Nanocapsules for delivery of cell modulating agents

Polymeric nanocapsules with ribonucleoprotein complexes address the inefficiencies in in vivo gene editing by delivering Cas proteins and guide RNAs to hematopoietic stem cells, achieving enhanced genome editing efficacy.

JP7795356B2Active Publication Date: 2026-01-07CENTEON A LLC OF DELAWARE
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
JP2021536372
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2018-12-23
Filing Date
2019-12-23
Publication Date
2026-01-07
Estimated Expiration
2039-12-23

AI Technical Summary

Technical Problem

In vivo delivery of gene editing elements, such as Cas9 and guide RNA, to human primary T cells and hematopoietic stem cells is inefficient, with existing methods like plasmid delivery and electroporation facing technical barriers.

Method used

Development of polymeric nanocapsules containing a ribonucleoprotein complex, comprising a polymeric shell made of positively charged and neutral monomers with a crosslinker, to deliver Cas proteins and guide RNAs specifically to target loci in hematopoietic stem cells.

Benefits of technology

The nanocapsules enable efficient and specific genome editing in hematopoietic stem cells, overcoming delivery challenges and enhancing gene editing efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007795356000040
    Figure 0007795356000040
  • Figure 0007795356000041
    Figure 0007795356000041
  • Figure 0007795356000042
    Figure 0007795356000042
Patent Text Reader

Abstract

The present disclosure relates to a polymer nanocapsule comprising a ribonucleoprotein complex and a method for its delivery.In some embodiments, the polymer nanocapsule comprises a polymer shell and a ribonucleoprotein complex, wherein the polymer shell comprises at least one positively charged monomer, at least one neutral monomer, and a crosslinker.Also disclosed is a conjugate of the polymer nanocapsule linked to one or more targeting moieties and / or one or more stabilizing moieties.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This disclosure claims priority to U.S. Provisional Application No. 62 / 784,503, filed December 23, 2018, which is incorporated by reference herein in its entirety.

[0002] The present disclosure generally relates to gene therapy. More specifically, the present disclosure relates to nanocapsules containing ribonucleoprotein complexes and their application in gene therapy. In particular, the present disclosure relates to nanocapsules containing ribonucleoprotein complexes and their application in hematopoietic stem cells in vivo and / or ex vivo. [Background technology]

[0003] Technologies that enable precise modification of DNA sequences in living cells are valuable for both basic and applied research. Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) is a prokaryotic immune system first discovered by Ishino et al. in Escherichia coli (E. coli) (Non-Patent Document 1). These systems provide bacteria and archaea with immunity against viruses and plasmids by sequence-specifically targeting viral and plasmid nucleic acids.

[0004] There are thought to be two main stages involved in providing the aforementioned immunity: the acquisition stage and the interference stage. The acquisition stage involves cleaving the genomes of invading viruses and plasmids and integrating these segments into the CRISPR loci of bacteria and archaea. The segments integrated into the genome are known as protospacers and help protect the organism from subsequent attacks by the same virus or plasmid. The interference stage involves attacking the invading virus or plasmid. This particular stage is thought to depend on the integrated sequence, called a spacer, which is transcribed into RNA, which then undergoes several processes and then associates with a protein or protein complex that hybridizes with a complementary sequence in the DNA or RNA of the invading polynucleotide (e.g., virus or plasmid) and effectively binds and / or cleaves the DNA or RNA.

[0005] There are several different CRISPR-Cas systems. In Class 2 Type II systems, there are two strands of RNA that are part of the CRISPR-Cas system: CRISPR RNA (crRNA) and trans-activating CRISPR RNA (tracrRNA). The tracrRNA hybridizes to a complementary region of the pre-crRNA, facilitating the maturation of the pre-crRNA into crRNA by RNase III enzyme. The duplex formed by the tracrRNA and crRNA is recognized by a protein, e.g., Cas9, which associates with and directs the crRNA to the target nucleic acid by the sequence of the crRNA that is complementary to and hybridizes to the sequence in the target nucleic acid. These minimal components of an RNA-based immune system are believed to be reprogrammed to target DNA in a site-specific manner using a single protein and two RNA guide polynucleotides or a single RNA molecule.

[0006] In class 2 type V CRISPR systems, a single crRNA sequence is thought to be used to reprogram the Cas protein Cpf1 to target DNA in a site-specific manner.

[0007] Generally, the expression of bacterial Cas9 nuclease and a short RNA containing genomic targeting information (e.g., a 20-base pair sequence) and a structural component for associating with Cas9 itself allows for the precise placement of double-stranded or single-stranded breaks (DSBs or SSBs) at desired locations within the target genome. The CRISPR-Cas system is considered superior to other genome editing methods, such as endonucleases, meganucleases, zinc finger nucleases, and TAL effector nucleases (TALENs), which may require de novo protein design for each new target locus.

[0008] Gene editing techniques such as the CRISPR / Cas9 system have been shown to work well in various cell lines and for germline genome editing (see Non-Patent Document 2). Lentiviral vectors are reasonably flexible, allow targeting of genomic loci, and show great potential for screening guide RNAs (gRNAs) for the CRISPR system, but integration of Cas9 has been shown to have limited potential therapeutic applications (Non-Patent Document 3).

[0009] Several groups have developed adeno-associated virus (AAV) vectors for in vivo gene editing due to their low immunogenicity and broad tropism. However, the packaging capacity and the need for very high titers for delivery to primary cells remain major concerns (see Non-Patent Document 4; Non-Patent Document 5; and Non-Patent Document 6). [Prior art documents] [Non-patent literature]

[0010] [Non-Patent Document 1] Ishino et al., Journal of Bacteriology 169(12):5429-5433 (1987) [Non-patent document 2] Doudna et al., "Genome editing, The new frontier of genome engineering with CRISPR-Cas9," Science 346(6213):1258096 [Non-patent document 3] Hsu et al., "Development and applications of CRISPR-Cas9 for genome engineering," Cell 157(6):1262-1278 [Non-patent document 4] Ran et al., "In vivo genome editing using Staphylococcus aureus Cas9," Nature, April 9, 2015;520(7546);186-91 [Non-patent document 5] Swiech et al., "In vivo interrogation of gene function in the mammalian brain using CRISPR-Cas9," Nat Biotechnol. 2015 January;33(1):102-6 [Non-patent document 6] Cong et al., "Multiplex genome engineering using CRISPR / Cas systems," Science, 2013 Feb. 15;339(6121):819-23 Summary of the Invention [Problem to be solved by the invention]

[0011] Plasmid delivery of Cas9 and single-stranded guide RNA (sgRNA) is efficient in other cell types, but has been shown to ablate only 1–5% of target protein expression in human primary T cells and hematopoietic stem cells (see Mandal et al., “Efficient ablation of genes in human hematopoietic stem and effector cells using CRISPR / Cas9,” Stem Cell, 15(5):643–652). Electroporation of Cas9 ribonucleoproteins has demonstrated efficient and specific genome editing in T cells and stem cells, but technical barriers exist for using electroporation for in vivo studies (see Schumann et al., “Generation of knock-in primary human T cells using Cas9 ribonucleoproteins,” Proc Natl Acad Sci, 2015 Aug. 18;112(33):10437–42). Thus, to date, in vivo delivery of gene editing elements remains a challenge. [Means for solving the problem]

[0012] A first aspect of the present disclosure is a polymeric nanocapsule comprising a polymeric shell and a ribonucleoprotein complex, wherein the polymeric shell comprises at least one positively charged monomer, at least one neutral monomer, and a crosslinker. In some embodiments, the polymeric shell comprises at least two positively charged monomers. In some embodiments, the ribonucleoprotein complex comprises an endonuclease and a guide RNA. In some embodiments, the endonuclease is a Cas protein. In some embodiments, the Cas protein is selected from the group consisting of Cas9, Cas12a, and Cas12b.

[0013] In some embodiments, the guide RNA targets the HPRT locus. In some embodiments, the guide RNA that targets HPRT comprises a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO: 2. In some embodiments, the guide RNA that targets HPRT comprises a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO: 2. In some embodiments, the guide RNA targets the beta globin locus. In some embodiments, the guide RNA that targets beta globin comprises a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO: 3.

[0014] In some embodiments, the guide RNA targeting beta globin comprises a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO: 3. In some embodiments, the guide RNA has at least 90% identity to any one of SEQ ID NOs: 39-54. In some embodiments, the guide RNA has at least 95% identity to any one of SEQ ID NOs: 39-54. In some embodiments, the guide RNA comprises any one of SEQ ID NOs: 39-54. In some embodiments, the guide RNA has at least 90% identity to any one of SEQ ID NOs: 1 and 4-23. In some embodiments, the guide RNA has at least 95% identity to any one of SEQ ID NOs: 1 and 4-23. In some embodiments, the guide RNA comprises any one of SEQ ID NOs: 1 and 4-23.

[0015] In some embodiments, the at least one positively charged monomer is: N-(3-((4-((3-aminopropyl)amino)butyl)amino)propyl)acrylamide, N-(3-((4-((3-aminopropyl)amino)butyl)amino)propyl)methacrylamide, N-(3-((4-aminobutyl)amino)propyl)acrylamide, N-(3-((4-aminobutyl)amino)propyl)methacrylamide, N-(2-((2-aminoethyl)(methyl)amino)ethyl)acrylamide, N-(2-((2-aminoethyl)(methyl)amino)ethyl)methacrylamide, N-(piperazin-1-ylmethyl)acrylamide, N-(piperazin-1-ylmethyl)methacrylamide, N-(2-(bis(2-aminoethyl)amino)ethyl)acrylamide, N-(2-(bis(2-aminoethyl)amino)ethyl)methacrylamide, N-(3-aminopropyl)methacrylamide hydrochloride, 2-(dimethylamino)ethyl acrylate, dimethylaminoethyl methacrylate, (3-acrylamidopropyl)trimethylammonium hydrochloride, 2-aminoethyl methacrylate, 3-(dimethylamino)propyl acrylate, N-[3-(dimethylamino)propyl]methacrylamide, and any combination thereof is selected from the group consisting of:

[0016] In some embodiments, the neutral monomer is selected from N-(1,3-dihydroxy-2-(hydroxymethyl)propan-2-yl)acrylamide, acrylamide, N-(hydroxymethyl)acrylamide, 2-hydroxyethyl acrylate, and 2-hydroxyethyl methacrylate. In some embodiments, the crosslinker is selected from the group consisting of 1,3-glycerol dimethacrylate, N,N'-methylenebisacrylamide, and glycerol 1,3-diglycerolate diacrylate.

[0017] In some embodiments, the polymer nanocapsule further comprises at least one targeting moiety. In some embodiments, the polymer nanocapsule comprises between 2 and 6 targeting moieties. In some embodiments, the at least one targeting moiety is an antibody. In some embodiments, the at least one targeting moiety is an antibody and the polymer nanocapsule comprises between 1 and 3 antibodies. In some embodiments, the polymer nanocapsule comprises at least one stabilizing moiety. In some embodiments, the at least one stabilizing moiety comprises at least one polyethylene glycol group. In some embodiments, the polymer nanocapsule comprises at least one targeting moiety and at least one stabilizing moiety. In some embodiments, the polymer nanocapsule comprises between 2 and 6 targeting moieties and at least 2 and 6 stabilizing moieties. In some embodiments, the at least one targeting moiety is an antibody and the stabilizing moiety comprises at least one polyethylene glycol group.

[0018] In some embodiments, the polymer shell does not include a monomer or crosslinker containing a heterocyclic group, in some embodiments, the polymer shell does not include a monomer or crosslinker containing an imidazole group, in some embodiments, the polymer shell does not include an imidazolylacryloyl monomer.

[0019] A second aspect of the present disclosure provides a composition comprising: (i) a polymeric nanocapsule comprising a polymeric shell and a ribonucleoprotein complex, wherein the polymeric shell comprises at least one positively charged monomer, at least one neutral monomer, and a crosslinker; and (ii) a pharmaceutically acceptable carrier or excipient. In some embodiments, the ribonucleoprotein complex comprises an endonuclease and a guide RNA. In some embodiments, the endonuclease is a Cas protein. In some embodiments, the Cas protein is selected from the group consisting of Cas9, Cas12a, and Cas12b. In some embodiments, the polymeric shell comprises at least two positively charged monomers.

[0020] In some embodiments, the guide RNA targets the HPRT locus. In some embodiments, the guide RNA targeting HPRT comprises a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO: 2. In some embodiments, the guide RNA targeting HPRT comprises a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO: 2. In some embodiments, the guide RNA targets the beta globin locus. In some embodiments, the guide RNA targeting beta globin comprises a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO: 3. In some embodiments, the guide RNA targeting beta globin comprises a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO: 3.

[0021] In some embodiments, the guide RNA has at least 90% identity to any one of SEQ ID NOs: 39-54. In some embodiments, the guide RNA has at least 95% identity to any one of SEQ ID NOs: 39-54. In some embodiments, the guide RNA comprises any one of SEQ ID NOs: 39-54. In some embodiments, the guide RNA has at least 90% identity to any one of SEQ ID NOs: 1 and 4-23. In some embodiments, the guide RNA has at least 95% identity to any one of SEQ ID NOs: 1 and 4-23. In some embodiments, the guide RNA comprises any one of SEQ ID NOs: 1 and 4-23.

[0022] In some embodiments, the polymer shell does not include a monomer or crosslinker containing a heterocyclic group, in some embodiments, the polymer shell does not include a monomer or crosslinker containing an imidazole group, in some embodiments, the polymer shell does not include an imidazolylacryloyl monomer.

[0023] A third aspect of the present disclosure is a modified host cell prepared by contacting a host cell with one or more polymeric nanocapsules, wherein the one or more polymeric nanocapsules comprise a polymer shell and a ribonucleoprotein complex, the polymer shell comprising at least one positively charged monomer, at least one neutral monomer, and a crosslinker. In some embodiments, the polymer shell comprises at least two positively charged monomers. In some embodiments, the host cell is a hematopoietic stem cell. In some embodiments, the hematopoietic stem cell is an allogeneic hematopoietic stem cell. In some embodiments, the hematopoietic stem cell is an autologous hematopoietic stem cell. In some embodiments, the hematopoietic stem cell is a sibling-matched hematopoietic stem cell.

[0024] In some embodiments, the ribonucleoprotein complex comprises an endonuclease and a guide RNA. In some embodiments, the endonuclease is a Cas protein. In some embodiments, the Cas protein is selected from the group consisting of Cas9, Cas12a, and Cas12b. In some embodiments, the guide RNA targets the HPRT locus. In some embodiments, the guide RNA that targets HPRT comprises a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the guide RNA that targets HPRT comprises a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the guide RNA targets the beta globin locus. In some embodiments, the guide RNA that targets beta globin comprises a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO:3.

[0025] In some embodiments, the guide RNA targeting beta globin comprises a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO: 3. In some embodiments, the guide RNA has at least 90% identity to any one of SEQ ID NOs: 39-54. In some embodiments, the guide RNA has at least 95% identity to any one of SEQ ID NOs: 39-54. In some embodiments, the guide RNA comprises any one of SEQ ID NOs: 39-54. In some embodiments, the guide RNA has at least 90% identity to any one of SEQ ID NOs: 1 and 4-23. In some embodiments, the guide RNA has at least 95% identity to any one of SEQ ID NOs: 1 and 4-23. In some embodiments, the guide RNA comprises any one of SEQ ID NOs: 1 and 4-23.

[0026] In some embodiments, the polymeric nanocapsules do not include a monomer or crosslinker that includes a heterocyclic group, hi some embodiments, the polymeric nanocapsules do not include a monomer or crosslinker that includes an imidazole group.

[0027] A fourth embodiment of the present disclosure includes a conjugate comprising: (i) derivatizing a polymer nanocapsule with a first reactive functional group capable of participating in a click chemistry reaction, wherein the polymer nanocapsule has a polymer shell and a ribonucleoprotein complex, the polymer shell comprising at least one positively charged monomer, at least one neutral monomer, and a crosslinker; (ii) derivatizing a targeting moiety with a second reactive functional group capable of participating in a click chemistry reaction with the first reactive functional group; and (iii) reacting the derivatized polymer nanocapsule with a derivatized targeting moiety. and a conjugate prepared according to a method comprising:

[0028] In some embodiments, the polymer shell comprises at least two different positively charged monomers. In some embodiments, the ribonucleoprotein complex comprises a Cas protein and a guide RNA. In some embodiments, the guide RNA targets the HPRT locus. In some embodiments, the guide RNA that targets HPRT comprises a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO: 2. In some embodiments, the guide RNA targets the beta globin locus.

[0029] In some embodiments, the guide RNA targeting beta globin comprises a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO: 3. In some embodiments, the guide RNA has at least 90% identity to any one of SEQ ID NOs: 39-54. In some embodiments, the guide RNA has at least 95% identity to any one of SEQ ID NOs: 39-54. In some embodiments, the guide RNA comprises any one of SEQ ID NOs: 39-54. In some embodiments, the guide RNA has at least 90% identity to any one of SEQ ID NOs: 1 and 4-23. In some embodiments, the guide RNA has at least 95% identity to any one of SEQ ID NOs: 1 and 4-23. In some embodiments, the guide RNA comprises any one of SEQ ID NOs: 1 and 4-23.

[0030] In some embodiments, the polymer shell does not include a monomer or crosslinker containing a heterocyclic group, in some embodiments, the polymer shell does not include a monomer or crosslinker containing an imidazole group, in some embodiments, the polymer shell does not include an imidazolylacryloyl monomer.

[0031] In some embodiments, the targeting moiety has the formula (IIIA): [ka] is derivatized by reacting with a compound of During the ceremony, A is maleimide-C(O)-; A "linker" is a branched or unbranched, straight-chain or cyclic, substituted or unsubstituted, saturated or unsaturated group having between 2 and 40 carbon atoms and optionally having one or more heteroatoms selected from O, N, or S; B is a second reactive functional group selected from the group consisting of dibenzocyclooctyne ("DBCO"), trans-cyclooctene ("TCO"), azide, tetrazine, maleimide, thiol, 1,3-nitrone, aldehyde, ketone, hydrazine, and hydroxylamine.

[0032] In some embodiments, the "linker" has formula (IIIB): [ka] wherein d and e are each independently an integer ranging from 2 to 10; t and u are independently 0 or 1; Q is a bond, O, S, or N(R c )(R d ) and R a and R b are independently H, a C1-C4 alkyl group, or halogen; R c and R d are independently CH or H; X and Y are independently branched or unbranched, saturated or unsaturated groups having between 1 and 4 carbon atoms and optionally one or more O, N, or S heteroatoms.

[0033] In some embodiments, the derivatized polymer nanocapsules have the formula (V): [ka] further reacts with the stabilizing moiety of wherein B is a second reactive functional group selected from the group consisting of dibenzocyclooctyne ("DBCO"), trans-cyclooctene ("TCO"), azide, tetrazine, maleimide, thiol, 1,3-nitrone, aldehyde, ketone, hydrazine, and hydroxylamine; Z is a hydroxyl group, a branched or unbranched C1-C4 alkyl group, -O-alkyl, or -NH2; f and g are independently 0 or an integer ranging from 1 to 4; h is an integer ranging from 1 to 24.

[0034] In some embodiments, the polymer nanocapsules are derivatized with at least three first reactive functional groups. In some embodiments, the first reactive functional groups are one of DBCO, TCO, maleimide, aldehyde, ketone, azide, tetrazine, thiol, 1,3-nitrone, hydrazine, and hydroxylamine. In some embodiments, the first reactive functional group is a DBCO group and the second reactive functional group is an azide group.

[0035] In some embodiments, the targeting moiety is an antibody. In some embodiments, the antibody is selected from the group consisting of an anti-CD4 antibody, an anti-CD8 antibody, and an anti-CD45 antibody. In some embodiments, the conjugate targets cells bearing a cluster of differentiation marker selected from CD3, CD4, CD8, or CD45.

[0036] In some embodiments, the polymer nanocapsules are derivatized with a first reactive functional group by reacting the polymer nanocapsules with a compound containing a disulfide group. ... [ka] is derivatized with a first reactive functional group by reacting with a compound of wherein A is maleimide-C(O)-; "Spacer" is a branched or unbranched, linear or cyclic, substituted or unsubstituted, saturated or unsaturated group having between 2 and 20 carbon atoms and containing a disulfide bond; B is selected from the group consisting of dibenzocyclooctyne ("DBCO"), trans-cyclooctene ("TCO"), azide, tetrazine, maleimide, thiol, 1,3-nitrone, aldehyde, ketone, hydrazine, and hydroxylamine.

[0037] In some embodiments, the "spacer" has the formula (IVB): [ka] having the structure During the ceremony, d is an integer ranging from 2 to 10; t and u are independently 0 or 1; Ra and Rb are independently H, a C1-C4 alkyl group, or a halogen; and X and Y are independently branched or unbranched, saturated or unsaturated groups having between 1 and 8 carbon atoms and optionally one or more O, N, or S heteroatoms.

[0038] A fifth aspect of the present disclosure includes a composition comprising: (a) a conjugate prepared according to a method comprising: (i) derivatizing a polymer nanocapsule with a first reactive functional group capable of participating in a click chemistry reaction, wherein the polymer nanocapsule has a polymer shell and a ribonucleoprotein complex, the polymer shell comprising at least one positively charged monomer, at least one neutral monomer, and a crosslinker; (ii) derivatizing a targeting moiety with a second reactive functional group capable of participating in a click chemistry reaction with the first reactive functional group; and (iii) reacting the derivatized polymer nanocapsule with the derivatized targeting moiety; and (b) a pharmaceutically acceptable carrier or excipient. In some embodiments, the polymer shell comprises at least two positively charged monomers. In some embodiments, the conjugate comprises between two and six targeting moieties. In some embodiments, the ribonucleoprotein complex comprises an endonuclease and a guide RNA. In some embodiments, the endonuclease is a Cas protein. In some embodiments, the Cas protein is selected from the group consisting of Cas9, Cas12a, and Cas12b. In some embodiments, the polymer shell does not include a monomer or crosslinker containing a heterocyclic group. In some embodiments, the polymer shell does not include a monomer or crosslinker containing an imidazole group. In some embodiments, the polymer shell does not include an imidazolylacryloyl monomer.

[0039] A sixth aspect of the present disclosure provides a modified host cell prepared by contacting the host cell with either (i) a polymeric nanocapsule comprising a polymeric shell and a ribonucleoprotein complex, wherein the polymeric shell comprises at least one different positively charged monomer, at least one neutral monomer, and a crosslinker; or (ii) a polymeric nanocapsule conjugate, wherein the conjugate comprises (a) a polymeric shell and a ribonucleoprotein complex, wherein the polymeric shell comprises at least two different positively charged monomers, at least one neutral monomer, and a crosslinker; and (b) a polymeric nanocapsule conjugate comprising one or more targeting moieties and / or one or more stabilizing moieties. In some embodiments, the polymeric shell comprises at least two positively charged monomers. In some embodiments, the host cell is a hematopoietic stem cell. In some embodiments, the hematopoietic stem cell is an allogeneic hematopoietic stem cell. In some embodiments, the hematopoietic stem cell is an autologous hematopoietic stem cell. In some embodiments, the hematopoietic stem cells are sibling-matched hematopoietic stem cells.

[0040] In some embodiments, the ribonucleoprotein complex comprises an endonuclease and a guide RNA. In some embodiments, the endonuclease is a Cas protein. In some embodiments, the Cas protein is selected from the group consisting of Cas9, Cas12a, and Cas12b. In some embodiments, the guide RNA targets the HPRT locus. In some embodiments, the guide RNA that targets HPRT comprises a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the guide RNA that targets HPRT comprises a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the guide RNA targets the beta globin locus. In some embodiments, the guide RNA that targets beta globin comprises a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the guide RNA that targets beta globin comprises a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO:3.

[0041] In some embodiments, the guide RNA has at least 90% identity to any one of SEQ ID NOs: 39-54. In some embodiments, the guide RNA has at least 95% identity to any one of SEQ ID NOs: 39-54. In some embodiments, the guide RNA comprises any one of SEQ ID NOs: 39-54. In some embodiments, the guide RNA has at least 90% identity to any one of SEQ ID NOs: 1 and 4-23. In some embodiments, the guide RNA has at least 95% identity to any one of SEQ ID NOs: 1 and 4-23. In some embodiments, the guide RNA comprises any one of SEQ ID NOs: 1 and 4-23.

[0042] In some embodiments, the polymer shell does not include a monomer or crosslinker containing a heterocyclic group, in some embodiments, the polymer shell does not include a monomer or crosslinker containing an imidazole group, in some embodiments, the polymer shell does not include an imidazolylacryloyl monomer.

[0043] A seventh aspect of the present disclosure provides a method for treating a genetic condition in a human subject in need thereof, the method comprising administering a therapeutically effective amount of modified host cells to the human subject, wherein the host cells are modified by contacting the host cells with either: (i) a polymer nanocapsule comprising a polymer shell and a ribonucleoprotein complex, wherein the polymer shell comprises at least one positively charged monomer, at least one neutral monomer, and a crosslinker; or (ii) a polymer nanocapsule conjugate, wherein the conjugate comprises: (a) a polymer shell and a ribonucleoprotein complex, wherein the polymer shell comprises at least one positively charged monomer, at least one neutral monomer, and a crosslinker; and (b) a polymer nanocapsule conjugate comprising one or more targeting moieties and / or one or more stabilizing moieties. In some embodiments, the polymer shell comprises at least two positively charged monomers. In some embodiments, the host cells are hematopoietic stem cells. In some embodiments, the hematopoietic stem cells are allogeneic hematopoietic stem cells. In some embodiments, the hematopoietic stem cells are autologous hematopoietic stem cells. In some embodiments, the hematopoietic stem cells are sibling-matched hematopoietic stem cells.

[0044] In some embodiments, the ribonucleoprotein complex comprises an endonuclease and a guide RNA. In some embodiments, the endonuclease is a Cas protein. In some embodiments, the Cas protein is selected from the group consisting of Cas9, Cas12a, and Cas12b. In some embodiments, the guide RNA targets the HPRT locus. In some embodiments, the guide RNA that targets HPRT comprises a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the guide RNA that targets HPRT comprises a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the guide RNA targets the beta globin locus. In some embodiments, the guide RNA that targets beta globin comprises a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the guide RNA that targets beta globin comprises a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO:3.

[0045] In some embodiments, the guide RNA has at least 90% identity to any one of SEQ ID NOs: 39-54. In some embodiments, the guide RNA has at least 95% identity to any one of SEQ ID NOs: 39-54. In some embodiments, the guide RNA comprises any one of SEQ ID NOs: 39-54. In some embodiments, the guide RNA has at least 90% identity to any one of SEQ ID NOs: 1 and 4-23. In some embodiments, the guide RNA has at least 95% identity to any one of SEQ ID NOs: 1 and 4-23. In some embodiments, the guide RNA comprises any one of SEQ ID NOs: 1 and 4-23.

[0046] In some embodiments, the polymer shell does not include a monomer or crosslinker containing a heterocyclic group, in some embodiments, the polymer shell does not include a monomer or crosslinker containing an imidazole group, in some embodiments, the polymer shell does not include an imidazolylacryloyl monomer.

[0047] In an eighth embodiment of the present disclosure, there is provided a polymeric nanocapsule comprising a polymeric shell and a ribonucleoprotein complex, wherein the polymeric shell comprises: (i) N-(3-((4-((3-aminopropyl)amino)butyl)amino)propyl)acrylamide, and 2-(Dimethylamino)ethyl acrylate; At least one of; (ii) acrylamide or a derivative thereof; and (iii) a polymer nanocapsule comprising a crosslinker.

[0048] In some embodiments, the polymer shell comprises both N-(3-((4-((3-aminopropyl)amino)butyl)amino)propyl)acrylamide and 2-(dimethylamino)ethyl acrylate. In some embodiments, the crosslinker is an acrylate. In some embodiments, the acrylate is 2-(dimethylamino)ethyl acrylate. In some embodiments, the polymer nanocapsules have a diameter ranging from about 50 nm to about 250 nm. In some embodiments, the polymer nanocapsules have a diameter ranging from about 100 nm to about 200 nm. In some embodiments, the polymer shell does not comprise a monomer or crosslinker containing a heterocyclic group. In some embodiments, the polymer shell does not comprise a monomer or crosslinker containing an imidazole group. In some embodiments, the polymer shell does not comprise an imidazolylacryloyl monomer.

[0049] In some embodiments, the ribonucleoprotein complex comprises an endonuclease and a guide RNA. In some embodiments, the endonuclease is a Cas protein. In some embodiments, the Cas protein is selected from the group consisting of Cas9, Cas12a, and Cas12b.

[0050] In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting HPRT, a gamma globin promoter, and / or beta globin. In some embodiments, the guide RNA targets the HPRT locus. In some embodiments, the guide RNA targeting HPRT comprises a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the guide RNA targeting HPRT comprises a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO:2.

[0051] In some embodiments, the guide RNA targets the beta globin locus. In some embodiments, the guide RNA targeting beta globin comprises a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO: 3. In some embodiments, the guide RNA targeting beta globin comprises a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO: 3.

[0052] In some embodiments, the guide RNA has at least 90% identity to any one of SEQ ID NOs: 39-54. In some embodiments, the guide RNA has at least 95% identity to any one of SEQ ID NOs: 39-54. In some embodiments, the guide RNA comprises any one of SEQ ID NOs: 39-54. In some embodiments, the guide RNA has at least 90% identity to any one of SEQ ID NOs: 1 and 4-23. In some embodiments, the guide RNA has at least 95% identity to any one of SEQ ID NOs: 1 and 4-23. In some embodiments, the guide RNA comprises any one of SEQ ID NOs: 1 and 4-23.

[0053] In some embodiments, the polymer nanocapsule further comprises at least one targeting moiety. In some embodiments, the polymer nanocapsule comprises 2 to 6 targeting moieties. In some embodiments, at least one targeting moiety is linked to the polymer nanocapsule via a spacer comprising a disulfide bond. In some embodiments, at least one targeting moiety is an antibody.

[0054] In some embodiments, the at least one targeting moiety facilitates delivery of the polymeric nanocapsule to a specific cell type, the cell type being selected from the group comprising immune cells, blood cells, heart cells, lung cells, photoreceptor cells, liver cells, kidney cells, brain cells, cells of the central nervous system, cells of the peripheral nervous system, cancer cells, virally infected cells, stem cells, skin cells, intestinal cells, and / or auditory cells. In some embodiments, the cancer cells are cells selected from the group comprising lymphoma cells, solid tumor cells, leukemia cells, bladder cancer cells, breast cancer cells, colon cancer cells, rectal cancer cells, endometrial cancer cells, kidney cancer cells, lung cancer cells, melanoma cells, pancreatic cancer cells, prostate cancer cells, and thyroid cancer cells.

[0055] In some embodiments, the polymer nanocapsule further comprises at least one stabilizing moiety. In some embodiments, the polymer nanocapsule comprises between 2 and 6 stabilizing moieties. In some embodiments, the at least one stabilizing moiety comprises at least one repeating group selected from the group consisting of polyethylene glycol repeating groups and polypropylene glycol repeating groups. In some embodiments, the at least one stabilizing moiety comprises at least two polyethylene glycol repeating groups. In some embodiments, the polymer nanocapsule comprises at least one targeting moiety and at least one stabilizing moiety.

[0056] A ninth aspect of the present disclosure is a polymer nanocapsule conjugate comprising a polymer shell and a ribonucleoprotein complex, wherein the polymer nanocapsule comprises at least one targeting moiety adapted to facilitate delivery of the ribonucleoprotein complex to hematopoietic stem cells. In some embodiments, the targeting moiety is linked to the polymer nanocapsule conjugate via a disulfide bond. In some embodiments, the at least one targeting moiety comprises an antibody. In some embodiments, the polymer nanocapsule conjugate further comprises at least one stabilizing moiety having a hydrophilic group. In some embodiments, the hydrophilic group of at least one stabilizing moiety comprises a polyethylene glycol group. In some embodiments, the hydrophilic group of at least one stabilizing moiety is a polyethylene glycol repeating group.

[0057] In some embodiments, the polymer shell comprises at least one positively charged monomer. In some embodiments, the polymer shell comprises at least two positively charged monomers. In some embodiments, the positively charged monomers are:

[0058] N-(3-((4-((3-aminopropyl)amino)butyl)amino)propyl)acrylamide, N-(3-((4-((3-aminopropyl)amino)butyl)amino)propyl)methacrylamide, N-(3-((4-aminobutyl)amino)propyl)acrylamide, N-(3-((4-aminobutyl)amino)propyl)methacrylamide, N-(2-((2-aminoethyl)(methyl)amino)ethyl)acrylamide, N-(2-((2-aminoethyl)(methyl)amino)ethyl)methacrylamide, N-(piperazin-1-ylmethyl)acrylamide, N-(piperazin-1-ylmethyl)methacrylamide, N-(2-(bis(2-aminoethyl)amino)ethyl)acrylamide, N-(2-(bis(2-aminoethyl)amino)ethyl)methacrylamide, N-(3-aminopropyl)methacrylamide hydrochloride, 2-(dimethylamino)ethyl acrylate, dimethylaminoethyl methacrylate, (3-acrylamidopropyl)trimethylammonium hydrochloride, 2-aminoethyl methacrylate, 3-(dimethylamino)propyl acrylate, N-[3-(dimethylamino)propyl]methacrylamide, and any combination thereof is selected from the group consisting of:

[0059] In some embodiments, the polymer shell further comprises a neutral monomer and a crosslinker. In some embodiments, the polymer shell does not comprise a monomer or crosslinker containing a heterocyclic group. In some embodiments, the polymer shell does not comprise a monomer or crosslinker containing an imidazole group. In some embodiments, the polymer shell does not comprise an imidazolylacryloyl monomer.

