilly), hydroxyurea (Bristol-Myers Squibb), 2-mercaptopurine (Sigma-Aldrich), 6-mercaptopurine (Sigma-Aldrich), fludarabine (Ben Venue Laboratories), clofarabine (Genzyme Corp.), nelarabine (GlaxoSmithKline), pralatrexate (Spectrum Pharmaceuticals), 6-thioguanine (Gate Pharmaceuticals), forodesine (BioCryst Pharmaceuticals), pentostatin (Bedford Laboratories), sapacitabine (Cyclacel Pharmaceuticals, Inc.), aminopterin (Sigma Aldrich), azathioprine (GlaxoSmithKline), pharmaceutically acceptable salts thereof, and combinations thereof.

[0057] As used herein, a "pyrimidine" is a compound containing a six-membered, nitrogen-containing ring. Non-limiting examples of pyrimidines important in intracellular metabolism include uracil, thymine, cytosine, and orotic acid. A "pyrimidine inhibitor" is a substance that alters, reduces, or prevents the production or use of pyrimidines by cells. Non-limiting examples of pyrimidine inhibitors include 5-fluorouracil (Tocris Bioscience), tegafur (LGM Pharma), capecitabine (Xeloda) (Roche), cladribine (LGM Pharma), gemcitabine (Eli Lilly), cytarabine (Bedford Laboratories), decitabine (Eisai Inc.), floxuridine (Bedford Laboratories), 5-azacytidine (Pharmion Pharmaceuticals), doxifluridine (Cayman Pharmaceutically acceptable salts and combinations thereof include acetaminophen (Santa Cruz Biotechnology, Inc.), thiarabine (Access Pharmaceuticals), troxacitabine (SGX Pharmaceuticals), raltitrexed (AstraZeneca), carmofur (Santa Cruz Biotechnology, Inc.), 6-azauracil (MP Biomedicals, LLC), pharmaceutically acceptable salts thereof, and combinations thereof.

[0058] In a preferred embodiment of the invention, the antimetabolite is 5-fluorouracil (Tocris Bioscience), tegafur (LGM Pharma), capecitabine (Xeloda) (Roche), cladribine (LGM Pharma), methotrexate (DuraMed Pharmaceuticals, Inc.), pemetrexed (Eli Lilly), hydroxyurea (Bristol-Myers Squibb), 2-mercaptopurine (Sigma-Aldrich), 6-mercaptopurine (Sigma-Aldrich), fludarabine (Ben Venue Laboratories), gemcitabine (Eli Lilly), clofarabine (Genzyme Corp.), cytarabine (Bedford Laboratories), decitabine (Eisai Inc.), floxuridine (Bedford Laboratories), nelarabine (GlaxoSmithKline), pralatrexate (Spectrum Pharmaceuticals), 6-thioguanine (Gate Pharmaceuticals), 5-azacytidine (Pharmion Pharmaceuticals), doxifluridine (Cayman Chemicals), forodesine (BioCryst Pharmaceuticals), pentostatin (Bedford Laboratories), sapacitabine (Cyclacel Pharmaceuticals, Inc.), thiarabine (Access Pharmaceuticals), troxacitabine (SGX Pharmaceuticals), raltitrexed (AstraZeneca), aminopterin (Sigma Aldrich), carmofur (Santa Cruz Biotechnology, Inc.), azathioprine (GlaxoSmithKline), 6-azauracil (MP Biomedicals, LLC), pharmaceutically acceptable salts thereof, and combinations thereof.

[0059] As used herein, a "microtubule inhibitor" is a substance that disrupts the function of microtubules, such as the polymerization or depolymerization of individual microtubule units. In one aspect of the present invention, the microtubule inhibitor may be selected from the group consisting of microtubule destabilizers, microtubule stabilizers, and combinations thereof. The microtubule inhibitor of the present invention may also be selected from the group consisting of taxanes, vinca alkaloids, epothilones, and combinations thereof.Non-limiting examples of microtubule inhibitors according to the present invention include BT-062 (Biotest), HMN-214 (D. Western Therapeutics), eribulin mesylate (Eisai), vindesine (Eli Lilly), EC-1069 (Endocyte), EC-1456 (Endocyte), EC-531 (Endocyte), vintafolide (Endocyte), 2-methoxyestradiol (EntreMed), GTx-230 (GTx), trastuzumab emtansine (Hoffmann-La Roche), crolibulin (Immune Pharmaceuticals, D1302A-maytansinoid conjugate (ImmunoGen), IMGN-529 (ImmunoGen), lorvotuzumab mertansine (ImmunoGen), SAR-3419 (ImmunoGen), SAR-566658 (ImmunoGen), IMP-03138 (Impact Therapeutics), topotecan / vincristine combination (LipoCure), BPH-8 (Molecular Discovery Systems), fosbretabulin tromethamine (OXiGENE), estramustine phosphate sodium (Pfizer), vincristine (Pierre Fabre), vinflunine (Pierre Fabre), vinorelbine (Pierre Fabre), RX-21101 (Rexahn), cabazitaxel (Sanofi), STA-9584 (Synta Pharmaceuticals), vinblastine, epothilone A, patupilone (Novartis), ixabepilone (Bristol-Myers Squibb), epothilone D (Kosan Biosciences), paclitaxel (Bristol-Myers Squibb), docetaxel (Sanofi-Aventis), HAI Abraxane, DJ-927 (Daiichi Sankyo), discodermolide (CAS number: 127943-53-7), eleutherobin (CAS number: 174545-76-7), pharmaceutically acceptable salts thereof, and combinations thereof.

[0060] DNA damaging agents of the present invention include, but are not limited to, alkylating agents, platinum-based agents, intercalating agents, and DNA replication inhibitors.

[0061] As used herein, an "alkylating agent" refers to a compound that attaches one or more alkyl groups (C n H m, where n and m are integers). In the present invention, the alkylating agent is selected from the group consisting of nitrogen mustards, nitrosoureas, alkylsulfonates, triazines, ethyleneimines, and combinations thereof. Non-limiting examples of nitrogen mustards include mechlorethamine (Lundbeck), chlorambucil (GlaxoSmithKline), cyclophosphamide (Mead Johnson Co.), bendamustine (Astellas), ifosfamide (Baxter International), melphalan (Ligand), melphalan flufenamide (Oncopeptides), and pharmaceutically acceptable salts thereof. Non-limiting examples of nitrosoureas include streptozocin (Teva), carmustine (Eisai), lomustine (Sanofi), and pharmaceutically acceptable salts thereof. Non-limiting examples of alkylsulfonates include busulfan (Jazz Pharmaceuticals) and pharmaceutically acceptable salts thereof. Non-limiting examples of triazines include dacarbazine (Bayer), temozolomide (Cancer Research Technology), and pharmaceutically acceptable salts thereof. Non-limiting examples of ethyleneimines include thiotepa (Bedford Laboratories), altretamine (MGI Pharma), and pharmaceutically acceptable salts thereof.Other alkylating agents include ProLindac (Access), Ac-225 BC-8 (Actinium Pharmaceuticals), ALF-2111 (Alfact Innovation), trofosfamide (Baxter International), MDX-1203 (Bristol-Myers Squibb), thioureidobutyronitrile (CellCeutix), mitobronitol (Chinoin), mitolactol (Chinoin), nimustine (Daiichi Sankyo), glufosfamide (Eleison Pharmaceuticals), HuMax-TAC ​​and PBD ADC combination (Genmab), BP-C1 (Meabco), treosulfan (Medac), nifurtimox (Metronomx), improsulfan tosilate (Mitsubishi Tanabe Pharma), ranimustine (Mitsubishi Tanabe Pharma), ND-01 (NanoCarrier), and HH-1 (Nordic Nanovector), a combination of 22P1G cells and ifosfamide (Nuvilex), estramustine phosphate (Pfizer), prednimustine (Pfizer), lurbinectedin (PharmaMar), trabectedin (PharmaMar), altreatamine (Sanofi), SGN-CD33A (Seattle Genetics), fotemustine (Servier), nedaplatin (Shionogi), heptaplatin (Sk Holdings), apaziquone (Spectrum Pharmaceuticals), SG-2000 (Spirogen), TLK-58747 (Telik), laromustine (Vion Pharmaceuticals), procarbazine (Alkem Laboratories Ltd.), and pharmaceutically acceptable salts thereof.

[0062] As used herein, "platinum-based agents" are anti-cancer agents including metallic platinum and analogs of such agents. Platinum can be in any oxidation state. Platinum-based agents of the present invention include, but are not limited to, 1,2-diaminocyclohexane (DACH) derivatives, phenanthroimidazole Pt(II) complexes, platinum IV compounds, binuclear and trinuclear platinum compounds, demethylcantharidin-integrated platinum complexes, platinum conjugate compounds, cisplatin nanoparticles and polymeric micelles, sterically hindered platinum complexes, oxaliplatin (Debiopharm), satraplatin (Johnson Matthey), BBR3464 (Novuspharma SpA), ZD0473 (Astra Zeneca), cisplatin (Nippon Kayaku), JM-11 (Johnson Matthey), PAD (cis-dichlorobiscyclopentylamineplatinum(II)), MBA ((trans-1,2-diaminocyclohexane)bisbromoacetatoplatinum(II)), PHM ((1,2-cyclohexanediamine)malonatoplatinum(II)), SHP ((1,2-cyclohexanediamine)sulfatoplatinum(II)), neo-PHM ((trans-R,R-1,2-cyclohexanediamine)malonatoplatinum(II)), neo-SHP ((trans-R,R-1,2-cyclohexanediamine)sulfatoplatinum(II)), JM-82 (Johnson Matthey), PYP ((1,2-cyclohexanediamine)bispyruvatoplatinum(II)), PHIC ((1,2-cyclohexanediamine)isocitratoplatinum(II)), TRK-710 ((trans-R,R-1,2-cyclohexanediamine)[3-acetyl-5-methyl-2,4(3H,5H)-furandionato]platinum(II)), BOP ((1,2-cyclooctanediamine)bisbromoacetatoplatinum(II)), JM-40 (Johnson Matthey), enloplatin (UnionPharma), zeniplatin (LGM Pharma), Cl-973 (Parke-Davis), lobaplatin (Zentaris AG / Hainan Tianwang International Pharmaceutical), cycloplatin (LGM Pharma), WA2114R (miboplatin / lobaplatin) (Chembest Research Laboratories, Ltd.), heptaplatin (SKI2053R) (SK Chemicals), TNO-6 (spiroplatin) (Haihang Industry Co., Ltd.), ormaplatin (tetraplatin) (LGM Pharma), JM-9 (iproplatin) (Johnson Matthey), BBR3610 (Novuspharma SpA), BBR3005 (Novuspharma SpA), BBR3571 (Novuspharma SpA), BBR3537 (Novuspharma SpA), aroplatin (L-NDDP) (BOC Sciences), Pt-ACRAMTU ({[Pt(en)CI(ACRAMTU-S)](NO3)2 (en = ethane-1,2-diamine, ACRAMTU = 1-[2-(acridin-9-ylamino)ethyl]-1,3-dimethylthiourea)}), cisplatin-loaded liposomes (LiPlasomes), SPI-077 (Alza), lipoplatin (Regulon), lipoxal (Regulon), carboplatin (Johnson Matthey), nedaplatin (Shionogi Seiyaku), miriplatin hydrate (Dainippon Sumitomo Pharma), ormaplatin (LGM Pharma), enloplatin (Lederle Laboratories), CI973 (Parke-Davis), PEGylated cisplatin, PEGylated carboplatin, PEGylated oxaliplatin, transplatin (trans-diamminedichloroplatinum(II); mixed Z:trans-[PtCI2{Z-HN=C(OMe)Me}(NH3)]), CD-37 (estradiol-platinum(II) hybrid molecule), picoplatin (Poniard Pharmaceuticals), [ka] AH44 (Komeda et al., 2006; Harris et al., 2005; Qu et al., 2004), Triplatin NC (Harris et al., 2005; Qu et al., 2004), ProLindac (Access), pharmaceutically acceptable salts thereof, and combinations thereof.

[0063] As used herein, "intercalating agents" include, but are not limited to, doxorubicin (Adriamycin), daunorubicin, idarubicin, mitoxantrone, pharmaceutically acceptable salts thereof, prodrugs and combinations thereof.

[0064] Non-limiting examples of DNA replication inhibitors include, but are not limited to, topoisomerase inhibitors. As used herein, a "topoisomerase inhibitor" is a substance that reduces the expression or activity of a topoisomerase. The topoisomerase inhibitor according to the present invention can inhibit topoisomerase I, topoisomerase II, or both topoisomerase I and topoisomerase II. Non-limiting examples of topoisomerase I inhibitors according to the present invention include irinotecan (Alchemia), APH-0804 (Aphios), camptothecin (Aphios), cositecan (BioNumerik), topotecan (GlaxoSmithKline), belotecan hydrochloride (Chon Kun Dang), firtecan pegol (Enzon), HN-30181A (Hanmi), hRS7-SN-38 (Immunomedics), labetuzumab-SN-38 (Immunomedics), etirinotecan pegol (Nektar Therapeutics), NK-012 (Nippon Kayaku), SER-203 (Serina Therapeutics), simmitecan hydrochloride prodrug (Shanghai HaiHe Pharmaceuticals, gimatecan (Sigma-Tau), namitecan (Sigma-Tau), SN-38 (Supratek Pharma), TLC-388 hydrochloride (Taiwan Liposome Company), lamellarin D (PharmaMar), pharmaceutically acceptable salts thereof, and combinations thereof. Non-limiting examples of topoisomerase II inhibitors according to the present invention include Adva-27a (Advanomics), zoptarelin, doxorubicin (Aeterna Zentaris), valrubicin (Anthra Pharmaceuticals), razoxane (AstraZeneca), doxorubicin (Avena Therapeutics), amsacrine (Bristol-Myers Squibb), etoposide phosphate (Bristol-Myers Squibb), etoposide (Novartis), dexrazoxane (Cancer Research Technology), cytarabine / daunorubicin combination (Celator Pharmaceuticals), CAP7.1 (CellAct Pharma), aldoxorubicin (CytRx), amrubicin hydrochloride (Sumitomo Dainippon Pharma), vosaroxin (Sumitomo Dainippon Pharma), daunorubicin (Gilead Sciences), milatuzumab / doxorubicin combination (Immunomedics), aclarubicin (Kyowa Hakko Kirin), mitoxantrone (Meda), pirarubicin (Meiji), epirubicin (Pfizer), teniposide (Novartis), F-14512 (Pierre Fabre), elliptinium acetate (Sanofi), zorubicin (Sanofi), dexrazoxane (TopoTarget), sobuzoxane (Zenyaku Kogyo), idarubicin (Pfizer), HU-331 (Cayman Chemical), aurintricarboxylic acid (Sigma Aldrich), pharmaceutically acceptable salts thereof, and combinations thereof.

[0065] Chemotherapeutic antibiotics according to the present invention include, but are not limited to, actinomycin, anthracyclines, valrubicin, epirubicin, bleomycin, plicamycin, mitomycin, pharmaceutically acceptable salts, prodrugs and combinations thereof.

[0066] As used herein, the term "anti-angiogenic agent" refers to any compound that inhibits or delays the formation of new blood vessels from pre-existing blood vessels. Examples of anti-angiogenic agents in the present invention include, but are not limited to, pegaptanib, ranibizumab, bevacizumab (avastin), carboxyamidotriazole, TNP-470, CM101, IFN-α, IL-12, platelet factor 4, suramin, SU5416, thrombospondin, VEGFR antagonists, angiostatic steroids and heparin, cartilage-derived angiogenesis inhibitor, matrix metalloproteinase inhibitors, angiostatin, endostatin, 2-methoxyestradiol, tecogalan, prolactin, α v The antiangiogenic agent includes β3 inhibitors, linomide, VEGF-Trap, aminosterols, cortisone, tyrosine kinase inhibitors, antiangiogenic siRNA, inhibitors of the complement system, vascular disrupting agents, and combinations thereof. Preferably, the antiangiogenic agent is bevacizumab.

[0067] VEGFR antagonists of the present invention include, but are not limited to, pazopanib, regorafenib, lenvatinib, sorafenib, sunitinib, axitinib, vandetanib, cabozantinib, vatalanib, semaxanib, ZD6474, SU6668, AG-013736, AZD2171, AEE788, MF1 / MC-18F1, DC101 / IMC-1C11, ramucirumab, and motesanib.VEGFR antagonists can also include VEGF inhibitors, such as bevacizumab, aflibercept, 2C3, r84, VEGF-Trap, and ranibizumab.

[0068] The angiogenic inhibitory steroids of the present invention include any steroid that inhibits, attenuates, suppresses angiogenesis or neovascularization, or causes regression of pathological angiogenesis. The angiogenic inhibitory steroids of the present invention include those disclosed in European Patent Application EP1236471A2, as well as the 20-substituted steroids disclosed in U.S. Patent No. 4,599,331, the 21-hydroxy steroids disclosed in U.S. Patent No. 4,771,042, the C-substituted steroids disclosed in International Patent Application WO1987 / 02672, and the 22-substituted steroids disclosed in U.S. Patent No. 4,771,042.11 Functionalized steroids, 6α-fluoro-17α,21-dihydroxy-16α-methylpregna-4,9(11)-diene-3,20-dione 21-acetate, 6α-fluoro-17α,21-dihydroxy-16β-methylpregna-4,9(11)-diene-3,20-dione, 6α-fluoro-17α,21-dihydroxy-16β-methylpregna-4,9(11)-diene-3,20-dione 21-phosphonooxy and pharmaceutically acceptable salts thereof, hydrocortisone, tetrahydrocortisol, 17α-hydroxy-progesterone and Δ9(11)-ethianate (all disclosed in International Patent Application WO 1990 / 015816 A1).

[0069] Cartilage-derived angiogenesis inhibitors include, but are not limited to, the peptides troponin and chondromodulin I.

