Pathogen-resistant animals with modified CD163 genes

Genetic modification of the CD163 gene in animals using CRISPR/Cas9 techniques addresses the inefficacy of PRRSV vaccines by reducing viral susceptibility, enhancing resistance to PRRSV infection and associated diseases.

JP7808875B2Active Publication Date: 2026-01-30THE CURATORS OF THE UNIVERSITY OF MISSOURI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
JP2024025140
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2015-08-06
Filing Date
2024-02-22
Publication Date
2026-01-30
Estimated Expiration
2036-07-22

AI Technical Summary

Technical Problem

Current vaccines for porcine reproductive and respiratory syndrome virus (PRRSV) are ineffective due to strain variation and insufficient immune stimulation, and there are no reliable methods to identify persistently infected pigs, leading to significant economic losses in pig populations.

Method used

Genetically modify the CD163 gene in animals to inhibit PRRSV entry and replication by introducing chromosomal modifications such as deletions and insertions, using CRISPR/Cas9 or other gene editing techniques, resulting in animals with reduced susceptibility to PRRSV.

Benefits of technology

The modified animals exhibit resistance to PRRSV infection, reducing disease incidence and severity, and provide a sustainable solution to the challenges faced by existing vaccines.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007808875000020
    Figure 0007808875000020
  • Figure 0007808875000021
    Figure 0007808875000021
  • Figure 0007808875000022
    Figure 0007808875000022
Patent Text Reader

Abstract

To provide methods of increasing resistance to porcine reproductive and respiratory syndrome virus in porcine animals, progeny, or cells.SOLUTION: A method of increasing resistance to porcine reproductive and respiratory syndrome virus comprises modifying at least one chromosomal sequence of a gene encoding a CD163 protein in a porcine animal, progeny, or cell, the modification being selected from the group consisting of a modification in exon 7 of the gene encoding the CD163 protein in which the modification comprises an in-frame deletion in exon 7, a modification in exon 8 of the gene encoding the CD163 protein, a modification in the intron adjacent to the exon 7 or exon 8 of the gene encoding the CD163 protein, and combinations thereof.SELECTED DRAWING: Figure 15
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to non-human animals and their progeny containing at least one modified chromosomal sequence in the gene encoding the CD163 protein. The invention further relates to animal cells containing such modified chromosomal sequences. The animals and cells have increased resistance to pathogens, including porcine reproductive and respiratory syndrome virus (PRRSV). The animals and their progeny contain a chromosomal modification in the CD163 gene that inhibits PRRSV entry and replication, and the resulting animals exhibit resistance to diseases and syndromes caused by the virus. The invention further relates to breeding methods for producing pathogen-resistant animals and populations of animals produced using such methods. The invention also relates to methods for gene editing of CD163, including direct embryo injection, and the development of animals, founder animals, and lines that are resistant to pathogens such as PRRSV. [Background technology]

[0002] Porcine reproductive and respiratory syndrome virus (PRRSV) belongs to the group of mammalian arteriviruses (which also includes mouse lactate dehydrogenase-inducing virus, simian hemorrhagic fever virus, and equine arteritis virus). Arteriviruses share important characteristics associated with viral pathogenesis, including macrophage tropism and the ability to cause severe disease and persistent infection. A clinical disease syndrome caused by PRRSV infection was first reported in the United States in 1987 (Keffaber, 1989) and later in Europe in 1990 (Wensvoort et al., 1991). PRRSV infection results in respiratory illness, such as cough and fever, reproductive impairment during late pregnancy, and reduced growth potential. The virus also participates in various polymicrobial disease syndrome interactions while maintaining a lifelong asymptomatic infection (Rowland et al., 2012).

[0003] Since its emergence, PRRS has become the most important disease of commercial pigs in North America, Europe, and Asia; only Australia and Antarctica are disease-free. In North America alone, losses associated with PRRSV are estimated to cost producers $664 million annually (Holtkamp et al., 2013). In 2006, a more severe form of the disease, known as highly pathogenic PRRS (HP-PRRS), decimated pig populations across China. Genetic diversity has limited the development of vaccines needed to effectively control and eliminate the disease. Genetic selection for natural resistance could be an option, but results have been limited to date (Boddicker et al., 2014).

[0004] Molecular comparisons between North American and European viruses have classified all PRRSV isolates into one of two genotypes, type 2 or type 1. Although the two genotypes share only about 70% identity at the nucleotide level ( Nelsen et al., 1999 ), both share a tropism for CD163-positive cells, establish long-term infection, and produce similar clinical signs.

[0005] CD163 is a 130 kDa type 1 membrane protein consisting of nine scavenger receptor cysteine-rich (SRCR) domains (Fabriek et al., 2005). Porcine CD163 contains 17 exons encoding a peptide signal sequence, followed by the nine SRCR domains, two linker domains (also called proline-serine-threonine (PST) domains, located after SRCR6 and SRCR9), and a cytoplasmic domain, followed by a short cytoplasmic tail. CD163 surface expression is restricted to cells of the monocyte-macrophage lineage. The protein was first identified in human tissues for its ability to bind hemoglobin-haptoglobin (HbHp) complexes (Kristiansen et al., 2001). HbHp capture is the primary function of CD163, which is located in SRCR3 (Madsen et al., 2004). Metabolic products released by macrophages after HbHp degradation include bilirubin, CO, and free iron. One important function of CD163 is the prevention of oxidative toxicity caused by free hemoglobin ( Kristiansen et al., 2001 ; Soares et al., 2009 ).

[0006] CD163 was first described by Calvert et al. (2007) as a receptor for PRRSV. Transfection of nonpermissive cell lines with CD163 cDNA from various species, including monkeys, humans, dogs, and mice, can render the cells permissive to PRRSV infection (Calvert et al., 2007). In addition to CD163, a second receptor protein, CD169 (also known as sialoadhesin or SIGLEC1), was identified as the primary PRRSV receptor, involved in the initial interaction with the GP5-matrix (M) heterodimer, the main protein on the surface of the virion (Delputte et al., 2002). In this model, subsequent interaction between CD163 and the GP2, 3, 4 heterotrimer within the endosomal compartment mediates uncoating and release of the viral genome into the cytoplasm (Van Breedam et al., 2010, Allende et al., 1999). Previous models explaining PRRSV infection of alveolar macrophages identified SIGLEC1 (CD169) as the primary viral receptor on the surface of macrophages; however, SIGLEC1 - / - Previous studies using pigs showed no difference in viral replication compared to wild-type pigs (Prather et al., 2013). These results supported previous in vitro studies showing that PRRSV-resistant cell lines lacking surface CD169 and CD163 supported viral replication after transfection with a CD163 plasmid (Welch et al., 2010).

[0007] Many characteristics of both PRRSV virulence (especially at the molecular level) and epizootics are poorly understood, making control efforts difficult. Currently, producers often vaccinate pigs against PRRSV using modified-live attenuated strains or inactivated virus vaccines; however, current vaccines often do not provide satisfactory protection. This is due to both strain variation and insufficient stimulation of the immune system. In addition to concerns about the efficacy of available PRRSV vaccines, currently used modified-live vaccines can persist in individual pigs and pig herds, and there is strong evidence that mutations can accumulate, as evidenced by virulent field isolates following experimental infection of pigs (Rowland et al., Virology, 259:262-266 (1999)). Mengeling et al., Am. J. Vet. Res, 60(3): 334-340 (1999)). Furthermore, vaccine virus has been shown to be shed in the semen of vaccinated boars (Christopher-Hennings et al., Am. J. Vet. Res, 58(1): 40-45 (1997)). As an alternative to vaccination, some experts advocate a "test and eliminate" strategy in breeding herds (Dee and Molitor, Vet. Rec., 143:474-476 (1998)). Successful use of this strategy depends on the elimination of all pigs acutely or persistently infected with PRRSV, followed by strict control to prevent reintroduction of the virus. Many of the difficulties and costs associated with this strategy are due to the fact that little is known about the pathogenesis of persistent PRRSV infection and, therefore, there are no reliable techniques for identifying persistently infected pigs.

[0008] Thus, there is a need in the art for the development of strategies to induce PRRSV resistance in animals. Summary of the Invention

[0009] Non-human animals, their progeny, and animal cells are provided that contain at least one modified chromosomal sequence in the gene encoding the CD163 protein.

[0010] Also provided is a breeding method for producing animals or lines with reduced susceptibility to pathogen infection. The method includes genetically modifying oocytes or sperm cells to introduce a modified chromosomal sequence in the gene encoding CD163 protein into at least one of the oocytes and sperm cells, and fertilizing the oocyte with a sperm cell to produce a zygote containing the modified chromosomal sequence in the gene encoding CD163 protein. Alternatively, the method includes genetically modifying a zygote to introduce the modified chromosomal sequence in the gene encoding CD163 protein into the zygote. The method further includes implanting the zygote into a surrogate female animal (wherein pregnancy and full-term birth produce offspring animals), screening the offspring animals for susceptibility to pathogens, and selecting offspring animals with reduced susceptibility to pathogens compared to animals that do not contain the modified chromosomal sequence in the gene encoding CD163 protein.

[0011] Also provided are populations of animals produced by the breeding methods.

[0012] Further provided is a method for increasing the resistance of a livestock animal to pathogen infection, the method comprising genetically editing at least one chromosomal sequence from a gene encoding a CD163 protein, thereby reducing CD163 protein production or activity compared to CD163 protein production or activity in a livestock animal that does not contain the edited chromosomal sequence in the gene encoding the CD163 protein.

[0013] As provided herein, modifications of the chromosomal sequence in the gene encoding the CD163 protein reduce the susceptibility of an animal, its offspring, a cell, or a population (e.g., a porcine animal, its offspring, a cell, or a population) to a pathogen (e.g., a virus such as porcine reproductive and respiratory syndrome virus (PRRSV)).

[0014] In any of the animals, progeny, cells, populations, and methods provided herein, the altered chromosomal sequence may result in the production of a substantially non-functional CD163 protein by the animal, progeny, cell, or population.

[0015] In any of the animals, progeny, cells, populations, and methods provided herein, the modified chromosomal sequence can include an in-frame deletion in the gene encoding the CD163 protein.

[0016] In any of the porcine animals, progeny, cells, populations, and methods provided herein, the modified chromosomal sequence can comprise SEQ ID NO:118. Alternatively, modifications of the chromosomal sequence in the gene encoding the CD163 protein can include: an 11 base pair deletion from nucleotide 3,137 to nucleotide 3,147 relative to the reference sequence SEQ ID NO:47; a 2 base pair insertion between nucleotides 3,149 and 3,150 relative to the reference sequence SEQ ID NO:47, and, on the same allele, a 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 relative to the reference sequence SEQ ID NO:47; a 124 base pair deletion from nucleotide 3,024 to nucleotide 3,147 relative to the reference sequence SEQ ID NO:47; a 123 base pair deletion from nucleotide 3,024 to nucleotide 3,146 relative to the reference sequence SEQ ID NO:47; a 1 base pair insertion between nucleotide 3,147 and nucleotide 3,148 relative to the reference sequence SEQ ID NO:47; a 130 base pair deletion from nucleotide 3,030 to nucleotide 3,159 relative to reference sequence SEQ ID NO:47; a 132 base pair deletion from nucleotide 3,030 to nucleotide 3,161 relative to reference sequence SEQ ID NO:47; a 1506 base pair deletion from nucleotide 1,525 to nucleotide 3,030 relative to reference sequence SEQ ID NO:47; a 7 base pair insertion between nucleotide 3,148 and nucleotide 3,149 relative to reference sequence SEQ ID NO:47; a 1280 base pair deletion from nucleotide 2,818 to nucleotide 4,097 relative to reference sequence SEQ ID NO:47; a 1373 base pair deletion from nucleotide 2,724 to nucleotide 4,096 relative to reference sequence SEQ ID NO:47; a 1467 base pair deletion from nucleotide 2,431 to nucleotide 3,897 relative to reference sequence SEQ ID NO:47;a 1930 base pair deletion from nucleotide 488 to nucleotide 2,417 relative to reference sequence SEQ ID NO:47, where the deleted sequence is replaced with a 12 base pair insertion starting at nucleotide 488, as well as an additional 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 relative to reference sequence SEQ ID NO:47; a 28 base pair deletion from nucleotide 3,145 to nucleotide 3,172 relative to reference sequence SEQ ID NO:47; a 1387 base pair deletion from nucleotide 3,145 to nucleotide 4,531 relative to reference sequence SEQ ID NO:47; a 1382 base pair deletion from nucleotide 3,113 to nucleotide 4,494 relative to reference sequence SEQ ID NO:47, where the deleted sequence is replaced with an 11 base pair insertion starting at nucleotide 3,113; a 1,720 base pair deletion from nucleotide 2,440 to nucleotide 4,160 relative to reference sequence SEQ ID NO:47; a 452 base pair deletion from nucleotide 3,015 to nucleotide 3,466 relative to reference sequence SEQ ID NO:47; or any combination thereof.

[0017] Nucleic acids are also provided, wherein the nucleic acid molecule comprises a nucleotide sequence selected from the group consisting of: (a) a nucleotide sequence comprising SEQ ID NO:47; (b) a nucleotide sequence having at least 80% sequence identity to the sequence of SEQ ID NO:47, wherein the nucleotide sequence contains at least one substitution, insertion, or deletion relative to SEQ ID NO:47; and (c) a cDNA sequence of (a) or (b).

[0018] For example, the nucleic acid molecule can comprise: (a) a nucleotide sequence having at least 87.5% sequence identity to the sequence of SEQ ID NO:47, wherein the nucleotide sequence contains at least one substitution, insertion, or deletion relative to SEQ ID NO:47; or (b) a cDNA sequence of (a).

[0019] Additional nucleic acids are also provided. The nucleic acids can include SEQ ID NOs: 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 118, or 119.

[0020] Any of the nucleic acid molecules can be an isolated nucleic acid molecule.

[0021] Other objects and features will be in part apparent and in part pointed out hereinafter. [Brief explanation of the drawings]

[0022] [Figure 1] The targeting vector and CRISPR used to modify CD163 are shown. Panel A shows wild-type exons 7, 8, and 9 of the CD163 gene targeted for modification using CRISPR. Panel B shows a targeting vector designed to replace porcine exon 7 (porcine domain SRCR5 of CD163) with DNA encoding human SRCR8 of CD163L. This targeting vector was used in transfections with drug selection using G418. PCR primers for the long-range left and right arm assays are labeled with arrows for 1230, 3752, 8791, 7765, and 7775. Panel C shows the same targeting vector as shown in panel B, but with the Neo cassette removed. This targeting vector was used to target CD163 in cells that were already neomycin-resistant. Primers used in small deletion assays are indicated by arrows and labeled GCD163F and GCD163R. Panel D highlights the exons targeted by CRISPR. The locations of CRISPRs 10, 131, 256, and 282 are indicated by downward arrows above exon 7. CRISPR numbers represent the number of base pairs from the intron-exon junction of intron 6 and exon 7. [Figure 2]The targeting vector and CRISPR used to modify CD1D are shown. Panel A shows wild-type exons 3, 4, 5, 6, and 7 of the CD1D gene targeted for modification by CRISPR. Panel B shows the targeting vector designed to replace exon 3 with the selectable marker Neo. This targeting vector was used in combination with CRISPR to modify CD1D. PCR primers for the long-range left and right arm assays are labeled with arrows for 3991, 4363, 7373, and 12806. Panel C shows the exons targeted by CRISPR. The locations of CRISPRs 4800, 5350, 5620, and 5626 are represented by downward arrows in exon 3. Primers used in the small deletion assay are indicated by arrows and labeled GCD1DF and GCD1DR. [Figure 3]Generation of CD163 and CD1D knockout pigs using CRISPR / Cas9 and SCNT is shown. A) Targeted deletion of CD163 in somatic cells after transfection with CRISPR / Cas9 and donor DNA. The wild-type (WT) genotype yields a 6545 base pair (bp) band. Lanes 1–6 represent six distinct colonies from a single transfection with CRISPR10 and Cas9 and donor DNA containing Neo. Lanes 1, 4, and 5 show large homozygous deletions of 1500–2000 bp. Lane 2 represents a smaller homozygous deletion. Lanes 3 and 6 represent the WT allele and either a small deletion or biallelic modification of both alleles. The exact modification of each colony was determined only by sequencing the colony used for SCNT. The faint WT band in some of the lanes may represent cross-contamination of fetal fibroblasts from neighboring WT colonies. NTC = no-template control. B) Targeted deletion of CD1D in somatic cells after transfection with CRISPR / Cas9 and donor DNA. The WT genotype yields an 8729 bp band. Lanes 1-4 represent colonies with 500-2000 bp deletions of CD1D. Lane 4 appears to be a WT colony. NTC = no template control. C) Image of a CD163 knockout pig generated by SCNT during the study. This male piglet contains a homozygous 1506 bp deletion of CD163. D) Image of a CD1D pig generated during the study. These piglets contain a 1653 bp deletion of CD1D. E) Genotypes of two SCNT litters containing the 1506 bp deletion of CD163. Lanes 1-3 (litter 63) and 1-4 (litter 64) represent the genotype for each piglet from each litter. Sows indicate recipient females of SCNT embryos, and WT represents the WT control. NTC = no template control. F) Genotypes of two SCNT litters containing the 1653 bp deletion in CD1D. Lanes 1-7 (litter 158) and lanes 1-4 (litter 159) represent the genotype for each piglet. [Figure 4]The effect of the CRISPR / Cas9 system on pig embryos is shown. A) The frequency of blastocyst formation after injection of different concentrations of the CRISPR / Cas9 system into zygotes. The toxicity of the CRISPR / Cas9 system was lowest at 10 ng / μl. B) When introduced into zygotes, the CRISPR / Cas9 system can successfully disrupt the expression of eGFP in blastocysts. Original magnification: ×4. C) The types of mutations in eGFP generated using the CRISPR / Cas9 system: WT genotype (SEQ ID NO: 16), #1 (SEQ ID NO: 17), #2 (SEQ ID NO: 18), and #3 (SEQ ID NO: 19). [Figure 5] Figure 1 shows the effectiveness of the CRISPR / Cas9 system in targeting CD163 in porcine embryos. A) Examples of mutations created on CD163 by the CRISPR / Cas9 system: WT genotype (SEQ ID NO: 20), #1-1 (SEQ ID NO: 21), #1-4 (SEQ ID NO: 22), and #2-2 (SEQ ID NO: 23). All embryos examined by DNA sequencing showed mutations on CD163 (18 / 18). CRISPR131 is highlighted in bold. B) Sequence read data of homozygous deletions caused by the CRISPR / Cas9 system. The image represents #1-4 from panel A, which carries a 2-bp deletion of CD163. [Figure 6]This figure shows the effectiveness of the CRISPR / Cas9 system when two types of CRISPR were introduced. A) PCR amplification of CD163 in blastocysts injected with CRISPR / Cas9 as zygotes. Lanes 1, 3, 6, and 12 show engineered deletions between two different CRISPRs. B) PCR amplification of CD1D in blastocysts injected with CRISPR / Cas9 as zygotes. CD1D had a lower deletion frequency (3 / 23) compared to CD163 as determined by gel electrophoresis; lanes 1, 8, and 15 show clear deletions in CD1D. C) The CRISPR / Cas9 system successfully targeted two genes when the system was provided with two CRISPRs targeting CD163 and eGFP. Modifications of CD163 and eGFP are shown: CD163WT (SEQ ID NO:24), CD163#1 (SEQ ID NO:25), CD163#2 (SEQ ID NO:26), CD163#3 (SEQ ID NO:27), eGFPWT (SEQ ID NO:28), eGFP#1-1 (SEQ ID NO:29), eGFP#1-2 (SEQ ID NO:30), eGFP#2 (SEQ ID NO:31), and eGFP#3 (SEQ ID NO:32). [Figure 7]CD163 knockout pigs generated by the CRISPR / Cas9 system injected into zygotes are shown. A) PCR amplification of CD163 from knockout pigs; clear signs of deletion were detected in litters 67-2 and 67-4. B) Image of CD163 knockout pigs with surrogate mothers. All animals are healthy and show no signs of abnormalities. C) Genotype of CD163 knockout pigs. The wild-type (WT) sequence is shown as SEQ ID NO:33. Two animals (from litters 67-1 (SEQ ID NO:34) and 67-3 (SEQ ID NO:37)) carry homozygous deletions or insertions in CD163. Two other animals (from litters 67-2 and 67-4) carried biallelic modifications of CD163: #67-2A1 (SEQ ID NO: 35), #67-2A2 (SEQ ID NO: 36), #67-4A1 (SEQ ID NO: 38), and #67-4a2 (SEQ ID NO: 39). Deletions were induced by introducing two different CRISPR-Cas9 systems. Animals derived from zygote injections for CD163 did not exhibit mosaic genotypes. [Figure 8] CD1D knockout pigs generated by the CRISPR / Cas9 system injected into zygotes are shown. A) PCR amplification of CD1D from knockout pigs; 166-1 shows a mosaic genotype for CD1D. 166-2, 166-3, and 166-4 show no change in size for the amplicon, but sequencing of the amplicon revealed the alteration. WT FF = wild-type fetal fibroblasts. B) PCR amplification of the long-range assay showed a clear deletion of one allele in piglets 166-1 and 166-2. C) Image of the CD1D knockout pig with its surrogate mother. D) Sequence data for CD1D knockout pigs: WT (SEQ ID NO:40), #166-1.1 (SEQ ID NO:41), #166-1.2 (SEQ ID NO:42), #166-2 (SEQ ID NO:43), #166-3.1 (SEQ ID NO:44), #166-3.2 (SEQ ID NO:45), and #166-4 (SEQ ID NO:46). The atg start codon in exon 3 is shown in bold and lowercase. [Figure 9] Figure 1 shows clinical signs during acute PRRSV infection. Results for daily assessment of the presence of respiratory signs and fever for CD163+ / + (n=6) and CD163- / - (n=3). [Figure 10] Figure 1 shows lung histopathology during acute PRRSV infection. Representative photomicrographs of H and E stained tissue from wild-type and knockout pigs. The left panel shows mononuclear cell edema and infiltration. The right panel from the knockout pig shows normal lung architecture. [Figure 11] Viremia of various genotypes is shown. Note that CD163- / - piglet data is along the x-axis. [Figure 12] Antibody production in null, wild-type and uncharacterized allele pigs is shown. [Figure 13-1] Cell surface expression of CD163 in individual pigs is shown. Lines appearing toward the right in the Uncharacterized A, Uncharacterized B, and CD163+ / + panels represent the CD163 antibody, while lines appearing toward the left-hand side of these panels are no-antibody controls (background). Note that in CD163- / - animals, CD163 staining overlaps with the background control, and CD163 staining in the uncharacterized allele is roughly halfway between WT levels and background (note also that this is a logarithmic scale, and therefore less than approximately 10%). [Figure 13-2] Cell surface expression of CD163 in individual pigs is shown. Lines appearing toward the right in the Uncharacterized A, Uncharacterized B, and CD163+ / + panels represent the CD163 antibody, while lines appearing toward the left-hand side of these panels are no-antibody controls (background). Note that in CD163- / - animals, CD163 staining overlaps with the background control, and CD163 staining in the uncharacterized allele is roughly halfway between WT levels and background (note also that this is a logarithmic scale, and therefore less than approximately 10%). [Figure 13-3]Cell surface expression of CD163 in individual pigs is shown. Lines appearing toward the right in the Uncharacterized A, Uncharacterized B, and CD163+ / + panels represent the CD163 antibody, while lines appearing toward the left-hand side of these panels are no-antibody controls (background). Note that in CD163- / - animals, CD163 staining overlaps with the background control, and CD163 staining in the uncharacterized allele is roughly halfway between WT levels and background (note also that this is a logarithmic scale, and therefore less than approximately 10%). [Figure 13-4] Cell surface expression of CD163 in individual pigs is shown. Lines appearing toward the right in the Uncharacterized A, Uncharacterized B, and CD163+ / + panels represent the CD163 antibody, while lines appearing toward the left-hand side of these panels are no-antibody controls (background). Note that in CD163- / - animals, CD163 staining overlaps with the background control, and CD163 staining in the uncharacterized allele is roughly halfway between WT levels and background (note also that this is a logarithmic scale, and therefore less than approximately 10%). [Figure 14] The levels of CD169 on alveolar macrophages from three representative pigs and an antibody-free control are shown (FITC-labeled anti-CD169). [Figure 15] Viremia of various genotypes is shown. Note that the Δ43 amino acid piglet data is along the X-axis. [Figure 16-1] Figure 1 shows the genomic sequence of wild-type CD163 exons 7-10, used as a reference sequence (SEQ ID NO:47). The sequence includes from 3000 bp upstream of exon 7 to the final base of exon 10. The underlined regions indicate the locations of exons 7, 8, 9, and 10, respectively. [Figure 16-2]Figure 1 shows the genomic sequence of wild-type CD163 exons 7-10, used as a reference sequence (SEQ ID NO:47). The sequence includes from 3000 bp upstream of exon 7 to the final base of exon 10. The underlined regions indicate the locations of exons 7, 8, 9, and 10, respectively. [Figure 17]

[0023] Figure 1 shows several CD163 gene modifications, the predicted protein product for each modification, and the relative macrophage expression for each modification as measured by the level of surface CD163 on porcine alveolar macrophages (PAMs). Black areas indicate introns, and white areas indicate exons. The shaded area indicates the hCD163L1 exon 11 mimic, a homolog of porcine exon 7. The gray area indicates a synthetic intron with the PGK Neo construct. [Figure 18] Diagram of porcine CD163 protein and gene sequence. A) CD163 protein SRCR (oval) and PST (box) domains shown with corresponding gene exons. B) Comparison of porcine CD163 SRCR5 (SEQ ID NO:120) with the human CD163L1 SRCR8 (SEQ ID NO:121) homolog. [Figure 19-1] Representative results are shown for surface expression of CD163 and CD169 on PAMs from wild-type and CD163-modified pigs. Panels A-E show results for the CD163 gene modification shown in Figure 17. Pooled data for d7(1467) and d7(1280) are shown in panel D. [Figure 19-2] Representative results are shown for surface expression of CD163 and CD169 on PAMs from wild-type and CD163-modified pigs. Panels A-E show results for the CD163 gene modification shown in Figure 17. Pooled data for d7(1467) and d7(1280) are shown in panel D. [Figure 20] Serum haptoglobin levels in wild-type and CD163-modified pigs are shown. [Figure 21] 1 shows the relative permissiveness of wild-type and HL11m PAM to infection with type 2 PRRSV isolates. [Figure 22] 1 shows infection of CD163-modified pigs with type 1 and type 2 PRRSV isolates. [Figure 23] Virus loads for WT and CD163-modified pigs infected with type 2 virus are shown. DETAILED DESCRIPTION OF THE INVENTION

[0023] Provided herein are methods for producing animals and gene-edited animals that have CD163 gene modification and are resistant to PRRSV and other related respiratory virus infections.Animals have chromosomal modifications (insertion or deletion) that inactivate or otherwise regulate CD163 gene activity.CD163 is required for PRRSV entry into cells and viral replication.Therefore, null CD163 animals are resistant to PRRSV infection when exposed.These animals can be produced by any of a number of protocols that utilize gene editing.

[0024] Also provided herein are methods for producing porcine animals, comprising introducing into porcine animal cells or porcine embryos an agent that specifically binds to a chromosomal target site in the cell and causes a double-stranded DNA break, or otherwise inactivates or reduces the activity of the CD163 gene or protein therein, using a gene editing method, for example, a clustered regularly interspaced short palindromic repeats (CRISPR) / Cas system, a transcription activator-like effector nuclease (TALEN), a zinc finger nuclease (ZFN), a recombinase fusion protein, or a meganuclease.

[0025] Also described herein is the use of one or more specific CD163 loci in conjunction with a polypeptide that can cleave and / or integrate specific nucleic acid sequences within the CD163 locus.Examples of the use of CD163 loci in conjunction with a polypeptide or RNA that can cleave and / or integrate the CD163 locus include polypeptides selected from the group consisting of zinc finger proteins, meganucleases, TAL domains, TALENs, RNA-guided CRISPR / Cas recombinases, leucine zippers, and others known to those skilled in the art.Specific examples include chimeric ("fusion") proteins comprising site-specific DNA binding domain polypeptides and cleavage domain polypeptides (e.g., nucleases), such as ZFN proteins comprising zinc finger polypeptides and FokI nuclease polypeptides.Polypeptides comprising DNA binding domains that specifically bind to the CD163 gene are described herein. Such polypeptides can also contain a nuclease (cleavage) domain or half-domain (e.g., a homing endonuclease, e.g., a homing endonuclease with a modified DNA-binding domain), and / or a ligase domain, so that the polypeptide can induce a targeted double-strand break and / or promote recombination of the nucleic acid of interest at the cleavage site. The DNA-binding domain targeting the CD163 locus can be a DNA-cleavage functional domain. The polypeptide can be used to introduce exogenous nucleic acids into the genome of a host organism (e.g., an animal species) at one or more CD163 loci. The DNA-binding domain can include a zinc finger protein with one or more zinc fingers (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or more zinc fingers), which has been engineered (non-naturally occurring) to bind to any sequence within the CD163 gene. Any of the zinc finger proteins described herein can bind to a target site within the coding sequence or adjacent sequence (e.g., a promoter or other expression element) of a target gene. The zinc finger protein can bind to a target site in the CD163 gene.

[0026] definition Units, prefixes, and symbols may be denoted in their SI-approved form. Unless otherwise specified, nucleic acids are written left to right in 5' to 3' orientation, and amino acid sequences are written left to right in amino to carboxy orientation. Numerical ranges recited within the specification are inclusive of the numbers defining the range and include each integer within the specified range. Amino acids may be referred to herein by either their commonly known three letter symbols or the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides may similarly be referred to by their commonly accepted single-letter codes. Unless otherwise specified, software, electrical, and electronic terms used herein are as defined in The New IEEE Standard Dictionary of Electrical and Electronics Term (5th ed., 1993). The terms defined below are more fully defined by reference to the specification as a whole.