[0060] In some embodiments, the ribonucleoprotein complex comprises an endonuclease and a guide RNA. In some embodiments, the endonuclease is a Cas protein. In some embodiments, the Cas protein is selected from the group consisting of Cas9, Cas12a, and Cas12b.

[0061] In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets HPRT, a gamma globin promoter, and / or beta globin. In some embodiments, the guide RNA targets the HPRT locus. In some embodiments, the guide RNA that targets HPRT comprises a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the guide RNA that targets HPRT comprises a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the guide RNA targets the beta globin locus. In some embodiments, the guide RNA that targets beta globin comprises a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the guide RNA that targets beta globin comprises a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO:3.

[0062] In some embodiments, the guide RNA has at least 90% identity to any one of SEQ ID NOs: 39-54. In some embodiments, the guide RNA has at least 95% identity to any one of SEQ ID NOs: 39-54. In some embodiments, the guide RNA comprises any one of SEQ ID NOs: 39-54. In some embodiments, the guide RNA has at least 90% identity to any one of SEQ ID NOs: 1 and 4-23. In some embodiments, the guide RNA has at least 95% identity to any one of SEQ ID NOs: 1 and 4-23. In some embodiments, the guide RNA comprises any one of SEQ ID NOs: 1 and 4-23.

[0063] A tenth aspect of the present disclosure is a pharmaceutical composition comprising a polymer nanocapsule conjugate comprising a polymer shell and a ribonucleoprotein complex, wherein the polymer nanocapsule comprises at least one targeting moiety adapted to facilitate delivery of the ribonucleoprotein complex to hematopoietic stem cells. In some embodiments, the at least one targeting moiety is linked to the polymer nanocapsule conjugate via a disulfide bond. In some embodiments, the polymer nanocapsule further comprises at least one stabilizing moiety having a hydrophilic group, and (ii) a pharmaceutically acceptable carrier or excipient.

[0064] In some embodiments, the polymer shell comprises at least one positively charged monomer. In some embodiments, the polymer shell comprises at least two positively charged monomers. In some embodiments, the positively charged monomers are: N-(3-((4-((3-aminopropyl)amino)butyl)amino)propyl)acrylamide, N-(3-((4-((3-aminopropyl)amino)butyl)amino)propyl)methacrylamide, N-(3-((4-aminobutyl)amino)propyl)acrylamide, N-(3-((4-aminobutyl)amino)propyl)methacrylamide, N-(2-((2-aminoethyl)(methyl)amino)ethyl)acrylamide, N-(2-((2-aminoethyl)(methyl)amino)ethyl)methacrylamide, N-(piperazin-1-ylmethyl)acrylamide, N-(piperazin-1-ylmethyl)methacrylamide, N-(2-(bis(2-aminoethyl)amino)ethyl)acrylamide, N-(2-(bis(2-aminoethyl)amino)ethyl)methacrylamide, N-(3-aminopropyl)methacrylamide hydrochloride, 2-(dimethylamino)ethyl acrylate, dimethylaminoethyl methacrylate, (3-acrylamidopropyl)trimethylammonium hydrochloride, 2-aminoethyl methacrylate, 3-(dimethylamino)propyl acrylate, N-[3-(dimethylamino)propyl]methacrylamide, and any combination thereof is selected from the group consisting of:

[0065] In some embodiments, the polymer shell further comprises a neutral monomer and a crosslinker. In some embodiments, the polymer shell does not comprise a monomer or crosslinker containing a heterocyclic group. In some embodiments, the polymer shell does not comprise a monomer or crosslinker containing an imidazole group. In some embodiments, the polymer shell does not comprise an imidazolylacryloyl monomer.

[0066] In some embodiments, the ribonucleoprotein complex comprises an endonuclease and a guide RNA. In some embodiments, the endonuclease is a Cas protein. In some embodiments, the Cas protein is selected from the group consisting of Cas9, Cas12a, and Cas12b.

[0067] In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets HPRT, a gamma globin promoter, and / or beta globin. In some embodiments, the guide RNA targets the HPRT locus. In some embodiments, the guide RNA that targets HPRT comprises a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the guide RNA that targets HPRT comprises a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the guide RNA targets the beta globin locus. In some embodiments, the guide RNA that targets beta globin comprises a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the guide RNA that targets beta globin comprises a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO:3.

[0068] In some embodiments, the guide RNA has at least 90% identity to any one of SEQ ID NOs: 39-54. In some embodiments, the guide RNA has at least 95% identity to any one of SEQ ID NOs: 39-54. In some embodiments, the guide RNA comprises any one of SEQ ID NOs: 39-54. In some embodiments, the guide RNA has at least 90% identity to any one of SEQ ID NOs: 1 and 4-23. In some embodiments, the guide RNA has at least 95% identity to any one of SEQ ID NOs: 1 and 4-23. In some embodiments, the guide RNA comprises any one of SEQ ID NOs: 1 and 4-23.

[0069] An eleventh aspect of the present disclosure is a modified hematopoietic stem cell, prepared by contacting the hematopoietic stem cell with a polymer nanocapsule conjugate comprising a polymer shell and a ribonucleoprotein complex, wherein the polymer nanocapsule comprises at least one targeting moiety adapted to facilitate delivery of the ribonucleoprotein complex to the hematopoietic stem cell. In some embodiments, the targeting moiety is linked to the polymer nanocapsule via a disulfide bond. In some embodiments, the polymer nanocapsule further comprises at least one stabilizing moiety having a hydrophilic group. In some embodiments, the polymer shell comprises at least one positively charged monomer. In some embodiments, the polymer shell comprises at least two positively charged monomers. In some embodiments, the positively charged monomer is: N-(3-((4-((3-aminopropyl)amino)butyl)amino)propyl)acrylamide, N-(3-((4-((3-aminopropyl)amino)butyl)amino)propyl)methacrylamide, N-(3-((4-aminobutyl)amino)propyl)acrylamide, N-(3-((4-aminobutyl)amino)propyl)methacrylamide, N-(2-((2-aminoethyl)(methyl)amino)ethyl)acrylamide, N-(2-((2-aminoethyl)(methyl)amino)ethyl)methacrylamide, N-(piperazin-1-ylmethyl)acrylamide, N-(piperazin-1-ylmethyl)methacrylamide, N-(2-(bis(2-aminoethyl)amino)ethyl)acrylamide, N-(2-(bis(2-aminoethyl)amino)ethyl)methacrylamide, N-(3-aminopropyl)methacrylamide hydrochloride, 2-(dimethylamino)ethyl acrylate, dimethylaminoethyl methacrylate, (3-acrylamidopropyl)trimethylammonium hydrochloride, 2-aminoethyl methacrylate, 3-(dimethylamino)propyl acrylate, N-[3-(dimethylamino)propyl]methacrylamide, and any combination thereof is selected from the group consisting of:

[0070] In some embodiments, the polymer shell further comprises a neutral monomer and a crosslinker. In some embodiments, the polymer shell does not comprise a monomer or crosslinker containing a heterocyclic group. In some embodiments, the polymer shell does not comprise a monomer or crosslinker containing an imidazole group. In some embodiments, the polymer shell does not comprise an imidazolylacryloyl monomer.

[0071] In some embodiments, the ribonucleoprotein complex comprises an endonuclease and a guide RNA. In some embodiments, the endonuclease is a Cas protein. In some embodiments, the Cas protein is selected from the group consisting of Cas9, Cas12a, and Cas12b.

[0072] In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets HPRT, a gamma globin promoter, and / or beta globin. In some embodiments, the guide RNA targets the HPRT locus. In some embodiments, the guide RNA that targets HPRT comprises a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the guide RNA that targets HPRT comprises a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the guide RNA targets the beta globin locus. In some embodiments, the guide RNA that targets beta globin comprises a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the guide RNA that targets beta globin comprises a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO:3.

[0073] In some embodiments, the guide RNA has at least 90% identity to any one of SEQ ID NOs: 39-54. In some embodiments, the guide RNA has at least 95% identity to any one of SEQ ID NOs: 39-54. In some embodiments, the guide RNA comprises any one of SEQ ID NOs: 39-54. In some embodiments, the guide RNA has at least 90% identity to any one of SEQ ID NOs: 1 and 4-23. In some embodiments, the guide RNA has at least 95% identity to any one of SEQ ID NOs: 1 and 4-23. In some embodiments, the guide RNA comprises any one of SEQ ID NOs: 1 and 4-23.

[0074] A twelfth aspect of the present disclosure is a method of treating a human patient, comprising administering a therapeutically effective amount of modified hematopoietic stem cells, wherein the hematopoietic stem cells are modified by contacting the hematopoietic stem cells with a polymer nanocapsule conjugate comprising a polymer shell and a ribonucleoprotein complex, wherein the polymer nanocapsule comprises at least one targeting moiety adapted to facilitate delivery of the ribonucleoprotein complex to the hematopoietic stem cells. In some embodiments, the targeting moiety is linked to the polymer nanocapsule via a disulfide bond. In some embodiments, the polymer nanocapsule further comprises at least one stabilizing moiety having a hydrophilic group. In some embodiments, the polymer shell comprises at least one positively charged monomer. In some embodiments, the polymer shell comprises at least two positively charged monomers. In some embodiments, the positively charged monomer is: N-(3-((4-((3-aminopropyl)amino)butyl)amino)propyl)acrylamide, N-(3-((4-((3-aminopropyl)amino)butyl)amino)propyl)methacrylamide, N-(3-((4-aminobutyl)amino)propyl)acrylamide, N-(3-((4-aminobutyl)amino)propyl)methacrylamide, N-(2-((2-aminoethyl)(methyl)amino)ethyl)acrylamide, N-(2-((2-aminoethyl)(methyl)amino)ethyl)methacrylamide, N-(piperazin-1-ylmethyl)acrylamide, N-(piperazin-1-ylmethyl)methacrylamide, N-(2-(bis(2-aminoethyl)amino)ethyl)acrylamide, N-(2-(bis(2-aminoethyl)amino)ethyl)methacrylamide, N-(3-aminopropyl)methacrylamide hydrochloride, 2-(dimethylamino)ethyl acrylate, dimethylaminoethyl methacrylate, (3-acrylamidopropyl)trimethylammonium hydrochloride, 2-aminoethyl methacrylate, 3-(dimethylamino)propyl acrylate, N-[3-(dimethylamino)propyl]methacrylamide, and any combination thereof is selected from the group consisting of:

[0075] In some embodiments, the polymer shell further comprises a neutral monomer and a crosslinker. In some embodiments, the polymer shell does not comprise a monomer or crosslinker containing a heterocyclic group. In some embodiments, the polymer shell does not comprise a monomer or crosslinker containing an imidazole group. In some embodiments, the polymer shell does not comprise an imidazolylacryloyl monomer.

[0076] In some embodiments, the ribonucleoprotein complex comprises an endonuclease and a guide RNA. In some embodiments, the endonuclease is a Cas protein. In some embodiments, the Cas protein is selected from the group consisting of Cas9, Cas12a, and Cas12b.

[0077] In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets HPRT, a gamma globin promoter, and / or beta globin. In some embodiments, the guide RNA targets the HPRT locus. In some embodiments, the guide RNA that targets HPRT comprises a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the guide RNA that targets HPRT comprises a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the guide RNA targets the beta globin locus. In some embodiments, the guide RNA that targets beta globin comprises a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the guide RNA that targets beta globin comprises a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO:3.

[0078] In some embodiments, the guide RNA has at least 90% identity to any one of SEQ ID NOs: 39-54. In some embodiments, the guide RNA has at least 95% identity to any one of SEQ ID NOs: 39-54. In some embodiments, the guide RNA comprises any one of SEQ ID NOs: 39-54. In some embodiments, the guide RNA has at least 90% identity to any one of SEQ ID NOs: 1 and 4-23. In some embodiments, the guide RNA has at least 95% identity to any one of SEQ ID NOs: 1 and 4-23. In some embodiments, the guide RNA comprises any one of SEQ ID NOs: 1 and 4-23.

[0079] A thirteenth aspect of the present disclosure provides a conjugate prepared according to a method comprising reacting a derivatized polymer nanocapsule with at least one derivatized targeting moiety, wherein the derivatized polymer nanocapsule comprises at least one first reactive functional group capable of participating in a click chemistry reaction, and the polymer nanocapsule has a polymer shell comprising at least one positively charged monomer, at least one neutral monomer, and a crosslinker, wherein the at least one derivatized targeting moiety comprises a second reactive functional group capable of participating in a click chemistry reaction with the first reactive functional group of the derivatized polymer nanocapsule. In some embodiments, the conjugate further comprises reacting the derivatized polymer nanocapsule with at least one derivatized stabilizing moiety, wherein the at least one derivatized stabilizing moiety comprises a third reactive functional group capable of participating in a click chemistry reaction with the first reactive functional group. In some embodiments, the polymer shell comprises at least two positively charged monomers. In some embodiments, the polymer shell does not comprise a monomer comprising a heterocyclic group or a crosslinker. In some embodiments, the polymer shell does not include any monomers or crosslinkers containing imidazole groups, hi some embodiments, the polymer shell does not include any imidazolylacryloyl monomers.

[0080] A fourteenth aspect of the present disclosure provides a method of treating a genetic condition in a human patient, comprising: generating a population of modified human hematopoietic stem cells by contacting an unmodified population of human hematopoietic stem cells with polymer nanocapsules, wherein the polymer nanocapsules comprise a polymer shell and a ribonucleoprotein complex, the polymer shell comprising at least one positively charged monomer, at least one neutral monomer, and a crosslinker; and administering a therapeutically effective amount of the modified population of human hematopoietic stem cells to the human patient. In some embodiments, the polymer shell comprises at least two positively charged monomers. In some embodiments, the ribonucleoprotein complex comprises an endonuclease and a guide RNA. In some embodiments, the endonuclease is a Cas protein. In some embodiments, the Cas protein is selected from the group consisting of Cas9, Cas12a, and Cas12b. In some embodiments, the ribonucleoprotein complex comprises a Cas protein and a guide RNA. In some embodiments, the guide RNA targets one of the HPRT locus and the beta globin locus. In some embodiments, the polymer shell does not contain any monomers or crosslinkers containing heterocyclic groups, in some embodiments, the polymer shell does not contain any monomers or crosslinkers containing imidazole groups, in some embodiments, the polymer shell does not contain any imidazolylacryloyl monomers.

[0081] A fifteenth aspect of the present disclosure provides a conjugate comprising: (i) a polymer nanocapsule, the polymer nanocapsule comprising a polymer shell and a ribonucleoprotein complex, wherein the polymer shell comprises at least one positively charged monomer, at least one neutral monomer, and a crosslinker; and (ii) at least one of (a) a targeting moiety or (b) a stabilizing moiety linked to the polymer nanocapsule. In some embodiments, the polymer shell comprises at least two positively charged monomers. In some embodiments, at least one of the targeting moiety or the stabilizing moiety is linked to the polymer nanocapsule via at least one linker. In some embodiments, at least one linker comprises a cleavable moiety. In some embodiments, at least one linker comprises one or more PEG groups.

[0082] In some embodiments, the conjugate comprises between 1 and 16 targeting moieties. In some embodiments, the targeting moiety is selected from the group consisting of an antibody, a peptide, a lectin, transferrin, a polysaccharide, a nucleic acid, and an aptamer. In some embodiments, the targeting moiety comprises human transferrin. In some embodiments, the targeting moiety is an antibody. In some embodiments, the antibody is an anti-cluster of differentiation marker antibody. In some embodiments, the anti-cluster of differentiation marker antibody is selected from the group consisting of an anti-CD3 antibody, an anti-CD4 antibody, an anti-CD8 antibody, an anti-CD34 antibody, an anti-CD45 antibody, an anti-CD133 antibody, and combinations thereof.

[0083] In some embodiments, the conjugate comprises between 1 and 16 stabilizing moieties. In some embodiments, the stabilizing moiety comprises one or more PEG groups. In some embodiments, the stabilizing moiety comprises one or more PPG groups. In some embodiments, the conjugate comprises one or more targeting moieties and one or more stabilizing moieties.

[0084] In some embodiments, the ribonucleoprotein complex comprises an endonuclease and a guide RNA. In some embodiments, the endonuclease is a Cas protein. In some embodiments, the Cas protein is selected from the group consisting of Cas9 and Cas12a.

[0085] In some embodiments, the guide RNA targets the HPRT locus. In some embodiments, the guide RNA that targets HPRT comprises a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the guide RNA targets beta globin. In some embodiments, the guide RNA that targets beta globin comprises a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO:3.

[0086] In some embodiments, the guide RNA has at least 90% identity to any one of SEQ ID NOs: 39-54. In some embodiments, the guide RNA has at least 95% identity to any one of SEQ ID NOs: 39-54. In some embodiments, the guide RNA comprises any one of SEQ ID NOs: 39-54. In some embodiments, the guide RNA has at least 90% identity to any one of SEQ ID NOs: 1 and 4-23. In some embodiments, the guide RNA has at least 95% identity to any one of SEQ ID NOs: 1 and 4-23. In some embodiments, the guide RNA comprises any one of SEQ ID NOs: 1 and 4-23.

[0087] In some embodiments, the at least one positively charged monomer is: N-(3-((4-((3-aminopropyl)amino)butyl)amino)propyl)acrylamide, N-(3-((4-((3-aminopropyl)amino)butyl)amino)propyl)methacrylamide, N-(3-((4-aminobutyl)amino)propyl)acrylamide, N-(3-((4-aminobutyl)amino)propyl)methacrylamide, N-(2-((2-aminoethyl)(methyl)amino)ethyl)acrylamide, N-(2-((2-aminoethyl)(methyl)amino)ethyl)methacrylamide, N-(piperazin-1-ylmethyl)acrylamide, N-(piperazin-1-ylmethyl)methacrylamide, N-(2-(bis(2-aminoethyl)amino)ethyl)acrylamide, N-(2-(bis(2-aminoethyl)amino)ethyl)methacrylamide, N-(3-aminopropyl)methacrylamide hydrochloride, 2-(dimethylamino)ethyl acrylate, dimethylaminoethyl methacrylate, (3-acrylamidopropyl)trimethylammonium hydrochloride, 2-aminoethyl methacrylate, 3-(dimethylamino)propyl acrylate, N-[3-(dimethylamino)propyl]methacrylamide, and Any combination thereof is selected from the group consisting of:

[0088] In some embodiments, the neutral monomer is selected from N-(1,3-dihydroxy-2-(hydroxymethyl)propan-2-yl)acrylamide, acrylamide, N-(hydroxymethyl)acrylamide, 2-hydroxyethyl acrylate, and 2-hydroxyethyl methacrylate. In some embodiments, the crosslinker is selected from the group consisting of 1,3-glycerol dimethacrylate, N,N'-methylenebisacrylamide, and glycerol 1,3-diglycerolate diacrylate. In some embodiments, the polymer shell does not contain a monomer or crosslinker containing a heterocyclic group. In some embodiments, the polymer shell does not contain a monomer or crosslinker containing an imidazole group. In some embodiments, the polymer shell does not contain an imidazolylacryloyl monomer.

[0089] A sixteenth aspect of the present disclosure provides a conjugate comprising: (i) a polymer nanocapsule comprising a polymer shell and a payload, wherein the polymer shell comprises at least one positively charged monomer, at least one neutral monomer, and a crosslinker; the payload is selected from the group consisting of a ribonucleoprotein complex, an siRNA molecule, an shRNA molecule, an expression vector, a polynucleotide having between 50 and 500 base pairs, a peptide, an enzyme, an antibody, and an antibody fragment; and (ii) at least one of (a) a targeting moiety or (b) a stabilizing moiety linked to the polymer nanocapsule. In some embodiments, the polymer shell comprises at least two positively charged monomers. In some embodiments, the at least one positively charged monomer is: N-(3-((4-((3-aminopropyl)amino)butyl)amino)propyl)acrylamide, N-(3-((4-((3-aminopropyl)amino)butyl)amino)propyl)methacrylamide, N-(3-((4-aminobutyl)amino)propyl)acrylamide, N-(3-((4-aminobutyl)amino)propyl)methacrylamide, N-(2-((2-aminoethyl)(methyl)amino)ethyl)acrylamide, N-(2-((2-aminoethyl)(methyl)amino)ethyl)methacrylamide, N-(piperazin-1-ylmethyl)acrylamide, N-(piperazin-1-ylmethyl)methacrylamide, N-(2-(bis(2-aminoethyl)amino)ethyl)acrylamide, N-(2-(bis(2-aminoethyl)amino)ethyl)methacrylamide, N-(3-aminopropyl)methacrylamide hydrochloride, 2-(dimethylamino)ethyl acrylate, dimethylaminoethyl methacrylate, (3-acrylamidopropyl)trimethylammonium hydrochloride, 2-aminoethyl methacrylate, 3-(dimethylamino)propyl acrylate, N-[3-(dimethylamino)propyl]methacrylamide, and Any combination thereof is selected from the group consisting of:

[0090] In some embodiments, the neutral monomer is selected from N-(1,3-dihydroxy-2-(hydroxymethyl)propan-2-yl)acrylamide, acrylamide, N-(hydroxymethyl)acrylamide, 2-hydroxyethyl acrylate, and 2-hydroxyethyl methacrylate. In some embodiments, the crosslinker is selected from the group consisting of 1,3-glycerol dimethacrylate, N,N'-methylenebisacrylamide, and glycerol 1,3-diglycerolate diacrylate. In some embodiments, the conjugate comprises between 1 and 16 targeting moieties selected from the group consisting of antibodies, peptides, lectins, transferrin, polysaccharides, nucleic acids, and aptamers. In some embodiments, the conjugate comprises between 1 and 16 targeting moieties selected from the group consisting of antibodies and human transferrin. In some embodiments, the polymer shell does not comprise a monomer or crosslinker containing a heterocyclic group. In some embodiments, the polymer shell does not comprise a monomer or crosslinker containing an imidazole group. In some embodiments, the polymer shell does not comprise an imidazolylacryloyl monomer.

[0091] A seventeenth aspect of the present disclosure is a polymeric nanocapsule comprising a polymeric shell and a ribonucleoprotein complex, wherein the polymeric shell comprises at least one positively charged monomer, at least one neutral monomer, and a crosslinker, and the ribonucleoprotein complex comprises at least one gRNA, wherein the at least one gRNA has at least 90% sequence identity to any one of SEQ ID NOs: 1-22 and 39-54. In some embodiments, the gRNA has at least 95% sequence identity to any one of SEQ ID NOs: 1-22 and 39-54.

[0092] An eighteenth aspect of the present disclosure is a polymer nanocapsule comprising a polymer shell and a ribonucleoprotein complex, wherein the polymer shell comprises at least one positively charged monomer, at least one neutral monomer, and a crosslinker, and the ribonucleoprotein complex comprises at least one gRNA, wherein the at least one gRNA comprises any one of SEQ ID NOs: 1-22 and 39-54.

[0093] A nineteenth aspect of the present disclosure is a polymeric nanocapsule comprising a polymeric shell and a ribonucleoprotein complex, wherein the polymeric shell comprises at least one positively charged monomer, at least one neutral monomer, and a crosslinker, and the ribonucleoprotein complex comprises at least one gRNA, wherein the at least one gRNA targets a nucleic acid sequence having at least 90% identity to any one of SEQ ID NOs: 24-37. [Effects of the Invention]

[0094] Applicant has developed nanocapsule technology with tunable chemistry and targeting capabilities that enable specific optimization of the delivery of a wide variety of therapeutic agents. By conjugating targeting / activation moieties to the nanocapsules, enabling precise control of delivery, Applicant was able to reorient the nanocapsules to specifically target T lymphocytes or CD34+ hematopoietic stem cells. Applicant demonstrated that CRISPR / Cas9 ribonucleoprotein complexes formulated in these nanocapsules exhibited fewer off-target effects and higher on-target efficiency. Applicant also demonstrated that polymer nanocapsules can be formulated to contain activation reagents that facilitate both delivery and gene editing processes, as most T lymphocytes or CD34+ hematopoietic stem cells are believed to require activation to facilitate genetic modification. Applicant further believes that by incorporating CRISPR / Cas9 into the disclosed polymer nanocapsules, it is possible to simultaneously achieve high efficiency of genetic modification and targeting capabilities.

[0095] For a general understanding of the features of the present disclosure, reference is made to the drawings, in which like reference numerals are used throughout to identify identical elements. [Brief explanation of the drawings]