[0070] Matrix metalloproteinase inhibitors of the present invention include, but are not limited to, succinyl hydroxamates such as marimastat and SC903, hydroxamic acid sulfonamides such as CGS27023A, hydroxamic acid phosphinamides, carboxylate inhibitors such as BAY12-9566, thiol inhibitors such as Compound B, aminomethylbenzimidazole analogs, peptides such as regasepin, and tetracyclines such as minocycline.

[0071] α v β3 inhibitors include, but are not limited to, IS20I, P11 peptide, EMD 85189, and 66203, RGD peptides, RGD mimetics such as S 36578-2, echistatin, αv These include antibodies or antibody fragments against β3 integrins such as Vitaxin (which targets the extracellular domain of the dimer), Cilengitide as well as peptidomimetics such as S247.

[0072] Anti-angiogenic siRNA includes but is not limited to the siRNA that targets the mRNA that is upregulated during angiogenesis, the siRNA that targets VEGF or VEGFR mRNA and the siRNA that targets UPR (unfolded protein response)-IRE1α, XBP-1 and ATF6 mRNA.In addition, the siRNA that is at least 21 nucleotides in length has been shown to suppress angiogenesis regardless of targeting sequence (Kleinman et al., 2008), and can be included in the anti-angiogenic siRNA of the present invention.

[0073] Inhibitors of the complement system include, but are not limited to, modified native complement components, such as soluble complement receptor type 1, soluble complement receptor type 1 lacking the long homologous repeat-A, and soluble complement receptor type 1-Sialyl Lewis. x , complement receptor type 2, soluble decay-accelerating factor, soluble membrane cofactor protein, soluble CD59, decay-accelerating factor-CD59 hybrid, membrane cofactor protein-decay-accelerating factor hybrid, C1 inhibitor, and C1q receptor, complement-inhibitory antibodies such as anti-C5 monoclonal antibodies and anti-C5 single-chain Fv, synthetic inhibitors of complement activation such as antagonistic peptides and analogs targeting the C5a receptor, and naturally occurring compounds that block complement activation, such as heparin and related glycosaminoglycan compounds. Additional inhibitors of the complement system are disclosed in Makrides (Makrides, 1998).

[0074] As used herein, the term "vascular disrupting agent" refers to any compound that targets existing vasculature, such as tumor vasculature, damages or destroys the vasculature, and / or causes tumor central necrosis. In the present invention, examples of vascular disrupting agents include, but are not limited to, ABT-751 (Abbott), AVE8062 (Aventis), BCN105 (Bionomics), BMXAA (Antisoma), CA-4-P (OxiGene), CA-1-P (OxiGene), CYT997 (Cytopia), MPC-6827 (Myriad Pharmaceuticals), MN-029 (MediciNova), NPI-2358 (Nereus), Oxi4503 (Oxigene), TZT-1027 (Daichi Pharmaceuticals), ZD6126 (AstraZeneca and Angiogene), their pharmaceutically acceptable salts, and combinations thereof.

[0075] As used herein, a "molecularly targeted agent" refers to a substance that, when administered to a subject, interferes with the function of a single molecule or group of molecules, preferably those involved in tumor growth and progression. Non-limiting examples of molecularly targeted agents of the present invention include signal transduction inhibitors, regulators of gene expression and other cellular functions, immune system modulators, antibody-drug conjugates (ADCs), and combinations thereof.

[0076] As used herein, a "signal transduction inhibitor" is a substance that disrupts cell-cell communication upon activation of a cell surface receptor, for example, by an extracellular signaling molecule. Non-limiting examples of signal transduction inhibitors of the present invention include anaplastic lymphoma kinase (ALK) inhibitors, B-Raf inhibitors, epidermal growth factor inhibitors (EGFRi), ERK inhibitors, Janus kinase inhibitors, MEK inhibitors, mammalian target of rapamycin (mTor) inhibitors, phosphoinositide 3-kinase inhibitors (PI3Ki), and Ras inhibitors.

[0077] As used herein, an "anaplastic lymphoma kinase (ALK) inhibitor" refers to a substance that (i) directly interacts with ALK, for example, by binding to ALK, and (ii) reduces the expression or activity of ALK. Non-limiting examples of anaplastic lymphoma kinase (ALK) inhibitors of the present invention include crizotinib (Pfizer, New York, NY), CH5424802 (Chugai Pharmaceutical Co., Ltd., Tokyo, Japan), GSK1838705 (GlaxoSmithKline, United Kingdom), Chugai 13d (Chugai Pharmaceutical Co., Ltd., Tokyo, Japan), CEP28122 (Teva Pharmaceutical Industries, Ltd., Israel), AP26113 (Ariad Pharmaceuticals, Cambridge, MA), Cephalon 30 (Teva Pharmaceutical Industries, Ltd., Israel), X-396 (Xcovery, Inc., West Palm Beach, FL), Amgen 36 (Amgen Pharmaceuticals, Thousand Oaks, CA), ASP3026 (Astellas Pharma US, Inc., Northbrook, Illinois), and Amgen 49 (Amgen Pharmaceuticals, Thousand Oaks, CA), pharmaceutically acceptable salts thereof, and combinations thereof.

[0078] As used herein, a "B-Raf inhibitor" of the present invention is a substance that (i) directly interacts with B-Raf, for example, by binding to B-Raf, and (ii) reduces the expression or activity of B-Raf. B-Raf inhibitors can be classified into two types depending on their binding mode. As used herein, a "type 1" B-Raf inhibitor is an inhibitor that targets the ATP-binding site of the kinase in its active conformation. A "type 2" B-Raf inhibitor is an inhibitor that preferentially binds to the inactive conformation of the kinase. Non-limiting examples of type 1 B-Raf inhibitors of the present invention include: [ka] [ka] Dabrafenib (GlaxoSmithKline), GDC-0879 (Genentech), L-779450 B-Raf (Merck), PLX3202 (Plexxikon), PLX4720 (Plexxikon), SB-590885 (GlaxoSmithKline), SB-699393 (GlaxoSmithKline), vemurafenib (Plexxikon), its pharmaceutically acceptable salts and combinations thereof.Preferably, the type 1 RAF inhibitor is dabrafenib or its pharmaceutically acceptable salts.

[0079] Non-limiting examples of type 2 B-Raf inhibitors of the present invention include: [ka] [ka] [ka] [ka] [ka] [ka] These include sorafenib (Onyx Pharmaceuticals), ZM-336372 (AstraZeneca), pharmaceutically acceptable salts thereof, and combinations thereof.

[0080] Other B-Raf inhibitors include, but are not limited to, AAL881 (Novartis); AB-024 (Ambit Biosciences), ARQ-736 (ArQule), ARQ-761 (ArQule), AZ628 (Axon Medchem BV), BeiGene-283 (BeiGene), BIIB-024 (MLN 2480) (Sunesis & Takeda), B-Raf inhibitors (Sareum), BRAF kinase inhibitors (Selexagen Therapeutics), BRAF siRNA 313 (tacaccagcaagctagatgca) and 253 (cctatcgttagagtcttcctg) (Liu et al., 2007), CTT239065 (Institute of Cancer Research), DP-4978 (Deciphera Pharmaceuticals), HM-95573 (Hanmi), GW 5074 (Sigma Aldrich), ISIS 5132 (Novartis), LErafAON (NeoPharm, Inc.), LBT613 (Novartis), LGX 818 (Novartis), pazopanib (GlaxoSmithKline), PLX5568 (Plexxikon), RAF-265 (Novartis), RAF-365 (Novartis), regorafenib (Bayer Healthcare Pharmaceuticals, Inc.), RO 5126766 (Hoffmann-La Roche), TAK 632 (Takeda), TL-241 (Teligene), XL-281 (Exelixis), pharmaceutically acceptable salts thereof, and combinations thereof.

[0081] As used herein, an "EGFR inhibitor" is a substance that (i) directly interacts with EGFR, for example, by binding to EGFR, and (ii) reduces the expression or activity of EGFR. Non-limiting examples of EGFR inhibitors according to the present invention include (+)-Aeroplysinin-1 (CAS No. 28656-91-9), 3-(4-isopropylbenzylidenyl)-indolin-2-one, ABT-806 (Life Science Pharmaceuticals), AC-480 (Bristol-Myers Squibb), afatinib (Boehringer Ingelheim), AG 1478 (CAS No. 153436-53-4), AG 494 (CAS No. 133550-35-3), AG 555 (CAS No. 133550-34-2), AG 556 (CAS No. 133550-41-1), AG 825 (CAS No. 149092-50-2), AG-490 (CAS No. 134036-52-5), antroquinonol (Golden Biotechnology), AP-26113 (Ariad), ARRY334543 (CAS No. 845272-21-1), and AST. 1306 (CAS number 897383-62-9), AVL-301 (Celgene), AZD8931 (CAS number 848942-61-0), BIBU 1361 (CAS number 793726-84-8), BIBX 1382 (CAS number 196612-93-8), BMS-690514 (Bristol-Myers Squibb), BPIQ-I (CAS number 174709-30-9), canertinib (Pfizer), cetuximab (Actavis), sipatinib (Jiangsu Hengrui Medicine), CL-387,785 (Santa Cruz Biotech), compound 56 (CAS number 171745-13-4), CTX-023 (CytomX Therapeutics), CUDC-101 (Curis), dacomitinib (Pfizer), DAPH (CAS number 145915-58-8), daphnetin (Santa Cruz Biotech), dovitinib lactate (Novartis), EGFR inhibitors (CAS number 879127-07-8), epitinib (Hutchison China MediTech), erbstatin analogues (CAS number 63177-57-1), erlotinib (Astellas), gefitinib (AstraZeneca), GT-MAB 5.2-GEX (Glycotope), GW 583340 (CAS No. 388082-81-3), GW2974 (CAS No. 202272-68-2), HDS 029 (CAS No. 881001-19-0), hypericin (Santa Cruz Biotech), icotinib hydrochloride (Betapharma), JNJ-26483327 (Johnson & Johnson), JNJ-28871063 (Johnson & Johnson), KD-020 (Kadmon Pharmaceuticals), lapatinib ditosylate (GlaxoSmithKline), lavendustin A (Sigma), lavendustin C (Sigma), LY-3016859 (Eli Lilly), MEHD-7945A (Hoffmann-La Roche), MM-151 (Merrimack), MT-062 (Medisyn Technologies), necitumumab (Eli Lilly), neratinib (Pfizer), nimotuzumab (Center of Molecular Immunology), NT-004 (NewGen Therapeutics), panitumumab (Amgen), PD 153035 (CAS number 153436-54-5), PD 161570 (CAS number 192705-80-9), PD 168393, PD. 174265 (CAS No. 216163-53-0), pyrotinib (Sihuan Pharmaceutical), poziotinib (Hanmi), PP 3 (CAS No. 5334-30-5), PR-610 (Proacta), pyrotinib (Jiangsu Hengrui Medicine), RG-13022 (CAS No. 136831-48-6), rindopepimut (Celldex Therapeutics), RPI-1 (CAS No. 269730-03-2), S-222611 (Shionogi), TAK 285 (CAS No. 871026-44-7), TAS-2913 (Taiho), teliatinib (Hutchison China) MediTech), Tyrphostin 47 (RG-50864, ​​AG-213) (CAS No. 118409-60-2), Tyrphostin 51 (CAS No. 122520-90-5), Tyrphostin AG 1478 (CAS No. 175178-82-2), Tyrphostin AG 183 (CAS No. 126433-07-6), Tyrphostin AG 528 (CAS No. 133550-49-9), Tyrphostin AG 99 (CAS No. 118409-59-9), Tyrphostin B42 (Santa Cruz Biotech), Tyrphostin B44 (Santa Cruz Biotech), Tyrphostin RG 14620 (CAS No. 136831-49-7), vandetanib (AstraZeneca), varlitinib (Array BioPharma), vatalanib (Novartis), WZ 3146 (CAS No. 1214265-56-1), WZ 4002 (CAS No. 1213269-23-8), WZ8040 (CAS No. 1214265-57-2), XL-647 (Exelixis), Z-650 (HEC Pharm), ZM 323881 (CAS No. 324077-30-7), pharmaceutically acceptable salts thereof, and combinations thereof. Preferably, the EGFR inhibitor is selected from the group consisting of panitumumab, erlotinib, pharmaceutically acceptable salts thereof, and combinations thereof.

[0082] As used herein, an "ERK inhibitor" refers to a substance that (i) directly interacts with ERK, such as ERK1 and ERK2, for example, by binding to ERK, and (ii) reduces the expression or activity of ERK protein kinase. Therefore, inhibitors that act upstream of ERK, such as MEK inhibitors and RAF inhibitors, are not ERK inhibitors according to the present invention. Non-limiting examples of ERK inhibitors of the present invention include AEZS-131 (Aeterna Zentaris), AEZS-136 (Aeterna Zentaris), SCH-722984 (Merck & Co.), SCH-772984 (Merck & Co.), SCH-900353 (MK-8353) (Merck & Co.), pharmaceutically acceptable salts thereof, and combinations thereof.

[0083] As used herein, a "Janus kinase inhibitor" is a substance that (i) directly interacts with a Janus kinase, for example, by binding to the Janus kinase, and (ii) reduces the expression or activity of the Janus kinase. Janus kinases of the present invention include Tyk2, Jak1, Jak2, and Jak3. Non-limiting examples of Janus kinase inhibitors of the present invention include ruxolitinib (Incyte Corporation, Wilmington, DE), baricitinib (Incyte Corporation, Wilmington, DE), tofacitinib (Pfizer, New York, NY), VX-509 (Vertex Pharmaceuticals, Inc., Boston, MA), GLPG0634 (Galapagos NV, Belgium), CEP-33779 (Teva Pharmaceuticals, Israel), pharmaceutically acceptable salts thereof, and combinations thereof.

[0084] As used herein, a "MEK inhibitor" refers to a substance that (i) directly interacts with MEK, for example, by binding to MEK, and (ii) reduces the expression or activity of MEK. Therefore, inhibitors that act upstream of MEK, such as RAS inhibitors and RAF inhibitors, are not MEK inhibitors according to the present invention. MEK inhibitors can be classified into two types depending on whether they compete with ATP. As used herein, a "type 1" MEK inhibitor is an inhibitor that competes with ATP for binding to MEK. A "type 2" MEK inhibitor is an inhibitor that does not compete with ATP for binding to MEK. Non-limiting examples of type 1 MEK inhibitors according to the present invention include bentamapimod (Merck KGaA), L783277 (Merck), RO092210 (Roche), pharmaceutically acceptable salts thereof, and combinations thereof. Preferably, the type 1 MEK inhibitor is RO092210 (Roche) or a pharmaceutically acceptable salt thereof. Non-limiting examples of type 2 MEK inhibitors according to the present invention include anthrax toxin, the lethal factor portion of anthrax toxin, ARRY-142886 (6-(4-bromo-2-chloro-phenylamino)-7-fluoro-3-methyl-3H-benzimidazole-5-carboxylic acid (2-hydroxy-ethoxy)-amide) (Array BioPharma), ARRY-438162 (Array BioPharma), AS-1940477 (Astellas), MEK162 (Array BioPharma), PD 098059 (2-(2'-amino-3'-methoxyphenyl)-oxanaphthalen-4-one), PD 184352 (CI-1040), PD-0325901 (Pfizer), pimasertib (Santhera Pharmaceuticals), refametinib (AstraZeneca), selumetinib (AZD6244) (AstraZeneca), TAK-733 (Takeda), trametinib (Japan Tobacco), U0126 (1,4-diamino-2,3-dicyano-1,4-bis(2-aminophenylthio)butadiene) (Sigma), RDEA119 (Ardea Biosciences / Bayer), pharmaceutically acceptable salts thereof, and combinations thereof. Preferably, the type 2 MEK inhibitor is trametinib or a pharmaceutically acceptable salt thereof. Other MEK inhibitors include, but are not limited to, antroquinonol (Golden Biotechnology), AS-1940477 (Astellas), AS-703988 (Merck KGaA), BI-847325 (Boehringer Ingelheim), E-6201 (Eisai), GDC-0623 (Hoffmann-La Roche), GDC-0973, RG422, RO4987655, RO5126766, SL327, WX-554 (Wilex), YopJ polypeptides, pharmaceutically acceptable salts thereof, and combinations thereof.

[0085] As used herein, an "mTOR inhibitor" is a substance that (i) interacts directly with mTOR, for example, by binding to mTOR, and (ii) reduces the expression or activity of mTOR. Non-limiting examples of mTOR inhibitors according to the present invention include zotarolimus (AbbVie), umirolimus (Biosensors), temsirolimus (Pfizer), sirolimus (Pfizer), sirolimus NanoCrystal (Elan Pharmaceutical Technologies), sirolimus TransDerm (TransDerm), sirolimus-PNP (Samyang), everolimus (Novartis), Biolimus A9 (Biosensors), ridaforolimus (Ariad), rapamycin, TCD-10023 (Terumo), DE-109 (MacuSight), MS-R001 (MacuSight), MS-R002 (MacuSight), MS-R003 (MacuSight), Perceiva (MacuSight), XL-765 (Exelixis), quinacrine (Cleveland) BioLabs), PKI-587 (Pfizer), PF-04691502 (Pfizer), GDC-0980 (Genentech and Piramed), dactolisib (Novartis), CC-223 (Celgene), PWT-33597 (Pathway Therapeutics), P-7170 (Piramal Life Sciences), LY-3023414 (Eli Lilly), INK-128 (Takeda), GDC-0084 (Genentech), DS-7423 (Daiichi Sankyo), DS-3078 (Daiichi Sankyo), CC-115 (Celgene), CBLC-137 (Cleveland BioLabs), AZD-2014 (AstraZeneca), X-480 (Xcovery), X-414 (Xcovery), EC-0371 (Endocyte), VS-5584 (Verastem), PQR-401 (Piqur), PQR-316(Piqur), PQR-311(Piqur), PQR-309(Piqur), PF-06465603(Pfizer), NV-128(Novogen), nPT-MTOR(BioticaBC-210(Biotica Technology), WAY-600(Biotica Technology), WYE-354(Biotica Technology), WYE-687(Biotica Technology), LOR-220(Lorus Therapeutics), HMPL-518(Hutchison China MediTech), GNE-317 (Genentech), EC-0565 (Endocyte), CC-214 (Celgene), and ABTL-0812 (Ability Pharmaceuticals).