[0027] As will be understood by those skilled in the art, for any and all purposes, especially in terms of providing a written specification, all ranges recited herein also encompass any and all possible subranges and combinations of subranges, as well as the individual values, particularly integers, that make up the range. A recited range includes each specific value, integer, decimal, or identity within the range. Any recited range can be readily recognized as fully descriptive and allows for the same range to be broken down into at least equal halves, thirds, quarters, fifths, or tenths. As a non-limiting example, each range recited herein can be easily broken down into a lower third, middle third, and upper third, etc.

[0028] When introducing elements of the present invention or preferred embodiment(s) thereof, the articles "a," "an," "the," and "said" are intended to mean that there are one or more of the elements. The terms "comprising," "containing," and "having" are intended to be inclusive and mean that there may be additional elements other than the listed elements.

[0029] The term "and / or" means any one of the items, any combination of the items, or all of the items with which the term is associated. The phrase "one or more" is readily understood by those of ordinary skill in the art, particularly when read in the context of its use.

[0030] A "binding protein" is a protein that can bind to another molecule. A binding protein can bind, for example, to a DNA molecule (a DNA-binding protein), an RNA molecule (an RNA-binding protein), and / or a protein molecule (a protein-binding protein). In the case of a protein-binding protein, it can bind to itself (forming a homodimer, homotrimer, etc.) and / or to one or more molecules of one or more different proteins. A binding protein can have more than one type of binding activity. For example, a zinc finger protein has DNA-binding, RNA-binding, and protein-binding activity.

[0031] The term "conservatively modified variants" applies to both amino acid and nucleic acid sequences. With respect to a particular nucleic acid sequence, "conservatively modified variants" refers to nucleic acids that encode identical or conservatively modified variants of the amino acid sequence. Due to the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given protein. For example, the codons GCA, GCC, GCG, and GCU all encode the amino acid alanine. Thus, at every position where alanine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide. Such nucleic acid variations are "silent variations" and represent one species of conservatively modified variation. All nucleic acid sequences herein that encode polypeptides also describe all possible silent variations of the nucleic acid by reference to the genetic code.

[0032] Those skilled in the art will recognize that each codon in a nucleic acid (except: AUG, which is normally the only codon for methionine; and UGG, which is normally the only codon for tryptophan) can be altered to obtain a functionally identical molecule. Accordingly, each silent variation of a nucleic acid encoding a polypeptide of the invention is implicit in each described polypeptide sequence and is within the scope of the invention.

[0033] With respect to amino acid sequences, one of skill in the art will recognize that individual substitutions, deletions, or additions to a nucleic acid, peptide, polypeptide, or protein sequence that alter, add, or delete a single amino acid or a few amino acids in the encoded sequence are "conservatively modified variants" if the alteration results in the substitution of an amino acid with a chemically similar amino acid. Thus, for example, any number of amino acid residues selected from the group of integers consisting of 1 to 15 can be so altered. Thus, for example, 1, 2, 3, 4, 5, 7, or 10 alterations are possible.

[0034] Conservatively modified variants typically provide biological activity similar to that of the unaltered polypeptide sequence from which they are derived. For example, the substrate specificity, enzymatic activity, or ligand / receptor binding to its native substrate is generally at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% of that of the native protein. Conservative substitution tables providing functionally similar amino acids are well known in the art.

[0035] The following six groups each contain amino acids that are conservative substitutions for one another: [1] alanine (A), serine (S), threonine (T); [2] aspartic acid (D), glutamic acid (E); [3] asparagine (N), glutamine (Q); [4] arginine (R), lysine (K); [5] isoleucine (I), leucine (L), methionine (M), valine (V); and [6] phenylalanine (F), tyrosine (Y), tryptophan (W). See also Creighton (1984) Proteins W.H. Freeman and Company.

[0036] The term "CRISPR" stands for "clustered regularly interspaced short palindromic repeats." The term "Cas9" refers to "CRISPR-associated protein 9." The term "CRISPR / Cas9" or "CRISPR / Cas9 system" refers to a programmable nuclease system for genetic manipulation, which includes a Cas9 protein, or a derivative thereof, and one or more non-coding RNAs that can provide the function of CRISPR RNA (crRNA) and a trans-activating RNA for Cas9 (tracrRNA). The crRNA and tracrRNA can be used individually or in combination to generate a "guide RNA" (gRNA). The crRNA or gRNA provides a sequence complementary to a genomic target. The CRISPR / Cas9 system is further described below.

[0037] Reference herein to a deletion in a nucleotide sequence from nucleotide x to nucleotide y means that all nucleotides in that range, inclusive of x and y, have been deleted. Thus, for example, the phrase "an 11 base pair deletion from nucleotide 3,137 to nucleotide 3,147 relative to SEQ ID NO:47" means that each of nucleotides 3,317 through 3,147, inclusive, have been deleted.

[0038] "Disease resistance" is a characteristic of an animal in which the animal avoids disease symptoms that are the result of an animal-pathogen interaction, such as the interaction between a swine animal and PRRSV. That is, the pathogen is prevented from causing animal disease and associated disease symptoms, or alternatively, there is a reduction in the incidence and / or severity of clinical signs or a reduction in clinical symptoms. Those skilled in the art will recognize that the compositions and methods disclosed herein can be used in conjunction with other compositions and methods available in the art for protecting animals from pathogen attack.

[0039] By "encoding" or "encoded," with respect to a particular nucleic acid, is meant that it contains information for translation into a particular protein. A nucleic acid that encodes a protein may contain intervening sequences (e.g., introns) within the translated region of the nucleic acid, or may lack such intervening untranslated sequences (e.g., as in the case of cDNA). The information that encodes a protein is specified by the use of codons. Typically, amino acid sequences are encoded by nucleic acids using the "universal" genetic code. When nucleic acids are prepared or modified synthetically, known codon preferences of the intended host in which the nucleic acid will be expressed can be utilized.

[0040] As used herein, the terms "gene editing," "gene-edited," "genetically edited," and "gene editing effector" refer to the use of homing technology using naturally occurring or engineered nucleases (also called "molecular scissors," "homing endonucleases," or "targeting endonucleases"). The nucleases generate specific double-stranded chromosomal breaks (DSBs) at desired locations within the genome, which, in some cases, utilize the cell's endogenous mechanisms to repair the induced break through the natural processes of homologous recombination (HR) and / or non-homologous end joining (NHEJ). Gene editing effectors include zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), clustered regularly interspaced short palindromic repeats / CAS9 (CRISPR / Cas9) systems, and meganucleases (e.g., meganucleases redesigned as homing endonucleases). The terms also include the use of transgenic procedures and techniques, for example, where the alteration is a deletion or a fairly small insertion (typically less than 20 nt) and / or where no DNA from a foreign species is introduced. The terms also encompass progeny animals, such as those produced by sexual mating or asexual reproduction from the original gene-edited animal.

[0041] As used herein, "heterologous" with respect to a nucleic acid is a nucleic acid that originates from a foreign species or, if from the same species, has been substantially modified in composition and / or genomic locus from its native form by deliberate human intervention. For example, a promoter operably linked to a heterologous structural gene may be from a species different from that from which the structural gene is derived, or, if from the same species, one or both may have been substantially modified from their original forms. A heterologous protein may originate from a foreign species or, if from the same species, has been substantially modified from its original form by deliberate human intervention.

[0042] As used herein, "homing DNA technology," "homing technology," and "homing endonucleases" encompass any mechanism that targets a specific molecule to a specific DNA sequence, including zinc finger (ZF) proteins, transcription activator-like effectors (TALEs), meganucleases, and CRISPR / Cas9 systems.

[0043] As used herein, the terms "increased resistance" and "reduced susceptibility" refer to, but are not limited to, a statistically significant reduction in the incidence and / or severity of clinical signs or symptoms associated with infection by a pathogen. For example, "increased resistance" or "reduced susceptibility" can refer to a statistically significant reduction in the incidence and / or severity of clinical signs or symptoms associated with infection by PRRSV in an animal comprising at least one modified chromosomal sequence in a gene encoding the CD163 protein, compared to a control animal having an unmodified chromosomal sequence. The term "statistically significant reduction in clinical symptoms" refers to, but is not limited to, a reduction in the frequency of occurrence of at least one clinical symptom in an edited group of subjects compared to a non-edited control group after exposure to an infectious pathogen by at least 10%, preferably at least 20%, more preferably at least 30%, even more preferably at least 50%, and even more preferably at least 70%.

[0044] As used herein, the term "knock-in" refers to the replacement of an endogenous gene with a transgene or the same endogenous gene with one or several structural modifications, while retaining the transcriptional control of the endogenous gene.

[0045] "Knockout" refers to the disruption of the structure or regulatory mechanism of a gene. Knockouts can be created by homologous recombination of targeting, replacement, or hit-and-run vectors or random insertion of gene trap vectors, resulting in complete, partial, or conditional loss of gene function.

[0046] The term "animal" includes any non-human animal, for example, a domestic animal (e.g., a livestock animal). The term "livestock animal" includes any animal traditionally raised in livestock agriculture, such as a porcine animal, a bovine animal (e.g., a beef or dairy cow), an ovine animal, a caprine animal, an equine animal (e.g., a horse or donkey), a buffalo, a camel, or an avian animal (e.g., a chicken, a turkey, a duck, a goose, a guinea fowl, or a chick). The term "livestock animal" does not include rats, mice, or other rodents.

[0047] As used herein, the term "mutation" includes an alteration in the nucleotide sequence of a polynucleotide, such as, for example, a gene or coding DNA sequence (CDS), compared to the wild-type sequence. This term includes, but is not limited to, substitutions, insertions, frameshifts, deletions, inversions, translocations, duplications, splice donor site mutations, point mutations, and the like.

[0048] As used herein, "operably linked" includes reference to a functional linkage between two nucleic acid sequences, e.g., a promoter sequence and a second sequence, where the promoter sequence initiates and mediates transcription of a DNA sequence corresponding to the second sequence. Generally, operably linked means that the linked nucleic acid sequences are contiguous, and, if necessary, that two protein-coding regions are linked contiguous and in the same reading frame.

[0049] As used herein, "polynucleotide" includes reference to deoxyribopolynucleotides, ribopolynucleotides, or conservatively modified variants; the term may also refer to analogs thereof that have the essential properties of natural ribonucleotides, in that they hybridize to substantially the same nucleotide sequence as naturally occurring nucleotides under stringent hybridization conditions and / or allow translation into the same amino acid(s) as the naturally occurring nucleotide(s). Polynucleotides can be full-length or partial sequences of natural or heterologous structural or regulatory genes. Unless otherwise specified, the term includes reference to a specific sequence as well as its complementary sequence. Thus, DNA or RNA with backbone modifications for stability or other reasons are "polynucleotides" as the term is intended herein. Furthermore, DNA or RNA containing unusual bases, such as inosine, or modified bases, such as tritylated bases, to name just two examples, are polynucleotides as the term is used herein. It will be recognized that a wide variety of modifications have been made to DNA and RNA that serve many useful purposes known to those skilled in the art.

[0050] The term polynucleotide as used herein encompasses such chemically, enzymatically, or metabolically modified forms of polynucleotides, as well as the DNA and RNA chemical forms characteristic of viruses and cells, e.g., simple and complex cells, among others.

[0051] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms may also apply to conservatively modified variants and amino acid polymers in which one or more amino acid residues are corresponding naturally occurring amino acids, as well as artificial chemical analogs of naturally occurring amino acid polymers. The essential property of such analogs of naturally occurring amino acids, when incorporated into a protein, is that the protein will react specifically with antibodies raised against the same protein except that it is composed entirely of naturally occurring amino acids.

[0052] The terms "polypeptide," "peptide," and "protein" also include modifications, including, but not limited to, glycosylation, lipid attachment, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation, and ADP-ribosylation. As is well known and discussed above, it will be recognized that polypeptides are not necessarily entirely linear. For example, polypeptides may be branched as a result of ubiquitination, and they may generally be circular, with or without branching, as a result of post-translational events, including natural processing events and events caused by human manipulation that do not occur in nature. Circular, branched, and branched circular polypeptides may also be synthesized by non-translational natural processes and by entirely synthetic methods. Furthermore, the invention contemplates both methionine-containing and methionine-less amino-terminal variants of the proteins of the invention.

[0053] As used herein, "reducing the incidence and / or severity of clinical signs" or "reducing clinical symptoms" refers to, but is not limited to, reducing the number of infected subjects in a group, reducing or eliminating the number of subjects showing clinical signs of infection, or reducing the severity of any clinical signs present in one or more subjects compared to wild-type infection. For example, these terms include any clinical signs of infection, lung pathology, viremia, antibody production, reduced pathogen load, reduced pathogen shedding, reduced pathogen transmission, or any clinical signs that are symptoms of PRRSV. Preferably, these clinical signs are reduced by at least 10% in one or more animals of the invention compared to infected subjects without a modification in the CD163 gene. More preferably, clinical signs are reduced by at least 20%, preferably by at least 30%, more preferably by at least 40%, and even more preferably by at least 50% in subjects of the invention.

[0054] The terms "residue" or "amino acid residue" or "amino acid" are used interchangeably herein to refer to an amino acid that is incorporated into a protein, polypeptide, or peptide (collectively, "protein"). The amino acid may be a naturally occurring amino acid, and, unless otherwise limited, can include non-naturally occurring analogs of the natural amino acids that can function in a manner similar to the naturally occurring amino acids.

[0055] The term "selectively hybridize" includes reference to hybridization of one nucleic acid sequence to another nucleic acid sequence or other biologic under stringent hybridization conditions. When using hybridization-based detection systems, a nucleic acid probe is selected that is complementary to a reference nucleic acid sequence, and then, by selection of appropriate conditions, the probe and reference sequence selectively hybridize, or bind, to each other, forming a double-stranded molecule.

[0056] The terms "stringent conditions" or "stringent hybridization conditions" include reference to conditions under which a probe will hybridize to its target sequence to a detectably greater extent than other sequences (e.g., at least 2-fold over background). Stringent conditions are sequence-dependent and will be different in different circumstances. By controlling the stringency of the hybridization and / or washing conditions, target sequences that are 100% complementary to the probe can be identified (homologous probing).

[0057] Alternatively, stringency conditions can be adjusted to allow for some mismatch in sequences, so that lower degrees of similarity are detected (heterologous probing). Generally, probes are less than about 1000 nucleotides in length, optionally less than 500 nucleotides in length.

[0058] Typically, stringent conditions are those in which the salt concentration is pH 7.0-8.3, the Na ion concentration is less than about 1.5 M, typically about 0.01-1.0 M, and the temperature is at least about 30°C for short probes (e.g., 10-50 nucleotides) and at least about 60°C for long probes (e.g., more than 50 nucleotides). Stringent conditions can also be achieved by adding destabilizing agents, such as formamide. Specificity is typically a function of post-hybridization washes, with important factors being the ionic strength and temperature of the final wash solution. For DNA / DNA hybrids, the thermal melting point (Tm) can be approximated by the formula of Meinkoth and Wahl, Anal. Biochem., 138: 267-284 (1984): T m [°C] = 81.5 + 16.6(logM) + 0.41(%GC) - 0.61(%form) - 500 / L; where M is the molar concentration of monovalent cations, %GC is the percentage of guanosine and cytosine nucleotides in the DNA, %form is the percentage of formamide in the hybridization solution, and L is the hybrid length in base pairs. m The Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. The Tm is reduced by approximately 1°C for each 1% mismatch; thus, the Tm, hybridization and / or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if a sequence with >90% identity is desired, the T m Generally, stringent conditions are those that achieve a T β -reactive activity for a specific sequence and its complement at a defined ionic strength and pH. m However, highly stringent conditions are chosen to be approximately 5°C lower than T m Hybridization and / or washing at 1-4°C lower than T can be used; moderately stringent conditions are T mHybridization and / or washing at temperatures 6-10°C lower than T can be used; low stringency conditions are m Hybridization and / or washing at temperatures 11-20°C lower than the desired temperature can be used. m Using the above, one skilled in the art will understand that variations in the stringency of hybridization and / or wash solutions are essentially described. Extensive guides to nucleic acid hybridization can be found in Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology—Hybridization with Nucleic Acid Probes, Part I, Chapter 2 “Overview of principles of hybridization and the strategy of nucleic acid probe assays,” Elsevier, New York (1993); and Current Protocols in Molecular Biology, Chapter 2, Ausubel, et al., Eds., Greene Publishing and Wiley-Interscience, New York (1995).

[0059] A "TALE DNA-binding domain" or "TALE" is a polypeptide containing one or more TALE repeat domains / units. The repeat domain is responsible for binding of the TALE to its cognate target DNA sequence. A single "repeat unit" (also called a "repeat") is typically 33-35 amino acids in length and exhibits at least some sequence homology to other TALE repeat sequences within naturally occurring TALE proteins. Zinc finger and TALE binding domains can be "engineered" to bind to predetermined nucleotide sequences, for example, by manipulating (changing one or more amino acids) the recognition helix region of a naturally occurring zinc finger or TALE protein. Thus, engineered DNA-binding proteins (zinc fingers or TALEs) are non-naturally occurring proteins. A non-limiting example of a method for engineering DNA-binding proteins is design and selection. Engineered DNA-binding proteins are proteins that do not occur in nature, and their design / composition results primarily from rational criteria. Rational criteria for design include substitution rules and the application of computerized algorithms to process information in databases that store information on existing ZFP and / or TALE designs and binding data. See, e.g., U.S. Patent Nos. 6,140,081; 6,453,242; and 6,534,261; see also WO98 / 53058; WO98 / 53059; WO98 / 53060; WO02 / 016536 and WO03 / 016496 and U.S. Patent Publication No. 20110301073.

[0060] As used herein, "vector" includes reference to a nucleic acid that can be used in transfection of a host cell and into which a polynucleotide can be inserted. Vectors are often replicons. Expression vectors allow for the transcription of a nucleic acid inserted therein.

[0061] "Wild type" refers to animals and blastocysts, embryos or cells derived therefrom that have not been genetically edited or otherwise genetically modified, typically inbred and outbred strains developed from naturally occurring species.

[0062] A "zinc finger DNA-binding protein" (or binding domain) is a protein, or domain within a larger protein, that binds to DNA in a sequence-specific manner via one or more zinc fingers (regions of amino acid sequence within the binding domain whose structure is stabilized by the coordination of zinc ions). The term zinc finger DNA-binding protein is often abbreviated as zinc finger protein or ZFP.

[0063] "Selected" zinc finger proteins or TALEs are proteins not found in nature, and their generation primarily results from empirical processes such as phage display, interaction traps, or hybrid selection. See, e.g., U.S. Patent Nos. 5,789,538; 5,925,523; 6,007,988; 6,013,453; 6,200,759; WO95 / 19431; WO96 / 06166; WO98 / 53057; WO98 / 54311; WO00 / 27878; WO01 / 60970; WO01 / 88197; WO02 / 099084; and U.S. Patent Publication No. 20110301073.

[0064] The following terms are used to describe the sequence relationships between polynucleotides / polypeptides of the present invention and reference polynucleotides / polypeptides: (a) "reference sequence," (b) "comparison window," (c) "sequence identity," and (d) "percentage of sequence identity."

[0065] (a) As used herein, a "reference sequence" is a defined sequence used as a basis for sequence comparison to a polynucleotide / polypeptide of the invention. A reference sequence may be a subset or the entirety of a particular sequence; for example, as a segment of a full-length cDNA or gene sequence, or as the complete cDNA or gene sequence.

[0066] (b) As used herein, the term "comparison window" refers to a specific contiguous segment of a polynucleotide / polypeptide sequence, where the polynucleotide / polypeptide sequence can be compared to a reference sequence, and a portion of the polynucleotide / polypeptide sequence within the comparison window can contain additions or deletions (i.e., gaps) compared to the reference sequence (which does not contain additions or deletions) for optimal alignment of the two sequences. Generally, the comparison window is at least 20 contiguous nucleotides / amino acid residues in length, and can optionally be 30, 40, 50, 100, or more. Those skilled in the art will understand that a gap penalty is typically introduced and subtracted from the number of matches to avoid high similarity to the reference sequence due to the inclusion of gaps in the polynucleotide / polypeptide sequence.

[0067] The method of aligning sequences for comparison is well known in the art.The optimal alignment of sequences for comparison can be carried out by Smith and Waterman's local homology algorithm, Adv. Appl. Math. 2: 482 (1981); Needleman and Wunsch's homology alignment algorithm, J. Mol. Biol. 48: 443 (1970); Pearson and Lipman's similarity search method, Proc. Natl. Acad. Sci. 85: 2444 (1988); and by computerized implementation of these algorithms, including but not limited to: CLUSTAL in the PC / Gene program by Intelligenetics, Mountain View, California; GAP, BESTFIT, BLAST, FASTA and TFASTA, and the related programs in GCG Wisconsin Genetics Software Package, version 10 (available from Accelrys Inc., 9685 Scranton Road, San Diego, California, USA). The CLUSTAL program is fully described by Higgins and Sharp, Gene 73: 237-244 (1988); Higgins and Sharp, CABIOS 5: 151-153 (1989); Corpet, et al., Nucleic Acids Research 16: 10881-90 (1988); Huang, et al., Computer Applications in the Biosciences 8: 155-65 (1992), and Pearson, et al., Methods in Molecular Biology 24: 307-331 (1994).

[0068] The BLAST family of programs that can be used for database similarity searching include: BLASTN for a nucleotide query sequence against a nucleotide database sequence; BLASTX for a nucleotide query sequence against a protein database sequence; BLASTP for a protein query sequence against a protein database sequence; TBLASTN for a protein query sequence against a nucleotide database sequence; and TBLASTX for a nucleotide query sequence against a nucleotide database sequence. See Current Protocols in Molecular Biology, Chapter 19, Ausubel, et al., Eds., Greene Publishing and Wiley-Interscience, New York (1995); Altschul et al., J. Mol. Biol., 215: 403-410 (1990); and Altschul et al., Nucleic Acids Res. 25: 3389-3402 (1997). Software for performing BLAST analyses is publicly available, for example, through the National Center for Biotechnology Information (ncbi.nlm.nih.gov / ). This algorithm is fully described in numerous publications. See, e.g., Altschul SF et al., Gapped BLAST and PSI-BLAST: A New Generation of Protein Database Search Programs, 25 NUCLEIC ACIDS RES. 3389 (1997); National Center for Biotechnology Information, THE NCBI HANDBOOK [INTERNET], CHAPTER 16: The BLAST Sequence Analysis Tool (McEntyre J, Ostell J, eds., 2002), available at http: / / www.ncbi.nlm.nih.gov / books / NBK21097 / pdf / ch16.pdf.The BLASTP program for amino acid sequences is also fully described (see Henikoff & Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915).

[0069] In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Nat'l. Acad. Sci. USA 90: 5873-5877 (1993)). Many low-complexity filter programs can be used to reduce such low-complexity alignments. For example, SEG (Wooten and Federhen, Comput. Chem., 17: 149-163 (1993)) and XNU (Claverie and States, Comput. Chem., 17: 191-201 (1993)) low-complexity filters can be used alone or in combination.

[0070] Unless otherwise specified, the nucleotide and protein identity / similarity values ​​provided herein are calculated using GAP (GCG version 10) with default settings. GAP (Global Alignment Program) can also be used to compare the polynucleotides or polypeptides of the present invention to a reference sequence. GAP uses the Needleman and Wunsch algorithm (J. Mol. Biol. 48: 443-453, 1970) to find an alignment of two full sequences that maximizes the number of matches and minimizes the number of gaps. GAP represents one member of a family of best alignments. Many members of this family may exist, but other members may not have better quality. GAP represents four forms of merit for alignment: quality, ratio, identity, and similarity. Quality is the metric that is maximized to align sequences. Ratio is the quality divided by the number of bases in the shorter segment. Percent identity is the percentage of symbols that actually match. Percent similarity is the percentage of symbols that are similar. Symbols directly across a gap are ignored. Similarity is scored if the scoring matrix value for a pair of symbols is equal to or greater than a similarity threshold of 0.50. The scoring matrix used in version 10 of the Wisconsin Genetics Software Package is BLOSUM62 (see Henikoff & Henikoff (1989) Proc. Natl. Acad. Sci. USA 89: 10915).

[0071] Multiple alignment of sequences can be performed using the CLUSTAL method of alignment (Higgins and Sharp (1989) CABIOS. 5: 151-153) with default parameters (gap penalty = 10, gap length penalty = 10). Default parameters for pairwise alignments using the CLUSTAL method include KTUPLE1, gap penalty = 3, window = 5, and preserved diagonals = 5.

[0072] (c) As used herein, "sequence identity" or "identity" in the context of two nucleic acid or polypeptide sequences includes reference to residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window. When percentage sequence identity is used in reference to proteins, it is recognized that non-identical residue positions often differ by conservative amino acid substitutions, in which an amino acid residue is replaced with another amino acid residue having similar chemical properties (e.g., charge or hydrophobicity), thereby not altering the functional properties of the molecule. When sequences differ by conservative substitutions, the percent sequence identity may be adjusted upward to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are said to have "sequence similarity" or "similarity." Means for making this adjustment are well known to those of skill in the art. Typically, this involves scoring conservative substitutions as partial rather than full mismatches, thereby increasing the percentage sequence identity. Thus, for example, where identical amino acids are given a score of 1 and non-conservative substitutions are given a score of zero, conservative substitutions are given a score between zero and 1. Scoring of conservative substitutions can be calculated by the algorithm of Meyers and Miller, Computer Applic. Biol. Sci., 4: 11-17 (1988), implemented, for example, in the program PC / GENE (Intelligenetics, Mountain View, California, USA).

[0073] (d) As used herein, "percentage of sequence identity" refers to a value determined by comparing two optimally aligned sequences over a comparison window, where a portion of the polynucleotide sequence within the comparison window may contain additions or deletions (i.e., gaps) relative to the reference sequence (which does not contain additions or deletions) due to optimal alignment of the two sequences. The percentage is calculated by determining the number of positions where the same nucleic acid base or amino acid residue occurs in both sequences to obtain the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity.

[0074] Animals and cells with altered chromosomal sequences in the gene encoding the CD163 protein CD163 has 17 exons, and the protein consists of an extracellular region with nine scavenger receptor cysteine-rich (SRCR) domains, a transmembrane segment, and a short cytoplasmic tail. Several different variants result from differential splicing of a single gene (Ritter et al. 1999a; Ritter et al. 1999b). Much of this variation is explained by the length of the cytoplasmic tail.

[0075] CD163 has many important functions, including acting as a haptoglobin-hemoglobin scavenger receptor. Because the heme group can be highly toxic, a key function of CD163 is the clearance of free hemoglobin from the blood (Kristiansen et al. 2001). CD163 possesses a cytoplasmic tail that promotes endocytosis. Mutation of this tail reduces the uptake of haptoglobin-hemoglobin complexes (Nielsen et al. 2006). Other functions of CD163 include erythroblast adhesion (SRCR2), TWEAK receptors (SRCR1-4&6-9), bacterial receptors (SRCR5), and African swine virus receptors (Sanchez-Tones et al. 2003), as well as a potential role as an immune modulator (reviewed in Van Gorp et al. 2010a). Given these important functions, it was previously thought that complete knockout of CD163 would result in animals that were not viable or were severely susceptible to infection (see, e.g., PCT Publication No. 2012 / 158828).

[0076] CD163 is a member of the scavenger receptor cysteine-rich (SRCR) superfamily and is composed of an intracellular domain and nine extracellular SRCR domains. In humans, CD163-mediated endocytosis of hemoglobin-heme uptake via SRCR3 protects cells from oxidative stress (Schaer et al., 2006a; Schaer et al., 2006b; Schaer et al., 2006c). CD163 also functions as a receptor for tumor necrosis factor-like weak inducer of apoptosis (TWEAK: SRCR1-4&6-9), a pathogen receptor (African swine fever virus; bacteria: SRCR2), and a receptor for erythroblast binding (SRCR2).

[0077] CD163 plays a role in infection by many different pathogens, and therefore, the invention is not limited to animals with reduced susceptibility to PRRSV infection, but includes animals with reduced susceptibility to any pathogen that depends on CD163 for either infection into cells or subsequent replication and / or persistence in cells. The PRRSV infection process begins with initial binding to heparan sulfate on the surface of alveolar macrophages. Prior to 2013, it was believed that secure binding to sialoadhesin (SIGLEC1, also known as CD169 or SN) then occurred. The virus is then internalized by clatherin-mediated endocytosis. Another molecule, CD163, then promotes viral uncoating in the endosome (Van Breedam et al. 2010a). The viral genome is released, and the cell is infected.

[0078] Described herein are animals and their progeny and cells that contain at least one modified chromosomal sequence, e.g., an insertion or deletion ("INDEL"), in the gene encoding the CD163 protein, which confers improved or complete resistance to infection by a pathogen (e.g., PRRSV) to the animal. Applicants have demonstrated that CD163 is a critical gene in PRRSV infection and have created founder resistant animals and lines.

[0079] The present disclosure provides genetically modified animals, their progeny, or animal cells comprising at least one modified chromosomal sequence in the gene encoding the CD163 protein. This invention does not involve inactivation or editing of the SIGLEC1 (CD169) gene, which was previously considered critical for PRRSV resistance.

[0080] The edited chromosomal sequence may contain an integrated sequence that is (1) inactivated, (2) modified, or (3) null. The inactivated chromosomal sequence is altered so that CD163 protein function is impaired, reduced, or eliminated in association with PRRSV infection. Thus, a genetically edited animal containing an inactivated chromosomal sequence may be referred to as a "knockout" or "conditional knockout." Similarly, a genetically edited animal containing an integrated sequence may be referred to as a "knockin" or "conditional knockin." Furthermore, a genetically edited animal containing a modified chromosomal sequence may contain targeted point mutation(s) or other modifications, thereby producing an altered protein product. Briefly, the process includes introducing into an embryo or cell at least one RNA molecule encoding a target zinc finger nuclease and, optionally, at least one accessory polynucleotide. The method further includes incubating the embryo or cell to express the zinc finger nuclease, and the double-strand break introduced into the target chromosomal sequence by the zinc finger nuclease is repaired by an error-prone non-homologous end joining DNA repair process or a homologous recombination DNA repair process. The method of using targeted zinc finger nuclease technology to edit chromosomal sequences encoding proteins associated with germline development is rapid, accurate, and highly efficient.

