Enzyme-virus drug composition and its use
A pharmaceutical composition using immunoglobulin-degrading enzymes addresses the challenge of neutralizing antibodies in oncolytic virus therapies and viral vaccines, enabling safe intravenous administration and improved therapeutic outcomes.
Patent Information
- Application Number
- JP2022574838
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2020-06-05
- Filing Date
- 2021-06-04
- Publication Date
- 2026-01-08
- Estimated Expiration
- 2041-06-04
AI Technical Summary
Current oncolytic virus therapies face challenges due to pre-existing neutralizing antibodies, which inhibit intravenous administration and limit the effectiveness of viral vector vaccines, necessitating a solution to safely degrade IgG and neutralize antibodies to enhance therapeutic efficacy.
A pharmaceutical composition comprising an immunoglobulin-degrading enzyme or endoglycosidase, such as Streptococcus pyogenes IgG cysteine protease or human-derived MMP protease, is used to cleave IgG and reduce antibody interference, paired with oncolytic viruses or viral vaccines, allowing for intravenous administration.
The composition effectively reduces neutralizing antibodies, enabling safe and effective intravenous delivery of oncolytic viruses and viral vaccines by pre-clearing antibodies, thereby enhancing treatment efficacy.
Smart Images

Figure 0007795790000006 
Figure 0007795790000007 
Figure 0007795790000008
Abstract
Description
[Technical Field]
[0001] The present invention relates to the field of biomedicine, specifically to a pharmaceutical composition of an enzyme and a virus and its use. [Background technology]
[0002] Viruses, such as oncolytic viruses, viral vaccines, and gene therapy viruses, are currently commonly used therapeutic vectors. Viruses such as HSV-1 and adenovirus are commonly used. The main problem with using these viruses for treatment is that most people have been infected with them, they are immunogenic, and neutralizing antibodies are widely present in the population. The prevalence of pre-existing neutralizing antibodies against HSV-1 is considerable. These neutralizing antibodies block the virus's function, which is one of the major limitations of viral vector therapy. In addition, after a single dose of viral vector therapy, the neutralizing antibody titer increases, and re-administration is not possible within one year, which is another major limitation of viral vector therapy. Currently, immunosuppressants are mainly used to solve this problem, but the therapeutic effect of this method is poor.
[0003] Oncolytic viruses are viruses that preferentially infect and kill tumor cells. Initially, some tumor cells are specifically infected and destroyed by the oncolytic virus. The oncolytic virus then replicates and grows within the tumor cells, releasing new infectious virus particles to infect and destroy other tumor cells. Oncolytic viruses exert their oncolytic effect by either directly lysing tumor cells or by stimulating the host to generate an anti-tumor immune response.
[0004] Oncolytic viruses can be administered via two routes: intratumoral injection and intravenous injection. Intratumoral injection is currently the primary route of administration due to its low risk of drug resistance, its ability to induce immune responses in the tumor microenvironment, and its low risk of cytokine storms. However, the effectiveness of intratumoral injection is limited for advanced tumors that have metastasized throughout the body, and intratumoral injection is unable to eliminate metastatic tumors. Therefore, research and development into intravenous injection of oncolytic viruses has become more prevalent than research into intratumoral injection. However, issues such as the presence of neutralizing antibodies and the safety of systemic injections remain major obstacles to the current use of intravenous injection of oncolytic viruses (Russell, S., Peng, K. & Bell, J. Oncolytic virotherapy. Nat Biotechnol 30, 658-670, 2012. https: / / doi.org / 10.1038 / nbt.2287). Therefore, there is a need for therapeutic agents that alleviate or eliminate the inhibition of intravenous injection of oncolytic viruses.
[0005] Pre-existing neutralizing antibodies in the human body are also one of the factors that hinder treatment with viral vector vaccines. Chen Wei pointed out in a clinical trial paper on the adenovirus-vectored COVID-19 vaccine Ad5-nCoV that pre-existing Ad5 immunity can slow down the rapid immune response to SARS-CoV-2 and reduce the peak level of the response. Furthermore, high levels of Ad5 immunity may also have a negative impact on the durability of vaccine-induced immune responses (Zhu Feng-Cai, Li Yu-Hua, Guan Xu-Hua et al. Safety, tolerability, and immunogenicity of a recombinant adenovirus type-5 vectored COVID-19 vaccine: a dose-escalation, open-label, non-randomized, first-in-human trial. [J]. Lancet, 2 020.) Therefore, there is a need for an enzyme that can safely and effectively degrade IgG and enzymatically cleave IgG in the serum of Ad5-nCoV vaccine-treated subjects.
[0006] WO2020102740A2 discloses a gene therapy method that employs IdeS or EndoS to enzymatically cleave IgG or sugar chains contained in IgG in the serum of a subject receiving AAV therapy. However, in the fields of oncolytic viruses and viral vaccines, there is an urgent need for enzymes that can effectively degrade the Fc portion of antibodies or sugar chains contained in IgG. Summary of the Invention
[0007] In response to the shortcomings of the prior art, the present invention provides a pharmaceutical composition and its use, which comprises an agent containing an immunoglobulin-degrading enzyme or endoglycosidase that reduces the interference of blood IgG with viral therapy, and a viral vector drug containing an oncolytic virus and a viral vaccine. For oncolytic viruses, the main obstacle to intravenous administration of oncolytic viruses is eliminated by pre-clearing neutralizing antibodies associated with the viral vector drug in the human body and / or by removing neutralizing antibodies that arise after viral vector administration. For viral vaccines, the neutralizing antibodies associated with the viral vector drug are pre-cleared, eliminating the effects of neutralizing antibodies.
[0008] Specifically, the present invention relates to the following items. [1] 1) a reagent that contains an immunoglobulin-degrading enzyme or an endoglycosidase and reduces binding of endogenous serum antibodies to Fc receptors; 2) a viral vector drug selected from an oncolytic virus and a viral vaccine; A pharmaceutical composition characterized in that the viral vector drug and the reagent can be administered separately.
[0009] [2] The pharmaceutical composition according to item [1], wherein the immunoglobulin-degrading enzyme is an IgG-degrading enzyme selected from Streptococcus pyogenes IgG cysteine protease or a mutant or fragment thereof, or human-derived MMP protease or a mutant or fragment thereof, wherein the mutant or fragment maintains the activity of enzymatically cleaving IgG, and preferably the IgG-degrading enzyme is selected from IdeS, MAC2, IdeZ, IdeZ2, IdeE, IdeE2, IdeP, and MMP.
[0010] [3] The pharmaceutical composition according to item [1], wherein the endoglycosidase is an IgG endoglycosidase selected from IgG endoglycosidases of Streptococcus, Corynebacterium pseudotuberculosis, Corynebacterium faecalis, or Elizabethkingiameningoseptica, or a mutant or fragment thereof, wherein the mutant or fragment maintains the activity of the IgG endoglycosidase; the Streptococcus is, for example, Streptococcus pyogenes, Streptococcus equi, or Streptococcus zooepidemicus; and preferably, the IgG endoglycosidase is EndoS, CP40, EndoE, or EndoF2.
[0011] [4] The pharmaceutical composition according to item [2], wherein the IgG-degrading enzyme comprises an amino acid sequence represented by SEQ ID NO: 1 to 41, or a protein consisting of the amino acid sequence.
[0012] [5] The pharmaceutical composition according to item [3], wherein the IgG endoglycosidase comprises an amino acid sequence represented by SEQ ID NO: 42 to 45, or a protein consisting of the amino acid sequence.
[0013] [6] The drug composition according to item [1], wherein the virus used in the viral vector drug is selected from ssDNA viruses, dsDNA viruses, ssRNA viruses, or dsRNA viruses, and / or the virus used in the viral vector drug is selected from wild-type virus strains or naturally attenuated strains, genetically engineered selectively attenuated strains, gene-carrying virus strains, and gene transcription-targeted virus strains.
[0014] [7] The pharmaceutical composition according to item [6], wherein the wild-type virus strain or naturally attenuated virus strain is selected from Newcastle disease virus, reovirus, mumps virus, West Nile virus, adenovirus, vaccinia virus, etc.
[0015] [8] The pharmaceutical composition according to item [6], characterized in that the genetically engineered selectively attenuated strain has key genes artificially deleted to achieve tumor selectivity of viral replication, and the genetically engineered selectively attenuated strain is, for example, ONYX-015 or G207.
[0016] [9] The pharmaceutical composition described in item [6], wherein the gene-carrying virus strain is carrying a foreign gene, such as granulocyte-macrophage colony-stimulating factor (GM-CSF), and the gene-carrying virus strain is, for example, JX-594 or T-VEC.
[0017]
[10] The drug composition according to item [6], characterized in that the gene transcription-targeted virus strain controls the replication of the oncolytic virus in tumor cells by inserting a tissue- or tumor-specific promoter before an essential viral gene, and the gene transcription-targeted virus strain is, for example, G92A.
[0018]
[11] The pharmaceutical composition according to item [6], wherein the ssDNA virus is selected from parvoviruses, and the parvovirus is, for example, H-1PV virus.
[0019]
[12] The dsDNA virus is selected from herpes simplex virus, adenovirus, and poxvirus. Preferably, the adenovirus is selected from Enadenotucirev, DNX-2401, C-REV, NG-348, ProsAtak, CG0070, ADV-TK, EDS01, KH901, H101, H103, VCN-01, and Telomelysin (OBP-301). The herpes simplex virus is preferably type I herpes simplex virus HSV-1. The herpes simplex virus is selected from R3616, T-VEC, HF10, G207, NV1020, and OrienX010. The poxvirus is selected from Pexa-Vec (vaccinia virus), JX-594 (vaccinia virus), and Item [6]. The pharmaceutical composition according to item [6], characterized in that the compound is selected from the group consisting of GL-ONC1, Myxoma, and GL-ONC2.