[0086] As used herein, a "PI3K inhibitor" refers to a substance that reduces the expression or activity of phosphatidylinositol-3 kinase (PI3K) or downstream proteins, such as Akt. When activated, PI3K phosphorylates the 3'-OH group of the inositol ring in inositol phospholipids, generating the second messenger phosphatidylinositol-3,4,5-triphosphate (PI-3,4,5-P(3)). Akt interacts with phospholipids, thereby transporting it to the inner membrane, where it is phosphorylated and activated. Activated Akt regulates the function of numerous substrates involved in regulating cell survival, cell cycle progression, and cell growth.

[0087] Non-limiting examples of PI3K inhibitors according to the present invention include A-674563 (CAS No. 552325-73-2), AGL 2263, AMG-319 (Amgen, Thousand Oaks, CA), AS-041164 (5-benzo[1,3]dioxol-5-ylmethylene-thiazolidine-2,4-dione), AS-604850 (5-(2,2-difluoro-benzo[1,3]dioxol-5-ylmethylene)-thiazolidine-2,4-dione), AS-605240 (5-quinoxyline-6-methylene-1,3-thiazolidine-2,4-dione), AT7867 (CAS No. 857531-00-1), the benzimidazole series, Genentech (Roche Holdings Inc., South San Francisco, CA). Francisco, CA), BML-257 (CAS number 32387-96-5), CAL-120 (Gilead Sciences, Foster City, CA), CAL-129 (Gilead Sciences), CAL-130 (Gilead Sciences), CAL-253 (Gilead Sciences), CAL-263 (Gilead Sciences), CAS No. 612847-09-3, CAS No. 681281-88-9, CAS No. 75747-14-7, CAS No. 925681-41-0, CAS No. 98510-80-6, CCT128930 (CAS No. 885499-61-6), CH5132799 (CAS No. 1007207-67-1), CHR-4432 (Chroma Therapeutics, Ltd., Abingdon, UK), FPA 124 (CAS No. 902779-59-3), GS-1101 (CAL-101) (Gilead Sciences), GSK 690693 (CAS No. 937174-76-0), H-89 (CAS No. 127243-85-0), honokiol, IC87114 (Gilead Science), IPI-145 (Intellikine Inc.), KAR-4139 (Karus Therapeutics, Chilworth, UK), KAR-4141 (Karus Therapeutics), KIN-1 (Karus Therapeutics), KT 5720 (CAS No. 108068-98-0), miltefosine, MK-2206 dihydrochloride (CAS No. 1032350-13-2), ML-9 (CAS No. 105637-50-1), naltrindole hydrochloride, OXY-111A (NormOxys Inc., Brighton, MA), perifosine, PHT-427 (CAS number 1191951-57-1), PI3 kinase δ inhibitor, Merck KGaA (Merck & Co., Whitehouse Station, NJ), PI3 kinase δ inhibitor, Genentech (Roche Holdings Inc.), PI3 kinase δ inhibitor, Incozen (Incozen Therapeutics, Pvt. Ltd., Hydrabad, India), PI3 kinase δ inhibitor-2, Incozen (Incozen Therapeutics), PI3 kinase inhibitor, Roche-4 (Roche Holdings Inc.), PI3 kinase inhibitor, Roche (Roche Holdings Inc.), PI3 kinase inhibitor, Roche-5 (Roche Holdings Inc.), PI3-α / δ inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd., South San Francisco, CA), PI3-δ inhibitor, Cellzome (Cellzome AG, Heidelberg, Germany), PI3-δ inhibitor, Intellikine (Intellikine Inc., La Jolla, CA), PI3-δ inhibitor, Pathway Therapeutics-1 (Pathway Therapeutics Ltd.), PI3-δ inhibitor, Pathway Therapeutics-2 (Pathway Therapeutics Ltd.), PI3-δ / γ inhibitor, Cellzome (Cellzome AG), PI3-δ / γ inhibitor, Cellzome (Cellzome AG), PI3-δ / γ inhibitor, Intellikine (Intellikine Inc.), PI3-δ / γ inhibitor, Intellikine (Intellikine Inc.), PI3-δ / γ inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-δ / γ inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-γ inhibitor, Evotec (Evotec), PI3-γ inhibitor, Cellzome (Cellzome AG), PI3-γ inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3K delta / gamma inhibitor, Intellikine-1 (Intellikine Inc.), PI3K delta / gamma inhibitor, Intellikine-1 (Intellikine Inc.), pictilisib (GDC-0941) (Roche Holdings Inc.), PIK-90 (CAS No. 677338-12-4), SC-103980 (Pfizer, New York, NY), SF-1126 (Semafore Pharmaceuticals, Indianapolis, IN), SH-5, SH-6, tetrahydrocurcumin, TG100-115 (Targegen Inc., San Diego, CA), triciribine, X-339 (Xcovery, West Palm Beach, FL), XL-499 (Evotech, Hamburg, Germany), pharmaceutically acceptable salts thereof, and combinations thereof. Preferably, the inhibitor of the PI3K / Akt pathway is pictilisib (GDC-0941) or a pharmaceutically acceptable salt thereof.

[0088] As used herein, a "RAS inhibitor" refers to a substance that (i) directly interacts with RAS, for example, by binding to RAS, and (ii) reduces the expression or activity of RAS. Non-limiting examples of RAS inhibitors according to the present invention include farnesyltransferase inhibitors (e.g., tipifarnib and lonafarnib), farnesyl-containing small molecules (e.g., salirasib and TLN-4601), DCAIs described in Maurer (Maurer et al., 2012), Kobe0065 and Kobe2602 described in Shima (Shima et al., 2013), and HBS 3 (Patgiri et al., 2011), and AIK-4 (Allinky), their pharmaceutically acceptable salts, and combinations thereof.

[0089] As used herein, "gene expression" is the process by which information from DNA is used to form polypeptides. "Regulators of gene expression and other cellular functions" are substances that affect gene expression and other cellular processes. Non-limiting examples of such regulators include hormones, histone deacetylase inhibitors (HDACi), and cyclin-dependent kinase inhibitors (CDKi), as well as poly ADP-ribose polymerase (PARP) inhibitors.

[0090] In the present invention, a "hormone" is a substance released by cells in one part of the body that affects cells in another part of the body. Non-limiting examples of hormones according to the present invention include prostaglandins, leukotrienes, prostacyclin, thromboxane, amylin, anti-Mullerian hormone, adiponectin, adrenocorticotropic hormone, angiotensinogen, angiotensin, vasopressin, atriopeptin, brain natriuretic peptide, calcitonin, cholecystokinin, corticotropin-releasing hormone, encephalin, endothelin, erythropoietin, follicle-stimulating hormone, galanin, gastrin, ghrelin, glucagon, gonadotropin-releasing hormone, growth hormone-releasing hormone, human chorionic gonadotropin, human placental lactogen, growth hormone, and ibuprofen. These include rhinhibin, insulin, somatomedin, leptin, liptropin, luteinizing hormone, melanocyte-stimulating hormone, motilin, orexin, oxytocin, pancreatic polypeptide, parathyroid hormone, prolactin, prolactin-releasing hormone, relaxin, renin, secretin, somatostatin, thrombopoietin, thyroid-stimulating hormone, testosterone, dehydroepiandrosterone, androstenedione, dihydrotestosterone, aldosterone, estradiol, estrone, estriol, cortisol, progesterone, calcitriol, and calcidiol.

[0091] Some compounds interfere with the activity of certain hormones or stop the production of certain hormones. Non-limiting examples of hormone-interfering compounds according to the present invention include tamoxifen (Nolvadex®), anastrozole (Arimidex®), letrozole (Femara®), and fulvestrant (Faslodex®). Such compounds are also included in the meaning of hormones in the present invention.

[0092] As used herein, an "HDAC inhibitor" is a substance that (i) interacts directly with HDACs, for example, by binding to HDACs, and (ii) reduces the expression or activity of HDACs. Non-limiting examples of HDAC inhibitors according to the present invention include 4SC-201 (4SC AG), 4SC-202 (Takeda), abexinostat (Celera), AN-1 (Titan Pharmaceuticals, Inc.), Apicidine (Merck & Co., Inc.), AR-42 (Arno Therapeutics), ARQ-700RP (ArQule), Avugane (TopoTarget AS), azelaic acid-1-hydroxamic acid-9-anilide (AAHA), belinostat (TopoTarget), butyrate (Enzo Life Sciences, Inc.), CG-1255 (Errant Gene Therapeutics, LLC), CG-1521 (Errant Gene Therapeutics, LLC), and CG-200745 (Crystal Genomics, Inc.).), chidamide (Shenzhen Chipscreen Biosciences), CHR-3996 (Chroma Therapeutics), CRA-024781 (Pharmacyclics), CS-3158 (Shenzhen Chipscreen Biosciences), CU-903 (Curis), DAC-60 (Genextra), entinostat (Bayer), hyaluronic acid butyrate (HA-But), IKH-02 (IkerChem), IKH-35 (IkerChem), ITF-2357 (Italfarmaco), ITF-A (Italfarmaco), JNJ-16241199 (Johnson & Johnson), KA-001 (Karus Therapeutics), KAR-3000 (Karus Therapeutics), KD-5150 (Kalypsys), KD-5170 (Kalypsys), KLYP-278 (Kalypsys), KLYP-298 (Kalypsys), KLYP-319 (Kalypsys), KLYP-722 (Kalypsys), m-carboxycinnamic acid bis-hydroxamide (CBHA), MG-2856 (MethylGene), MG-3290 (MethylGene), MG-4230 (MethylGene), MG-4915 (MethylGene), MG-5026 (MethylGene), MGCD-0103 (MethylGene Inc.), mocetinostat (MethylGene), MS-27-275 (Schering AG), NBM-HD-1 (NatureWise), NVP-LAQ824 (Novartis), OCID-4681-S-01 (Orchid Pharmaceuticals), oxamflatin ((2E)-5-[3-[(phenylsulfonyl)aminolphenyl]-pent-2-en-4-ynohydroxamic acid), panobinostat (Novartis), PCI-34051 (Pharmacyclics), phenylbutyrate (Enzo Life Sciences, Inc.), pivaloyloxymethyl butyrate (AN-9, Titan Pharmaceuticals, Inc.), pivanex (Titan Pharmaceuticals, Inc.), pracinostat (SBIO), PX-117794 (TopoTarget AS), PXD-118490 (LEO-80140) (TopoTarget AS), pyroxamide (suberoyl-3-aminopyridine amide hydroxamic acid), resminostat (Takeda), RG-2833 (RepliGen), ricolinostat (Acetylon), romidepsin (Astellas), SB-1304 (S. * BIO), SB-1354(S * BIO), SB-623(Merrion Research I Limited), SB-624(Merrion Research I Limited), SB-639(Merrion Research I Limited), SB-939(S * BIO), Scriptaid (N-hydroxy-1,3-dioxo-1H-benz[de]isoquinoline-2(3H)-hexanamide), SK-7041 (In2Gen / SK Chemical Co.), SK-7068 (In2Gen / SK Chemical Co.), suberoylanilide hydroxamic acid (SAHA), sulfonamide hydroxamic acid, tributyrin (Sigma Aldrich), trichostatin A (TSA) (Sigma Aldrich), valproic acid (VPA) (Sigma Aldrich), vorinostat (Zolinza), WF-27082B (Fujisawa Pharmaceutical Co.), pharmaceutically acceptable salts thereof, and combinations thereof. Preferably, the HDAC inhibitor is romidepsin, pharmaceutically acceptable salts thereof, and combinations thereof.

[0093] As used herein, "CDK" refers to a family of protein kinases that regulate the cell cycle. Known CDKs include cdk1, cdk2, ckd3, ckd4, cdk5, cdk6, cdk7, cdk8, cdk9, cdk10, and cdk11. A "CDK inhibitor" is a substance that (i) directly interacts with a CDK, for example, by binding to the CDK, and (ii) reduces the expression or activity of the CDK. Non-limiting examples of CDK inhibitors according to the present invention include 2-hydroxybohemine, 3-ATA, 5-iodo-indirubin-3'-monoxime, 9-cyanopaullone, aloisine A, alsterpaullone 2-cyanoethyl, alvocidib (Sanofi), AM-5992 (Amgen), aminopurvalanol A, arcyliaflavin A, AT-7519 (Astex). Pharmaceuticals), AZD 5438 (CAS No. 602306-29-6), BMS-265246 (CAS No. 582315-72-8), BS-181 (CAS No. 1092443-52-1), butyrolactone I (CAS No. 87414-49-1), Cdk / Crk inhibitor (CAS No. 784211-09-2), Cdk1 / 5 inhibitor (CAS No. 40254-90-8), Cdk2 inhibitor II (CAS No. 222035-13-4), Cdk2 inhibitor IV, NU6140 (CAS No. 444723-13-1), Cdk4 inhibitor (CAS No. 546102-60-7), Cdk4 inhibitor III (CAS No. 265312-55-8), Cdk4 / 6 inhibitor IV (CAS No. 359886-84-3), Cdk9 inhibitor II (CAS No. 140651-18-9), CGP 74514A, CR8, CYC-065 (Cyclacel), dinaciclib (Ligand), (R)-DRF053 dihydrochloride (CAS number 1056016-06-8), Fascaplysin, flavopiridol, hygroridine, indirubin, LEE-011 (Astex Pharmaceuticals), LY-2835219 (Eli Lilly), milciclib maleate (Nerviano) Medical Sciences), MM-D37K (Maxwell Biotech), N9-isopropyl-olomoucine, NSC 625987 (CAS No. 141992-47-4), NU2058 (CAS No. 161058-83-9), NU6102 (CAS No. 444722-95-6), olomoucine, ON-108600 (Onconova), ON-123300 (Onconova), oxindole I, P-1446-05 (Piramal), P-276-00 (Piramal), palbociclib (Pfiz er), PHA-767491 (CAS No. 845714-00-3), PHA-793887 (CAS No. 718630-59-2), PHA-848125 (CAS No. 802539-81-7), Purvalanol A, Purvalanol B, R547 (CAS No. 741713-40-6), RO-3306 (CAS No. 872573-93-8), Roscovitine, SB-1317 (SBIO), SCH 900776 (CAS No. 891494-63-6), SEL-120 (Selvita), seliciclib (Cyclacel), SNS-032 (CAS No. 345627-80-7), SU9516 (CAS No. 377090-84-1), WHI-P180 (CAS No. 211555-08-7), pharmaceutically acceptable salts thereof, and combinations thereof. Preferably, the CDK inhibitor is selected from the group consisting of dinaciclib, palbociclib, pharmaceutically acceptable salts thereof, and combinations thereof.

[0094] As used herein, "poly ADP-ribose polymerase (PARP) inhibitor" refers to a substance that reduces the expression or activity of poly ADP-ribose polymerase (PARP) or downstream proteins.Non-limiting examples of poly ADP-ribose polymerase (PARP) inhibitors of the present invention include PF01367338 (Pfizer, New York, NY), olaparib (AstraZeneca, United Kingdom), iniparib (Sanofi-Aventis, Paris, France), veliparib (Abbott Laboratories, Abbott Park, IL), MK 4827 (Merck, White House Station, NJ), CEP 9722 (Teva Pharmaceuticals, Israel), LT-673 (Biomarin, San Rafael, CA) and BSI 401 (Sanofi-Aventis, Paris, France), its pharmaceutically acceptable salts and combinations thereof.

[0095] In a preferred embodiment, the chemotherapy comprises administering to the human an agent selected from the group consisting of gemcitabine, taxol, adriamycin, ifosfamide, trabectedin, pazopanib, abraxane, avastin, everolimus, and combinations thereof.

[0096] As used herein, "radiotherapy" refers to any therapeutic regimen compatible with treatment with the C. novyi of the present invention, e.g., C. novyi NT, in which radiation is delivered to a subject, e.g., a human, for the treatment of cancer. Radiation therapy can be delivered to, e.g., a human subject, e.g., by a machine outside the body (external beam radiotherapy) or by a radioactive material inside the body (brachytherapy, total body radiotherapy).

[0097] External beam radiation therapy includes, but is not limited to, three-dimensional conformal radiation therapy, intensity-modulated radiation therapy, image-guided radiation therapy, tomotherapy, stereotactic radiosurgery, stereotactic body radiation therapy, proton beam therapy, and other charged particle beam therapies, such as electron beam therapy. External beam radiation therapy is widely used in the treatment of cancer and is well known to those skilled in the art.

[0098] Brachytherapy refers to radiation therapy delivered by implantation within or placement on a subject's body. Brachytherapy includes, but is not limited to, interstitial brachytherapy, intracavitary brachytherapy, and episcleral brachytherapy. Brachytherapy techniques are also widely used in the treatment of cancer and are well known to those skilled in the art.

[0099] Systemic radiotherapy refers to radiotherapy delivered by injection into or ingestion by a subject. One example of systemic radiotherapy is radioactive iodine therapy. Radioactive iodine is a radioactively labeled iodine molecule that is safe and effective for use in subjects, such as humans. Non-limiting examples of radioactive iodine according to the present invention include: 123 I, 124 I, 125 I, 131 I and combinations thereof. Preferably, the radioactive iodine is 131 I.