[0096] [Figure 1] FIG. 1 illustrates an overall method for preparing targeted polymeric nanocapsules with one or more stabilizing moieties. [Figure 2] FIG. 1 illustrates the synthesis of polymer nanocapsules containing ribonucleoprotein complexes derived from various types of introduced monomers. [Figure 3] FIG. 1 illustrates the conjugation of targeting moieties to polymer nanocapsules using copper-free click chemistry. [Figure 4]Figure 1 provides GFP mRNA nanocapsules (unconjugated - unconjugated nanocapsules; TR1.1 - nanocapsules conjugated with an average of 1.1 moles of human transferrin; TR1.1PEG3.5 - nanocapsules conjugated with approximately 1.1 moles of human transferrin and 3.5 moles of PEG) incubated with human serum protein solution (5 mg / mL) for 24 and 48 hours. Nanocapsule diameters were determined by dynamic light scattering. [Figure 5A] Figure 1 illustrates GFP mRNA nanocapsules conjugated with different average numbers of PEGs per particle. Each nanocapsule was tested with pre-stimulated PBMCs (nB-CD31.2-nanocapsules were conjugated with an average of about 1.2 anti-CD3 antibodies per particle; nB-CD31.2-PEG1.8-nanocapsules were conjugated with an average of about 1.2 CD3 antibodies per particle and an average of about 1.8 PEGs per particle; or nB-CD31.2-PEG3.4-nanocapsules were conjugated with an average of about 1.2 CD3 antibodies per particle and an average of about 3.4 PEGs per particle). The nanocapsules were incubated with pre-stimulated PBMCs for 4 hours, and then flow data was collected after 3 days. This corresponded to a mock test using GFP mRNA to target CD3+ PBMC cells. Each of the three samples showed similar GFP expression levels, i.e., about 15% in the CD3+ population. This demonstrated that average conjugation of PEG of about 1.8 and about 3.4 does not impair nanocapsule uptake by the CD3+ subpopulation of cells. Both nB-CD31.2-PEG3.4 and nB-CD31.2-PEG1.8 nanocapsules showed a significant reduction in nonspecific uptake by the CD3- subpopulation of PBMC cells (from 14% to about 4% and about 1%), demonstrating that average conjugation of PEG of about 1.8 and about 3.4 per particle can reduce nonspecific uptake by the CD3- population of PBMC cells. [Figure 5B]Figure 1 illustrates three GFP mRNA nanocapsules (nA-CD31.3, nB-CD31.2, and nC-CD30.9), each with a different surface zeta potential, tested in 293T cells. The positively charged nanocapsule nA-CD31.3 showed a higher GFP+ subpopulation (percentage) compared to the neutrally charged nB-CD31.2 nanocapsule and the negatively charged nC-CD30.9 nanocapsule, which showed nearly zero. The nanocapsules were incubated with 293T cells for approximately 4 hours, and flow data were collected after 3 days. These results further demonstrate that gene editing using nanocapsules of the present disclosure, such as those with polymer shells derived from a combination of positively charged and neutral monomers, is effective. Furthermore, the results demonstrate that gene editing using nanocapsules with a net positive charge was effective. [Figure 5C] Figure 1 illustrates three GFP mRNA nanocapsules (nA-CD31.3, nB-CD31.2, and nC-CD30.9), each with a different surface zeta potential, tested in pre-stimulated PBMC cells. The positively charged nanocapsule nA-CD31.3 had a higher GFP+ subpopulation percentage (approximately 15%) compared to nearly zero for the neutrally charged nanocapsule nB-CD31.2 (approximately 13%). However, the negatively charged nanocapsule nC-CD30.9 showed a much lower GFP+ subpopulation percentage (approximately 6%). This demonstrates the effect of zeta potential on nanocapsule uptake in pre-stimulated PBMC cells. These results further demonstrate that gene editing using nanocapsules of the present disclosure, such as those with polymer shells derived from a combination of positively charged and neutral monomers, was effective. Furthermore, the results demonstrate that gene editing using nanocapsules with a net positive charge was effective. [Figure 5D]Figure 1 illustrates the surface zeta potential of three GFP mRNA nanocapsules (nA-CD31.3, nB-CD31.2, and nC-CD30.9), measured to be approximately +9 mV, 0 mV, and -5 mV, respectively, based on dynamic light scattering. Each GFP mRNA nanocapsule had a different formulation (i.e., the components, e.g., monomers, of each nanocapsule were different), but each nanocapsule formulation contained a similar average number of conjugated CD3 targeting moieties per particle (1.3, 1.2, and 0.9). [Figure 5E] Figure 5 illustrates GFP mRNA nanocapsules, each conjugated with a different average number of PEGs per particle, tested on pre-stimulated PBMCs (nB-CD31.2-nanocapsules were conjugated with an average of about 1.2 anti-CD3 antibodies per particle; nB-CD31.2-PEG1.8-nanocapsules were conjugated with an average of about 1.2 CD3 antibodies per particle and an average of about 1.8 PEGs per particle; nB-CD31.2-PEG3.4-nanocapsules were conjugated with an average of about 1.2 CD3 antibodies per particle and an average of about 3.4 PEGs per particle). The nanocapsules were incubated with pre-stimulated PBMCs for about 4 hours, and then flow data was collected 3 days later. This represented a mock test using GFP mRNA to confirm CD3 receptor-mediated endocytosis (see also Figures 5F and 5G). The three samples showed similar GFP expression levels of approximately 15%, approximately 14% and approximately 12% in all PBMC populations, respectively. [Figure 5F]Figure 1 illustrates GFP mRNA nanocapsules conjugated with different average numbers of PEGs per particle, tested in 293T cells as a model of CD3- cells (nB-CD31.2-nanocapsules were conjugated with an average of 1.2 anti-CD3 antibodies per particle; nB-CD31.2-PEG1.8-nanocapsules were conjugated with an average of about 1.2 CD3 antibodies per particle and an average of about 1.8 PEGs per particle; nB-CD31.2-PEG3.4-nanocapsules were conjugated with an average of about 1.2 CD3 antibodies per particle and an average of about 3.4 PEGs per particle). The nanocapsules were incubated with 293T cells for about 4 hours, and then flow data were collected after 3 days. The three samples showed similar low GFP expression levels of about 4%, about 2%, and about 0% in CD3-293T cells, respectively. [Figure 5G] Figure 5 illustrates GFP mRNA nanocapsules conjugated with different average numbers of PEGs per particle and tested on pre-stimulated PBMCs (nB-CD31.2-nanocapsules were conjugated with an average of about 1.2 anti-CD3 antibodies per particle; nB-CD31.2-PEG1.8-nanocapsules were conjugated with an average of about 1.2 CD3 antibodies per particle and an average of about 1.8 PEGs per particle; nB-CD31.2-PEG3.4-nanocapsules were conjugated with an average of about 1.2 CD3 antibodies per particle and an average of about 3.4 PEGs per particle). The nanocapsules were incubated with pre-stimulated PBMCs containing 0.1 mg / mL CD3 antibodies in medium for about 4 hours, and then flow data was collected 3 days later. This represented a mock test using GFP mRNA to confirm CD3 receptor-mediated endocytosis (see also Figures 5E and 5F). The GFP expression levels of the three nanocapsules were reduced to approximately 5%, 2%, and 0% in all PBMC populations compared to Figure 5F (no CD3 antibody in the medium), confirming that the three nanocapsules were taken up by PBMCs via the CD3 receptor-assisted endocytosis pathway. [Figure 5H]FIG. 1 illustrates 5H GFP mRNA nanocapsules conjugated with different average numbers of PEGs per particle and tested by dynamic light scattering for solution stability over a period of approximately 48 hours (unconjugated nanocapsules; nanocapsules conjugated with an average of approximately 1.1 human transferrins per particle; nanocapsules conjugated with an average of approximately 1.1 human transferrins per particle and an average of approximately 3.5 PEGs per particle). Unconjugated nanocapsules and nanocapsules conjugated with an average of approximately 1.1 human transferrins per particle showed an increase in particle size and aggregation over a period of approximately 48 hours. Nanocapsules conjugated with an average of approximately 1.1 human transferrins per particle and approximately 3.5 PEGs were stable in size, and no significant formation of aggregates was observed. [Figure 6A] Figures 6A (knockdown) and 6B (knockout) illustrate the effect of positive selection by 6TG (ex vivo) in K562 cells. As shown in Figure 6A, K562 cells transduced with the sh7-GFP vector at MOIs of 1, 2, and 5 in the absence of 6TG in the culture medium showed stable expression from day 3 to day 14. When approximately 300 nM of 6TG was present in the culture medium, the GFP+ subpopulation of K562 cells transduced with the sh7-GFP vector at MOIs of 1, 2, and 5 showed stable increases from approximately 19% to approximately 40%, from approximately 40% to approximately 78%, and from approximately 78% to approximately 94% from day 3 to day 14. As shown in Figure 6B, when 6TG was not present in the culture medium, K562 cells transfected with RNP-targeted HPRT1 nanocapsules showed a stable HPRT knockout INDEL of approximately 23% from day 3 to day 14. In the presence of approximately 300, 600, and 900 nM 6TG in the culture medium, the HPRT knockout population of K562 cells showed stable expansion to approximately 78%, 95%, and 97% at day 14, confirming positive selection from day 3 to day 14. [Figure 6B]Figures 6A (knockdown) and 6B (knockout) illustrate the effect of positive selection by 6TG (ex vivo) in K562 cells. As shown in Figure 6A, K562 cells transduced with the sh7-GFP vector at MOIs of 1, 2, and 5 in the absence of 6TG in the culture medium showed stable expression from day 3 to day 14. When approximately 300 nM of 6TG was present in the culture medium, the GFP+ subpopulation of K562 cells transduced with the sh7-GFP vector at MOIs of 1, 2, and 5 showed stable increases from approximately 19% to approximately 40%, from approximately 40% to approximately 78%, and from approximately 78% to approximately 94% from day 3 to day 14. As shown in Figure 6B, when 6TG was not present in the culture medium, K562 cells transfected with RNP-targeted HPRT1 nanocapsules showed a stable HPRT knockout INDEL of approximately 23% from day 3 to day 14. In the presence of approximately 300, 600, and 900 nM 6TG in the culture medium, the HPRT knockout population of K562 cells showed stable expansion to approximately 78%, 95%, and 97% at day 14, confirming positive selection from day 3 to day 14. [Figure 7A] Figures 7A (knockdown) and 7B (knockout) illustrate the effect of positive selection with 0, 300, 600, and 900 nM 6TG (ex vivo) on CEM cells transduced with sh7-GFP lentiviral vector or transfected with RNP-targeted HPRT1 nanocapsules. [Figure 7B] Figures 7A (knockdown) and 7B (knockout) illustrate the effect of positive selection with 0, 300, 600, and 900 nM 6TG (ex vivo) on CEM cells transduced with sh7-GFP lentiviral vector or transfected with RNP-targeted HPRT1 nanocapsules. [Figure 8A] FIG. 1 illustrates knockout of HPRT and 6TG selection of PBMCs using CD3-conjugated CRISPR RNP-targeted HPRT1 nanocapsules, according to some embodiments (see, e.g., Example 11). [Figure 8B]FIG. 1 illustrates knockout of HPRT and 6TG selection of PBMCs using CD3-conjugated CRISPR RNP-targeted HPRT1 nanocapsules, according to some embodiments (see, e.g., Example 11). [Figure 8C] FIG. 1 illustrates knockout of HPRT and 6TG selection of PBMCs using CD3-conjugated CRISPR RNP-targeted HPRT1 nanocapsules, according to some embodiments (see, e.g., Example 11). [Figure 8D] FIG. 1 illustrates VCN and InDel data after selection of CD34+ transduced cells or HPRT-KO CD34+ cells with sh734-rGbG / rGbG-sh734 / sh734-GFP vectors on 6-TG-treated methylcellulose plates. [Figure 8E] FIG. 1 illustrates VCN and InDel data after selection of CD34+ transduced cells or HPRT-KO CD34+ cells with sh734-rGbG / rGbG-sh734 / sh734-GFP vectors on 6-TG-treated methylcellulose plates. [Figure 9A] FIG. 1 illustrates the effect of negative selection with 300 nM MTX on K562 cells transduced with sh7-GFP lentiviral vector or transfected with RNP-targeted HPRT1 nanocapsules. [Figure 9B] FIG. 1 illustrates the effect of negative selection with 300 nM MTX on K562 cells transduced with sh7-GFP lentiviral vector or transfected with RNP-targeted HPRT1 nanocapsules. [Figure 10A] FIG. 1 illustrates the effect of negative selection with 300 nM MTX, 1 μM and 10 μM MPA on CEM cells transduced with sh7-GFP lentiviral vector or transfected with RNP-targeted HPRT1 nanocapsules. [Figure 10B]FIG. 1 illustrates the effect of negative selection with 300 nM MTX, 1 μM and 10 μM MPA on CEM cells transduced with sh7-GFP lentiviral vector or transfected with RNP-targeted HPRT1 nanocapsules. [Figure 11A] 11A illustrates gene editing to knock out CCR5 in PBMCs. 1×10 PBMCs were incubated with CD3-conjugated Cas9-CCR5 RNP nanocapsules (150 ng of Cas9 and 100 ng of gRNA targeting the CCR5 locus) and C46 nanocapsules (100 ng or 200 ng of a short EF1a-driven C46 expression DNA cassette) for 4 hours. PBMCs were then stimulated overnight with PHA / IL-2. Five days later, the flow chart is shown in FIG. 11A. The top left panel of Figure 11A shows that the unstained negative control had >99% of the CCR5 subpopulation; the top center panel shows that the CCR5-stained stimulated PBMCs contained approximately 41.2% of the CCR5 subpopulation; the top right panel shows that PBMCs treated with CCR5-targeted RNP nanocapsules had 75.8% of the CCR5 subpopulation; the bottom left panel shows that PBMCs treated with CCR5-targeted RNP nanocapsules and C46 nanocapsules (100 ng) had 69.7% of the CCR5 subpopulation; the bottom center panel shows that PBMCs treated with CCR5-targeted RNP nanocapsules and C46 nanocapsules (200 ng) had 63.7% of the CCR5 subpopulation; and the bottom right panel shows that PBMCs transduced with Cal-1 at an MOI of 5 had 92.9% of the CCR5 subpopulation. T7E1 analysis was performed (the results of which are shown in Figure 11B). [Figure 11B]Figure 1 illustrates a T7E1 assay showing knockout of CCR5. From left to right: CD3-conjugated CCR5-targeted RNP nanocapsules (150 ng of Cas9 and 100 ng of gRNA targeting the CCR5 locus); CD3-conjugated CCR5-targeted RNP nanocapsules (150 ng of Cas9 and 100 ng of gRNA targeting the CCR5 locus) and C46 nanocapsules (100 ng of a short EF1a-driven C46 expression DNA cassette); CD3-conjugated CCR5-targeted RNP nanocapsules (150 ng of Cas9 and 100 ng of gRNA targeting the CCR5 locus) and C46 nanocapsules (200 ng of a short EF1a-driven C46 expression DNA cassette); unmodified cell control; DNA ladder. [Figure 12] Figure 1 provides data illustrating the delivery of gCCR5-Cas9 RNP by nanocapsules designed to target CD3+ PBMCs. 1 x 105 unstimulated PBMCs were incubated with antibody-CD3-conjugated Cas9 RNP nanocapsules (1 / 2 / 4 pmol) for 4 hours. PBMCs were then stimulated overnight with PHA / IL-2 and cultured with IL-2 for 4 days before staining. Overall, CCR5 expression in stimulated PBMCs in the CD3+ subpopulation was shown to decrease when the Cas9 RNP nanocapsule dose was reduced from 55.4% (control) to 34.6% (1 pmol RNP nanocapsules targeting the CCR5 locus), 27.0% (2 pmol RNP nanocapsules targeting the CCR5 locus), and 20.5% (5 pmol RNP nanocapsules targeting the CCR5 locus). [Figure 13] 13A and 13B illustrate the preparation of nanocapsules containing at least Cas9 and gRNA. [Figure 14] FIG. 1 illustrates the results of T7E1 assays of control, nanoRNP, and nanohdr DNA in knockout 293T cells. [Figure 15]Figure 1 provides flow cytometry data. Panels A and B show CCR staining results from untreated Mocha (approximately 95% CCR5+) cells and treated MOCHA. Panels C, D, and E show C46 staining results from untreated Mocha, the CCR5 subpopulation of treated Mocha, and the C46 knock-in AW072 cell line. [Figure 16] Panels A, B, and C show CCR5 staining results from unstained control, CD34+ cells without 6TG treatment (44.9% of CCR5+) (Figure 16, panel B), and with 6TG treatment (43.4% of CCR5+) (Figure 16, panel C). Figure 16, panel D shows CCR5+ staining results from nanocapsule-treated CD34+ cells without 6TG in the culture medium (23.8%) and with 6TG in the culture medium (10.2%). [Figure 17] Figure 17 shows CCR5 staining results from unstained control, CD34+ cells without 6TG treatment (44.9% CCR5+), and with 6TG treatment (43.4% CCR5+). Figure 17 further shows CCR5 staining results from nanocapsule-treated CD34+ cells without 6TG in the culture medium (23.8%) and with 6TG in the culture medium (10.2%). The CCR5 staining data suggest that 6-TG selection is performed on sh734-KI mPB CD34+ cells in bulk culture. DETAILED DESCRIPTION OF THE INVENTION

[0097] Sequence Listing The nucleic acid and amino acid sequences appended hereto are shown using standard letter abbreviations for nucleotide bases and three-letter codes for amino acids, as defined in 37 C.F.R. 1.822. The Sequence Listing is submitted as a 12 KB ASCII text file named "Calimmune-042WO_ST25.txt," created December 21, 2019, which is incorporated herein by reference.

[0098] Detailed Description Unless expressly stated to the contrary, it should also be understood that in any method claimed herein that includes more than one step or act, the order of the method steps or acts is not necessarily limited to the order in which the method steps or acts are recited.

[0099] As used herein, the singular terms "a," "an," and "the" include plural referents unless the context clearly indicates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherwise. The term "comprising" is defined inclusively, such that "including A or B" means A, B, or A and B.

[0100] As used herein, the term "or" should be understood to have the same meaning as "and / or" as defined above. For example, separate items in a list, "or" or "and / or" should be interpreted as being inclusive, i.e., including at least one, but also more than one, of a number or list of elements, and optionally additional unlisted items. Only terms expressly indicated otherwise, such as "only one of" or "exactly one of," or, when used in the claims, "consisting of," refer to the inclusion of exactly one element of a number or list of elements. In general, the term "or," as used herein, will only be interpreted to indicate exclusive alternatives (i.e., "one or the other, but not both") when followed by terms of exclusivity, such as "either," "one of," "only one of," or "exactly one of." "Consisting essentially of," when used in the claims, shall have its ordinary meaning as used in the field of patent law.

[0101] As used herein, the terms "comprising," "including," "having," etc. are used interchangeably and have the same meaning. Similarly, "comprises," "includes," "having," etc. are used interchangeably and have the same meaning. In particular, each of the terms is to be interpreted as an open term meaning "at least the following," and is also to be interpreted as not excluding additional features, limitations, embodiments, etc. Thus, for example, "an apparatus having components a, b, and c" means an apparatus that includes at least components a, b, and c. Similarly, the phrase "a method including steps a, b, and c" means that the method includes at least steps a, b, and c. Furthermore, although steps and methods are outlined herein in a particular order, one of ordinary skill in the art will recognize that the ordering of the steps and methods can be varied.

[0102] As used herein, the phrase "at least one," in connection with a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of every element specifically listed in the list of elements, nor excluding any combination of elements in the list of elements. This definition also allows that there may optionally be elements other than those specifically identified in the list of elements to which the phrase "at least one" refers, whether related or unrelated to the specifically identified elements. Thus, as a non-limiting example, "at least one of A and B" (or, equivalently, "at least one of A or B," or, equivalently, "at least one of A and / or B") can refer to, in one embodiment, at least one, optionally including more than one, A (optionally including elements other than B), where B is absent; in another embodiment, at least one, optionally including more than one, B (optionally including elements other than A), where A is absent; in yet another embodiment, at least one, optionally including more than one, A, and at least one, optionally including more than one, B (optionally including other elements); etc.

[0103] As used herein, the term "administering" refers to oral, topical, intravenous, subcutaneous, transcutaneous, transdermal, intramuscular, intra-joint, parenteral, intra-arteriolar, intradermal, intraventricular, intracranial, intraperitoneal, intralesional, intranasal, rectal, vaginal, by inhalation, or via an implanted reservoir. The term "parenteral" includes subcutaneous, intravenous, intramuscular, intra-articular, intrasynovial, intrasternal, intrathecal, intrahepatic, intralesional, and intracranial injection or infusion techniques.

[0104] As used herein, the term "alkyl" refers to a straight-chain or branched hydrocarbon chain, including fully saturated (no double or triple bonds) hydrocarbon groups. The term "alkyl" includes saturated aliphatic groups, including straight-chain alkyl groups (e.g., methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, etc.), branched-chain alkyl groups (isopropyl, tert-butyl, isobutyl, etc.), cycloalkyl (alicyclic) groups (cyclopropyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl), alkyl-substituted cycloalkyl groups, and cycloalkyl-substituted alkyl groups. The term "alkyl" further includes alkyl groups in which one or more heteroatoms, such as oxygen, nitrogen, sulfur, or phosphorus, replace one or more carbons of the hydrocarbon backbone. In certain embodiments, a straight-chain or branched-chain alkyl has 30 or fewer carbon atoms in its backbone (e.g., C1-C6 for a straight chain). 30 , C1 to C for branched chains 30Furthermore, the term "alkyl" includes both "unsubstituted alkyls" and "substituted alkyls," the latter of which refers to alkyl moieties having substituents replacing a hydrogen on one or more carbons of the hydrocarbon backbone. Such substituents include, for example, alkenyl, alkynyl, halogen, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl, alkoxycarbonyl, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, alkylthiocarbonyl, alkoxy, phosphate, phosphonate, phosphinate, cyano, amino (including alkylamino, dialkylamino, arylamino, diarylamino, and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl, and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfate, alkylsulfinyl, sulfonato, sulfamoyl, sulfonamido, nitro, trifluoromethyl, cyano, azido, heterocyclyl, alkylaryl, or aromatic or heteroaromatic moiety.

[0105] As used herein, the term "alkene" includes unsaturated aliphatic groups analogous in length and possible substitution to the alkyls described above, but which contain at least one double bond. For example, the term "alkene" includes straight-chain alkenyl groups (e.g., ethylenyl, propenyl, butenyl, pentenyl, hexenyl, heptenyl, octenyl, nonenyl, decenyl, etc.), branched-chain alkenyl groups, cycloalkenyl (alicyclic) groups (cyclopropenyl, cyclopentenyl, cyclohexenyl, cycloheptenyl, cyclooctenyl), alkyl- or alkenyl-substituted cycloalkenyl groups, and cycloalkyl- or cycloalkenyl-substituted alkenyl groups. The term alkenyl further includes alkenyl groups that contain oxygen, nitrogen, sulfur, or phosphorus atoms replacing one or more carbons of the hydrocarbon backbone. In certain embodiments, straight-chain or branched-chain alkenyl groups have 30 or fewer carbon atoms in their backbone (e.g., C2-C6 for a straight chain). 30 , C3 to C for branched chains 30Furthermore, the term alkenyl includes both "unsubstituted alkenyls" and "substituted alkenyls," the latter of which refers to alkenyl moieties having substituents replacing a hydrogen on one or more carbons of the hydrocarbon backbone. Such substituents include, for example, alkyl groups, alkenyl groups, alkynyl groups, halogen, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl, alkoxycarbonyl, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, alkylthiocarbonyl, alkoxy, phosphate, phosphonate, phosphinate, cyano, amino (including alkylamino, dialkylamino, arylamino, diarylamino, and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl, and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfate, alkylsulfinyl, sulfonato, sulfamoyl, sulfonamido, nitro, trifluoromethyl, cyano, azido, heterocyclyl, alkylaryl, or aromatic or heteroaromatic moiety. Other examples of alkenyl groups include, but are not limited to, ethenyl, 1-propenyl, 2-propenyl, 1-methyl-ethenyl, 1-butenyl, 2-butenyl, 3-butenyl, 1-methyl-1-propenyl, 2-methyl-1-propenyl, 1-methyl-2-propenyl, 2-methyl-2-propenyl, 1-pentenyl, 2-pentenyl, 3-pentenyl, 4-pentenyl, 1-methyl-1-butenyl, 2-methyl-1-butenyl, 3-methyl-1-butenyl, 1-methyl-2-butenyl, 2-methyl-2-butenyl, 3-methyl-2-butenyl, 1-methyl-3-butenyl, 2-methyl-3-butenyl, 3-methyl-3-butenyl, 1,1-dimethyl-2-propenyl, 1,2-dimethyl-1-propenyl, 1,2-dimethyl-2-propenyl, 1-ethyl-1-propenyl, 1-ethyl-2-propenyl, 1-hexenyl, 2-hexenyl, 3-hexenyl, 4-hexenyl, 5-hexenyl, 1-methyl-1-pentenyl, 2-methyl-1-pentenyl, 3-methyl-1-pentenyl, 4-methyl-1-pentenyl, 1-methyl-2-pentenyl, 2-methyl-2-pentenyl, 3-methyl-2 -pentenyl, 4-methyl-2-pentenyl, 1-methyl-3-pentenyl, 2-methyl-3-pentenyl, 3-methyl-3-pentenyl, 4-methyl-3-pentenyl, 1-methyl-4-pentenyl, 2-methyl-4-pentenyl, 3-methyl-4-pentenyl, 4-methyl-4-pentenyl, 1,1-dimethyl-2-butenyl, 1,1-dimethyl-3-butenyl, 1,2-dimethyl-1 -butenyl, 1,2-dimethyl-2-butenyl, 1,2-dimethyl-3-butenyl, 1,3-dimethyl-1-butenyl, 1,3-dimethyl-2-butenyl, 1,3-dimethyl-3-butenyl, 2,2-dimethyl-3-butenyl, 2,3-dimethyl-1-butenyl, 2,3-dimethyl-2-butenyl, 2,3-dimethyl-3-butenyl, 3,3-dimethyl-1-butenyl, 3,3-dimethyl Examples of double bonds include 1,1,2-trimethyl-2-butenyl, 1-ethyl-1-butenyl, 1-ethyl-2-butenyl, 1-ethyl-3-butenyl, 2-ethyl-1-butenyl, 2-ethyl-2-butenyl, 2-ethyl-3-butenyl, 1,1,2-trimethyl-2-propenyl, 1-ethyl-1-methyl-2-propenyl, 1-ethyl-2-methyl-1-propenyl, and 1-ethyl-2-methyl-2-propenyl groups. Groups containing multiple double bonds include, but are not limited to, buta-1,3-dienyl, penta-1,3-dienyl, or penta-1,4-dienyl groups.

[0106] As used herein, unless otherwise indicated, the terms "cycloalkyl" or "heterocycloalkyl," by themselves or in combination with other terms, refer to cyclic versions of "alkyl" and "heteroalkyl," respectively. Cycloalkyls and heterocycloalkyls are not aromatic. Cycloalkyls and heterocycloalkyls may be further substituted, for example, with any of the substituents described herein.

[0107] By way of example only, an alkyl group can have 1 to 20 carbon atoms (wherever it appears herein, a numerical range such as "1 to 20" refers to each integer in the given range; for example, "1 to 20 carbon atoms" means that the alkyl group can consist of 1 carbon atom, 2 carbon atoms, 3 carbon atoms, etc., up to and including 20 carbon atoms, but this definition also encompasses the presence of the term "alkyl" when no numerical range is given). As further described herein, the alkyl group of a compound is designated as "C1-C4 alkyl" or similar designation. By way of example only, "C1-C4 alkyl" indicates that there are 1 to 4 carbon atoms in the alkyl chain, i.e., the alkyl chain is selected from methyl, ethyl, propyl, isopropyl, n-butyl, isobutyl, sec-butyl, and t-butyl.

[0108] As used herein, the term "antibody" refers to immunoglobulins or immunoglobulin-like molecules, including, by way of example and not limitation, IgA, IgD, IgE, IgG, and IgM, and combinations thereof, and similar molecules generated during an immune response in any vertebrate (e.g., in mammals such as humans, goats, rabbits, and mice), as well as antibody fragments (such as F(ab')2 fragments, Fab' fragments, Fab'-SH fragments, and Fab fragments, as known in the art, recombinant antibody fragments (sFv fragments, dsFv fragments, bispecific sFv fragments, bispecific dsFv fragments, F(ab')2 fragments, Fab' fragments, Fab'-SH fragments, and Fab fragments, as known in the art), that specifically bind to a molecule of interest (or a group of highly similar molecules of interest) to the extent that they substantially exclude binding to other molecules. b') refers to antibody fragments, single-chain Fv proteins ("scFv"), disulfide-stabilized Fv proteins ("dsFv"), diabodies, and triabodies (as known in the art), as well as camelid antibodies. Antibody further refers to a polypeptide ligand comprising at least a light or heavy chain immunoglobulin variable region that specifically recognizes and binds to an epitope of an antigen. Antibodies can be composed of heavy and light chains, each with a variable region called a variable heavy (VH) region and a variable light (VL) region. Together, the VH and VL regions are responsible for binding the antigen recognized by the antibody. The term antibody also includes intact immunoglobulins and variants, as well as portions thereof, known in the art.

[0109] As used herein, the term "B-cell lymphoma / leukemia 11A" or "BCL11A" refers to a C2H2-type zinc finger protein by analogy to the mouse Bcl 11a / Evi9 protein. The corresponding mouse gene is a frequent site of retroviral integration in myeloid leukemia and may function as a leukemic disease gene, in part through interaction with BCL6. During hematopoietic cell differentiation, this gene is downregulated. This may be involved in lymphoma pathogenesis, as translocations associated with B-cell malignancies also deregulate its expression. Multiple transcript variants encoding several different isoforms have been found for this gene.

[0110] As used herein, the term "C9orf72" refers to the gene that provides instructions for producing a protein found in various tissues.This protein is abundant in nerve cells (neurons) in the outer layer of the brain (cerebral cortex) and in specialized neurons (motor neurons) in the brain and spinal cord that control movement.C9orf72 protein is thought to be located at the tip of neurons in a region called presynaptic terminal.This region is important for sending and receiving signals between neurons.

[0111] As used herein, "C" refers to a group of integers where "a" and "b" are integers. a From C b " or "Ca-Cb" refers to the number of carbon atoms in an alkyl, alkenyl, or alkynyl group, or the number of carbon atoms in a cycloalkyl, cycloalkenyl, cycloalkynyl, or aryl ring, or the total number of carbon atoms and heteroatoms in a heteroalkyl, heterocyclyl, heteroaryl, or heteroalicyclyl group. That is, an alkyl, alkenyl, alkynyl, cycloalkyl ring, cycloalkenyl ring, cycloalkynyl ring, aryl ring, heteroaryl ring, or heteroalicyclyl ring can contain "a" to "b," inclusive, carbon atoms. Thus, for example, a "C1-C4 alkyl" group refers to all alkyl groups having one to four carbons, i.e., CH3-, CH3CH2-, CH3CH2CH2-, (CH3)2CH-, CH3CH2CH2CH2-, CH3CH2CH(CH3)-, and (CH3)3C-. When "a" and "b" are not specified for an alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, aryl, heteroaryl, or heteroalicyclic group, the broadest range described by those definitions is intended.

[0112] As used herein, the term "Cas protein" refers to an RNA-guided nuclease, including a Cas protein, or a fragment thereof. Cas proteins are also referred to as CRISPR (clustered regularly interspaced short palindromic repeats)-associated nucleases. CRISPR is an adaptive immune system that provides defense against mobile genetic elements (viruses, transposable elements, and conjugative plasmids). CRISPR clusters contain a spacer, which is a sequence complementary to the preceding mobile element, and an invading nucleic acid, which is a target. CRISPR clusters are transcribed and processed into CRISPR RNA (crRNA). CRISPR-Cas systems are further characterized as class 1 or class 2 systems. Class 1 systems are characterized by multi-subunit effectors, i.e., they contain multiple Cas proteins. Class 1 systems can be further characterized as type I, type III, and type IV. Class 2 systems are characterized by a single effector protein with multiple domains. Class 1 systems are further characterized as type II, type V, and type VI. For example, Class 2 Type II systems include the Cas9 protein, while Class 2 Type V systems include Cpf1 (Cas12a). Further examples of Cas proteins include, but are not limited to, Cas9 proteins, Cas9-like proteins encoded by Cas9 orthologues, Cas9-like synthetic proteins, Cpf1 proteins, proteins encoded by Cpf1 orthologues, Cpf1-like synthetic proteins, C2c1 proteins, C2c2 proteins, C2c3 proteins, and variants and modifications thereof.Further examples of Cas proteins include, but are not limited to, MAD7, MAD2, Cpf1, C2c1, C2c3, Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas13a, Cas13b, and Cas13c, Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas100, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, These include Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, Cpf1, C2c1, C2c3, Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas13a, Cas13b, and Cas13c.

[0113] In some embodiments, the Cas protein is a class 2 CRISPR-associated protein. As described above, "class 2 type CRISPR-Cas system," as defined herein, refers to a CRISPR-Cas system that functions with a single protein (such as Cas9) as an effector complex. As used herein, "class 2 type II CRISPR-Cas system" refers to a CRISPR-Cas system that includes a cas9 gene among its Cas genes. "class 2 type II-A CRISPR-Cas system" refers to a CRISPR-Cas system that includes Cas9 and Csn2 genes. "class 2 type II-B CRISPR-Cas system" refers to a CRISPR-Cas system that includes Cas9 and Cas4 genes. "class 2 type II-C CRISPR-Cas system" refers to a CRISPR-Cas system that includes a Cas9 gene but does not include a Csn2 or Cas4 gene. A "Class 2 Type V CRISPR-Cas system" refers to a CRISPR-Cas system that contains a Cas12 gene (Cas12a, Cas12b, or Cas12c gene) among its Cas genes. A "Class 2 Type VI CRISPR-Cas system" refers to a CRISPR-Cas system that contains a Cas13 gene (Cas13a, Cas13b, or Cas13c gene) among its Cas genes. Each wild-type CRISPR-Cas protein interacts with one or more cognate polynucleotides (most typically RNA) to form a nucleoprotein complex (most typically a ribonucleoprotein complex). Additional Cas proteins are described by Haft et al., "A Guild of 45 CRISPR-Associated (Cas) Protein Families and Multiple CRISPR / Cas Subtypes Exist in Prokaryotic Genomes," PLOS Comput. Biol., November 2005;1(6):e60. In some embodiments, the Cas protein is an engineered Cas protein, for example, an engineered variant of any of the Cas proteins identified herein.

[0114] As used herein, the term "Cas9" or "Cas9 protein" refers to an enzyme (wild-type or recombinant) that can perform endonuclease activity (e.g., cleave phosphodiester bonds within a polynucleotide) guided by a CRISPR RNA (crRNA) having a sequence complementary to a target polynucleotide. Cas9 polypeptides are known in the art and include Cas9 polypeptides from any of a variety of biological sources, including prokaryotic sources such as bacteria and archaea. Bacterial Cas9 includes Actinomyces (e.g., Actinomyces naeslundii) Cas9, Aquifex Cas9, Bacteroides Cas9, Chlamydia Cas9, Green Non-Sulfur Bacteria Cas9, Cyanobacteria Cas9, Yersinia Cas9, Fibrobacter Cas9, Firmicutes Cas9 (e.g., Streptococcus pyogenes Cas9, Streptococcus thermophilus Cas9, Listeria innocua Cas9, Streptococcus agalactiae Cas9, Streptococcus mutans Cas9, and Enterococcus faecium Cas9), Fusobacterium Cas9, Proteobacteria (e.g., Neisseria meningitidis, Campylobacter jejuni, and lari) Cas9, and Spirochetes (e.g., Treponema denticola) Cas9. Examples of archaeal Cas9 include euryarchaeal Cas9 (e.g., Methanococcus maripaludis Cas9).Various Cas9 and related polypeptides are known and are reviewed in, for example, Makarova et al. (2011) Nature Reviews Microbiology 9:467-477; Makarova et al. (2011) Biology Direct 6:38; Haft et al. (2005) PLOS Computational Biology I:e60 and Chylinski et al. (2013) RNA Biology 10:726-737; K. Makarova et al., An updated evolutionary classification of CRISPR-Cas systems (2015) Nat. Rev. Microbio. 13:722-736; and B. Zetsche et al., Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system (2015) Cell 163(3):759-771.Other Cas9 polypeptides include Francisella tularensis subsp.novicida Cas9, Pasteurella multocida Cas9, Mycoplasma gallisepticum str. diazotrophicus Cas9, Azospirillum B510 Cas9, Sphaerochaeta globus str.Buddy cas9, Flavobacterium columnare Cas9, Fluviicola taffensis Cas9, Bacteroides coprophilus Cas9, Mycoplasma mobile Cas9, Lactobacillus farciminis Cas9, Streptococcus pasteurianus Cas9, Lactobacillus johnsonii Cas9, Staphylococcus pseudintermedius The Cas9 polypeptide may be any of the Cas9 family of Cas9 polypeptides, including any Cas9 isoform. The amino acid sequences of various Cas9 homologs, orthologs, and variants beyond those specifically set forth or provided herein are known and generally available to those skilled in the art, and therefore within the spirit and scope of this disclosure.

[0115] As used herein, the term "Cas12" or "Cas12 protein" refers to any Cas12 protein, including, but not limited to, Cas12a, Cas12b, Cas12c, Cas12d, and Cas12e. In some embodiments, the Cas12 protein is a functional Cas12 protein, specifically the Cas12a / Cpf1 protein from Acidaminococcus sp. strain BV3L6 (UniProt Entry: (U2UMQ6; UniProt Entry Name: CS12A_ACISB) or Francisella tularensis (UniProt Entry: A0Q7Q2; UniProt Entry In some embodiments, the Cas12 protein has an amino acid sequence that is at least 85% (or at least 90%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%) identical to the amino acid sequence of the Cas12a / Cpf1 protein from Cas12a / Cpf1 protein derived ... The Cas12 polypeptide may have substantially the same biological activity as the Cas12 polypeptide (e.g., 98% sequence identity, or at least 99% sequence identity). Examples of Cas12a proteins include, but are not limited to, FnCas12a, AsCas12a, LbCas12a, Lb5Cas12a, HkCas12a, OsCas12a, TsCas12a, BbCas12a, BoCas12a, or Lb4Cas12a; the Cas12a is preferably LbCas12a. Examples of Cas12b proteins include, but are not limited to, AacCas12b, Aac2Cas12b, AkCas12b, AmCas12b, AhCas12b, and AcCas12b.

[0116] As used herein, the term "CCR5" refers to CC chemokine receptor type 5, a protein on the surface of white blood cells involved in the immune system that acts as a receptor for chemokines. This is the process by which T cells are attracted to specific tissue and organ targets. Many forms of HIV, the virus that causes AIDS, initially use CCR5 to enter and infect host cells. Certain individuals carry a mutation in the CCR5 gene known as CCR5-Δ32, which protects them from these strains of HIV.

[0117] As used herein, the term "conjugate" refers to two or more molecules or moieties (including macromolecules or supramolecules) covalently linked, bonded, or otherwise coupled together into a larger construct.

[0118] As used herein, the term "crosslinker" refers to a bond or moiety that provides a link (e.g., an intramolecular or intermolecular link) between two or more molecular chains, domains, or other moieties. In some embodiments, a crosslinker is a molecule that forms a link between molecular chains to form a linked molecule.

[0119] As used herein, the term "endocytosis" refers to a form of active transport in which cells transport molecules (such as proteins) into the cell by engulfing them in an energy utilization process. Endocytosis includes pinocytosis and phagocytosis. Pinocytosis is a mode of endocytosis in which small particles are brought into the cell, forming invaginations and then suspended within vesicles. These pinocytic vesicles then fuse with lysosomes to hydrolyze (destroy) the particles. Phagocytosis is the process by which cells engulf solid particles to form internal compartments known as phagosomes.

[0120] As used herein, the phrase "effective amount" refers to the amount of a composition or formulation described herein that elicits the diagnostic, biological, or medical response in a tissue, system, animal, or human that is desired by a researcher, veterinarian, physician, or other clinician.

[0121] As used herein, the term "gene" broadly refers to any segment of DNA associated with a biological function. Genes include, but are not limited to, sequences containing coding sequences, promoter regions, cis-regulatory sequences, non-expressed DNA segments that are specific recognition sequences for regulatory proteins, non-expressed DNA segments that contribute to gene expression, DNA segments designed to have desired parameters, or combinations thereof.