[0020]
[13] The ssRNA virus is selected from Picornavirus, alphavirus, Retroviruses, Paramyxoviruses, and Rhabdoviruses. Preferably, the Picornavirus is selected from CAVATAK, PVS-RIPO, CVA21 (enterovirus), and RIGVIR. The alphavirus is selected from M1, Sindbis AR339, and Semliki Forest virus. The Retrovirus is selected from Toca511. The Paramyxovirus is selected from MV-NIS and PV701 (Newcastle disease virus). The Rhabdovirus is preferably selected from The pharmaceutical composition according to item [6], wherein ses is selected from VSV-IFNβ, MG1-MAGEA3, and VSV-GP.
[0021]
[14] The pharmaceutical composition according to item [6], wherein the dsRNA virus is selected from Reoviruses, preferably Reoviruses are selected from Pelareorp, Reovirus (Reolysin), vaccinia virus, mumps virus, and human immunodeficiency virus (HIV).
[0022]
[15] The pharmaceutical composition according to item [6], wherein the ssRNA virus is selected from the group consisting of reovirus, coxsackievirus, poliovirus, Seneca Valley virus, measles virus, Newcastle disease virus, vesicular stomatitis virus (VSV), and influenza virus.
[0023]
[16] The pharmaceutical composition according to item [1], wherein the oncolytic virus expresses a foreign gene, and the foreign gene is selected from the group consisting of bispecific T cell engagers (BiTEs), GM-CSF, interleukin-2 (IL-2), interleukin-12 (IL-12), interferon (IFN), tumor necrosis factor (TNF), soluble CD80, and CCL3.
[0024]
[17] The pharmaceutical composition according to any one of items [1] to
[16] , further comprising a targeted drug, a chemotherapeutic drug, or an immune checkpoint blocker, wherein the targeted drug is selected from an epigenetic drug, an inhibitor targeting the PI3K / Akt / mTOR signaling pathway, and a tyrosine kinase inhibitor, the chemotherapeutic drug is selected from an immunosuppressant and a proteasome inhibitor, the immune checkpoint blocker is selected from an anti-CTLA-4 antibody, an anti-PD-1 antibody, and an anti-TIM-3 antibody, the epigenetic drug is, for example, a histone deacetylase inhibitor, the inhibitor targeting the PI3K / Akt / mTOR signaling pathway is, for example, Tricibine, the tyrosine kinase inhibitor is, for example, sunitinib, and the immunosuppressant is, for example, cyclophosphamide, gemcitabine, temozolomide, mitoxantrone, or bortezomib.
[0025]
[18] Use of the drug composition according to any one of items [1] to
[17] in the manufacture of a drug for treating or preventing a disease, The reagent is administered to the subject by intravenous infusion or subcutaneous injection, and / or the amount of the reagent administered is 0.01 mg / kg to 2 mg / kg body weight, 0.04 to 2 mg / kg body weight, 0.12 mg / kg to 2 mg / kg body weight, 0.24 mg / kg to 2 mg / kg body weight, or 1 mg / kg to 2 mg / kg body weight, and preferably, the disease is cancer, a viral infection, a bacterial infection, or a fungal infection.
[0026]
[19] The administration time interval between the reagent and the viral vector drug is at least 30 minutes, at least 1 hour, at least 2 hours, at least 3 hours, at least 4 hours, at least 4 hours, at least 5 hours, or at least 6 hours, and is up to 35 days, up to 28 days, up to 21 days, up to 18 days, up to 14 days, up to 13 days, up to 12 days, up to 11 days, up to 10 days, up to 9 days, up to 8 days, up to 7 days, up to 6 days, up to 5 days, up to 4 days, up to 3 days, up to 2 days, up to 24 hours, up to 18 hours, up to 12 hours, up to 10 hours, up to 8 hours, up to 7 hours, or up to 6 hours, as described in
[18] . Use of.
[0027]
[20] The use according to
[18] , wherein the time interval between administration of the reagent and the viral vector drug is 30 minutes to 1 hour, 30 minutes to 2 hours, 30 minutes to 3 hours, 30 minutes to 4 hours, 30 minutes to 5 hours, 30 minutes to 6 hours, 1 to 2 hours, 1 to 3 hours, 1 to 4 hours, 1 to 5 hours, 1 to 6 hours, 2 to 3 hours, 2 to 4 hours, 2 to 5 hours, 2 to 6 hours, 3 to 4 hours, 3 to 5 hours, 3 to 6 hours, 4 to 5 hours, 4 to 6 hours, or 5 to 6 hours.
[0028]
[21] The use according to item
[18] , wherein the reagent is administered before administration of the viral vector drug, or the reagent is administered after administration of the viral vector drug.
[0029]
[22] When the reagent is administered before the administration of the viral vector drug, the use described in
[19] , in which antibodies binding to the viral vector in the blood of the subject are quantitatively detected before administration of the reagent, after administration of the reagent and before administration of the viral vector drug, and after administration of the viral vector drug, to confirm antibody-mediated effector function.
[0030]
[23] When the reagent is administered after the administration of the viral vector drug, the use described in
[20] , in which antibodies that bind to the viral vector in the blood of the subject are quantitatively detected before administration of the viral vector drug, after administration of the viral vector drug and before administration of the reagent, and after administration of the reagent, to confirm antibody-mediated effector function.
[0031]
[24] A method for treating or preventing cancer or an infectious disease by administering the pharmaceutical composition according to any one of items [1] to
[17] to a subject, The method reduces antibodies binding to the viral vector drug by 20-50%, 50-75%, 75-90%, 90-95%, or 95% or more, and the infectious disease is preferably a viral infection, a bacterial infection, or a fungal infection.
[0032]
[25] The method according to item
[24] , wherein the viral vector drug is an oncolytic virus, and preferably the cancer is prostate cancer, breast cancer, bladder cancer, colon cancer, rectal cancer, pancreatic cancer, ovarian cancer, lung cancer, cervical cancer, endometrial cancer, renal (renal cell) cancer, esophageal cancer, thyroid cancer, lymphoma, skin cancer, melanoma, or leukemia.
[0033]
[26] The method according to
[24] , wherein the viral vector drug is a viral vaccine, and preferably the viral vaccine is used to target or treat prostate cancer, breast cancer, bladder cancer, colon cancer, rectal cancer, pancreatic cancer, ovarian cancer, lung cancer, cervical cancer, endometrial cancer, renal (renal cell) cancer, esophageal cancer, thyroid cancer, lymphoma, skin cancer, melanoma, leukemia, or a disease caused by coronavirus, novel coronavirus.
[0034]
[27] The method according to any one of
[24] to
[26] , wherein the components of the drug composition are administered singly.
[0035]
[28] The method according to any one of
[24] to
[26] , wherein the components of the drug composition are administered simultaneously. [Brief explanation of the drawings]
[0036] [Figure 1] FIG. 1 shows an electrophoresis diagram of IdeS and IdeE expression, in which 1 is a molecular weight marker, 2 is before induction, 3 is IdeS, and 4 is IdeE. [Figure 2] 2 and 3 show electrophoresis images of in vitro enzyme-cleaved IgG1 by IdeS and IdeE, respectively. In the figures, the arrows on the right indicate various cleavage products derived from IgG. Arrow 1: intact IgG1, arrow 2: scIgG1 (single-cleaved IgG1- generated by the first cleavage of the IgG heavy chain), and arrow 3: F(ab')2 fragment (generated by the second cleavage of the IgG heavy chain). [Figure 3] 2 and 3 show electrophoresis images of in vitro enzyme-cleaved IgG1 by IdeS and IdeE, respectively. In the figures, the arrows on the right indicate various cleavage products derived from IgG. Arrow 1: intact IgG1, arrow 2: scIgG1 (single-cleaved IgG1- generated by the first cleavage of the IgG heavy chain), and arrow 3: F(ab')2 fragment (generated by the second cleavage of the IgG heavy chain). [Figure 4] Figures 4 and 5 are electrophoretic diagrams showing the enzymatic cleavage of IVIg in vitro by IdeS and IdeE, respectively. [Figure 5] Figures 4 and 5 are electrophoretic diagrams showing the enzymatic cleavage of IVIg in vitro by IdeS and IdeE, respectively. [Figure 6] Figure 6 shows the virus infection status of mice in different groups. [Figure 7] FIG. 7: Detection of neutralizing antibodies in mouse serum. [Figure 8] FIG. 8 shows the growth curves of the internal tumor volume of mice in different groups. DETAILED DESCRIPTION OF THE INVENTION
[0037] The immunoglobulin-degrading enzyme provided by the present invention can effectively enzymatically cleave immunoglobulins in blood, and the human body does not produce antibodies against this enzyme, making it safe to use.
[0038] I. Drug Compositions In a first aspect, there is provided a pharmaceutical composition comprising: 1) a reagent containing an immunoglobulin-degrading enzyme or endoglycosidase that reduces the binding of endogenous serum antibodies to Fc receptors; and 2) a viral vector drug selected from an oncolytic virus and a viral vaccine, wherein the antibody and the reagent can be administered separately. Preferably, the pharmaceutical composition comprises therapeutically effective amounts of the immunoglobulin-degrading enzyme and the viral vector drug. Preferably, the pharmaceutical composition is a pharmaceutical composition and further comprises a pharmaceutically acceptable vector or diluent.