[0100] As used herein, "immunotherapy" refers to any anticancer treatment regimen that is compatible with treatment with C. novyi of the present invention, e.g., C. novyi NT, and uses substances that modify the immune response by increasing or decreasing the immune system's ability to produce antibodies or sensitized cells that recognize and react with the antigen that initiated the production. Immunotherapeutic agents can be recombinant, synthetic, or natural preparations and include cytokines, corticosteroids, cytotoxic drugs, thymosin, and immunoglobulins. Some immunotherapeutic agents occur naturally in the body, and certain of these are available in pharmacological preparations. Examples of immunotherapeutic agents include, but are not limited to, granulocyte colony-stimulating factor (G-CSF), interferon, imiquimod, bacterial membrane fractions, IL-2, IL-7, IL-12, CCL3, CCL26, CXCL7, and synthetic cytosine phosphate-guanosine (CpG).

[0101] In a preferred embodiment, the immunotherapy comprises administering an immune checkpoint inhibitor to the human. As used herein, "immune checkpoint inhibitor" refers to a substance that blocks the activity of molecules involved in attenuating immune responses. Such molecules include, for example, cytotoxic T-lymphocyte antigen 4 (CTLA-4) and programmed cell death protein 1 (PD-1). Immune checkpoint inhibitors of the present invention include, but are not limited to, ipilimumab (Bristol-Myers Squibb), tremelimumab (Pfizer), MDX-1106 (Medarex, Inc.), MK3475 (Merck), CT-011 (CureTech, Ltd.), AMP-224 (Amplmmune), MDX-1105 (Medarex, Inc.), IMP321 (Immutep SA), and MGA271 (Macrogenics).

[0102] In a further aspect of this embodiment, the C. novyi therapy, e.g., C. novyi NT therapy, of the present invention is effective against solid tumors that are resistant to treatments selected from the group consisting of, for example, chemotherapy, radiation therapy, immunotherapy, and combinations thereof.

[0103] In another aspect of this embodiment, the solid tumor is refractory to standard treatments or there is no standard treatment available for the solid tumor, but the C. novyi therapy of the invention, e.g., C. novyi NT therapy, is effective against such tumors.

[0104] As used herein, "resistant" and "refractory" are used interchangeably. Being "refractory" to a treatment means that a previous treatment(s) is less effective, for example, in treating cancer or killing cancer cells, than the same subject before they became resistant to the treatment.

[0105] As used herein, the term "standard of care" refers to a care generally accepted by medical professionals as being appropriate for treating a particular cancer, preferably a particular solid tumor. Standard care may be the same or different for different tumor types. Standard care is typically approved by various regulatory agencies, such as the U.S. Food and Drug Administration.

[0106] In a further aspect of this embodiment, the method induces a strong local inflammatory and adaptive immune response in the human.

[0107] As used herein, an "inflammatory response" is a local response to cellular damage, pathogens, or irritants and may include, but is not limited to, capillary dilation, leukocyte infiltration, swelling, redness, heat, itching, pain, loss of function, and combinations thereof.

[0108] As used herein, an "adaptive immune response" involves B cells and T cells of a subject's immune system. Upon exposure to a pathogenic substance, such as cancer cells, B cells can produce antibodies against pathogenic antigens on the pathogenic substance, allowing T cells to target and ultimately destroy the pathogen. Specific B cell and T cell populations specific to a given antigen are maintained by the immune system and subsequently required in the event of exposure to a pathogenic antigen. In this way, the adaptive immune response is persistent, providing the host subject's immune system with the ongoing ability to recognize and destroy a given pathogenic antigen-presenting pathogen.

[0109] Another embodiment of the present invention is a method for debulking a solid tumor in a human, comprising administering to the human approximately 1 x 10 6 cells suspended in a pharmaceutically acceptable carrier or solution. 3 ~Approx. 1×10 7 CFU, preferably C. novyi CFU This involves intratumoral administration of a unit dose of NT CFU.

[0110] As used herein, "debulking" a solid tumor means reducing the size or number of cancers in the solid tumor. Such measures are palliative and can be used to improve the effectiveness of treatments such as radiation therapy, chemotherapy, or amputation. In this embodiment, the solid tumor is as described above. Preferably, the solid tumor is selected from the group consisting of soft tissue sarcoma, hepatocellular carcinoma, breast cancer, pancreatic cancer, and melanoma. More preferably, the solid tumor is a leiomyosarcoma, such as a retroperitoneal leiomyosarcoma.

[0111] A further embodiment of the invention is a method for debulking a solid tumor in a human, the method comprising administering to the human about 1 x 10 per cycle. 4 Spore-containing C. novyi The method comprises intratumorally administering one to four unit doses of C. novyi NT spores, each unit dose being suspended in a pharmaceutically acceptable carrier or solution. In this embodiment, the type of solid tumor is as described above. Preferably, the solid tumor is selected from the group consisting of soft tissue sarcoma, hepatocellular carcinoma, breast cancer, pancreatic cancer, and melanoma.

[0112] A further embodiment of the present invention is a method for treating or ameliorating the effects of a solid tumor in a human, the method comprising administering to the human about 1 x 10 per cycle 4 The method comprises administering unit doses of C. novyi NT spores containing spores intratumorally in one to four cycles, each unit dose being suspended in a pharmaceutically acceptable carrier or solution. Various types of solid tumors are as described above. Preferably, the solid tumor is selected from the group consisting of soft tissue sarcoma, hepatocellular carcinoma, breast cancer, pancreatic cancer, and melanoma.

[0113] Another embodiment of the present invention is a method for removing a solid tumor present in a human, comprising administering to the human approximately 1 x 10 cells suspended in a pharmaceutically acceptable carrier or solution. 3 ~Approx. 1×10 7 CFU, preferably C. novyi NT The method involves administering a unit dose of CFU intratumorally, and removing the tumor leaving a margin of normal tissue.

[0114] As used herein, "removing" a solid tumor means that the process removes the entire solid tumor. After treatment, the process leaves a margin of normal tissue around the area where the tumor once was. In this embodiment, the type of solid tumor is as set forth above. Preferably, the solid tumor is a sarcoma. More preferably, the solid tumor is a leiomyosarcoma, such as a retroperitoneal leiomyosarcoma.

[0115] A further embodiment of the present invention is a C. novyi CFU unit dose, which comprises about 1 x 10 CFU in a pharmaceutically acceptable carrier or solution effective to treat or ameliorate the effects of solid tumors in humans. 3 ~Approx. 1×10 7 As noted above, C. novyi CFUs can be vegetative and spore forms.

[0116] In one aspect of this embodiment, the C. novyi is C. novyi NT. Preferably, the unit dose is about 1 x 10 in a pharmaceutically acceptable carrier or solution. 4 ~Approx. 1×10 7 C. novyi NT spores, e.g., approximately 1 × 10 6 ~Approx. 1×10 7 Preferably, the unit dose contains about 1 x 10 C. novyi NT spores in a pharmaceutically acceptable carrier or solution. 4 Contains C. novyi NT spores.

[0117] A further embodiment of the present invention is a kit for treating or ameliorating the effects of a solid tumor in a human. The kit comprises about 1 x 10 mAb in a pharmaceutically acceptable carrier or solution. 3 ~Approx. 1×10 7 The kit includes a C. novyi CFU unit dose containing CFU and instructions for use of the kit. The kit may be divided into one or more compartments and may have one or more containers for various reagents. The kit may also be adapted to aid in the storage and transport of each component.

[0118] In one aspect of this embodiment, the kit further comprises one or more antibiotics effective in treating or alleviating adverse side effects caused by C. novyi CFUs. The CFUs may be in the vegetative or spore form. Suitable antibiotics are as set forth above. Preferably, the kit further comprises 1 to 4 unit doses of C. novyi for 1 to 4 treatment cycles.

[0119] In another aspect of this embodiment, the C. novyi is C. novyi NT. Preferably, the unit dose is about 1 x 10 in a pharmaceutically acceptable carrier or solution. 4 ~Approx. 1×10 7 C. novyi NT spores, e.g., approximately 1 × 10 6 ~Approx. 1×10 7 C. novyi NT spores or approximately 1 × 10 4 Preferably, the kit further contains 1 to 4 unit doses of C. novyi NT spores for 1 to 4 treatment cycles. It has NT spores.

[0120] Another embodiment of the present invention is a method for microscopically precise excision of tumor cells in a human, the method comprising administering to the human approximately 1 x 10 cells suspended in a pharmaceutically acceptable carrier or solution. 3 ~Approx. 1×10 7 This involves intratumoral administration of a unit dose of C. novyi NT colony-forming units (CFUs) containing CFUs.

[0121] As used herein, "microscopically precise ablation" refers to the elimination of target tissue, e.g., pathogenic tissue, within a subject, said elimination being essentially specific to the pathogenic tissue at the cellular level, while causing minimal or no harm to nearby "healthy" tissue. Elimination of the target tissue can be, but is not limited to, apoptosis, necrosis, and cytolysis. This embodiment can be achieved by, for example, precise delivery of C. novyi NT spores of the present invention via CT-guided intratumoral injection using a multi-prong delivery device, e.g., a multi-prong needle.

[0122] In the present invention, C. novyi spores, e.g., C. novyi NT spores, are delivered intratumorally to a subject, e.g., a human patient, by any medically appropriate method. For example, C. novyi NT spores can be delivered by a single needle used at one or more sites of a tumor. Alternatively, C. novyi NT spores can be delivered to a tumor using a multi-pronged delivery device, e.g., a multi-pronged needle. For example, spores can be delivered to the same depth or to various depths at one or more sites of a tumor. The selected delivery device can be manually operated or electronically controlled. The delivery device can be positioned and / or repositioned on or within a tumor manually or by a remotely controlled device, and visualization of the injection site can be enhanced using various imaging techniques known in the art, e.g., CT imaging. Multi-branched delivery vehicles that can be used in the present invention include, for example, those disclosed in McGuckin, Jr. et al., U.S. Patent Nos. 6,905,480 and 7,331,947, which are incorporated herein by reference.

[0123] A further embodiment of the present invention is a method for treating or ameliorating the effects of a solid tumor that has metastasized to one or more sites in a human, comprising administering to the human at least about 1 x 10 6 cells / ml of the tumor suspended in a pharmaceutically acceptable carrier or solution. 3 ~Approx. 1×10 7 Preferably, at least one metastatic site is distal to the original solid tumor.

[0124] As used herein, "metastasis" and its grammatical variants refer to the spread of pathogenic cells, i.e., tumor cells, from their original primary location in the body to secondary locations in the body. Metastasis can be localized or distant depending on the distance from the original primary tumor site. Whether metastasis is localized or distant can be determined by a doctor. For example, breast cancer that has spread to the brain is distant, while the spread of breast cancer cells to the axillary lymph nodes is localized.

[0125] In the present invention, an "effective amount" or "therapeutically effective amount" of a compound or composition disclosed herein is the amount of such compound or composition sufficient to produce the beneficial or desired results described herein when administered to a subject. Effective dosage forms, modes of administration, and dosage amounts are as disclosed herein or as modified by a medical professional. Those skilled in the art will understand that dosage amounts will vary depending on the route of administration, excretion rate, duration of treatment, the identity of other drugs (if any) administered, the age and size of the patient, and similar factors well known in the medical arts. In general, a suitable dose of a composition according to the present invention is the amount of the composition that is the lowest dose effective to produce the desired effect. Effective doses of the compositions of the present invention have been described above. Furthermore, the compositions of the present invention may be administered in combination with other treatments.

[0126] The compositions of the present invention comprise one or more active ingredients, mixed with one or more pharmaceutically acceptable carriers and optionally one or more other compounds, drugs, ingredients and / or substances. Regardless of the route of administration selected, the drugs / compounds of the present invention are formulated into pharmaceutically acceptable unit dosage forms by conventional methods known to those skilled in the art. For example, see Remington, The Science and Practice of Pharmacy (21st Edition, Lippincott Williams and Wilkins, Philadelphia, PA).

[0127] Pharmaceutically acceptable carriers or solutions are well known in the art (see, e.g., Remington, The Science and Practice of Pharmacy (21st ed., Lippincott Williams and Wilkins, Philadelphia, PA.) and The National Formulary (American Pharmaceutical Association, Washington, DC)), sugars (e.g., lactose, sucrose, mannitol, and sorbitol), starch, cellulose preparations, calcium phosphates (e.g., dicalcium phosphate, tricalcium phosphate, and calcium hydrogen phosphate), sodium citrate, water, aqueous solutions (e.g., saline, sodium chloride injection, Ringer's injection, dextrose injection, dextrose and sodium chloride injection, lactated Ringer's injection), alcohols (e.g., ethyl alcohol, propyl alcohol, and benzyl alcohol), Included are polyols (e.g., glycerol, propylene glycol, and polyethylene glycol), organic esters (e.g., ethyl oleate and triglycerides), biodegradable polymers (e.g., polylactide-polyglycolide, poly(orthoesters), and poly(anhydrides)), elastomeric matrices, liposomes, microspheres, oils (e.g., corn, germ, olive, castor, sesame, cottonseed, and peanut), cocoa butter, waxes (e.g., suppository wax), paraffin, silicones, talc, salicylates, and the like. Each pharmaceutically acceptable carrier or solution used in a unit dose according to the present invention must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not deleterious to the subject. Carriers or solutions suitable for a selected dosage form and intended route of administration, e.g., IT, are well known in the art, and acceptable carriers or solutions for a selected dosage form and method of administration can be determined using ordinary skill in the art.

[0128] The unit doses of the present invention may optionally contain additional ingredients and / or substances commonly used in pharmaceutical compositions. Such ingredients and substances are well known in the art and include: (1) fillers or extenders, such as starch, lactose, sucrose, glucose, mannitol, and silicic acid; (2) binders, such as carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidone, hydroxypropylmethylcellulose, sucrose, and acacia; (3) humectants, such as glycerol; and (4) disintegrants, such as agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, starches. (5) solution retarders, such as paraffin; (6) absorption enhancers, such as quaternary ammonium compounds; (7) wetting agents, such as cetyl alcohol and glycerol monostearate; (8) absorbents, such as kaolin and bentonite clay; (9) lubricants, such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, and sodium lauryl sulfate; (10) suspending agents, such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, and tragacanth; (11) buffering agents; (12) excipients, such as lactose, milk sugar, polyethylene glycol, animal and vegetable fats, oils, waxes, paraffin, cocoa butter, starch, tragacanth, cellulose derivatives, polyethylene glycol, silicones, bentonite, silicic acid, talc, salicylates, zinc oxide. , aluminum hydroxide, calcium silicate, and polyamide powder; (13) inert diluents, such as water or other solvents; (14) preservatives; (15) surface-active agents; (16) dispersing agents; (17) controlled-release or absorption-retarding agents, such as hydroxypropyl methylcellulose, other polymer matrices, biodegradable polymers, liposomes, microspheres, aluminum monostearate, gelatin, and waxes; (18) opacifying agents; (19) adjuvants; (20) wetting agents; (21) emulsifying and suspending agents;(22) solubilizers and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oils (especially cottonseed, peanut, corn, germ, olive, castor, and sesame oils), glycerol, tetrahydrofuryl alcohol, polyethylene glycol, and fatty acid esters of sorbitan; (23) propellants, such as chlorofluorohydrocarbons and volatile unsubstituted hydrocarbons, such as butane and propane; (24) antioxidants; (25) agents that render the formulation isotonic with the blood of the intended recipient, such as sugars and sodium chloride; (26) thickening agents; (27) coating materials, such as lecithin; and (28) sweetening agents, flavoring agents, coloring agents, fragrances, and preservatives. Each such ingredient or substance must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject. Ingredients and materials suitable for a selected dosage form and intended route of administration are well known in the art, and ingredients and materials acceptable for a selected dosage form and method of administration can be determined using ordinary skill in the art.

[0129] Liquid dosage forms include pharmaceutically acceptable emulsions, microemulsions, solutions and suspensions.Liquid dosage forms can contain suitable inert diluents that are commonly used in the art.In addition to inert diluents, oral compositions can also contain adjuvants such as wetting agents, emulsifiers and suspending agents, coloring agents and preservatives.Suspensions can contain suspending agents.

[0130] Dosage forms for intratumoral administration include solutions, dispersions, suspensions or emulsions, or sterile powders. The active agent(s) / compound(s) can be mixed with a suitable pharmaceutically acceptable carrier under sterile conditions.

[0131] Alternatively, the unit doses of the present invention may contain one or more active agents, e.g., C. novyi CFU or C. novyi NT spores, in combination with a sterile powder that can be reconstituted immediately before use into a sterile injectable solution or dispersion, and may contain appropriate antioxidants, buffers, solutes that render the formulation isotonic with the blood of the intended recipient, or suspending or thickening agents. Proper fluidity can be maintained, for example, by the use of coating materials, by maintaining the required particle size in the case of dispersions, and by the use of surfactants. Such compositions may also contain suitable adjuvants, such as wetting agents, emulsifying agents, and dispersing agents. It may also be desirable to include an isotonic agent. Prolonged absorption of injectable pharmaceutical forms can also be achieved by including agents that delay absorption.

[0132] Intratumoral injectable depot forms can be prepared by forming a matrix of microencapsulated active ingredients in biodegradable polymers.The release rate of active ingredients can be controlled depending on the ratio of active ingredients to polymers and the properties of the specific polymers used.Depot injectable preparations can also be prepared by entrapping active agents in liposomes or microemulsions that are compatible with body tissues.

[0133] As noted above, the formulations may be presented in unit-dose or multi-dose sealed containers, for example, ampoules and vials, and may be stored in a freeze-dried condition requiring only the addition of the sterile liquid carrier, for example, water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the type described above.

[0134] The following examples are presented to further illustrate the method of the present invention, but are illustrative only and are not intended to limit the scope of the invention in any way. [Example]

[0135] Example 1 Intravenous (IV) administration of C. novyi NT in combination with radiation A single IV dose of C. novyi NT spores was tested in dogs with spontaneous tumors after treatment with external beam radiation.