[0122] As used herein, the terms "guide polynucleotide," "guide RNA," or "gRNA" refer to any polynucleotide sequence that has sufficient complementarity with a target polynucleotide sequence to hybridize with the target sequence and direct sequence-specific binding of a CRISPR complex to the target sequence. The degree of complementarity between a guide polynucleotide and its corresponding target sequence, when optimally aligned using a suitable alignment algorithm, can be about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or more. In some embodiments, the degree of complementarity between a guide polynucleotide and its corresponding target sequence, when optimally aligned using a suitable alignment algorithm, can be about 50% or less, such as 40%, 30%, 20%, or less. Optimal alignment may be determined by use of any suitable algorithm for aligning sequences, non-limiting examples of which include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler transform (e.g., the Burrows-Wheeler aligner), Clustal W, Clustal X, BLAT, Novoalign (Novocraft Technologies, ELAND (Illumina, San Diego, CA), SOAP (available at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net). The guide polynucleotide (also referred to herein as a guide sequence, including a single-stranded guide sequence (sgRNA)) can be about 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 75, 90, 100, 110, 112, 115, 120, 130, 140, or more nucleotides in length.

[0123] A guide polynucleotide may contain a nucleotide sequence complementary to a target DNA sequence. This portion of the guide sequence is referred to as the complementary region of the guide RNA. In some contexts, the two are distinguished from one another by referring to one as the complementary region or target region and the remaining polynucleotide as the guide sequence or tracrRNA. A guide sequence may also contain one or more miRNA target sequences linked to the 3' end of the guide sequence. A guide sequence may contain one or more MS2 RNA aptamers incorporated within the portion of the guide strand that is not complementary. As used herein, the term guide sequence may include any specially modified guide sequence, including, but not limited to, those configured for use in synergistic activation mediator (SAM)-implemented CRISPR (Nature 517, pp. 583-588 (January 29, 2015)). The guide polynucleotide can be less than about 150, about 125, about 75, about 50, about 45, about 40, about 35, about 30, about 25, about 20, about 15, about 12, or less nucleotides in length. The ability of a guide polynucleotide to direct the sequence-specific binding of a CRISPR complex to a target sequence can be evaluated by any suitable assay. For example, sufficient components of a CRISPR system to form a CRISPR complex, including the guide polynucleotide to be tested, can be provided to a host cell having the corresponding target sequence by transfecting a vector encoding the components of the CRISPR sequence, and then evaluating preferential cleavage within the target sequence, or by using any of the delivery systems provided elsewhere herein. Similarly, the cleavage of a target polynucleotide sequence can be evaluated in a test tube by providing components of a CRISPR complex including the target sequence, the guide polynucleotide to be tested, and a control guide polynucleotide that is different from the test guide polynucleotide, and comparing the rate of binding or cleavage at the target sequence between the test and control guide polynucleotide reactions. Other assays are possible and will be apparent to those skilled in the art.

[0124] As used herein, the term "hemoglobin subunit beta" or "HBB" refers to the gene that provides instructions for the production of a protein called beta globin. Beta globin is a component (subunit) of a larger protein called hemoglobin, located inside red blood cells. In adults, hemoglobin normally consists of four protein subunits: two subunits of beta globin and two subunits of another protein called alpha globin, which is produced from another gene called HBA. Each of these protein subunits is attached to (bound with) an iron-containing molecule called heme; each heme contains an iron molecule in its center that can bind to one oxygen molecule. Hemoglobin in red blood cells binds to oxygen molecules in the lungs. These cells then travel through the bloodstream, delivering oxygen to tissues throughout the body.

[0125] As used herein, the term "heteroalkyl," by itself or in combination with another term, means, unless otherwise indicated, stable linear or branched chains, or combinations thereof, consisting of at least one carbon atom and at least one heteroatom selected from the group consisting of O, N, P, Si, and S, where the nitrogen, phosphorus, and sulfur atoms are optionally oxidized, and the nitrogen heteroatom may optionally consist of tetraatoms. The heteroatoms O, N, P, S, and Si may be placed at any interior position of the heteroalkyl group or at the position at which the alkyl group is attached to the remainder of the molecule. Heteroalkyls are not cyclized. Examples include, but are not limited to: -CH2-CH2-O-CH3, -CH2-CH2-NH-CH3, -CH2-CH2-N(CH3)-CH3, -CH2-S-CH2-CH3, -CH2-O-CH3, -S(O)-CH3, -CH2-CH2-S(O)2-CH3, -CH=CH-O-CH3, -Si(CH3)3, -CH2-CH=N-OCH3, -CH=CH-N(CH3)-CH3, -O-CH3, -O-CH2-CH3, and -CN. Up to two heteroatoms may be consecutive, such as -CH2-NH-OCH3.

[0126] The term "heteroatom" as used herein refers to an atom other than carbon or hydrogen. Examples include nitrogen, oxygen, sulfur, phosphorus, chlorine, boron, and iodine.

[0127] As used herein, the terms "host cell" or "target cell" refer to cells modified using the methods of the present disclosure. Suitable mammalian host cells include, but are not limited to, human cells, mouse cells, non-human primate cells (e.g., rhesus monkey cells), human progenitor or stem cells, 293 cells, HeLa cells, D17 cells, MDCK cells, BHK cells, and Cf2Th cells. In some embodiments, host cells include hematopoietic cells such as hematopoietic progenitor / stem cells (e.g., CD34-positive hematopoietic progenitor / stem cells), monocytes, macrophages, peripheral blood mononuclear cells, CD4+ T lymphocytes, CD8+ T lymphocytes, or dendritic cells. In some embodiments, hematopoietic cells (e.g., CD4+ T lymphocytes, CD8+ T lymphocytes, and / or monocytes / macrophages) transfected with the polymer nanocapsules or polymer nanocapsule conjugates of the present disclosure can be allogeneic, autologous, or derived from a matched sibling. In some embodiments, the hematopoietic progenitor / stem cells are CD34 positive and can be isolated from the patient's bone marrow or peripheral blood. The isolated CD34 positive hematopoietic progenitor / stem cells (and / or other hematopoietic cells described herein) are, in some embodiments, transfected with the polymer nanocapsules or polymer nanocapsule conjugates described herein.

[0128] As used herein, the term "hyaluronic acid" refers to a polymer that can bind to cell surface receptors for active targeting. Hyaluronic acid is a polysaccharide and, along with collagen, is one of the major components of the extracellular matrix.

[0129] As used herein, the term "hypoxanthine-guanine phosphoribosyltransferase" or "HPRT" refers to an enzyme involved in purine metabolism that is encoded by the HPRT1 gene (see, e.g., SEQ ID NO: 12). HPRT1 is located on the X chromosome and is therefore present in a single copy in males. HPRT1 encodes a transferase that catalyzes the conversion of hypoxanthine to inosine monophosphate and guanine to guanosine monophosphate by transferring the 5-phosphoribosyl group from 5-phosphoribosyl 1-pyrophosphate to a purine. The enzyme functions primarily to reclaim purines from degraded DNA for use in de novo purine synthesis.

[0130] As used herein, the term "knock down" or "knockdown," when used in reference to the effect of RNAi on gene expression, means that the level of gene expression is inhibited or reduced to a level below that typically observed when examined under substantially the same conditions but without RNAi.

[0131] As used herein, the term "knock-out" or "knockout" refers to the partial or complete suppression of expression of an endogenous gene. This is generally achieved by deleting a portion of the gene or replacing it with a second sequence, but may also be by other modifications to the gene, such as introducing a stop codon, mutating critical amino acids, removing intron junctions, etc. Thus, a "knockout" construct is a nucleic acid sequence, such as a DNA construct, that when introduced into a cell results in the suppression (partial or complete) of expression of a polypeptide or protein encoded by endogenous DNA in the cell. In some embodiments, a "knockout" includes mutations such as point mutations, insertions, deletions, frameshifts, or missense mutations.

[0132] As used herein, the term "multiplicity of infection" or "MOI" refers to the ratio of an agent (e.g., a phage, or more generally, a virus, a bacterium) to an infected target (e.g., a cell). For example, when referring to a group of cells incubated with virus particles, the multiplicity of infection or MOI is the ratio of the number of virus particles to the number of target cells present in a defined space.

[0133] As used herein, the term "pharmaceutically acceptable carrier or excipient" refers to a carrier or excipient that is generally safe, non-toxic, and not biologically or otherwise undesirable and is useful in preparing pharmaceutical compositions or formulations, and includes carriers or excipients that are acceptable for veterinary use and for human pharmaceutical use.

[0134] As used herein, the term "positively charged monomer" or "cationic monomer" refers to a monomer having a net positive charge, i.e., +1, +2, +3. In some embodiments, a positively charged monomer is a monomer comprising a positively charged group. As used herein, the term "negatively charged monomer" or "anionic monomer" refers to a monomer having a net negative charge, i.e., -1, -2, -3. In some embodiments, a negatively charged monomer is a monomer comprising a negatively charged group. As used herein, the term "neutral monomer" refers to a monomer having a net neutral charge.

[0135] As used herein, the term "polymer" is defined to include homopolymers, copolymers, interpenetrating networks, and oligomers. Thus, the term polymer may be used interchangeably herein with the terms homopolymer, copolymer, interpenetrating polymer network, etc. The term "homopolymer" is defined as a polymer derived from a single type of monomer. The term "copolymer" is defined as a polymer derived from more than one type of monomer, including copolymers obtained by copolymerization of two monomer types, those obtained from three monomer types ("terpolymers"), those obtained from four monomer types ("tetrapolymers"), etc. The term "copolymer" is further defined to include random copolymers, alternating copolymers, graft copolymers, and block copolymers. Copolymers, as the term is generally used, include interpenetrating polymer networks. The term "random copolymer" is defined as a copolymer comprising macromolecules in which the probability of a given monomer unit occurring at any given site in the chain is independent of the nature of neighboring units. In random copolymers, the sequence distribution of the monomer units follows Bernoulli statistics. The term "alternating copolymer" is defined as a copolymer comprising macromolecules containing two types of monomer units in alternating sequences.

[0136] As used herein, the terms "targeting moiety" or "targeting moieties" and their derivatives refer to a moiety that localizes to or distances from a particular location (e.g., in a subject). For example, in some embodiments, a targeting moiety aids in directing a nanocapsule or polymer nanocapsule conjugate to a particular tissue or location. In some embodiments, a targeting moiety aids in delivery of the payload of a nanocapsule or polymer nanocapsule conjugate, e.g., a ribonucleoprotein complex, to a particular tissue site in vivo or to a particular cell type in vivo or ex vivo. Non-limiting examples include antibodies, antibody fragments, peptides, proteins, polysaccharides, carbohydrates, nucleic acids, vitamins, aptamers, or small molecules.

[0137] As used herein, the terms "stabilizing moiety" or "stabilizing moieties" and derivatives thereof refer to moieties that help promote the stability of nanocapsules or polymer nanocapsule conjugates. For example, in some embodiments, the stabilizing moiety helps promote the stability of nanocapsules or polymer nanocapsule conjugates by reducing aggregation, reducing opsonization, reducing phagocytosis, extending systemic circulation time, or a combination thereof. Without wishing to be bound by theory, in some embodiments, the stabilizing moiety may also help promote delivery of the payload, e.g., ribonucleoprotein complex, of the nanocapsule or polymer nanocapsule conjugate.

[0138] As used herein, the phrase "programmed cell death protein 1" or "PD-1" refers to a cell surface receptor that plays an important role in downregulating the immune system and promoting self-tolerance by suppressing T cell inflammatory activity. PD-1 is an immune checkpoint inhibitor that protects against autoimmunity through a dual mechanism: promoting apoptosis (programmed cell death) in antigen-specific T cells (anti-inflammatory suppressor T cells) in lymph nodes while simultaneously reducing apoptosis in regulatory T cells.

[0139] As used herein, the term "reactive group" refers to a functional group that can chemically associate, interact, hybridize, hydrogen bond, or link with a functional group of a different moiety. In some embodiments, a "reaction" between two reactive groups or two reactive functional groups can mean that a covalent bond is formed between the two reactive groups or two reactive functional groups; or it can mean that the two reactive groups or two reactive functional groups associate with each other, interact with each other, hybridize with each other, hydrogen bond with each other, etc.

[0140] As used herein, the term "subject" refers to a mammal such as a human, mouse, or primate. Typically, the mammal is a human (Homo sapiens).

[0141] Whenever a group or moiety is described as "substituted" or "optionally substituted" (or "optionally having" or "optionally containing"), the group can be unsubstituted or substituted with one or more of the indicated substituents. Similarly, when a group is described as "substituted or unsubstituted," if substituted, the substituents may be selected from one or more of the indicated substituents. When no substituents are indicated, the indicated "optionally substituted" or "substituted" group each independently includes alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, aryl, heteroaryl, heteroalicyclic, aralkyl, heteroaralkyl, (heteroalicyclic)alkyl, hydroxy, protected hydroxyl, alkoxy, aryloxy, acyl, mercapto, alkylthio, arylthio, cyano, cyanate, halogen, thiocarbonyl, O-carbamyl, N-carbamyl, O-thiocarbamyl, N ... means substituted with one or more groups selected from octacarbamyl, C-amido, N-amido, S-sulfonamido, N-sulfonamido, C-carboxy, protected C-carboxy, O-carboxy, isocyanate, thiocyanate, isothiocyanate, nitro, silyl, sulfenyl, sulfinyl, sulfonyl, haloalkyl, haloalkoxy, trihalomethanesulfonyl, trihalomethanesulfonamido, amino, ether, amino (e.g., mono- or di-substituted amino groups), and protected derivatives thereof.

[0142] As used herein, "TCR" refers to a T cell receptor, a molecule found on the surface of a T cell, or T lymphocyte, that is responsible for recognizing fragments of antigens as peptides that bind to major histocompatibility complex (MHC) molecules. The binding between the TCR and antigenic peptides is relatively low affinity and reduced: i.e., many TCRs recognize the same antigenic peptide, and many antigenic peptides are recognized by the same TCR.

[0143] As used herein, the term "transferrin" or "transferrins" refers to an iron-binding glycoprotein that is thought to be responsible for iron transport in the body. The transporting receptors are thought to be highly expressed in certain tissues and cells.

[0144] As used herein, the terms "treatment," "treating," or "treating" refer to obtaining a desired pharmacological and / or physiological effect with respect to a particular condition. The effect can be preventative, in that it completely or partially prevents a disease or its symptoms, and / or therapeutic, in that it partially or completely cures the disease and / or the deleterious effects caused by the disease. "Treatment," as used herein, encompasses any treatment of a disease or disorder in a subject, particularly a human, and includes (a) preventing the onset of a disease or disorder in a subject who is predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting a disease or disorder, i.e., arresting its development; and (c) alleviating or mitigating a disease or disorder, i.e., causing regression of the disease or disorder and / or alleviating one or more symptoms of the disease or disorder. "Treatment" can also encompass the delivery of an agent or administration of a therapy to provide a pharmacological effect even in the absence of a disease, disorder, or condition. The term "treatment" is used in some embodiments to refer to the administration of a compound of the present disclosure to alleviate a disease or disorder in a host, preferably in a mammalian subject, more preferably in a human. Thus, the term "treatment" can include preventing the occurrence of a disorder in a host, particularly when the host is predisposed to acquiring the disease but has not yet been diagnosed with the disease; inhibiting the disorder; and / or alleviating or reversing the disorder. As long as the method of the present disclosure is directed to preventing a disorder, it is understood that the term "preventing" does not require that the pathology be completely blocked. Rather, as used herein, the term "preventing" refers to the ability of a person skilled in the art to identify a population susceptible to a disorder so that administration of a compound of the present disclosure can occur prior to the onset of the disease. The term does not mean that the pathology must be completely avoided.

[0145] As used herein, the term "zeta potential" refers to the potential difference that exists between the surfaces of solid particles immersed in a conducting liquid.

[0146] polymer nanocapsules Provided herein are polymeric nanocapsules, such as polymeric nanocapsules comprising a payload. In some embodiments, a "polymeric nanocapsule" is a composition comprising a polymeric shell and a payload. In some embodiments, the payload is present within the core of the polymeric shell. In some embodiments, the payload is encapsulated within the polymeric shell.

[0147] payload Any payload can be contained within the polymer nanocapsules of the present disclosure. Non-limiting examples of payloads include, but are not limited to, ribonucleoproteins or ribonucleoprotein complexes, siRNA molecules, shRNA molecules, expression vectors, polynucleotides such as polynucleotides having between about 50 and about 500 base pairs, peptides, enzymes, antibodies, antibody fragments, vectors (e.g., AAV vectors, adeno-associated vectors), etc. Although the present disclosure may exemplify ribonucleoprotein complexes as payloads, the polymer nanocapsules (or polymer nanocapsule conjugates) disclosed herein are not limited to those containing ribonucleoproteins or ribonucleoprotein complexes.

[0148] Also provided herein are methods for delivering payloads held and / or encapsulated by polymer nanocapsules. In some embodiments, methods are provided for using the disclosed polymer nanocapsules and / or polymer nanocapsule conjugates to deliver payloads containing ribonucleoprotein complexes (e.g., Cas9 / gRNA) into cells, e.g., host cells, with high efficiency. Applicant has surprisingly discovered that the disclosed polymer nanocapsules and / or polymer nanocapsule conjugates are effective in delivering ribonucleoprotein complexes to host cells, such as pluripotent stem cells. In some embodiments, the present disclosure also demonstrates a novel strategy of self-assembly and in situ polymerization for imprinting ribonucleoprotein complexes into polymer nanocapsules.

[0149] As provided herein, a "ribonucleoprotein complex" refers to a complex or particle comprising a nucleoprotein and a ribonucleic acid. As provided herein, a "nucleoprotein" refers to a protein capable of binding to nucleic acids (e.g., RNA, DNA). When a nucleoprotein binds to a ribonucleic acid, it is called a "ribonucleoprotein." The interaction between a ribonucleoprotein and a ribonucleic acid may be direct, for example, through a covalent bond, or indirect, for example, through a non-covalent bond (e.g., electrostatic interactions (e.g., ionic bonds, hydrogen bonds, halogen bonds), van der Waals interactions (e.g., dipole-dipole, dipole-induced dipole, London dispersion), ring stacking (pi effect), hydrophobic interactions, etc.). In some embodiments, a ribonucleoprotein comprises an RNA-binding motif non-covalently bound to a ribonucleic acid. For example, a positively charged aromatic amino acid residue (e.g., lysine residue) in the RNA-binding motif may form an electrostatic interaction with the negative nucleic acid phosphate backbone of RNA, thereby forming a ribonucleoprotein complex. Non-limiting examples of ribonucleoproteins include ribosomes, telomerase, RNAseP, hnRNP, CRISPR-associated protein 9 (Cas9), and small nuclear RNPs (snRNPs). The ribonucleoprotein can be an enzyme. In embodiments, the ribonucleoprotein is an endonuclease. In some embodiments, the endonuclease is a Cas protein. In some embodiments, the Cas protein is Cas9. In other embodiments, the Cas protein is Cas12. In some embodiments, the Cas12 protein is Cas12a. In other embodiments, the Cas12 protein is Cas12b.

[0150] In some embodiments, the CRISPR-associated protein is believed to bind to a ribonucleic acid, thereby forming a ribonucleoprotein complex. In some embodiments, the ribonucleic acid is a guide RNA. In some embodiments, the guide RNA comprises one or more RNA molecules. In some embodiments, the endonuclease is Cas9, and the ribonucleic acid is a guide RNA. In some embodiments, the endonuclease is Cas12a, and the ribonucleic acid is a guide RNA. In some embodiments, the endonuclease is Cas12b, and the ribonucleic acid is a guide RNA.

[0151] In some embodiments, the gRNA comprises a nucleotide sequence that is complementary to the target site. The complementary nucleotide sequence may mediate binding of the ribonucleoprotein complex to the target site, thereby providing sequence specificity for the ribonucleoprotein complex. In some embodiments, the guide RNA is complementary to the target nucleic acid. In some embodiments, the guide RNA binds to the target nucleic acid sequence. In some embodiments, the guide RNA is complementary to a CRISPR nucleic acid sequence. In some embodiments, the complement of the guide RNA has about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity with the target nucleic acid. A target nucleic acid sequence as provided herein is a nucleic acid sequence expressed by a cell. In some embodiments, the target nucleic acid sequence is an exogenous nucleic acid sequence. In some embodiments, the target nucleic acid sequence is an endogenous nucleic acid sequence. In some embodiments, the target nucleic acid sequence forms part of a cellular gene. Thus, in some embodiments, the guide RNA is complementary to a cellular gene or a fragment thereof. In some embodiments, the guide RNA is about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary to the target nucleic acid sequence. In some embodiments, the guide RNA is about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary to the sequence of the cellular gene. In some embodiments, the guide RNA binds to the cellular gene sequence.

[0152] In some embodiments, two different versions of the Cas9 RNP complex can be used: (1) a combination of sgRNA and Cas9 protein, and (2) a combination of crRNA, tracrRNA (two separate strands that form the complete guide RNA), and Cas9 protein. In some embodiments, Cas9, the common component of the two versions, is used as the recombinant protein. In some embodiments, the RNA component (sgRNA) in the first version is typically synthesized using in vitro transcription, while the RNA components (crRNA and tracrRNA) in the second version are chemically synthesized.

[0153] In some embodiments, the Cas9 protein is recombinant S. pyogenes Cas9 nuclease, such as purified from an E. coli strain expressing codon-optimized Cas9, and contains one N-terminal nuclear localization sequence (NLS), two C-terminal NLSs, and a C-terminal 6-His tag. In some embodiments, the guide RNA is annealed from two parts: tracrRNA (67 nt) and crRNA (36 nt) from IDT (Cat. No. 1072532). Both are chemically modified to increase stability.

[0154] Without wishing to be bound by theory, it is generally recognized that, with respect to gene therapy, targeted integration (as opposed to random integration) of an expression cassette, transgene, gene fragment, or point mutation may offer one or more advantages. Specifically, it is believed that targeted integration can provide improved therapeutic outcomes and can reduce the risk of insertional mutagenesis and combinations thereof.

[0155] With this in mind, the potential advantages of targeting "safe harbor loci" as integration sites have been described, e.g., in Papasavva, P. et al. (2019). Mol Diagn Ther. 23(2):201-222, the entire disclosure of which is incorporated herein by reference. A safe harbor locus is understood to refer to a genomic locus or site where a transgene or other genetic element can be safely inserted and / or expressed.

[0156] Examples of suitable safe harbor loci include, but are not limited to, AAV integration site 1 (AAVS1), HPRT locus, albumin locus, hROSA26 locus, and chemokine (CC motif) receptor 5 (CCR5) locus. It is recognized that some safe harbor loci can preferably allow for the insertion of autonomous expression cassettes, such as AAVS1 and HPRT. Other safe harbor loci can preferably allow for transgene expression from endogenous control elements, such as hROSA26 and CCR5.

[0157] In some embodiments, the payload present in or encapsulated by the nanocapsule or polymer nanocapsule conjugate targets a safe harbor locus. In some embodiments, the payload present in or encapsulated by the nanocapsule or polymer nanocapsule conjugate comprises an autonomous expression cassette for insertion into the safe harbor locus. In other embodiments, the payload present in or encapsulated by the nanocapsule or polymer nanocapsule conjugate comprises one or more transgenes for insertion into the safe harbor locus. In some embodiments, the safe harbor locus is selected from the group consisting of AAV integration site 1 (AAVS1), the HPRT locus, the albumin locus, the hROSA26 locus, and the CCR5 locus. In some preferred embodiments, the safe harbor locus is HPRT. In some embodiments, the nanocapsule or polymer nanocapsule conjugate comprises a payload that targets a safe harbor locus. In some embodiments, the nanocapsule or polymer nanocapsule conjugate comprises a payload that targets the HPRT locus.

[0158] In some embodiments, the payload comprises a ribonucleoprotein complex. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets the CCR5 locus. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets the CCR5 locus and an endonuclease. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets the CCR5 locus and a Cas protein. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets the CCR5 locus and Cas9. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets the CCR5 locus and Cas12a. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets the CCR5 locus and Cas12b. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that has at least 90% sequence identity to the guide RNA of SEQ ID NO: 1. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having SEQ ID NO: 1. In some embodiments, the ribonucleoprotein complex comprises a guide RNA and a Cas protein having at least 90% sequence identity to the guide RNA of SEQ ID NO: 1. In some embodiments, the ribonucleoprotein complex comprises a guide RNA and a Cas protein having SEQ ID NO: 1.

[0159] In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets the HPRT locus. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets the HPRT locus and an endonuclease. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets the HPRT locus and a Cas protein. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets the HPRT locus and Cas9. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets the HPRT locus and Cas12a. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets the HPRT locus and Cas12b. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that has at least 90% sequence identity to a guide RNA of SEQ ID NO: 2. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that has SEQ ID NO: 2. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that has at least 90% sequence identity to a guide RNA of SEQ ID NO: 2 and a Cas protein. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having SEQ ID NO:2 and a Cas protein.

[0160] In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets the HBB locus. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets the HBB locus and an endonuclease. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets the HBB locus and a Cas protein. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets the HBB locus and Cas9. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets HBB and Cas12a. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets the HBB locus and Cas12b. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that has at least 90% sequence identity to a guide RNA of SEQ ID NO: 2. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that has SEQ ID NO: 3. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that has at least 90% sequence identity to a guide RNA of SEQ ID NO: 3 and a Cas protein. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having SEQ ID NO:3 and a Cas protein.

[0161] In some embodiments, the ribonucleoprotein complex comprises a guide RNA having at least 90% sequence identity to any one of SEQ ID NOs: 39-54. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having at least 95% sequence identity to any one of SEQ ID NOs: 39-54. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having any one of SEQ ID NOs: 39-54. In some embodiments, the ribonucleoprotein complex comprises a guide RNA and a Cas protein having at least 90% sequence identity to any one of SEQ ID NOs: 39-54. In some embodiments, the ribonucleoprotein complex comprises a guide RNA and a Cas protein having at least 95% sequence identity to any one of SEQ ID NOs: 39-54. In some embodiments, the ribonucleoprotein complex comprises a guide RNA and a Cas protein having any one of SEQ ID NOs: 39-54.

[0162] In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets the TCR. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets the TCR and an endonuclease. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets the TCR and a Cas protein. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets the TCR and Cas9. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets the TCR and Cas12a. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets the TCR and Cas12b. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that has at least 90% sequence identity to a guide RNA of SEQ ID NO: 4. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that has SEQ ID NO: 4. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that has at least 90% sequence identity to a guide RNA of SEQ ID NO: 4 and a Cas protein. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that has SEQ ID NO: 4 and a Cas protein.

[0163] In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets PD-1. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets PD-1 and an endonuclease. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets PD-1 and a Cas protein. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets PD-1 and Cas9. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets PD-1 and Cas12a. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets PD-1 and Cas12b. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that has at least 90% sequence identity to a guide RNA of SEQ ID NO: 5. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that has SEQ ID NO: 5. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that has at least 90% sequence identity to a guide RNA of SEQ ID NO: 5 and a Cas protein. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that has SEQ ID NO: 5 and a Cas protein.

[0164] In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets BCL11a. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets BCL11a and an endonuclease. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets BCL11a and a Cas protein. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets BCL11a and Cas9. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets BCL11a and Cas12a. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets BCL11a and Cas12b. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that has at least 90% sequence identity to a guide RNA of SEQ ID NO: 6. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that has SEQ ID NO: 6. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that has at least 90% sequence identity to a guide RNA of SEQ ID NO: 6 and a Cas protein. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having SEQ ID NO:6 and a Cas protein.

[0165] In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets C9orf72. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets C9orf72 and an endonuclease. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets C9orf72 and a Cas protein. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets C9orf72 and Cas9. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets C9orf72 and Cas12a. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets C9orf72 and Cas12b. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that has at least 90% sequence identity to a guide RNA of SEQ ID NO: 7. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that has SEQ ID NO: 7. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that has at least 90% sequence identity to a guide RNA of SEQ ID NO: 7 and a Cas protein. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having SEQ ID NO:7 and a Cas protein.

[0166] In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gDrosha1-complete. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gDrosha1-complete and an endonuclease. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gDrosha1-complete and a Cas protein. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gDrosha1-complete and Cas9. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gDrosha1-complete and Cas12a. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gDrosha1-complete and Cas12b. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having at least 90% sequence identity to the guide RNA of SEQ ID NO:8. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having SEQ ID NO:8. In some embodiments, the ribonucleoprotein complex comprises a guide RNA and a Cas protein having at least 90% sequence identity to the guide RNA of SEQ ID NO: 8. In some embodiments, the ribonucleoprotein complex comprises a guide RNA and a Cas protein having SEQ ID NO: 8.

[0167] In some embodiments, the payload comprises a ribonucleoprotein complex. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gDrosha2-complete. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gDrosha2-complete and an endonuclease. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gDrosha2-complete and a Cas protein. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gDrosha2-complete and Cas9. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gDrosha2-complete and Cas12a. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gDrosha2-complete and Cas12b. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having at least 90% sequence identity to the guide RNA of SEQ ID NO: 9. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having SEQ ID NO: 9. In some embodiments, the ribonucleoprotein complex comprises a guide RNA and a Cas protein having at least 90% sequence identity to the guide RNA of SEQ ID NO: 9. In some embodiments, the ribonucleoprotein complex comprises a guide RNA and a Cas protein having SEQ ID NO: 9.

[0168] In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHPRT4-complete. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHPRT4-complete and an endonuclease. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting a TCR and a Cas protein. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHPRT4-complete and Cas9. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHPRT4-complete and Cas12a. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHPRT4-complete and Cas12b. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having at least 90% sequence identity to a guide RNA of SEQ ID NO: 10. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having SEQ ID NO: 10. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having at least 90% sequence identity to a guide RNA of SEQ ID NO: 10 and a Cas protein. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having SEQ ID NO: 10 and a Cas protein.

[0169] In some embodiments, the payload comprises a ribonucleoprotein complex. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHPRT3-complete. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHPRT3-complete and an endonuclease. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHPRT3-complete and a Cas protein. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHPRT3-complete and Cas9. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHPRT3-complete and Cas12a. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHPRT3-complete and Cas12b. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having at least 90% sequence identity to the guide RNA of SEQ ID NO: 11. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having SEQ ID NO: 11. In some embodiments, the ribonucleoprotein complex comprises a guide RNA and a Cas protein having at least 90% sequence identity to the guide RNA of SEQ ID NO: 11. In some embodiments, the ribonucleoprotein complex comprises a guide RNA and a Cas protein having SEQ ID NO: 11.

[0170] In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets gWas1. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets gWas1 and an endonuclease. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets gWas1 and a Cas protein. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets gWas1 and Cas9. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets gWas1 and Cas12a. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets gWas1 and Cas12b. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that has at least 90% sequence identity to a guide RNA of SEQ ID NO: 12. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that has SEQ ID NO: 12. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that has at least 90% sequence identity to a guide RNA of SEQ ID NO: 12 and a Cas protein. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having SEQ ID NO: 12 and a Cas protein.

[0171] In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBG1-117. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBG1-117 and an endonuclease. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBG1-117 and a Cas protein. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBG1-117 and Cas9. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBG1-117 and Cas12a. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBG1-117 and Cas12b. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having at least 90% sequence identity to the guide RNA of SEQ ID NO: 13. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having SEQ ID NO: 13. In some embodiments, the ribonucleoprotein complex comprises a guide RNA and a Cas protein having at least 90% sequence identity to the guide RNA of SEQ ID NO: 13. In some embodiments, the ribonucleoprotein complex comprises a guide RNA and a Cas protein having SEQ ID NO: 13.

[0172] In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBG2-114. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBG2-114 and an endonuclease. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBG2-114 and a Cas protein. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBG2-114 and Cas9. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBG2-114 and Cas12a. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBG2-114 and Cas12b. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having at least 90% sequence identity to the guide RNA of SEQ ID NO: 14. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having SEQ ID NO: 14. In some embodiments, the ribonucleoprotein complex comprises a guide RNA and a Cas protein having at least 90% sequence identity to the guide RNA of SEQ ID NO: 14. In some embodiments, the ribonucleoprotein complex comprises a guide RNA and a Cas protein having SEQ ID NO: 14.

[0173] In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets gHBB2. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets gHBB2 and an endonuclease. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets gHBB2 and a Cas protein. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets gHBB2 and Cas9. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets gHBB2 and Cas12a. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets gHBB2 and Cas12b. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that has at least 90% sequence identity to a guide RNA of SEQ ID NO: 15. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that has SEQ ID NO: 15. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that has at least 90% sequence identity to a guide RNA of SEQ ID NO: 15 and a Cas protein. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having SEQ ID NO: 15 and a Cas protein.