[0039] 1.1 Immunoglobulin-degrading enzymes or endoglycosidases Preferably, in the pharmaceutical composition, the immunoglobulin-degrading enzyme is an IgG-degrading enzyme selected from Streptococcus pyogenes IgG cysteine protease or a mutant or fragment thereof, or human-derived MMP protease or a mutant or fragment thereof, wherein the mutant or fragment maintains the activity of enzymatically cleaving IgG, and preferably, the IgG-degrading enzyme is selected from IdeS, MAC2, IdeZ, IdeZ2, IdeE, IdeE2, IdeP, and MMP.
[0040] Preferably, in the pharmaceutical composition, the endoglycosidase is an IgG endoglycosidase, and the IgG endoglycosidase is selected from IgG endoglycosidases of Streptococcus, Corynebacterium pseudotuberculosis, Corynebacterium faecalis, or Elizabethkingiameningoseptica, or variants or fragments thereof, wherein the variants or fragments maintain the activity of the IgG endoglycosidase, and the Streptococcus is, for example, Streptococcus pyogenes, Streptococcus equi, or Streptococcus zooepidemicus, and preferably, the IgG endoglycosidase is EndoS, CP40, EndoE, or EndoF2.
[0041] Preferably, the IgG-degrading enzyme comprises the amino acid sequence of SEQ ID NOs: 1 to 41 or a variant thereof having the same function, or a protein consisting of the amino acid sequence or a fragment thereof. In one embodiment, the IgG-degrading enzyme comprises the amino acid sequence of SEQ ID NOs: 1 to 41, and is The present invention may further include variants thereof having at least 50% identity with SEQ ID NOs: 1 to 41 and having the IgG-degrading enzyme activity of 1) and 2), or fragments thereof having the IgG-degrading enzyme activity of 1) and 2). Among them, SEQ ID NOs: 7 to 41 are IgG-degrading enzyme mutants described in CN107532156A and CN107532158A.
[0042] Preferably, the IgG endoglycosidase comprises the amino acid sequence of SEQ ID NOs: 42 to 45, or a variant thereof having the same function, or a protein consisting of the amino acid sequence. In one embodiment, the IgG endoglycosidase comprises 1) the amino acid sequence of SEQ ID NOs: 42 to 45, 2) a variant thereof which has at least 50% identity with the amino acid sequence of SEQ ID NOs: 42 to 45 and has IgG endoglycosidase activity, or a fragment of 1) and 2) having the IgG endoglycosidase activity.
[0043] In a fourth aspect of the present invention, there is provided a composition, particularly a drug composition, comprising the mutant or protein and a therapeutic agent, the therapeutic agent being a therapeutic agent that generates or is likely to generate anti-drug antibodies in vivo after any administration, including, but not limited to, antibody drugs, fusion proteins, small molecule drugs, nucleic acid drugs, antibody-drug conjugates, or viral vector drugs, and the drug composition further comprises a pharmaceutically acceptable vector or excipient.
[0044] 1.2 Viral vector drugs Preferably, in the viral vector drug of the drug composition, the virus used in the viral vector drug is selected from ssDNA viruses, dsDNA viruses, ssRNA viruses, or dsRNA viruses, and / or the virus used in the viral vector drug is selected from wild-type virus strains or naturally attenuated strains, genetically engineered selectively attenuated strains, gene-carrying virus strains, and gene transcription-targeted virus strains.
[0045] Preferably, the wild-type virus strain or naturally attenuated strain is selected from Newcastle disease virus, reovirus, mumps virus, West Nile virus, adenovirus, vaccinia virus, and the like.
[0046] Preferably, the genetically engineered selectively attenuated strain has a key gene artificially deleted to achieve tumor selectivity of viral replication, such as herpes simplex virus I (HSV-1) engineered with a thymidine kinase (TK) knockout gene. Examples of the genetically engineered selectively attenuated strain include ONYX-015 and G207. ONYX-015 has an 827-bp deletion in the E1b region and a point mutation in the gene encoding the E1B55K protein, which terminates the gene expression prematurely and prevents the expression of the E1B55K protein. G207 has a deletion of the γ34.5 gene, which is a neurovirulence determinant of HSV-1.
[0047] Preferably, the gene-carrying virus strain is carrying a foreign gene, for example, granulocyte-macrophage colony-stimulating factor (GM-CSF), and the gene-carrying virus strain is, for example, JX-594 or T-VEC.
[0048] Preferably, the gene transcription-targeted virus strain controls the replication of the oncolytic virus in tumor cells by inserting a tissue- or tumor-specific promoter before an essential viral gene, and the gene transcription-targeted virus strain is, for example, G92A.
[0049] Preferably, in the pharmaceutical composition, the ssDNA virus is selected from parvoviruses, and preferably, the parvovirus is H-1PV virus. It is virus.
[0050] Preferably, the dsDNA virus is selected from herpes simplex virus, adenovirus, and poxvirus. More preferably, the herpes simplex virus is type I herpes simplex virus HSV-1, such as R3616, T-VEC, HF10, G207, NV1020, and OrienX010. The poxvirus is selected from Pexa-Vec (vaccinia virus), JX-594 (vaccinia virus), GL-ONC1, and Myxoma. The adenovirus is selected from Enadenotucirev, DNX-2401, C-REV, NG-348, ProsAtak, CG0070, ADV-TK, EDS01, KH901, H101, H103, VCN-01, and Telomelysin (OBP-301).
[0051] Preferably, the ssRNA virus is selected from picornaviruses, alphaviruses, retroviruses, paramyxoviruses, and rhabdoviruses. Preferably, the picornavirus is selected from CAVATAK, PVS-RIPO, CVA21 (enterovirus), and RIGVIR, and the alphavirus is selected from M1, Sindbis AR339, and Semliki. The Retroviruses are selected from Toca511, the Paramyxoviruses are selected from MV-NIS and PV701 (Newcastle disease virus), and the Rhabdoviruses are selected from VSV-IFNβ, MG1-MAGEA3, and VSV-GP.
[0052] Preferably, the dsRNA virus is selected from Reoviruses, and preferably, the Reoviruses are selected from Pelareorep, Reolysin, vaccinia virus, mumps virus, and human immunodeficiency virus (HIV), and preferably, the RNA virus is selected from reovirus, coxsackievirus, poliovirus, Seneca Valley virus, measles virus, Newcastle disease virus, vesicular stomatitis virus, and influenza virus.
[0053] Preferably, in the pharmaceutical composition, the oncolytic virus expresses a foreign gene, which is preferably a bispecific T cell engager (BiTE), an scFv fragment, a cytokine, or a chemokine. The BiTE can bind to a molecule that activates T cells, such as CD3, and simultaneously bind to an antigen target on the surface of cancer cells. The scFv targets an immune checkpoint, including CTLA-4, PD-1, TIM-3, LAG3, Siglec15, 4-1BB, GITR, OX40, CD40L, CD28, TIGIT, and VISTA. Examples of the cytokine or chemokine include GM-CSF, interleukin-2 (IL-2), interleukin-12 (IL-12), interferon (IFN), tumor necrosis factor (TNF), soluble CD80, and CCL3.
[0054] 1.3 Drug Targets Preferably, in the drug composition, the target of the drug may be a cell surface protein, such as AFP, αv integrin, α4β7 integrin, BCMA, CD2, CD3, CD19, CD20, CD22, CD25, CD30, CD32, CD33, CD36, CD40, CD46, CD52, CD56, CD64, CD70, CD74, CD79, CD80, CD86, CD105, CD121, CD123, C D133, CD138, CD174, CD205, CD227, CD326, CD340, CEA, c-Met, Cripto, CA1X, Claudin18.2, ED-B, EGFR, EpCAM, EphA2, EphB2, FAP, FOLR1, GD2, Globo Examples of such proteins include, but are not limited to, H, GPC3, GPNMB, HER-1, HER-2, HER-3, MAGE-A3, Mesothelin, MUC16, GPNMB, PSMA, TMEFF2, TAG-72, 5T4, ROR-1, Sca-1, SP, VEGF, and WT1.
[0055] The target of the antibody drug may be a cytokine, including, but not limited to, interleukins IL-1 to IL-13, tumor necrosis factors α and β, interferons α, β and γ, transforming growth factor β (TGF-β), colony-stimulating factors (CSFs), or granulocyte-monocyte colony-stimulating factor (GM-CSF). See Human Cytokines: Handbook for Basic & Clinical Research (Aggrawal et al., Blackwell Scientific, Boston, MA 1991).
[0056] The targets of the antibody drugs may be hormones, enzymes, intracellular messengers and intercellular messengers, such as adenylate cyclase, guanylate cyclase or phospholipase C.
[0057] The target of the antibody drug may be an immune checkpoint, including CTLA-4, PD-1, PD-L1, TIM-3, LAG3, Siglec15, 4-1BB, GITR, OX40, CD40L, CD28, TIGIT, and VISTA.
[0058] 1.4 Other drugs Preferably, in any of the above-mentioned pharmaceutical compositions, the pharmaceutical composition further comprises a targeted drug, a chemotherapeutic drug, or an immune checkpoint blocker, wherein the targeted drug is selected from epigenetic drugs, inhibitors targeting the PI3K / Akt / mTOR signaling pathway, and tyrosine kinase inhibitors, the chemotherapeutic drug is selected from immunosuppressants, proteasome inhibitors, cytotoxic drugs, and cell cycle non-specific drugs, and the immune checkpoint blocker is selected from anti-CTLA-4 antibody, anti-PD-1 antibody, anti-TIM-3 antibody, anti-LAG3 antibody, anti-Siglec15 antibody, anti-4-1BB antibody, anti-GITR antibody, anti-OX40 antibody, anti-CD40L antibody. , anti-CD28 antibody, anti-TIGIT antibody, anti-VISTA antibody, the epigenetic drug is, for example, a histone deacetylase inhibitor, the inhibitor targeting the PI3K / Akt / mTOR signaling pathway is, for example, Tricibine, the tyrosine kinase inhibitor is, for example, sunitinib, the immunosuppressant is, for example, cyclophosphamide, the proteasome inhibitor is, for example, bortezomib, the immunosuppressant is, for example, thalidomide or pomalidomide, the cytotoxic drug is, for example, gemcitabine or temozolomide, and the cell cycle non-specific drug is, for example, mitoxantrone.