[0081] Alternatively, the process can include using the CRISPR / Cas9 system to modify genomic sequences. To use Cas9 to modify genomic sequences, proteins can be delivered directly to cells. Alternatively, mRNA encoding Cas9 can be delivered to cells, or a gene that provides expression of mRNA encoding Cas9 can be delivered to cells. In addition, target-specific crRNA and tracrRNA can be delivered directly to cells, or target-specific gRNA(s) can be delivered to cells (these RNAs can alternatively be generated by genes engineered to express these RNAs). The selection of designed target sites for crRNA / gRNA is well known in the art. A discussion of gRNA construction and cloning can be found at http: / / www.genome-engineering.org / crispr / wp-content / uploads / 2014 / 05 / CRISPR-Reagent-Description-Rev20140509.pdf.

[0082] At least one CD163 locus can be used as a target site for site-specific editing. Site-specific editing can include the insertion of an exogenous nucleic acid (e.g., a nucleic acid comprising a nucleotide sequence encoding a polypeptide of interest) or the deletion of a nucleic acid from the locus. For example, the integration of an exogenous nucleic acid and / or the deletion of a portion of a genomic nucleic acid can modify the locus to generate a disrupted CD163 gene (i.e., the activity of the CD163 protein is reduced).

[0083] Provided herein are non-human animals, progeny of said animals, and animal cells that comprise at least one modified chromosomal sequence in the gene encoding the CD163 protein.

[0084] Provided is a non-human animal or its descendants or animal cells comprising at least one modified chromosomal sequence in the gene encoding the CD163 protein, which modified chromosomal sequence results in the production of a substantially non-functional CD163 protein by the animal, its descendants, or the cell.

[0085] Another non-human animal or a descendant thereof or animal cell is provided, which comprises at least one modified chromosomal sequence in the gene encoding the CD163 protein, wherein the modified chromosomal sequence comprises an in-frame deletion in the gene encoding the CD163 protein.

[0086] A porcine animal or progeny thereof or a porcine cell comprising at least one modified chromosomal sequence in the gene encoding the CD163 protein is provided. The modified chromosomal sequence comprises (a) SEQ ID NO:118; or (b) a modification selected from the group consisting of: an 11 base pair deletion from nucleotide 3,137 to nucleotide 3,147 relative to reference sequence SEQ ID NO:47; a 2 base pair insertion between nucleotides 3,149 and 3,150 relative to reference sequence SEQ ID NO:47 and, on the same allele, a 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 relative to reference sequence SEQ ID NO:47; a 124 base pair deletion from nucleotide 3,024 to nucleotide 3,147 relative to reference sequence SEQ ID NO:47; a 123 base pair deletion from nucleotide 3,024 to nucleotide 3,146 relative to reference sequence SEQ ID NO:47; a 1 base pair insertion between nucleotide 3,147 and nucleotide 3,148 relative to reference sequence SEQ ID NO:47; a 130 base pair deletion from nucleotide 3,030 to nucleotide 3,159 relative to reference sequence SEQ ID NO:47; a 132 base pair deletion from nucleotide 3,030 to nucleotide 3,161 relative to reference sequence SEQ ID NO:47; a 1506 base pair deletion from nucleotide 1,525 to nucleotide 3,030 relative to reference sequence SEQ ID NO:47; a 7 base pair insertion between nucleotide 3,148 and nucleotide 3,149 relative to reference sequence SEQ ID NO:47; a 1280 base pair deletion from nucleotide 2,818 to nucleotide 4,097 relative to reference sequence SEQ ID NO:47; a 1373 base pair deletion from nucleotide 2,724 to nucleotide 4,096 relative to reference sequence SEQ ID NO:47; a 1467 base pair deletion from nucleotide 2,431 to nucleotide 3,897 relative to reference sequence SEQ ID NO:47;a 1930 base pair deletion from nucleotide 488 to nucleotide 2,417 relative to reference sequence SEQ ID NO:47, where the deleted sequence is replaced with a 12 base pair insertion starting at nucleotide 488, as well as an additional 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 relative to reference sequence SEQ ID NO:47; a 28 base pair deletion from nucleotide 3,145 to nucleotide 3,172 relative to reference sequence SEQ ID NO:47; a 1387 base pair deletion from nucleotide 3,145 to nucleotide 4,531 relative to reference sequence SEQ ID NO:47; a 1382 base pair deletion from nucleotide 3,113 to nucleotide 4,494 relative to reference sequence SEQ ID NO:47, where the deleted sequence is replaced with an 11 base pair insertion starting at nucleotide 3,113; a 1,720 base pair deletion from nucleotide 2,440 to nucleotide 4,160 relative to reference sequence SEQ ID NO:47; a 452 base pair deletion from nucleotide 3,015 to nucleotide 3,466 relative to reference sequence SEQ ID NO:47; and combinations thereof.

[0087] The modification of the chromosomal sequence in the gene encoding the CD163 protein reduces the susceptibility of the animal, its offspring, or its cells to infection by a pathogen (e.g., a virus such as PRRSV) compared to the susceptibility of an animal, its offspring, or its cells that does not contain the modified chromosomal sequence in the gene encoding the CD163 protein to infection by the pathogen.

[0088] For example, altering the chromosomal sequence in the gene encoding the CD163 protein can reduce the susceptibility of the animal, its offspring, or cells to type 1 PRRSV virus, type 2 PRRSV, or both type 1 and type 2 PRRSV viruses.

[0089] Modification of the chromosomal sequence in the gene encoding the CD163 protein may reduce the susceptibility of the animal, its offspring, or its cells to a PRRSV isolate selected from the group consisting of NVSL97-7895, KS06-72109, P129, VR2332, CO90, AZ25, MLV-ResPRRS, KS62-06274, KS483 (SD23983), CO84, SD13-15, Lelystad, 03-1059, 03-1060, SD01-08, 4353PZ, and combinations thereof.

[0090] The animal or offspring can be an embryo, a juvenile, or an adult. Similarly, the cells can include embryonic cells, cells from a juvenile animal, or cells from an adult animal.

[0091] The animal or its offspring can include a domestic animal. Similarly, the cell can include a cell derived from a domestic animal. The domestic animal can include a livestock animal, such as a porcine animal, a bovine animal (e.g., beef cattle or dairy cattle), an ovine animal, a caprine animal, an equine animal (e.g., a horse or donkey), a buffalo, a camel, or an avian animal (e.g., a chicken, a turkey, a duck, a goose, a guinea fowl, or a chick). The livestock animal is preferably a bovine or porcine animal, and most preferably a porcine animal.

[0092] The animal or offspring can comprise a genetically edited animal. The cells can comprise genetically edited cells.

[0093] Animals or cells can be genetically edited using homing endonucleases. Homing endonucleases can be naturally occurring endonucleases, but are preferably rationally designed, non-naturally occurring homing endonucleases, which have a DNA recognition sequence designed so that the endonuclease targets the chromosomal sequence in the gene encoding the CD163 protein. Thus, homing endonucleases can be designed homing endonucleases. Homing endonucleases can include, for example, clustered regularly interspaced short palindromic repeats (CRISPR) / Cas9 systems, transcription activator-like effector nucleases (TALENs), zinc finger nucleases (ZFNs), recombinase fusion proteins, meganucleases, or combinations thereof. The animals or cells are preferably genetically edited animals or cells using the CRISPR / Cas9 system.

[0094] The genetically edited animal, its progeny, or the genetically edited cells preferably exhibit increased resistance to pathogens (e.g., viruses such as PRRSV) compared to non-edited animals.

[0095] For example, the genetically edited animal can exhibit increased resistance to PRRSV type 1 virus, PRRSV type 2, or both PRRSV type 1 and type 2 viruses.

[0096] The genetically edited animals can exhibit increased resistance to a PRRSV isolate selected from the group consisting of NVSL97-7895, KS06-72109, P129, VR2332, CO90, AZ25, MLV-ResPRRS, KS62-06274, KS483 (SD23983), CO84, SD13-15, Lelystad, 03-1059, 03-1060, SD01-08, 4353PZ, and combinations thereof.

[0097] The animal, offspring, or cells can be heterozygous for the altered chromosomal sequence. Alternatively, the animal, offspring, or cells can be homozygous for the altered chromosomal sequence.

[0098] In any of the animals, offspring, or cells, the modified chromosomal sequence can include an insertion in the gene encoding the CD163 protein, a deletion in the gene encoding the CD163 protein, or a combination thereof. For example, the modified chromosomal sequence can include a deletion (e.g., an in-frame deletion) in the gene encoding the CD163 protein. Alternatively, the modified chromosomal sequence can include an insertion in the gene encoding the CD163 protein.

[0099] The insertion or deletion can reduce CD163 protein production or activity compared to CD163 protein production or activity in an animal, progeny, or cells lacking the insertion or deletion.

[0100] The insertion or deletion can result in the production of a substantially non-functional CD163 protein by the animal, its progeny, or its cells. By "substantially non-functional CD163 protein" is meant that the level of CD163 protein in the animal, its progeny, or its cells is undetectable, or, if detectable, is at least about 90% lower than the level observed in an animal, its progeny, or its cells that does not contain the insertion or deletion.

[0101] Where the animal, offspring, or cells comprise porcine animals, offspring, or cells, the modified chromosomal sequence can comprise a modification in exon 7 of the gene encoding the CD163 protein, exon 8 of the gene encoding the CD163 protein, an intron adjacent to exon 7 or exon 8 of the gene encoding the CD163 protein, or a combination thereof. The modified chromosomal sequence preferably comprises a modification in exon 7 of the gene encoding the CD163 protein.

[0102] The modification in exon 7 of the gene encoding the CD163 protein can comprise a deletion (e.g., an in-frame deletion in exon 7). Alternatively, the modification in exon 7 of the gene encoding the CD163 protein can comprise an insertion.

[0103] In any of the porcine animals, progeny, or cells, the modified chromosomal sequence can comprise SEQ ID NO: 118. Alternatively, the modified chromosomal sequence can comprise a modification selected from the group consisting of: an 11 base pair deletion from nucleotide 3,137 to nucleotide 3,147 relative to the reference sequence SEQ ID NO:47; a 2 base pair insertion between nucleotides 3,149 and 3,150 relative to the reference sequence SEQ ID NO:47, and, on the same allele, a 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 relative to the reference sequence SEQ ID NO:47; a 124 base pair deletion from nucleotide 3,024 to nucleotide 3,147 relative to the reference sequence SEQ ID NO:47; a 123 base pair deletion from nucleotide 3,024 to nucleotide 3,146 relative to the reference sequence SEQ ID NO:47; a 1 base pair insertion between nucleotides 3,147 and 3,148 relative to the reference sequence SEQ ID NO:47; a 130 base pair deletion from nucleotide 3,030 to nucleotide 3,159 relative to reference sequence SEQ ID NO:47; a 132 base pair deletion from nucleotide 3,030 to nucleotide 3,161 relative to reference sequence SEQ ID NO:47; a 1506 base pair deletion from nucleotide 1,525 to nucleotide 3,030 relative to reference sequence SEQ ID NO:47; a 7 base pair insertion between nucleotide 3,148 and nucleotide 3,149 relative to reference sequence SEQ ID NO:47; a 1280 base pair deletion from nucleotide 2,818 to nucleotide 4,097 relative to reference sequence SEQ ID NO:47; a 1373 base pair deletion from nucleotide 2,724 to nucleotide 4,096 relative to reference sequence SEQ ID NO:47; a 1467 base pair deletion from nucleotide 2,431 to nucleotide 3,897 relative to reference sequence SEQ ID NO:47;a 1930 base pair deletion from nucleotide 488 to nucleotide 2,417 relative to reference sequence SEQ ID NO:47, where the deleted sequence is replaced with a 12 base pair insertion starting at nucleotide 488, as well as an additional 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 relative to reference sequence SEQ ID NO:47; a 28 base pair deletion from nucleotide 3,145 to nucleotide 3,172 relative to reference sequence SEQ ID NO:47; a 1387 base pair deletion from nucleotide 3,145 to nucleotide 4,531 relative to reference sequence SEQ ID NO:47; a 1382 base pair deletion from nucleotide 3,113 to nucleotide 4,494 relative to reference sequence SEQ ID NO:47, where the deleted sequence is replaced with an 11 base pair insertion starting at nucleotide 3,113; a 1,720 base pair deletion from nucleotide 2,440 to nucleotide 4,160 relative to reference sequence SEQ ID NO:47; a 452 base pair deletion from nucleotide 3,015 to nucleotide 3,466 relative to reference sequence SEQ ID NO:47; or a combination thereof.

[0104] For example, the modification can include an 11 base pair deletion from nucleotide 3,137 to nucleotide 3,147 relative to the reference sequence SEQ ID NO:47.

[0105] The modifications can include a 2 base pair insertion between nucleotides 3,149 and 3,150 relative to the reference sequence SEQ ID NO:47, and a 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 in the same allele relative to the reference sequence SEQ ID NO:47.

[0106] The modification can include a 124 base pair deletion from nucleotide 3,024 to nucleotide 3,147 relative to the reference sequence SEQ ID NO:47.

[0107] The modification can include a 123 base pair deletion from nucleotide 3,024 to nucleotide 3,146 relative to the reference sequence SEQ ID NO:47.

[0108] The modification can include a single base pair insertion between nucleotides 3,147 and 3,148 relative to the reference sequence SEQ ID NO:47.

[0109] The modification can include a 130 base pair deletion from nucleotide 3,030 to nucleotide 3,159 relative to the reference sequence SEQ ID NO:47.

[0110] The modification can include a 132 base pair deletion from nucleotide 3,030 to nucleotide 3,161 relative to the reference sequence SEQ ID NO:47.

[0111] The modification can include a 1506 base pair deletion from nucleotide 1,525 to nucleotide 3,030 relative to the reference sequence SEQ ID NO:47.

[0112] The modification can include a 7 base pair insertion between nucleotides 3,148 and 3,149 relative to the reference sequence SEQ ID NO:47.

[0113] The modification can include a 1280 base pair deletion from nucleotide 2,818 to nucleotide 4,097 relative to the reference sequence SEQ ID NO:47.

[0114] The modification can include a 1373 base pair deletion from nucleotide 2,724 to nucleotide 4,096 relative to the reference sequence SEQ ID NO:47.

[0115] The modification can include a 1467 base pair deletion from nucleotide 2,431 to nucleotide 3,897 relative to the reference sequence SEQ ID NO:47.

[0116] The modification can include a 1,930 base pair deletion from nucleotide 488 to nucleotide 2,417 relative to the reference sequence SEQ ID NO:47, where the deleted sequence is replaced with a 12 base pair insertion beginning at nucleotide 488, as well as an additional 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 relative to the reference sequence SEQ ID NO:47.

[0117] The modification can include a 28 base pair deletion from nucleotide 3,145 to nucleotide 3,172 relative to the reference sequence SEQ ID NO:47.

[0118] The modification can include a 1387 base pair deletion from nucleotide 3,145 to nucleotide 4,531 relative to the reference sequence SEQ ID NO:47.

[0119] The modification can include a 1382 base pair deletion from nucleotide 3,113 to nucleotide 4,494 relative to the reference sequence SEQ ID NO:47, where the deleted sequence is replaced with an 11 base pair insertion beginning at nucleotide 3,113.

[0120] The modification can include a 1720 base pair deletion from nucleotide 2,440 to nucleotide 4,160 relative to the reference sequence SEQ ID NO:47.

[0121] The modification can include a 452 base pair deletion from nucleotide 3,015 to nucleotide 3,466 relative to the reference sequence SEQ ID NO:47.

[0122] The porcine animal, progeny, or cells can contain any combination of the above insertions and deletions.

[0123] SEQ ID NO:47 provides the nucleotide sequence for the region starting 3000 base pairs (bp) upstream of exon 7 of the wild-type porcine CD163 gene through the last base of exon 10 of the gene. SEQ ID NO:47 is used as a reference sequence herein and is shown in FIG.

[0124] When the porcine animal, offspring, or cells contain a two base pair insertion between nucleotides 3,149 and 3,150 compared to the reference sequence SEQ ID NO:47, the two base pair insertion can include the insertion of the dinucleotide AG.

[0125] When the porcine animal, offspring, or cells contain a single base pair insertion between nucleotides 3,147 and 3,148 compared to the reference sequence SEQ ID NO:47, the single base pair insertion can comprise the insertion of a single adenine residue.

[0126] If the porcine animal, offspring, or cells contain a 7 base pair insertion between nucleotides 3,148 and 3,149 compared to the reference sequence SEQ ID NO:47, the 7 base pair insertion can contain the sequence TACTACT (SEQ ID NO:115).

[0127] If the porcine animal, offspring, or cells comprise a 1930 base pair deletion from nucleotide 488 to nucleotide 2,417 relative to the reference sequence SEQ ID NO:47, where the deleted sequence is replaced with a 12 base pair insertion beginning at nucleotide 488, and there is an additional 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 relative to the reference sequence SEQ ID NO:47, where the 12 base pair insertion comprises the sequence TGTGGAGAATTC (SEQ ID NO:116).

[0128] When the porcine animal, progeny, or cells comprise a 1382 base pair deletion from nucleotide 3,113 to nucleotide 4,494 relative to the reference sequence SEQ ID NO:47, where the deleted sequence is replaced with an 11 base pair insertion beginning at nucleotide 3,113, the 11 base pair insertion can comprise the sequence AGCCAGCGTGC (SEQ ID NO:117).

[0129] When the modified chromosomal sequence in the gene encoding CD163 protein contains deletion, the deletion preferably contains in-frame deletion.In-frame deletion is the deletion that does not cause a shift in triplet reading frame, and thus has one or more amino acid internal deletions, but obtains a non-truncated protein product.Assuming that splicing occurs correctly, the deletion of 3 base pairs or more than 3 base pairs in exon will result in in-frame mutation.

[0130] The following INDELs described herein for porcine animals and cells are predicted to be in-frame deletions because the deletions within exon 7 of the porcine CD163 gene are a multiple of three: a 1506 base pair deletion from nucleotide 1,525 to nucleotide 3,030 relative to reference sequence SEQ ID NO:47; a 1930 base pair deletion from nucleotide 488 to nucleotide 2,417 relative to reference sequence SEQ ID NO:47, where the deleted sequence is replaced with a 12 base pair insertion starting at nucleotide 488, and there is an additional 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 relative to reference sequence SEQ ID NO:47; a 1373 base pair deletion from nucleotide 2,724 to nucleotide 4,096 relative to reference sequence SEQ ID NO:47. a 123 base pair deletion from nucleotide 3,024 to nucleotide 3,146 relative to reference sequence SEQ ID NO:47; a 1467 base pair deletion from nucleotide 2,431 to nucleotide 3,897 relative to reference sequence SEQ ID NO:47; a 1387 base pair deletion from nucleotide 3,145 to nucleotide 4,531 relative to reference sequence SEQ ID NO:47; a 1382 base pair deletion from nucleotide 3,113 to nucleotide 4,494 relative to reference sequence SEQ ID NO:47, where the deleted sequence is replaced with an 11 base pair insertion starting at nucleotide 3,113; and a 1720 base pair deletion from nucleotide 2,440 to nucleotide 4,160 relative to reference sequence SEQ ID NO:47.

[0131] Thus, in porcine animals, progeny, and cells, the insertion or deletion in the gene encoding the CD163 protein can comprise an in-frame deletion in exon 7 selected from the group consisting of: a 1506 base pair deletion from nucleotide 1,525 to nucleotide 3,030 relative to reference sequence SEQ ID NO:47; a 1930 base pair deletion from nucleotide 488 to nucleotide 2,417 relative to reference sequence SEQ ID NO:47, where the deleted sequence is replaced with a 12 base pair insertion starting at nucleotide 488, and there is an additional 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 relative to reference sequence SEQ ID NO:47; a 1373 base pair deletion from nucleotide 2,724 to nucleotide 4,096 relative to reference sequence SEQ ID NO:47; a 123 base pair deletion from nucleotide 3,024 to nucleotide 3,146 relative to reference sequence SEQ ID NO:47; a 1,467 base pair deletion from nucleotide 2,431 to nucleotide 3,897 relative to reference sequence SEQ ID NO:47; a 1,387 base pair deletion from nucleotide 3,145 to nucleotide 4,531 relative to reference sequence SEQ ID NO:47; a 1,382 base pair deletion from nucleotide 3,113 to nucleotide 4,494 relative to reference sequence SEQ ID NO:47, wherein the deleted sequence is replaced with an 11 base pair insertion starting at nucleotide 3,113; a 1,720 base pair deletion from nucleotide 2,440 to nucleotide 4,160 relative to reference sequence SEQ ID NO:47; and combinations thereof.

[0132] The pig animal, offspring, or cells may contain an insertion or deletion selected from the group consisting of: a 2 base pair insertion between nucleotides 3,149 and 3,150 relative to the reference sequence SEQ ID NO:47, and, in the same allele, a 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 relative to the reference sequence SEQ ID NO:47; a 28 base pair deletion from nucleotide 3,145 to nucleotide 3,172 relative to the reference sequence SEQ ID NO:47; a 452 base pair deletion from nucleotide 3,015 to nucleotide 3,466 relative to the reference sequence SEQ ID NO:47; and combinations thereof.

[0133] For example, the porcine animal, offspring, or cells can include a 2 base pair insertion between nucleotides 3,149 and 3,150 relative to the reference sequence SEQ ID NO:47, and a 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 in the same allele relative to the reference sequence SEQ ID NO:47.

[0134] The porcine animal, progeny, or cells can comprise a 28 base pair deletion from nucleotide 3,145 to nucleotide 3,172 relative to the reference sequence SEQ ID NO:47.

[0135] The porcine animal, progeny, or cells can comprise a 452 base pair deletion from nucleotide 3,015 to nucleotide 3,466 relative to the reference sequence SEQ ID NO:47.

[0136] The porcine animal, offspring, or cells can contain any combination of the modified chromosomal sequences described herein.

[0137] For example, the porcine animal, offspring, or cells can comprise: a 7 base pair insertion between nucleotide 3,148 and nucleotide 3,149 in one allele of the gene encoding the CD163 protein compared to the reference sequence SEQ ID NO:47; and an 11 base pair deletion from nucleotide 3,137 to nucleotide 3,147 in the other allele of the gene encoding the CD163 protein compared to the reference sequence SEQ ID NO:47.

[0138] The porcine animal, offspring, or cells can comprise: a 7 base pair insertion between nucleotide 3,148 and nucleotide 3,149 in one allele of the gene encoding the CD163 protein relative to the reference sequence SEQ ID NO:47; and a 1,382 base pair deletion from nucleotide 3,113 to nucleotide 4,494 in the other allele of the gene encoding the CD163 protein relative to the reference sequence SEQ ID NO:47, wherein the deleted sequence is replaced with an 11 base pair insertion beginning at nucleotide 3,113.

[0139] The porcine animal, offspring, or cells may comprise: SEQ ID NO:118 in one allele of the gene encoding the CD163 protein; and an 11 base pair deletion from nucleotide 3,137 to nucleotide 3,147 in the other allele of the gene encoding the CD163 protein relative to the reference sequence SEQ ID NO:47.

[0140] The pig animal, offspring, or cells may comprise: SEQ ID NO:118 in one allele of the gene encoding the CD163 protein; and in the other allele of the gene encoding the CD163 protein, a 2 base pair insertion between nucleotides 3,149 and 3,150 compared to reference sequence SEQ ID NO:47, and a 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 compared to reference sequence SEQ ID NO:47.

[0141] The porcine animal, offspring, or cells can comprise: a 1,280 base pair deletion from nucleotide 2,818 to nucleotide 4,097 in one allele of the gene encoding the CD163 protein relative to the reference sequence SEQ ID NO:47; and an 11 base pair deletion from nucleotide 3,137 to nucleotide 3,147 in the other allele of the gene encoding the CD163 protein relative to the reference sequence SEQ ID NO:47.

[0142] The porcine animal, offspring, or cells may comprise: in one allele of the gene encoding the CD163 protein, a 1,280 base pair deletion from nucleotide 2,818 to nucleotide 4,097 relative to the reference sequence SEQ ID NO:47; and in the other allele of the gene encoding the CD163 protein, a 2 base pair insertion between nucleotides 3,149 and 3,150 relative to the reference sequence SEQ ID NO:47 and a 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 relative to the reference sequence SEQ ID NO:47.

[0143] The porcine animal, offspring, or cells can comprise: in one allele of the gene encoding the CD163 protein, a 1,930 base pair deletion from nucleotide 488 to nucleotide 2,417 relative to the reference sequence SEQ ID NO:47, where the deleted sequence is replaced with a 12 base pair insertion starting at nucleotide 488, and there is an additional 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 relative to the reference sequence SEQ ID NO:47; and in the other allele of the gene encoding the CD163 protein, a 2 base pair insertion between nucleotides 3,149 and 3,150 relative to the reference sequence SEQ ID NO:47 and a 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 relative to the reference sequence SEQ ID NO:47.

[0144] The porcine animal, offspring, or cells can comprise: SEQ ID NO:118 in one allele of the gene encoding the CD163 protein; and in the other allele of the gene encoding the CD163 protein, a 1,930 base pair deletion from nucleotide 488 to nucleotide 2,417 relative to the reference sequence SEQ ID NO:47, where the deleted sequence is replaced with a 12 base pair insertion beginning at nucleotide 488, and there is an additional 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 relative to the reference sequence SEQ ID NO:47.

[0145] The porcine animal, offspring, or cells can comprise: in one allele of the gene encoding the CD163 protein, a 1,930 base pair deletion from nucleotide 488 to nucleotide 2,417 relative to the reference sequence SEQ ID NO:47, where the deleted sequence is replaced with a 12 base pair insertion starting at nucleotide 488, and there is an additional 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 relative to the reference sequence SEQ ID NO:47; and in the other allele of the gene encoding the CD163 protein, an 11 base pair deletion from nucleotide 3,137 to nucleotide 3,147 relative to the reference sequence SEQ ID NO:47.

[0146] The porcine animal, offspring, or cells may comprise: in one allele of the gene encoding the CD163 protein, a 1,467 base pair deletion from nucleotide 2,431 to nucleotide 3,897 relative to the reference sequence SEQ ID NO:47; and in the other allele of the gene encoding the CD163 protein, a 2 base pair insertion between nucleotides 3,149 and 3,150 relative to the reference sequence SEQ ID NO:47 and a 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 relative to the reference sequence SEQ ID NO:47.

[0147] The porcine animal, offspring, or cells can comprise: a 1,467 base pair deletion from nucleotide 2,431 to nucleotide 3,897 in one allele of the gene encoding the CD163 protein relative to the reference sequence SEQ ID NO:47; and an 11 base pair deletion from nucleotide 3,137 to nucleotide 3,147 in the other allele of the gene encoding the CD163 protein relative to the reference sequence SEQ ID NO:47.

[0148] A porcine animal, offspring, or cell containing any of the above-described insertions or deletions can comprise a chromosomal sequence outside the insertion or deletion that has a high degree of sequence identity to SEQ ID NO: 47. Thus, for example, the porcine animal, offspring, or cell can comprise a chromosomal sequence that has at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, at least 99.9%, or 100% sequence identity to SEQ ID NO: 47 in a region of the chromosomal sequence outside the insertion or deletion.

[0149] The porcine animal, progeny, or cells can comprise a chromosomal sequence comprising SEQ ID NO:98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 118, or 119. As further described in the Examples below, SEQ ID NOs. 98-114 and 119 provide nucleotide sequences for regions corresponding to those of wild-type porcine CD163 provided in SEQ ID NO:47 and include insertions or deletions in the porcine CD163 chromosomal sequence described herein. SEQ ID NO:118 provides a sequence for a region corresponding to those of wild-type porcine CD163 provided by SEQ ID NO:47, in which exon 7 has been replaced with a synthetic exon encoding a homolog of SRCR8 of human CD163-like 1 protein (hCD163L1).

[0150] For example, the pig, offspring, animal, or cell can comprise a chromosomal sequence comprising SEQ ID NO: 98, 101, 105, 109, 110, 112, 113, or 114. SEQ ID NO: 98, 101, 105, 109, 110, 112, 113, and 114 provide the nucleotide sequences for in-frame deletions in exon 7 of the porcine CD163 chromosomal sequence.

[0151] As another example, the porcine animal, offspring, or cells can comprise a chromosomal sequence comprising SEQ ID NO:103, 111, or 119.

[0152] The porcine animal, offspring, or cells can comprise an 11 base pair deletion in one allele of the gene encoding the CD163 protein and a 2 base pair insertion and a 377 base pair deletion in the other allele of the gene encoding the CD163 protein.

[0153] The porcine animal, offspring, or cells can comprise a 124 base pair deletion in one allele of the gene encoding the CD163 protein and a 123 base pair deletion in the other allele of the gene encoding the CD163 protein.

[0154] The porcine animal, progeny, or cells may contain a single base pair insertion.

[0155] The porcine animal, offspring, or cells can comprise a 130 base pair deletion in one allele of the gene encoding the CD163 protein and a 132 base pair deletion in the other allele of the gene encoding the CD163 protein.

[0156] The porcine animal, progeny, or cells can contain a 1506 base pair deletion.

[0157] The porcine animal, progeny, or cells may contain a 7 base pair insertion.

[0158] The porcine animal, offspring, or cells can comprise a 1280 base pair deletion in one allele of the gene encoding the CD163 protein and a 1373 base pair deletion in the other allele of the gene encoding the CD163 protein.

[0159] The porcine animal, progeny, or cells can contain a 1467 base pair deletion.

[0160] The porcine animal, progeny, or cells can contain a 1930 base pair intron 6 deletion from nucleotide 488 to nucleotide 2,417, and a 12 base pair insertion in exon 7 at nucleotide 4,488 and an additional 129 base pair deletion.

[0161] The porcine animal, offspring, or cells can comprise a 28 base pair deletion in one allele of the gene encoding the CD163 protein and a 1387 base pair deletion in the other allele of the gene encoding the CD163 protein.

[0162] The porcine animal, offspring, or cells can comprise a 1382 base pair deletion and an 11 base pair insertion in one allele of the gene encoding the CD163 protein, and a 1720 base pair deletion in the other allele of the gene encoding the CD163 protein.

[0163] Any of the cells that contain at least one modified chromosomal sequence in the gene encoding the CD163 protein can include sperm cells, or any of these cells can include egg cells (e.g., fertilized eggs).

[0164] Any cell that contains at least one altered chromosomal sequence in the gene encoding the CD163 protein can include a somatic cell, for example, any of the cells can include a fibroblast (e.g., a fetal fibroblast).