[0174] In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBG12a1. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBG12a1 and an endonuclease. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBG12a1 and a Cas protein. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBG12a1 and Cas9. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBG12a1 and Cas12a. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBG12a1 and Cas12b. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having at least 90% sequence identity to the guide RNA of SEQ ID NO: 16. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having SEQ ID NO: 16. In some embodiments, the ribonucleoprotein complex comprises a guide RNA and a Cas protein having at least 90% sequence identity to the guide RNA of SEQ ID NO: 16. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having SEQ ID NO: 16 and a Cas protein.

[0175] In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBG12a2. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBG12a2 and an endonuclease. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBG12a2 and a Cas protein. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBG12a2 and Cas9. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBG12a2 and Cas12a. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBG12a2 and Cas12b. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having at least 90% sequence identity to the guide RNA of SEQ ID NO: 17. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having SEQ ID NO: 17. In some embodiments, the ribonucleoprotein complex comprises a guide RNA and a Cas protein having at least 90% sequence identity to the guide RNA of SEQ ID NO: 17. In some embodiments, the ribonucleoprotein complex comprises a guide RNA and a Cas protein having SEQ ID NO: 17.

[0176] In some embodiments, the payload comprises a ribonucleoprotein complex. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBG12a3. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBG12a3 and an endonuclease. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBG12a3 and a Cas protein. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBG12a3 and Cas9. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBG12a3 and Cas12a. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBG12a3 and Cas12b. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having at least 90% sequence identity to the guide RNA of SEQ ID NO: 18. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having SEQ ID NO: 18. In some embodiments, the ribonucleoprotein complex comprises a guide RNA and a Cas protein having at least 90% sequence identity to the guide RNA of SEQ ID NO: 18. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having SEQ ID NO: 18 and a Cas protein.

[0177] In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBG12a4. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBG12a4 and an endonuclease. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBG12a4 and a Cas protein. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBG12a4 and Cas9. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBG12a4 and Cas12a. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBG12a4 and Cas12b. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having at least 90% sequence identity to the guide RNA of SEQ ID NO: 19. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having SEQ ID NO: 19. In some embodiments, the ribonucleoprotein complex comprises a guide RNA and a Cas protein having at least 90% sequence identity to the guide RNA of SEQ ID NO: 19. In some embodiments, the ribonucleoprotein complex comprises a guide RNA and a Cas protein having SEQ ID NO: 19.

[0178] In some embodiments, the payload comprises a ribonucleoprotein complex. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBB12a1. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBB12a1 and an endonuclease. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBB12a1 and a Cas protein. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBB12a1 and Cas9. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBB12a1 and Cas12a. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBB12a1 and Cas12b. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having at least 90% sequence identity to the guide RNA of SEQ ID NO: 20. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having SEQ ID NO: 20. In some embodiments, the ribonucleoprotein complex comprises a guide RNA and a Cas protein having at least 90% sequence identity to the guide RNA of SEQ ID NO: 20. In some embodiments, the ribonucleoprotein complex comprises a guide RNA and a Cas protein having SEQ ID NO: 20.

[0179] In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBB12a2. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBB12a2 and an endonuclease. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBB12a2 and a Cas protein. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBB12a2 and Cas9. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBB12a2 and Cas12a. In some embodiments, the ribonucleoprotein complex comprises a guide RNA targeting gHBB12a2 and Cas12b. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having at least 90% sequence identity to the guide RNA of SEQ ID NO: 21. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having SEQ ID NO: 21. In some embodiments, the ribonucleoprotein complex comprises a guide RNA and a Cas protein having at least 90% sequence identity to the guide RNA of SEQ ID NO: 21. In some embodiments, the ribonucleoprotein complex comprises a guide RNA and a Cas protein having SEQ ID NO: 21.

[0180] In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets gHPRT12a1. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets gHPRT12a1 and an endonuclease. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets gHPRT12a1 and a Cas protein. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets gHPRT12a1 and Cas9. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets gHPRT12a1 and Cas12a. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets gHPRT12a1 and Cas12b. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that has at least 90% sequence identity to the guide RNA of SEQ ID NO: 22. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having SEQ ID NO: 22. In some embodiments, the ribonucleoprotein complex comprises a guide RNA and a Cas protein having at least 90% sequence identity to the guide RNA of SEQ ID NO: 22. In some embodiments, the ribonucleoprotein complex comprises a guide RNA and a Cas protein having SEQ ID NO: 22.

[0181] In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets gHPRT12a2. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets gHPRT12a2 and an endonuclease. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets gHPRT12a2 and a Cas protein. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets gHPRT12a2 and Cas9. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets gHPRT12a2 and Cas12a. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets gHPRT12a2 and Cas12b. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that has at least 90% sequence identity to the guide RNA of SEQ ID NO: 23. In some embodiments, the ribonucleoprotein complex comprises a guide RNA having SEQ ID NO: 23. In some embodiments, the ribonucleoprotein complex comprises a guide RNA and a Cas protein having at least 90% sequence identity to the guide RNA of SEQ ID NO: 23. In some embodiments, the ribonucleoprotein complex comprises a guide RNA and a Cas protein having SEQ ID NO: 23.

[0182] In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets the gamma globin promoter. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets the gamma globin promoter and an endonuclease. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets the gamma globin promoter and a Cas protein. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets the gamma globin promoter and Cas9. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets the gamma globin promoter and Cas12a. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets the gamma globin promoter and Cas12b.

[0183] Non-limiting examples of guide RNAs that can be incorporated into any ribonucleoprotein complex are shown below:

[0184] [Table 1-1] [Table 1-2]

[0185] Further non-limiting examples of guide RNAs that can be incorporated into any ribonucleoprotein complex, such as one containing the Cas12a protein, are shown below:

[0186] [Table 2]

[0187] Further non-limiting examples of target sequences for guide RNAs are shown below: [Table 3]

[0188] Additional target genes for gRNAs may include BCL11a for sickle cell disease, PD-1 for cancer therapy and / or C9orf72 for amyotrophic lateral sclerosis (ALS).

[0189] In some embodiments, polymeric nanocapsules (or conjugates described herein) are utilized to knock out HPRT. For example, isolated cells can be treated with HPRT-targeted CRISPR / Cas9 RNPs, such as those contained within the polymeric nanocapsules disclosed herein. In some embodiments, the nanocapsules contain a ribonucleoprotein complex comprising a gRNA molecule that targets a sequence within the human hypoxanthine phosphoribosyltransferase (HPRT) gene. In some embodiments, the nanocapsules contain a ribonucleoprotein complex comprising a gRNA molecule that targets a sequence within human chromosome X at a position ranging from about 134460145 to about 134500668. In some embodiments, the targeted sequence within the position ranging from about 134460145 to about 134500668 on chromosome X ranges in length from about 12 to about 28 contiguous base pairs. In some embodiments, the targeted sequence within the range of about 134460145 to about 134500668 on chromosome X is between about 14 and about 26 contiguous base pairs in length. In some embodiments, the targeted sequence within the range of about 134460145 to about 134500668 on chromosome X is between about 16 and about 24 contiguous base pairs in length. In some embodiments, the targeted sequence within the range of about 134460145 to about 134500668 on chromosome X is between about 18 and about 22 contiguous base pairs in length.

[0190] In some embodiments, a suitable target within the HPRT gene comprises a SEQ ID NO: 90% identical to any of SEQ ID NOs: 30-37. In other embodiments, a suitable target within the HPRT gene comprises a SEQ ID NO: 95% identical to any of SEQ ID NOs: 30-37. In other embodiments, a suitable target within the HPRT gene comprises a SEQ ID NO: 96% identical to any of SEQ ID NOs: 30-37. In other embodiments, a suitable target within the HPRT gene comprises a SEQ ID NO: 97% identical to any of SEQ ID NOs: 30-37. In other embodiments, a suitable target within the HPRT gene comprises a SEQ ID NO: 98% identical to any of SEQ ID NOs: 30-37. In other embodiments, a suitable target within the HPRT gene comprises a SEQ ID NO: 99% identical to any of SEQ ID NOs: 30-37. In other embodiments, a suitable target within the HPRT gene comprises a SEQ ID NO: 30-37.

[0191] polymer shell Various combinations of monomers and crosslinkers can be used to form polymer shells by in situ polymerization, thus encapsulating payloads, such as ribonucleoprotein complexes. In some embodiments, the polymeric nanocapsules of the present disclosure comprise at least one positively charged monomer, a neutral monomer, and a crosslinker (e.g., a degradable or erodible crosslinker). In other embodiments, the polymeric nanocapsules of the present disclosure comprise two positively charged monomers, a neutral monomer, and a crosslinker. Non-limiting examples of suitable positive monomers, neutral monomers, and crosslinkers are disclosed below.

[0192] In some embodiments, suitable positively charged monomers for forming the polymer shell of the polymer nanocapsules of the present disclosure are represented by formulas (IA) and (IB): [ka] and During the ceremony, R 1is H or a substituted or unsubstituted C1-C6 alkyl group; R 2 is -(CH2) m -NR 3 R 4 R 5 and m is an integer from 1 to 5; R 3 is H, an unsubstituted C1-C6 alkyl group, or NR 6 R 7 is a C1-C6 alkyl group substituted with R 6 and R 7 are independently H or an unsubstituted C1-C6 alkyl group or an amino-substituted C1-C6 alkyl group or NR 8 R 9 C1-C6 alkyl substituted with R 8 and R 9 are independently selected from H, an unsubstituted C1-C6 alkyl group, or an amino-substituted C1-C6 alkyl group; R 4 is H, an unsubstituted C1-C6 alkyl group, an amino-substituted C1-C6 alkyl group, or NR 10 R 11 C1-C6 alkyl substituted with R 10 and R 11 are independently H, an unsubstituted C1-C6 alkyl group, an amino-substituted C1-C6 alkyl group, or NR 12 R 13 C1-C6 alkyl groups substituted with R 12 and R 13 are independently selected from H, an unsubstituted C1-C6 alkyl group, or an amino-substituted C1-C6 alkyl group; or R 3 and R 4 may be taken together to form a 5- to 7-membered heterocycloalkyl ring; R 5 is a lone pair of electrons or an unsubstituted C1-C6 alkyl group.

[0193] In other embodiments, suitable positively charged monomers for forming polymeric nanocapsules of the present disclosure have the formula (IC) or (ID): [ka] and In the formula, R 2 is as defined above.

[0194] In some embodiments, the positively charged monomer is: N-(3-((4-((3-aminopropyl)amino)butyl)amino)propyl)acrylamide, N-(3-((4-((3-aminopropyl)amino)butyl)amino)propyl)methacrylamide, N-(3-((4-aminobutyl)amino)propyl)acrylamide, N-(3-((4-aminobutyl)amino)propyl)methacrylamide, N-(2-((2-aminoethyl)(methyl)amino)ethyl)acrylamide, N-(2-((2-aminoethyl)(methyl)amino)ethyl)methacrylamide, N-(piperazin-1-ylmethyl)acrylamide, N-(piperazin-1-ylmethyl)methacrylamide, N-(2-(bis(2-aminoethyl)amino)ethyl)acrylamide, N-(2-(bis(2-aminoethyl)amino)ethyl)methacrylamide, N-(3-aminopropyl)methacrylamide hydrochloride, 2-(dimethylamino)ethyl acrylate, dimethylaminoethyl methacrylate, (3-acrylamidopropyl)trimethylammonium hydrochloride, 2-aminoethyl methacrylate, 3-(dimethylamino)propyl acrylate, and N-[3-(dimethylamino)propyl]methacrylamide is selected from the group consisting of:

[0195] In some embodiments, the positive monomer is selected from the group consisting of N-(3-((4-((3-aminopropyl)amino)butyl)amino)propyl)acrylamide, 2-(dimethylamino)ethyl acrylate, and any combination thereof.

[0196] In some embodiments, suitable crosslinkers for forming polymeric nanocapsules of the present disclosure have the formula (IE): [ka] having the structure In the formula, R 14 and R 15 are independently H or a substituted or unsubstituted C1-C6 alkyl group; W is -N(H)-R 16 -N(H)- or -[O-CH2-C(H)(OH)-CH2] n -O- and R 16 is a substituted or unsubstituted C1-C6 alkylene.

[0197] In some embodiments, the crosslinker is selected from 1,3-glycerin dimethacrylate, N,N'-methylenebisacrylamide, and / or glycerin 1,3-diglycerolate diacrylate.

[0198] In some embodiments, suitable neutral monomers for forming the polymeric nanocapsules of the present disclosure have the formula (IF): [ka] having the structure In the formula, R 17 is H or an unsubstituted C1-C6 alkyl group, R 18 is an amino or hydroxy-substituted alkyl-substituted amino or OR 19 and R 19 is a hydroxyalkyl substituent.

[0199] In some embodiments, the neutral monomer is selected from N-(1,3-dihydroxy-2-(hydroxymethyl)propan-2-yl)acrylamide, acrylamide, N-(hydroxymethyl)acrylamide, 2-hydroxyethyl acrylate, and / or 2-hydroxyethyl methacrylate.

[0200] In some embodiments, polymeric nanocapsules can be synthesized by in-situ polymerization techniques. In some embodiments, polymerization can be initiated using at least one positively charged monomer (e.g., N-(3-((4-((3-aminopropyl)amino)butyl)amino)propyl)acrylamide and / or 2-(dimethylamino)ethyl acrylate), a crosslinker (e.g., 1,3-glycerol dimethacrylate), and a neutral monomer (e.g., acrylamide). The monomers are then concentrated around the surface of the payload, e.g., a negatively charged ribonucleoprotein complex, through electrostatic interactions and / or hydrogen bonding. Without wishing to be bound by any particular theory, it is believed that various crosslinkers can be used to form copolymer coatings with tunable composition, structure, surface properties, and functionality. It is also believed that the crosslinked polymer shell provided by the above polymerization provides protection to the payload, e.g., a ribonucleoprotein complex, from, for example, enzymatic degradation, temperature dissociation, and serum inactivation.

[0201] As another example, the synthesis of polymer nanocapsules utilizes electrostatic interactions that exist around the surface of a payload, e.g., a negatively charged ribonucleoprotein complex. For example, monomers can self-assemble along the surface of a negatively charged ribonucleoprotein complex through electrostatic interactions and / or hydrogen bonds. Using crosslinkers and positive and neutral monomers, room-temperature polymerization can occur in aqueous solution after the initial interaction. During room-temperature polymerization, each ribonucleoprotein complex is thought to be "encased" in a thin shell of polymer network. Such a crosslinked shell (i.e., polymer shell) is thought to protect the ribonucleoprotein complex now present within the core of the polymer nanocapsule from hydrolysis and the like. As further described herein, additional moieties can be added to the formed polymer shell for targeting and / or to increase water solubility and / or charge.

[0202] In some embodiments, the polymeric nanocapsules are synthesized using an encapsulation buffer, such as one having a pH ranging from about 6 to about 7.5. In other embodiments, the pH of the encapsulation buffer ranges from about 6 to about 7. In yet other embodiments, the pH of the encapsulation buffer is about 6.7. In some embodiments, the encapsulation buffer comprises 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), NaCl, and / or MgCl. In some embodiments, HEPES is present in an amount ranging from about 10 to about 50 mM. In other embodiments, HEPES is present in an amount of about 20 mM. In some embodiments, NaCl is present in an amount ranging from about 50 to about 150 mM. In other embodiments, NaCl is present in an amount of about 100 mM. In some embodiments, MgCl is present in an amount ranging from about 1 to about 10 mM. In other embodiments, MgCl is present in an amount of about 5 mM.

[0203] In some embodiments, the amount of positive monomer ranges from about 20% to about 65% of the total weight of the polymer shell of the polymer nanocapsule. In other embodiments, the amount of positive monomer ranges from about 25% to about 60% of the total weight of the polymer shell of the polymer nanocapsule. In still other embodiments, the amount of positive monomer ranges from about 25% to about 55% of the total weight of the polymer shell of the polymer nanocapsule. In further embodiments, the amount of positive monomer ranges from about 30% to about 50% of the total weight of the polymer shell of the polymer nanocapsule.

[0204] In some embodiments, the amount of neutral monomer ranges from about 40% to about 70% of the total weight of the polymer shell of the polymer nanocapsule. In other embodiments, the amount of neutral monomer ranges from about 40% to about 65% of the total weight of the polymer shell of the polymer nanocapsule. In still other embodiments, the amount of neutral monomer ranges from about 45% to about 65% of the total weight of the polymer shell of the polymer nanocapsule. In further embodiments, the amount of neutral monomer ranges from about 45% to about 60% of the total weight of the polymer shell of the polymer nanocapsule.

[0205] In some embodiments, the amount of crosslinker (e.g., an erodible or degradable crosslinker) ranges from about 5% to about 20% of the total weight of the polymer shell of the polymer nanocapsule. In other embodiments, the amount of crosslinker ranges from about 5% to about 15% of the total weight of the polymer shell of the polymer nanocapsule. In still other embodiments, the amount of crosslinker ranges from about 5% to about 12.5% ​​of the total weight of the polymer shell of the polymer nanocapsule. In other embodiments, the amount of crosslinker ranges from about 5% to about 10% of the total weight of the polymer shell of the polymer nanocapsule.

[0206] In some embodiments, the ribonucleoprotein or ribonucleoprotein complex may comprise between about 10% and about 50% of the total weight of the polymeric nanocapsule containing its payload. In other embodiments, the ribonucleoprotein or ribonucleoprotein complex may comprise between about 15% and about 45% of the total weight of the polymeric nanocapsule containing its payload. In still other embodiments, the ribonucleoprotein or ribonucleoprotein complex may comprise between about 20% and about 40% of the total weight of the polymeric nanocapsule containing its payload.

[0207] In some embodiments, the ratio of positively charged monomers to neutrally charged monomers ranges from about 6:1 to about 1:6. In other embodiments, the ratio of positively charged monomers to neutrally charged monomers ranges from about 5:1 to about 1:5. In other embodiments, the ratio of positively charged monomers to neutrally charged monomers ranges from about 4:1 to about 1:4. In other embodiments, the ratio of positively charged monomers to neutrally charged monomers ranges from about 3:1 to about 1:3. In still other embodiments, the ratio of positively charged monomers to neutrally charged monomers ranges from about 1:1 to about 1:5. In still other embodiments, the ratio of positively charged monomers to neutrally charged monomers ranges from about 1:1 to about 1:4. In still other embodiments, the ratio of positively charged monomers to neutrally charged monomers ranges from about 1:1 to about 1:3. In yet other embodiments, the ratio of positively charged monomers to neutrally charged monomers ranges from about 1:1 to about 1:2. One skilled in the art will appreciate that as the amount of positively charged monomers relative to the amount of neutral monomers increases, the amount of positive surface charge on the polymeric nanocapsules formed therefrom will increase (i.e., the resulting polymeric nanocapsules will have a net positive charge). Similarly, if the amount of neutral monomers increases relative to the amount of positively charged monomers, the polymeric nanocapsules formed therefrom may have a neutral or slightly negative charge.

[0208] In some embodiments, the ratio of monomers (positively and neutrally charged monomers) to crosslinker ranges from about 1:2 to about 1:10. In other embodiments, the ratio of monomers (positively and neutrally charged monomers) to crosslinker ranges from about 1:2 to about 1:9. In other embodiments, the ratio of monomers (positively and neutrally charged monomers) to crosslinker ranges from about 1:2 to about 1:8. In some embodiments, the ratio of monomers (positively and neutrally charged monomers) to crosslinker ranges from about 1:3 to about 1:8.

[0209] [Table 4]

[0210] In some embodiments, and with reference to the table below, the molar ratios of positive ("monomer 1"), neutral hydrophilic monomer ("monomer 2") and cross-linker to various payloads such as horseradish peroxidase, siRNA duplexes, sh5 DNA cassettes, antibodies, Cas9 protein, RNPs (Cas9 and gRNA complexes) and adenovirus can be estimated based on the molecular weight and net charge of the cargo to be contained within the formed nanocapsules.

[0211] [Table 5]

[0212] In some embodiments, the overall net charge on the nanocapsule surface is positive. For example, in some embodiments, the nanocapsule surface may have a charge between about 1 and about 15 millivolts (mV) (as measured in a standard phosphate solution). In other embodiments, the nanocapsule surface may have a charge between about 1 and about 10 mV. In still other embodiments, the nanocapsule surface may have a charge between about 5 and about 10 mV. In further embodiments, the nanocapsule surface may have a charge between about 1 and about 5 mV. In still further embodiments, the nanocapsule surface may have a charge ranging from about 3 to about 5 mV. All of the listed charges were measured using a Zetasizer-NanoZS (available from Malvern Panalytical Ltd) at a pH of about 7.4. The net positive surface charge of the nanocapsules of the present disclosure is believed to be important for achieving interactions between the nanocapsules and biological surfaces, particularly between the nanocapsules and cell membranes.

[0213] In some embodiments, the polymeric nanocapsules have an average diameter of about 200 nanometers (nm) or less, e.g., between about 1 and 200 nm, or between about 5 and about 200 nm, or between about 10 and 150 nm, or between 15 and 100 nm, or between about 15 and about 150 nm, or between about 20 and about 125 nm, or between about 50 and about 100 nm, or between about 50 and about 75 nm. In other embodiments, the polymeric nanocapsules have an average diameter of between about 10 nm and about 20 nm, about 20 to about 25 nm, about 25 nm and about 30 nm, about 30 nm and about 35 nm, about 35 nm and about 40 nm, about 40 nm and about 45 nm, about 45 nm and about 50 nm, about 50 nm and about 55 nm, about 55 nm and about 60 nm, about 60 nm and about 65 nm, about 70 nm and about 75 nm, about 75 nm and about 80 nm, about 80 nm and about 85 nm, about 85 nm and about 90 nm, about 90 nm and about 95 nm, about 95 nm and about 100 nm, or about 100 nm and about 110 nm. In still other embodiments, the polymeric nanocapsules have an average diameter between about 120 nm and about 130 nm, about 130 nm and about 140 nm, about 140 nm and about 150 nm, about 150 nm and about 160 nm, about 160 nm and about 170 nm, about 170 nm and about 180 nm, about 180 nm and about 190 nm, about 190 nm and about 200 nm, about 200 nm and about 210 nm, about 220 nm and about 230 nm, about 230 nm and about 240 nm, about 240 nm and about 250 nm, or a diameter greater than about 250 nm. It is believed that the size of the polymeric nanocapsules described herein can be determined based on the polymer:crosslinker ratio as described herein.

[0214] In some embodiments, the polymeric nanocapsules are designed to degrade in about 1 hour, or about 2 hours, or about 3 hours, or about 4 hours, or about 5 hours, or about 6 hours, or about 12 hours, or about 1 day, or about 2 days, or about 1 week, or about 1 month. In other embodiments, the polymeric nanocapsules are designed to degrade at any of the above specified rates at physiological pH. In certain embodiments, the polymeric nanocapsules are designed to degrade at any of the above specified rates after administration to a subject in need thereof.

[0215] In some embodiments, the ribonucleoprotein complex comprises a Cas protein comprising one or more nuclear localization signal fusion peptides (NLSs). In some embodiments, each Cas endonuclease, e.g., Cas9 endonuclease, comprises one, two, three, or more NLSs. In some embodiments, the presence of one or more NLSs facilitates nuclear transport of the ribonucleoprotein complex.

[0216] Polymer nanocapsule conjugates Also disclosed herein are conjugates of polymer nanocapsules (including any payload) and another molecular entity (hereinafter referred to as "conjugates" or "polymer nanocapsule conjugates"). In some embodiments, the molecular entity conjugated to the polymer nanocapsule comprises a targeting moiety and / or a stabilizing moiety. In some embodiments, the targeting moiety and / or the stabilizing moiety are linked to the surface of the polymer shell of the polymer nanocapsule. Conjugation of one or more targeting moieties and / or one or more stabilizing moieties to the polymer nanocapsule is believed to provide one or more of the following: (i) specific targeting of the polymer nanocapsule to the surface of a specific cell type, thereby providing directed delivery of the ribonucleoprotein complex to the specific cell type; (ii) enhanced water solubility of the conjugate; (iii) enhanced stability of the polymer nanocapsule / conjugate against serum proteins; and / or (iv) reduced nonspecificity of the targeted delivery.

[0217] In some embodiments, the polymer nanocapsule conjugate comprises one or more targeting moieties. In other embodiments, the polymer nanocapsule conjugate comprises one or more stabilizing moieties. In still other embodiments, the polymer nanocapsule conjugate comprises one or more targeting moieties and one or more stabilizing moieties. In some embodiments, the polymer nanocapsule conjugate comprises at least one targeting moiety and at least two stabilizing moieties. In other embodiments, the polymer nanocapsule conjugate comprises at least two targeting moieties and at least one stabilizing moiety.

[0218] In some embodiments of polymer nanocapsule conjugates, the total number of one or more targeting and / or stabilizing moieties linked to the polymer nanocapsule ranges from about 1 to about 24. In other embodiments of polymer nanocapsule conjugates, the total number of one or more targeting and / or stabilizing moieties linked to the polymer nanocapsule ranges from about 1 to about 16. In some embodiments of polymer nanocapsule conjugates, the total number of one or more targeting and / or stabilizing moieties linked to the polymer nanocapsule ranges from about 1 to about 12. In some embodiments of polymer nanocapsule conjugates, the total number of one or more targeting and / or stabilizing moieties linked to the polymer nanocapsule ranges from about 2 to about 12. In some embodiments of the polymer nanocapsule conjugate, the total number of one or more targeting and / or stabilizing moieties linked to the polymer nanocapsule ranges from about 2 to about 9. In some embodiments of the polymer nanocapsule conjugate, the total number of one or more targeting and / or stabilizing moieties linked to the polymer nanocapsule ranges from about 2 to about 8. In some embodiments of the polymer nanocapsule conjugate, the total number of one or more targeting and / or stabilizing moieties linked to the polymer nanocapsule ranges from about 2 to about 6.In some embodiments of polymer nanocapsule conjugates comprising one or more targeting and / or one or more stabilizing moieties, the total number of one or more targeting and / or stabilizing moieties linked to the polymer nanocapsule ranges from about 2 to about 4. In some embodiments of polymer nanocapsule conjugates comprising one or more targeting and / or one or more stabilizing moieties, the total number of one or more targeting and / or stabilizing moieties linked to the polymer nanocapsule ranges from about 3 to about 6. Those skilled in the art will appreciate that larger polymer nanocapsules (e.g., those with a larger total surface area) will be able to facilitate the incorporation of more targeting and / or stabilizing moieties, respectively, compared to smaller polymer nanocapsules.

[0219] In some embodiments, the polymer nanocapsule conjugate has formula (II): [ka] having the general structure During the ceremony, A "polymeric nanocapsule" is a polymeric nanocapsule that contains a payload (such as any of the polymeric nanocapsules and / or payloads described herein), U is a targeting or stabilizing moiety; s is an integer ranging from 1 to 24.

[0220] In some embodiments, s is an integer ranging from 1 to 16. In some embodiments, s is an integer ranging from 1 to 12. In some embodiments, s is an integer ranging from 2 to 12. In some embodiments, s is an integer ranging from 2 to 9. In some embodiments, s is an integer ranging from 2 to 8. In some embodiments, s is an integer ranging from 2 to 6. In some embodiments, s is an integer ranging from 2 to 4. In some embodiments, s is an integer ranging from 1 to 12. In some embodiments, s is an integer ranging from 3 to 9. In some embodiments, s is an integer ranging from 3 to 6. In some embodiments, the conjugate of Formula (II) comprises at least one targeting moiety and at least one stabilizing moiety. By way of example only, the polymer nanocapsule conjugate of formula (II) can include one or more targeting moieties including one or more of an anti-CD4 antibody, an anti-CD8 antibody, and an anti-CD45 antibody, such that the polymer nanocapsule conjugate targets cells, e.g., host cells, bearing a cluster of differentiation marker selected from the group consisting of CD4, CD8, CD45, and any combination thereof.

[0221] In some embodiments, the polymer nanocapsule conjugate is internalized into cells via the endocytosis process. In some embodiments, the polymer nanocapsule conjugate does not contain a targeting moiety (e.g., one or more stabilizing moieties) and is internalized via the caveolae-mediated endocytosis pathway (see also Yan et al., "A Novel Intracellular Protein Delivery Platform Based on Single-Protein Nanocapsules," Nature Nano 2010, 5, pp. 48-53, and Yan et al., "Single siRNA nanocapsules for enhanced RNAi delivery," JACS 2012, 134, 33, pp. 13542-5, the entire disclosures of which are incorporated herein by reference). In some embodiments, for nanocapsules that do not contain one or more targeting moieties, the endocytosis process is initiated depending on the charge of the nanocapsule. In some embodiments, a positive charge on the polymer nanocapsule is required to initiate the caveolae-mediated endocytosis pathway. In other embodiments, the polymer nanocapsule conjugates comprise one or more targeting moieties and are internalized by receptor-mediated or integrin-mediated endocytosis, as further described herein. As demonstrated in Figures 5E-5G, endocytosis of the disclosed polymer nanocapsule conjugates can occur even in the absence of imidazolyl groups within the polymer shell of the polymer nanocapsule conjugate.

[0222] In some embodiments, the endocytosis process is thought to proceed according to the following process: polymer nanocapsules (or polymer nanocapsule conjugates) are attached to the surface of the cell membrane through electrostatic interactions, antibody-receptor interactions, and / or RGD-integrin interactions, and then the nanocapsules are endocytosed, i.e., internalized into the cell within the endosome, i.e., membrane-bound compartment. Once inside the endosome, protons are pumped into the endosome, causing the pH within the endosome to decrease, i.e., become more acidic. The nanocapsules then gradually swell and disassemble, and the ribonucleoprotein complexes are thought to "escape" from the swollen endosome. In some embodiments, a nuclear localization signal fusion peptide, when present on a Cas protein, is thought to assist in the nuclear transport of RNPs, i.e., assist in the transport of the RNP payload across the nuclear membrane.

[0223] In some embodiments, the polymer nanocapsule conjugate is stable at neutral pH (e.g., a pH range of between 7 and 7.6), and in some embodiments, the polymer nanocapsule conjugate degrades at acidic pH (e.g., a pH range of between about 5 and about 6), allowing release of the RNP complex payload into the cytoplasm.

[0224] Targeting moieties and polymer nanocapsule conjugates containing targeting moieties - Patent Application 20070122999 The present disclosure provides a conjugate comprising one or more targeting moieties and any of the polymer nanocapsules described herein. In some embodiments, conjugation of one or more targeting moieties to the polymer nanocapsule allows the payload of the polymer nanocapsule conjugate, such as a ribonucleoprotein complex, to be delivered to a specific tissue site in vivo or to a specific cell type either in vivo or ex vivo. In some embodiments, the targeting moiety of the polymer nanocapsule conjugate can enhance the accumulation of the polymer nanocapsule in a target cell or tissue. For example, the targeting moiety of the polymer nanocapsule conjugate can bind to or otherwise associate with a cell-specific cell surface receptor, thereby bringing the polymer nanocapsule directly into proximity with the target cell.

[0225] In some embodiments, the targeting moiety is selected from those that enable delivery of the polymer nanocapsule conjugate to a specific cell type that has a specific type of receptor or marker. In some embodiments, the targeting moiety comprises an antibody (e.g., an anti-CD3 antibody, an anti-CD4 antibody, an anti-CD8 antibody, an anti-CD45 antibody), an antibody fragment, a peptide (e.g., a cell-penetrating peptide, arginylglycylaspartic acid (RGD), IL4RPep-1), a protein (e.g., a lectin, transferrin), a polysaccharide (e.g., hyaluronic acid), a carbohydrate, a nucleic acid, a vitamin (e.g., vitamin D), an aptamer (e.g., AS-1411, GBI-10), or a small molecule (folic acid, anisamide, phenylboronic acid), etc. In other embodiments, the targeting moiety comprises a cyclodextrin, adamantine, HLA, or N-acetylgalactosamine (GalNac). In some embodiments, the targeting moiety comprises an anti-CD34 antibody. In some embodiments, the targeting moiety comprises an anti-CD49f antibody. In some embodiments, the targeting moiety comprises an anti-CD133 antibody. In some embodiments, the targeting moiety comprises an arginine-glycine-aspartic acid (RGD)-containing peptide. In some embodiments, the targeting moiety comprises transferrin or a cyclic variant thereof. In some embodiments, the targeting moiety comprises IL-3.

[0226] In some embodiments, the targeting moiety is an antibody, and between about 1 and about 5 antibodies are linked to the polymeric nanocapsule. In some embodiments, the targeting moiety is an antibody, and between about 1 and about 4 antibodies are linked to the polymeric nanocapsule. In some embodiments, the targeting moiety is an antibody, and between about 1 and about 3 antibodies are linked to the polymeric nanocapsule. In some embodiments, the targeting moiety is an antibody, and between about 1 and about 2 antibodies are linked to the polymeric nanocapsule.