[0059] II. Uses of the Drug Composition The present invention further provides a use of any of the pharmaceutical compositions described above for the manufacture of a drug for treating or preventing a disease. Preferably, the disease is cancer or an infectious disease. The infectious disease includes a viral infection, a bacterial infection, or a fungal infection.
[0060] 2.1 Cancer The cancers include acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical carcinoma, AIDS-related cancer, AIDS-related lymphoma, anal cancer, appendix cancer, childhood cerebellar or cerebral astrocytoma, basal cell carcinoma, extrahepatic bile duct cancer, bladder cancer, bone cancer, osteosarcoma / malignant fibrous histiocytoma, brain stem glioma, brain cancer, brain tumor, childhood astrocytoma, brain tumor, cerebral astrocytoma / malignant glioma, brain tumor, ependymal cell tumor, brain tumor, medulloblastoma, brain tumor, supratentorial primitive neuroectodermal tumor, brain tumor, visual pathway and hypothalamic glioma, breast cancer, bronchial adenoma / carcinoid, Burkitt's lymphoma, carcinoid tumor, gastrointestinal carcinoid tumor, cancer of unknown primary, central nervous system lymphoma, childhood astrocytoma, cerebral astrocytoma / malignant glioma, cervical cancer, chronic lymphocytic leukemia, chronic myeloid leukemia Chronic myeloproliferative disorders, colon cancer, cutaneous T-cell lymphoma, desmoplastic small round cell tumor, endometrial cancer, ependymoma, esophageal cancer, Ewing's sarcoma of the Ewing's sarcoma family of tumors, extracranial germ cell tumors, childhood extragonadal germ cell tumors, extrahepatic bile duct cancer, ocular cancer, intraocular melanoma, ocular cancer, retinoblastoma, gallbladder cancer, gastrointestinal (stomach) cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor (GIST), germ cell tumors: extracranial, extraglandular, or ovarian, gestational trophoblastic tumor, brainstem glioma, glioma Childhood cerebral astrocytoma, glioma, childhood visual pathway and hypothalamic, gastric carcinoid, hairy cell leukemia, head and neck cancer, heart cancer, hepatocellular (liver) cancer, Hodgkin's lymphoma, hypopharyngeal cancer, hypothalamic and visual pathway glioma, intraocular melanoma, islet cell carcinoma (pancreatic endocrine gland), Kaposi's sarcoma, kidney cancer (renal cell carcinoma), pharyngeal cancer, leukemias, acute lymphoblastic leukemia (also called acute lymphocytic leukemia), acute myeloid leukemia (also called acute myelogenous leukemia), chronic lymphoblastic leukemia (also called chronic lymphocytic leukemia), chronic myeloid leukemia (chronic myeloid leukemia),leukemia), hairy cell leukemia, lip and oral cavity cancer, liposarcoma, (primary) liver cancer, non-small cell lung cancer, small cell lung cancer, lymphomas, AIDS-related lymphoma, Burkitt lymphoma, cutaneous T-cell lymphoma, Hodgkin lymphoma, non-Hodgkin lymphoma (all lymphomas other than Hodgkin's lymphomas under the old classification), primary central nervous system lymphoma, Waldenstrom's macroglobulinemia, malignant fibrous histiocytoma / osteosarcoma of bone, medulloblastoma, melanoma, intraocular (eye) melanoma, Merkel cell Cancer, mesothelioma, adult malignant mesothelioma, metastatic squamous cell carcinoma of occult primary, oral cancer, multiple endocrine neoplasia, multiple melanoma / plasma cell neoplasia, mycosis fungoides, myelodysplastic syndrome, myelodysplastic / myeloproliferative disorders, myeloid leukemia, chronic myeloid leukemia, adult acute myelogenous leukemia, childhood acute myeloma, multiple (cancer of the bone marrow), myeloproliferative disorders, nasal cavity and paranasal sinus cancer, nasopharyngeal carcinoma, neuroblastoma, non-Hodgkin's lymphoma, non-small cell lung cancer, oral cancer, oropharyngeal cancer, osteosarcoma / malignant fibrous histiocytoma of bone, ovarian cancer, ovarian epithelial carcinoma (surface epithelial-interstitial Plasma tumors), ovarian germ cell tumors, ovarian tumors of low malignant potential, pancreatic cancer, pancreatic islet cell carcinoma, paranasal sinus and nasal cancer, parathyroid carcinoma, penile cancer, pharyngeal cancer, pheochromocytoma, pineal astrocytoma, pineal germ cell tumor, pineoblastoma and supratentorial primitive neuroectodermal tumor, pituitary adenoma, plasma cell tumor / multiple myeloma, pleuropulmonary blastoma, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell carcinoma (kidney cancer), renal pelvis and ureter, transitional cell carcinoma, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, sarcoma, Ewing's sarcoma family The cancer is selected from the group consisting of: Leigh's tumor, Kaposi's sarcoma, sarcoma, soft tissue, sarcoma, uterine, Sézary syndrome, skin cancer (non-melanoma), skin cancer (melanoma), skin tumor, Merkel cell, small cell lung cancer, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, metastatic squamous cell neck cancer of occult primary, gastric cancer, supratentorial primitive neuroectodermal tumor, cutaneous T-cell lymphoma - see mycosis fungoides and Sézary syndrome, testicular cancer, pharyngeal cancer, thymoma, thymoma and thymic carcinoma, thyroid cancer, thyroid carcinoma, transitional cell carcinoma of the renal pelvis and ureter, trophoblastic tumor, transitional cell carcinoma of the ureter and renal pelvis, urethral cancer, uterine cancer, endometrium, uterine sarcoma, vaginal cancer, visual pathway and hypothalamic glioma, vulvar cancer, Waldenstrom's macroglobulinemia, and Wilms' tumor (kidney cancer).
[0061] 2.2 Cancer or infectious diseases The cancer or infectious disease may be an animal disease or a human disease, and may be any of the following: Here's an example.
[0062] [Table 1] [Table 1-2]
[0063] III. Methods of Treatment with Pharmaceutical Compositions In the use of the present invention, the reagent and viral vector drug are present as a combined preparation that can be used simultaneously, separately or sequentially.
[0064] In some embodiments, the method comprises the steps of: 1) administering the reagent to a subject; and then 2) administering the viral vector drug to the subject. Preferably, the reagent is an immunoglobulin-degrading enzyme, and there is a time interval between administering the immunoglobulin-degrading enzyme and the viral vector drug.
[0065] In some embodiments, the method comprises the steps of: 1) administering the viral vector drug to the subject; and then 2) administering the reagent to the subject. Preferably, the reagent is an immunoglobulin-degrading enzyme, and there is a time interval between administering the immunoglobulin-degrading enzyme and the viral vector drug.
[0066] Preferably, the dose and time interval of the mutant is sufficient to reduce immunoglobulin levels in the subject to 60% of initial levels. More preferably, the dose and time interval of the reagents in combination are sufficient to reduce immunoglobulin levels in the subject to less than 50%, 40%, 30%, 20%, or 10% of initial levels in the patient. The reagents may be administered at a single time point or over a period of time.
[0067] Preferably, the mutant is administered by intravenous, intraperitoneal, intramuscular, intraarticular, intradermal or subcutaneous injection, with intravenous injection being the preferred injection route, and / or the amount of the mutant administered is 0.01 mg / kg to 2 mg / kg body weight, 0.04 to 2 mg / kg body weight, 0.12 mg / kg to 2 mg / kg body weight, 0.24 mg / kg to 2 mg / kg body weight, or 1 mg / kg to 2 mg / kg body weight.
[0068] Preferably, the time interval between administration of the mutant and the therapeutic agent is at least 30 minutes, at least 1 hour, at least 2 hours, at least 3 hours, at least 4 hours, at least 4 hours, at least 5 hours or at least 6 hours, and is up to 35 days, up to 28 days, up to 21 days, up to 18 days, up to 14 days, up to 13 days, up to 12 days, up to 11 days, up to 10 days, up to 9 days, up to 8 days, up to 7 days, up to 6 days, up to 5 days, up to 4 days, up to 3 days, up to 2 days, up to 24 hours, up to 18 hours, up to 12 hours, up to 10 hours, up to 8 hours, up to 7 hours or up to 6 hours.
[0069] Preferably, the time interval between the mutant and the therapeutic agent is 30 minutes to 1 hour, 30 minutes to 2 hours, 30 minutes to 3 hours, 30 minutes to 4 hours, 30 minutes to 5 hours, 30 minutes to 6 hours, 1 to 2 hours, 1 to 3 hours, 1 to 4 hours, 1 to 5 hours, 1 to 6 hours, 2 to 3 hours, 2 to 4 hours, 2 to 5 hours, 2 to 6 hours, 3 to 4 hours, 3 to 5 hours, 3 to 6 hours, 4 to 5 hours, 4 to 6 hours, or 5 to 6 hours.