[0136] C. novyi NT spores were produced and final formulated at the Johns Hopkins Development laboratory according to the following method: C. novyi NT spores, prepared according to Dang et al., 2001, were inoculated into rich sporulation medium and incubated in an anaerobic chamber at 37°C for 17–19 days. Spores were purified by sequential continuous Percoll gradient centrifugation and then extensively washed with phosphate-buffered saline. Spores were stored at 2–8°C. Prior to transport, spores were prepared by suspending them in sterile phosphate-buffered saline and diluting them with 50 ml of 0.9% sodium chloride.

[0137] C. novyi NT spores were reconstituted in a 50 ml saline bag and delivered overnight to the test site. The radiation dose was approximately 54 Gy, delivered in 20 doses: 11 doses before and 9 doses after the IV injection of C. novyi NT. C. novyi NT spores were administered at a dose of 1 x 10 per body surface area as a single injection. 9 Spores / m 2 The dose was 100 mg / kg / day. Transfer of the spores to the syringe was performed on an absorbent pad with an impermeable backing. A 22-gauge needle fitted with a three-way stopcock was inserted into the bag. A closed chemotherapy system (ONGUARD™, TEVA The male end of a sealed chemotherapy system (Ventilator Medical Ltd.) was attached to the stopcock port. The contents were completely drawn from the bag into a 60 cubic centimeter (cc) syringe, which was then fitted with the female end of the sealed system. The spores were injected into each subject over 15 minutes via an IV catheter, which was fitted with the male end of a sealed chemotherapy system. The infusion was followed by a 10 cc saline flush. Subjects were closely monitored for 6 hours after infusion as follows: vital signs, blood pressure, and oxygen saturation were monitored every 15 minutes for the first 60 minutes, followed by every 30 minutes for the next 60 minutes, then every 60 minutes for the next 120 minutes. Subsequent checks were performed every 60 minutes for a total of 6 hours.

[0138] Study subjects were hospitalized for 3 weeks for the initial treatment, 2 weeks for radiation treatment, and 1 week after C. novyi NT IV treatment. They then had follow-up visits at 1, 2, 3, and 6 months for up to 6 months post-treatment. See Tables 1 and 2 for sample treatment schedules. [Table 1] [Table 2]

[0139] As of September 10, 2012, five dogs had been treated in this manner. Of the five, two developed abscesses, one maintained stable disease, and two died or were euthanized. The two study subjects that developed abscesses were photographed throughout the treatment period, as shown in Figures 1A and 1B.

[0140] Figure 1A shows a canine osteosarcoma presenting in the distal right radius / ulna during the course of treatment. Test subject Sasha presented with fever and swelling on day 3 and a ruptured abscess on day 6. Antibiotics were initiated on day 8 for the open wound, and necrotic bone and tissue were subsequently removed. Sasha completed 12 of 19 radiation treatments and remained cured with stable disease as of September 10, 2012.

[0141] Figure 1B also shows a canine osteosarcoma presenting in the distal right radius / ulna during the course of treatment. Test subject Sampson presented with fever and swelling on day 5. On day 6, the abscess was drained and antibiotics were initiated. Sampson completed 14 of 20 radiation treatments and remained cured with stable disease as of September 10, 2012.

[0142] The other subjects, Chipper, Bailey, and Ruskin, had mixed results. Chipper presented with squamous cell carcinoma of the left lower jaw. During treatment, Chipper had swelling at the tumor site and underwent 20 of 20 radiation treatments. As of September 10, 2012, Chipper had stable disease.

[0143] Another subject, Bailey, presented with a soft tissue sarcoma in the left axilla. During the procedure, Bailey died of sepsis, acute renal failure, possibly disseminated intravascular coagulation, and cardiac arrest. However, autopsy showed that all tissue within the tumor was dead and no tumor cells were present.

[0144] The remaining subject, Ruskin, presented with osteosarcoma in the proximal right humerus. During treatment, Ruskin experienced swelling at the tumor site and completed 20 / 20 radiation treatments. However, by day 30, a large amount of purulent material had formed at the tumor site, and Ruskin was experiencing renal failure. When his renal condition did not improve, the owner decided to euthanize him. As of September 10, 2012, necropsy results were still pending.

[0145] Example 2 IT-injected C. novyi-NT spores specifically target tumor tissue and prolong survival in rats - Methods Cell lines and tissue culture The rat F98 glioma cell line, lentivirally transfected with the luciferase construct, was maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin and streptomycin.

[0146] Experiments on rats Six-week-old female F344 Fisher rats (weight 100-150 grams) were purchased from the National Cancer Institute. For the implantation procedure, female F344 Fisher rats were anesthetized by intraperitoneal (IP) injection of ketamine hydrochloride (75 mg / kg; 100 mg / mL ketamine HCl; Abbot Laboratories), xylazine (7.5 mg / kg; 100 mg / mL Xyla-ject; Phoenix Pharmaceutical, Burlingame, CA), and ethanol (14.25%) in sterile NaCl (0.9%). F98 glioma cells (2 × 10 4 ) were stereotactically implanted into the right frontal lobe through a burr hole drilled 3 mm lateral and 2 mm anterior to the previous section, as previously described (Bai et al., 2011). Twelve days after tumor cell implantation, 8 mg / rat of D-luciferin potassium salt was injected IP, and tumor size was assessed using a Xenogen instrument. Subsequently, 3 million C. novyi-NT spores, prepared as previously described (Dang et al., 2001; Bettegowda et al., 2006), were stereotactically injected into the intracranial tumor using the same coordinates as above, and the rats were treated with 10 mg / kg / day of IP dexamethasone for the first 2 days. Animals were observed daily for signs of deterioration, lethargy, neurotoxicity, or pain (if any) in accordance with the Johns Hopkins Animal Care and Use Guidelines. If symptoms of distress were present, supportive care with hydration and doxycycline (15 mg / kg IP, followed by a loading dose of 10 mg / kg every 12 hours for maintenance) was initiated and continued for 7 days. Moribund animals were euthanized if symptoms persisted and / or if they became debilitated. The efficacy of IT-injected C. novyi-NT spores was assessed by Kaplan-Meier survival curves and residual tumor burden in brain sections. In the latter case, brains were collected postmortem, placed in formaldehyde, and embedded in paraffin for further pathological examination. Gram-stained slides and H&E slides counterstained with safranin were obtained according to standard procedure guidelines.

[0147] statistical analysis Kaplan-Meier survival curves were generated and analyzed by the Mantel-Cox test using GraphPad Prism v.5.00 (GraphPad Software, San Diego, CA).

[0148] Example 3 IT-injected C. novyi-NT spores specifically target tumor tissue and prolong survival in rats - Results Complete surgical resection of advanced gliomas is almost always impossible, and such tumors relentlessly recur. Although this tumor type generally does not metastasize, there are no highly effective pharmaceutical therapies available to treat it. Therefore, gliomas were suspected as a tumor type in which local injection of C. novyi-NT spores might be therapeutically useful. To evaluate this possibility, F98 rat glioma cells were orthotopically implanted into 6-week-old F433 Fisher rats, resulting in locally invasive tumors that were rapidly lethal (Figure 2A). Intratumoral injection of C. novyi-NT spores into these rat tumors resulted in their germination within 24 hours and a rapid decline in luciferase activity, an indicator of tumor burden, between 24 and 48 hours (Figures 2B and 2C). Germination of C. novyi-NT was indicated by the emergence of vegetative forms of the bacterium. Remarkably, C. novyi-NT was tightly localized to the tumor, separated from adjacent normal cells by only a few microns (Figures 3A and 3B). Furthermore, we observed that these vegetative bacteria specifically proliferated within and simultaneously destroyed islands of microinvasive tumor cells embedded within normal brain parenchyma (Figures 4A and 4B). This bacterial biosurgery conferred a significant survival advantage in this highly aggressive mouse model (Figure 2A, P value <0.0001).

[0149] Example 4 Canine soft tissue sarcomas resemble human tumors - Methods Isolation of genomic DNA for sequencing Genomic DNA was collected from dogs participating in a comparative IT C. novyi-NT spore study, peripheral blood lymphocytes (PBL), and formalin-fixed, paraffin-embedded tumor tissues, and analyzed using QIAamp®. Extraction was performed using a DNA mini kit (QIAGEN, Valencia, CA) according to the manufacturer's protocol.

[0150] Sequencing and bioinformatics analysis Genome purification, library construction, exome capture, next-generation sequencing, and bioinformatics analysis of tumor and normal samples were performed at Personal Genome Diagnostics (PGDx, Baltimore, MD). Briefly, genomic DNA from tumor and normal samples was fragmented and used to construct Illumina TruSeq libraries (Illumina, San Diego, CA). Exonic regions were enriched in solution using the Agilent Canine All Exon Kit according to the manufacturer's instructions (Agilent, Santa Clara, CA). Paired-end sequencing (100 bases from each end of the fragment) was performed using a HiSeq 2000 Genome Analyzer (Illumina, San Diego, CA). Tags were aligned to the canine reference sequence (CanFam 2.0) using the Eland algorithm in CASAVA 1.7 software (Illumina, San Diego, CA). Sequence reads were selected for subsequent analysis using the chastity filter in Illumina's BaseCall software. Point mutations and minor insertions and deletions were then identified using the ELAND algorithm in CASAVA 1.7 software (Illumina, San Diego, CA). Known polymorphisms recorded in dbSNP131 (CanFam2.0) were excluded from the analysis. Potential somatic mutations were filtered and visually inspected as previously described (Jones et al., 2010).

[0151] Example 5 Canine soft tissue sarcomas resemble human tumors - Results Preclinical animal testing of anticancer drugs often fails to reproduce the effects observed in humans. However, clinically used therapeutic agents induce similar toxicities and effects in dogs as in humans (Paoloni et al., 2008). Testing investigational therapeutics in dogs may represent a crucial bridge between preclinical animal testing and human clinical trials. In particular, canine soft tissue sarcomas are an excellent model because they are common in many breeds of dogs and share clinical and histopathological features that are remarkably similar to those of human soft tissue sarcomas (Paoloni et al., 2008; Vail et al., 2000). However, while recent advances in genomics have greatly expanded our knowledge of cancer genetics in humans, relatively little is known about the genetic background of canine cancers. Therefore, to investigate whether canine tumors are genetically similar to those in humans, we sequenced the exomes of tumors and matched normal DNA from 11 dogs participating in a comparative study (Figure 5). This analysis involved the interrogation of 30,194 nominal genes encompassing 32.9 megabases (Mb) of DNA. Ten dogs had soft tissue sarcomas (six with peripheral nerve sheath tumours) and one with chondroblastic osteosarcoma. On average, 15.7 gigabases (Gb) (range: 8.1-23.3 Gb) of generated sequence mapped to the genome, with 92.1% of bases within the targeted region encompassed by at least 10 unique reads in tumor DNA. Similarly, an average of 16.3 Gb (range: 14.6-19.7 Gb) of sequence mapped to the genome in normal DNA, with 93.6% of targeted bases encompassed by at least 10 unique reads. The mean coverage of each targeted base in tumors was 153-fold (range: 73-227-fold) and 152-fold (range: 130-178-fold) in matched normal samples.

[0152] Using rigorous analysis criteria, 156 somatic mutations and 28 somatic copy number alterations were identified in 10 soft tissue sarcomas (Table 3 and Figure 6). The range of somatic mutations was 0–95, with a mean of 14 per tumor. Mutation prevalence in soft tissue sarcomas was low, averaging 0.47 / Mb (range: 0.00–2.89 / Mb). Excluding one outlier sample with 95 somatic alterations, the mean prevalence was 0.21 mutations / Mb (range: 0.00–0.61 / Mb) (Figure 5), similar to estimates of mutation rates in human pediatric rhabdoid tumors (Lee et al., 2012) and other soft tissue sarcomas (Joseph et al., 2013). The most common type of somatic alteration was a missense mutation, with C-to-T (45.5%) and G-to-A transitions predominating (34.0%; Tables 4a and 4b). [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5] [Table 3-6] [Table 3-7] [Table 3-8] [Table 3-9] [Table 3-10] [Table 3-11] [Table 3-12] [Table 3-13] [Table 3-14] [Table 3-15] [Table 3-16] [Table 3-17] [Table 3-18] [Table 3-19] [Table 3-20] [Table 4a] [Table 4b-1] [Table 4b-2] Amplifications and deletions were less common, averaging 3 per tumor (range 0-17) (Figure 5). Seven of 10 soft tissue sarcomas had amplifications and deletions. The chondrogenic osteosarcoma exome was similar to that of soft tissue sarcomas (14 somatic mutations and 4 amplifications) (Table 3 and Figure 6).

[0153] Single-base substitutions were identified in four tumor suppressor genes (NF1, MLL3, TP53, and PTCH1) that are frequently mutated in human tumors. Furthermore, the oncogene MDM4, which has been shown to be amplified but not point-mutated in human cancers, was found to be amplified (but not point-mutated) in one canine tumor (Lee et al., 2012, Barretina et al., 2010, Chmielecki et al., 2013, Vogelstein et al., 2013). The only genes mutated in more than one tumor were ATP7B (missense mutations in two tumors) and AIG1 (amplified in two tumors). Interestingly, mutations in ATP7B were also found in human liposarcoma (Joseph et al., 2013). Of the 184 somatic mutations in canine tumors, 22 were in genes previously shown to be mutated in human soft tissue sarcomas (Table 5). [Table 5] "More extensive studies of both types of soft tissue sarcoma are needed to determine whether these are driver mutations that represent important conserved tumorigenesis pathways. However, the genetic background of the canine tumors was similar to that of humans in terms of the number and range of genetic alterations. Specifically, this excludes the possibility that canine tumors harbor a very large number of mutations that may make them more susceptible to an immune response than similar tumor types in humans."

[0154] Example 6 Intratumoral (IT) administration of C. novyi NT - Study 1 Methods To examine the safety and efficacy of the method of the present invention, a controlled study was conducted in 16 dogs with spontaneous solid tumors (Table 6). [Table 6-1] [Table 6-2]

[0155] Dogs were enrolled at multiple sites participating in the Animal Clinical Investigation Oncology Network (ACI, Washington, DC), and written informed consent was obtained from the owner(s) prior to enrollment. Treatment, management, and study evaluations were performed under the supervision of board-certified veterinary oncologists. Enrollment was offered to client-owned dogs with spontaneous solid tumors, preferentially soft tissue sarcomas, that had failed standard treatment or whose owner(s) declined such treatment. Participation was limited to tumor-bearing dogs with target lesions measuring 1 to 7 centimeters in maximum diameter. Dogs with tumors located in areas where abscess development could be catastrophic (e.g., nasal tumors extending into the brain or significant pulmonary metastatic disease) were excluded from the study.

[0156] Dogs with evidence of active bacterial infection that required systemic antibiotic therapy within 7 days of C. novyi-NT spore treatment or cancer treatment (chemotherapy, radiation therapy, and immunotherapy) within 21 days were ineligible. Dogs were required to have a performance score of 0 or 1 (Table 7) and be available for the entire study period. Concurrent use of anticancer drugs and participation in other clinical trials was prohibited. Pregnant dogs or dogs with the potential to become pregnant were not included in the study. Dogs that may not be available for the entire study period or that were deemed ineligible for study enrollment by the investigator or medical director were also not included. [Table 7]

[0157] During the screening visit, each dog was assigned a unique study dog ​​identification number consisting of a five-digit numeric code (which may mean that screening dog numbers are not sequential). The first two digits indicated the study site (01-99), the middle digit indicated study "R," and the last two digits indicated the study dog ​​number within the study site (01-99). For example, the 11th dog enrolled at site 9 was assigned study dog ​​number 09-R11. Study dog ​​numbers were assigned chronologically in the order in which dogs were enrolled at a given study site. Dogs were considered enrolled in the study if they met the inclusion and exclusion criteria.

[0158] Gross and histopathological examinations were performed in accordance with the U.S. Food and Drug Administration's CVM Guidance Necropsy was performed in accordance with Industry 185. At necropsy, the following tissues (Table 8) were evaluated for gross and histopathological examination and are described in the necropsy report: Samples of brain, heart, lung, liver, spleen, kidney, muscle, bone, small intestine, large intestine, and tissues with gross abnormalities (if present) were collected for microbiological examination. [Table 8]

[0159] All dogs were hospitalized from day 0 (D0) through day 4 (D4) and then optionally admitted for 24–48 hours (at the physician's discretion) after each subsequent treatment for clinical observation. During hospitalization, all study dogs received intravenous (IV) crystalloids at 4 ml / kg / h for 2 hours after C. novyi NT treatment. On the dosing day, all dogs received crystalloids intravenously (IV) at 4 ml / kg / h for 2 hours. Dogs were closely monitored for 6 hours after each IT injection of C. novyi-NT spores. At the next visit (day 4), all dogs received subcutaneous (SQ) crystalloids at 20 ml / kg. If a dog was hospitalized and received IV crystalloids on the day SQ crystalloids should have been administered, SQ administration was not required.

[0160] Study visits and events for an example four-dose treatment regimen are summarized in Table 9. When dogs were to be treated with repeat dosing, the dosing interval was proposed to be on a weekly basis. During the course of the study, delays in treatment occurred with repeat dosing due to adverse events or investigator discretion. [Table 9-1] [Table 9-2]

[0161] Sixteen dogs were enrolled in the study: nine neutered males, one intact male, and six neutered females (Table 6). Their demographic data and tumor characteristics are shown in Table 6. The enrolled cases represented a variety of breeds, weights, and ages. The cases were previously diagnosed with naturally occurring cancers of varying histological origin: 13 dogs had a diagnosis of soft tissue sarcoma (81.3%), one osteosarcoma (6.3%), one melanoma (6.3%), and one mast cell tumor (6.3%). Histologic subtypes were available for 11 of the 13 soft tissue sarcomas: four hemangiopericytomas (30.8%), three peripheral nerve sheath tumors (23.1%), one synovial cell sarcoma (7.7%), one myxosarcoma (7.7%), one rhabdomyosarcoma (7.7%), and one fibrosarcoma (7.7%). The mean weight of the study dogs was 29.4 kg (range 8.1-44.3 kg), and the mean age was 10.9 years (range 7.2-14.3 years). Thirteen dogs had a diagnosis of soft tissue sarcoma, and one each of osteosarcoma, malignant melanoma, and mast cell tumor. Of the 13 soft tissue sarcomas, six were available for immunohistochemistry (IHC). All six cases were positive for S100 and negative for smooth muscle actin, suggesting a diagnosis of a sarcoma subtype called peripheral nerve sheath tumor. Seven tumors were grade I, five were grade II, and four were grade III. Eight dogs had previously been surgically treated for their cancer.