[0165] Targeted integration of nucleic acids at the CD163 locus Site-specific integration of an exogenous nucleic acid at the CD163 locus can be achieved by any technique known to those skilled in the art. For example, integration of an exogenous nucleic acid at the CD163 locus can include contacting a cell (e.g., an isolated cell or a cell in a tissue or organism) with a nucleic acid molecule containing the exogenous nucleic acid. Such a nucleic acid molecule can include nucleotide sequences flanking the exogenous nucleic acid that promote homologous recombination between the nucleic acid molecule and at least one CD163 locus. The nucleotide sequences flanking the exogenous nucleic acid that promote homologous recombination can be complementary to endogenous nucleotides at the CD163 locus. Alternatively, the nucleotide sequences flanking the exogenous nucleic acid that promote homologous recombination can be complementary to previously integrated exogenous nucleotides. Multiple exogenous nucleic acids can be integrated at a single CD163 locus, for example, by gene stacking.

[0166] Integration of a nucleic acid at the CD163 locus can be facilitated (e.g., catalyzed) by the endogenous cellular machinery of the host cell, including, but not limited to, endogenous DNA and endogenous recombinase enzymes. Alternatively, integration of a nucleic acid at the CD163 locus can be facilitated by one or more factors (e.g., polypeptides) provided to the host cell. For example, nuclease(s), recombinase(s), and / or ligase polypeptides can be provided (independently or as part of a chimeric polypeptide) by contacting the polypeptide with the host cell or by expressing the polypeptide in the host cell. Thus, a nucleic acid comprising a nucleotide sequence encoding at least one nuclease, recombinase, and / or ligase polypeptide can be introduced into the host cell simultaneously with or sequentially to the nucleic acid to be site-specifically integrated at the CD163 locus, wherein at least one nuclease, recombinase, and / or ligase polypeptide is expressed from that nucleotide sequence in the host cell.

[0167] DNA-binding polypeptides Site-specific integration can be achieved, for example, by using a factor capable of recognizing and binding to a specific nucleotide sequence in the genome of a host organism. For example, many proteins contain polypeptide domains capable of recognizing and binding to DNA in a site-specific manner. The DNA sequence recognized by a DNA-binding polypeptide can be referred to as a "target" sequence. A polypeptide domain capable of recognizing and binding to DNA in a site-specific manner generally functions independently to correctly fold and bind to DNA in a site-specific manner, even when the domain is expressed in a polypeptide other than the protein from which it was originally isolated. Similarly, a target sequence for recognition and binding by a DNA-binding polypeptide can generally be recognized and bound by such a polypeptide even when it is present in a larger DNA structure (e.g., a chromosome), particularly when the site where the target sequence is located is known to be accessible to soluble cellular proteins (e.g., a gene).

[0168] Although DNA-binding polypeptides identified from naturally occurring proteins typically bind to distinct nucleotide sequences or motifs (e.g., consensus recognition sequences), methods exist and are known in the art for modifying many such DNA-binding polypeptides to recognize different nucleotide sequences or motifs. DNA-binding polypeptides include, but are not limited to, zinc finger DNA-binding domains, leucine zippers, UPA DNA-binding domains, GAL4, TAL, LexA, Tet repressor, LacI, and steroid hormone receptors.

[0169] For example, the DNA-binding polypeptide can be a zinc finger. Individual zinc finger motifs can be designed to target and specifically bind to any of a wide variety of DNA sites. Canonical Cys2His2 (as well as non-canonical Cys3His) zinc finger polypeptides bind to DNA by inserting their α-helix into the major groove of the target DNA double helix. Zinc finger DNA recognition is modular; each finger primarily contacts three consecutive base pairs within the target, and a few key residues within the polypeptide mediate recognition. The inclusion of multiple zinc finger DNA-binding domains within a targeting endonuclease can further increase the DNA-binding specificity of the targeting endonuclease (and thus the specificity of any gene regulatory effect imparted thereby). See, e.g., Urnov et al. (2005) Nature 435:646-51. Thus, one or more zinc finger DNA-binding polypeptides can be engineered and used such that a targeting endonuclease introduced into a host cell interacts with a DNA sequence that is unique within the genome of the host cell.

[0170] Preferably, the zinc finger protein is non-naturally occurring in that it has been engineered to bind to a selected target site (see, e.g., Beerli et al. (2002) Nature Biotechnol. 20:135-141; Pabo et al. (2001) Ann. Rev. Biochem. 70:313-340; Isalan et al. (2001) Nature Biotechnol. 19:656-660; Segal et al. (2001) Curr. Opin. Biotechnol. 12:632-637; Choo et al. (2000) Curr. Opin. Struct. Biol. 10:411-416; U.S. Patent Nos. 6,453,242; 6,534,261; 6,599,692; 6,503,717; 6,689,558; 7,030,215; 6,794,136; 7,067,317; 7,262,054; 7,070,934; 7,361,635; 7,253,273; and U.S. Patent Publication Nos. 2005 / 0064474; 2007 / 0218528; 2005 / 0267061.

[0171] Engineered zinc finger binding domains can have novel binding specificities compared to naturally occurring zinc finger proteins. Engineering methods include, but are not limited to, rational design and various types of selection. Rational design, for example, includes the use of a database containing triplet (or quadruplet) nucleotide sequences and individual zinc finger amino acid sequences, where each triplet or quadruplet nucleotide sequence is associated with one or more amino acid sequences of zinc fingers that bind to a specific triplet or quadruplet sequence. See, for example, U.S. Patent Nos. 6,453,242 and 6,534,261.

[0172] Exemplary selection methods, such as phage display and two-hybrid system, are disclosed in U.S. Patent Nos. 5,789,538; 5,925,523; 6,007,988; 6,013,453; 6,410,248; 6,140,466; 6,200,759; and 6,242,568; and WO98 / 37186; WO98 / 53057; WO00 / 27878; WO01 / 88197 and GB2,338,237.In addition, the binding specificity enhancement for zinc finger binding domain is described, for example, in WO02 / 077227.

[0173] Additionally, as disclosed in these and other references, zinc finger domains and / or multi-finger zinc finger proteins can be linked together using any suitable linker sequence (e.g., including linkers of 5 or more amino acids in length). For exemplary linker sequences of 6 or more amino acids in length, see also U.S. Patent Nos. 6,479,626; 6,903,185; and 7,153,949. The proteins described herein can include any combination of suitable linkers between the individual zinc fingers of the protein.

[0174] Selection of Target Sites: Methods for designing and constructing ZFPs and fusion proteins (and polynucleotides encoding same) are known to those of skill in the art and are described in detail in U.S. Patent Nos. 6,140,0815; 789,538; 6,453,242; 6,534,261; 5,925,523; 6,007,988; 6,013,453; 6,20 0,759; WO95 / 19431; WO96 / 06166; WO98 / 53057; WO98 / 54311; WO00 / 27878; WO01 / 60970; WO01 / 88197; WO02 / 099084; WO98 / 53058; WO98 / 53059; WO98 / 53060; WO02 / 016536 and WO03 / 016496.

[0175] Additionally, as disclosed in these and other references, zinc finger domains and / or multi-finger zinc finger proteins can be linked together using suitable linker sequences (e.g., including linkers of 5 or more amino acids in length). See also U.S. Patent Nos. 6,479,626; 6,903,185; and 7,153,949 for exemplary linker sequences of 6 or more amino acids in length. The proteins described herein can include any combination of suitable linkers between the individual zinc fingers of the protein.

[0176] Alternatively, the DNA-binding polypeptide is a DNA-binding domain derived from GAL4. GAL4 is a modular transactivator in Saccharomyces cerevisiae, but it also functions as a transactivator in many other organisms. See, for example, Sadowski et al. (1988) Nature 335:563-4. In this regulatory system, expression of genes encoding enzymes of the galactose metabolic pathway in S. cerevisiae is tightly controlled by the available carbon source. Johnston (1987) Microbiol. Rev. 51:458-76. Transcriptional control of these metabolic enzymes is mediated by interactions between a positive regulatory protein, GAL4, and a 17-bp symmetric DNA sequence (upstream activating sequence (UAS)) to which GAL4 specifically binds.

[0177] Native GAL4 consists of 881 amino acid residues and has a molecular weight of 99 kDa. GAL4 contains functionally independent domains, the combined activities of which are responsible for GAL4 activity in vivo. Ma and Ptashne (1987) Cell 48:847-53; Brent and Ptashne (1985) Cell 43(3 Pt 2):729-36. The N-terminal 65 amino acids of GAL4 comprise the GAL4 DNA-binding domain. Keegan et al. (1986) Science 231:699-704; Johnston (1987) Nature 328:353-5. Sequence-specific binding requires the presence of a divalent cation coordinated by six Cys residues in the DNA-binding domain. The domain containing the coordinated cation interacts with and recognizes conserved CCG triplets at each end of the 17-bp UAS by direct contact with the major groove of the DNA helix. Marmorstein et al. (1992) Nature 356:408-14. The DNA-binding function of the protein positions the C-terminal transcription activation domain in proximity to the promoter, so that the activation domain can direct transcription.

[0178] Additional DNA-binding polypeptides that can be used include, for example, but are not limited to, binding sequences from AVRBS3-inducible genes; consensus binding sequences from AVRBS3-inducible genes or synthetic binding sequences engineered therefrom (e.g., the UPA DNA-binding domain); TAL; LexA (see, e.g., Brent & Ptashne (1985), supra); LacR (see, e.g., Labow et al. (1990) Mol. Cell. Biol. 10:3343-56; Baim et al. (1991) Proc. Natl. Acad. Sci. USA 88(12):5072-6); steroid hormone receptors (Ellliston et al. (1990) J. Biol. Chem. 265:11517-121); the Tet repressor (U.S. Patent No. 6,271,341) and a mutant Tet repressor that binds to the tet operator sequence in the presence but not in the absence of tetracycline (Tc); the DNA binding domain of NF-κB; and components of the regulatory system described in Wang et al. (1994) Proc. Natl. Acad. Sci. USA 91(17):8180-4, which uses fusions of GAL4, a hormone receptor, and VP16.

[0179] The one or more DNA-binding domains of the nucleases used in the methods and compositions described herein can comprise naturally occurring or engineered (non-naturally occurring) TAL effector DNA-binding domains. See, e.g., U.S. Patent Publication No. 2011 / 0301073.

[0180] Alternatively, the nuclease can comprise a CRISPR / Cas system. Such a system comprises a CRISPR (clustered regularly interspaced short palindromic repeats) locus (encoding the RNA component of the system) and a Cas (CRISPR-associated) locus (encoding protein) (Jansen et al., 2002. Mol. Microbiol. 43: 1565-1575; Makarova et al., 2002. Nucleic Acids Res. 30: 482-496; Makarova et al., 2006. Biol. Direct 1: 7; Haft et al., 2005. PLoS Comput. Biol. 1: e60). The CRISPR locus in a microbial host comprises a Cas gene and a non-coding RNA element that can program the specificity of CRISPR-mediated nucleic acid cleavage.

[0181] Type II CRISPR, one of the best-characterized systems, essentially performs targeted DNA double-strand breaks in four sequential steps. First, two non-coding RNAs, the pre-crRNA and tracrRNA, are transcribed from the CRISPR locus. Second, tracrRNA hybridizes to the repeat region of the pre-crRNA and mediates processing of the pre-crRNA into mature crRNAs containing individual spacer sequences. Third, the mature crRNA:tracrRNA complex directs Cas9 to the target DNA via Wastson-Crick base pairing between the spacer on the crRNA and the protospacer on the target DNA adjacent to the protospacer adjacent motif (PAM), an additional requirement for target recognition. Finally, Cas9 mediates cleavage of the target DNA, generating a double-strand break within the protospacer.

[0182] In the use of the CRISPR / Cas system to create targeted insertions and deletions, two non-coding RNAs (crRNA and TracrRNA) can be replaced by a single RNA called a guide RNA (gRNA). The activity of the CRISPR / Cas system involves three steps: (i) insertion of exogenous DNA sequences into the CRISPR array to prevent future attacks in a process called "adaptation," (ii) expression of associated proteins, and expression and processing of the array, followed by (iii) RNA-mediated interference of the foreign nucleic acid. In bacterial cells, several Cas proteins are involved in the natural function of the CRISPR / Cas system and play a role in functions such as the insertion of foreign DNA.

[0183] A Cas protein can be a "functional derivative" of a naturally occurring Cas protein. A "functional derivative" of a native sequence polypeptide is a compound that shares qualitative biological properties with the native sequence polypeptide. "Functional derivatives" include, but are not limited to, fragments of native sequences and derivatives of native sequence polypeptides and their fragments, provided that they share a biological activity with the corresponding native sequence polypeptide. The biological activity contemplated herein is the ability of a functional derivative to hydrolyze a DNA substrate into fragments. The term "derivative" encompasses both amino acid sequence variants of a polypeptide, covalent modifications, and fusions thereof. Suitable derivatives of a Cas polypeptide or fragment thereof include, but are not limited to, mutants, fusions, and covalent modifications of a Cas protein or fragment thereof. Cas proteins (including Cas proteins or fragments thereof), as well as derivatives of Cas proteins or fragments thereof, can be obtained from cells or synthesized chemically or by a combination of these two procedures. The cells may be cells that naturally produce Cas proteins, or cells that naturally produce Cas proteins and have been engineered to produce endogenous Cas proteins at higher expression levels or to produce Cas proteins from exogenously introduced nucleic acids that encode the same or different Cas proteins as the endogenous Cas. In some cases, the cells do not naturally produce Cas proteins and are engineered to produce Cas proteins.

[0184] The DNA-binding polypeptide can specifically recognize and bind to a target nucleotide sequence contained in the genomic nucleic acid of a host organism. In some instances, several separate instances of the target nucleotide sequence can be found in the host genome. The target nucleotide sequence may be rare in the genome of an organism (e.g., less than about 10, about 9, about 8, about 7, about 6, about 5, about 4, about 3, about 2, or about 1 copy(s) of the target sequence may be present in the genome). For example, the target nucleotide sequence may be located at a unique site in the genome of an organism. For example, but not limited to, the target nucleotide sequences may be randomly distributed with respect to each other throughout the genome; located in different linkage groups within the genome; located in the same linkage group; located on different chromosomes; located on the same chromosome; located in the genome at sites that are expressed under similar conditions within the organism (e.g., under the control of the same or substantially functionally identical regulatory elements); and located close to each other within the genome (e.g., the target sequences may be contained within nucleic acids integrated as concatemers at genomic loci).

[0185] Targeting Endonucleases A DNA-binding polypeptide that specifically recognizes and binds to a target nucleotide sequence can be included within the chimeric polypeptide to confer specific binding to the target sequence. In examples, such chimeric polypeptides can include, for example, but not limited to, nuclease, recombinase, and / or ligase polypeptides. These polypeptides are described above. Chimeric polypeptides comprising a DNA-binding polypeptide and a nuclease, recombinase, and / or ligase polypeptide can also include other functional polypeptide motifs and / or domains, such as, but not limited to, spacer sequences located between functional polypeptides within the chimeric protein; leader peptides; peptides that target the fusion protein to organelles (e.g., the nucleus); polypeptides that are cleaved by cellular enzymes; peptide tags (e.g., Myc, His, etc.); and other amino acid sequences that do not interfere with the function of the chimeric polypeptide.

[0186] Functional polypeptides within a chimeric polypeptide (e.g., a DNA-binding polypeptide and a nuclease polypeptide) can be operatively linked. The functional polypeptides of a chimeric polypeptide can be operatively linked at least by their expression from a single polynucleotide encoding the functional polypeptides linked to each other in frame, so as to generate a chimeric gene encoding the chimeric protein. Alternatively, the functional polypeptides of a chimeric polypeptide can be operatively linked by other means, such as by cross-linking the independently expressed polypeptides.

[0187] The DNA binding polypeptide or guide RNA that specifically recognizes and binds to the target nucleotide sequence can be contained in a naturally isolated protein (or its variant), wherein the naturally isolated protein or its variant also contains a nuclease polypeptide (and may also contain a recombinase and / or a ligase polypeptide).Examples of such isolated proteins include TALEN, recombinase (e.g., Cre, Hin, Tre, and FLP recombinase), RNA-guided CRISPR / Cas9, and meganuclease.

[0188] As used herein, the term "targeting endonuclease" refers to naturally occurring or engineered isolated proteins and variants thereof comprising a DNA-binding polypeptide or guide RNA and a nuclease polypeptide, as well as chimeric polypeptides comprising a DNA-binding polypeptide or guide RNA and a nuclease. Any targeting endonuclease comprising a DNA-binding polypeptide or guide RNA that specifically recognizes and binds to a target nucleotide sequence contained within the CD163 locus (e.g., because the target sequence is contained in the natural sequence of the locus or because the target sequence has been introduced into the locus, e.g., by recombinant means) can be used.

[0189] Some examples of suitable chimeric polypeptides include, but are not limited to, combinations of the following polypeptides: zinc finger DNA-binding polypeptides; FokI nuclease polypeptides; TALE domains; leucine zippers; transcription factor DNA-binding motifs; and DNA recognition and / or cleavage domains isolated from, for example, but not limited to, TALENs, recombinases (e.g., Cre, Hin, RecA, Tre, and FLP recombinases), RNA-guided CRISPR / Cas9, meganucleases; and others known to those skilled in the art. Specific examples include chimeric proteins comprising site-specific DNA-binding polypeptides and nuclease polypeptides. Chimeric polypeptides can be engineered by methods known to those skilled in the art to alter the recognition sequence of the DNA-binding polypeptide contained within the chimeric polypeptide to target the chimeric polypeptide to a specific nucleotide sequence of interest.

[0190] The chimeric polypeptide can comprise a DNA binding domain (e.g., zinc finger, TAL-effector domain, etc.) and a nuclease (cleavage) domain. The cleavage domain can be heterologous to the DNA binding domain, such as a zinc finger DNA binding domain and a cleavage domain derived from a nuclease, or a TALEN DNA binding domain and a cleavage domain, or a meganuclease DNA binding domain and a cleavage domain derived from a different nuclease. The heterologous cleavage domain can be obtained from any endonuclease or exonuclease. Exemplary endonucleases from which the cleavage domain can be derived include, but are not limited to, restriction endonucleases and homing endonucleases. See, for example, 2002-2003 Catalogue, New England Biolabs, Beverly, Mass.; and Belfort et al. (1997) Nucleic Acids Res. 25:3379-3388. Additional enzymes that cleave DNA are known (e.g., S1 nuclease; mungbean nuclease; pancreatic DNAse I; micrococcal nuclease; yeast HO endonuclease; see also Linn et al. (eds.) Nucleases, Cold Spring Harbor Laboratory Press, 1993). One or more of these enzymes (or functional fragments thereof) can be used as a source of the cleavage domain and cleavage half-domains.

[0191] Similarly, the cleavage half-domains can be derived from any of the nucleases specified above, or portions thereof, and dimerization is required for cleavage activity. Generally, when a fusion protein contains a cleavage half-domain, two fusion proteins are required for cleavage. Alternatively, a single protein containing two cleavage half-domains can be used. The two cleavage half-domains can be derived from the same endonuclease (or functional fragments thereof), or each cleavage half-domain can be derived from a different endonuclease (or functional fragments thereof). In addition, the target sites for the two fusion proteins are preferably positioned relative to each other such that binding of the two fusion proteins to their respective target sites places the cleavage half-domains in a spatial orientation relative to each other, allowing the cleavage half-domains to form a functional cleavage domain, e.g., by dimerization. Thus, the proximal ends of the target sites can be separated by 5-8 nucleotides or 15-18 nucleotides. However, any integral number of nucleotides or nucleotide pairs can intervene between the two target sites (e.g., from 2 to 50 nucleotide pairs or more). Generally, a cleavage site is present between the target sites.

[0192] Restriction endonucleases (restriction enzymes) exist in many species and can sequence-specifically bind to DNA (at recognition sites) and cleave the DNA at or near the binding site, e.g., thereby integrating one or more exogenous sequences (donor / transgenes) at or near the binding (target) site. Certain restriction enzymes (e.g., type IIS) cleave DNA at sites distal to the recognition site and have separable binding and cleavage domains. For example, the type IIS enzyme FokI catalyzes double-stranded cleavage of DNA, one strand 9 nucleotides from its recognition site and the other 13 nucleotides from its recognition site. See, e.g., U.S. Patent Nos. 5,356,802; 5,436,150 and 5,487,994; and Li et al. (1992) Proc. Natl. Acad. Sci. USA 89:4275-4279; Li et al. (1993) Proc. Natl. Acad. Sci. USA 90:2764-2768; Kim et al. (1994a) Proc. Natl. Acad. Sci. USA 91:883-887; Kim et al. (1994b) J. Biol. Chem. 269:31,978-31,982. Thus, a fusion protein can include a cleavage domain (or cleavage half-domain) from at least one Type IIS restriction enzyme and one or more zinc finger binding domains (engineered or unengineered).

[0193] An exemplary type IIS restriction enzyme (whose cleavage domain is separable from the binding domain) is FokI. This particular enzyme is active as a dimer. Bitinaite et al. (1998) Proc. Natl. Acad. Sci. USA 95: 10,570-10,575. Therefore, for purposes of this disclosure, the portion of the FokI enzyme used in the disclosed fusion proteins is considered to be the cleavage half-domain. Thus, for targeted double-strand cleavage and / or targeted replacement of cellular sequences using zinc finger-FokI fusions, two fusion proteins (each containing a FokI cleavage half-domain) can be used to reconstitute a catalytically active cleavage domain. Alternatively, a single polypeptide molecule containing a DNA-binding domain and two FokI cleavage half-domains can also be used.

[0194] A cleavage domain or cleavage half-domain can be any portion of a protein that retains cleavage activity or retains the ability to multimerize (e.g., dimerize) to form a functional cleavage domain.

[0195] Exemplary Type IIS restriction enzymes are described in U.S. Patent Publication No. 2007 / 0134796. Additional restriction enzymes also contain separable binding and cleavage domains and are contemplated by the present disclosure. See, e.g., Roberts et al. (2003) Nucleic Acids Res. 31:418-420.

[0196] The cleavage domain can comprise one or more engineered cleavage half-domains (also called dimerization domain mutants) that minimize or prevent homodimerization, e.g., as described in U.S. Patent Publication Nos. 2005 / 0064474; 2006 / 0188987 and 2008 / 0131962.

[0197] Alternatively, nucleases can be constructed in vivo at nucleic acid target sites using so-called "cleavage enzyme" technology (see, e.g., U.S. Patent Publication No. 20090068164). The components of such cleavage enzymes can be expressed on separate expression constructs or can be linked in a single open reading frame, where the individual components are separated, for example, by a self-cleaving 2A peptide or an IRES sequence. The components can also be individual zinc finger binding domains or domains of meganuclease nucleic acid binding domains.

[0198] Zinc finger nuclease The chimeric polypeptide can comprise a custom-designed zinc finger nuclease (ZFN) that can be engineered to deliver targeted, site-specific double-stranded DNA breaks (in which exogenous nucleic acids, or donor DNA, can be incorporated) (see U.S. Patent Publication No. 2010 / 0257638). ZFNs are chimeric polypeptides that contain a non-specific cleavage domain derived from a restriction endonuclease (e.g., FokI) and a zinc finger DNA-binding domain polypeptide. For example, Huang et al. (1996) J. Protein Chem. 15:481-9; Kim et al. (1997a) Proc. Natl. Acad. Sci. USA 94:3616-20; Kim et al. (1996) Proc. Natl. Acad. Sci. USA 93:1156-60; Kim et al. (1994) Proc Natl. Sci. USA 91:883-7; Kim et al. (1997b) Proc. Natl. Acad. Sci. USA 94:12875-9; Kim et al. (1997c) Gene 203:43-9; Kim et al. (1998) Biol. Chem. 379:489-95; Nahon and Raveh (1998) Nucleic Acids Res. 26:1233-9; Smith et al. (1999) Nucleic Acids Res. 27:674-81. ZFNs can contain non-canonical zinc finger DNA binding domains (see US Patent Publication No. 2008 / 0182332). The FokI restriction endonuclease must dimerize via the nuclease domain to cleave DNA and introduce double-strand breaks. Consequently, ZFNs containing a nuclease domain derived from such an endonuclease also require dimerization of the nuclease domain to cleave target DNA.Mani et al. (2005) Biochem. Biophys. Res. Commun. 334:1191-7; Smith et al. (2000) Nucleic Acids Res. 28:3361-9. ZFN dimerization can be promoted by two adjacent, inverted DNA-binding sites. Ibid.

[0199] A method for site-specific integration of exogenous nucleic acid into at least one CD163 locus of a host can include introducing a ZFN into a host cell, wherein the ZFN recognizes and binds to a target nucleotide sequence, wherein the target nucleotide sequence is contained in at least one CD163 locus of the host. In some examples, the target nucleotide sequence is not contained in the host genome at any position other than at least one CD163 locus. For example, the DNA-binding polypeptide of the ZFN can be engineered to recognize and bind to a target nucleotide sequence identified in at least one CD163 locus (e.g., by sequencing the CD163 locus). A method for site-specific integration of an exogenous nucleic acid into at least one CD163 locus of a host, comprising introducing a ZFN into a cell of the host, can also comprise introducing the exogenous nucleic acid into the cell, wherein recombination of the exogenous nucleic acid into the host nucleic acid comprising at least one CD163 locus is facilitated by site-specific recognition and binding of the ZFN to a target sequence (and subsequent cleavage of the nucleic acid comprising the CD163 locus).

[0200] Optional exogenous nucleic acid for integration at the CD163 locus Exogenous nucleic acids for integration at the CD163 locus include: exogenous nucleic acids for site-specific integration at at least one CD163 locus, such as, but not limited to, ORFs; nucleic acids comprising a nucleotide sequence encoding a targeting endonuclease; and vectors comprising at least one of either or both of the foregoing. Thus, certain nucleic acids include a nucleotide sequence encoding a polypeptide, a structural nucleotide sequence, and / or a DNA-binding polypeptide recognition and binding site.

[0201] Optional exogenous nucleic acid molecule for site-specific integration As described above, insertion of an exogenous sequence (also referred to as a "donor sequence" or "donor" or "transgene") is provided for, for example, expressing a polypeptide, correcting a mutant gene, or increasing expression of a wild-type gene. It will be readily apparent that the donor sequence is typically not identical to the genomic sequence at the location where it is placed. The donor sequence can contain a non-homologous sequence flanked by two homologous regions, allowing for efficient homology-directed repair (HDR) at the target location. In addition, the donor sequence can comprise a vector molecule containing a sequence that is not homologous to the target region in cellular chromatin. The donor molecule can contain several, discontinuous regions of homology with cellular chromatin. For example, for targeted insertion of a sequence not normally present in the target region, the sequence can be present in the donor nucleic acid molecule and be flanked by regions homologous to a sequence in the target region.

[0202] Donor polynucleotide can be DNA or RNA, single-stranded or double-stranded, and can be introduced into cells in linear or circular form.For example, see US Patent Publication Nos. 2010 / 0047805, 2011 / 0281361, 2011 / 0207221, and 2013 / 0326645.When introduced in linear form, the end of donor sequence can be protected (for example, from exonuclease degradation) by methods known to those skilled in the art.For example, one or more dideoxynucleotide residues are added to the 3' end of linear molecule, and / or self-complementary oligonucleotides are linked to one or both ends.For example, see Chang et al. (1987) Proc. Natl. Acad. Sci. USA 84:4959-4963; Nehls et al. (1996) Science 272:886-889. Additional methods for protecting exogenous polynucleotides from degradation include, but are not limited to, the addition of terminal amino group(s) and modified internucleotide linkages, such as, for example, phosphorothioate, phosphoramidate, and the use of O-methylribose or deoxyribose residues.

[0203] Polynucleotides can be introduced into cells as part of a vector molecule having additional sequences, such as, for example, an origin of replication, a promoter, and a gene encoding antibiotic resistance. Moreover, donor polynucleotides can be introduced as naked nucleic acids, as nucleic acids complexed with agents such as liposomes or poloxamers, or delivered by viruses (e.g., adenovirus, AAV, herpesvirus, retrovirus, lentivirus, and integrase-deficient lentivirus (IDLV)).

[0204] The donor is generally integrated such that its expression is driven by the endogenous promoter of the integration site, i.e., the promoter that drives expression of the endogenous gene (e.g., CD163) into which the donor is integrated. However, it will be apparent that the donor can include a promoter and / or enhancer, e.g., a constitutive promoter or an inducible or tissue-specific promoter.

[0205] Additionally, although not required for expression, the exogenous sequence may also include transcriptional or translational regulatory sequences, such as promoters, enhancers, insulators, internal ribosome entry sites, sequences encoding 2A peptides, and / or polyadenylation signals.

[0206] Exogenous nucleic acids that can be integrated into at least one CD163 locus in a site-specific manner to modify the CD163 locus include, for example, but are not limited to, a nucleic acid comprising a nucleotide sequence encoding a polypeptide of interest; a nucleic acid comprising an agricultural gene; a nucleic acid comprising a nucleotide sequence encoding an RNAi molecule; or a nucleic acid that disrupts the CD163 gene.

[0207] An exogenous nucleic acid can be integrated into the CD163 locus to modify the CD163 locus, wherein the nucleic acid comprises a nucleotide sequence encoding a polypeptide of interest, such that the nucleotide sequence is expressed from the CD163 locus in a host. In some instances, a polypeptide of interest (e.g., a foreign protein) is expressed in commercial quantities from a nucleotide sequence encoding the polypeptide of interest. In such instances, the polypeptide of interest can be extracted from host cells, tissues, or biomass.

[0208] Nucleic acid molecule comprising a nucleotide sequence encoding a targeting endonuclease The nucleotide sequence encoding the targeting endonuclease can be manipulated (e.g., ligation) with the natural nucleotide sequence encoding the polypeptide contained in the targeting endonuclease. For example, the nucleotide sequence of the gene encoding the protein containing the DNA-binding polypeptide can be examined to identify the nucleotide sequence of the gene corresponding to the DNA-binding polypeptide, and this nucleotide sequence can be used as an element of the nucleotide sequence encoding the targeting endonuclease containing the DNA-binding polypeptide. Alternatively, the amino acid sequence of the targeting endonuclease can be used to deduce the nucleotide sequence encoding the targeting endonuclease, for example, according to the degeneracy of the genetic code.