[0070] In another embodiment, the method comprises the steps of: 1) ex vivo treating blood from the subject with the mutant, 2) returning the blood to the subject, and 3) administering the therapeutic agent to the subject.
[0071] In another embodiment, the method comprises the steps of: 1) administering the therapeutic agent to the subject, 2) treating blood from the subject ex vivo with the mutant, and 3) returning the blood to the subject.
[0072] In a preferred embodiment, the mutants and therapeutic agents are used in the prevention and / or treatment of cancer.
[0073] In a preferred embodiment, the mutants and therapeutic agents are used to prevent and / or treat viral infections.
[0074] In a preferred embodiment, the mutants and therapeutic agents are used to prevent and / or treat bacterial infections.
[0075] In a preferred embodiment, the mutants and therapeutic agents are used to prevent and / or treat fungal infections.
[0076] The present invention further provides a method for treating or preventing cancer or an infectious disease by administering the drug composition to a subject. In particular, the method reduces the viral vector-binding antibodies by 20-50%, 50-75%, 75-90%, 90-95%, 95%, or 95% or more, and in particular, the method reduces the pathogenic IgG antibodies by 20-50%, 50-75%, 75-90%, 90-95%, 95%, or 95% or more. Preferably, the drug is used in a method for treating or preventing cancer or an infectious disease. The infectious disease is preferably a viral infection, a bacterial infection, or a fungal infection. Preferably, the drug is used in a method for treating cancer.
[0077] Preferably, the therapeutic agent is a viral vector drug, and preferably, the viral vector drug is an oncolytic virus or a viral vaccine.
[0078] Preferably, the components of the pharmaceutical composition are administered alone or simultaneously with the components of the pharmaceutical composition.
[0079] IV. Product The present invention further provides a product, which comprises a reagent for reducing blood IgG levels, including an IgG-degrading enzyme and a viral vector drug, and is used as a combined preparation simultaneously, separately, or sequentially for the treatment of cancer, or the prevention of cancer and / or infectious diseases. Preferably, the combined preparation is used in a method for treating cancer.
[0080] In some embodiments, the cancer is acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical carcinoma, AIDS-related cancer, AIDS-related lymphoma, anal cancer, appendiceal cancer, childhood cerebellar or Cerebral astrocytoma, basal cell carcinoma, extrahepatic bile duct cancer, bladder cancer, bone cancer, osteosarcoma / malignant fibrous histiocytoma, brain stem glioma, brain cancer, brain tumor, childhood astrocytoma, brain tumor, cerebral astrocytoma / malignant glioma, brain tumor, ependymoma, brain tumor, medulloblastoma, brain tumor, supratentorial primitive neuroectodermal tumor, brain tumor, optic pathway and hypothalamic glioma, breast cancer, bronchial adenoma / carcinoid, Burkitt lymphoma, carcinoid tumor, gastrointestinal carcinoid tumor, cancer of unknown primary, central nervous system lymphoma, childhood astrocytoma, cerebral astrocytoma / malignant glioma, cervical cancer, chronic lymphocytic leukemia, chronic myeloid leukemia Chronic myeloproliferative disorders, colon cancer, cutaneous T-cell lymphoma, desmoplastic small round cell tumor, endometrial cancer, ependymoma, esophageal cancer, Ewing's sarcoma of the Ewing's sarcoma family of tumors, extracranial germ cell tumors, childhood extragonadal germ cell tumors, extrahepatic bile duct cancer, ocular cancer, intraocular melanoma, ocular cancer, retinoblastoma, gallbladder cancer, gastrointestinal (stomach) cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor (GIST), germ cell tumors: extracranial, extraglandular, or ovarian, gestational trophoblastic tumor, brainstem glioma, glioma Childhood cerebral astrocytoma, glioma, childhood visual pathway and hypothalamic, gastric carcinoid, hairy cell leukemia, head and neck cancer, heart cancer, hepatocellular (liver) cancer, Hodgkin's lymphoma, hypopharyngeal cancer, hypothalamic and visual pathway glioma, intraocular melanoma, islet cell carcinoma (pancreatic endocrine gland), Kaposi's sarcoma, kidney cancer (renal cell carcinoma), pharyngeal cancer, leukemias, acute lymphoblastic leukemia (also called acute lymphocytic leukemia), acute myeloid leukemia (also called acute myelogenous leukemia), chronic lymphoblastic leukemia (also called chronic lymphocytic leukemia), chronic myeloid leukemia (chronic myeloid leukemia),leukemia), hairy cell leukemia, lip and oral cavity cancer, liposarcoma, (primary) liver cancer, non-small cell lung cancer, small cell lung cancer, lymphomas, AIDS-related lymphoma, Burkitt lymphoma, cutaneous T-cell lymphoma, Hodgkin lymphoma, non-Hodgkin lymphoma (all lymphomas other than Hodgkin's lymphomas under the old classification), primary central nervous system lymphoma, Waldenstrom's macroglobulinemia, malignant fibrous histiocytoma / osteosarcoma of bone, medulloblastoma, melanoma, intraocular (eye) melanoma, Merkel cell Cancer, mesothelioma, adult malignant mesothelioma, metastatic squamous cell carcinoma of occult primary, oral cancer, multiple endocrine neoplasia, multiple melanoma / plasma cell neoplasia, mycosis fungoides, myelodysplastic syndrome, myelodysplastic / myeloproliferative disorders, myeloid leukemia, chronic myeloid leukemia, adult acute myelogenous leukemia, childhood acute myeloma, multiple (cancer of the bone marrow), myeloproliferative disorders, nasal cavity and paranasal sinus cancer, nasopharyngeal carcinoma, neuroblastoma, non-Hodgkin's lymphoma, non-small cell lung cancer, oral cancer, oropharyngeal cancer, osteosarcoma / malignant fibrous histiocytoma of bone, ovarian cancer, ovarian epithelial carcinoma (surface epithelial-interstitial Plasma tumors), ovarian germ cell tumors, ovarian tumors of low malignant potential, pancreatic cancer, pancreatic islet cell carcinoma, paranasal sinus and nasal cancer, parathyroid carcinoma, penile cancer, pharyngeal cancer, pheochromocytoma, pineal astrocytoma, pineal germ cell tumor, pineoblastoma and supratentorial primitive neuroectodermal tumor, pituitary adenoma, plasma cell tumor / multiple myeloma, pleuropulmonary blastoma, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell carcinoma (kidney cancer), renal pelvis and ureter, transitional cell carcinoma, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, sarcoma, Ewing's sarcoma family The cancer is selected from the group consisting of: Leigh's tumor, Kaposi's sarcoma, sarcoma, soft tissue, sarcoma, uterine, Sézary syndrome, skin cancer (non-melanoma), skin cancer (melanoma), skin tumor, Merkel cell, small cell lung cancer, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, metastatic squamous cell neck cancer of occult primary, gastric cancer, supratentorial primitive neuroectodermal tumor, cutaneous T-cell lymphoma - see mycosis fungoides and Sézary syndrome, testicular cancer, pharyngeal cancer, thymoma, thymoma and thymic carcinoma, thyroid cancer, thyroid carcinoma, transitional cell carcinoma of the renal pelvis and ureter, trophoblastic tumor, transitional cell carcinoma of the ureter and renal pelvis, urethral cancer, uterine cancer, endometrium, uterine sarcoma, vaginal cancer, visual pathway and hypothalamic glioma, vulvar cancer, Waldenstrom's macroglobulinemia, and Wilms' tumor (kidney cancer).
[0081] The present invention further provides a drug composition or therapeutic agent for use in a method for treating cancer or preventing cancer and / or an infectious disease, the drug composition or therapeutic agent comprising: 1) a therapeutically effective amount of a reagent containing an IgG-degrading enzyme that reduces blood IgG levels; 2) a therapeutically effective amount of a viral vector drug, preferably an oncolytic virus; and 3) a pharmaceutically acceptable vector or diluent.
[0082] The pharmaceutical composition of the present invention may be used in combination with a targeted drug, which is selected from epigenetic drugs, inhibitors targeting the PI3K / Akt / mTOR signaling pathway, and receptor tyrosine kinase inhibitors.
[0083] Histone deacetylase inhibitors (HDACi) are widely studied epigenetic drugs. HDACi can promote tumor cell differentiation and apoptosis by inhibiting tumor cell proliferation and inducing cell cycle blockade, and can also reduce the body's antiviral immune response by suppressing the interferon signaling pathway. It has been demonstrated that the histone deacetylase inhibitor HDAC6 can significantly increase the replication level of the HSV-1 oncolytic virus in glioma cells and can kill tumors synergistically with HSV-1.
[0084] The PI3K / Akt signaling pathway is an important signaling pathway that regulates cell proliferation and apoptosis under stress conditions. The Akt inhibitor Tricibine can induce apoptosis in glioma cells in synergy with the oncolytic virus MG18L, and the combined use of these two drugs to treat mouse gliomas is more effective than treatment with either drug alone. Rapamycin, an inhibitor of the mTOR signaling pathway, can kill tumor cells that are resistant to disease in synergy with adenovirus and HSV-1.
[0085] Protein tyrosine kinase (PTK) inhibitors have multiple effects, such as inhibiting tumor angiogenesis and tumor cell growth. Sunitinib is a small molecule receptor tyrosine kinase inhibitor that inhibits intracellular PTK activity, thereby enhancing the replication of VSV oncolytic viruses in tumor cells. It also inhibits the VEGFR signaling pathway and disrupts tumor angiogenesis, thereby enhancing the intratumoral infection ability of oncolytic viruses, thereby significantly enhancing the therapeutic effect of oncolytic viruses.