[0227] In some embodiments, the targeting moiety may target specific cell surface receptors specific to immune cells, blood cells, heart cells, lung cells, photoreceptors, liver cells, kidney cells, brain cells, cells of the central nervous system, cells of the peripheral nervous system, cancer cells, virus-infected cells, stem cells, skin cells, intestinal cells, and / or auditory cells. In some embodiments, the cancer cells are cells selected from the group including lymphoma cells, solid tumor cells, leukemia cells, bladder cancer cells, breast cancer cells, colon cancer cells, rectal cancer cells, endometrial cancer cells, kidney cancer cells, lung cancer cells, melanoma cells, pancreatic cancer cells, prostate cancer cells, and thyroid cancer cells. As an example, an anti-CD3 antibody linked to a polymer nanocapsule can target T cells expressing the CD3 marker. Following this example, the same polymer nanocapsule linked to an anti-CD3 antibody does not target B cells expressing the CD19 marker.

[0228] In some embodiments, the targeting moiety targets a cluster of differentiation marker ("CD marker"). In some embodiments, the targeting moiety is an anti-CD marker antibody. Cluster of differentiation (CD) designations refer to cell surface proteins. Each unique molecule is assigned a different numerical designation, which allows for the identification of a cell phenotype. Surface expression of a particular CD molecule may not be specific to just one type of cell, or even to a cell lineage, but many are useful for characterizing cell phenotypes. In some embodiments, the targeting moiety targets a CD marker expressed by stem cells. In some embodiments, the targeting moiety targets any one of the following markers: CD117 (e.g., an anti-CD117 antibody), CD10 (e.g., an anti-CD10 antibody), CD34 (e.g., an anti-CD34 antibody), CD38 (e.g., an anti-CD38 antibody), CD45 (e.g., an anti-CD45 antibody), CD123 (e.g., an anti-CD123 antibody), CD127 (e.g., an anti-CD127 antibody), CD135 (e.g., an anti-CD135 antibody), CD44 (e.g., an anti-CD44 antibody), CD47 (e.g., an anti-CD47 antibody), CD96 (e.g., an anti-CD96 antibody), CD2 (e.g., an anti-CD2 antibody), CD4 (e.g., an anti-CD4 antibody), CD3 (e.g., an anti-CD3 antibody), and CD9 (e.g., an anti-CD9 antibody). In some embodiments, the targeting moiety targets any one of human mesenchymal stem cell CD markers including CD29 (e.g., an anti-CD29 antibody), CD44 (e.g., an anti-CD44 antibody), CD90 (e.g., an anti-CD90 antibody), CD49a-f (e.g., an anti-CD49a-f antibody), CD51 (e.g., an anti-CD117 antibody), CD73 (SH3), CD105 (SH2), CD106 (e.g., an anti-CD106 antibody), CD166 (e.g., an anti-CD166 antibody), and Stro-1 markers. In some embodiments, the targeting moiety targets any one of human hematopoietic stem cell CD markers including CD34 (e.g., an anti-CD34 antibody), CD38 (e.g., an anti-CD38 antibody), CD45RA (e.g., an anti-CD45A antibody), CD90 (e.g., an anti-CD90 antibody), and CD49 (e.g., an anti-CD49 antibody).

[0229] In other embodiments, the conjugate used to achieve specific targeting of the polymer nanocapsules comprises any one or more of AFP, beta-catenin, BMI-1, BMP-4, c-kit, CXCL12, SDF-1, CXCR4, decorin, E-cadherin, cadherin 1, EGFR, ErbB1, endoglin, EpCAM, TROP-1, Fc epsilon RI A, FCER1A, L1CAM, LMO2, Nodal, Notch-1, PDGFRB, podoplanin, PTEN, sonic hedgehog, STAT3, syndecan-1, transferrin receptor, and vimentin.

[0230] In other embodiments, conjugates used to achieve specific targeting of the polymer nanocapsules include any one or more of ALK, AFP, B2M, beta-hCG, BCR-ABL, BRAF, CA15-3, CA19-9, CA-125, calcitonin, CEA (carcinoembryonic antigen), CD20, chromagranin A, cytokeratin or a fragment thereof, EGFR, estrogen receptor, progesterone receptor, fibrin, fibrinogen, HE4, HER2 / neu, IgG variant, KIT, lactate dehydrogenase, nuclear matrix protein 22, PSA, thyroglobulin, uPA, PAI-1, and Oval. In some embodiments, targeting moieties can be linked to the polymer nanocapsules using "click chemistry." "Click chemistry," a chemical principle independently defined by the Sharpless and Meldal groups to describe tailored chemistry for rapidly and easily generating materials by linking small units together, has been applied to a collection of reliable, autonomous organic reactions (Kolb, H.C.; Finn, M.G.; Sharpless, K.B. Angew. Chem. Int. Ed. 2001, 40, pp. 2004-2021). For example, the identification of the copper-catalyzed azide-alkyne [3 + 2] cycloaddition as a highly reliable molecular linkage in water (Rostovtsev, V.V. et al., Angew. Chem. Int. Ed. 2002, 41, pp. 2596-2599) has been used to enhance the investigation of several types of biomolecular interactions (Wang, Q. et al., J. Am. Chem. Soc. 2002, 41, pp. 2596-2599). 003, 125, pp. 3192-3193; Speers, AE et al., J.Am.Chem.Soc.2003, 125, pp. 4686-4687; Link, AJ; Tirrell, DAJ Am.Chem.Soc.2003, 125, pp. 11164-11165; Deiters, A. et al., J.Am.Chem.Soc.2003, 125, pp. 11782-11783).Furthermore, they have been used in organic synthesis (Lee, LV et al., J. Am. Chem. Soc. 2003, 125, 9588-9589), drug discovery (Kolb, HC; Sharpless, KB DrugDisc. Today 2003, 8, 1128-1137; Lewis, WG et al., Angew. Chem. Int. Ed. 2002, 41, 1053-1057) and surface functionalization (Meng, J.-C. et al., Angew. Chem. Int. Ed. 2004, 43, 1255-1260; Fazio, F. et al., J. Am. Chem. Soc. 2002, 124, 14397-14402; Collman, JP et al., Langmuir 2004, ASAP, in press; Lummerstorfer, T.; Hoffmann, H.J. Phys. Chem. B 2004, in press).

[0231] In some embodiments, after engagement of the cell-specific surface receptor with the targeting moiety, the entire nanocapsule or just the RNP payload is internalized by the process of endocytosis. In some embodiments, the targeting moiety can bind to a receptor on a cell or tissue of interest, and the targeting moiety can enhance receptor-mediated or integrin-assisted endocytosis of the nanocapsule by the cell or tissue of interest.

[0232] In some embodiments, the targeting moiety is linked to the polymer nanocapsule via a linker and / or spacer that includes at least one cleavable group, such as a group that can be cleaved during the endocytosis process.In some embodiments, the cleavable group is a disulfide group as described herein.In some embodiments, the cleavable group is a photocleavable group (e.g., DBCO-PHC-NHS as described herein).In other embodiments, the photocleavable group can be a nitrobenzyl-based group that can undergo Norrish type II reaction.In still other embodiments, the photocleavable group is a phenacyl group.

[0233] Those skilled in the art will appreciate that targeting moieties can be linked to polymeric nanocapsules by any suitable method in chemical synthesis. For example, in one or more embodiments, it is contemplated that coupling reactions including homo- or cross-coupling, alkylation, condensation, esterification, etherification, or amide formation can be used to link one or more targeting moieties to the polymeric nanocapsules.

[0234] In some embodiments, "click chemistry" is utilized to link one or more targeting moieties to polymer nanocapsules. Generally, click chemistry has a wide range of modular applications, has high chemical yields, produces harmless by-products, is chemically specific, requires simple reaction conditions, uses readily available starting materials and reagents, is solvent-free or uses benign solvents (such as water), leads to easy product isolation, has a large thermodynamic driving force that favors reactions with a single reaction product, and / or promotes reactions with high atom economy. Certain general criteria may be subjective in nature, but not all criteria need to be met.

[0235] Those skilled in the art will understand that polymeric nanocapsules containing suitable reactive groups (e.g., DBCO groups) can undergo a "click" reaction to form click adducts (e.g., functionalized with azide groups) with appropriately functionalized targeting moieties. Indeed, those skilled in the art will recognize that for one member of a click conjugate pair to react with the other member of the click conjugate pair and thus form a covalent bond, the two members of the click conjugate pair must have reactive functional groups capable of reacting with each other. For example, the targeting moiety must contain a first reactive functional group (e.g., an azide group) capable of participating in a click chemistry reaction with a polymeric nanocapsule bearing a suitable second reactive functional group (e.g., a DBCO group). While the above example illustrates the reaction between a first member of a click conjugate pair containing a DBCO group and a second member of a click conjugate pair containing an azide group, the following table shows various pairs of reactive functional groups that react with each other via "click chemistry" to form a covalent bond.

[0236] [Table 6]

[0237] In some embodiments, the targeting moiety must first be derivatized before it can be conjugated to the polymer nanocapsule. In some embodiments, a targeting moiety (e.g., an antibody having a free reactive group) can be reacted with a compound of formula (IIIA) to provide a derivatized targeting moiety, i.e., a targeting moiety having a reactive functional group that can participate in a click chemistry reaction with an appropriately functionalized polymer nanocapsule.

[0238] [ka] wherein A is maleimide-C(O)-; A "linker" is a branched or unbranched, linear or cyclic, substituted or unsubstituted, saturated or unsaturated group having between 2 and 40 carbon atoms and optionally one or more heteroatoms selected from O, N, or S; B is selected from the group consisting of dibenzocyclooctyne ("DBCO"), trans-cyclooctene ("TCO"), azide, tetrazine, maleimide, thiol, 1,3-nitrone, aldehyde, ketone, hydrazine, and hydroxylamine.

[0239] In some embodiments, moiety A is linked to a lysine or amine group on a target molecule, such as the N-terminal group on a protein, such as a Cas9 protein.

[0240] In some embodiments, the "linker" has formula (IIIB): [ka] It has a structure represented by In the formula, d and e are each independently an integer ranging from 2 to 10; t and u are independently 0 or 1; Q is a bond, O, S, or N(R c )(R d ) and R a and R b are independently H, a C1-C4 alkyl group, or halogen; R c and R d are independently CH or H; X and Y are independently branched or unbranched, saturated or unsaturated groups having between 1 and 4 carbon atoms, and optionally one or more O, N, or S heteroatoms. In some embodiments, X and Y comprise carbonyl groups, amide groups, ester groups, substituted or unsubstituted aryl groups, or any combination thereof. In other embodiments, d and e are integers between 2 and 6.

[0241] In some embodiments, the "linker" has formula (IIIC): [ka] It has a structure represented by During the ceremony, d and e are each independently an integer ranging from 2 to 10; t and u are independently either 0 or 1; Q is a bond, O, S, or N(R c )(R d ) and; R c and R d are independently CH3 or H; X and Y are independently branched or unbranched, saturated or unsaturated groups having between 1 and 4 carbon atoms and optionally one or more O, N, or S heteroatoms.

[0242] In other embodiments, d and e are integers between 2 and 6.

[0243] In some embodiments, the "linker" has formula (IIID): [ka] It has a structure represented by During the ceremony, d and e are each independently an integer ranging from 2 to 10; t and u are independently either 0 or 1; X and Y are independently branched or unbranched, saturated or unsaturated groups having between 1 and 4 carbon atoms and optionally one or more O, N, or S heteroatoms.

[0244] In other embodiments, d and e are integers between 2 and 6.

[0245] Specific non-limiting examples of compounds of formula (IIIA) include: [ka]

[0246] Although the compounds identified above contain 4, 8, or 12 polyethylene glycol ("PEG") groups, respectively, one of ordinary skill in the art would understand that the compounds of formula (IIIA) can contain any number of PEG groups, such as between about 2 and about 20 PEG groups, or between about 2 and about 16 PEG groups, or between about 4 and about 12 PEG groups. One of ordinary skill in the art would also understand that the polypropylene glycol ("PPG") group can be substituted with any PEG group, and that the compounds of formula (IIIA) can contain any number of PPG groups, such as between about 2 and about 20 PPG groups, or between about 2 and about 16 PPG groups, or between about 4 and about 12 PPG groups.

[0247] In embodiments where the targeting moiety is an antibody, functional groups present on the antibody can first be reduced in the presence of dithiothreitol (“DTT”) to provide an antibody bearing one or more thiol groups, which are reactive NHS-ester groups of the compound of formula (IIIA).

[0248] The polymer nanocapsules of the present disclosure can similarly be derivatized to include functional groups capable of participating in a click chemistry reaction. In some embodiments, the polymer nanocapsules can be reacted with a compound of formula (IVA) to provide polymer nanocapsules having reactive functional groups capable of participating in a click chemistry reaction with an appropriately functionalized targeting moiety. In some embodiments, the polymer nanocapsules include amine groups that can be reacted with a compound of formula (IVA), such that the polymer nanocapsules are functionalized with functional groups capable of participating in a click chemistry reaction.

[0249] [ka] wherein A is maleimide-C(O)-; "Spacer" is a group that is branched or unbranched, straight-chain or cyclic, substituted or unsubstituted, saturated or unsaturated, has between 2 and 20 carbon atoms, and has a cleavable group or bond; B is selected from the group consisting of dibenzocyclooctyne ("DBCO"), trans-cyclooctene ("TCO"), azide, tetrazine, maleimide, thiol, 1,3-nitrone, aldehyde, ketone, hydrazine, and hydroxylamine.

[0250] In some embodiments, the cleavable group comprises a disulfide group.

[0251] In some embodiments, the "spacer" group has formula (IVB): [ka] It has the structure During the ceremony, d is an integer ranging from 2 to 10; t and u are independently 0 or 1; R a and R b are independently H, a C1-C4 alkyl group, or halogen; X and Y are independently branched or unbranched, saturated or unsaturated groups having between 1 and 8 carbon atoms and optionally one or more O, N, or S heteroatoms.

[0252] In some embodiments, X and Y independently comprise one or more carbonyl groups, amide groups, ester groups, substituted or unsubstituted aryl groups, or any combination thereof. In other embodiments, d and e are integers between 2 and 6.

[0253] In some embodiments, polymeric nanocapsules (such as those having between 1 and 10 free amine groups) can be reacted with dibenzocyclooctyne-SSN-hydroxysuccinimidyl ester (exemplified below) to provide polymeric nanocapsules having reactive DBCO groups, thereby providing derivatized polymeric nanocapsules.

[0254] [ka]

[0255] In other embodiments, the polymer nanocapsules can be reacted with one or more of DBCO-NHS, DBCO-sulfo-NHS, DBCO-PEG4-NHS, DBCO-PEG5-NHS, DBCO-C6-NHS, or DBCO-PHC-NHS.

[0256] [ka]

[0257] Without wishing to be bound by any particular theory, it is believed that the use of a spacer containing a disulfide bond allows the disulfide bond to be cleaved during endocytosis, allowing the polymer nanocapsule or its contents to enter the cell without the use of a targeting moiety.

[0258] Stabilizing Moieties and Conjugates Comprising Stabilizing Moieties The present disclosure provides conjugates comprising one or more stabilizing moieties and any of the polymeric nanocapsules described herein. In some embodiments, between about 1 and about 16 stabilizing moieties are linked to the polymeric nanocapsule. In other embodiments, between about 12 and about 12 stabilizing moieties are linked to the polymeric nanocapsule. In still other embodiments, between about 1 and about 9 stabilizing moieties are linked to the polymeric nanocapsule. In further embodiments, between about 2 and about 8 stabilizing moieties are linked to the polymeric nanocapsule. Of course, the conjugates can further comprise one or more targeting moieties.

[0259] Those skilled in the art will appreciate that stabilizing moieties can be attached to the polymeric nanocapsules by any method suitable in chemical synthesis. For example, in one or more embodiments, it is contemplated that one or more stabilizing moieties can be attached to the polymeric nanocapsules using coupling reactions including homo- or cross-coupling, alkylation, condensation, esterification, etherification, or amide formation.

[0260] In some embodiments, as described above, "click chemistry" can be used to link stabilizing moieties to polymeric nanocapsules. In some embodiments, as described above, polymeric nanocapsules can be functionalized with reactive functional groups that can participate in click chemistry reactions. For example, as described above, polymeric nanocapsules can be functionalized with DBCO groups by reacting them with dibenzocyclooctyne-SSN-hydroxysuccinimidyl ester.

[0261] A stabilizing moiety having a functional group capable of participating in a click chemistry reaction can then be reacted with the functionalized polymer nanocapsule (i.e., a derivatized polymer nanocapsule). In some embodiments, the stabilizing moiety comprises one or more polyethylene glycol (PEG) and / or polypropylene glycol (PPG) groups. In some embodiments, the PEG-based stabilizing moiety or PPG-based stabilizing moiety has an average molecular weight ranging from about 150 Da to about 3000 Da. In some embodiments, the PEG-based stabilizing moiety or PPG-based stabilizing moiety has an average molecular weight ranging from about 200 Da to about 2500 Da. In some embodiments, the PEG-based stabilizing moiety or PPG-based stabilizing moiety has an average molecular weight ranging from about 250 Da to about 2000 Da. In some embodiments, the PEG-based stabilizing moiety or PPG-based stabilizing moiety has an average molecular weight ranging from about 250 Da to about 1500 Da. In some embodiments, the PEG-based stabilizing moiety or PPG-based stabilizing moiety has an average molecular weight ranging from about 250 Da to about 1250 Da. In some embodiments, the PEG-based stabilizing moiety or PPG-based stabilizing moiety has an average molecular weight ranging from about 250 Da to about 1000 Da. In some embodiments, the PEG-based stabilizing moiety or PPG-based stabilizing moiety has an average molecular weight ranging from about 250 Da to about 750 Da. In some embodiments, the PEG-based stabilizing moiety or PPG-based stabilizing moiety has an average molecular weight ranging from about 250 Da to about 500 Da.

[0262] Other suitable stabilizing moieties include those of formula (V): [ka] and wherein B is selected from the group consisting of dibenzocyclooctyne ("DBCO"), trans-cyclooctene ("TCO"), azide, tetrazine, maleimide, thiol, 1,3-nitrone, aldehyde, ketone, hydrazine, and hydroxylamine; Z is a hydroxyl group, a branched or unbranched C1-C4 alkyl group, -O-alkyl, -NH2; f and g are independently 0 or an integer ranging from 1 to 4; h is an integer ranging from 1 to 24.

[0263] Specific non-limiting examples of stabilizing moieties having formula (V) include, but are not limited to, the following: O-(2-aminoethyl)-O'-(2-azidoethyl)heptaethylene glycol, O-(2-aminoethyl)-O'-(2-azidoethyl)nonaethylene glycol, O-(2-aminoethyl)-O'-(2-azidoethyl)pentaethylene glycol, 2-[2-(2-azidoethoxy)ethoxy]ethanol, O-(2-azidoethyl)heptaethylene glycol, O-(2-azidoethyl)-O'-methyl-triethylene glycol, O-(2-azidoethyl)-O'-methyl-undecaethylene glycol, 11-azido-3,6,9-trioxaundecan-1-amine, and Methoxypolyethylene glycol azide.

[0264] In some embodiments, the stabilizing moiety having formula (V) comprises (or is derived from) an azido-PEG-amine, wherein the number of PEG groups ranges from 1 to 24. Suitable non-limiting examples of azido-PEG-amines include: azido-PEG1-amine, azido-PEG2-amine, azido-PEG3-amine, azido-PEG4-amine, azido-PEG5-amine, azido-PEG6-amine, azido-PEG7-amine, azido-PEG8-amine, azido-PEG10-amine, azido-PEG11-amine, azido-PEG20-amine, and azido-PEG24-amine.

[0265] In some embodiments, the stabilizing moiety having formula (V) comprises (or is derived from) an azido-PEG-alcohol, wherein the number of PEG groups ranges from 1 to 24. Suitable non-limiting examples of azido-PEG-alcohols include: azido-PEG2-alcohol, azido-PEG3-alcohol, azido-PEG4-alcohol, azido-PEG5-alcohol, azido-PEG6-alcohol, azido-PEG7-alcohol, azido-PEG8-alcohol, azido-PEG9-alcohol, azido-PEG10-alcohol, azido-PEG11-alcohol, azido-PEG12-alcohol, azido-PEG16-alcohol, azido-PEG20-alcohol, and azido-PEG24-alcohol.

[0266] In some embodiments, the stabilizing moiety having formula (V) comprises azido-PEG-methyl, wherein the number of PEG groups ranges from 1 to 24. Suitable non-limiting examples of azido-PEG-methyl include: azido-PEG1-methyl, azido-PEG2-methyl, azido-PEG3-methyl, azido-PEG4-methyl, azido-PEG5-methyl, azido-PEG6-methyl, azido-PEG7-methyl, azido-PEG8-methyl, azido-PEG9-methyl, azido-PEG10-methyl, azido-PEG11-methyl, azido-PEG12-methyl, azido-PEG16-methyl, azido-PEG20-methyl, and azido-PEG24-methyl.

[0267] In some embodiments, the stabilizing moiety having formula (V) comprises azido-PEG-(CH2)3OH, where the number of PEG groups ranges from 1 to 24. Suitable examples of such azido-PEG-(CH2)3OH compounds include azido-PEG3-(CH2)3OH and azido-PEG4-(CH2)3OH.

[0268] Methods for delivering ribonucleoprotein complexes Another aspect of the present disclosure is a method for delivering a payload, such as a ribonucleoprotein complex, to a cell. In some embodiments, the method comprises contacting any of the polymer nanocapsules or polymer nanocapsule conjugates described herein (including those having a ribonucleoprotein-containing core) with a cell, such as a host cell. In some embodiments, the method facilitates the delivery of a payload, such as a ribonucleoprotein complex, to the nucleus of the cell. In some embodiments, the cell may be a mammalian cell, such as a human cell. In some embodiments, the cell may be a neuron, T cell, fibroblast, epithelial cell, tumor cell, muscle cell, skin cell, or immune system cell.

[0269] In some embodiments, upon contacting the polymer nanocapsule with a cell, the payload, e.g., a ribonucleoprotein complex, is released from the polymer nanocapsule or polymer nanocapsule conjugate. In some embodiments, the polymer nanocapsule is transported across the cell membrane upon contact with the cell. In some embodiments, the polymer nanocapsule is internalized into the cell by the process of endocytosis. In some embodiments, the polymer nanocapsule is internalized by a receptor-mediated endocytosis process. In some embodiments, the polymer nanocapsule comprises one or more targeting moieties that bind to a cell surface membrane protein receptor that effects endocytosis. In some embodiments, the polymer nanocapsule comprises an antibody that targets a specific type of receptor (e.g., a CD marker), and after engagement of the nanocapsule-bound targeting antibody with the cellular receptor, the nanocapsule (or its payload) is internalized by the process of endocytosis. In some embodiments, some or all of the targeting antibody and / or solubilizing moiety conjugated to the polymer nanocapsule are cleaved during the process of endocytosis.

[0270] In some embodiments, the ribonucleoprotein complexes are released from the polymer nanocapsules after being transported across the cell membrane. In some embodiments, at least 50% of the ribonucleoprotein complexes are released from the nanocapsules (based on the total amount of ribonucleoprotein complexes in the polymer nanocapsules). In other embodiments, at least 60% of the ribonucleoprotein complexes are released from the nanocapsules (based on the total amount of ribonucleoprotein complexes in the polymer nanocapsules). In still other embodiments, at least 75% of the ribonucleoprotein complexes are released from the nanocapsules (based on the total amount of ribonucleoprotein complexes in the polymer nanocapsules). In further embodiments, at least 90% of the ribonucleoprotein complexes are released from the nanocapsules (based on the total amount of ribonucleoprotein complexes in the polymer nanocapsules). In even further embodiments, at least 95% of the ribonucleoprotein complexes are released from the nanocapsules (based on the total amount of ribonucleoprotein complexes in the polymer nanocapsules).

[0271] In some embodiments, contacting the cells with the polymer nanocapsules or polymer nanocapsule conjugates is performed in vitro. In some embodiments, contacting the cells with the polymer nanocapsules or polymer nanocapsule conjugates is performed in vivo, e.g., in the body of a subject or patient, e.g., a human (homo sapiens) or other animal. In some embodiments, the polymer nanocapsules or polymer nanocapsule conjugates are present in the cells in an effective amount to provide a detectable effect, e.g., a therapeutic effect, in the subject upon or after release of the ribonucleoprotein complex. In some embodiments, the observed or detectable effect results from cell penetration of the polymer nanocapsules and release of the ribonucleoprotein complexes from the nanocapsules. In some embodiments, for in vivo preparation of stem cells, due to the low frequency of CD34+ cells in bone marrow (less than about 1 to about 2%), polymer nanocapsule conjugates comprising one or more anti-CD34 antibodies are utilized to target CD34+ stem cells. In some embodiments, prior to formulation with nanocapsules, the CD34+ cells are pre-stimulated with cytokines, i.e., the patient is first treated with cytokines and then receives an infusion of the polymer-nanocapsule conjugate.

[0272] On the other hand, in the case of ex vivo preparation of stem cells, collected stem cells (e.g., CD34+ stem cells) can be pre-stimulated, in some embodiments, with FLT3-L (Fms-related tyrosine kinase 3 ligand), thrombopoietin (TPO), and / or stem cell factor (SCF), such as overnight. The pre-stimulated stem cells can then be incubated with the polymer nanocapsules or polymer nanocapsule conjugates of the present disclosure for a period ranging from about 3 to about 10 hours, or from about 4 to about 8 hours, or from about 4 to about 6 hours. After this initial incubation, the stem cells can then be incubated in fresh culture medium for about 24 to about 48 hours before cryopreservation. A therapeutically effective amount of the cryopreserved gene-edited stem cells can be infused into a patient in need of stem cell treatment.

[0273] Methods of treatment utilizing nanocapsules The nanocapsules and pharmaceutical formulations thereof described herein can be used for the diagnosis, treatment, or prevention of diseases, disorders, syndromes, or symptoms thereof. Amounts of the polymer nanocapsules and pharmaceutical formulations thereof described herein can be administered to a subject in need thereof one or more times per day, week, month, or year.

[0274] In some embodiments, the disease or disorder is a monogenic disease or disorder. Non-limiting examples of monogenic diseases or disorders include thalassemia, sickle cell anemia, hemophilia, cystic fibrosis, Tay-Sachs disease, fragile X syndrome, and Huntington's disease.

[0275] In some embodiments, the amount administered can be an effective amount of polymer nanocapsules or pharmaceutical formulations thereof. For example, the nanocapsules or pharmaceutical formulations thereof can be administered in a daily dose. This amount can be given in a single dose per day. In other embodiments, the daily dose can be administered in multiple doses per day, each containing a proportion (partial dose) of the total daily dose to be administered. In some embodiments, the number of doses delivered per day is 2, 3, 4, 5, or 6. In further embodiments, the compound, formulation, or salt thereof is administered one or more times per week, such as 1, 2, 3, 4, 5, or 6 times per week. In other embodiments, the nanocapsules or pharmaceutical formulations thereof are administered one or more times per month, such as 1 to 5 times per month. In even further embodiments, the nanocapsules or pharmaceutical formulations thereof are administered one or more times per year, such as 1 to 11 times per year.

[0276] In embodiments in which more than one polymer nanocapsule, its pharmaceutical formulation and / or adjunct(s) are administered sequentially, the sequential administration can be close in time or distant in time. For example, administration of a second nanocapsule, its pharmaceutical formulation and / or adjunct(s) can occur within seconds or minutes (up to about 1 hour) after administration of the first agent (close in time). In other embodiments, administration of a second nanocapsule, its pharmaceutical formulation and / or adjunct(s) occurs at another time greater than 1 hour after administration of the first nanocapsule or its pharmaceutical formulation.

[0277] The amount of the polymeric nanocapsules described herein, their pharmaceutical formulations and / or adjuvant(s) can be administered in an amount ranging from about 0.01 mg to about 1 g per day, calculated as the free or salt-free pharmaceutical formulation. The amount of the nanocapsules described herein, their pharmaceutical formulations and / or adjuvant(s) can be administered in an amount ranging from about 0.01 μM to about 100 μM per day.

[0278] In some embodiments, polymer nanocapsules are used to facilitate delivery of genome editing molecules. In further embodiments, cells or populations of cells can be incubated with one or more polymer nanocapsules or formulations thereof described herein for a period of time. In some embodiments, the nanocapsules contain a Cas9:sgRNA complex. Incubation times can range from about 1 hour to about 10 days or longer. Following incubation, the cell(s) can be cultured using techniques known in the art and / or described herein. The cell(s) can also be analyzed for genome modification using techniques and / or methods known in the art or described herein.

[0279] Polymer nanocapsule formulation The polymer nanocapsules described herein can be provided to a subject alone, or in contact with cells (in vivo or in vitro), or as an active ingredient in a pharmaceutical preparation or other composition.As such, pharmaceutical preparations containing one or more of the nanocapsules described herein are also described herein.In some embodiments, the pharmaceutical preparation contains an effective amount of the polymer nanocapsules described herein.The pharmaceutical preparation can be administered to a subject in need thereof.

[0280] The pharmaceutical formulation may contain a homogeneous population of polymer nanocapsules. In these embodiments, all of the polymer nanocapsules contained in the pharmaceutical formulation are identical. In other embodiments, the pharmaceutical formulation may contain a homogeneous population of polymer nanocapsules. In these embodiments, the populations of polymer nanocapsules are different from each other, for example, they contain at least two polymer nanocapsules, each containing a different ribonucleoprotein complex, such as a different ribonucleoprotein complex containing a different gRNA. The two different polymer nanocapsules may differ from each other in the type of targeting moiety, the amount of linked targeting moiety, the type and / or amount of stabilizing molecules and / or components (or ratios of components) that make up the polymer nanocapsule shell.

[0281] Another aspect of the present disclosure includes a composition comprising a plurality of nanocapsules. As used herein, "a plurality of nanocapsules" refers to a composition comprising more than one nanocapsule, for example, more than 10 nanocapsules. The polymer nanocapsules may include polymer nanocapsules having the structures and components described above. In some embodiments, the composition comprises a plurality of nanocapsules dispersed in an aqueous solution.

[0282] The aqueous solution may comprise water, deionized water, a buffer (e.g., phosphate buffered saline, phosphate buffer, etc.), or the like, or a combination thereof. In some embodiments, the composition comprises 1 to 50 volume percent (vol%), e.g., 1 to 20 vol%, e.g., 5 to 15 vol%, of nanocapsules, based on the total volume of the composition. Thus, in some embodiments, the composition comprises 50 to 99 vol%, or 80 to 99 vol%, or 85 to 95 vol% of the aqueous solution, based on the total volume of the composition.

[0283] Pharmaceutically acceptable carriers and auxiliary ingredients and agents The pharmaceutical preparation that contains effective amount of polymer nanocapsules described herein can further comprise pharmaceutically acceptable carrier.Suitable pharmaceutically acceptable carrier includes but is not limited to, and does not adversely react with active composition, water, salt solution, alcohol, gum arabic, vegetable oil, benzyl alcohol, polyethylene glycol, gelatin, carbohydrates such as lactose, amylose or starch, magnesium stearate, talc, silicic acid, viscous paraffin, perfume oil, fatty acid ester, hydroxymethylcellulose and polyvinylpyrrolidone.

[0284] Pharmaceutical formulations can be sterilized and, if necessary, mixed with auxiliary agents that do not adversely react with the active composition, such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorants, flavorings, and / or aromatic substances. In addition to an effective amount of nanocapsules, pharmaceutical formulations can also contain an effective amount of supplemental active agents, including, but not limited to, DNA, RNA, amino acids, peptides, polypeptides, antibodies, aptamers, ribozymes, guide polynucleotides for ribozymes that inhibit the translation or transcription of essential tumor proteins and genes, hormones, immunomodulators, antipyretics, anxiolytics, antipsychotics, analgesics, antispasmodics, anti-anti-inflammatory agents, antihistamines, anti-infective agents, and chemotherapeutic agents. Suitable compounds for supplemental active agents have been described herein above in connection with nanocapsules.

[0285] Effective amounts of nanocapsules and adjuvants The pharmaceutical formulation may contain an effective amount of polymer nanocapsules and / or an effective amount of an auxiliary agent. In some embodiments, the effective amount of polymer nanocapsules is in the range of about 0.001 pg to about 10,000 μg. In some embodiments, the effective amount of polymer nanocapsules is in the range of about 0.1 pg to about 5,000 μg. In some embodiments, the effective amount of polymer nanocapsules is in the range of about 1 pg to about 1,000 μg. In some embodiments, the effective amount of polymer nanocapsules is in the range of about 1 pg to about 500 μg. In some embodiments, the effective amount of polymer nanocapsules is in the range of about 100 pg to about 500 μg.