[0209] In exemplary nucleic acid molecules comprising a nucleotide sequence encoding a targeting endonuclease, the last codon of a first polynucleotide sequence encoding a nuclease polypeptide and the first codon of a second polynucleotide sequence encoding a DNA-binding polypeptide can be separated by any number of nucleotide triplets, e.g., without encoding an intron or a "STOP." Similarly, the last codon of a first polynucleotide sequence encoding a DNA-binding polypeptide and the first codon of a second polynucleotide sequence encoding a nuclease polypeptide can be separated by any number of nucleotide triplets. The last codon (i.e., the 3'-most codon in the nucleic acid sequence) of a first polynucleotide sequence encoding a nuclease polypeptide and the second polynucleotide sequence encoding a DNA-binding polypeptide can be fused in phase register with the first codon of an additional polynucleotide coding sequence, either immediately adjacent to it or separated therefrom by only a short peptide sequence, such as a synthetic nucleotide linker (e.g., a nucleotide linker that can be used to achieve the fusion). Examples of such additional polynucleotide sequences include, but are not limited to, tags, targeting peptides, and enzyme cleavage sites. Similarly, the 5'-most (in the nucleic acid sequence) first codons of the first and second polynucleotide sequences can be fused congruently with the last codon of an additional polynucleotide coding sequence, either directly adjacent thereto or separated therefrom by only a short peptide sequence.

[0210] The sequences separating the polynucleotide sequences encoding functional polypeptides (e.g., DNA-binding polypeptides and nuclease polypeptides) within a targeting endonuclease can be composed of, for example, any sequence such that the encoded amino acid sequence is unlikely to significantly alter translation of the targeting endonuclease. Due to the free-standing nature of known nuclease polypeptides and known DNA-binding polypeptides, intervening sequences will not interfere with the individual functions of these structures.

[0211] Other knockout methods A variety of other techniques known in the art can be used to inactivate genes and create knockout animals and / or introduce nucleic acid constructs into animals to create founder animals and generate animal lines in which the knockout or nucleic acid construct is integrated into the genome. Such techniques include, but are not limited to, pronuclear microinjection (U.S. Pat. No. 4,873,191), retrovirus-mediated gene transfer into the germ line (Van der Putten et al. (1985) Proc. Natl. Acad. Sci. USA 82, 6148-1652), gene targeting into embryonic stem cells (Thompson et al. (1989) Cell 56, 313-321), embryo electroporation (Lo (1983) Mol. Cell. Biol. 3, 1803-1814), sperm-mediated gene transfer (Lavitrano et al. (2002) Proc. Natl. Acad. Sci. USA 99, 14230-14235; Lavitrano et al. (2006) Reprod. Fert. Develop. 18, 19-23), and in vitro transformation of somatic cells, such as cumulus or mammary cells, or adult, fetal, or embryonic stem cells, followed by nuclear transfer (Wilmut et al. (1997) Nature 385, 810-813; and Wakayama et al. (1998) Nature 394, 369-374). Pronuclear microinjection, sperm-mediated gene transfer, and somatic cell nuclear transfer are particularly useful techniques. A genomically modified animal is one in which all of its cells, including its germline cells, have the genetic modification. If a method is used to create an animal that is mosaic for its genetic modification, the animal may be inbred, and genomically modified progeny may be selected. If the cell is modified at the blastocyst stage, for example, using cloning, a mosaic animal may be created, or if a single cell is modified, the genome modification can occur. Animals modified to prevent sexual maturity can be homozygous or heterozygous for the modification, depending on the particular approach used.If a particular gene is inactivated by a knockout modification, homozygosity will usually be required. If a particular gene is inactivated by RNA interference or a dominant-negative strategy, then heterozygosity is often sufficient.

[0212] Typically, in embryo / zygote microinjection, nucleic acid constructs or mRNA are introduced into fertilized eggs; one- or two-cell zygotes are used, with the nuclear structure containing sperm heads and egg-derived genetic material visible within the cytoplasm. Pronuclear-stage zygotes can be obtained in vitro or in vivo (i.e., surgically retrieved from the oviducts of donor animals). In vitro fertilized eggs can be produced as follows. For example, pig ovaries can be collected at a slaughterhouse and maintained at 22–28°C during transport. Ovaries can be washed and isolated for follicular aspiration; follicles ranging from 4–8 mm can be aspirated under vacuum using an 18-gauge needle into a 50 mL conical centrifuge tube. Follicular fluid and aspirated oocytes can be rinsed through a prefilter with commercially available TL-HEPES (Minitube, Verona, Wis.). Oocytes surrounded by a dense cumulus mass can be selected and placed in TCM-199 oocyte maturation medium (Minitube, Verona, Wis.) supplemented with 0.1 mg / mL cysteine, 10 ng / mL epidermal growth factor, 10% porcine follicular fluid, 50 μM 2-mercaptoethanol, 0.5 mg / mL cAMP, 10 IU / mL pregnant mare serum gonadotropin (PMSG), and human chorionic gonadotropin (hCG) for approximately 22 hours at 38.7°C and 5% CO2 in humidified air. The oocytes can then be transferred to fresh TCM-199 maturation medium (without cAMP, PMSG, or hCG) and incubated for an additional 22 hours. Mature oocytes can be freed of their cumulus cells by vortexing in 0.1% hyaluronidase for 1 minute.

[0213] In pigs, mature oocytes can be fertilized in 500 μl Minitube PORCPRO IVF medium system (Minitube, Verona, Wis.) in a Minitube 5-well fertilization dish. In preparation for in vitro fertilization (IVF), freshly collected or frozen boar semen can be washed and resuspended to 400,000 sperm in PORCPRO IVF medium. Sperm concentration can be analyzed by computer-assisted semen analysis (SPERMVISION, Minitube, Verona, Wis.). Final in vitro insemination can be performed by boars in a 10 μl volume at a final concentration of approximately 40 motile sperm / oocyte. All fertilized oocytes can be incubated for 6 hours at 38.7°C in a 5.0% CO2 atmosphere. Six hours after insemination, prospective zygotes can be washed twice in NCSU-23 and transferred to 0.5 mL of the same medium. This system is capable of producing 20-30% blastocysts routinely across most boars, with a 10-30% polyspermic insemination rate.

[0214] Linearized nucleic acid constructs or mRNA can be injected into one of the pronuclei or into the cytoplasm. The injected eggs can then be implanted into a female recipient (e.g., into the oviduct of the female recipient) and allowed to develop in the female recipient, resulting in the creation of transgenic or gene-edited animals. In particular, IVF embryos can be centrifuged at 15,000 x g for 5 minutes to sediment lipids, allowing visualization of the pronuclei. Embryos can be injected using an Eppendorf FEMTOJET injector and cultured until blastocyst formation. The rate and characteristics of embryo cleavage and blastocyst formation can be recorded.

[0215] Embryos can be surgically transferred into the uterus of an asynchronous recipient. Typically, 100-200 (e.g., 150-200) embryos can be placed at the ampulla-isthmus junction of the fallopian tube using a 5.5-inch TOMCAT® catheter. After surgery, real-time ultrasound monitoring of the pregnancy can be performed.

[0216] In somatic cell nuclear transfer, transgenic or gene-edited cells containing the nucleic acid constructs described above, such as embryonic blastomeres, fetal fibroblasts, adult ear fibroblasts, or granulosa cells, can be introduced into enucleated oocytes, resulting in the establishment of a hybrid cell. Oocytes can be enucleated by partially dissecting the zona pellucida near the polar body and then extruding the cytoplasm through the dissection area. Typically, an injection pipette with a sharp, beveled tip is used to inject the transgenic or gene-edited cells into enucleated oocytes arrested in meiosis II. In some cases, oocytes arrested in meiosis II are referred to as oocytes. After generating pig or bovine embryos (e.g., by fusing and activating oocytes), the embryos are transferred into the oviducts of female recipients approximately 20–24 hours after activation. See, for example, Cibelli et al. (1998) Science 280, 1256-1258 and U.S. Patent Nos. 6,548,741, 7,547,816, 7,989,657, or 6,211,429. In pigs, female recipients can be checked for pregnancy approximately 20-21 days after embryo transfer.

[0217] Standard breeding techniques can be used to create animals that are homozygous for the inactivated gene from the original heterozygous founder animal.However, homozygosity may not be required.The gene-edited pigs described herein can be bred with other pigs of interest.

[0218] Once a gene-edited animal is created, inactivation of endogenous nucleic acids can be assessed using standard techniques. Initial screening can be accomplished by Southern blot analysis to determine whether inactivation has occurred. For a description of Southern analysis, see sections 9.37-9.52 of Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, 2nd ed., Cold Spring Harbor Press, Plainview, NY. Polymerase chain reaction (PCR) technology can also be used in initial screening. PCR refers to a procedure or technique in which target nucleic acids are amplified. Generally, sequence information from or beyond the edge of the region of interest is used to design oligonucleotide primers that are identical or similar in sequence to the opposite strand of the template to be amplified. PCR can be used to amplify specific sequences from DNA as well as RNA, including sequences from total genomic DNA or total cellular RNA. Primers are typically 14-40 nucleotides in length but can range in length from 10 nucleotides to hundreds of nucleotides. PCR is described, for example, in "PCR Primer: A Laboratory Manual," ed. Dieffenbach and Dveksler, Cold Spring Harbor Laboratory Press, 1995. Nucleic acids can also be amplified by ligase chain reaction, strand displacement amplification, self-sustained sequence replication, or nucleic acid sequence-based amplification. See, for example, Lewis (1992) Genetic Engineering News 12,1; Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87:1874; and Weiss (1991) Science 254:1292. At the blastocyst stage, embryos can be individually processed for analysis by PCR, Southern hybridization, and splinkerette PCR (see, for example, Dupuy et al. Proc Natl Acad Sci USA (2002) 99:4495).

[0219] Interfering RNA Various interfering RNA (RNAi) systems are known. Double-stranded RNA (dsRNA) induces sequence-specific degradation of homologous gene transcripts. The RNA-induced silencing complex (RISC) metabolizes dsRNA into small 21-23 nucleotide small interfering RNAs (siRNAs). RISC contains double-stranded RNAs (dsRNAs, e.g., Dicer) and ssRNAs (e.g., Argonaute 2 or Ago2). RISC uses the antisense strand as a guide to find cleavable targets. Both siRNAs and microRNAs (miRNAs) are known. Methods for gene inactivation in genetically edited animals involve inducing RNA interference against target genes and / or nucleic acids such that expression of the target genes and / or nucleic acids is reduced.

[0220] For example, exogenous nucleic acid sequence can induce RNA interference to the nucleic acid that encodes polypeptide.For example, double-stranded small interfering RNA (siRNA) or short hairpin RNA (shRNA) that is homologous to target DNA can be used to reduce the expression of that DNA.The construct for siRNA can be prepared as described in, for example, Fire et al. (1998) Nature 391:806; Romano and Masino (1992) Mol. Microbiol. 6:3343; Cogoni et al. (1996) EMBO J. 15:3153; Cogoni and Masino (1999) Nature 399:166; Misquitta and Paterson (1999) Proc. Natl. Acad. Sci. USA 96:1451; and Kennerdell and Carthew (1998) Cell 95:1017. Constructs for shRNAs can be made as described by McIntyre and Fanning (2006) BMC Biotechnology 6: 1. Generally, shRNAs are transcribed as single-stranded RNA molecules that contain complementary regions, which can anneal and form short hairpins.

[0221] The probability of finding a single, individual functional siRNA or miRNA directed to a specific gene is high. Although the predictability of the specific sequence of an siRNA is, for example, about 50%, many interfering RNAs can be generated with good certainty that at least one of them will be effective.

[0222] Can be used in vitro cell, in vivo cell or genetically edited animal, such as livestock animal, that expresses RNAi directed to the gene encoding CD163.RNAi can be selected from the group consisting of, for example, siRNA, shRNA, dsRNA, RISC and miRNA.

[0223] Guidance System In order to inactivate the CD163 gene, an inducible system can be used. Various inducible systems are known that allow spatial and temporal control of gene inactivation. Some have been proven to be functional in vivo in pigs.

[0224] One example of an inducible system is the tetracycline (tet)-on promoter system, which can be used to regulate nucleic acid transcription. In this system, a mutant Tet repressor (TetR) is fused to the activation domain of the herpes simplex virus VP16 transactivator protein, creating a tetracycline-controlled transcriptional activator (tTA), which is regulated by tet or doxycycline (dox). In the absence of antibiotics, transcription is minimal, while in the presence of tet or dox, transcription is induced. Another inducible system is the ecdysone or rapamycin system. Ecdysone is an insect molting hormone, and its production is controlled by a heterodimer of the ecdysone receptor and the product of the ultraspiracle gene (USP). Expression is induced by treatment with ecdysone or an ecdysone analog, such as muristerone A. The agent administered to an animal to initiate an inducible system is called an inducer.

[0225] The tetracycline-inducible system and the Cre / loxP recombinase system (constitutive or inducible) are among the more commonly used inducible systems. The tetracycline-inducible system includes a tetracycline-controlled transactivator (tTA) / reverse tTA (rtTA). A method for using these systems in vivo involves generating two lines of genetically edited animals. One line of animals expresses an activator (tTA, rtTA, or Cre recombinase) under the control of a selected promoter. Another line of animals expresses a receptor, in which expression of the gene of interest (or the gene to be modified) is under the control of a target sequence for the tTA / rtTA transactivator (or flanked by loxP sequences). Mating the two animals provides control of gene expression.

[0226] The tetracycline-dependent regulatory system (tet system) relies on two components: a tetracycline-controlled transactivator (tTA or rtTA) and a tTA / rtTA-dependent promoter that controls the expression of downstream cDNA in a tetracycline-dependent manner. In the absence of tetracycline or its derivatives (e.g., doxycycline), tTA binds to the tetO sequence, allowing transcriptional activation of the tTA-dependent promoter. However, in the presence of doxycycline, tTA cannot interact with its target, and transcription does not occur. tet systems using tTA are called tet-OFF because tetracycline or doxycycline allows downregulation of transcription. Administration of tetracycline or its derivatives allows temporal control of transgene expression in vivo. rtTA is a variant of tTA that is not functional in the absence of doxycycline but requires the presence of a ligand for transactivation. Therefore, this tet system is called tet-ON. The tet system has been used in vivo for the inducible expression of several transgenes, for example, encoding reporter genes, oncogenes, or proteins involved in signal transduction cascades.

[0227] The Cre / lox system uses Cre recombinase, which catalyzes site-specific recombination by crossover between two distant Cre recognition sequences, i.e., loxP sites. The DNA sequence introduced between the two loxP sites (called floxed DNA) is excised by Cre-mediated recombination. Controlling Cre expression in transgenic and / or gene-edited animals using either spatial control (through tissue- or cell-specific promoters) or temporal control (through an inducible system) allows for controlled DNA excision between the two loxP sites. One application is for conditional gene inactivation (conditional knockout). Another application is for protein overexpression, where a floxed stop codon is inserted between the promoter sequence and the target DNA. Genetically edited animals do not express the transgene until Cre is expressed and the floxed stop codon is excised. This system has been applied to tissue-specific carcinogenesis and to control antigen receptor expression in B lymphocytes. An inducible Cre recombinase has also been developed. Inducible Cre recombinase is activated only by the administration of an exogenous ligand. It is a fusion protein containing the original Cre recombinase and a specific ligand-binding domain. The functional activity of Cre recombinase depends on the external ligand being able to bind to this specific domain within the fusion protein.

[0228] The in vitro cell, the in vivo cell, or the genetically edited animal, such as livestock animal, can be used, which contains CD163 gene under the control of induction system.The genetic modification of the animal can be genomic or mosaic.The induction system can be selected from the group consisting of Tet-On, Tet-Off, Cre-lox, and Hif1α.

[0229] Vectors and Nucleic Acids Various nucleic acids can be introduced for cell knockout purposes, gene inactivation, gene expression, or other purposes. As used herein, the term nucleic acid includes DNA, RNA, and nucleic acid analogs, as well as double-stranded or single-stranded (i.e., sense or antisense single-stranded) nucleic acids. Nucleic acid analogs can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve the stability, hybridization, or solubility of the nucleic acid. Modifications at the base moiety include deoxyuridine for deoxythymidine, and 5-methyl-2'-deoxycytidine and 5-bromo-2'-deoxycytidine for deoxycytidine. Modifications at the sugar moiety include modifying the 2' hydroxyl of the ribose sugar to form 2'-O-methyl or 2'-O-allyl sugars. The deoxyribose phosphate backbone can be modified to produce morpholino nucleic acids (in which each base moiety is linked to a six-membered morpholino ring) or peptide nucleic acids (in which the deoxyphosphate backbone is replaced by a pseudopeptide backbone and four bases are retained). See Summerton and Weller (1997) Antisense Nucleic Acid Drug Dev. 7(3):187; and Hyrup et al. (1996) Bioorgan. Med. Chem. 4:5. Additionally, the deoxyphosphate backbone can be replaced with, for example, a phosphorothioate or phosphorodithioate backbone, a phosphoramidite, or an alkyl phosphotriester backbone.

[0230] The target nucleic acid sequence can be operably linked to a regulatory region, such as a promoter. The regulatory region can be a porcine regulatory region or can be from another species. As used herein, operably linked refers to the positioning of the regulatory region relative to the nucleic acid sequence so as to allow or promote transcription of the target nucleic acid.

[0231] Any type of promoter can be operably linked to the target nucleic acid sequence. Examples of promoters include, but are not limited to, tissue-specific promoters, constitutive promoters, inducible promoters, and promoters that are responsive or unresponsive to specific stimuli. A suitable tissue-specific promoter can result in preferential expression of a nucleic acid transcript in β cells, such as the human insulin promoter. Other tissue-specific promoters can result in preferential expression in hepatocytes or cardiac tissue, such as the albumin or α-myosin heavy chain promoter, respectively. A promoter that promotes the expression of a nucleic acid molecule without significant tissue or temporal specificity (i.e., a constitutive promoter) can be used. For example, a β-actin promoter, such as the chicken β-actin gene promoter, ubiquitin promoter, miniCAGs promoter, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter, or 3-phosphoglycerate kinase (PGK) promoter, as well as viral promoters, such as the herpes simplex virus thymidine kinase (HSV-TK) promoter, SV40 promoter, or cytomegalovirus (CMV) promoter, can be used. For example, a fusion of the chicken β-actin gene promoter and the CMV enhancer can be used as the promoter. See, e.g., Xu et al. (2001) Hum. Gene Ther. 12:563; and Kiwaki et al. (1996) Hum. Gene Ther. 7:821.

[0232] Additional regulatory regions that may be useful in nucleic acid constructs include, but are not limited to, polyadenylation sequences, translation control sequences (e.g., internal ribosome entry segments, IRES), enhancers, inducible elements, or introns. While such regulatory regions may not be essential, they can increase expression by affecting transcription, mRNA stability, translation efficiency, etc. Such regulatory regions can be included in the nucleic acid construct, as desired, to obtain optimal expression of the nucleic acid in a cell(s). However, sufficient expression can sometimes be obtained without such additional elements.

[0233] Nucleic acid constructs encoding signal peptides or selectable markers can be used. Signal peptides can be used to direct the encoded polypeptide to a specific cellular location (e.g., the cell surface). Non-limiting examples of selectable markers include puromycin, ganciclovir, adenosine deaminase (ADA), aminoglycoside phosphotransferase (neo, G418, APH), dihydrofolate reductase (DHFR), hygromycin-B-phosphotransferase, thymidine kinase (TK), and xanthine-guanine phosphoribosyltransferase (XGPRT). Such markers are useful for selecting stable transformants in culture. Other selectable markers include fluorescent polypeptides, such as green fluorescent protein or yellow fluorescent protein.

[0234] The sequence encoding the selectable marker can be flanked by recognition sequences for a recombinase, such as Cre or Flp. For example, the selectable marker can be flanked by loxP recognition sites (a 34-bp recognition site recognized by Cre recombinase) or FRT recognition sites, allowing the selectable marker to be excised from the construct. For reviews of Cre / lox technology, see Orban, et al., Proc. Natl. Acad. Sci. (1992) 89:6861 and Brand and Dymecki, Dev. Cell (2004) 6:7. Transposons containing a Cre- or Flp-activatable transgene interrupted by a selectable marker gene can also be used to obtain animals with conditional expression of the transgene. For example, the promoter driving expression of the marker / transgene can be either ubiquitous or tissue-specific, resulting in ubiquitous or tissue-specific expression of the marker in F0 animals (e.g., pigs). Tissue-specific activation of a transgene can be achieved, for example, by breeding pigs that ubiquitously express a marker-disrupted transgene to pigs that express Cre or Flp in a tissue-specific manner, or by breeding pigs that express a marker-disrupted transgene in a tissue-specific manner to pigs that ubiquitously express Cre or Flp recombinase. Controlled expression of the transgene or controlled excision of the marker allows for expression of the transgene.

[0235] The exogenous nucleic acid can encode a polypeptide. The nucleic acid sequence encoding the polypeptide can include a tag sequence that encodes a "tag" designed to facilitate subsequent manipulation of the encoded polypeptide (e.g., to facilitate localization or detection). The tag sequence can be inserted into the nucleic acid sequence encoding the polypeptide such that the encoded tag is located at either the carboxyl or amino terminus of the polypeptide. Non-limiting examples of encoded tags include glutathione S-transferase (GST) and FLAG™ tags (Kodak, New Haven, Conn.).

[0236] Nucleic acid constructs can be methylated using SssI CpG methylase (New England Biolabs, Ipswich, Mass.). Generally, nucleic acid constructs can be incubated with S-adenosylmethionine and SssI CpG-methylase in a buffer at 37°C. Hypermethylation can be confirmed by incubating the construct with 1 unit of HinP1I endonuclease for 1 hour at 37°C and assaying by agarose gel electrophoresis.

[0237] Nucleic acid constructs can be introduced into any type of embryonic, fetal, or adult animal cell, such as, for example, germ cells, such as oocytes or eggs, progenitor cells, adult or embryonic stem cells, primordial germ cells, kidney cells, such as PK-15 cells, islet cells, beta cells, hepatocytes, or fibroblasts, such as skin fibroblasts, using a variety of techniques. Non-limiting examples of techniques include transposon systems, recombinant viruses capable of infecting cells, or liposomes or other non-viral methods, such as electroporation, microinjection, or calcium phosphate precipitation, which can deliver nucleic acids to cells.

[0238] In transposon systems, the transcription unit of nucleic acid constructs, i.e., the regulatory region operably linked to exogenous nucleic acid sequences, is flanked by the inverted repeats of transposon.Several transposon systems, such as Sleeping Beauty (see, for example, U.S. Patent No. 6,613,752 and U.S. Patent Publication No. 2005 / 0003542); Frog Prince (Miskey et al. (2003) Nucleic Acids Res. 31:6873); Tol2 (Kawakami (2007) Genome Biology 8(Suppl.1):S7; Minos (Pavlopoulos et al. (2007) Genome Biology 8(Suppl.1):S2); Hsmar1 (Miskey et al. (2007)) Mol Cell Biol. 27:4589); and Passport have been developed for introducing nucleic acid into cells, including mouse, human, and pig cells. The Sleeping Beauty transposon is particularly useful. The transposase can be delivered as a protein encoded on the same nucleic acid construct as the exogenous nucleic acid, can be introduced on a separate nucleic acid construct, or can be provided as mRNA (e.g., in vitro transcribed and capped mRNA).

[0239] Insulator elements can also be included in nucleic acid constructs to maintain the expression of exogenous nucleic acids and prevent unwanted transcription of host genes.See, for example, US Patent Publication No. 2004 / 0203158.Typically, insulator sequences flank both sides of the transcription unit and are located inside the inverted repeat of the transposon.Non-limiting examples of insulator sequences include matrix attachment region (MAR) type insulator sequences and border type insulator sequences.See, for example, US Patent Nos. 6,395,549, 5,731,178, 6,100,448, and 5,610,053, and US Patent Publication No. 2004 / 0203158.

[0240] Nucleic acids can be incorporated into vectors. The term "vector" is a broad term and includes any specific DNA segment designed to migrate from a carrier into target DNA. A vector, also referred to as an expression vector or vector system, is a set of components required for DNA insertion into a genome or other target DNA sequence, such as an episome, a plasmid, or even a viral / phage DNA segment. Vector systems used for gene delivery in animals, such as viral vectors (e.g., retroviruses, adeno-associated viruses, and integrative phage viruses) and non-viral vectors (e.g., transposons), have two basic components: 1) a vector composed of DNA (or RNA that is reverse-transcribed into cDNA) and 2) a transposase, recombinase, or other integrase enzyme that recognizes both the vector and the DNA target sequence and inserts the vector into the target DNA sequence. Vectors often contain one or more expression cassettes, which contain one or more expression control sequences, which are DNA sequences that control and regulate the transcription and / or translation of another DNA sequence or mRNA, respectively.

[0241] Many different types of vectors are known. For example, plasmids and viral vectors, such as retroviral vectors, are known. Mammalian expression plasmids typically have a replication origin, a suitable promoter and optional enhancer, necessary ribosome binding sites, polyadenylation sites, splice donor and acceptor sites, transcription termination sequences, and 5'-flanking non-transcribed sequences. Examples of vectors include: plasmids (which may also be carriers of other types of vectors), adenoviruses, adeno-associated viruses (AAVs), lentiviruses (e.g., modified HIV-1, SIV, or FIV), retroviruses (e.g., ASV, ALV, or MoMLV), and transposons (e.g., Sleeping Beauty, P-elements, Tol-2, Frog Prince, piggyBac).

[0242] As used herein, the term nucleic acid refers to both RNA and DNA, including, for example, cDNA, genomic DNA, synthetic (e.g., chemically synthesized) DNA, and naturally occurring and chemically modified nucleic acids, e.g., containing synthetic bases or alternative backbones. Nucleic acid molecules can be double-stranded or single-stranded (i.e., sense or antisense single strands).

[0243] Founder animals, animal lines, traits, and breeding Founder animals can be produced by cloning and other methods described herein. Founders can be homozygous for genetic modification, such as when zygotes or primary cells undergo homozygous modification. Similarly, heterozygous founders can also be produced. For animals containing at least one modified chromosomal sequence in the gene encoding CD163 protein, founders are preferably heterozygous. Founders can be genomically modified, meaning that all of their cells undergo modification in their genome. Founders can be mosaic for the modification, as can occur when a vector is introduced into one of multiple cells in an embryo, typically at the blastocyst stage. The progeny of mosaic animals can be tested to identify genomically modified progeny. They can be bred sexually or by assisted reproductive technology, and when a pool of animals is produced in which heterozygous or homozygous progeny consistently express the modification, an animal line is established.

[0244] In livestock, many alleles are known to be associated with various traits, such as production traits, body type traits, processability traits, and other functional traits. Those skilled in the art are familiar with monitoring and quantifying these traits, for example, Visscher et al., Livestock Production Science, 40 (1994) 123-137, U.S. Patent No. 7,709,206, U.S. Patent No. US2001 / 0016315, U.S. Patent No. US2011 / 0023140, and U.S. Patent No. US2005 / 0153317. Animal lines may include traits selected from the group consisting of production traits, body type traits, processability traits, fertility traits, maternal traits, and disease resistance traits. Additional traits include the expression of recombinant gene products.

[0245] Animals with one or more desired traits can be modified to prevent their sexual maturation. Because animals cannot reproduce until they reach maturity, sexual maturation can be regulated as a means of controlling animal reproduction. Animals bred or modified to have one or more traits can thus be provided to recipients with reduced risk of the recipient breeding the animals and appropriating the value of the trait. For example, the genome of an animal can be genetically modified, where the modification includes inactivating a sexual maturation gene, where the sexual maturation gene in a wild-type animal expresses a factor selective for sexual maturation. The animal can be treated by administering a compound that treats the deficiency caused by the loss of expression of a gene that induces sexual maturation in the animal.

[0246] Breeding of animals requiring administration of a compound to induce sexual maturity can be conveniently accomplished in a treatment facility. Treatment facilities can implement standardized protocols with well-controlled lines, efficiently producing consistent animals. Animal progeny can be distributed to multiple locations for breeding. Farms and farmers (a term that includes ranches and ranchers) can thus order a desired number of progeny with a specific range of age and / or weight and / or traits and have them delivered at a desired time and / or location. Recipients, for example, farmers, can then raise the animals and deliver them to market as they wish.

[0247] Genetically modified livestock animals with inactivated maturation genes can be delivered (e.g., to one or more locations, multiple farms). The animals can be between about 1 day and about 180 days old. The animals can have one or more traits (e.g., expressing a desired trait or a high-value trait or a novel trait or a recombinant trait).

[0248] Breeding methods and animal populations for increasing resistance of animals to infections Provided herein is a breeding method for producing animals or lines that have reduced susceptibility to pathogen infection.The method comprises: genetically modifying oocytes or sperm cells, so that modified chromosomal sequences in the gene encoding CD163 protein are introduced into at least one of oocytes and sperm cells; and fertilizing the oocytes with sperm cells to produce zygotes that contain modified chromosomal sequences in the gene encoding CD163 protein.Alternatively, the method comprises genetically modifying zygotes, so that modified chromosomal sequences in the gene encoding CD163 protein are introduced into zygotes.The method further comprises: implanting the zygotes into surrogate female animals, whereby offspring animals are produced by pregnancy and full-term birth; screening the offspring animals for pathogen susceptibility; and selecting offspring animals that have reduced susceptibility to pathogens compared with animals that do not contain modified chromosomal sequences in the gene encoding CD163 protein.

[0249] Another breeding method is provided for producing animals or lines with reduced susceptibility to pathogen infection. The method includes genetically modifying oocytes or sperm cells to introduce a modified chromosomal sequence in the gene encoding CD163 protein into at least one of the oocytes and sperm cells, and fertilizing the oocyte with the sperm cell to produce a zygote containing the modified chromosomal sequence in the gene encoding CD163 protein. Alternatively, the method includes genetically modifying a fertilized egg to introduce the modified chromosomal sequence in the gene encoding CD163 protein into the zygote. The method further includes implanting the fertilized egg into a surrogate female animal (wherein pregnancy and full-term birth produce offspring animals); screening the offspring animals for susceptibility to pathogens; and selecting offspring animals with reduced susceptibility to pathogens compared to animals that do not contain the modified chromosomal sequence in the gene encoding CD163 protein. The modified chromosomal sequence results in the offspring animals producing substantially non-functional CD163 protein.