[0086] The pharmaceutical composition of the present invention may be used in combination with a chemotherapeutic agent. This combined use can induce immunological cell death, enhance tumor cell antigenicity or immune cell sensitivity, and suppress negative regulatory Treg cells and myeloid-derived suppressor cells (MDSCs). The chemotherapeutic agent is selected from immunosuppressants, proteasome inhibitors, cytotoxic agents, and cell cycle non-specific agents. The immunosuppressant is, for example, cyclophosphamide, the proteasome inhibitor is, for example, bortezomib, the immunosuppressant is, for example, thalidomide or pomalidomide, the cytotoxic agent is, for example, gemcitabine or temozolomide, and the cell cycle non-specific agent is, for example, mitoxantrone. Preferably, the combined use is a combination of oncolytic reovirus (RV) and bortezomib (BTZ).
[0087] The pharmaceutical composition of the present invention may be used in combination with an immune checkpoint blocker, wherein the immune checkpoint is selected from CTLA-4, PD-1, TIM-3, LAG3, Siglec15, 4-1BB, GITR, OX40, CD40L, CD28, TIGIT, and VISTA, and the immune checkpoint blocker is selected from anti-CTLA-4 antibody, anti-PD-1 antibody, anti-TIM-3 antibody, anti-LAG3 antibody, anti-Siglec15 antibody, anti-4-1BB antibody, anti-GITR antibody, anti-OX40 antibody, anti-CD40L antibody, anti-CD28 antibody, anti-TIGIT antibody, and anti-VISTA antibody.
[0088] The present invention further provides a kit or anti-VISTA antibody for preventing or treating cancer or an infectious disease, the kit comprising: 1) a therapeutically effective amount of a drug containing the mutant; and 2) a therapeutically effective amount of a therapeutic agent selected from a viral vector drug, an antibody, or a polypeptide drug capable of reducing blood IgG levels, the viral vector drug being preferably an oncolytic virus, a gene and a therapeutic agent that is a gene therapy virus. The kit may further include 3) a targeted drug, a chemotherapeutic drug, or an immune checkpoint blocker.
[0089] the targeted drug is selected from an epigenetic drug, an inhibitor targeting the PI3K / Akt / mTOR signaling pathway, and a tyrosine kinase inhibitor; the chemotherapeutic drug is selected from an immunosuppressant, a proteasome inhibitor, a cytotoxic drug, and a cell cycle non-specific drug; the immune checkpoint blocker is selected from an anti-CTLA-4 antibody, an anti-PD-1 antibody, an anti-TIM-3 antibody, an anti-LAG3 antibody, an anti-Siglec15 antibody, an anti-4-1BB antibody, an anti-GITR antibody, an anti-OX40 antibody, an anti-CD40L antibody, an anti-CD28 antibody, an anti-TIGIT antibody, and an anti-VISTA antibody; The epigenetic drug is, for example, a histone deacetylase inhibitor, the inhibitor targeting the PI3K / Akt / mTOR signaling pathway is, for example, Tricibine, the tyrosine kinase inhibitor is, for example, sunitinib, the immunosuppressant is, for example, cyclophosphamide, the proteasome inhibitor is, for example, bortezomib, the immunosuppressant is, for example, thalidomide or pomalidomide, the cytotoxic drug is, for example, gemcitabine or temozolomide, and the cell cycle non-specific drug is, for example, mitoxantrone.
[0090] The kit or pharmaceutical pack includes Pack A and Pack B, where Pack A contains a therapeutically effective amount of a drug containing an IgG-degrading enzyme to reduce blood immunoglobulin levels, and Pack B contains a therapeutically effective amount of a therapeutic agent, where the therapeutic agent is selected from a viral vector drug, an antibody, or a polypeptide drug capable of reducing blood IgG levels, and the viral vector drug is preferably an oncolytic virus. The pharmaceutical pack may further include Pack C, where Pack C contains a targeted drug, a chemotherapeutic drug, or an immune checkpoint blocker. the targeted drug is selected from an epigenetic drug, an inhibitor targeting the PI3K / Akt / mTOR signaling pathway, and a tyrosine kinase inhibitor; the chemotherapeutic drug is selected from an immunosuppressant, a proteasome inhibitor, a cytotoxic drug, and a cell cycle non-specific drug; the immune checkpoint blocker is selected from an anti-CTLA-4 antibody, an anti-PD-1 antibody, an anti-TIM-3 antibody, an anti-LAG3 antibody, an anti-Siglec15 antibody, an anti-4-1BB antibody, an anti-GITR antibody, an anti-OX40 antibody, an anti-CD40L antibody, an anti-CD28 antibody, an anti-TIGIT antibody, and an anti-VISTA antibody; The epigenetic drug is, for example, a histone deacetylase inhibitor, the inhibitor targeting the PI3K / Akt / mTOR signaling pathway is, for example, Tricibine, the tyrosine kinase inhibitor is, for example, sunitinib, the immunosuppressant is, for example, cyclophosphamide, the proteasome inhibitor is, for example, bortezomib, the immunosuppressant is, for example, thalidomide or pomalidomide, the cytotoxic drug is, for example, gemcitabine or temozolomide, and the cell cycle non-specific drug is, for example, mitoxantrone.
[0091] The kit may include a therapeutically effective amount of a drug that reduces blood immunoglobulin levels and instructions for administering the therapeutically effective amount of the therapeutic agent (e.g., dosage information, administration time interval information), where the therapeutic agent is selected from a viral vector drug, an antibody, or a polypeptide drug that can reduce blood IgG levels, and the viral vector drug is preferably an oncolytic virus.
[0092] In any aspect of the present invention, the drug that reduces blood immunoglobulin levels and the therapeutically effective amount of the therapeutic agent may be administered simultaneously, separately, or sequentially, for example, for the treatment of cancer, or the prevention and / or treatment of cancer and / or infectious diseases. The mutant or protein and viral vector drug may be provided as separate formulations or as a combined formulation.
[0093] As used herein, the term "drugs (or reagents) that reduce blood immunoglobulin levels" refers to ) preferably refers to a drug or reagent that reduces blood immunoglobulin levels to 60% or less of their original levels. Preferably, the drug or reagent reduces blood immunoglobulins to at most 60% of their original levels, at most 50% of their original levels, at most 40% of their original levels, at most 30% of their original levels, at most 20% of their original levels, at most 10% of their original levels, or at most 0% of their original levels. More preferably, the drug or reagent reduces blood immunoglobulins to at most 20% of their original levels, at most 10% of their original levels, or at most 0% of their original levels.
[0094] Viral vector drugs can be produced using well-established expression systems. Some examples of methods use mammalian cell expression systems to generate viral particles, such as HEK293 cells, to produce adenovirus-type viral vector drugs (Freedman Joshua D, Duffy Margaret R, Lei-Rossmann Janet et al., An Oncolytic Virus Expressing a T-cell Engager Simultaneously Targets Cancer and Immunosuppressive Stromal Cells. [J]. Cancer Res., 2018, 78:6852-6865.).
[0095] The drug vector may be liquid, and the drug composition may be in the form of a solution. Liquid vectors are used to prepare solutions, suspensions, emulsions, syrups, elixirs, and pressurized compositions. The active ingredient can be dissolved or suspended in a pharmaceutically acceptable liquid vector, such as water, an organic solvent, a mixture of both, or a pharmaceutically acceptable oil or fat.
[0096] Drug compositions for parenteral administration are sterile, substantially isotonic, pyrogen-free, and prepared in accordance with FDA or similar organization good manufacturing practice. Viral vector drugs can be administered as an injectable solution or suspension in a physiologically acceptable diluent containing the drug vector, which can be a sterile liquid such as water, oil, saline, glycerol, or ethanol. Additionally, auxiliary substances, such as wetting or emulsifying agents, surfactants, pH buffering substances, and the like, can be present in the composition. Other components of drug compositions are those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, and mineral oil. Glycols, such as propylene glycol or polyethylene glycol, are generally preferred liquid vectors, particularly for injectable solutions. Viral vector drugs can also be administered in the form of depot injections or implant preparations, which can be formulated to allow sustained release of the active ingredient. Typically, compositions are prepared for injection as either liquid solutions or suspensions; solid forms suitable for solution or suspension in liquid vehicles can also be prepared prior to injection.
[0097] The reagent and oncolytic virus or viral vaccine can be administered by any route. Preferably, the reagent and oncolytic virus are both administered intravenously (iv). Preferably, the reagent and viral vaccine are both administered intravenously (iv). Preferably, the reagent is administered intravenously (iv) and the viral vaccine is administered intramuscularly.
[0098] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods, devices, and materials similar or equivalent to those described herein can be used in the practice or measurement of the present invention, the preferred methods, devices, and materials are described below.
[0099] The terms "polypeptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The term "antigen" applies equally to peptide descriptions and to protein descriptions, and vice versa. The term applies to naturally occurring amino acid polymers and to amino acid polymers in which one or more amino acid residues are non-naturally encoded amino acids. As used herein, the term encompasses amino acid chains of any length, including full-length proteins (i.e., antigens) in which the amino acid residues are linked by covalent peptide bonds.
[0100] Any combination of the above preferred conditions, provided that it is in accordance with common knowledge in this field, will result in any preferred embodiment of the present invention.
[0101] All of the reagents and raw materials used in the present invention are commercially available.