[0286] In embodiments where a supplemental active agent is included in the pharmaceutical formulation in addition to the polymer nanocapsules, the effective amount of the supplemental active agent varies depending on the supplemental active agent. In some embodiments, the effective amount of the supplemental active agent ranges from 0.001 micrograms to about 1 milligram. In other embodiments, the effective amount of the supplemental active agent ranges from about 0.01 IU to about 1000 IU. In further embodiments, the effective amount of the supplemental active agent ranges from 0.001 mL to about 1 mL. In still other embodiments, the effective amount of the supplemental active agent ranges from about 1% w / w to about 50% w / w of the total pharmaceutical formulation. In other embodiments, the effective amount of the supplemental active agent ranges from about 1% v / v to about 50% v / v of the total pharmaceutical formulation. In still other embodiments, the effective amount of the supplemental active agent ranges from about 1% w / v to about 50% w / v of the total pharmaceutical formulation.

[0287] Dosage form In some embodiments, the pharmaceutical formulations described herein (such as those comprising any of the polymer nanocapsules and / or polymer nanocapsule conjugates) can be provided in a dosage form suitable for administration. In some embodiments, the dosage form can be adapted for administration by any suitable route. Suitable routes include, but are not limited to, oral (including buccal or sublingual), rectal, intraocular, inhalation, intranasal, topical (including buccal, sublingual, or transdermal), vaginal, parenteral, subcutaneous, intramuscular, intravenous, and intradermal. Such formulations can be prepared by any method known in the art.

[0288] Dosage forms suitable for oral administration can be discrete dosage units such as capsules, pellets or tablets, powders or granules, solutions, or suspensions in aqueous or non-aqueous liquids; edible foams or whips, or oil-in-water or water-in-oil liquid emulsions. In some embodiments, pharmaceutical preparations suitable for oral administration also contain one or more agents that flavor, preserve, color, or aid dispersion of the pharmaceutical preparation. Dosage forms prepared for oral administration can also be in the form of liquid solutions that can be delivered as foams, sprays, or liquid solutions. The oral dosage form can be administered to a subject in need thereof. In some embodiments, this is a subject with cancer. In some embodiments, the cancer is a folate-positive cancer.

[0289] Where appropriate, the dosage forms described herein can be microencapsulated. Dosage forms can also be prepared to extend or sustain the release of any component. In some embodiments, nanocapsules can be the component whose release is delayed. In other embodiments, the release of an auxiliary component is delayed. Suitable methods for delaying the release of an component include, but are not limited to, coating or embedding the component in a material such as a polymer, wax, or gel. Delayed-release dosage formulations can be prepared as described in standard references such as "Pharmaceutical Dosage Form Tablets," edited by Liberman et al. (New York, Marcel Dekker, Inc., 1989), "Remington - The Science and Practice of Pharmacy," 20th Edition, Lippincott Williams & Wilkins, Baltimore, MD, 2000, and "Pharmaceutical Dosage Forms and Drug Delivery Systems," 6th Edition, Ansel et al. (Media, PA: Williams and Wilkins, 1995). These references provide information on excipients, materials, equipment, and processes for preparing delayed-release dosage forms of tablets and capsules, as well as tablets and pellets, capsules, and granules. The delayed release can be anywhere from about 1 hour to about 3 months or longer.

[0290] Examples of suitable coating materials include, but are not limited to, cellulose polymers such as cellulose acetate phthalate, hydroxypropyl cellulose, hydroxypropyl methylcellulose, hydroxypropyl methylcellulose phthalate, and hydroxypropyl methylcellulose acetate succinate; polyvinyl acetate phthalate, acrylic acid polymers and copolymers and methacrylic resins commercially available under the trade name EUDRAGIT® (Roth Pharma, Westerstadt, Germany), zein, shellac, and polysaccharides.

[0291] Coatings can be formed using various ratios of water-soluble polymers, water-insoluble polymers, and / or pH-dependent polymers, with or without water-insoluble / water-soluble non-polymeric excipients, to provide the desired release profile. Coatings can be applied to dosage forms (matrix or simple) including, but not limited to, tablets (compressed with or without coated beads), capsules (with or without coated beads), beads, particulate compositions, or formulated "neat" as, but not limited to, suspension forms or sprinkle dosage forms.

[0292] Dosage forms adapted for topical administration can be formulated as ointments, creams, suspensions, lotions, powders, solutions, pastes, gels, sprays, aerosols, or oils. In some embodiments, for the treatment of the eye or other external tissues, such as the mouth or skin, pharmaceutical preparations are applied as topical ointments or creams. When formulated into an ointment, the nanocapsules, auxiliary active ingredients, and / or their pharmaceutically acceptable salts can be formulated with a paraffinic or water-miscible ointment base. In other embodiments, the active ingredient can be formulated into a cream with an oil-in-water cream base or a water-in-oil base. Dosage forms adapted for topical administration in the oral cavity include lozenges, pastilles, and mouthwashes.

[0293] Dosage forms adapted for nasal or inhalation administration include aerosols, solutions, suspension drops, gels, or dry powders. In some embodiments, the nanocapsules, derivatives thereof, auxiliary active ingredients, and / or pharmaceutically acceptable salts thereof in dosage forms adapted for inhalation are in particle size-reduced forms obtained or obtainable by micronization. In some embodiments, the particle size of the size-reduced (e.g., micronized) compound or its salt or solvate is defined by a D50 value of about 0.5 to about 10 microns, as measured by a suitable method known in the art. Dosage forms adapted for inhalation administration also include particle powders or combinations. Suitable dosage forms in which the carrier or excipient is a liquid for administration as a nasal spray or droplets include aqueous or oil solutions / suspensions of the active ingredient, which can be produced by various types of metered-dose pressurized aerosols, nebulizers, or inhalers.

[0294] In some embodiments, the dosage form is an aerosol formulation suitable for administration by inhalation.In some of these embodiments, the aerosol formulation contains nanocapsules, auxiliary active ingredients and / or their pharmaceutically acceptable salts, and a solution or fine suspension in a pharmaceutically acceptable aqueous or non-aqueous solvent.The aerosol formulation can be presented in a sterile form in a sealed container in single or multiple doses.For some of these embodiments, the sealed container is a single or multiple dose nasal or aerosol dispenser (e.g., a metered dose inhaler) equipped with a metering valve, which is intended to be discarded when the contents of the container are used up.

[0295] When the aerosol dosage form is contained in an aerosol dispenser, the dispenser contains a suitable propellant under pressure, such as compressed air, carbon dioxide, or an organic propellant, including but not limited to, hydrofluorocarbons. In other embodiments, the aerosol dosage form is contained in a pump atomizer. The pressurized aerosol formulation may also contain a solution or suspension of nanocapsules, their derivatives, supplementary active ingredients, and / or pharmaceutically acceptable salts thereof. In further embodiments, the aerosol formulation may also contain cosolvents and / or modifiers incorporated, for example, to improve the stability and / or taste and / or particulate mass characteristics (quantity and / or profile) of the formulation. The aerosol formulation may be administered once, once daily, or several times daily, for example, 2, 3, 4, or 8 times daily, with 1, 2, or 3 doses being delivered each time.

[0296] In some dosage forms suitable and / or adapted for inhalation administration, the pharmaceutical formulation is a dry powder inhalable formulation. In addition to the nanocapsules, the supplementary active ingredient, and / or its pharmaceutically acceptable salt, such dosage forms may contain a powder base such as lactose, glucose, trehalose, mannitol, and / or starch. In some of these embodiments, the conjugate compound, its derivative, the supplementary active ingredient, and / or its pharmaceutically acceptable salt are in a particle size-reduced form. In further embodiments, a performance modifier such as L-leucine or another amino acid, cellulose octaacetate, and / or a metal salt of stearic acid, such as magnesium or calcium stearate, may be added.

[0297] In some embodiments, the aerosol formulation is configured so that each metered dose of the aerosol contains a predetermined amount of the active ingredient, such as one or more of the compounds described herein.

[0298] Dosage forms adapted for vaginal administration may be presented as pessaries, tampons, creams, gels, pastes, foams, or spray formulations. Dosage forms adapted for rectal administration include suppositories or enemas.

[0299] Dosage forms adapted for parenteral administration and / or injection (IV, sq, icv, im, etc.) may include aqueous and / or non-aqueous sterile injection solutions, which may contain antioxidants, buffers, bacteriostats, solutes that render the composition isotonic with the subject's blood, and aqueous and / or non-aqueous sterile suspensions, which may contain suspending agents and thickening agents. Dosage forms adapted for parenteral administration may be presented in single-unit or multi-unit-dose containers, including, but not limited to, sealed ampoules or vials. Doses may be lyophilized and resuspended in a sterile carrier prior to administration to reconstitute the dose. In some embodiments, extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules, and tablets.

[0300] In some embodiments, the dosage form contains a predetermined amount of the nanocapsules provided herein per unit dose. In one embodiment, the predetermined amount of the nanocapsules provided herein is an effective amount of nanocapsules for diagnosing, treating, preventing, or alleviating symptoms of cancer. In other embodiments, the predetermined amount of nanocapsules is an appropriate proportion of an effective amount of the active ingredient. Thus, such a unit dose can be administered once or more times a day. Such pharmaceutical preparations can be prepared by any method known in the art.

[0301] The supplemental active agent may be included in a pharmaceutical formulation or may be present as a separate compound or pharmaceutical formulation administered simultaneously or sequentially with the nanocapsules, derivatives thereof, or pharmaceutical formulations thereof provided herein. In embodiments where the supplemental active agent is a separate compound or pharmaceutical formulation, the effective amount of the supplemental active agent may vary depending on the supplemental active agent used. In some of these embodiments, the effective amount of the supplemental active agent ranges from 0.001 micrograms to about 1000 grams. In other embodiments, the effective amount of the supplemental active agent ranges from about 0.01 IU to about 1000 IU. In further embodiments, the effective amount of the supplemental active agent ranges from 0.001 mL to about 1 mL. In still other embodiments, the effective amount of the supplemental active agent ranges from about 1% w / w to about 50% w / w of the total supplemental active agent pharmaceutical formulation. In other embodiments, the effective amount of the supplemental active agent ranges from about 1% v / v to about 50% v / v of the total pharmaceutical formulation. In yet other embodiments, the effective amount of supplemental active agent ranges from about 1% w / v to about 50% w / v of the total supplemental pharmaceutical formulation. [Example]

[0302] Cas9 protein stock (67 μM) and gRNA stock (100 μM) were added to a final concentration of 1 μM in 50 mM pH 6.4, 50 mM HEPES buffer, and 150 μM NaCl. The RNP complex formed from Cas9 and gRNA was negatively charged. Various polymer nanocapsules were formulated, each incorporating a gRNA with one of SEQ ID NOs: 8-15.

[0303] Next, a chemical cocktail of (i) N-(3-((4-((3-aminopropyl)amino)butyl)amino)propyl)acrylamide, (ii) 2-(dimethylamino)ethyl acrylate, (iii) 1,3-glycerin dimethacrylate, and (iv) acrylamide was dissolved in deoxygenated, RNase-free water and added to the tube of Cas9-gRNA complex. The ratio of the various monomers was 250:500:1000:4000 (monomers (i):(ii):(iii):(iv)). Radical polymerization was carried out by adding 0.02 mg of ammonium persulfate and 0.4 μL of N,N,N',N'-tetramethylethylenediamine dissolved in 2 μL of deoxygenated, deionized water. The reaction was allowed to proceed for 180 min at 4 °C in a nitrogen atmosphere. After completion of the polymerization, excess monomers were removed using dialysis or ultrafiltration.

[0304] The nanocapsules were then purified and conjugated with targeting moieties and PEG. Specifically, a 30- to 50-fold excess of dibenzocyclooctyne-SSN-hydroxysuccinimidyl ester was used to modify the surface of the nanocapsules, reaching a final conjugation of between about 3 and about 10 esters per nanocapsule. Next, a 5- to 10-fold excess of azide-functionalized PEG with a molecular weight of about 2000 daltons and a 5- to 10-fold excess of azide-functionalized abCD3 or abCD34 were used to introduce targeting and stabilizing moieties onto the surface of the formed polymer nanocapsules. The conjugated nanocapsules were then separated from unreacted targeting molecules and PEG, and the final product was concentrated using size-exclusion column chromatography. The resulting polymer nanocapsule conjugates had a neutral charge and a size range of between about 50 nm and about 100 nm. [Example]

[0305] HIV as a disease target Nanocapsules were formulated to contain DNA molecules encoding sh5 or C46, ​​or to contain CRISPR / Cas9 ribonucleoprotein complexes (RNPs). To target T lymphocytes or CD34+ stem / progenitor cells, the nanocapsules were conjugated with anti-CD3, anti-CD4, or anti-CD34 antibodies. They were then injected into specific locations, such as the bone marrow of humanized mice in the endosteal microenvironment (intraosseous transduction). The resulting cell-containing constructs were stimulated to replicate and differentiate with one or a combination of: 1) construct-responsive growth / differentiation agents, 2) specific cytokines and antibodies, and 3) alpha9beta1 / alpha4beta1 inhibitors. Peripheral blood was examined, and the mice were then sacrificed to determine the degree of construct expression, including CCR5 downregulation and C46 expression in the case of sh5 / C46 transduction, and CCR5 knockout and C46 knockout in the case of CRISPR / CAS transduction. [Example]

[0306] Globinopathies as disease targets Nanocapsules are formulated to contain CRISPR / CAS targeting BCL11A erythroid enhancer.These formulated nanocapsules are introduced into some specific locations, for example, into the bone marrow of humanized mice in endosteal microenvironment.This acts to knock out the activity of BCL11A erythroid enhancer, which inhibits BCL11A activity and causes the activation of fetal hemoglobin, thereby relieving sickle cell disease or beta thalassemia. [Example]

[0307] HPRT as a target HPRT-deficient cells (i.e., those sensitive to purine analogs, e.g., 6TG, such as those with 20% or less residual HPRT gene expression) could be negatively selected by inhibiting the enzyme dihydrofolate reductase (DHFR) in the purine de novo synthesis pathway using a dihydrofolate reductase inhibitor. This has been developed as a safe procedure to eliminate genetically modified HSCs if unexpected adverse effects are observed. If any adverse side effects occur, patients may be treated with methotrexate ("MTX") or mycophenolic acid ("MPA"). Adverse side effects include, for example, insertional mutagenesis in specific clones of cells or abnormal blood counts / clonal proliferation indicative of cytokine storm.

[0308] It is believed that MTX or MPA competitively inhibits dihydrofolate reductase (DHFR), an enzyme involved in tetrahydrofolate (THF) synthesis. DHFR catalyzes the conversion of dihydrofolate to the active tetrahydrofolate. Folate is required for the de novo synthesis of the nucleoside thymidine, which is necessary for DNA synthesis. Folate is also essential for purine and pyrimidine base biosynthesis, so its synthesis is inhibited. Therefore, MTX or MPA inhibits the synthesis of DNA, RNA, thymidylate, and protein. MTX or MPA blocks the de novo pathway by inhibiting DHFR. In HPRT- / - cells, there is no functional salvage or de novo pathway, which does not lead to purine synthesis, and the cells die. However, HPRT wild-type cells have a functional salvage pathway, which allows purine synthesis, and the cells survive. In some embodiments, an analog or derivative of MTX or MPA may be substituted for MTX or MPA. Derivatives of MTX are described in US Pat. No. 5,958,928 and PCT Publication No. WO / 2007 / 098089, the disclosures of which are incorporated herein by reference in their entireties.

[0309] Given the sensitivity of the modified HSCs generated according to the present disclosure, MTX or MPA can be used to selectively eliminate HPRT-deficient cells. In some embodiments, MTX or MPA is administered as a single dose. In some embodiments, multiple doses of MTX or MPA are administered.

[0310] Nanocapsules are formulated to contain CRISPR / CAS targeting the HPRT locus. These formulated nanocapsules are introduced into human primary CD4+ or CD8+ T cells. This acts to knock out the activity of HPRT, which inhibits HPRT activity and leads to resistance to 6-thioguanine (6-TG) and sensitivity to methotrexate (MTX). These 6-TG-resistant T cells can provide temporary immune support to leukemia patients undergoing 6-TG chemotherapy. These MTX-sensitive T cells can be eliminated using MTX infusion after the patient has completed 6-TG chemotherapy. [Example]

[0311] HPRT knockdown versus knockout using 6TG selection 6TG is a purine analogue with both anticancer and immunosuppressive activities. Thioguanine competes with hypoxanthine and guanine for the enzyme hypoxanthine-guanine phosphoribosyltransferase (HGPRTase) and is itself converted to 6-thioguanylate (TGMP). This nucleotide reaches high intracellular concentrations at therapeutic doses. TGMP interferes with several aspects of guanine nucleotide synthesis. It inhibits de novo purine biosynthesis through false feedback inhibition of glutamine-5-phosphoribosylpyrophosphate amidotransferase, the first enzyme specific to the de novo pathway for purine ribonucleotides. TGMP also inhibits the conversion of inosinic acid (IMP) to xanthylic acid (XMP) by competing for the enzyme IMP dehydrogenase. It was previously thought that TGMP was a key inhibitor of ATP:GMP phosphotransferase (guanylate kinase), but recent results suggest this is not the case. Thioguanylate is further converted to the di- and tri-phosphates, thioguanosine diphosphate (TGDP) and thioguanosine triphosphate (TGTP) (and its 2'-deoxyribosyl analog) by the same enzymes that metabolize guanine nucleotides.

[0312] On day zero (0), K562 cells were transduced with a vector containing a nucleic acid sequence designed to knockdown HPRT and a nucleic acid sequence encoding green fluorescent protein (GFP) (MOI = 1 / 2 / 5); or transfected with nanocapsules containing CRISPR / Cas9 and sgRNA against HPRT (100 ng / 5 × 10 4(1 cell). 6-TG was added to the medium from days 3 to 14. The medium was refreshed every 3–4 days. GFP was analyzed using a flow machine, and InDel% was analyzed using the T7E1 assay ("Indel" is a molecular biology term for the insertion or deletion of a base in an organism's genome). Figure 6A illustrates that the GFP+ population of transduced K562 cells increased from days 3 to 14 under 6TG treatment; whereas, the GFP+ population remained almost unchanged without 6-TG treatment. Figure 6B illustrates that the HPRT knockout population of K562 cells increased from days 3 to 14 under 6TG treatment, and a higher dose of 6TG (900 nM) led to more rapid selection compared to the 300 / 600 nM doses of 6TG. It should be noted that the 6TG selection process occurred much more rapidly in HPRT knockout cells compared to HPRT knockdown cells (MOI=1) at the same concentration of 300 nM 6TG from day 3 to day 14. The difference between knockdown and knockout can be explained by some level of residual HPRT with the RNAi knockdown approach compared to the complete elimination of HPRT with the knockout approach. Therefore, according to the present disclosure, HPRT-knockout cells appeared to be much more resistant to 6TG and grew much more rapidly at a higher dose of 6TG (900 nM) compared to HPRT-knockdown cells.

[0313] On day 0, CEM cells were transduced with a vector containing a nucleic acid sequence designed to knockdown HPRT and a nucleic acid sequence encoding green fluorescent protein, or transfected with nanocapsules containing CRISPR / Cas9 and an sgRNA against HPRT. 6-TG was added to the culture medium from day 3 to day 17. The medium was refreshed every 3–4 days. GFP was analyzed using a flow machine, and InDel% was analyzed by T7E1 assay. Figure 7A illustrates that the GFP+ population of transduced K562 cells increased from day 3 to day 17 under 6TG treatment, while the GFP+ population remained almost unchanged without 6-TG treatment. Figure 7B comparatively shows that the HPRT knockout population of CEM cells increased from day 3 to day 17 under 6TG treatment, and a higher dose of 6TG (900 nM) led to more rapid selection compared to doses of 300 / 600 nM. It should be noted that the 6TG selection process occurred more rapidly in HPRT knockout cells than in HPRT knockdown cells (MOI=1) at the same concentration of 6TG from day 3 to day 17. [Example]

[0314] HPRT knockout and 6-TG selection in PBMCs using CD3-conjugated CRISPR nanocapsules PBMC cells were stimulated with PHA / IL2 two days before transduction (see Figure 8A). On day 0, stimulated PBMC cells were transduced with LV rsh7-GFP (MOI = 0.5) or transfected with nanoRNP-HPRT1 (see Figure 8A). 6-TG was added to the medium from day 3 to day 14 (see Figure 8A). The medium was refreshed every 3–4 days. GFP was analyzed using a flow machine. Figure 8B illustrates the GFP+ population of PBMCs transduced with Rsh7-GFP at two different MOIs (2 and 10), both of which increased with 100 nM 6TG. Figure 8C illustrates the HPRT-knockout population of PBMCs increased with 300 nM 6TG from day 3 to day 14. [Example]

[0315] Negative selection using MTX or MPA Transduced or transfected K562 cells (such as those from Example 5) were cultured with or without MTX from day 0 to day 14. The medium was refreshed every 3–4 days. GFP was analyzed using a flow machine, and InDel% was analyzed by T7E1 assay. Figure 9A shows that the GFP population of transduced K562 cells decreased under treatment with 0.3 μM MTX, while the population of cells without MTX remained unchanged. Figure 9B illustrates that transfected K562 cells were eliminated at a faster pace than the HPRT-KD population under treatment with 0.3 μM MTX.

[0316] Transduced or transfected CEM cells (such as those from Example 6) were cultured with or without MTX from day 0 to day 14. The medium was refreshed every 3–4 days. GFP was analyzed using a flow machine, and InDel% was analyzed by T7E1 assay. Figure 10A shows that the GFP population of transduced K562 cells decreased under treatment with 1 μM MPA, 0.3 μM MTX, or 10 μM MPA, while the population of cells remained unchanged in the untreated group. Figure 10B illustrates that the HPRT knockout population of CEM cells was eliminated at a faster pace under treatment with 1 μM MPA, 0.3 μM MTX, or 10 μM MPA. [Example]

[0317] Preparation of gRNA and hdrDNA - Knockout and HDR of HBB using gRNA-Cas9-hdrDNA nanocapsules method 293T cells were seeded one day before transduction. 1.5 pmol of i) RNP (control), ii) RNP-hdrDNA complex, or iii) RNP and hdrDNA nanocapsules containing HBB-specific RNP were added to the wells and incubated for 4 hours, after which the medium was refreshed. T7E1 assays were performed 3 days later (see also Figures 13A, 13B, and 14).

[0318] The target sequence was as follows: TTACTGCCCTGTGGGGCAAG (SEQ ID NO: 38). The hdr DNA (HBB-SCD) sequence was: CACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGTGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTG (SEQ ID NO: 56).

[0319] The nanon (RNP-hdrDNA) complex-gRNA sequences are provided in the table below: [Table 7]

[0320] INDEL%=8 / 23 (35% vs. 33% from T7E1) HDR%=3 / 8 (38%)

[0321] The nanoRNP and nanohdrDNA-gRNA sequences are provided in the table below: [Table 8]

[0322] INDEL%=6 / 21 (29% vs. 26% from T7E1) HDR%=1 / 6 (17%) [Example]

[0323] Transduction / Transfection Unless otherwise stated, transduction / transfection was performed by standard methods. See, for example, Yan, M. et al. (2015); PloS One.; 10(6): e0127986; Yan, M. et al. (2012). Journal of the American Chemical Society, 134, 13542-13545; Zhang, J. et al. (2011). Biomacromolecules, 12(4), 1006-1014. [Example]

[0324] Knockout of CCR5 and knockin of C46 in MOCHA using 3-in-1 CRISPR nanomachinery Knockout of CCR5 and knock-in of C46 in MOCHA (i.e., transferrin-conjugated Cas9-CCR5-gRNA-EF1a-C46 (3-in-1) nanocapsules).

[0325] Nanocapsules were formulated to contain the CRISPR / Cas9 / C46 HDR template-CRISPR machinery complex. The nanocapsules were also conjugated with transferrin to facilitate delivery to the MOCHA cell line. 500 ng of Cas9-CCR5-gRNA-EF1a-C46 nanocapsules were added, and flow analysis was performed 3 days later. Figure 15, panels A and B, show CCR5 staining results from untreated Mocha (approximately 95% CCR5+) cells and treated MOCHA. Figure 15, panels C, D, and E, show C46 staining results for untreated Mocha, the CCR5 subpopulation of treated Mocha, and the C46 knock-in AW072 cell line.

[0326] method: Cas9 protein stock (67 μM), CCR5-targeting gRNA stock (100 μM), and C46 expression DNA cassette double-stranded DNA HDR template (100 μM) were added to a 50 mM pH 6.4 50 mM HEPES buffer and 150 μM NaCl to a final concentration of 1 μM. The 3-in-1 CRISPR machinery complex formed from the Cas9 / gRNA / HDR template was negatively charged. Various polymer nanocapsules were formulated, each incorporating a gRNA with SEQ ID NO: 55.

[0327] Next, a chemical cocktail of (i) N-(3-((4-((3-aminopropyl)amino)butyl)amino)propyl)acrylamide, (ii) 2-(dimethylamino)ethyl acrylate, (iii) 1,3-glycerin dimethacrylate, and (iv) acrylamide was dissolved in deoxygenated, Rnase-free water and added to the Cas9-gRNA complex tube. The ratio of the various monomers was 750:500:1000:4000 (monomers (i):(ii):(iii):(iv)). Radical polymerization was carried out by adding 0.02 mg of ammonium persulfate and 0.4 μL of N,N,N',N'-tetramethylethylenediamine dissolved in 2 μL of deoxygenated, deionized water. The reaction was allowed to proceed for 180 min at 4 °C in a nitrogen atmosphere. After completion of the polymerization, excess monomers were removed using dialysis or ultrafiltration.

[0328] The nanocapsules were then purified and conjugated with targeting moieties and PEG. Specifically, a 30- to 50-fold excess of dibenzocyclooctyne-SSN-hydroxysuccinimidyl ester was used to modify the surface of the nanocapsules, reaching a final conjugation of between about 3 and about 10 esters per nanocapsule. Next, a 5- to 10-fold excess of azide-functionalized PEG with a molecular weight of about 2000 daltons and a 5- to 10-fold excess of azide-functionalized transferrin, abCD3, or abCD34 were used to introduce targeting and stabilizing moieties onto the surface of the formed polymer nanocapsules. The conjugated nanocapsules were then separated from unreacted targeting molecules and PEG, and the final product was concentrated using size-exclusion column chromatography. The resulting polymer nanocapsule conjugates had a neutral charge and a size range of between about 50 nm and about 100 nm. [Example]

[0329] 6-TG selection using 3-in-1 CRISPR machinery Assay protocol and results of CCR5 staining using 6-TG selection in sh734-KI mPB CD34+ cells (i.e., mobilized CD34+ cells cultured with TPO / SCF / FLT3 / IL3 and CCR5 knockout and sh734 knockin in CD34+ cells).

[0330] Nanocapsules were formulated to contain CRISPR / Cas9 / gRNAR targeting the CCR5 / mi-sh734 expression cassette HDR template CRISPR machinery complex (see Methods). Cd34+ cells were thawed and pre-stimulated overnight in x-vivo 10 containing 100 ng / mL TPO / SCF / FLT4 / IL3. 500 ng of Cas9-CCR5-gRNA-3G-mi-sh734 nanocapsules were then added to 5 x 10^4 cells per well, and 100 nM 6TG was added to the culture medium from day 4 to day 14. Flow analysis was performed on day 14. Figure 16, panels A, B, and C, show CCR5 staining results from unstained control, CD34+ cells without 6TG treatment (44.9% CCR5+) (Figure 16, panel B), and with 6TG treatment (43.4% CCR5+) (Figure 16, panel C). Figure 16, panel D, shows CCR5+ staining results from nanocapsule-treated CD34+ cells without 6TG in the culture medium (23.8%) and with 6TG in the culture medium (10.2%).

[0331] The CCR5 staining data suggest that 6-TG selection occurs for sh734-KI mPB CD34+ cells in bulk culture.

[0332] method To a 50 mM HEPES buffer (pH 6.4) containing 50 mM HEPES and 150 μM NaCl, Cas9 protein stock (67 μM), CCR5-targeting gRNA stock (100 μM), and 7SK-sh734 expression DNA cassette double-stranded DNA HDR template (100 μM) were added to a final concentration of 1 μM. The 3-in-1 CRISPR machinery complex formed from the Cas9 / gRNA / HDR template was negatively charged.

[0333] Next, a chemical cocktail of (i) N-(3-((4-((3-aminopropyl)amino)butyl)amino)propyl)acrylamide, (ii) 2-(dimethylamino)ethyl acrylate, (iii) 1,3-glycerin dimethacrylate, and (iv) acrylamide was dissolved in deoxygenated, Rnase-free water and added to the Cas9-gRNA complex tube. The ratio of the various monomers was 850:500:1000:4000 (monomers (i):(ii):(iii):(iv)). Radical polymerization was carried out by adding 0.02 mg of ammonium persulfate and 0.4 μL of N,N,N',N'-tetramethylethylenediamine dissolved in 2 μL of deoxygenated, deionized water. The reaction was allowed to proceed for 180 min at 4 °C under a nitrogen atmosphere. After completion of the polymerization, excess monomers were removed using dialysis or ultrafiltration.

[0334] The nanocapsules were then purified and conjugated with targeting moieties and PEG. Specifically, a 30- to 50-fold excess of dibenzocyclooctyne-SSN-hydroxysuccinimidyl ester was used to modify the surface of the nanocapsules, reaching a final conjugation of between about 3 and about 10 esters per nanocapsule. A 5- to 10-fold excess of azide-functionalized PEG with a molecular weight of about 2000 daltons and a 5- to 10-fold excess of azide-functionalized transferrin, abCD3, or abCD34 were then used to introduce targeting and stabilizing moieties onto the surface of the formed polymer nanocapsules. The conjugated nanocapsules were then separated from unreacted targeting molecules and PEG, and the final product was concentrated using size-exclusion column chromatography. The resulting polymer nanocapsule conjugates had a neutral charge and ranged in size from about 50 nm to about 100 nm (see Figure 16). [Example]

[0335] 6TG selection using CRISPR nanocapsules 6-TG selection was investigated using VCN / InDel data. mPB CD34+ cells were transfected / transduced as shown in Figure 8A. Nanocapsules were formulated to contain CRISPR / Cas9 / gRNAR targeting the CCR5 / mi-sh734 expression cassette HDR template CRISPR machinery complex (see Methods). CD34+ cells were thawed and pre-stimulated overnight in X-vivo 10 containing 100 ng / mL TPO / SCF / FLT4 / IL3. 5x10 cells per well were then cultured. 4 500 ng of Cas9-CCR5-gRNA-3G-mi-sh734 nanocapsules were added to each cell, and 100 nM of 6TG was added to the culture medium from day 4 to day 14. Flow analysis was performed on day 14. Figure 17 shows CCR5 staining results from unstained control, CD34+ cells without 6TG treatment (44.9% CCR5+), and with 6TG treatment (43.4% CCR5+). Figure 17 also shows CCR5 staining results from nanocapsule-treated CD34+ cells without 6TG in the culture medium (23.8%) and with 6TG in the culture medium (10.2%). The CCR5 staining data suggest that 6-TG selection occurs for sh734-KI mPB CD34+ cells in bulk culture.

[0336] We examined 6-TG selection of mPB CD34 cells or HPRT-KO CD34 cells transduced with the sh734-rGbG / rGbG-sh734 / sh734-GFP vector on 6-TG-treated methylcellulose plates. The VCN / InDel data suggest that 6-TG selection of mPB CD34 cells or HPRT-KO CD34 cells transduced with the sh734-rGbG / rGbG-sh734 / sh734-GFP vector on 6-TG-treated methylcellulose plates occurs (see Figures 8D and 8E).

[0337] Additional Embodiments In a first additional embodiment, there is provided a polymeric nanocapsule comprising a polymeric shell and a payload, wherein the polymeric shell comprises at least two different positively charged monomers, at least one neutral monomer, and a crosslinker; and the payload is selected from the group consisting of a ribonucleoprotein complex, an siRNA molecule, an shRNA molecule, an expression vector, a polynucleotide such as a polynucleotide having between 50 and 500 base pairs, a peptide, an enzyme, an antibody, and an antibody fragment. In some embodiments, the ribonucleoprotein complex comprises an endonuclease and a guide RNA. In some embodiments, the endonuclease is a Cas protein. In some embodiments, the Cas protein is selected from the group consisting of Cas9, Cas12a, and Cas12b. In some embodiments, the guide RNA targets the HPRT locus. In some embodiments, the guide RNA targeting HPRT comprises a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the guide RNA targeting HPRT comprises a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the guide RNA targets the beta globin locus. In some embodiments, the guide RNA targeting beta globin comprises a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO: 3. In some embodiments, the guide RNA targeting beta globin comprises a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO: 3.