[0250] Yet another breeding method is provided for producing animals or lines with reduced susceptibility to pathogen infection. The method comprises genetically modifying oocytes or sperm cells to introduce a modified chromosomal sequence in the gene encoding CD163 protein into at least one of the oocytes and sperm cells, and fertilizing the oocyte with the sperm cell to produce a zygote comprising a modified chromosomal sequence in the gene encoding CD163 protein. Alternatively, the method comprises genetically modifying a fertilized egg to introduce a modified chromosomal sequence in the gene encoding CD163 protein into the zygote. The method further comprises implanting the fertilized egg into a surrogate female animal (wherein pregnancy and full-term birth produce offspring animals); screening the offspring animals for susceptibility to pathogens; and selecting offspring animals with reduced susceptibility to pathogens compared to animals that do not contain the modified chromosomal sequence in the gene encoding CD163 protein. The modified chromosomal sequence comprises an in-frame deletion in the gene encoding CD163 protein.

[0251] The pathogen preferably comprises a virus, for example PRRSV.

[0252] For example, the modification can reduce susceptibility to type 1 PRRSV virus, type 2 PRRSV, or both type 1 and type 2 PRRSV viruses.

[0253] The modifications may reduce susceptibility to a PRRSV isolate selected from the group consisting of NVSL97-7895, KS06-72109, P129, VR2332, CO90, AZ25, MLV-ResPRRS, KS62-06274, KS483 (SD23983), CO84, SD13-15, Lelystad, 03-1059, 03-1060, SD01-08, 4353PZ, and combinations thereof.

[0254] The animal can be an embryo, juvenile, or adult.

[0255] The animals can include farm animals. Farm animals can include livestock animals, such as porcine animals, bovine animals (e.g., beef cattle or dairy cattle), ovine animals, caprine animals, equine animals (e.g., horses or donkeys), buffalo, camels, or avian animals (e.g., chickens, turkeys, ducks, geese, guinea fowl, or chicks). The livestock animals are preferably bovine or porcine animals, and most preferably porcine animals.

[0256] The step of genetically modifying oocytes, sperm cells, or fertilized eggs can include genetic editing of oocytes, sperm cells, or fertilized eggs. Genetic editing can include the use of a homing endonuclease. The homing endonuclease can be a naturally occurring endonuclease, but preferably a rationally designed, non-naturally occurring homing endonuclease with a DNA recognition sequence designed to target the chromosomal sequence in the gene encoding the CD163 protein. Thus, the homing endonuclease can be a designed homing endonuclease. The homing endonuclease can include, for example, a clustered regularly interspaced short palindromic repeats (CRISPR) / Cas9 system, a transcription activator-like effector nuclease (TALEN), a zinc finger nuclease (ZFN), a recombinase fusion protein, a meganuclease, or a combination thereof. Genetic editing preferably includes the use of a CRISPR / Cas9 system.

[0257] The oocyte, sperm cell, or zygote can be heterozygous for the altered chromosomal sequence, or the oocyte, sperm cell, or zygote can be homozygous for the altered chromosomal sequence.

[0258] The modified chromosomal sequence can include an insertion in the gene encoding the CD163 protein, a deletion in the gene encoding the CD163 protein, or a combination thereof. For example, the modified chromosomal sequence can include a deletion (e.g., an in-frame deletion) in the gene encoding the CD163 protein. Alternatively, the modified chromosomal sequence can include an insertion in the gene encoding the CD163 protein.

[0259] The insertion or deletion can reduce CD163 protein production or activity compared to CD163 protein production or activity in an animal lacking the insertion or deletion.

[0260] The insertion or deletion may result in the animal producing a substantially non-functional CD163 protein. By "substantially non-functional CD163 protein" is meant that the level of CD163 protein in the animal, its offspring, or cells is undetectable, or, if detectable, is at least about 90% lower than the level observed in an animal, its offspring, or cells that does not contain the insertion or deletion.

[0261] When the animal is a porcine animal, the modified chromosomal sequence may comprise a modification in exon 7 of the gene encoding the CD163 protein, exon 8 of the gene encoding the CD163 protein, an intron adjacent to exon 7 or exon 8 of the gene encoding the CD163 protein, or a combination thereof. The modified chromosomal sequence preferably comprises a modification in exon 7 of the gene encoding the CD163 protein.

[0262] The modification in exon 7 of the gene encoding the CD163 protein can comprise a deletion (e.g., an in-frame deletion in exon 7). Alternatively, the modification in exon 7 of the gene encoding the CD163 protein can comprise an insertion.

[0263] If the animal is a porcine animal, the modified chromosomal sequence can include: (a) SEQ ID NO:118; or (b) a modification selected from the group consisting of: an 11 base pair deletion from nucleotide 3,137 to nucleotide 3,147 relative to reference sequence SEQ ID NO:47; a 2 base pair insertion between nucleotides 3,149 and 3,150 relative to reference sequence SEQ ID NO:47 and, on the same allele, a 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 relative to reference sequence SEQ ID NO:47; a 124 base pair deletion from nucleotide 3,024 to nucleotide 3,147 relative to reference sequence SEQ ID NO:47; a 123 base pair deletion from nucleotide 3,024 to nucleotide 3,146 relative to reference sequence SEQ ID NO:47; a 1 base pair insertion between nucleotide 3,147 and nucleotide 3,148 relative to reference sequence SEQ ID NO:47; a 130 base pair deletion from nucleotide 3,030 to nucleotide 3,159 relative to reference sequence SEQ ID NO:47; a 132 base pair deletion from nucleotide 3,030 to nucleotide 3,161 relative to reference sequence SEQ ID NO:47; a 1506 base pair deletion from nucleotide 1,525 to nucleotide 3,030 relative to reference sequence SEQ ID NO:47; a 7 base pair insertion between nucleotide 3,148 and nucleotide 3,149 relative to reference sequence SEQ ID NO:47; a 1280 base pair deletion from nucleotide 2,818 to nucleotide 4,097 relative to reference sequence SEQ ID NO:47; a 1373 base pair deletion from nucleotide 2,724 to nucleotide 4,096 relative to reference sequence SEQ ID NO:47; a 1467 base pair deletion from nucleotide 2,431 to nucleotide 3,897 relative to reference sequence SEQ ID NO:47 a 1930 base pair deletion from nucleotide 488 to nucleotide 2,417 compared to reference sequence SEQ ID NO:47, where the deleted sequence is replaced with a 12 base pair insertion beginning at nucleotide 488, as well as an additional 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 compared to reference sequence SEQ ID NO:47;a 28 base pair deletion from nucleotide 3,145 to nucleotide 3,172 relative to reference sequence SEQ ID NO:47; a 1387 base pair deletion from nucleotide 3,145 to nucleotide 4,531 relative to reference sequence SEQ ID NO:47; a 1382 base pair deletion from nucleotide 3,113 to nucleotide 4,494 relative to reference sequence SEQ ID NO:47, wherein the deleted sequence is replaced with an 11 base pair insertion beginning at nucleotide 3,113; a 1720 base pair deletion from nucleotide 2,440 to nucleotide 4,160 relative to reference sequence SEQ ID NO:47; a 452 base pair deletion from nucleotide 3,015 to nucleotide 3,466 relative to reference sequence SEQ ID NO:47; or a combination thereof.

[0264] When the porcine animal comprises a two base pair insertion between nucleotides 3,149 and 3,150 compared to the reference sequence SEQ ID NO:47, the two base pair insertion can comprise the insertion of the dinucleotide AG.

[0265] When the porcine animal comprises a single base pair insertion between nucleotides 3,147 and 3,148 compared to the reference sequence SEQ ID NO:47, the single base pair insertion can comprise the insertion of a single adenine residue.

[0266] If the porcine animal comprises a 7 base pair insertion between nucleotides 3,148 and 3,149 compared to the reference sequence SEQ ID NO:47, the 7 base pair insertion can comprise the sequence TACTACT (SEQ ID NO:115).

[0267] If the porcine animal contains a 1,930 base pair deletion from nucleotide 488 to nucleotide 2,417 relative to the reference sequence SEQ ID NO:47, where the deleted sequence is replaced with a 12 base pair insertion beginning at nucleotide 488, and there is an additional 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 relative to the reference sequence SEQ ID NO:47, where the 12 base pair insertion comprises the sequence TGTGGAGAATTC (SEQ ID NO:116).

[0268] If the porcine animal comprises a 1,382 base pair deletion from nucleotide 3,113 to nucleotide 4,494 relative to the reference sequence SEQ ID NO:47, where the deleted sequence is replaced with an 11 base pair insertion beginning at nucleotide 3,113, the 11 base pair insertion can comprise the sequence AGCCAGCGTGC (SEQ ID NO:117).

[0269] If the modified chromosomal sequence in the gene encoding the CD163 protein comprises a deletion, the deletion preferably comprises an in-frame deletion. Thus, when the animal is a porcine animal, the insertion or deletion in the gene encoding the CD163 protein can comprise an in-frame deletion in exon 7 selected from the group consisting of: a 1506 base pair deletion from nucleotide 1,525 to nucleotide 3,030 relative to reference sequence SEQ ID NO:47; a 1930 base pair deletion from nucleotide 488 to nucleotide 2,417 relative to reference sequence SEQ ID NO:47, where the deleted sequence is replaced with a 12 base pair insertion starting at nucleotide 488, and there is an additional 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 relative to reference sequence SEQ ID NO:47; a 1373 base pair deletion from nucleotide 2,724 to nucleotide 4,096 relative to reference sequence SEQ ID NO:47; a 123 base pair deletion from nucleotide 3,024 to nucleotide 3,146 relative to reference sequence SEQ ID NO:47; a 1,467 base pair deletion from nucleotide 2,431 to nucleotide 3,897 relative to reference sequence SEQ ID NO:47; a 1,387 base pair deletion from nucleotide 3,145 to nucleotide 4,531 relative to reference sequence SEQ ID NO:47; a 1,382 base pair deletion from nucleotide 3,113 to nucleotide 4,494 relative to reference sequence SEQ ID NO:47, wherein the deleted sequence is replaced with an 11 base pair insertion starting at nucleotide 3,113; a 1,720 base pair deletion from nucleotide 2,440 to nucleotide 4,160 relative to reference sequence SEQ ID NO:47; and combinations thereof.

[0270] When the animal is a porcine animal, the insertion or deletion can be selected from the group consisting of: a 2 base pair insertion between nucleotides 3,149 and 3,150 relative to the reference sequence SEQ ID NO:47, and, in the same allele, a 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 relative to the reference sequence SEQ ID NO:47; a 28 base pair deletion from nucleotide 3,145 to nucleotide 3,172 relative to the reference sequence SEQ ID NO:47; a 452 base pair deletion from nucleotide 3,015 to nucleotide 3,466 relative to the reference sequence SEQ ID NO:47; and combinations thereof.

[0271] For example, the modified chromosomal sequence can include a 2 base pair insertion between nucleotides 3,149 and 3,150 compared to the reference sequence SEQ ID NO:47, and a 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 in the same allele compared to the reference sequence SEQ ID NO:47.

[0272] The modified chromosomal sequence can include a 28 base pair deletion from nucleotide 3,145 to nucleotide 3,172 relative to the reference sequence SEQ ID NO:47.

[0273] The modified chromosomal sequence can include a 452 base pair deletion from nucleotide 3,015 to nucleotide 3,466 relative to the reference sequence SEQ ID NO:47.

[0274] The modified chromosomal sequence can include any combination of the modified chromosomal sequences described herein.

[0275] For example, the modified chromosomal sequence can include: a 7 base pair insertion between nucleotide 3,148 and nucleotide 3,149 in one allele of the gene encoding the CD163 protein compared to the reference sequence SEQ ID NO:47; and an 11 base pair deletion from nucleotide 3,137 to nucleotide 3,147 in the other allele of the gene encoding the CD163 protein compared to the reference sequence SEQ ID NO:47.

[0276] The modified chromosomal sequences can include: a 7 base pair insertion between nucleotide 3,148 and nucleotide 3,149 in one allele of the gene encoding the CD163 protein, relative to the reference sequence SEQ ID NO:47; and a 1,382 base pair deletion from nucleotide 3,113 to nucleotide 4,494 in the other allele of the gene encoding the CD163 protein, relative to the reference sequence SEQ ID NO:47, wherein the deleted sequence is replaced with an 11 base pair insertion beginning at nucleotide 3,113.

[0277] The modified chromosomal sequence can include: SEQ ID NO:118 in one allele of the gene encoding the CD163 protein; and an 11 base pair deletion from nucleotide 3,137 to nucleotide 3,147 in the other allele of the gene encoding the CD163 protein compared to the reference sequence SEQ ID NO:47.

[0278] The modified chromosomal sequence can include: SEQ ID NO:118 in one allele of the gene encoding the CD163 protein; and, in the other allele of the gene encoding the CD163 protein, a 2 base pair insertion between nucleotides 3,149 and 3,150 compared to the reference sequence SEQ ID NO:47, and a 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 compared to the reference sequence SEQ ID NO:47.

[0279] The modified chromosomal sequence can include: a 1,280 base pair deletion from nucleotide 2,818 to nucleotide 4,097 in one allele of the gene encoding the CD163 protein compared to the reference sequence SEQ ID NO:47; and an 11 base pair deletion from nucleotide 3,137 to nucleotide 3,147 in the other allele of the gene encoding the CD163 protein compared to the reference sequence SEQ ID NO:47.

[0280] The modified chromosomal sequence can include: a 1,280 base pair deletion from nucleotide 2,818 to nucleotide 4,097 in one allele of the gene encoding the CD163 protein compared to the reference sequence SEQ ID NO:47; and a 2 base pair insertion between nucleotides 3,149 and 3,150 in the other allele of the gene encoding the CD163 protein compared to the reference sequence SEQ ID NO:47 and a 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 in the other allele of the gene encoding the CD163 protein compared to the reference sequence SEQ ID NO:47.

[0281] The modified chromosomal sequence can include: in one allele of the gene encoding the CD163 protein, a 1,930 base pair deletion from nucleotide 488 to nucleotide 2,417 relative to the reference sequence SEQ ID NO:47, where the deleted sequence is replaced with a 12 base pair insertion starting at nucleotide 488, and there is an additional 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 relative to the reference sequence SEQ ID NO:47; and in the other allele of the gene encoding the CD163 protein, a 2 base pair insertion between nucleotides 3,149 and 3,150 relative to the reference sequence SEQ ID NO:47, and a 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 relative to the reference sequence SEQ ID NO:47.

[0282] The modified chromosomal sequence can include: SEQ ID NO:118 in one allele of the gene encoding the CD163 protein; and in the other allele of the gene encoding the CD163 protein, a 1,930 base pair deletion from nucleotide 488 to nucleotide 2,417 relative to the reference sequence SEQ ID NO:47, where the deleted sequence is replaced with a 12 base pair insertion starting at nucleotide 488, as well as an additional 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 relative to the reference sequence SEQ ID NO:47.

[0283] The modified chromosomal sequence can include: in one allele of the gene encoding the CD163 protein, a 1,930 base pair deletion from nucleotide 488 to nucleotide 2,417 relative to the reference sequence SEQ ID NO:47, where the deleted sequence is replaced with a 12 base pair insertion starting at nucleotide 488, and there is an additional 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 relative to the reference sequence SEQ ID NO:47; and in the other allele of the gene encoding the CD163 protein, an 11 base pair deletion from nucleotide 3,137 to nucleotide 3,147 relative to the reference sequence SEQ ID NO:47.

[0284] The modified chromosomal sequence can include: a 1,467 base pair deletion from nucleotide 2,431 to nucleotide 3,897 in one allele of the gene encoding the CD163 protein compared to the reference sequence SEQ ID NO:47; and a 2 base pair insertion between nucleotides 3,149 and 3,150 in the other allele of the gene encoding the CD163 protein compared to the reference sequence SEQ ID NO:47 and a 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 in the other allele of the gene encoding the CD163 protein compared to the reference sequence SEQ ID NO:47.

[0285] The modified chromosomal sequence can include: a 1,467 base pair deletion from nucleotide 2,431 to nucleotide 3,897 in one allele of the gene encoding the CD163 protein compared to the reference sequence SEQ ID NO:47; and an 11 base pair deletion from nucleotide 3,137 to nucleotide 3,147 in the other allele of the gene encoding the CD163 protein compared to the reference sequence SEQ ID NO:47.

[0286] A modified chromosomal sequence containing any of the insertions or deletions described above can contain chromosomal sequences outside the insertion or deletion that have a high degree of sequence identity to SEQ ID NO: 47. Thus, for example, an oocyte, sperm cell, or zygote can contain chromosomal sequences that have at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, at least 99.9%, or 100% sequence identity to SEQ ID NO: 47 in a region of the chromosomal sequence outside the insertion or deletion.

[0287] The modified chromosomal sequence can include a chromosomal sequence comprising SEQ ID NO:98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 118, or 119. As further described in the Examples below, SEQ ID NOs. 98-114 and 119 provide nucleotide sequences for regions corresponding to those of wild-type porcine CD163 provided in SEQ ID NO:47 and contain insertions or deletions in the porcine CD163 chromosomal sequence described herein. SEQ ID NO:118 provides a sequence for a region corresponding to those of wild-type porcine CD163 provided by SEQ ID NO:47, in which exon 7 has been replaced with a synthetic exon encoding a homolog of SRCR8 of human CD163-like 1 protein (hCD163L1).

[0288] For example, the modified chromosomal sequence can include a chromosomal sequence comprising SEQ ID NO: 98, 101, 105, 109, 110, 112, 113, or 114. SEQ ID NO: 98, 101, 105, 109, 110, 112, 113, or 114 provide the nucleotide sequence for an in-frame deletion in exon 7 of the porcine CD163 chromosomal sequence.

[0289] As another example, the modified chromosomal sequence can include a chromosomal sequence comprising SEQ ID NO:103, 111, or 119.

[0290] The modified chromosomal sequence can include an 11 base pair deletion in one allele of the gene encoding the CD163 protein and a 2 base pair insertion and a 377 base pair deletion in the other allele of the gene encoding the CD163 protein.

[0291] The modified chromosomal sequence can comprise a 124 base pair deletion in one allele of the gene encoding the CD163 protein and a 123 base pair deletion in the other allele of the gene encoding the CD163 protein.

[0292] The modified chromosomal sequence can include a single base pair insertion.

[0293] The modified chromosomal sequence can comprise a 130 base pair deletion in one allele of the gene encoding the CD163 protein and a 132 base pair deletion in the other allele of the gene encoding the CD163 protein.

[0294] The modified chromosomal sequence can include a 1506 base pair deletion.

[0295] The modified chromosomal sequence can include a 7 base pair insertion.

[0296] The modified chromosomal sequence can comprise a 1280 base pair deletion in one allele of the gene encoding the CD163 protein and a 1373 base pair deletion in the other allele of the gene encoding the CD163 protein.

[0297] The modified chromosomal sequence can include a 1467 base pair deletion.

[0298] The modified chromosomal sequence can include a 1930 base pair intron 6 deletion from nucleotide 488 to nucleotide 2,417, and a 12 base pair insertion in exon 7 at nucleotide 4,488 and an additional 129 base pair deletion.

[0299] The modified chromosomal sequence can include a 28 base pair deletion in one allele of the gene encoding the CD163 protein and a 1387 base pair deletion in the other allele of the gene encoding the CD163 protein.

[0300] The modified chromosomal sequence can include a 1382 base pair deletion and an 11 base pair insertion in one allele of the gene encoding the CD163 protein, and a 1720 base pair deletion in the other allele of the gene encoding the CD163 protein.

[0301] In either breeding method, selected animals can be used as founder animals.

[0302] In any of the breeding methods, fertilization can include artificial insemination.

[0303] Also provided are animal populations produced by any of the breeding methods. The animal populations are preferably resistant to infection by pathogens, such as viruses, such as PRRSV. For example, the populations can be resistant to infection by PRRSV type 1 viruses, PRRSV type 2 viruses, or both PRRSV type 1 and type 2 viruses. The populations can be resistant to infection by PRRSV isolates selected from the group consisting of NVSL97-7895, KS06-72109, P129, VR2332, CO90, AZ25, MLV-ResPRRS, KS62-06274, KS483 (SD23983), CO84, SD13-15, Lelystad, 03-1059, 03-1060, SD01-08, 4353PZ, and combinations thereof.

[0304] Also provided is a method for increasing the resistance of livestock animals to pathogen infection.The method comprises genetically editing at least one chromosomal sequence from the gene encoding CD163 protein, thereby reducing the CD163 protein production or activity compared with the CD163 protein production or activity in livestock animals that do not contain the edited chromosomal sequence in the gene encoding CD163 protein.The pathogen preferably comprises a virus (for example, PRRSV).

[0305] Another method for increasing resistance to pathogen infection in a livestock animal is provided, comprising genetically editing at least one chromosomal sequence from a gene encoding the CD163 protein, such that the livestock animal produces a substantially non-functional CD163 protein.

[0306] Provided is another method for increasing the resistance of livestock animals to pathogen infection.Method comprises: genetically editing at least one chromosomal sequence from the gene encoding CD163 protein, and introducing in-frame deletion, wherein the CD163 protein production or activity in livestock animals is reduced compared with the CD163 protein production or activity in livestock animals that do not contain the edited chromosomal sequence in the gene encoding CD163 protein.In-frame deletion can be, for example, any of the in-frame deletions described herein.

[0307] nucleic acid Nucleic acids are provided. The nucleic acid molecules can comprise a nucleotide sequence selected from the group consisting of: (a) a nucleotide sequence comprising SEQ ID NO:47; (b) a nucleotide sequence having at least 80% sequence identity to the sequence of SEQ ID NO:47, wherein the nucleotide sequence contains at least one substitution, insertion, or deletion relative to SEQ ID NO:47; and (c) a cDNA sequence of (a) or (b).

[0308] Alternatively, the nucleic acid may comprise: (a) a nucleotide sequence having at least 87.5% sequence identity to the sequence of SEQ ID NO:47, wherein said nucleotide sequence contains at least one substitution, insertion, or deletion relative to SEQ ID NO:47; and (b) the cDNA sequence of (a).

[0309] Any of the nucleic acid molecules described herein can be an isolated nucleic acid molecule.

[0310] For example, the isolated nucleic acid can comprise a nucleotide sequence comprising SEQ ID NO:47.

[0311] Alternatively, the nucleic acid can comprise a nucleotide sequence having at least 80% sequence identity to the sequence of SEQ ID NO:47, wherein said nucleotide sequence comprises at least one substitution, insertion, or deletion relative to SEQ ID NO:47. The nucleic acid can comprise a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 99.9% sequence identity to the sequence of SEQ ID NO:47, wherein said nucleotide sequence comprises at least one substitution, insertion, or deletion relative to SEQ ID NO:47.

[0312] The nucleic acid molecule preferably has at least 87.5% sequence identity to the sequence of SEQ ID NO:47, wherein the nucleotide sequence contains at least one substitution, insertion, or deletion relative to SEQ ID NO:47.

[0313] The substitution, insertion, or deletion preferably reduces or eliminates CD163 protein production or activity compared to a nucleic acid that does not contain the substitution, insertion, or deletion.

[0314] The nucleic acid can comprise SEQ ID NO:98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 118, or 119.

[0315] For example, the nucleic acid can include SEQ ID NO:98, 101, 105, 109, 110, 112, 113, or 114.

[0316] For example, the nucleic acid can include SEQ ID NO:103, 111, or 119.

[0317] The nucleic acid can comprise cDNA.

[0318] Further nucleic acids are provided. The nucleic acids can include SEQ ID NOs: 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 118, or 119. For example, the nucleic acids can include SEQ ID NOs: 98, 101, 105, 109, 110, 112, 113, or 114. As another example, the nucleic acids can include SEQ ID NOs: 103, 111, or 119.