[0102] The beneficial effects of the present invention are at least that by using an immunoglobulin-degrading enzyme or endoglycosidase in combination with an oncolytic virus, on the one hand, interference by oncolytic virus-neutralizing antibodies is eliminated, and on the other hand, side effects such as cytokine storm mediated by intravenous injection of oncolytic virus are eliminated, making intravenous injection of oncolytic virus no longer an obstacle to administration and enabling oncolytic virus treatment of metastatic tumors. On the other hand, by using an immunoglobulin-degrading enzyme or endoglycosidase in combination with a viral vaccine, on the other hand, interference by neutralizing antibodies against the vaccine viral vector is eliminated, and on the other hand, side effects such as cytokine storm mediated by intravenous injection of viral vaccine are eliminated, significantly improving the safety of viral vaccines. [Example]
[0103] The present invention will be further explained by the following examples, but the present invention is not limited to the scope of the above examples. In the following examples, for test methods for which specific conditions are not specified, the usual methods and conditions are selected according to the product instructions.
[0104] Example 1 Preparation of Samples The IdeS and IdeE protease nucleotide sequences were obtained by gene synthesis, and then recombined into the expression vector pET32a to construct a recombinant expression vector. The recombinant expression vector, which was verified to be correct by sequencing, was transformed into the expression bacterium BL21 E. coli to obtain positive expression bacteria containing the IdeS and IdeE protease gene sequences.
[0105] The synthetic sequence encoding IdeS is as follows (SEQ ID NO:46): GATAGCTTTAGCGCAAACCAGGAGATCCGCTATAGCGAGGTTACCCCGTATCACGTTACCAGCGTTTGGACCAAAGGCGTTACCCCGCCGGCCAACTTTACCCAGGGCGAAGACGTGTTTCATGCCCCGTATGTTGCCAATCAGGGCTGGTACGACATCACCAAAACCTTCAATGGCAAGGACGATCTGCTGTGCGGTGCCGCAACCGCCGGTAACATGCTGCACTGGTGGTTCGACCAGAATAAAGACCAGATCAAACGCTACCTGGAGGAACACCCGGAAAAACAGAAAATTAATTTCAACGGCGAACAGATGTTTGATGTGAAAGAAGCTATTGATACCAAGAACCACCAGCTGGACAGCAAGCTGTTCGAATATTTTAAGGAGAAAGCCTTCCCGTACCTGAGCACCAAACATCTGGGCGTGTTTCCGGACCATGTGATCGACATGTTCATCAACGGCTATCGCCTGAGCCTGACCAATCATGGTCCGACCCCGGTGAAAGAAGGTAGCAAAGATCCGCGCGGTGGTATCTTCGATGCCGTGTTTACACGTGGCGATCAGAGTAAGCTGCTGACCAGCCGCCATGATTTTAAAGA GAAAAATCTGAAAGAAATCAGCGATCTGATTAAGAAGGAGCTGACCGAGGGCAAAGCCCTGGGCCTGAGCCACACCTACGCCAATGTGCGCATCAACCACGTGATCAACCTGTGGGGTGCCGACTTTGATAGCAACGGCAACCTGAAGGCAATTTACGTGACCGACAGCGACAGCAATGCCAGTATTGGCATGAAAAAATACTTTGTTGGTGTGAACAGCGCCGGCAAAGTGGCAATCAGTGCCAAGGAGATCAAAGAAGATAACATCGGCGCCCAGGTTCTGGGTCTGTTTACCCTGAGCACAGGTCAGGATAGCTGGAATCAGACCAATCATCATCACCACCATCACAGTAGTGGT
[0106] The synthetic sequence encoding IdeE is as follows (SEQ ID NO:47): GATGACTATCAAAGAAACGCGACGGAGGCCTATGCTAAGGAGGTCCCTCATCAAATTACGTCCGTTTGGACTAAGGGGGTTACCCCACTGACTCCCGAGCAGTTTAGATATAATAACGAAGATGTCATCCATGCCCCATACCTTGCGCACCAGGGTTGGTACGACATAACAAAGGCTTTTGACGGCAAAGATAACCTTCTGTGTGGTGCGGCAACTGCCGGTAACATGCTTCATTGGTGGTTCGATCAAAACAAAACAGAAATTGAGGCGTACCTTAGTAAACACCCCGAAAAACAGAAGATCATCTTCAACAACCAGGAGCTTTTTGACTTAAAGGCCGCTATTGATACGAAGGATAGTCAGACGAACAGTCAATTATTTAACTATTTCAGAGACAAAGCGTTCCCAAACCTTAGCGCGCGCCAACTGGGCGTTATGCCTGACCTGGTGTTGGACATGTTCATTAACGGATATTACCTGAATGTATTTAAAACTCAATCGACTGATGTCAACCGCCCTTACCAGGACAAGGATAAACGTGGTGGCATATTTGACGCAGTATTTACACGTGGGGACCAAACGACACTTTTAACTGCGCGGCACGACCTTAAAAACAAGGGTCTGAATGATATCTCAACTATAATTAAGCAGGAACTTACTGAGGGACGCGCATTGGCTTTGTCACATACTTACGCAAACGTATCTATTTCCCATGTGATTAACTTGTGGGGGGCCGATTTTAACGCTGAGGGAAATCTGGAAGCTATCTATGTGACTGACTCCGACGCTAACGCTTCAATCGGGATGAAGAAATACTTCGTGGGAATAAACGCCCACCGCCACGTTGCGATAAGCGCCAAAAAGATAGAGGGGGAAAACATAGGCGCACAGGTATTGGGGTTGTTTACACTGTCATCGGGAAAGGATATTTGGCAAAAGCTGTCGCATCACCATCATCACCAC
[0107] Specifically, six single colonies were picked and cultured overnight at 37°C. The overnight culture was added to 5 mL of Amp+LB medium at a ratio of 1:100 and cultured at 37°C, 220 rpm for 2–3 h. One mL of the culture was used as an uninduced control, and IPTG was added to the remaining culture to a final concentration of 0.5 mM depending on the volume, and cultured at 37°C, 180 rpm for 4 h. The expression products were detected by 12% SDS-PAGE electrophoresis (Figure 1). The expressed cells were collected and disrupted using standard methods. IdeS and IdeE proteases were purified using a nickel column. Endotoxins were removed, sterilized, and filtered for further use.
[0108] Example 2 Evaluation of cleavage activity against human IgG1 The cleavage activity against human IgG1 was measured, and trastuzumab was selected as the substrate. IdeS and IdeE were diluted to 0.1 mg / mL, 0.05 mg / mL, 0.025 mg / mL, and 0.0125 mg / mL. 1 μL of each enzyme at different concentrations was taken and analyzed. The cleavage reaction was initiated by adding IdeS to 9 μl of a reaction mixture containing 1 mg / ml trastuzumab, and the reaction mixture was incubated at 37°C for 30 min. The sample was mixed with an equal volume of 2x SDS loading buffer and incubated in a water bath at 75°C for 5 min. The cleavage products were detected by SDS-PAGE. IdeS and IdeE clearly cleaved human IgG1 (Figures 2 and 3).
[0109] Example 3 In vitro cleavage of IVIg with IgG-degrading enzyme The in vitro cleavage activity of IdeE, IdeS, and IdeZ proteases against human IVIg immunoglobulin was evaluated by adding IdeE, IdeS, and IdeZ proteases and detecting the amount of intact or single-cleaved IVIg.
[0110] Five microliters of diluted IdeE, IdeS, or IdeZ (Genovis) proteases were added to 45 μl of IVIg-containing reaction mixtures to initiate the cleavage reaction. The enzyme / IVIg mass ratio was 1:200, and 1 unit of IdeZ cleaved 10 μg of IVIg. The reaction mixture was incubated at 37°C for 1 hour. The sample was mixed with an equal volume of 2x SDS loading buffer and incubated at 75°C for 5 minutes in a water bath. The cleavage products were then detected by SDS-PAGE.
[0111] Figure 4 shows the enzymatic cleavage efficiency of the three enzymes used to cleave human IVIg in vitro. Electrophoresis results showed that all three proteases could effectively cleave human IVIg.
[0112] Example 4 In vivo cleavage of IVIg by IgG-degrading enzymes Under sterile conditions, eight mice were intraperitoneally injected with human IVIg (human immunoglobulins injected intravenously), with two mice per group (two mice in parallel experiments, designated mouse numbers 1 and 2), at a dose of 1 g / kg. Twenty-four hours after the human IVIg injection, the mice were further intravenously injected with the IgG-degrading enzymes IdeS and IdeE at 5 mg / kg and IdeZ at 1,000 units / kg. One group served as a blank control (saline). Blood was collected from both mice in each group 24 hours after the IgG-degrading enzyme injection, and serum samples were analyzed by non-reducing SDS-PAGE. The results demonstrated that IdeS, IdeZ, and IdeE were effective in cleaving IVIg in vivo, achieving complete enzymatic cleavage of IVIg within 24 hours (Figure 5).
[0113] Detection of adenovirus neutralizing antibody titers 5 × 10 HEK293 cells 4 The cells were seeded at 100 cells / well in a 96-well plate and cultured at 37°C, 5% CO for approximately 7 hours. Mouse serum was collected and diluted 10-fold, then diluted two-fold to form 10 gradients, each containing Ad5-Luc virus (2 × 104 The mixture was mixed in equal volumes (TU / well) and incubated at room temperature for 1 hour. Each was diluted in three duplicate wells, and no serum or virus was added to the negative control group. After incubation, the mixture was added to a cell culture plate and incubated at 37°C, 5% CO2 for 24 hours. After incubation, Bio-Bright TM The One-Step Firefly Luciferase Assay Kit reagent was added, and the procedure was carried out according to the manufacturer's instructions to detect the chemiluminescent signal.