[0338] In some embodiments, the positively charged monomer is: N-(3-((4-((3-aminopropyl)amino)butyl)amino)propyl)acrylamide, N-(3-((4-((3-aminopropyl)amino)butyl)amino)propyl)methacrylamide, N-(3-((4-aminobutyl)amino)propyl)acrylamide, N-(3-((4-aminobutyl)amino)propyl)methacrylamide, N-(2-((2-aminoethyl)(methyl)amino)ethyl)acrylamide, N-(2-((2-aminoethyl)(methyl)amino)ethyl)methacrylamide, N-(piperazin-1-ylmethyl)acrylamide, N-(piperazin-1-ylmethyl)methacrylamide, N-(2-(bis(2-aminoethyl)amino)ethyl)acrylamide, N-(2-(bis(2-aminoethyl)amino)ethyl)methacrylamide, N-(3-aminopropyl)methacrylamide hydrochloride, 2-(dimethylamino)ethyl acrylate, dimethylaminoethyl methacrylate, (3-acrylamidopropyl)trimethylammonium hydrochloride, 2-aminoethyl methacrylate, 3-(dimethylamino)propyl acrylate, N-[3-(dimethylamino)propyl]methacrylamide and any combination thereof is selected from the group consisting of:

[0339] In some embodiments, the neutral monomer is selected from N-(1,3-dihydroxy-2-(hydroxymethyl)propan-2-yl)acrylamide, acrylamide, N-(hydroxymethyl)acrylamide, 2-hydroxyethyl acrylate, and 2-hydroxyethyl methacrylate. In some embodiments, the crosslinker is selected from the group consisting of 1,3-glycerin dimethacrylate, N,N'-methylenebisacrylamide, and glycerin 1,3-diglycerolate diacrylate.

[0340] In some embodiments, the polymer nanocapsule further comprises at least one targeting moiety. In some embodiments, the polymer nanocapsule comprises between 2 and 6 targeting moieties. In some embodiments, the at least one targeting moiety is an antibody. In some embodiments, the at least one targeting moiety is an antibody and the polymer nanocapsule comprises between 1 and 3 antibodies. In some embodiments, the polymer nanocapsule comprises at least one stabilizing moiety. In some embodiments, the at least one stabilizing moiety comprises at least one polyethylene glycol group. In some embodiments, the polymer nanocapsule comprises at least one targeting moiety and at least one stabilizing moiety. In some embodiments, the polymer nanocapsule comprises between 2 and 6 targeting moieties and at least 2 and 6 stabilizing moieties. In some embodiments, the at least one targeting moiety is an antibody and the stabilizing moiety comprises at least one polyethylene glycol group.

[0341] In some embodiments, the polymer shell does not include a monomer or crosslinker containing a heterocyclic group, in some embodiments, the polymer shell does not include a monomer or crosslinker containing an imidazole group, in some embodiments, the polymer shell does not include an imidazolylacryloyl monomer.

[0342] In a second additional embodiment, there is provided a method for modifying a target nucleic acid sequence in a host cell, comprising contacting the host cell with one or more polymeric nanocapsules, wherein the one or more polymeric nanocapsules comprise a polymeric shell and a payload, wherein the polymeric shell comprises at least two different positively charged monomers, at least one neutral monomer, and a crosslinker; and the payload is selected from the group consisting of a ribonucleoprotein complex, an siRNA molecule, an shRNA molecule, an expression vector, a polynucleotide such as a polynucleotide having between 50 and 500 base pairs, a peptide, an enzyme, an antibody, and an antibody fragment. In some embodiments, the host cell is a hematopoietic stem cell. In some embodiments, the hematopoietic stem cell is an allogeneic hematopoietic stem cell. In some embodiments, the hematopoietic stem cell is an autologous hematopoietic stem cell. In some embodiments, the hematopoietic stem cell is a sibling-matched hematopoietic stem cell.

[0343] In some embodiments, the ribonucleoprotein complex comprises an endonuclease and a guide RNA. In some embodiments, the endonuclease is a Cas protein. In some embodiments, the Cas protein is selected from the group consisting of Cas9, Cas12a, and Cas12b. In some embodiments, the guide RNA targets the HPRT locus. In some embodiments, the guide RNA targeting HPRT comprises a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO: 2. In some embodiments, the guide RNA targeting HPRT comprises a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO: 2. In some embodiments, the guide RNA targets the beta globin locus. In some embodiments, the guide RNA targeting beta globin comprises a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO: 3. In some embodiments, the guide RNA targeting beta globin comprises a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO: 3. In some embodiments, the polymeric nanocapsule does not comprise a monomer or crosslinker comprising a heterocyclic group. In some embodiments, the polymeric nanocapsules do not include any monomers or crosslinkers that include imidazole groups.

[0344] In a third additional embodiment, there is a method for providing the benefits of lymphocyte infusion to a patient in need of such treatment while reducing side effects, the method comprising the steps of generating HPRT-deficient lymphocytes from a donor sample by transfecting lymphocytes in the donor sample with nanocapsules containing components adapted to knock out HPRT (e.g., Cas9 or Cas12a protein and a gRNA targeting a portion of the HPRT gene); positively selecting for HPRT-deficient lymphocytes ex vivo to provide a population of modified lymphocytes; administering the HSC graft to the patient; administering the population of modified lymphocytes to the patient after administration of the HSC graft; and, optionally, administering a dihydrofolate reductase inhibitor if side effects occur. In some embodiments, the dihydrofolate reductase inhibitor is selected from the group consisting of methotrexate (MTX) or mycophenolic acid (MPA). In some embodiments, the positive selection comprises contacting the generated HPRT-deficient lymphocytes with a purine analog. In some embodiments, the purine analog is 6TG. In some embodiments, the amount of 6TG ranges between about 1 and about 15 μg / mL. In some embodiments, positive selection comprises contacting the generated HPRT-deficient lymphocytes with both a purine analog and allopurinol. In some embodiments, the modified lymphocytes are administered as a single bolus. In some embodiments, multiple doses of modified lymphocytes are administered to the patient. In some embodiments, each dose of modified lymphocytes is about 0.1 x 10 6 Individual cells / kg ~ approx. 240×10 6 In some embodiments, the total dose of modified lymphocytes is between about 0.1 x 10 cells / kg. 6 Individual cells / kg ~ approx. 730×10 6 Between 100 and 150 cells / kg.

[0345] In a fourth additional embodiment, there is a polymer nanocapsule comprising a polymer shell and a ribonucleoprotein complex. In some embodiments, the ribonucleoprotein comprises an endonuclease and a guide RNA. In some embodiments, the endonuclease is a Cas protein. In some embodiments, the Cas protein is Cas9. In some embodiments, the Cas protein is Cas12. In some embodiments, the guide RNA targets the HPRT locus. In some embodiments, the guide RNA targets a nucleic acid sequence within the beta globin gene. In some embodiments, the guide RNA targets a BCL11A binding site in the regulatory region of the gamma globin promoter. In some embodiments, the polymer nanocapsule further comprises at least one targeting moiety to facilitate delivery of the ribonucleoprotein complex to a specific cell type (e.g., a targeting moiety conjugated to the surface of the polymer nanocapsule). In some embodiments, the polymer nanocapsule is erodible or biodegradable. In some embodiments, the polymer nanocapsule comprises a pH-sensitive crosslinker. In some embodiments, the polymer nanocapsule has a size ranging from about 50 nm to about 250 nm. In some embodiments, the polymer shell comprises one positively charged monomer, hi some embodiments, the polymer shell comprises two positively charged monomers.

[0346] In some embodiments, there is a polymeric nanocapsule comprising a polymeric shell and a ribonucleoprotein complex, wherein the polymeric shell comprises: (i) at least one of N-(3-((4-((3-aminopropyl)amino)butyl)amino)propyl)acrylamide or 2-(dimethylamino)ethyl acrylate; (ii) acrylamide or a derivative thereof; and (iii) a crosslinker (e.g., a pH-degradable crosslinker). In some embodiments, the polymeric shell comprises both N-(3-((4-((3-aminopropyl)amino)butyl)amino)propyl)acrylamide and 2-(dimethylamino)ethyl acrylate. In some embodiments, the crosslinker is an acrylate. In some embodiments, the acrylate is 2-(dimethylamino)ethyl acrylate.

[0347] In some embodiments, the polymeric nanocapsule further comprises at least one targeting moiety. In some embodiments, the targeting moiety is linked to the polymeric nanocapsule by a spacer comprising a cleavable group, e.g., a disulfide bond. In some embodiments, the targeting moiety is an antibody. In some embodiments, the targeting moiety facilitates delivery of the polymeric nanocapsule to a specific cell type, the cell type being selected from the group including immune cells, blood cells, heart cells, lung cells, photoreceptor cells, liver cells, kidney cells, brain cells, cells of the central nervous system, cells of the peripheral nervous system, cancer cells, virus-infected cells, stem cells, skin cells, intestinal cells, and / or auditory cells. In some embodiments, the cancer cells are selected from the group including lymphoma cells, solid tumor cells, leukemia cells, bladder cancer cells, breast cancer cells, colon cancer cells, rectal cancer cells, endometrial cancer cells, kidney cancer cells, lung cancer cells, melanoma cells, pancreatic cancer cells, prostate cancer cells, and thyroid cancer cells.

[0348] In some embodiments, the polymer nanocapsule further comprises at least one stabilizing moiety. In some embodiments, the at least one stabilizing moiety comprises at least one alkylene oxide group, such as a polyethylene glycol repeating group and / or a polypropylene glycol repeating group. In some embodiments, the at least one stabilizing moiety comprises at least four polyethylene glycol repeating groups and / or polypropylene glycol repeating groups.

[0349] In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets the HPRT gene. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets the beta globin gene. In some embodiments, the ribonucleoprotein complex comprises a guide RNA that targets a BCL11A binding site in the regulatory region of the gamma globin promoter. In some embodiments, the polymer nanocapsule has a diameter ranging from about 50 nm to about 250 nm.

[0350] In a fifth additional embodiment, there is a polymeric nanocapsule comprising a polymeric shell and a ribonucleoprotein complex, wherein the polymeric shell comprises at least two different positively charged monomers, at least one neutral monomer, and a crosslinker. In some embodiments, the ribonucleoprotein complex comprises an endonuclease and a guide RNA. In some embodiments, the endonuclease is a Cas protein. In some embodiments, the Cas protein is selected from the group consisting of Cas9, Cas12a, and Cas12b. In some embodiments, the guide RNA targets the HPRT locus. In some embodiments, the guide RNA that targets HPRT comprises a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the guide RNA that targets HPRT comprises a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the guide RNA targets the beta globin locus. In some embodiments, the guide RNA that targets beta globin comprises a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the guide RNA targeting beta globin comprises a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO:3.

[0351] In some embodiments, the positively charged monomer is: N-(3-((4-((3-aminopropyl)amino)butyl)amino)propyl)acrylamide, N-(3-((4-((3-aminopropyl)amino)butyl)amino)propyl)methacrylamide, N-(3-((4-aminobutyl)amino)propyl)acrylamide, N-(3-((4-aminobutyl)amino)propyl)methacrylamide, N-(2-((2-aminoethyl)(methyl)amino)ethyl)acrylamide, N-(2-((2-aminoethyl)(methyl)amino)ethyl)methacrylamide, N-(piperazin-1-ylmethyl)acrylamide, N-(piperazin-1-ylmethyl)methacrylamide, N-(2-(bis(2-aminoethyl)amino)ethyl)acrylamide, N-(2-(bis(2-aminoethyl)amino)ethyl)methacrylamide, N-(3-aminopropyl)methacrylamide hydrochloride, 2-(dimethylamino)ethyl acrylate, dimethylaminoethyl methacrylate, (3-acrylamidopropyl)trimethylammonium hydrochloride, 2-aminoethyl methacrylate, 3-(dimethylamino)propyl acrylate, N-[3-(dimethylamino)propyl]methacrylamide and any combination thereof is selected from the group consisting of:

[0352] In some embodiments, the neutral monomer is selected from N-(1,3-dihydroxy-2-(hydroxymethyl)propan-2-yl)acrylamide, acrylamide, N-(hydroxymethyl)acrylamide, 2-hydroxyethyl acrylate, and 2-hydroxyethyl methacrylate. In some embodiments, the crosslinker is selected from the group consisting of 1,3-glycerin dimethacrylate, N,N'-methylenebisacrylamide, and glycerin 1,3-diglycerolate diacrylate.

[0353] In some embodiments, the polymer nanocapsule further comprises at least one targeting moiety. In some embodiments, the polymer nanocapsule comprises between 2 and 6 targeting moieties. In some embodiments, the at least one targeting moiety is an antibody. In some embodiments, the at least one targeting moiety is an antibody and the polymer nanocapsule comprises between 1 and 3 antibodies. In some embodiments, the polymer nanocapsule comprises at least one stabilizing moiety. In some embodiments, the at least one stabilizing moiety comprises at least one polyethylene glycol group. In some embodiments, the polymer nanocapsule comprises at least one targeting moiety and at least one stabilizing moiety. In some embodiments, the polymer nanocapsule comprises between 2 and 6 targeting moieties and at least 2 and 6 stabilizing moieties. In some embodiments, the at least one targeting moiety is an antibody and the stabilizing moiety comprises at least one polyethylene glycol group.

[0354] In some embodiments, the polymer shell does not include a monomer or crosslinker containing a heterocyclic group, in some embodiments, the polymer shell does not include a monomer or crosslinker containing an imidazole group, in some embodiments, the polymer shell does not include an imidazolylacryloyl monomer.

[0355] In a sixth additional embodiment, there is (i) a polymeric nanocapsule, the polymeric nanocapsule comprising a polymeric shell and a ribonucleoprotein complex, the polymeric shell comprising at least two positively charged monomers, at least one neutral monomer, and a crosslinker; and (ii) a conjugate linked to the polymeric nanocapsule, the conjugate comprising at least one of (a) a targeting moiety, or (b) a stabilizing moiety.

[0356] In a seventh additional embodiment, there is a method of treating a genetic condition in a human patient, comprising: producing a population of modified human hematopoietic stem cells by contacting an unmodified population of human hematopoietic stem cells with polymer nanocapsules, wherein the polymer nanocapsules comprise a polymer shell and a ribonucleoprotein complex, the polymer shell comprising at least two positively charged monomers, at least one neutral monomer, and a crosslinker; and administering a therapeutically effective amount of the population of modified human hematopoietic stem cells to the human patient.

[0357] In an eighth additional embodiment, there is a conjugate prepared according to a method comprising: derivatizing a polymer nanocapsule with a first reactive functional group capable of participating in a click chemistry reaction, wherein the polymer nanocapsule has a polymer shell and a ribonucleoprotein complex, the polymer shell comprising at least two positively charged monomers, at least one neutral monomer, and a crosslinker; derivatizing a targeting moiety with a second reactive functional group capable of participating in a click chemistry reaction with the first reactive functional group; and reacting the derivatized polymer nanocapsule with the derivatized targeting moiety.

[0358] In a ninth additional embodiment, there is a conjugate prepared according to a method comprising reacting a derivatized polymeric nanocapsule with at least one derivatized targeting moiety, wherein the derivatized polymeric nanocapsule comprises at least one first reactive functional group capable of participating in a click chemistry reaction, the polymeric nanocapsule having a polymer shell having at least two positively charged monomers, at least one neutral monomer, and a crosslinker; and the at least one derivatized targeting moiety comprises a second reactive functional group capable of participating in a click chemistry reaction with the first reactive functional group.

[0359] All U.S. patents, U.S. patent application publications, U.S. patent applications, foreign patents, foreign patent applications, and non-patent publications referred to herein and / or listed in the Application Data Sheet are incorporated herein by reference in their entirety. Aspects of the embodiments can be modified as necessary to provide still further embodiments using the scope concepts of the various patents, applications, and publications.

[0360] While the present disclosure has been described with reference to certain exemplary embodiments, it should be understood that numerous other modifications and embodiments may be devised by those skilled in the art which fall within the spirit and scope of the principles of the present disclosure. More particularly, reasonable variations and modifications may be made in the component parts and / or arrangements of the combined arrangements of the subject matter within the scope of the foregoing disclosure, drawings, and appended claims without departing from the spirit of the present disclosure. In addition to variations and modifications in the component parts and / or arrangements, alternative uses will also be apparent to those skilled in the art.

Claims

1. A polymeric nanocapsule comprising a polymer shell and a ribonucleoprotein complex, wherein the polymer shell comprises at least two different positively charged monomers, at least one neutral monomer, and a crosslinker, and the polymer shell does not comprise any monomers or crosslinkers containing imidazole groups; The positively charged monomers have the formulas (IA) and (IB): 【Chemistry 1】 (In the formula, R 1 is H or substituted or unsubstituted C 1 ~C 6 is an alkyl group; R 2 is -(CH 2 ) m -NR 3 R 4 R 5 wherein m is an integer from 1 to 5; R 3 is H, unsubstituted C 1 ~C 6 Alkyl group or NR 6 R 7 C substituted with 1 ~C 6 Alkyl is a group, and R 6 and R 7 are independently H or unsubstituted C 1 ~C 6 C substituted with alkyl group or amino group 1 ~C 6 Alkyl group or NR 8 R 9 C substituted with 1 ~C 6 alkyl, and R 8 and R 9 are independently H, unsubstituted C 1 ~C 6 C substituted with alkyl group or amino group 1 ~C 6 alkyl groups; R 4 is H, unsubstituted C 1 ~C 6 C substituted with alkyl group or amino group 1 ~C 6 Alkyl group or NR 10 R 11 C substituted with 1 ~C 6 alkyl, and R 10 and R 11 are independently H, unsubstituted C 1 ~C 6 C substituted with alkyl group, amino 1 ~C 6 Alkyl group or NR 12 R 13 C substituted with 1 ~C 6 alkyl groups, R 12 and R 13 are independently H, unsubstituted C 1 ~C 6 C substituted with alkyl group or amino group 1 ~C 6 alkyl groups; or R 3 and R 4 may be taken together to form a 5- to 7-membered heterocycloalkyl ring; R 5 is a lone pair of electrons or a non-substituted C 1 ~C 6 alkyl group) and The crosslinker has the formula (IE): 【Chemistry 2】 (In the formula, R 14 and R 15 are independently H or substituted or unsubstituted C 1 ~C 6 is an alkyl group; W is -N(H)-R 16 -N(H)- or -[O-CH 2 -C(H)(OH)-CH 2 ] n -O-, and R 16 is a substituted or unsubstituted C 1 ~C 6 alkylene) and The neutral monomer has the formula (IF): 【Transformation 3】 (In the formula, in the formula, R 17 is H or unsubstituted C 1 ~C 6 is an alkyl group, R 18 is an amino or an amino substituted with a hydroxy-substituted alkyl or OR 19 and R 19 is a hydroxyalkyl substituent The polymer nanocapsules having the following structure:

2. The polymer nanocapsule of claim 1 , wherein the ribonucleoprotein complex comprises an endonuclease and a guide RNA.

3. The polymer nanocapsule of claim 2 , wherein the endonuclease is a Cas protein.

4. The polymer nanocapsule of claim 3 , wherein the Cas protein is a type II Cas protein or a type V Cas protein.

5. The polymer nanocapsule of claim 3 , wherein the Cas protein is selected from the group consisting of a Cas9 protein and a Cas12a protein.

6. The polymer nanocapsule of claim 2 , wherein the guide RNA targets the HPRT locus, the beta globin locus, or the CCR5 locus.

7. The polymer nanocapsule of claim 2, wherein the guide RNA comprises a nucleic acid sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO:

3.

8. The polymeric nanocapsule of claim 1 , further comprising at least one targeting moiety.

9. The polymeric nanocapsule of claim 8 , wherein at least one targeting moiety is an antibody.

10. The polymeric nanocapsule of claim 1 , further comprising at least one stabilizing moiety.

11. The polymeric nanocapsule of claim 10 , wherein at least one stabilizing moiety comprises at least one polyethylene glycol group.

12. A polymeric nanocapsule comprising a polymeric shell and a ribonucleoprotein complex, wherein the polymeric nanocapsule comprises at least one targeting moiety adapted to facilitate delivery of the ribonucleoprotein complex to hematopoietic stem cells, the at least one targeting moiety being linked to the polymeric nanocapsule via a disulfide bond, the polymeric nanocapsule further comprising at least one stabilizing moiety having a hydrophilic group, and the polymeric shell comprising at least one positively charged monomer, at least one neutral monomer, and a crosslinker; The positively charged monomers have the formulas (IA) and (IB): 【Chemistry 4】 (In the formula, R 1 is H or substituted or unsubstituted C 1 ~C 6 is an alkyl group; R 2 is -(CH 2 ) m -NR 3 R 4 R 5 wherein m is an integer from 1 to 5; R 3 is H, unsubstituted C 1 ~C 6 Alkyl group or NR 6 R 7 C substituted with 1 ~C 6 Alkyl is a group, and R 6 and R 7 are independently H or unsubstituted C 1 ~C 6 C substituted with alkyl group or amino group 1 ~C 6 Alkyl group or NR 8 R 9 C substituted with 1 ~C 6 alkyl, and R 8 and R 9 are independently H, unsubstituted C 1 ~C 6 C substituted with alkyl group or amino group 1 ~C 6 alkyl groups; R 4 is H, unsubstituted C 1 ~C 6 C substituted with alkyl group or amino group 1 ~C 6 Alkyl group or NR 10 R 11 C substituted with 1 ~C 6 alkyl, and R 10 and R 11 are independently H, unsubstituted C 1 ~C 6 C substituted with alkyl group, amino 1 ~C 6 Alkyl group or NR 12 R 13 C substituted with 1 ~C 6 alkyl groups, R 12 and R 13 are independently H, unsubstituted C 1 ~C 6 C substituted with alkyl group or amino group 1 ~C 6 alkyl groups; or R 3 and R 4 may be taken together to form a 5- to 7-membered heterocycloalkyl ring; R 5 is a lone pair of electrons or a non-substituted C 1 ~C 6 alkyl group) and The crosslinker has the formula (IE): 【Transformation 5】 (In the formula, R 14 and R 15 are independently H or substituted or unsubstituted C 1 ~C 6 is an alkyl group; W is -N(H)-R 16 -N(H)- or -[O-CH 2 -C(H)(OH)-CH 2 ] n -O-, and R 16 is a substituted or unsubstituted C 1 ~C 6 alkylene) and The neutral monomer has the formula (IF): 【Transformation 6】 (In the formula, in the formula, R 17 is H or unsubstituted C 1 ~C 6 is an alkyl group, R 18 is an amino or an amino substituted with a hydroxy-substituted alkyl or OR 19 and R 19 is a hydroxyalkyl substituent The polymer nanocapsules having the following structure:

13. The polymer nanocapsule of claim 12 , wherein the ribonucleoprotein complex comprises a guide RNA targeting HPRT, a gamma globin promoter, and / or beta globin.

14. The polymeric nanocapsule of claim 12 , wherein at least one targeting moiety comprises an antibody.

15. The polymeric nanocapsule of claim 12 , wherein the hydrophilic group of at least one stabilizing moiety comprises a polyethylene glycol group.

16. The polymeric nanocapsule of claim 12 , wherein the hydrophilic group of at least one stabilizing moiety comprises a polypropylene glycol repeating group.

17. The polymeric nanocapsule of claim 12 , wherein the polymer shell further comprises a neutral monomer and a crosslinker.

18. Neutral monomers are: N-(1,3-dihydroxy-2-(hydroxymethyl)propan-2-yl)acrylamide, acrylamide, N-(hydroxymethyl)acrylamide, 2-hydroxyethyl acrylate, and 2-hydroxyethyl methacrylate 18. The polymeric nanocapsule of claim 17, selected from the group consisting of:

19. Crosslinkers are: 1,3-glycerin dimethacrylate, N,N'-methylenebisacrylamide, and Glycerin 1,3-diglycerolate diacrylate 18. The polymeric nanocapsule of claim 17, selected from the group consisting of:

20. The polymer shell is: N-(3-((4-((3-aminopropyl)amino)butyl)amino)propyl)acrylamide, N-(3-((4-((3-aminopropyl)amino)butyl)amino)propyl)methacrylamide, N-(3-((4-aminobutyl)amino)propyl)acrylamide, N-(3-((4-aminobutyl)amino)propyl)methacrylamide, N-(2-((2-aminoethyl)(methyl)amino)ethyl)acrylamide, N-(2-((2-aminoethyl)(methyl)amino)ethyl)methacrylamide, N-(piperazin-1-ylmethyl)acrylamide, N-(piperazin-1-ylmethyl)methacrylamide, N-(2-(bis(2-aminoethyl)amino)ethyl)acrylamide, N-(2-(bis(2-aminoethyl)amino)ethyl)methacrylamide, N-(3-aminopropyl)methacrylamide hydrochloride, 2-(dimethylamino)ethyl acrylate, dimethylaminoethyl methacrylate, (3-acrylamidopropyl)trimethylammonium hydrochloride, 2-aminoethyl methacrylate, 3-(dimethylamino)propyl acrylate, and N-[3-(dimethylamino)propyl]methacrylamide, 13. The polymeric nanocapsule of claim 12, comprising at least one positively charged monomer selected from the group consisting of:

21. A pharmaceutical composition comprising the polymer nanocapsule of claim 1 and a pharmaceutically acceptable carrier or excipient.

22. 10. A modified host cell, prepared by contacting an unmodified host cell with the polymer nanocapsule of claim 1.

23. 23. The modified host cell of claim 22, wherein the unmodified host cell is a hematopoietic stem cell.

24. 24. The modified host cell of claim 23, wherein the hematopoietic stem cell is a CD34+ hematopoietic stem cell.

25. 24. The modified host cell of claim 23, wherein the hematopoietic stem cells are selected from the group consisting of allogeneic hematopoietic stem cells, autologous hematopoietic stem cells, and sibling-matched hematopoietic stem cells.

26. The polymer nanocapsule ribonucleoprotein complex contains at least one guide RN having at least 95% sequence identity with any one of SEQ ID NOs: 1-23 and 39-54.

23. The modified host cell of claim 22, comprising A.

27. 23. The modified host cell of claim 22, wherein the ribonucleoprotein complex of the polymer nanocapsule comprises at least one guide RNA comprising any one of SEQ ID NOs: 1-23 and 39-54.

28. 23. The modified host cell of claim 22, wherein the ribonucleoprotein complex of the polymer nanocapsule comprises at least one guide RNA targeting a sequence having at least 95% identity to any one of SEQ ID NOs: 24-38 and 55-56.

29. 1. A polymeric nanocapsule comprising a polymeric shell and a ribonucleoprotein complex, the polymeric shell comprising: (i) at least one positively charged monomer having formula (IA) and (IB): 【Transformation 7】 (In the formula, R 1 is H or substituted or unsubstituted C 1 ~C 6 is an alkyl group; R 2 is -(CH 2 ) m -NR 3 R 4 R 5 wherein m is an integer from 1 to 5; R 3 is H, unsubstituted C 1 ~C 6 Alkyl group or NR 6 R 7 C substituted with 1 ~C 6 Alkyl is a group, and R 6 and R 7 are independently H or unsubstituted C 1 ~C 6 C substituted with alkyl group or amino group 1 ~C 6 Alkyl group or NR 8 R 9 C substituted with 1 ~C 6 alkyl, and R 8 and R 9 are independently H, unsubstituted C 1 ~C 6 C substituted with alkyl group or amino group 1 ~C 6 alkyl groups; R 4 is H, unsubstituted C 1 ~C 6 C substituted with alkyl group or amino group 1 ~C 6 Alkyl group or NR 10 R 11 C substituted with 1 ~C 6 alkyl, and R 10 and R 11 are independently H, unsubstituted C 1 ~C 6 C substituted with alkyl group, amino 1 ~C 6 Alkyl group or NR 12 R 13 C substituted with 1 ~C 6 alkyl groups, R 12 and R 13 are independently H, unsubstituted C 1 ~C 6 C substituted with alkyl group or amino group 1 ~C 6 alkyl groups; or R 3 and R 4 may be taken together to form a 5- to 7-membered heterocycloalkyl ring; R 5 is a lone pair of electrons or a non-substituted C 1 ~C 6 alkyl group) the positively charged monomer having any one of: (ii) acrylamide or a derivative thereof; and (iii) Crosslinker Including, The crosslinker has the formula (IE): 【Transformation 8】 (In the formula, R 14 and R 15 are independently H or substituted or unsubstituted C 1 ~C 6 is an alkyl group; W is -N(H)-R 16 -N(H)- or -[O-CH 2 -C(H)(OH)-CH 2 ] n -O-, and R 16 is a substituted or unsubstituted C 1 ~C 6 alkylene) The polymer nanocapsules having the following structure:

30. 30. The polymeric nanocapsule of claim 29, wherein the polymer shell comprises two different positively charged monomers, a first positively charged monomer having formula (IA) and a second positively charged monomer having formula (IB).

31. 31. The polymeric nanocapsule of claim 30, wherein the second positively charged monomer is N-(3-aminopropyl) methacrylamide or a salt thereof.

32. The polymeric nanocapsule of any one of claims 29 to 31, wherein the first positively charged monomer is dimethylaminoethyl methacrylate.

33. The polymer shell comprises two different positively charged monomers, the first positively charged monomer having formula (IA), where R 1 is C 1 ~C 6 alkyl group, m is 2, and R 3 and R 4 are each independently C 1 ~C 6 30. The polymer nanoparticles of claim 29, wherein the polymer nanoparticles are alkyl groups. Pussel.

34. 34. The polymeric nanocapsule of claim 33, wherein the second positively charged monomer is N-(3-aminopropyl) methacrylamide or a salt thereof.

35. The polymer shell comprises two different positively charged monomers, the second positively charged monomer having formula (IB), where R 1 is C 1 ~C 6 alkyl group, m is 3, and R 3 and R 4 are each independently C 1 ~C 6 30. The polymer nanocapsule of claim 29, wherein the group is an alkyl group.

36. 36. The polymeric nanocapsule of claim 35, wherein the first positively charged monomer is dimethylaminoethyl methacrylate.

37. 1. A polymeric nanocapsule comprising a polymeric shell and a ribonucleoprotein complex, the polymeric shell comprising: (i) N-(3-((4-((3-aminopropyl)amino)butyl)amino)propyl)acrylamide or dimethylaminoethyl methacrylate; (ii) acrylamide or a derivative thereof; (iii) a crosslinker; and (iv) an additional positively charged monomer wherein the polymer shell does not comprise a monomer or crosslinker containing an imidazole group; The additional positively charged monomers have the formulas (IA) and (IB): 【Chemistry 9】 (In the formula, R 1 is H or substituted or unsubstituted C 1 ~C 6 is an alkyl group; R 2 is -(CH 2 ) m -NR 3 R 4 R 5 wherein m is an integer from 1 to 5; R 3 is H, unsubstituted C 1 ~C 6 Alkyl group or NR 6 R 7 C substituted with 1 ~C 6 Alkyl is a group, and R 6 and R 7 are independently H or unsubstituted C 1 ~C 6 C substituted with alkyl group or amino group 1 ~C 6 Alkyl group or NR 8 R 9 C substituted with 1 ~C 6 alkyl, and R 8 and R 9 are independently H, unsubstituted C 1 ~C 6 C substituted with alkyl group or amino group 1 ~C 6 alkyl groups; R 4 is H, unsubstituted C 1 ~C 6 C substituted with alkyl group or amino group 1 ~C 6 Alkyl group or NR 10 R 11 C substituted with 1 ~C 6 alkyl, and R 10 and R 11 are independently H, unsubstituted C 1 ~C 6 C substituted with alkyl group, amino 1 ~C 6 Alkyl group or NR 12 R 13 C substituted with 1 ~C 6 alkyl groups, R 12 and R 13 are independently H, unsubstituted C 1 ~C 6 C substituted with alkyl group or amino group 1 ~C 6 alkyl groups; or R 3 and R 4 may be taken together to form a 5- to 7-membered heterocycloalkyl ring; R 5 is a lone pair of electrons or a non-substituted C 1 ~C 6 alkyl group) and the additional positively charged monomer is not N-(3-((4-((3-aminopropyl)amino)butyl)amino)propyl)acrylamide or dimethylaminoethyl methacrylate; The crosslinker has the formula (IE): 【Chemistry 10】 (In the formula, R 14 and R 15 are independently H or substituted or unsubstituted C 1 ~C 6 is an alkyl group; W is -N(H)-R 16 -N(H)- or -[O-CH 2 -C(H)(OH)-CH 2 ] n -O-, and R 16 is a substituted or unsubstituted C 1 ~C 6 alkylene) The polymer nanocapsules having the following structure:

Citation Information

Patent Citations

  • Single protein nanocapsules for long-lasting protein delivery

    JP2012519733A

  • Novel RNAi molecular delivery platform based on single siRNA and shRNA nanocapsules

    JP2015510896A

  • Methods and compositions for treatment of genetic conditions

    JP2016521975A

  • Methods, compositions, and systems for delivering therapeutic and diagnostic agents to cells

    JP2018509387A

  • Non-viral, non-cationic nanoparticles and uses thereof

    WO2018170414A1