[0319] Having described the invention in detail, it will be apparent that modifications and variations are possible without departing from the scope of the invention as defined in the appended claims. The present disclosure relates, for example, to the following: [Section 1] A non-human animal or a descendant thereof or animal cell comprising at least one modified chromosomal sequence in the gene encoding the CD163 protein. [Section 2] 2. The animal, progeny, or cell of paragraph 1, wherein the modification reduces the susceptibility of the animal, progeny, or cell to infection by a pathogen compared to the susceptibility of an animal, progeny, or cell that does not contain the modified chromosomal sequence in the gene encoding the CD163 protein to infection by the pathogen. [Section 3] Item 3. The animal, its offspring, or its cells of Item 2, wherein the pathogen comprises a virus. [Section 4] Item 4. The animal, its descendants, or the cells according to Item 3, wherein the virus comprises porcine reproductive and respiratory syndrome virus (PRRSV). [Section 5] Item 5. The animal, progeny, or cell of item 4, wherein the modification reduces the susceptibility of the animal, progeny, or cell to type 1 PRRSV virus, type 2 PRRSV, or both type 1 and type 2 PRRSV viruses. [Section 6] 6. The animal, progeny, or cell of paragraph 5, wherein the modification reduces the susceptibility of the animal, progeny, or cell to a PRRSV isolate selected from the group consisting of NVSL97-7895, KS06-72109, P129, VR2332, CO90, AZ25, MLV-ResPRRS, KS62-06274, KS483 (SD23983), CO84, SD13-15, Lelystad, 03-1059, 03-1060, SD01-08, 4353PZ, and combinations thereof. [Section 7] Item 7. The animal, its offspring, or the cell of any one of items 1 to 6, wherein the animal or its offspring is an embryo, a juvenile, or an adult, or the cell comprises an embryonic cell, a cell derived from a juvenile animal, or a cell derived from an adult animal. [Section 8] Item 8. The animal, its descendants, or cells according to any one of Items 1 to 7, wherein the animal or its descendants include domestic animals, or the cells include cells derived from domestic animals. [Section 9] Item 9. The animal, its offspring, or the cell of Item 8, wherein the domesticated animal includes a livestock animal. [Section 10] 10. The animal, its descendants, or cells of paragraph 9, wherein the livestock animal is selected from the group consisting of a porcine animal, a bovine animal, an ovine animal, a caprine animal, an equine animal, a buffalo, a camel, or an avian animal. [Section 11] Item 11. The animal, progeny, or cell of Item 10, wherein the bovine animal comprises a beef cattle or dairy cattle. [Section 12] 11. The animal, progeny, or cell of paragraph 10, wherein the avian animal comprises a chicken, turkey, duck, goose, guinea fowl, or chick. [Section 13] Item 11. The animal, progeny, or cell of Item 10, wherein the equine animal comprises a horse or a donkey. [Section 14] Item 11. The animal, progeny, or cell of paragraph 10, wherein the livestock animal is a bovine or porcine animal. [Section 15] Item 15. The animal, offspring, or cell of Item 14, wherein the livestock animal is a porcine animal. [Section 16] Item 16. The animal, its descendants, or the cell of any one of items 1 to 15, wherein the animal or its descendants comprises a genetically edited animal or its descendants, and the cell comprises a genetically edited cell. [Section 17] 17. The animal, its offspring, or the cell of paragraph 16, wherein the animal or cell has been genetically edited using a homing endonuclease. [Section 18] 18. The animal, offspring, or cell of paragraph 17, wherein said homing endonuclease comprises an engineered homing endonuclease. [Section 19] 19. The animal, its descendants, or cells of paragraph 17 or 18, wherein the homing endonuclease comprises a clustered regularly interspaced short palindromic repeats (CRISPR) / Cas9 system, a transcription activator-like effector nuclease (TALEN), a zinc finger nuclease (ZFN), a recombinase fusion protein, a meganuclease, or a combination thereof. [Section 20] 20. The animal, its descendants, or the cells of any one of paragraphs 16 to 19, wherein the animal or cells are genetically edited using the CRISPR / Cas9 system. [Section 21] 21. The animal, progeny, or cell of any one of paragraphs 16 to 20, wherein the edited animal, progeny, or cell exhibits increased resistance to PRRSV compared to a non-edited animal. [Section 22] Item 22. The animal, offspring, or cell of any one of items 1 to 21, wherein the animal, offspring, or cell is heterozygous for the modified chromosomal sequence. [Section 23] Item 22. The animal, offspring, or cell of any one of items 1 to 21, wherein the animal, offspring, or cell is homozygous for the modified chromosomal sequence. [Section 24] 24. The animal, its offspring, or the cell of any one of items 1 to 23, wherein the modified chromosomal sequence comprises an insertion in the gene encoding the CD163 protein, a deletion in the gene encoding the CD163 protein, or a combination thereof. [Section 25] 25. The animal, offspring, or cell of paragraph 24, wherein the modified chromosomal sequence comprises a deletion in the gene encoding the CD163 protein. [Section 26] 26. The animal, offspring, or cell of paragraph 24 or 25, wherein the deletion comprises an in-frame deletion. [Section 27] 27. The animal, its offspring, or the cell of any one of items 24 to 26, wherein the modified chromosomal sequence comprises an insertion in the gene encoding the CD163 protein. [Section 28] 28. The animal, offspring, or cell of any one of paragraphs 1 to 27, wherein the modified chromosomal sequence causes reduced CD163 protein production or activity compared to CD163 protein production or activity in an animal, offspring, or cell lacking the modified chromosomal sequence. [Section 29] 29. The animal, its offspring, or the cell of any one of paragraphs 1 to 28, wherein the altered chromosomal sequence results in the production of a substantially non-functional CD163 protein by the animal, its offspring, or the cell. [Section 30] 30. The pig animal, offspring, or cell according to any one of items 15 to 29, wherein the modified chromosomal sequence comprises a modification in exon 7 of the gene encoding the CD163 protein, exon 8 of the gene encoding the CD163 protein, an intron adjacent to exon 7 or exon 8 of the gene encoding the CD163 protein, or a combination thereof. [Section 31] 31. The porcine animal, offspring, or cell of paragraph 30, wherein the modified chromosomal sequence comprises a modification in exon 7 of the gene encoding the CD163 protein. [Section 32] 32. The porcine animal, offspring, or cells of paragraph 31, wherein the modification in exon 7 of the gene encoding the CD163 protein comprises a deletion. [Section 33] 33. The pig animal, offspring, or cells of paragraph 32, wherein the deletion comprises an in-frame deletion in exon 7. [Section 34] 34. The porcine animal, its offspring, or its cells of any one of items 31 to 33, wherein the modification in exon 7 of the gene encoding the CD163 protein comprises an insertion. [Section 35] The modified chromosomal sequence is (a) SEQ ID NO:118; or (b) a modification selected from the group consisting of: an 11 base pair deletion from nucleotide 3,137 to nucleotide 3,147 compared to the reference sequence SEQ ID NO:47; a 2 base pair insertion between nucleotides 3,149 and 3,150 relative to reference sequence SEQ ID NO:47, and, on the same allele, a 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 relative to reference sequence SEQ ID NO:47; a 124 base pair deletion from nucleotide 3,024 to nucleotide 3,147 compared to the reference sequence SEQ ID NO:47; a 123 base pair deletion from nucleotide 3,024 to nucleotide 3,146 compared to the reference sequence SEQ ID NO:47; a one base pair insertion between nucleotides 3,147 and 3,148 compared to reference sequence SEQ ID NO:47; a 130 base pair deletion from nucleotide 3,030 to nucleotide 3,159 compared to the reference sequence SEQ ID NO:47; a 132 base pair deletion from nucleotide 3,030 to nucleotide 3,161 compared to the reference sequence SEQ ID NO:47; a 1,506 base pair deletion from nucleotide 1,525 to nucleotide 3,030 compared to the reference sequence SEQ ID NO:47; a 7 base pair insertion between nucleotides 3,148 and 3,149 compared to reference sequence SEQ ID NO:47; a 1280 base pair deletion from nucleotide 2,818 to nucleotide 4,097 compared to the reference sequence SEQ ID NO:47; a 1373 base pair deletion from nucleotide 2,724 to nucleotide 4,096 compared to the reference sequence SEQ ID NO:47; a 1467 base pair deletion from nucleotide 2,431 to nucleotide 3,897 compared to the reference sequence SEQ ID NO:47; a 1,930 base pair deletion from nucleotide 488 to nucleotide 2,417 relative to the reference sequence SEQ ID NO:47, wherein the deleted sequence is replaced with a 12 base pair insertion beginning at nucleotide 488, and there is an additional 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 relative to the reference sequence SEQ ID NO:47; a 28 base pair deletion from nucleotide 3,145 to nucleotide 3,172 compared to the reference sequence SEQ ID NO:47; a 1387 base pair deletion from nucleotide 3,145 to nucleotide 4,531 compared to the reference sequence SEQ ID NO:47; a 1382 base pair deletion from nucleotide 3,113 to nucleotide 4,494 relative to the reference sequence SEQ ID NO:47, wherein the deleted sequence is replaced with an 11 base pair insertion beginning at nucleotide 3,113; a 1720 base pair deletion from nucleotide 2,440 to nucleotide 4,160 compared to the reference sequence SEQ ID NO:47; a 452 base pair deletion from nucleotide 3,015 to nucleotide 3,466 compared to the reference sequence SEQ ID NO:47; and combinations thereof, 35. The pig animal, progeny, or cell according to any one of paragraphs 30 to 34, comprising: [Section 36] 36. The pig animal, offspring, or cell of paragraph 35, wherein the two base pair insertion between nucleotides 3,149 and 3,150 compared to reference sequence SEQ ID NO:47 comprises an insertion of the dinucleotide AG. [Section 37] 36. The pig animal, offspring, or cell of paragraph 35, wherein the one base pair insertion between nucleotides 3,147 and 3,148 compared to reference sequence SEQ ID NO:47 comprises the insertion of a single adenine residue. [Section 38] 36. The pig animal, offspring, or cell of paragraph 35, wherein the 7 base pair insertion between nucleotide 3,148 and nucleotide 3,149, compared to reference sequence SEQ ID NO:47, comprises the sequence TACTACT (SEQ ID NO:115). [Section 39] 36. The pig animal, progeny, or cell of paragraph 35, wherein the animal, progeny, or cell comprises the 1,930 base pair deletion from nucleotide 488 to nucleotide 2,417 relative to reference sequence SEQ ID NO:47, wherein the deleted sequence is replaced with a 12 base pair insertion beginning at nucleotide 488, and wherein there is an additional 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 relative to reference sequence SEQ ID NO:47, wherein the 12 base pair insertion comprises the sequence TGTGGAGAATTC (SEQ ID NO:116). [Section 40] 36. The pig animal, progeny, or cell of paragraph 35, wherein the animal, progeny, or cell comprises the 1,382 base pair deletion from nucleotide 3,113 to nucleotide 4,494 relative to the reference sequence SEQ ID NO:47, wherein the deleted sequence is replaced with an 11 base pair insertion beginning at nucleotide 3,113, wherein the 11 base pair insertion comprises the sequence AGCCAGCGTGC (SEQ ID NO:117). [Section 41] The deletion is the 1,506 base pair deletion from nucleotide 1,525 to nucleotide 3,030 relative to the reference sequence SEQ ID NO:47; the 1,930 base pair deletion from nucleotide 488 to nucleotide 2,417 relative to the reference sequence SEQ ID NO:47, wherein the deleted sequence is replaced with a 12 base pair insertion beginning at nucleotide 488, and there is an additional 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 relative to the reference sequence SEQ ID NO:47; the 1373 base pair deletion from nucleotide 2,724 to nucleotide 4,096 relative to the reference sequence SEQ ID NO:47; the 123 base pair deletion from nucleotide 3,024 to nucleotide 3,146 relative to the reference sequence SEQ ID NO:47; the 1,467 base pair deletion from nucleotide 2,431 to nucleotide 3,897 relative to the reference sequence SEQ ID NO:47; the 1387 base pair deletion from nucleotide 3,145 to nucleotide 4,531 relative to the reference sequence SEQ ID NO:47; the 1382 base pair deletion from nucleotide 3,113 to nucleotide 4,494 relative to the reference sequence SEQ ID NO:47, wherein the deleted sequence is replaced with an 11 base pair insertion beginning at nucleotide 3,113; the 1720 base pair deletion from nucleotide 2,440 to nucleotide 4,160 relative to the reference sequence SEQ ID NO:47; and combinations thereof, 36. The pig animal, offspring, or cells of paragraph 35, comprising an in-frame deletion in exon 7 selected from the group consisting of: [Section 42] The insertion or deletion may be the 2 base pair insertion between nucleotides 3,149 and 3,150 relative to reference sequence SEQ ID NO:47, and, in the same allele, the 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 relative to reference sequence SEQ ID NO:47; the 28 base pair deletion from nucleotide 3,145 to nucleotide 3,172 relative to the reference sequence SEQ ID NO:47; the 452 base pair deletion from nucleotide 3,015 to nucleotide 3,466 relative to the reference sequence SEQ ID NO:47; and combinations thereof 37. The porcine animal, offspring, or cells of paragraph 35 or 36, selected from the group consisting of: [Section 43] 43. The pig animal, offspring, or cell of paragraph 42, wherein the animal, offspring, or cell comprises the two base pair insertion between nucleotides 3,149 and 3,150 relative to reference sequence SEQ ID NO:47 and the 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 in the same allele relative to reference sequence SEQ ID NO:47. [Section 44] 43. The pig animal, offspring, or cell of paragraph 42, wherein the animal, offspring, or cell comprises the 28 base pair deletion from nucleotide 3,145 to nucleotide 3,172 relative to the reference sequence SEQ ID NO:47. [Section 45] 43. The pig animal, offspring, or cell of paragraph 42, wherein the animal, offspring, or cell comprises the 452 base pair deletion from nucleotide 3,015 to nucleotide 3,466 relative to the reference sequence SEQ ID NO:47. [Section 46] The animal, its descendants, or its cells are the 7 base pair insertion between nucleotides 3,148 and 3,149 in one allele of the gene encoding the CD163 protein, relative to reference sequence SEQ ID NO:47; and the 11 base pair deletion from nucleotide 3,137 to nucleotide 3,147 in another allele of the gene encoding the CD163 protein, relative to the reference sequence SEQ ID NO:47; 39. The pig animal, progeny, or cell of paragraph 35 or 38, comprising: [Section 47] The animal, its descendants, or its cells are the 7 base pair insertion between nucleotides 3,148 and 3,149 in one allele of the gene encoding the CD163 protein, relative to reference sequence SEQ ID NO:47; and In another allele of the gene encoding the CD163 protein, the 1382 base pair deletion from nucleotide 3,113 to nucleotide 4,494 relative to the reference sequence SEQ ID NO:47, wherein the deleted sequence is replaced with an 11 base pair insertion starting at nucleotide 3,113. 42. The porcine animal, progeny, or cell of any one of paragraphs 35, 38, 40, and 41, comprising: [Section 48] The animal, its descendants, or its cells are SEQ ID NO: 118 in one allele of the gene encoding the CD163 protein; and the 11 base pair deletion from nucleotide 3,137 to nucleotide 3,147 in another allele of the gene encoding the CD163 protein, relative to the reference sequence SEQ ID NO:47; 36. The pig animal, progeny, or cell of paragraph 35, comprising: [Section 49] The animal, its descendants, or its cells are SEQ ID NO: 118 in one allele of the gene encoding the CD163 protein; and In another allele of the gene encoding the CD163 protein, the 2 base pair insertion between nucleotides 3,149 and 3,150 relative to the reference sequence SEQ ID NO:47, and the 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 relative to the reference sequence SEQ ID NO:47. 44. The porcine animal, progeny, or cell of any one of paragraphs 35, 36, 42, and 43, comprising: [Section 50] The animal, its descendants, or its cells are the 1,280 base pair deletion from nucleotide 2,818 to nucleotide 4,097 in one allele of the gene encoding the CD163 protein, relative to reference sequence SEQ ID NO:47; and the 11 base pair deletion from nucleotide 3,137 to nucleotide 3,147 in another allele of the gene encoding the CD163 protein, relative to the reference sequence SEQ ID NO:47; 36. The pig animal, progeny, or cell of paragraph 35, comprising: [Section 51] The animal, its descendants, or its cells are the 1,280 base pair deletion from nucleotide 2,818 to nucleotide 4,097 in one allele of the gene encoding the CD163 protein, relative to reference sequence SEQ ID NO:47; and In another allele of the gene encoding the CD163 protein, the 2 base pair insertion between nucleotides 3,149 and 3,150 relative to the reference sequence SEQ ID NO:47, and the 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 relative to the reference sequence SEQ ID NO:47. 44. The porcine animal, progeny, or cell of any one of paragraphs 35, 36, 42, and 43, comprising: [Section 52] The animal, its descendants, or its cells are the 1,930 base pair deletion in one allele of the gene encoding the CD163 protein from nucleotide 488 to nucleotide 2,417 relative to reference sequence SEQ ID NO:47, wherein the deleted sequence is replaced with a 12 base pair insertion beginning at nucleotide 488, and there is an additional 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 relative to reference sequence SEQ ID NO:47; and In another allele of the gene encoding the CD163 protein, the 2 base pair insertion between nucleotides 3,149 and 3,150 relative to the reference sequence SEQ ID NO:47, and the 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 relative to the reference sequence SEQ ID NO:47. 44. The porcine animal, progeny, or cell of any one of paragraphs 35, 36, 39, 41, 42, and 43, comprising: [Section 53] The animal, its descendants, or its cells are SEQ ID NO: 118 in one allele of the gene encoding the CD163 protein; and In another allele of the gene encoding the CD163 protein, the 1,930 base pair deletion from nucleotide 488 to nucleotide 2,417 relative to the reference sequence SEQ ID NO:47, wherein the deleted sequence is replaced with a 12 base pair insertion starting at nucleotide 488, and there is an additional 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 relative to the reference sequence SEQ ID NO:47. 42. The porcine animal, progeny, or cell of any one of paragraphs 35, 39, and 41, comprising: [Section 54] The animal, its descendants, or its cells are the 1,930 base pair deletion in one allele of the gene encoding the CD163 protein from nucleotide 488 to nucleotide 2,417 relative to reference sequence SEQ ID NO:47, wherein the deleted sequence is replaced with a 12 base pair insertion beginning at nucleotide 488, and there is an additional 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 relative to reference sequence SEQ ID NO:47; and the 11 base pair deletion from nucleotide 3,137 to nucleotide 3,147 in another allele of the gene encoding the CD163 protein, relative to the reference sequence SEQ ID NO:47; 42. The porcine animal, progeny, or cell of any one of paragraphs 35, 39, and 41, comprising: [Section 55] The animal, its descendants, or its cells are the 1,467 base pair deletion from nucleotide 2,431 to nucleotide 3,897 in one allele of the gene encoding the CD163 protein, relative to reference sequence SEQ ID NO:47; and In another allele of the gene encoding the CD163 protein, the 2 base pair insertion between nucleotides 3,149 and 3,150 relative to the reference sequence SEQ ID NO:47, and the 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 relative to the reference sequence SEQ ID NO:47. 44. The pig animal, progeny, or cell of any one of paragraphs 35, 36, and 41 to 43, comprising: [Section 56] The animal, its descendants, or its cells are the 1,467 base pair deletion from nucleotide 2,431 to nucleotide 3,897 in one allele of the gene encoding the CD163 protein, relative to reference sequence SEQ ID NO:47; and the 11 base pair deletion from nucleotide 3,137 to nucleotide 3,147 in another allele of the gene encoding the CD163 protein, relative to the reference sequence SEQ ID NO:47; 42. The pig animal, progeny, or cell of paragraph 35 or 41, comprising: [Section 57] 57. The pig animal, offspring, or cell of any one of paragraphs 35 to 56, wherein the animal, offspring, or cell comprises a chromosomal sequence having at least 80% sequence identity to SEQ ID NO: 47 in a region of the chromosomal sequence outside the insertion or deletion. [Section 58] 58. The pig animal, offspring, or cell of paragraph 57, wherein the animal, offspring, or cell comprises a chromosomal sequence having at least 85% sequence identity to SEQ ID NO: 47 in a region of the chromosomal sequence outside the insertion or deletion. [Section 59] 58. The pig animal, its offspring, or its cells of paragraph 57, wherein the animal, its offspring, or its cells comprise a chromosomal sequence having at least 90% sequence identity to SEQ ID NO: 47 in a region of the chromosomal sequence outside the insertion or deletion. [Section 60] 58. The pig animal, offspring, or cell of paragraph 57, wherein the animal, offspring, or cell comprises a chromosomal sequence having at least 95% sequence identity to SEQ ID NO: 47 in a region of the chromosomal sequence outside the insertion or deletion. [Section 61] 58. The pig animal, offspring, or cell of paragraph 57, wherein the animal, offspring, or cell comprises a chromosomal sequence having at least 98% sequence identity to SEQ ID NO: 47 in a region of the chromosomal sequence outside the insertion or deletion. [Section 62] 58. The pig animal, offspring, or cell of paragraph 57, wherein the animal, offspring, or cell comprises a chromosomal sequence having at least 99% sequence identity to SEQ ID NO: 47 in a region of the chromosomal sequence outside the insertion or deletion. [Section 63] 58. The pig animal, offspring, or cell of paragraph 57, wherein the animal, offspring, or cell comprises a chromosomal sequence having at least 99.9% sequence identity to SEQ ID NO: 47 in a region of the chromosomal sequence outside the insertion or deletion. [Section 64] 58. The pig animal, offspring, or cell of paragraph 57, wherein the animal, offspring, or cell comprises a chromosomal sequence having 100% sequence identity to SEQ ID NO: 47 in a region of the chromosomal sequence outside the insertion or deletion. [Section 65] 65. The pig animal, offspring, or cell of any one of paragraphs 35 to 64, wherein the animal, offspring, or cell comprises a chromosomal sequence comprising SEQ ID NO: 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 118, or 119. [Section 66] 66. The pig animal, offspring, or cell of paragraph 65, comprising a chromosomal sequence comprising SEQ ID NO: 98, 101, 105, 109, 110, 112, 113, or 114. [Section 67] 66. The pig animal, offspring, or cell of paragraph 65, comprising a chromosomal sequence comprising SEQ ID NO: 103, 111, or 119. [Section 68] The animal, its descendants, or its cells are the 11 base pair deletion in one allele of the gene encoding the CD163 protein; and the 2 base pair insertion and the 377 base pair deletion in another allele of the gene encoding the CD163 protein. Item 35, 36, 42, 43, 57-65, and 67, comprising the porcine animal, progeny, or cell. [Section 69] The animal, its descendants, or its cells are the 124 base pair deletion in one allele of the gene encoding the CD163 protein; and The 123 base pair deletion in another allele of the gene encoding the CD163 protein 67. The pig animal, progeny, or cell of any one of paragraphs 35, 41, and 57 to 66, comprising: [Section 70] 66. The pig animal, progeny, or cell of any one of paragraphs 35, 37, and 57-65, wherein the animal, progeny, or cell comprises the single base pair insertion. [Section 71] The animal, its descendants, or its cells are the 130 base pair deletion in one allele of the gene encoding the CD163 protein; and The 132 base pair deletion in another allele of the gene encoding the CD163 protein Item 35 and 57-65, a pig animal, a descendant, or a cell comprising the pig animal, a descendant, or a cell. [Section 72] 67. The pig animal, progeny, or cell of any one of paragraphs 35, 41, and 57-66, wherein the animal, progeny, or cell comprises the 1506 base pair deletion. [Section 73] 66. The pig animal, progeny, or cell of any one of paragraphs 35, 38, and 57-65, wherein the animal, progeny, or cell comprises the 7 base pair insertion. [Section 74] The animal, its descendants, or its cells are the 1280 base pair deletion in one allele of the gene encoding the CD163 protein; and The 1373 base pair deletion in another allele of the gene encoding the CD163 protein 67. The pig animal, progeny, or cell of any one of paragraphs 35, 41, and 57 to 66, comprising: [Section 75] 67. The pig animal, offspring, or cell of any one of paragraphs 35, 41, and 57-66, wherein the animal, offspring, or cell comprises the 1467 base pair deletion. [Section 76] 67. The pig animal, progeny, or cell of any one of paragraphs 35, 39, 41, and 57-66, wherein the animal, progeny, or cell comprises a 1,930 base pair intron 6 deletion from nucleotide 488 to nucleotide 2,417, and a 12 base pair insertion at nucleotide 4,488 and an additional 129 base pair deletion in exon 7. [Section 77] The animal, its descendants, or its cells are the 28 base pair deletion in one allele of the gene encoding the CD163 protein; and The 1387 base pair deletion in another allele of the gene encoding the CD163 protein 67. The pig animal, progeny, or cell of any one of paragraphs 35, 41, 42, 44, and 57-66, comprising: [Section 78] The animal, its descendants, or its cells are the 1382 base pair deletion and the 11 base pair insertion in one allele of the gene encoding the CD163 protein; and the 1720 base pair deletion in another allele of the gene encoding the CD163 protein; 67. The pig animal, progeny, or cell of any one of paragraphs 35, 40, 41, and 57-66, comprising: [Section 79] Item 79. The cell according to any one of items 1 to 78. [Section 80] Item 79. The non-human animal according to any one of Items 1 to 78. [Section 81] Item 79. The offspring of any one of Items 1 to 78. [Section 82] Item 80. The cell according to any one of Items 1 to 79, wherein the cell is a sperm cell. [Section 83] Item 80. The cell according to any one of Items 1 to 79, wherein the cell is an egg cell. [Section 84] 84. The cell of paragraph 83, wherein the egg cell is a fertilized egg. [Section 85] Item 80. The cell according to any one of Items 1 to 79, wherein the cell is a somatic cell. [Section 86] 86. The cell of paragraph 85, wherein said somatic cell comprises a fibroblast. [Section 87] 87. The cell of paragraph 86, wherein said fibroblast comprises a fetal fibroblast. [Section 88] genetically modifying an oocyte or a sperm cell to introduce a modified chromosomal sequence in a gene encoding a CD163 protein into at least one of the oocyte and the sperm cell, and fertilizing the oocyte with the sperm cell to produce a zygote comprising the modified chromosomal sequence in a gene encoding a CD163 protein; or genetically modifying a fertilized egg to introduce into said fertilized egg an altered chromosomal sequence in a gene encoding a CD163 protein; implanting the fertilized egg into a surrogate female animal, resulting in pregnancy and full-term birth to produce an offspring animal; screening the progeny animals for susceptibility to the pathogen; and selecting progeny animals that have reduced susceptibility to said pathogen compared to animals that do not contain the modified chromosomal sequence in the gene encoding the CD163 protein. 10. A breeding method for producing an animal or line with reduced susceptibility to infection by a pathogen, comprising: [Section 89] 89. The method of paragraph 88, wherein the pathogen comprises a virus. [Section 90] 90. The method of paragraph 89, wherein the virus comprises PRRSV. [Section 91] 91. The method of paragraph 90, wherein the modification reduces susceptibility to type 1 PRRSV virus, type 2 PRRSV, or both type 1 and type 2 PRRSV viruses. [Section 92] 92. The method of paragraph 91, wherein the modification reduces susceptibility to a PRRSV isolate selected from the group consisting of NVSL97-7895, KS06-72109, P129, VR2332, CO90, AZ25, MLV-ResPRRS, KS62-06274, KS483 (SD23983), CO84, SD13-15, Lelystad, 03-1059, 03-1060, SD01-08, 4353PZ, and combinations thereof. [Section 93] 93. The method of any one of paragraphs 88 to 92, wherein the animal is an embryo, juvenile, or adult. [Section 94] Item 94. The method of any one of Items 88 to 93, wherein the animal comprises a farmed animal. [Section 95] 95. The method of paragraph 94, wherein the farmed animal comprises a livestock animal. [Section 96] 96. The method of paragraph 95, wherein said livestock animal is selected from the group consisting of a porcine animal, a bovine animal, an ovine animal, a caprine animal, an equine animal, a buffalo, a camel, or an avian animal. [Section 97] 97. The method of paragraph 96, wherein the bovine animal comprises a beef cattle or a dairy cattle. [Section 98] 97. The method of paragraph 96, wherein the avian animal comprises a chicken, turkey, duck, goose, guinea fowl, or chick. [Section 99] 97. The method of paragraph 96, wherein the equine animal comprises a horse or a donkey. [Section 100] 97. The method of paragraph 96, wherein the livestock animal is a bovine or porcine animal. [Section 101] 101. The method of claim 100, wherein the livestock animal is a porcine animal. [Section 102] Item 102. The method according to any one of Items 88 to 101, wherein the step of genetically modifying the oocyte, sperm cell, or fertilized egg comprises genetic editing of the oocyte, sperm cell, or fertilized egg. [Section 103] 103. The method of paragraph 102, wherein said genetic editing comprises the use of a homing endonuclease. [Section 104] 104. The method of Paragraph 103, wherein said homing endonuclease comprises an engineered homing endonuclease. [Section 105] 105. The method of claim 103 or 104, wherein the homing endonuclease comprises a clustered regularly interspaced short palindromic repeats (CRISPR) / Cas9 system, a transcription activator-like effector nuclease (TALEN), a zinc finger nuclease (ZFN), a recombinase fusion protein, a meganuclease, or a combination thereof. [Section 106] 106. The method of any one of paragraphs 102 to 105, wherein the genetic editing comprises the use of a CRISPR / Cas9 system. [Section 107] 107. The method of any one of paragraphs 88 to 106, wherein the oocyte, sperm cell, or fertilized egg is heterozygous for the modified chromosomal sequence. [Section 108] 107. The method of any one of paragraphs 88 to 106, wherein the oocyte, sperm cell, or fertilized egg is homozygous for the modified chromosomal sequence. [Section 109] 109. The method of any one of items 88 to 108, wherein the modified chromosomal sequence comprises an insertion in the gene encoding the CD163 protein, a deletion in the gene encoding the CD163 protein, or a combination thereof. [Section 110] 110. The method of paragraph 109, wherein the modified chromosomal sequence comprises a deletion in the gene encoding the CD163 protein. [Section 111] 111. The method of paragraph 109 or 110, wherein the deletion comprises an in-frame deletion. [Section 112] 112. The method of any one of paragraphs 109 to 111, wherein the modified chromosomal sequence comprises an insertion in the gene encoding the CD163 protein. [Section 113] 113. The method of any one of paragraphs 88 to 112, wherein the modified chromosomal sequence causes a decrease in CD163 protein production or activity compared to CD163 protein production or activity in an animal lacking the modified chromosomal sequence. [Section 114] 114. The method of any one of paragraphs 88 to 113, wherein the altered chromosomal sequence results in the production of a substantially non-functional CD163 protein by the animal. [Section 115] 115. The method of any one of Items 101 to 114, wherein the modified chromosomal sequence comprises a modification in exon 7 of the gene encoding the CD163 protein, exon 8 of the gene encoding the CD163 protein, an intron adjacent to exon 7 or exon 8 of the gene encoding the CD163 protein, or a combination thereof. [Section 116] 116. The method of paragraph 115, wherein the modified chromosomal sequence comprises a modification in exon 7 of the gene encoding the CD163 protein. [Section 117] 117. The method of paragraph 116, wherein the modification in exon 7 of the gene encoding the CD163 protein comprises a deletion. [Section 118] 118. The method of Clause 117, wherein the deletion comprises an in-frame deletion in exon 7. [Section 119] 119. The method of any one of Items 116 to 118, wherein the modification in exon 7 of the gene encoding the CD163 protein comprises an insertion. [Section 120] The modified chromosomal sequence is (a) SEQ ID NO:118; or (b) a modification selected from the group consisting of: an 11 base pair deletion from nucleotide 3,137 to nucleotide 3,147 compared to the reference sequence SEQ ID NO:47; a 2 base pair insertion between nucleotides 3,149 and 3,150 relative to reference sequence SEQ ID NO:47, and, on the same allele, a 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 relative to reference sequence SEQ ID NO:47; a 124 base pair deletion from nucleotide 3,024 to nucleotide 3,147 compared to the reference sequence SEQ ID NO:47; a 123 base pair deletion from nucleotide 3,024 to nucleotide 3,146 compared to the reference sequence SEQ ID NO:47; a one base pair insertion between nucleotides 3,147 and 3,148 compared to reference sequence SEQ ID NO:47; a 130 base pair deletion from nucleotide 3,030 to nucleotide 3,159 compared to the reference sequence SEQ ID NO:47; a 132 base pair deletion from nucleotide 3,030 to nucleotide 3,161 compared to the reference sequence SEQ ID NO:47; a 1,506 base pair deletion from nucleotide 1,525 to nucleotide 3,030 compared to the reference sequence SEQ ID NO:47; a 7 base pair insertion between nucleotides 3,148 and 3,149 compared to reference sequence SEQ ID NO:47; a 1280 base pair deletion from nucleotide 2,818 to nucleotide 4,097 compared to the reference sequence SEQ ID NO:47; a 1373 base pair deletion from nucleotide 2,724 to nucleotide 4,096 compared to the reference sequence SEQ ID NO:47; a 1467 base pair deletion from nucleotide 2,431 to nucleotide 3,897 compared to the reference sequence SEQ ID NO:47; a 1,930 base pair deletion from nucleotide 488 to nucleotide 2,417 relative to the reference sequence SEQ ID NO:47, wherein the deleted sequence is replaced with a 12 base pair insertion beginning at nucleotide 488, and there is an additional 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 relative to the reference sequence SEQ ID NO:47; a 28 base pair deletion from nucleotide 3,145 to nucleotide 3,172 compared to the reference sequence SEQ ID NO:47; a 1387 base pair deletion from nucleotide 3,145 to nucleotide 4,531 compared to the reference sequence SEQ ID NO:47; a 1382 base pair deletion from nucleotide 3,113 to nucleotide 4,494 relative to the reference sequence SEQ ID NO:47, wherein the deleted sequence is replaced with an 11 base pair insertion beginning at nucleotide 3,113; a 1720 base pair deletion from nucleotide 2,440 to nucleotide 4,160 compared to the reference sequence SEQ ID NO:47; a 452 base pair deletion from nucleotide 3,015 to nucleotide 3,466 compared to the reference sequence SEQ ID NO:47; and combinations thereof Item 115 to 119, the method according to any one of items 115 to 119. [Section 121] 121. The method of paragraph 120, wherein the two base pair insertion between nucleotides 3,149 and 3,150 compared to the reference sequence SEQ ID NO:47 comprises the insertion of the dinucleotide AG. [Section 122] 121. The method of paragraph 120, wherein the one base pair insertion between nucleotides 3,147 and 3,148 relative to the reference sequence SEQ ID NO:47 comprises the insertion of a single adenine residue. [Section 123] 121. The method of paragraph 120, wherein the 7 base pair insertion between nucleotide 3,148 and nucleotide 3,149, relative to reference sequence SEQ ID NO:47, comprises the sequence TACTACT (SEQ ID NO:115). [Section 124] 121. The method of Clause 120, wherein the modified chromosomal sequence comprises the 1,930 base pair deletion from nucleotide 488 to nucleotide 2,417 relative to the reference sequence SEQ ID NO:47, wherein the deleted sequence is replaced with a 12 base pair insertion beginning at nucleotide 488, and wherein there is an additional 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 relative to the reference sequence SEQ ID NO:47, wherein the 12 base pair insertion comprises the sequence TGTGGAGAATTC (SEQ ID NO:116). [Section 125] 121. The method of Clause 120, wherein the modified chromosomal sequence comprises the 1382 base pair deletion from nucleotide 3,113 to nucleotide 4,494 relative to the reference sequence SEQ ID NO:47, and the deleted sequence is replaced with an 11 base pair insertion beginning at nucleotide 3,113, wherein the 11 base pair insertion comprises the sequence AGCCAGCGTGC (SEQ ID NO:117). [Section 126] The deletion is the 1,506 base pair deletion from nucleotide 1,525 to nucleotide 3,030 relative to the reference sequence SEQ ID NO:47; the 1,930 base pair deletion from nucleotide 488 to nucleotide 2,417 relative to the reference sequence SEQ ID NO:47, wherein the deleted sequence is replaced with a 12 base pair insertion beginning at nucleotide 488, and there is an additional 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 relative to the reference sequence SEQ ID NO:47; the 1373 base pair deletion from nucleotide 2,724 to nucleotide 4,096 relative to the reference sequence SEQ ID NO:47; the 123 base pair deletion from nucleotide 3,024 to nucleotide 3,146 relative to the reference sequence SEQ ID NO:47; the 1,467 base pair deletion from nucleotide 2,431 to nucleotide 3,897 relative to the reference sequence SEQ ID NO:47; the 1387 base pair deletion from nucleotide 3,145 to nucleotide 4,531 relative to the reference sequence SEQ ID NO:47; the 1382 base pair deletion from nucleotide 3,113 to nucleotide 4,494 relative to the reference sequence SEQ ID NO:47, wherein the deleted sequence is replaced with an 11 base pair insertion beginning at nucleotide 3,113; the 1720 base pair deletion from nucleotide 2,440 to nucleotide 4,160 relative to the reference sequence SEQ ID NO:47; and combinations thereof 121. The method of claim 120, comprising an in-frame deletion in exon 7 selected from the group consisting of: [Section 127] The insertion or deletion may be the 2 base pair insertion between nucleotides 3,149 and 3,150 relative to reference sequence SEQ ID NO:47, and, in the same allele, the 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 relative to reference sequence SEQ ID NO:47; the 28 base pair deletion from nucleotide 3,145 to nucleotide 3,172 relative to the reference sequence SEQ ID NO:47; the 452 base pair deletion from nucleotide 3,015 to nucleotide 3,466 relative to the reference sequence SEQ ID NO:47; and combinations thereof 122. The method of claim 120 or 121, selected from the group consisting of: [Section 128] 128. The method of Clause 127, wherein the modified chromosomal sequence comprises the 2 base pair insertion between nucleotides 3,149 and 3,150 relative to the reference sequence SEQ ID NO:47 and the 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 in the same allele relative to the reference sequence SEQ ID NO:47. [Section 129] 128. The method of paragraph 127, wherein the modified chromosomal sequence comprises the 28 base pair deletion from nucleotide 3,145 to nucleotide 3,172 relative to the reference sequence SEQ ID NO:47. [Section 130] 128. The method of paragraph 127, wherein the modified chromosomal sequence comprises the 452 base pair deletion from nucleotide 3,015 to nucleotide 3,466 relative to the reference sequence SEQ ID NO:47. [Section 131] The modified chromosomal sequence is the 7 base pair insertion between nucleotides 3,148 and 3,149 in one allele of the gene encoding the CD163 protein, relative to reference sequence SEQ ID NO:47; and the 11 base pair deletion from nucleotide 3,137 to nucleotide 3,147 in another allele of the gene encoding the CD163 protein, relative to the reference sequence SEQ ID NO:47; 124. The method of claim 120 or 123, comprising: [Section 132] The modified chromosomal sequence is the 7 base pair insertion between nucleotides 3,148 and 3,149 in one allele of the gene encoding the CD163 protein, relative to reference sequence SEQ ID NO:47; and In another allele of the gene encoding the CD163 protein, the 1382 base pair deletion from nucleotide 3,113 to nucleotide 4,494 relative to the reference sequence SEQ ID NO:47, wherein the deleted sequence is replaced with an 11 base pair insertion starting at nucleotide 3,113. 127. The method of any one of paragraphs 120, 123, 125, and 126, comprising: [Section 133] The modified chromosomal sequence is SEQ ID NO: 118 in one allele of the gene encoding the CD163 protein; and the 11 base pair deletion from nucleotide 3,137 to nucleotide 3,147 in another allele of the gene encoding the CD163 protein, relative to the reference sequence SEQ ID NO:47; Item 121. The method of item 120, comprising: [Section 134] The modified chromosomal sequence is SEQ ID NO: 118 in one allele of the gene encoding the CD163 protein; and In another allele of the gene encoding the CD163 protein, the 2 base pair insertion between nucleotides 3,149 and 3,150 relative to the reference sequence SEQ ID NO:47, and the 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 relative to the reference sequence SEQ ID NO:47. 129. The method of any one of paragraphs 120, 121, 127, and 128, comprising: [Section 135] The modified chromosomal sequence is the 1,280 base pair deletion from nucleotide 2,818 to nucleotide 4,097 in one allele of the gene encoding the CD163 protein, relative to reference sequence SEQ ID NO:47; and the 11 base pair deletion from nucleotide 3,137 to nucleotide 3,147 in another allele of the gene encoding the CD163 protein, relative to the reference sequence SEQ ID NO:47; Item 121. The method of item 120, comprising: [Section 136] The modified chromosomal sequence is the 1,280 base pair deletion from nucleotide 2,818 to nucleotide 4,097 in one allele of the gene encoding the CD163 protein, relative to reference sequence SEQ ID NO:47; and In another allele of the gene encoding the CD163 protein, the 2 base pair insertion between nucleotides 3,149 and 3,150 relative to the reference sequence SEQ ID NO:47, and the 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 relative to the reference sequence SEQ ID NO:47. 129. The method of any one of paragraphs 120, 121, 127, and 128, comprising: [Section 137] The modified chromosomal sequence is the 1,930 base pair deletion in one allele of the gene encoding the CD163 protein from nucleotide 488 to nucleotide 2,417 relative to reference sequence SEQ ID NO:47, wherein the deleted sequence is replaced with a 12 base pair insertion beginning at nucleotide 488, and there is an additional 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 relative to reference sequence SEQ ID NO:47; and In another allele of the gene encoding the CD163 protein, the 2 base pair insertion between nucleotides 3,149 and 3,150 relative to the reference sequence SEQ ID NO:47, and the 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 relative to the reference sequence SEQ ID NO:47. Item 120, 121, 124, and the method of any one of items 126 to 128, comprising: [Section 138] The modified chromosomal sequence is SEQ ID NO: 118 in one allele of the gene encoding the CD163 protein; and In another allele of the gene encoding the CD163 protein, the 1,930 base pair deletion from nucleotide 488 to nucleotide 2,417 relative to the reference sequence SEQ ID NO:47, wherein the deleted sequence is replaced with a 12 base pair insertion starting at nucleotide 488, and there is an additional 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 relative to the reference sequence SEQ ID NO:47. 127. The method of any one of paragraphs 120, 124, and 126, comprising: [Section 139] The modified chromosomal sequence is the 1,930 base pair deletion in one allele of the gene encoding the CD163 protein from nucleotide 488 to nucleotide 2,417 relative to reference sequence SEQ ID NO:47, wherein the deleted sequence is replaced with a 12 base pair insertion beginning at nucleotide 488, and there is an additional 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 relative to reference sequence SEQ ID NO:47; and the 11 base pair deletion from nucleotide 3,137 to nucleotide 3,147 in another allele of the gene encoding the CD163 protein, relative to the reference sequence SEQ ID NO:47; 127. The method of any one of paragraphs 120, 124, and 126, comprising: [Section 140] The modified chromosomal sequence is the 1,467 base pair deletion from nucleotide 2,431 to nucleotide 3,897 in one allele of the gene encoding the CD163 protein, relative to reference sequence SEQ ID NO:47; and In another allele of the gene encoding the CD163 protein, the 2 base pair insertion between nucleotides 3,149 and 3,150 relative to the reference sequence SEQ ID NO:47, and the 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 relative to the reference sequence SEQ ID NO:47. Item 120, 121, and the method of any one of items 126 to 128, comprising: [Section 141] The modified chromosomal sequence is the 1,467 base pair deletion from nucleotide 2,431 to nucleotide 3,897 in one allele of the gene encoding the CD163 protein, relative to reference sequence SEQ ID NO:47; and the 11 base pair deletion from nucleotide 3,137 to nucleotide 3,147 in another allele of the gene encoding the CD163 protein, relative to the reference sequence SEQ ID NO:47; 127. The method of claim 120 or 126, comprising: [Section 142] 142. The method of any one of paragraphs 120 to 141, wherein the modified chromosomal sequence comprises a chromosomal sequence having at least 80% sequence identity to SEQ ID NO: 47 in a region of the chromosomal sequence outside the insertion or deletion. [Section 143] 143. The method of Paragraph 142, wherein the modified chromosomal sequence comprises a chromosomal sequence having at least 85% sequence identity to SEQ ID NO:47 in a region of the chromosomal sequence outside the insertion or deletion. [Section 144] 143. The method of Paragraph 142, wherein the modified chromosomal sequence comprises a chromosomal sequence having at least 90% sequence identity to SEQ ID NO:47 in a region of the chromosomal sequence outside the insertion or deletion. [Section 145] 143. The method of Paragraph 142, wherein the modified chromosomal sequence comprises a chromosomal sequence having at least 95% sequence identity to SEQ ID NO:47 in a region of the chromosomal sequence outside the insertion or deletion. [Section 146] 143. The method of Paragraph 142, wherein the modified chromosomal sequence comprises a chromosomal sequence having at least 98% sequence identity to SEQ ID NO:47 in a region of the chromosomal sequence outside the insertion or deletion. [Section 147] 143. The method of Paragraph 142, wherein the modified chromosomal sequence comprises a chromosomal sequence having at least 99% sequence identity to SEQ ID NO:47 in a region of the chromosomal sequence outside the insertion or deletion. [Section 148] 143. The method of Paragraph 142, wherein the modified chromosomal sequence comprises a chromosomal sequence having at least 99.9% sequence identity to SEQ ID NO:47 in a region of the chromosomal sequence outside the insertion or deletion. [Section 149] 143. The method of Paragraph 142, wherein the modified chromosomal sequence comprises a chromosomal sequence having 100% sequence identity to SEQ ID NO:47 in a region of the chromosomal sequence outside the insertion or deletion. [Section 150] 150. The method of any one of paragraphs 120 to 149, wherein the modified chromosomal sequence comprises a chromosomal sequence comprising SEQ ID NO: 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 118, or 119. [Section 151] 151. The method of Paragraph 150, wherein the modified chromosomal sequence comprises a chromosomal sequence comprising SEQ ID NO: 98, 101, 105, 109, 110, 112, 113, or 114. [Section 152] 151. The method of Paragraph 150, wherein the modified chromosomal sequence comprises a chromosomal sequence comprising SEQ ID NO: 103, 111, or 119. [Section 153] The modified chromosomal sequence is the 11 base pair deletion in one allele of the gene encoding the CD163 protein; and the 2 base pair insertion and the 377 base pair deletion in another allele of the gene encoding the CD163 protein Item 120, 121, 127, 128, 142-150, and 152, comprising the method of any one of items 120, 121, 127, 128, 142-150, and 152. [Section 154] The modified chromosomal sequence is the 124 base pair deletion in one allele of the gene encoding the CD163 protein; and The 123 base pair deletion in another allele of the gene encoding the CD163 protein Item 120, 126, and the method of any one of items 142 to 151, comprising: [Section 155] 151. The method of any one of paragraphs 120, 122, and 142-150, wherein the modified chromosomal sequence comprises the single base pair insertion. [Section 156] The modified chromosomal sequence is the 130 base pair deletion in one allele of the gene encoding the CD163 protein; and The 132 base pair deletion in another allele of the gene encoding the CD163 protein Item 120 and the method according to any one of items 142 to 150, comprising: [Section 157] 152. The method of any one of paragraphs 120, 126, and 142-151, wherein the modified chromosomal sequence comprises the 1506 base pair deletion. [Section 158] 151. The method of any one of paragraphs 120, 123, and 142-150, wherein the modified chromosomal sequence comprises the 7 base pair insertion. [Section 159] The modified chromosomal sequence is the 1280 base pair deletion in one allele of the gene encoding the CD163 protein; and The 1373 base pair deletion in another allele of the gene encoding the CD163 protein Item 120, 126, and the method of any one of items 142 to 151, comprising: [Section 160] 152. The method of any one of paragraphs 120, 126, and 142-151, wherein the modified chromosomal sequence comprises the 1467 base pair deletion. [Section 161] 152. The method of any one of paragraphs 120, 124, 126, and 142-151, wherein the modified chromosomal sequence comprises the 1930 base pair intron 6 deletion from nucleotide 488 to nucleotide 2,417, and a 12 base pair insertion at nucleotide 4,488 and an additional 129 base pair deletion in exon 7. [Section 162] The modified chromosomal sequence is the 28 base pair deletion in one allele of the gene encoding the CD163 protein; and The 1387 base pair deletion in another allele of the gene encoding the CD163 protein Item 120, 126, 127, 129, and 142-151, comprising the method of any one of items 120, 126, 127, 129, and 142-151. [Section 163] 152. The method of any one of paragraphs 120, 125, 126, and 142-151, wherein the modified chromosomal sequence comprises the 1382 base pair deletion and the 11 base pair insertion in one allele of the gene encoding the CD163 protein, and the 1720 base pair deletion in the other allele of the gene encoding the CD163 protein. [Section 164] Item 164. The method of any one of Items 88 to 163, wherein the selected animals are used as founder animals. [Section 165] Item 165. The method of any one of items 88 to 164, wherein the fertilization comprises artificial insemination. [Section 166] A population of animals produced by the method according to any one of paragraphs 88 to 165. [Section 167] 167. The population of animals of paragraph 166, wherein the population of animals is resistant to infection by a pathogen. [Section 168] 168. The population of clause 167, wherein the pathogen comprises a virus. [Section 169] 169. The population of clause 168, wherein the virus comprises PRRSV. [Section 170] 169. The population of paragraph 169, wherein the viruses comprise a type 1 PRRSV virus, a type 2 PRRSV, or both type 1 and type 2 PRRSV viruses. [Section 171] 171. The population of clause 170, wherein the virus comprises a PRRSV isolate selected from the group consisting of NVSL97-7895, KS06-72109, P129, VR2332, CO90, AZ25, MLV-ResPRRS, KS62-06274, KS483 (SD23983), CO84, SD13-15, Lelystad, 03-1059, 03-1060, SD01-08, 4353PZ, and combinations thereof. [Section 172] A method for increasing the resistance of a livestock animal to infection by a pathogen, comprising genetically editing at least one chromosomal sequence from a gene encoding a CD163 protein, thereby reducing CD163 protein production or activity compared to CD163 protein production or activity in a livestock animal that does not contain the edited chromosomal sequence in the gene encoding the CD163 protein. [Section 173] 173. The method of paragraph 172, wherein said livestock animal produces a CD163 protein that is substantially non-functional. [Section 174] 173. The method of paragraph 172, wherein said method comprises genetically editing at least one chromosomal sequence encoding the CD163 protein to introduce an in-frame deletion. [Section 175] (a) a nucleotide sequence comprising SEQ ID NO:47; (b) a nucleotide sequence having at least 80% sequence identity to the sequence of SEQ ID NO:47, wherein the nucleotide sequence contains at least one substitution, insertion, or deletion relative to SEQ ID NO:47; and (c) The cDNA sequence of (a) or (b). A nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of: [Section 176] 176. The nucleic acid molecule of Paragraph 175, wherein said nucleic acid molecule is an isolated nucleic acid molecule. [Section 177] 177. The nucleic acid of Paragraph 175 or 176, wherein the nucleic acid comprises a nucleotide sequence comprising SEQ ID NO:47. [Section 178] 177. The nucleic acid of paragraph 175 or 176, wherein the nucleic acid comprises a nucleotide sequence having at least 80% sequence identity to the sequence of SEQ ID NO:47, and the nucleotide sequence comprises at least one substitution, insertion, or deletion relative to SEQ ID NO:47. [Section 179] 179. The nucleic acid of Paragraph 178, comprising a nucleotide sequence having at least 85% sequence identity to the sequence of SEQ ID NO:47, wherein the nucleotide sequence comprises at least one substitution, insertion, or deletion relative to SEQ ID NO:47. [Section 180] 179. The nucleic acid of Paragraph 178, comprising a nucleotide sequence having at least 87.5% sequence identity to the sequence of SEQ ID NO:47, wherein the nucleotide sequence comprises at least one substitution, insertion, or deletion relative to SEQ ID NO:47. [Section 181] 179. The nucleic acid of Paragraph 178, comprising a nucleotide sequence having at least 90% sequence identity to the sequence of SEQ ID NO:47, wherein the nucleotide sequence comprises at least one substitution, insertion, or deletion relative to SEQ ID NO:47. [Section 182] 179. The nucleic acid of Paragraph 178, comprising a nucleotide sequence having at least 95% sequence identity to the sequence of SEQ ID NO:47, wherein the nucleotide sequence comprises at least one substitution, insertion, or deletion relative to SEQ ID NO:47. [Section 183] 179. The nucleic acid of Paragraph 178, comprising a nucleotide sequence having at least 98% sequence identity to the sequence of SEQ ID NO:47, wherein the nucleotide sequence comprises at least one substitution, insertion, or deletion relative to SEQ ID NO:47. [Section 184] 179. The nucleic acid of Paragraph 178, comprising a nucleotide sequence having at least 99% sequence identity to the sequence of SEQ ID NO:47, wherein the nucleotide sequence comprises at least one substitution, insertion, or deletion relative to SEQ ID NO:47. [Section 185] 179. The nucleic acid of Paragraph 178, comprising a nucleotide sequence having at least 99.9% sequence identity to the sequence of SEQ ID NO:47, wherein the nucleotide sequence comprises at least one substitution, insertion, or deletion relative to SEQ ID NO:47. [Section 186] 186. The nucleic acid of any one of paragraphs 175, 176, and 178-185, wherein the substitution, insertion, or deletion reduces or eliminates CD163 protein production or activity compared to a nucleic acid that does not include the substitution, insertion, or deletion. [Section 187] 187. The nucleic acid of paragraph 175, 176, 178, or 186, wherein the nucleic acid comprises SEQ ID NO: 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 118, or 119. [Section 188] 188. The nucleic acid of Paragraph 187, wherein the nucleic acid comprises SEQ ID NO: 98, 101, 105, 109, 110, 112, 113, or 114. [Section 189] 188. The nucleic acid of Paragraph 187, wherein the nucleic acid comprises SEQ ID NOs: 103, 111, 119. [Section 190] 177. The isolated nucleic acid of paragraph 175 or 176, wherein the nucleic acid comprises a cDNA. [Section 191] A nucleic acid comprising SEQ ID NOs: 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 118, 119. [Section 192] 192. The nucleic acid of Paragraph 191, wherein the nucleic acid is an isolated nucleic acid. [Section 193] 193. The isolated nucleic acid of paragraph 191 or 192, comprising SEQ ID NO:98, 101, 105, 109, 110, 112, 113, or 114. [Section 194] 193. The isolated nucleic acid of paragraph 191 or 192, wherein the nucleic acid comprises SEQ ID NO:103, 111, or 119.