[0114] Detection of HSV-1 virus-neutralizing antibody titers 2 × 10 U-2 OS cells 4 The cells were seeded in a 96-well plate at 10 cells / well and cultured at 37°C, 5% CO2 for approximately 7 hours. Mouse serum was collected and diluted 10-fold, and then diluted two-fold to form 10 gradients. Each gradient was infused with HSV-1 virus (1 x 10 4 The mixture was mixed in equal volumes (PFU / well) and incubated at room temperature for 1 hour. Each was diluted in triplicate wells, and no serum or virus was added to the negative control group. After incubation, the mixture was added to the cell culture plate. The cells were cultured for 16 hours. After incubation, the cells were fixed with 1% paraformaldehyde, then added with 0.1% Triton X-100 and incubated at room temperature for 5 minutes. Then, HSV1 antibody (10 μg / ml) was added and incubated for 1 hour. Anti-mouse IgG-HRP secondary antibody (diluted 1:2000) was added and incubated for 30 minutes. TMB substrate was added and incubated for 15 minutes. After drying the well plate, data were read and analyzed using a CTL ELISPOT analyzer.
[0115] [Table 2]
[0116] Neutralizing antibody titer detection tests showed that IVIg produced neutralizing antibodies against HSV1 and Adv, and that IdeS, IdeZ, and IdeE could effectively cleave the neutralizing antibodies in mice.
[0117] Example 5: Effect of IgG-degrading enzyme on Adv5 in vivo infection C57BL / 6 mice were used to evaluate the effect of IgG-degrading enzymes on in vivo Adv5-Luc infection. Human IVIg was intraperitoneally injected into C57BL / 6 mice, with six mice per group. On day 1, human IVIg was intraperitoneally injected at a dose of 1 g / kg. 30 min after human IVIg injection, IdeS and IdeE proteases were intravenously administered at a dose of 5 mg / kg, and IdeZ was intravenously injected at a dose of 1000 units / kg. On day 0, Adv5-Luc was administered at 5 x 10 10 The mice were administered 100 mg / vg of IgG-degrading enzymes at 100 mg / vg / mouse, and mouse fluorescence was detected on days 6 and 10. The experimental design is shown in Table 2. The experimental results are shown in Figure 6. All three IgG-degrading enzymes were able to reduce the effect of IVIg on Adv5-Luc virus infection.
[0118] [Table 3]
[0119] Example 6 Mouse tumor model Using the A549 athymic nude mouse tumor model, the combined administration of IdeE and KJ-Adv5 adenovirus was compared with the administration of the KJ-Adv5 viral vector drug alone. Six- to eight-week-old female athymic mice were inoculated with A549 tumor cells (5 × 10 cells / mL) in 0.1 ml of PBS in the right lower leg region for tumor development. 6 ) was subcutaneously inoculated. The tumor size was approximately 150 mm. 3 When the mice reached 100 mg / kg / day, they were randomly divided into three groups with six mice per group. On day -1, blood was collected and then intraperitoneally injected with human IVIg. 30 minutes after the injection of human IVIg, protease was administered intravenously at a dose of 5 mg / kg. On day 0, blood was collected and used to detect neutralizing antibodies. After blood collection, 5 × 10 KJ-Adv5 was administered. 10 The mice were intravenously injected at 100 mg / vp per mouse. Tumor volumes were measured twice a week, body weights were calculated, and the mice were sacrificed on day 28. The experimental design is shown in Table 3.
[0120] [Table 4]
[0121] Detection of neutralizing antibodies: Mouse serum was collected and diluted 10-fold, then diluted 2-fold into 10 gradients, each containing Ad5-Luc adenovirus (2 × 10 4 The mixture was mixed with 1000kJ / well of 1000kcal of 1000kJ / ml, added to a 96-well plate, and incubated at room temperature for 1 hour. Each dilution was performed in duplicate wells. Negative controls were treated with no serum or virus. After incubation, 5 × 10 HEK293 cells were added. 4 The cells were added at 1000 cells / well and cultured at 37°C and 5% CO2 for 24 hours. TM One-Step Firefly Luciferase Assay Kit The drug was added, and the procedure was followed according to the manufacturer's instructions. The chemiluminescent signal was detected. Figure 7 shows that IVIg contains adenovirus-neutralizing antibodies, neutralizing antibodies that can be degraded by IdeS or IdeE.
[0122] The test results showed that both IdeS and IdeE could eliminate the negative effects of IVIg on the therapeutic efficacy of intravenous viral administration (Figure 8).
[0123] The present invention has been described in detail in the above examples, but the applicant declares that the present invention is not limited to the above detailed methods, that is, it does not mean that the present invention must be carried out only by the above detailed methods. Those skilled in the art should understand that any improvements to the present invention, equivalent substitution of each raw material of the product of the present invention, addition of auxiliary ingredients, selection of specific forms, etc., are all within the scope of protection and disclosure of the present invention.
Claims
1. 1) a reagent that includes an immunoglobulin-degrading enzyme to reduce binding of endogenous serum antibodies to Fc receptors; 2) a viral vector drug that is an oncolytic virus; the immunoglobulin-degrading enzyme comprises an amino acid sequence shown in SEQ ID NO: 4 or 5, or a protein consisting of said amino acid sequence; The oncolytic virus is adenovirus type 5 (Adv5). A combination preparation for treating lung cancer, characterized in that the viral vector drug and the reagent can be administered alone.
2. The combination formulation according to claim 1, further comprising a targeted drug, a chemotherapeutic drug, or an immune checkpoint blocker, wherein the targeted drug is selected from an epigenetic drug, an inhibitor targeting the PI3K / Akt / mTOR signaling pathway, and a tyrosine kinase inhibitor; the chemotherapeutic drug is selected from an immunosuppressant and a proteasome inhibitor; the immune checkpoint blocker is selected from an anti-CTLA-4 antibody, an anti-PD-1 antibody, and an anti-TIM-3 antibody; the epigenetic drug is, for example, a histone deacetylase inhibitor; the inhibitor targeting the PI3K / Akt / mTOR signaling pathway is, for example, Tricibine; the tyrosine kinase inhibitor is, for example, sunitinib; and the immunosuppressant is, for example, cyclophosphamide, gemcitabine, temozolomide, mitoxantrone, or bortezomib.
3. Use of the combined preparation according to claim 1 or 2 in the manufacture of a medicament for treating or preventing lung cancer, The reagent is administered to the subject by intravenous infusion or subcutaneous injection, and / or the amount of the reagent administered is 0.01 mg / kg to 2 mg / kg body weight, 0.04 to 2 mg / kg body weight, 0.12 mg / kg to 2 mg / kg body weight, 0.24 mg / kg to 2 mg / kg body weight, or 1 mg / kg to 2 mg / kg body weight.
4. The time interval between administration of the reagent and the viral vector drug is at least 30 minutes, at least 1 hour, at least 2 hours, at least 3 hours, at least 4 hours, at least 4 hours, at least 5 hours, or at least 6 hours, and is at most 35 days, at most 28 days.
4. The use according to claim 3, wherein the period is up to 21 days, up to 18 days, up to 14 days, up to 13 days, up to 12 days, up to 11 days, up to 10 days, up to 9 days, up to 8 days, up to 7 days, up to 6 days, up to 5 days, up to 4 days, up to 3 days, up to 2 days, up to 24 hours, up to 18 hours, up to 12 hours, up to 10 hours, up to 8 hours, up to 7 hours or up to 6 hours.
5. The use according to claim 4, wherein the time interval between administration of the reagent and the viral vector drug is 30 minutes to 1 hour, 30 minutes to 2 hours, 30 minutes to 3 hours, 30 minutes to 4 hours, 30 minutes to 5 hours, 30 minutes to 6 hours, 1 to 2 hours, 1 to 3 hours, 1 to 4 hours, 1 to 5 hours, 1 to 6 hours, 2 to 3 hours, 2 to 4 hours, 2 to 5 hours, 2 to 6 hours, 3 to 4 hours, 3 to 5 hours, 3 to 6 hours, 4 to 5 hours, 4 to 6 hours, or 5 to 6 hours.
6. The use according to claim 3, wherein the reagent is administered before the administration of the viral vector drug, or the reagent is administered after the administration of the viral vector drug.
7. The use described in claim 3, characterized in that when the reagent is administered before administration of the viral vector drug, antibodies that bind to the viral vector in the subject's blood are quantitatively detected before administration of the reagent, after administration of the reagent and before administration of the viral vector drug, and after administration of the viral vector drug, to confirm antibody-mediated effector function.
8. The use of claim 3, wherein when the reagent is administered after the administration of the viral vector drug, antibodies that bind to the viral vector are quantitatively detected in the blood of the subject before administration of the viral vector drug, after administration of the viral vector drug and before administration of the reagent, and after administration of the reagent, to confirm antibody-mediated effector function.
9. The use described in any one of claims 3 to 8, characterized in that the administration reduces antibody binding to the viral vector drug by 20 to 50%, 50 to 75%, 75 to 90%, 90 to 95% or more.
10. The use according to any one of claims 3 to 9, characterized in that the components of the combined preparation are administered singly.
11. The use according to any one of claims 3 to 9, characterized in that the components of the combined preparation are administered simultaneously.
Citation Information
Patent Citations
Combined therapeutic use of antibodies and endoglycosidases
CN104519911A
Combined therapeutic use of antibodies and endoglycosidases
CN108619509A
Oncolytic viral vectors and uses thereof
CN108884448A
Compositions and methods for increasing or enhancing transduction of gene therapy vectors and for removing or reducing immunoglobulins
WO2020016318A1
Compositions and methods for increasing or enhancing transduction of gene therapy vectors and for removing or reducing immunoglobulins
WO2020102740A2