[0162] Preparation of C. novyi-NT spores and IT injection into spontaneous canine tumors C. novyi-NT spores for use in comparative canine studies were produced as previously described (Dang et al., 2001; Bettegowda et al., 2006). Briefly, bacteria were cultured in sporulation medium for at least 2 weeks to ensure maximum yield of mature spores. Mature spores were purified through two sequential Percoll gradients, followed by four washes and resuspension in PBS. Sterility testing of the final product was performed by culturing the product in soybean-casein digest medium and thioglycollate medium according to FDA 21 CFR 610.12 guidelines (Nelson Laboratories, Salt Lake City, UT). Germination efficiency assays were performed under anaerobic conditions on Brucella agar supplemented with 5% horse blood to ensure that spores met pre-established viability criteria. Spores were placed in sterile 1.8 mL cryovials with O-ring sealed screw caps (Simport, Beloeil, Canada) at a volume of 1000 μL and 1 × 10 9 The spores were packaged at a concentration of 100 spores / mL. C. novyi-NT cryovials were stored at 2–8°C. For dosing, 0.4 mL aliquots of the stock spore solution were packaged in 0.5 mL cryovials. After dosing, the cryovials and unused C. novyi-NT spores were disposed of according to applicable regulations for disposal of biosafety level 2 materials. Prior to IT injection, the spores were resuspended by vortex mixing at maximum speed for 10 seconds, a total of three times, and then drawn into a 1 mL syringe. The injection site was prepared aseptically. When available, ultrasound or computed tomography (CT) was used to identify necrotic areas of the tumor. If no necrotic areas were identified, the injection was directed toward the center of the tumor. A needle was inserted once within the predefined area, and 100 μL of the spore suspension (1 × 10 8 The injection was administered with even pressure. The needle was slowly withdrawn and the injection site was disinfected. All dogs received 1 x 10 spores in 100 μL of saline. 8At least one cycle of IT dosing (biosurgery) of spores was administered: 3 dogs received a single treatment cycle, and 13 dogs received more than one, up to four treatment cycles. Dogs could receive up to four cycles of biosurgery, with a one-week interval between cycles. Treated dogs were followed for at least 90 days after the first IT injection. Extended follow-up for disease progression and survival was warranted, if available. Early discontinuation of the study was permitted for toxicity or progressive disease.

[0163] Study evaluations were performed as described in Table 9. Prescreening evaluations were performed 1-14 days before the first cycle of biosurgery. Dogs were monitored regularly throughout the study on both an inpatient and outpatient basis. Laboratory samples were collected as specified in Table 9 and included complete blood count, serum biochemistry, prothrombin time, partial thromboplastin time, and urinalysis. Imaging was performed at screening and included regional CT, chest radiography, and abdominal ultrasound. Further imaging may be performed during the study at the investigator's discretion.

[0164] Adverse events were evaluated using the Veterinary Co-operative Oncology Group - Common Terminology Criteria for Adverse Events (VCOG-CTCAE) v1.0 (Veterinary Co-operative Oncology Group, 2004) when possible, and the terminology of the Veterinary Dictionary for Drug Related Affairs (VeDDRA) rev. 4 (European Medicines Agency, 2012). The terminology for adverse events (target lesion reactions) related to C. novyi-NT germination is defined in Table 10. Clinical observations without appropriate VeDDRA or target lesion reaction terminology were classified separately as non-coding signs (Table 11). The relevance of events to C. novyi-NT therapy was determined by the reporting investigator. [Table 10-1] [Table 10-2] [Table 11]

[0165] Measurements of the maximum diameter of the target (injected) lesion were performed on days 0, 7, 14, 21, 60, and 90 after treatment (Table 9). Non-target and new lesions were recorded but not measured. Best overall tumor response was assessed at or after the 21-day study visit: complete response (CR) was defined as complete disappearance of the target lesion; partial response (PR) was defined as at least a 30% reduction in the maximum diameter of the target lesion; and progressive target disease (PD) was defined as at least a 20% increase in the maximum diameter of the target lesion or the appearance of new non-target lesions. Stable disease (SD) was defined as a reduction or increase in the maximum diameter of the target lesion that was insufficient to qualify for CR, PR, or PD. In the case of C. novyi-NT-associated abscesses, medical or surgical clearance of necrotic tissue was at the discretion of the investigator.

[0166] Surgical and necropsy specimens were evaluated by a board-certified veterinary pathologist. Tissue specimens were fixed in 10% neutral-buffered formalin and embedded in paraffin. Slides were stained with H&E and / or Gram stain, and slides were prepared for evaluation according to standard procedure guidelines. For immunohistochemistry (IHC), formalin-fixed, paraffin-embedded tumor tissues were sectioned at 5 μm, deparaffinized in xylene, and rehydrated through graded alcohols. Antigen retrieval was performed using unmasking solution (Vector Laboratories, Burlingame, CA). Primary antibodies S100 (DAKO, Carpinteria, CA) and anti-smooth muscle actin (DAKO, Carpinteria, CA) were used at 1:100. DAB-labeled secondary antibodies (Vector Laboratories, Burlingame, CA) were used at a dilution of 1:500. Sections were incubated with ABC reagent (Vector Laboratories, Burlingame, CA) and counterstained with hematoxylin. Tumor grades were assigned based on published criteria (Dennis et al., 2011; Patnaik et al., 1984; Smedley et al., 2011; Sabattini et al., 2014).

[0167] Example 7 Intratumoral (IT) administration of C. novyi-NT - Study 1 results All dogs underwent at least one cycle of biosurgery, 53 of a planned maximum of 64 cycles. Most dogs (10 of 16) underwent the intended four cycles. Biosurgery cycles were typically separated by 1 week. No placebo control or masking was used.

[0168] Dogs that showed early tumor response, toxicity, or progressive disease after the first cycle were discontinued from subsequent cycles. The most common adverse events were consistent with local infection at the C. novyi-NT spore injection site and included fever (17 cases), tumor inflammation (12 cases), tumor abscess (10 cases), refusal to eat (9 cases), and lethargy (6 cases) (Table 12). Clinical signs of an inflammatory response at the injection target lesion site were observed in 14 of 16 dogs (87.5%) and included tumor inflammation (12 / 14), tumor abscess (7 / 14), tumor pain (5 / 14), and tumor discharge (4 / 14) (Table 13). [Table 12-1] [Table 12-2] [Table 13] a Clinical evidence of C. novyi-NT germination on or after day 0 of the study, including target lesion response (Figure 5). b After Study Day 21, the best response to target lesions as defined in the study protocol is: CR - complete response; PR - partial response; SD - stable disease; PD - progressive disease; NE - not evaluable for response on Study Day 21 or thereafter.

[0169] Early-onset adverse events Early-onset adverse events refer to events occurring within the first 7 days after the first treatment cycle (13 dogs) or a single treatment cycle (3 dogs). Multiple cases of various adverse events (AEs) were observed. Early-onset adverse events occurring within 7 days after either the first treatment cycle (13 dogs that received multiple cycles) or a single treatment cycle (3 dogs that received only one cycle) are summarized in Table 14. [Table 14]

[0170] Common early adverse event findings included target tumor lesion reactions, changes in systemic signs and symptoms, and hematologic and lymphatic abnormalities. Most early adverse events were mild to moderate (grade I-II), with tumor inflammation, anorexia, tumor edema, and fever being the most commonly observed events. Grade III tumor abscess and grade III tumor inflammation were observed in two cases (10-R02 and 16-R03). Early adverse event findings appear consistent with the expected tumor inflammatory response resulting from the mechanism of action of C. novyi-NT therapeutics.

[0171] Late-onset adverse events A subset of three dogs received only one treatment cycle (as of December 2, 2012). Late-onset adverse events, defined as events occurring 7 days or more after a single treatment cycle, are summarized in Table 15 for three dogs (04-R04, 10-R02, and 11-R01). Most late-onset adverse events were mild to moderate (Grade I-II), with 11 of the 12 late-onset findings observed in a single subject, 04-R04. This dog presented with a chondroblastic osteosarcoma in the right forelimb with an LD measurement of 94.5 mm at baseline (CT measurements unavailable). Due to progressive disease, amputation was performed 20 days after C. novyi-NT spore injection. The other two subjects tolerated the single treatment cycle well. Late-onset AEs were exclusively limited to mild fever (Grade I). [Table 15]

[0172] In summary, 1 x 10 8 The safety profile observed after one treatment cycle of IT administration of C. novyi-NT spores suggested good tolerability. Early and late-onset adverse events were consistent with the expected tumor inflammatory response due to the mechanism of action of C. novyi-NT. Adverse events were monitored and effectively managed as disclosed herein.

[0173] Adverse events observed in dogs receiving multiple treatment cycles of IT C. novyi-NT are summarized in Table 9 for any grade adverse events (AEs) and in Table 10 for the Grade III AEs listed above.

[0174] The diversity and occurrence of these adverse events after multiple treatment cycles was broadly similar to that observed after a single treatment cycle. Similarly, the occurrence of events appeared largely consistent with that observed after a single treatment cycle: of 169 findings across all cases, only 30 were observed more than 7 days after the prior dose. Similarly, tumor inflammation, anorexia, and fever were the most commonly observed events. Adverse events occurring in more than one case included: target lesion reactions, changes in systemic signs and symptoms, blood and lymphatic system abnormalities, difficulty walking, hypertension, lymphadenopathy, diarrhea, and new masses. Most (approximately 95%) findings were mild to moderate in intensity (Grade I-II).

[0175] Severe adverse events Severe adverse events (grade III or higher) were observed in five cases (Table 16). Subject 04-R05 developed a grade III neutrophil count increase. Subject 10-R01 developed grade III anemia, lethargy, muscle weakness, myositis, pain, and recumbency. Widespread metastatic disease was not observed at baseline but was diagnosed after autopsy in case 10-R01 on day 60; progressive disease in this case may have influenced the adverse event findings. Subject 10-R02 developed a grade III tumor abscess. Subject 11-R01 developed a grade IV platelet count decrease 93 days after the first treatment cycle, which resolved without intervention. The symptoms resolved 21 days after the day 93 visit without any medical treatment. Of note, this subject also exhibited grade I and grade III symptomatic thrombocytopenia at screening and baseline, respectively. Subject 16-R03 experienced grade III diarrhea, difficulty walking, and tumor inflammation, which resolved within 1 week. [Table 16]

[0176] Two dogs had new masses noted during the study: a rectal mass was identified in subject 04-R04 on day 82, and a T1 lytic spinal lesion was identified in subject 10-R01 on day 9. Such findings may represent metastasis or a second, distinct pathology. The relationship of both cases to C. novyi-NT therapy was unknown.

[0177] Response to C. novyi-NT therapy In summary, 1 × 10 per treatment cycle 8 C. novyi-NT IT treatment in pet dogs with up to four cycles of spore doses was well tolerated. Most adverse events higher than grade III, possibly or possibly drug-related, resolved within one week. Anticipated adverse events were primarily associated with local inflammatory changes after intratumoral treatment and generally resolved within one week. Adverse events and serious adverse events were monitored and effectively managed as disclosed herein.

[0178] Given that C. novyi-NT IT administration was accompanied by evidence of widespread biological activity, a preliminary assessment of primary tumor response was performed using RECIST 1.1 and is summarized in Table 17 below. [Table 17-1] [Table 17-2]

[0179] Dogs were evaluated for best response on or after Day 21 of the study. Three dogs had a complete response (CR) to treatment, three had a partial response (PR), five had stable disease (SD), and three had progressive disease (PD). Two dogs (04-R04 and 04-R08) were not evaluable for response because the injected tumors were surgically removed before Day 21. The objective response rate to biosurgery was 37.5% (6 of 16 dogs; 95 percent confidence interval: 15.2–64.6%). Tumor abscesses and responses occurred after one to four cycles of biosurgery. Dog 11-R01 had a PR after a single cycle, 04-R03 had a CR after three cycles, dogs 04-R02 and 04-R05 had a PR after four cycles, and 04-R01 and 04-R06 had a CR after four cycles. Figures 7A–F and 8A–F show representative changes in dogs with a partial response (11-R01) and a complete response (04-R03), respectively. Abscess resolution occurred with debridement, leading to complete wound healing after 2–4 weeks. However, overt abscess formation was not always observed before an objective response. Dogs 04-R01 and 04-R06 underwent four cycles of biosurgery, and tumor inflammation but no abscess formation was observed by the study visit on day 21. Nevertheless, complete responses were observed in these two dogs at study visits on days 42 (unscheduled visit) and 60, respectively.

[0180] Each subject is discussed in more detail below.

[0181] Andy (11-R01, Figures 7A–F), a 10-year-old neutered male Maltese, presented with a grade II soft tissue sarcoma on the left ear pinna. The dog's treatment history included surgery prior to enrollment. The dog received a single dose of C. novyi-NT spores on June 18, 2012. Andy developed a grade I tumor swelling on day 1 (June 19, 2012). Abscess formation led to tumor ulceration and secretion of purulent necrotic material. The resulting wound healed without complications. During the extended follow-up period, grade IV thrombocytopenia was observed on day 93 (September 19, 2012), which had resolved at a routine follow-up visit several weeks later. After wound healing, an approximately 8 mm thickened skin area remained. (See Figure 9 for the time course of tumor measurements over the course of the study.) This may have been scar tissue or residual tumor.

[0182] Molly (11-R02), a 12-year-old neutered female Labrador retriever, presented with a grade II soft tissue sarcoma in the left stifle joint. The dog had no prior treatment history. The dog received three cycles of IT C. novyi-NT spores followed by one IV dose of 1 × 10 8 C. novyi-NT spores were administered 7 days after the third IT dose. This dog's first, second, and third IT doses were administered on July 11, 18, and 25, 2012, respectively. Due to lack of biological activity with the previous IT doses, a single IV dose of C. novyi-NT spores was administered on August 1, 2012. The only adverse event observed was grade I hypertension after the third IT dose. The hypertension was transient and self-limiting, resolving within 1 hour. Molly's tumor was surgically removed on day 30 (August 10, 2012) for histological analysis. The mass was confirmed to be a soft tissue sarcoma with areas of necrosis and inflammation. Gram staining showed no bacteria, confirming the lack of biological activity in this case.

[0183] Ricky (10-R01), a 13-year-old neutered male golden retriever, presented with oral melanoma. His treatment history included surgery prior to enrollment. He received two cycles of IT C. novyi-NT spores. IT C. novyi-NT treatments were administered on August 2, 2012, and August 9, 2012. On day 9 (August 11, 2012), two days after the second treatment cycle, Ricky suddenly developed neck pain and hindlimb neuropathy. Grade III anemia was also noted. An MRI was performed, revealing possible cervical panniculitis and cervical spinal cord compression. Corticosteroids and gastrointestinal protective agents were administered, and Ricky recovered within 3 days. No change was observed in the oral melanoma, and no further C. novyi-NT treatments were administered. On Day 21 (August 23, 2012), an MRI was performed and showed improvement in the previously described panniculitis; however, a chest CT scan revealed a metastatic pulmonary nodule. An excision of the oral melanoma was performed. Human tyrosinase melanoma vaccine was initiated on August 30, 2012. On Day 42 (September 13, 2012), Ricky presented with recurrent neck pain and forelimb pain 2 weeks after melanoma vaccination (2 weeks after discontinuation of corticosteroids). Four days later, medication management with analgesics did not result in improvement, so corticosteroids were restarted. On Day 46, grade III anemia and elevated BUN were noted. A suspected gastrointestinal bleed was treated with gastrointestinal protective agents. On Day 60, Ricky collapsed and vomited blood. He was humanely euthanized. Autopsy revealed disseminated metastatic melanoma involving the submandibular, mediastinal, and mesenteric lymph nodes, kidneys, and perispinal fat within the cervical region. There was no evidence of intragastric or intestinal ulceration. The presumed cause of these two episodes of spinal pain is metastatic melanoma. The association with C. novyi-NT is uncertain.

[0184] Finnegan (04-R02), an 11-year-old full-length male golden retriever, presented with a soft tissue sarcoma (hemangiopericytoma) on the right lateral metacarpal region. The dog's treatment history included surgery prior to enrollment. The dog received four cycles of IT C. novyi-NT spores. Adverse events were mild and well tolerated. After four treatment cycles, complete tumor removal was achieved, leaving a margin of normal tissue surrounding the tumor site. Finnegan received his first, second, third, and fourth treatment cycles on August 3, 2012, August 10, 2012, August 17, 2012, and August 24, 2012, respectively. The only grade I adverse events associated with C. novyi-NT administration were reported after the first, second, and third cycles. Grade I and II adverse events were observed 48 hours after the fourth dose. Tumor infection was noted, consisting of fever, leukocytosis, neutrophilia, and tumor-related pain and abscess formation. The infection progressed to abscess formation, and removal of the entire tumor with minimal debridement was performed 96 hours after the fourth dose. Tumor measurements were recorded in the morning at this visit, and the macroscopic tumor was completely removed the following day. On day 25 (August 28, 2012), amputation of the limb was performed rather than open wound management, and antibiotics were administered. Ninety-four days (November 5, 2012) after the dog's initial procedure, Finnegan recovered uneventfully from surgery and remains macroscopically tumor-free.

[0185] Drake (04-R01, Figure 10A), a 7-year-old neutered male golden retriever, presented with a soft tissue sarcoma (fibrosarcoma) in the right midmaxilla. The dog had no prior treatment history prior to enrollment. He received four cycles of IT C. novyi-NT spores. Adverse events were mild and well tolerated. After four cycles, complete tumor removal was achieved, leaving a margin of normal tissue surrounding the tumor site. Drake received his first, second, third, and fourth treatments on August 13, 2012, August 20, 2012, August 27, 2012, and September 4, 2012, respectively. The interval between the first, second, and third doses was 7 days; however, the interval between the third and fourth doses was 8 days to observe a national holiday. Administration of C. novyi-NT was associated with mild adverse events, including grade I lethargy and anorexia and grade II vomiting and bloody stools, reported 24–48 hours after the first cycle. These AEs were successfully treated with antiemetics and antibiotics. AEs, including grade I tumor pain and swelling, were noted within 24 hours of the fourth dose. No further evidence of tumor infection or abscess formation was observed. On day 60 (October 12, 2012), tumor clearance was evident, and the tumor was no longer measurable (see Figure 10B for the timeline of tumor measurements over the course of the study). The area remained firm and slightly swollen, and a CT scan was performed. On day 86 (November 7, 2012) after the first dose, Drake remains tumor-free.

[0186] Baxter (04-R03, Figure 8A-F), a 9-year-old neutered male Boxer, presented with a grade II soft tissue sarcoma on the left medial forearm. The dog had no prior treatment history. He received three cycles of IT C. novyi-NT spores. Adverse events were mild and well tolerated. After the three injections, complete tumor removal was achieved, leaving a margin of normal tissue around the tumor site. Baxter received the first, second, and third doses of C. novyi-NT spores on August 17, 2012, August 24, 2012, and August 31, 2012, respectively. C. novyi-NT administration was well tolerated, and no study drug-related toxicity was reported after the first or second dose. A study-related adverse event was observed 24 hours after the third dose. The adverse event was accompanied by tumor infection and consisted of fever, anorexia, lethargy, and tumor-related pain, swelling, and bleeding. The adverse event was mild (Grade II or less) and managed with supportive care and analgesics. The C. novyi-NT-associated tumor infection progressed throughout the tumor, resulting in abscess formation. Surgical debridement of the tumor on September 2, 2012, resulted in rapid resolution of the AE. Wound healing was uncomplicated and complete by October 16, 2012. As of 94 days after initial treatment (November 19, 2012), Baxter remains grossly tumor-free (see Figure 11 for the timeline of tumor measurements over the course of the study).

[0187] Harley (26-R01), a 7-year-old neutered male Labrador retriever, presented with a grade II soft tissue sarcoma (hemangiopericytoma) on his right paw. The dog had no prior treatment history. He received four cycles of IT C. novyi-NT spores. The first, second, third, and fourth doses were administered on August 20, 2012, August 27, 2012, September 4, 2012, and September 10, 2012. The interval between doses was 6–8 days. An elevated baseline temperature was observed during the first and second doses. IT treatment with C. novyi-NT spores was well tolerated, and no adverse events were reported. There was no response to treatment.

[0188] Ursula (04-R-04), an 11-year-old spayed female Saint Bernard mix, presented with chondroblastic osteosarcoma of the right forelimb. Her treatment history included surgery prior to enrollment. She received a single IT dose of C. novyi-NT spores. At enrollment, no metastatic disease was present. After the initial treatment on August 31, 2012, tumor abscess formation and peritumoral inflammation became evident within the first 24 hours and were managed with analgesics, warm compresses, and intravenous crystalloid solutions. No improvement was observed, and the tumor / abscess was excised on day 2 (September 2, 2012). A moderate amount of serous fluid was present. C. novyi was isolated from anaerobic culture. Antibiotic treatment was initiated on day 4 (September 4, 2012). The incision was managed as an open wound until day 20 (September 20, 2012), at which time amputation was performed for progressive disease. Histopathology revealed residual chondroblastic osteosarcoma along with severe necrosis and hemorrhage. After amputation, infection at the incision site was noted. Cultures did not demonstrate C. novyi. No adjuvant therapy was administered after amputation. On day 81 (November 21, 2012), Ursula presented with rectal prolapse and was found to have rectal polyps. A chest radiograph performed at this evaluation revealed pulmonary metastases.

[0189] Gabriel (16-R02), a 9-year-old neutered male Labrador retriever, presented with a grade I soft tissue sarcoma of the left lateral thigh. The dog's treatment history included surgery prior to enrollment. The dog received four cycles of IT C. novyi-NT spores. IT administration of C. novyi-NT was generally well tolerated, with a one-week delay between the first and second doses due to grade II diarrhea that responded to medical management. Gabriel received his first, second, third, and fourth doses on September 12, 2012, September 26, 2012, October 3, 2012, and October 10, 2012, respectively. Toxicity was mild and consisted primarily of diarrhea and structural signs. Grade II diarrhea was observed after each dose and responded well to medical management. After the first dose, dosing was delayed by one week, resulting in a 14-day interval between the first and second doses. Grade II diarrhea on subsequent doses was not delayed. Furthermore, grade II tumor swelling was observed on day 4 (September 16, 2012). Tumor size remained stable from D0 (September 12, 2012) to the most recent study visit, D63 (November 14, 2012).

[0190] Buddy (04-R05), a 13-year-old neutered male Shetland sheepdog, presented with a soft tissue sarcoma (rhabdomyosarcoma) on his right forearm. The dog's treatment history included surgery, chemotherapy, and a prior C. novyi-NT clinical trial prior to enrollment. No metastatic disease was noted at the time of study enrollment. The dog received four cycles of IT C. novyi-NT spores. The only clinically significant adverse events associated with C. novyi-NT were grade III neutropenia and fever after the third treatment cycle. This event resolved within 48 hours of medical management with intravenous antibiotics and fluid therapy. Buddy received his first, second, third, and fourth treatment cycles on September 20, 2012, September 27, 2012, October 5, 2012, and October 12, 2012. Mild tumor inflammation (erythema, warmth, swelling) was observed during two of the four cycles. A transient reduction in tumor size was observed on Day 4 (September 24, 2012). A new non-target lesion was observed near the primary tumor site on Day 21 (October 12, 2012). The primary target tumor remained stable on Day 61.

[0191] Amber (16-R03), a 10-year-old neutered female German Shepherd, presented with a grade I soft tissue sarcoma on the palmar and dorsal aspects of her left paw. Her treatment history included surgery prior to enrollment. She received four cycles of IT C. novyi-NT spores. The first, second, third, and fourth doses were administered on September 26, 2012, October 3, 2012, October 15, 2012, and October 24, 2012. The interval between doses was 7 to 12 days. Amber developed grade II tumor swelling and pain after the first and second doses. Grade I anorexia was noted on day 2 (September 28, 2012). On Day 8 (October 4, 2012, 1 day after the second dose), the dog experienced grade I fever, grade II tumor warmth, and grade III lameness. The dog's tumor was incised, and analgesics were administered. On Day 11 (October 7, 2012), grade III diarrhea was observed and managed with medication. Due to tumor-related adverse events and diarrhea, the third dose was delayed until Day 19 (October 15, 2012). Grade II tumor swelling was observed again on Day 19 after the third dose of C. novyi-NT and was managed with analgesics. No adverse events were observed after the fourth dose.

[0192] Six (11-R04), a 9-year-old neutered male husky, presented with a grade I soft tissue sarcoma in his right paw. He had no prior treatment history. He received four cycles of IT C. novyi-NT spores. Six received the first, second, third, and fourth doses on October 1, 2012, October 8, 2012, October 15, 2012, and October 22, 2012, respectively. The administered C. novyi-NT spores were well tolerated, and only mild adverse events were observed. After the first dose, grade I hypertension and fever were observed. The fever and hypertension were self-limiting and resolved within 1 and 2 hours of dosing, respectively. On Day 4 (October 5, 2012), the tumor was subjectively softened, and a small area of ​​ulceration (Grade I) was observed at the site of the previous biopsy. The ulceration continued until the most recent study visit, Day 31 (November 1, 2012). This ulceration may have been secondary to either the study medication or a complication of the biopsy required for study enrollment.

[0193] Belle (04-R06), an 11-year-old spayed female Labrador retriever, presented with a mast cell tumor (initially aspirated as a soft tissue sarcoma) in the right hind third toe with popliteal lymph node metastasis. The dog had no prior treatment history prior to enrollment. She received four cycles of IT C. novyi-NT spores. Adverse events were mild and limited to grade I fever and grade I tumor inflammation. Belle received her first, second, third, and fourth treatment cycles on October 19, 2012, October 26, 2012, November 2, 2012, and November 9, 2012. Grade I fever and tumor inflammation were associated with C. novyi-NT treatment. Fever and inflammation were self-resolving and required no extraprotocol medication management, except for subcutaneous fluid administration at scheduled study visits. Tumor ulceration was observed on Day 21 (November 9, 2012). Photographs of the tumor sent by the dog's owner to the investigator showed resolution of the ulceration and significant regression of the mass. Tumor response was assessed at an unscheduled visit on Day 46 (December 4, 2012). Complete regression of the tumor was observed.

[0194] Frida (11-R01), a 7-year-old spayed female German Shepherd mix, presented with a soft tissue sarcoma (hemangiopericytoma) in her right hind leg with possible lymph node metastasis (based on CT scan). Her treatment history included surgery prior to enrollment. The dog traveled with her owner from Mexico to participate in this clinical trial. She received three cycles of intravenous C. novyi-NT spores. Adverse events were limited to a waxing and waning fever over 48 hours, which resolved with intravenous fluids and NSAIDs. Frida received her first, second, and third treatment cycles on November 6, 2012, November 14, 2012, and November 21, 2012. The only significant adverse event included grade I fever, which required hospitalization and infusion (starting on day 4 (November 10, 2012)), and progressed to grade II fever on day 5 (November 11, 2012). The fever resolved after 48 hours. Grade I fever recurred after the third treatment cycle on day 18 (November 24, 2012). An immediate amputation was performed on day 21 (November 27, 2012) due to tumor progression.

[0195] Mhija (01-R02), a 7-year-old neutered male Border Collie, presented with a soft tissue sarcoma (peripheral nerve sheath tumor) on the left thoracic flank. The dog had no prior treatment history. He received three cycles of IT C. novyi-NT spores. Adverse events were mild and well tolerated. Tumor inflammation, fever, and serous to mucopurulent discharge are likely associated with C. novyi-NT activity. A fourth cycle of C. novyi-NT spores is planned. Mhija received the first, second, and third doses on November 12, 2012, November 20, 2012, and November 27, 2012, respectively. The interval between the first and second doses was 8 days; however, the interval between the second and third doses was 7 days. C. novyi-NT administration was associated with mild (grade I-II) toxicity. Grade I nausea and vomiting were observed after the first dose, and grade I anorexia and lethargy were observed after the third dose. The toxicity resolved within a short period of time with medication management. Most toxicity was localized to the tumor site and was grade I or II (fever, inflammation, pruritus, serous to mucopurulent discharge, and erythema) and occurred within 2 days of C. novyi-NT administration. Furthermore, grade I-II abdominal edema was observed 2 days after the first and third doses.

[0196] Tank (10-R02), a 10-year-old neutered male mixed breed, presented with a soft tissue sarcoma (hemangiopericytoma) on his right flank. His treatment history included surgery before enrollment. He received one cycle of IT C. novyi-NT spores on November 12, 2012. Four days after treatment (November 16, 2012), he developed grade I fever, decreased appetite, grade II peritumoral edema, and a grade III tumor abscess. Medical management, including analgesics, IV fluids, and broad-spectrum antibiotics, was used to manage the abscess. The tumor inflammation and peritumoral edema resolved on day 11 (November 23, 2012). On December 3, 2012, Tank underwent a second treatment cycle. The interval between cycles was 21 days. The second dose was delayed due to an antibiotic washout period.

[0197] The time course of tumor measurements for eight dogs is shown in Figure 12A. Figure 12B shows the time course for three cases that were rounded up due to amputation or data cutoff.

[0198] In summary, C. novyi-NT was administered by IT injection at 1 × 10 per cycle. 8 Spore doses administered in up to four treatment cycles demonstrated significant biological and antitumor activity and appeared to be well tolerated in companion dogs with naturally occurring solid tumors. Tumor responses were rapid, with significant tumor necrosis and notable disease regression occurring within days of C. novyi-NT administration. Most adverse events were limited to grade 1 and 2, consistent with the mechanism-based tumor inflammatory response expected with C. novyi-NT therapy. Several cases are currently undergoing long-term follow-up to assess progression and survival.

[0199] Example 8 Intratumoral (IT) administration of C. novyi-NT - Study 2 Methods A study will be conducted to characterize the dose and volume of C. novyi-NT administered by IT injection for the treatment of dogs with solid tumors (excluding osteosarcoma or mast cell tumors).

[0200] Dogs of any weight, breed, sex, or age with solid tumors (excluding osteosarcoma and mastocytoma) were screened for enrollment. Inclusion criteria were similar to those set forth in Example 6, except that each dog had a cytologic or histologic diagnosis of any cancer except osteosarcoma or mastocytoma, and each dog had at least one measurable tumor lesion ≥ 1 cm in greatest diameter.

[0201] At the first screening visit, each dog was assigned a unique study dog ​​identification number consisting of a five-digit numeric code (it is possible that screening dog numbers may not be sequential). The first two digits indicated the study site (01-99), the middle digit indicated study "5," and the last two digits indicated the study dog ​​number within the study site (01-99). For example, the 11th dog enrolled at site 9 was assigned study dog ​​number 09-511. Study dog ​​numbers were assigned chronologically in the order in which dogs were enrolled at a given study site. Dogs were considered enrolled in the study if they met the inclusion and exclusion criteria.

[0202] Gross pathology, histopathology and necropsy were performed as described in Example 6.

[0203] C. novyi-NT spores were prepared at 1 × 10 as indicated above before transport. 8 Each cycle of C. novyi treatment consisted of 1 mL of spore suspension (1 × 10) per injection into a single target lesion. 8 The total number of injections consisted of up to five injections of 1 × 10 8 The spore suspension containing the spores was packaged in individual cryovials for each 1 mL injection, and the vial, syringe, and needle were discarded after each injection.

[0204] The injection scheme is shown in Figure 13. Five 1 mL injection sites (represented by squares) were distributed within the tumor: the center and four injection sites evenly distributed within the tumor. Each 1 mL injection site was further divided into five redirection sites (represented by circles in Figure 13). 200 μL of spore suspension was administered at each redirection site. The needle was first directed toward the center of the injection site and then redirected evenly to the four corners of the injection site without withdrawing the needle. After the first 1 mL injection, the needle was withdrawn and the syringe was discarded. The depth of each injection should be sufficiently distributed to ensure optimal distribution. The recommended syringe size for each injection was 1 mL, and the recommended needle was 22-gauge to 25-gauge. A needle of sufficient length should be selected based on the depth of the tumor lesion.

[0205] All dogs were hospitalized from Days 0 to 2 and then, after each subsequent treatment, were admitted for 24 to 48 hours at the physician's discretion for clinical observation. During hospitalization, all study dogs received intravenous fluids after C. novyi-NT treatment. On the dosing day, all dogs received IV crystalloid fluids at 4 ml / hg / h for 2 hours after treatment with C. novyi-NT.

[0206] Study visits and events for an example 8-cycle treatment regimen are summarized in Table 18. If dogs were intended to be treated with multiple treatment cycles, a weekly dosing interval was suggested. [Table 18] * Owners will leave their dogs at the clinic from D0 to D2, and all dogs will receive IV crystalloids at the clinic. In subsequent cycles, investigators will fill in D according to the number of days from D0 on the study. ** Dogs are administered IV crystalloid fluid. *** Chest radiograph only. † Dogs may not have received 8 cycles. In this study, the decision to continue with subsequent cycles is made on an individual case-by-case basis in consultation between the Medical Director, Investigator, and Sponsor. †† After study completion, if systemic antibiotics were required for management of adverse events, it is recommended that dogs be administered doxycycline at 5–10 mg / kg PO BID for 3 months.

[0207] Example 9 Intratumoral (IT) administration of C. novyi-NT - Study 2 preliminary results As of December 2, 2012, two pet dogs were receiving treatment in the study. Both animals received 5 x 10 per treatment cycle. 8 Spore dose levels were administered at five unique IT injection sites.

[0208] The first dog, Buddy (04-503), a 9-year-old neutered male Belgian Malinois, presented with a soft tissue sarcoma in the left carpus at baseline with an LD measurement of 69 mm (4.4 × 3.3 × 0.7 cm on CT). The dog's treatment history included surgery prior to enrollment. The dog received two cycles of IT C. novyi-NT spores. Adverse events were mild and limited to grade I fever and grade I tumor inflammation. Buddy received his first and second treatment cycles on November 21, 2012, and November 28, 2012. Within 6 hours of the first injection, grade I fever and increased tumor redness, swelling, and pain were noted. The fever resolved within 6 hours after treatment with the NSAID carprofen. On the second day after treatment (November 23, 2012), mild tumor ulceration was noted. On Day 7 (November 28, 2012), a slight decrease in mass size was noted (-12.0%). Each treatment cycle was well tolerated, with no adverse events higher than grade I.

[0209] The second dog, Guinness (04-502), a 9-year-old neutered male Wheaten terrier, presented with a squamous cell carcinoma of the left shoulder with a LD measurement of 122 mm (9.1 × 9.3 × 14.5 cm on CT) at baseline, a low-grade hemangiosarcoma of the hind limb, and evidence of pulmonary metastases (based on CT). The dog's treatment history included surgery prior to enrollment. Pre-existing mitral valve disease was evident based on an echocardiogram performed prior to enrollment. The dog received a single dose of intravenous C. novyi-NT spores on November 28, 2012. Grade III fever was noted within 6 hours of the procedure and was managed with IV fluid therapy. On day 1 (November 29, 2012), a mass abscess, purulent discharge, and neutrophilia were noted. IV fluid therapy was continued, and analgesics (including an NSAID) were initiated. On day 2 (November 30, 2012), progressive tumor swelling and evidence of sepsis (fever, neutropenia, hypoglycemia, hypoalbuminemia) led to accelerated tumor incision and irrigation. Broad-spectrum antibiotics, hetastarch, and human albumin were administered. On day 3 (December 1, 2012), progressive deterioration was noted, and the patient developed respiratory distress. Euthanasia solution was administered. A necropsy was performed. Clinically significant gross findings included proliferative endocarditis, suppurative pulmonary nodules, and generalized subcutaneous hemorrhage and edema. Postmortem aerobic cultures from various tissues and organs (lungs, liver, heart, kidneys, spleen, gastrointestinal tract, and stomach) revealed multiple bacterial growths (Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, and Streptococcus species); anaerobic cultures from all organs and tissues were negative for C. novyi-NT growth, except for tumor tissue and the bladder. Histopathological examination of affected tissues is pending. Septicemic shock is considered the most likely cause of death, and its relationship to C. novyi-NT therapy is unknown at this time.

[0210] Example 10 Intratumoral (IT) administration of C. novyi-NT in humans - Methods Phase I human clinical trial of IT injection of C. novyi-NT spores An open-label, non-randomized, multicenter, Phase I safety study of a single intratumoral injection of C. novyi-NT spores is currently ongoing in patients with treatment-refractory solid tumors. The clinical trial protocol was reviewed and approved by the Institutional Review Board (IRB) at each participating center, and all review steps were conducted under U.S. Food and Drug Administration (FDA) guidance (number NCT01924689). All patients were required to sign a written informed consent form (ICF) before study enrollment.

[0211] The primary objective of this Phase I study was to determine the safety profile, dose-limiting toxicities (DLTs), and maximum tolerated dose (MTD) of IT-injected C. novyi-NT. The antitumor activity of the therapeutic agent was also investigated.

[0212] Preparation and IT injection of C. novyi-NT spores in a phase I study Clinical supply C. novyi-NT spores were placed in single-use, 2-mL sterile, pyrogen-free, type I borosilicate glass vials (having tamper-resistant caps with rubber stoppers and aluminum seals) at 8.52 × 10 8 The product was packaged in a total volume of 1.0 mL at a concentration of spores / mL (suspended in sterile phosphate-buffered saline (PBS)). Vials were stored at 2-8°C in a controlled temperature environment with constant temperature monitoring. GMP product was manufactured and formulated at Omnia Biologies, Inc. (Rockville, MD).

[0213] Once a patient was enrolled in the trial, one vial was shipped to the study site. Further preparation of C. novyi-NT was required, and IT injections were administered the same day. Dilution of the concentrated spore suspension was performed in a designated biological safety cabinet using an appropriately sized sterile saline (0.9%) infusion bag to provide the required dose based on the assigned cohort. The injection volume (3 mL) was then drawn from the saline bag and injected under radiographic guidance. C. novyi-NT spores were injected with an 18-gauge multiprong needle (Quadra-Fuse®, Rex-Medical, Conshohocken, PA).

[0214] Design and conduct of human clinical trials The study was conducted in a standard 3+3 dose-escalation design. Patients had to be diagnosed with advanced solid malignant tumors, and the target tumors had to be measurable, palpable, or palpable under ultrasound or radiography guidance and suitable for percutaneous injection of C. novyi-NT spores. Targeted lesions had a maximum diameter ≥ 1 cm and met RECIST criteria. The test must be measurable as specified per criterion 1.1. Key eligibility criteria included a history of treatment for a refractory malignancy; age at least 18 years; Eastern Cooperative Oncology Group (ECOG) performance status ≤ 2; and the ability to stay within 45 minutes of an emergency room drive and have someone available to care for them for 28 days after IT injection. Key exclusion criteria included pregnancy; primary brain malignancy or brain metastases; clinically significant ascites or clinical evidence or history of portosystemic hypertension or liver cirrhosis; Glasgow Coma Scale (GCS) < 15; serum creatinine level > 1.5 × upper limit of normal (ULN), chronic renal failure requiring hemodialysis or peritoneal dialysis; oxygen saturation (SpO2) < 95% (room air); mean arterial blood pressure (BP) < 70 mmHg; and platelet count ≤ 100,000 / mm3. 3 Hemoglobin <9.0 g / dL; absolute neutrophil count (ANC) <1,000 / mm 3clinically significant pleural, pericardial, or pericardial effusion or any fluid anywhere around the heart more than 1.0 cm; the need for ongoing immunosuppressant treatment; a history of solid organ transplantation; or systemic or localized infection.

[0215] Eligible patients were identified and enrolled in a treatment cohort. Under the protocol, patients remained hospitalized and observed for 8 days after spore administration, then returned to the clinical site for routine follow-up visits over a 12-month period. Safety and efficacy assessments were conducted during this time.

[0216] Clinical response and progression were assessed using RECIST version 1.1. Objective response was measured by serial CT or MRI scans of the injected tumor and distant metastases (up to five target lesions). Safety monitoring for infectious complications or other treatment-related adverse events was ongoing for 12 months.

[0217] Example 11 Intratumoral (IT) administration of C. novyi-NT in humans - Results C. novyi-NT induces rapid local tumor destruction in the first human patient The promising outcomes and favorable risk / benefit profile of biosurgery in the comparative dog trial, combined with those observed in rats, provided a rationale for attempting biosurgery in humans. Therefore, we initiated a Phase I clinical trial in human patients with solid tumors that were either refractory to standard treatments or for which no standard treatments were available (NCT01924689). We report here the first patient enrolled in this trial: a 53-year-old woman diagnosed with retroperitoneal leiomyosarcoma in August 2006. This patient underwent several surgical resections and multiple chemotherapy and radiation treatments, including a right radical nephrectomy and radiation therapy in March 2007, chemotherapy with gemcitabine, taxol, adriamycin, and ifosfamide, resection of liver metastases in November 2008, multiple wedge resection of right-sided lung metastases in December 2009, and trabectedin therapy from March 2010 to April 2011. Treatment included multiple wedge resection of left-sided pulmonary metastases in December 2010, pazopanib treatment in April 2011, left lower lobectomy in October 2011, HAI with Abraxane, gemcitabine, and Avastin from February 2012 to January 2013, everolimus and pazopanib from February 2013 to July 2013, and sterile transcatheter arterial embolization in August 2013 and September 2013. However, the patient's metastatic disease in the liver, lungs, peritoneum, and soft tissues of the right shoulder and adjacent right upper arm progressed.

[0218] Biosurgery is 1 x 10 4 The planned starting dose of C. novyi-NT spores was administered by injection with an 18-gauge multiprong needle into the metastatic tumor in the patient's right shoulder (day 0, November 19, 2013).

[0219] CT-guided intratumoral injection using a tripolar needle Subjects were moderately sedated with fentanyl and Versed for 35 minutes. An 18-gauge Quadra-Fuse device (Rex Medical) (Figure 16A) was used for injection by inserting a tripolar needle (27 g) into the target injection area under CT guidance (Figures 16B and 16C). Three prongs (each with two through-holes and four fluid outlets) (Figure 16D) were dispensed at 4, 3, and 2 cm from the site (Figure 16E), and 1 ml aliquots of C. novyi-NT spore fluid were injected during the stepwise retraction process. Once the dispensed prongs were fully retracted into the needle cannula, the device was removed and hemostasis was achieved by manual pressure.

[0220] On day 1, the patient experienced mild right shoulder pain extending to the scapula, which responded to tramadol and acetaminophen. On day 2, the pain required patient-controlled intravenous hydromorphone analgesia, and the white blood cell count increased to 18,300 / μL. The patient developed fever and a maximum temperature of 39.2°C. On day 3, the patient's right shoulder and scapula pain was difficult to control. The maximum temperature was 37.8°C. A CT scan of the right upper extremity showed extensive tumor destruction, with gas within the soft tissue and bony components of the tumor (Figure 14A). Necrosis of the upper arm was noted. A CT-guided aspirate of the tumor revealed C. novyi-NT growth under anaerobic culture conditions. The patient was then started on antibiotics, and the fever subsided shortly thereafter. On day 4, an MRI of the right upper extremity showed a significant reduction in enhancement compared to baseline, limited to the tumor mass (Figures 14B and 14C). Tumor biopsy revealed numerous gram-positive bacteria and the absence of viable tumor cells. At the time of biopsy, a percutaneous drain was placed into the tumor abscess to drain fluid and debris. The patient remained afebrile, and his white blood cell count gradually normalized. The patient continued antibiotics and was hospitalized for IV analgesia until day 20, at which point he was transitioned to oral analgesics. At discharge, he received oral metronidazole and doxycycline as per protocol. On day 29, a follow-up MRI demonstrated continued reduction in tumor enhancement (Figure 14D). On day 55, the patient presented with localized pain as a result of a pathological fracture of the proximal right humerus induced by the patient's efforts. Subsequent partial humerectomy, debridement, and internal fixation with an intramedullary nail and cement spacer resulted in significant improvement in pain and increased range of motion. Intraoperative cultures revealed C. novyi-NT growth under anaerobic culture conditions. Histopathological examination showed extensive tumor necrosis with a few residual tumor cell foci (Figure 15A-D). The patient continues to be monitored and has an Eastern Cooperative Oncology Group (ECOG) performance status of 1 with no clinical signs of infection.

[0221] literature [Table 19-1] [Table 19-2] [Table 19-3]

[0222] All documents cited in this application are incorporated herein by reference as if fully set forth herein.

[0223] While illustrative embodiments of the present invention have been described herein, it will be understood that the invention is not limited to what has been described and that various other changes or modifications can be made by those skilled in the art without departing from the scope or spirit of the invention.

Claims

1. A composition for slowing the growth of a solid tumor in a human, the composition comprising a unit dose of C. novyi-NT colony forming units (CFUs) comprising 1 x 10 to 1 x 10 CFUs suspended in a pharmaceutically acceptable carrier or solution, the composition being administered intratumorally to the human.

2. The composition of claim 1, wherein the unit dose of C. novyi-NT colony forming units (CFU) comprises 1 x 10 4 CFU.

3. The composition of claim 1, wherein the unit dose of C. novyi-NT colony forming units (CFU) comprises 1 x 10 5 CFU.

4. The composition of claim 1, wherein the unit dose of C. novyi-NT colony forming units (CFU) comprises 1 x 10 6 CFU.

5. The composition of any one of claims 1 to 4, wherein the unit dose of C. novyi-NT colony forming units (CFUs) is the only therapeutic agent in the composition.

6. The composition of any one of claims 1 to 5, comprising a unit dose of C. novyi-NT colony forming units (CFUs) suspended in the pharmaceutically acceptable carrier or solution.

7. The composition described in any one of claims 1 to 6, wherein the solid tumor is selected from the group consisting of soft tissue sarcoma, hepatocellular carcinoma, breast cancer, pancreatic cancer and melanoma.

8. A composition described in any one of claims 1 to 6, wherein the solid tumor is leiomyosarcoma.

9. The composition described in claim 8, wherein the solid tumor is retroperitoneal leiomyosarcoma.

10. The composition of any one of claims 1 to 9, wherein the C. novyi-NT CFU is selected from the group consisting of a vegetative form and a spore form.

11. A composition described in any one of claims 1 to 10, characterized in that the composition is injected into the solid tumor at a single site.

12. A composition described in any one of claims 1 to 10, characterized in that the composition is injected into the solid tumor at multiple unique locations.

13. The composition of any one of claims 1 to 10, wherein the composition is injected into the solid tumor at one to five unique locations.

14. A composition described in any one of claims 1 to 10, characterized in that the composition is injected into the solid tumor at five or more unique sites.

15. The composition of any one of claims 1 to 10, wherein multiple treatment cycles are administered to the human, each treatment cycle comprising injecting one unit dose of the C. novyi-NT CFU into the solid tumor.

16. The composition of any one of claims 1 to 10, wherein 1 to 10 treatment cycles are administered to the human, each treatment cycle comprising injecting one unit dose of the C. novyi-NT CFU into the solid tumor.

17. The composition of claim 15, wherein 2 to 4 treatment cycles are administered.

18. The composition described in claim 15, wherein the interval between each treatment cycle is 5 to 100 days.

19. The composition described in claim 15, wherein the interval between each treatment cycle is 7 days.

20. The composition of any one of claims 1 to 10, wherein an IV infusion is administered to the human before, during, and / or after each dose of the C. novyi-NT CFU.

21. The composition of any one of claims 1 to 10, wherein the human is administered a first course of antibiotics for a duration and at a dosage effective to treat or alleviate adverse side effects caused by the C. novyi-NT.

22. The composition of claim 21, wherein the antibiotic is administered for two weeks after administration of C. novyi-NT.

23. The composition of claim 21 or 22, wherein the antibiotic is selected from the group consisting of amoxicillin, clavulanate, metronidazole and combinations thereof.

24. The composition of any one of claims 21 to 23, wherein the human is administered a second course of antibiotics for a duration and at a dosage effective to treat or alleviate adverse side effects caused by the C. novyi-NT.

25. The composition described in claim 24, wherein the second course of antibiotics is initiated after the completion of the first course of antibiotics and is administered for 1 to 6 months.

26. The composition described in claim 24 or 25, wherein the second course of antibiotics is initiated after the completion of the first course of antibiotics and is administered for three months.

27. ​​A composition described in any one of claims 24 to 26, wherein the antibiotic used in the second course is doxycycline.

28. A composition described in any one of claims 1 to 10, characterized in that a treatment selected from the group consisting of chemotherapy, radiation therapy, immunotherapy and combinations thereof is administered in combination with the composition.

29. The composition described in claim 28, wherein the immunotherapy includes an immune checkpoint inhibitor.

30. The composition described in any one of claims 1 to 29, wherein the solid tumor is resistant to a treatment selected from the group consisting of chemotherapy, radiation therapy, immunotherapy, and combinations thereof.

31. The composition of claim 30, wherein the chemotherapy comprises an agent selected from the group consisting of antimetabolites, microtubule inhibitors, DNA damaging agents, antibiotics, antiangiogenic agents, vascular disrupting agents, molecular targeted agents and combinations thereof.

32. The composition of claim 30, wherein the chemotherapy comprises a drug selected from the group consisting of gemcitabine, taxol, adriamycin, ifosfamide, trabectedin, pazopanib, abraxane, avastin, everolimus, and combinations thereof.

33. A composition described in any one of claims 1 to 32, wherein the solid tumor is refractory to standard treatment or there is no standard treatment available for the solid tumor.

34. A composition described in any one of claims 1 to 33, which induces a strong local inflammatory response and adaptive immune response in the human.

35. A composition for slowing the growth of a solid tumor that has metastasized to one or more sites in a human, said composition comprising a unit dose of C. novyi-NT colony forming units (CFUs) comprising 1 x 10 to 1 x 10 CFUs suspended in a pharmaceutically acceptable carrier or solution, said composition being administered intratumorally to said human.

36. The composition described in claim 35, wherein at least one site is distal to the original solid tumor.

37. A composition for slowing the growth of a solid tumor in a human, the composition comprising unit doses of C. novyi-NT spores containing 1 x 10 to 1 x 10 CFU, each unit dose of C. novyi-NT spores suspended in a pharmaceutically acceptable carrier or solution, the composition being administered intratumorally to the human in one to four cycles.

38. The composition of any one of claims 35-37, wherein the unit dose of C. novyi-NT colony forming units (CFU) comprises 1 x 10 4 CFU.

39. The composition of any one of claims 35-37, wherein the unit dose of C. novyi-NT colony forming units (CFU) comprises 1 x 10 5 CFU.

40. The composition of any one of claims 35-37, wherein the unit dose of C. novyi-NT colony forming units (CFU) comprises 1 x 10 6 CFU.

41. The composition of any one of claims 35-40, wherein the unit dose of C. novyi-NT colony forming units (CFU) is the only therapeutic agent in the composition.

42. The composition of any one of claims 35 to 41, comprising a unit dose of C. novyi-NT colony forming units (CFUs) suspended in the pharmaceutically acceptable carrier or solution.

43. The composition described in any one of claims 35 to 42, wherein the solid tumor is selected from the group consisting of soft tissue sarcoma, hepatocellular carcinoma, breast cancer, pancreatic cancer and melanoma.

44. A kit for slowing the growth of a solid tumor in a human, comprising: a composition comprising a C. novyi-NT CFU unit dose comprising 1 x 10 to 1 x 10 CFU suspended in a pharmaceutically acceptable carrier or solution; and instructions for use of said kit, wherein said composition is administered intratumorally to said human.

45. The kit of claim 44, further comprising one or more antibiotics effective in treating or ameliorating adverse side effects caused by the C. novyi-NT CFU.

46. ​​The kit of claim 44 or 45, wherein the C. novyi-NT CFU is selected from the group consisting of a vegetative form and a spore form.

47. The kit of any one of claims 44 to 46, wherein the unit dose of C. novyi-NT colony forming units (CFU) comprises 1 x 10 4 CFU.

48. The kit of any one of claims 44 to 46, wherein the unit dose of C. novyi-NT colony forming units (CFU) comprises 1 x 10 5 CFU.

49. The kit of any one of claims 44-46, wherein the unit dose of C. novyi-NT colony forming units (CFU) comprises 1 x 10 6 CFU.

50. The kit of any one of claims 44-49, wherein the unit dose of C. novyi-NT colony forming units (CFUs) is the only therapeutic agent in the composition.

51. The kit of any one of claims 44 to 50, comprising a unit dose of C. novyi-NT colony forming units (CFUs) suspended in the pharmaceutically acceptable carrier or solution.

52. The kit of claim 44, further comprising 1 to 4 unit doses of the C. novyi-NT CFU for 1 to 4 treatment cycles.

53. The kit of claim 46, further comprising 1 to 4 unit doses of the spore form of the C. novyi-NT CFU for 1 to 4 treatment cycles.

Images