[0320] Example The following non-limiting examples are provided to further illustrate the present invention.

[0321] Example 1: Use of the CRISPR / Cas9 system to generate genetically engineered pigs from in vitro-derived oocytes and embryos Recent reports describing homing endonucleases, such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and components of the clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated (Cas9) system, suggest that genetic engineering (GE) in pigs is now more efficient. Targeted homing endonucleases induce double-strand breaks (DSBs) at specific locations within the genome, leading to random mutations either through nonhomologous end joining (NHEJ) or by stimulating homologous recombination (HR) if donor DNA is provided. Targeted modification of the genome by HR can be achieved by homing endonucleases when donor DNA is provided along with the targeted nuclease. After introducing specific modifications in somatic cells, these cells have been used to generate GE pigs by SCNT for various purposes. Thus, homing endonucleases are useful tools for generating GE pigs. Among the different homing endonucleases, the CRISPR / Cas9 system, adapted from prokaryotes where it is used as a defense mechanism, appears to be an effective approach. In nature, the Cas9 system requires three components: an RNA (approximately 20 bases) containing a region complementary to the target sequence (cis-repressing RNA [crRNA]), an RNA containing a region complementary to the crRNA (trans-activating crRNA [tracrRNA]), and the enzyme protein component of this complex, Cas9. A single guide RNA (gRNA) can be engineered to fulfill the role of the base-paired crRNA and tracrRNA. The gRNA / protein complex can scan the genome and catalyze DSBs at the region complementary to the crRNA / gRNA. Unlike other engineered nucleases, only short oligomers need to be engineered to construct the reagents required to target the gene of interest, while a series of cloning steps are required to assemble ZFNs and TALENs.

[0322] Unlike current standard methods for gene disruption, the use of engineered nucleases offers the opportunity to use zygotes as starting materials for GE. Standard methods for gene disruption in livestock include HR in cultured cells followed by embryo reconstruction by somatic cell nuclear transfer (SCNT). Because cloned animals generated by SCNT sometimes exhibit signs of developmental defects, the progeny of SCNT / GE founders are typically used for research to avoid confounding SCNT abnormalities and phenotypes that may occur when founder animals are used for experiments. Given the longer gestation period and higher housing costs of pigs compared with rodents, reducing the need for breeding offers time and cost advantages. Recent reports have demonstrated that direct injection of ZFNs and TALENs into pig zygotes can disrupt endogenous genes and generate piglets with desired mutations. However, only approximately 10% of piglets exhibited biallelic alterations of the targeted gene, and some exhibited mosaic genotypes. A recent paper demonstrated that the CRISPR / Cas9 system can induce mutations in developing embryos and generate GE pigs with higher efficiency than ZFN or TALEN. However, the GE pigs generated using the CRISPR / Cas9 system also had mosaic genotypes. In addition, all of the above studies used in vivo induced zygotes for experiments, which requires intensive labor and many sows to obtain a sufficient number of zygotes.

[0323] This example describes an efficient approach using the CRISPR / Cas9 system to generate GE pigs by both in vitro-induced zygote injection and somatic cell modification followed by SCNT. Two endogenous genes (CD163 and CD1D) and one transgene (eGFP) were targeted, and only in vitro-induced oocytes or zygotes were used for SCNT or RNA injection, respectively. CD163 is thought to be required for productive infection by porcine reproductive and respiratory syndrome virus (PRRSV), a virus known to cause significant economic losses in the swine industry. CD1D is thought to be a nonclassical major histocompatibility complex protein and is involved in the presentation of lipid antigens to invariant natural killer T cells. Pigs lacking these genes were engineered to serve as models for agriculture and biomedicine. The eGFP transgene was used as a target for preliminary proof-of-concept experiments and method optimization.

[0324] material and method Chemicals and Reagents Unless otherwise stated, all chemicals used in this study were purchased from Sigma.

[0325] Designing gRNAs for specific CRISPR constructs Guide RNAs were designed to a region within exon 7 of CD163 that is unique to wild-type CD163 and not present in the domain swap targeting vector (described below), so that CRISPR would result in a DSB in wild-type CD163 but not in the domain swap targeting vector. There were only four positions where the targeting vector introduced a single nucleotide polymorphism (SNP) that altered the S. pyogenes (Spy) protospacer adjacent motif (PAM). All four targets were selected, including: (SEQ ID NO:1)GGAAACCCAGGCTGGTTGGAgGG(CRISPR10), (SEQ ID NO:2)GGAACTACAGTGCGGCACTGtGG(CRISPR131), (SEQ ID NO:3) CAGTAGCACCCCGCCCTGACgGG (CRISPR256) and (SEQ ID NO:4) TGTAGCCACAGCAGGGACGTcGG (CRISPR282). PAMs can be identified by the bold type in each gRNA.

[0326] For the CD1D mutation, the search for CRISPR targets was arbitrarily restricted to the coding strand within the first 1000 bp of the primary transcript. However, RepeatMasker

[26] (a "pig" repeat library) identified a repetitive element starting at base 943 of the primary transcript. The search for CRISPR targets was then restricted to the first 942 bp of the primary transcript. The search was further restricted to the first 873 bp of the primary transcript because the final Spy PAM is located at base 873. The first target (CRISPR4800) was selected because it overlapped with the start codon located at base 42 in the primary transcript (CCAGCCTCGCCCAGCGACATgGG (SEQ ID NO:5)). Two additional targets (CRISPR5620 and 5626) were selected. These targets overlap because they were the most distal from the first selection within the arbitrarily selected region (CTTTCATTTATCTGAACTCAgGG (SEQ ID NO:6) and TTATCTGAACTCAGGGTCCCcGG (SEQ ID NO:7)). The most proximal Spy PAM, relative to the start codon, was located in a simple sequence containing a homopolymer-rich region as determined by visual inspection. The fourth target (CRISPR5350) was selected because it was the most proximal target relative to the first target selection that did not contain a homopolymer-rich region (CAGCTGCAGCATATATTTAAgGG (SEQ ID NO:8)). The specificity of the designed crRNA was confirmed by searching for similar porcine sequences in GenBank. The oligonucleotides (Table 1) were annealed and cloned into the p330X vector, containing two expression cassettes: human codon-optimized S. pyogenes (hSpy) Cas9 and a chimeric guide RNA. P330X was digested with BbsI (New England Biolabs) according to the Zhang lab protocol (http: / / www.addgene.org / crispr / zhang / ).

[0327] To target eGFP, two specific gRNAs were designed to target the eGFP coding sequence within the first 60 bp of the eGFP start codon. Both eGFP1 and eGFP2 gRNAs were on the antisense strand, and eGFP1 directly targeted the start codon. The eGFP1 gRNA sequence was CTCCTCGCCCTTGCTCACCAtGG (SEQ ID NO: 9), and the eGFP2 gRNA sequence was GACCAGGATGGGCACCACCCcGG (SEQ ID NO: 10). [Table 1]

[0328] Synthesis of donor DNA for CD163 and CD1D genes Both porcine CD163 and CD1D were amplified by PCR from DNA isolated from fetal fibroblasts and used for subsequent transfection to ensure an isogenic match between the targeting vector and the transfected cell line. Briefly, a 9538-bp fragment of CD163 was amplified using LA taq (Clontech) with the forward primer CTCTCCCTCACTCTAACCTACTT (SEQ ID NO: 11) and the reverse primer TATTTTCTCTCACATGGCCAGTC (SEQ ID NO: 12). This fragment was the DNA sequence confirmed and used to construct the domain-swap targeting vector (Figure 1). This vector contains 33 point mutations within exon 7 and therefore will encode the same amino acid sequence as human CD163L from exon 11. The replacement exon was 315 bp. Additionally, the subsequent intron was replaced with a modified myostatin intron B containing a selectable marker gene that can be removed by Cre recombinase (Cre). With the loxP site retained, normal splicing was previously demonstrated (Wells, unpublished results). The long arm of the construct was 3469 bp and contained the domain-swapped DS exon. The short arm was 1578 bp and contained exons 7 and 8 (Figure 1, panel B). This plasmid was used to attempt to replace the coding region of exon 7 in initial transfection experiments, allowing selection of targeting events with a selectable marker (G418). If targeting occurs, the marker can be removed by Cre recombinase. The CD163DS targeting vector was then modified for use with cell lines that already contained a disrupted SIGLEC1 gene in Neo, which could not be removed with Cre. In this targeting vector, the Neo cassette, loxP, and myostatin intron B were removed, leaving only the DS exon along with the WT long and short arms (Figure 1, panel C).

[0329] The genomic sequence for porcine CD1D was amplified by LA taq using the forward primer CTCTCCCTCACTCTAACCTACTT (SEQ ID NO: 13) and the reverse primer GACTGGCCATGTGAGAGAAATA (SEQ ID NO: 14), yielding an 8729 bp fragment. This DNA sequence was used to construct the targeting vector shown in Figure 2. The Neo cassette was under the control of the phosphoglycerol kinase (PGK) promoter and flanked by loxP sequences (introduced for selection). The long arm of the construct was 4832 bp, and the short arm was 3563 bp, containing exons 6 and 7. If successful HR occurs, exons 3, 4, and 5 are removed and replaced with the Neo cassette. If NHEJ repair occurs incorrectly, exon 3 will be destroyed.

[0330] Fetal fibroblast collection Pig fetal tissue was collected on day 35 of gestation to generate cell lines. Two wild-type (WT) male and female fetal fibroblast cell lines were established from large white domestic crossbreds. Male and female fetal fibroblasts previously modified to contain a Neo cassette (SIGLEC1- / - genetics) were also used in these studies. Fetal fibroblasts with minor modifications were collected as described; tissue from each fetus was minced and digested at 38.5°C for 5 hours in 20 ml of digestion medium (Dulbecco's modified Eagle's medium [DMEM] containing L-glutamine and 1 g / L D-glucose [Cellgro], supplemented with 200 units / ml collagenase and 25 Kunitz units / ml DNAse I). After digestion, fetal fibroblasts were washed and cultured with DMEM, 15% fetal bovine serum (FBS), and 40 μg / ml gentamicin. After overnight culture, cells were trypsinized, frozen in aliquots in FBS with 10% dimethyl sulfoxide at -80°C, and stored in liquid nitrogen.

[0331] Cell transfection and genotyping Transfection conditions were essentially as previously reported. A constant amount of 1 μg of donor DNA was used, along with varying amounts of CRISPR / Cas9 plasmids (listed below). Donor DNA was linearized with MLUI (CD163) (NEB) or AFLII (CD1D) (NEB) prior to transfection. The gender of established cell lines was determined by PCR prior to transfection as previously described. Both male and female cell lines were transfected, and genome modification data were analyzed together between transfections. Fetal fibroblast cell lines of similar passage numbers (2–4) were cultured and grown to 75–85% confluence for 2 days in DMEM containing L-glutamine and 1 g / L D-glucose (Cellgro), supplemented with 15% FBS, 2.5 ng / ml basic fibroblast growth factor, and 10 mg / ml gentamicin. Fibroblasts were washed with phosphate-buffered saline (PBS) (Life Technologies) and trypsinized. Once detached, the cells were rinsed with electroporation medium (75% cytosalts [120 mM KCl, 0.15 mM CaCl, 10 mM KHPO, pH 7.6, 5 mM MgCl]) and 25% Opti-MEM (Life Technologies). Cell concentration was quantified using a hemocytometer. Cells were pelleted at 600 × g for 5 minutes and diluted to 1 × 10 in electroporation medium. 6The cells were resuspended at a concentration of 1000 kJ / well. For each electroporation, 200 μl of cells were used in a 2 mm gap cuvette, and three (1 msec) square-wave pulses were administered at 250 V using BTX ECM2001. After electroporation, the cells were resuspended in the DMEM described above. For selection, 600 μg / ml G418 (Life Technologies) was added 24 hours after transfection, and the medium was changed on day 7. Colonies were picked on day 14 after transfection. Fetal fibroblasts were plated at 10,000 cells / plate when G418 selection was used and 50 cells / plate when G418 selection was not used. Fetal fibroblast colonies were collected by applying a 10 mm autoclaved cloning cylinder sealed around each colony with autoclaved vacuum grease. Colonies were rinsed with PBS and recovered with trypsin; then, resuspended in DMEM medium. A portion of the resuspended colonies (1 / 3) was transferred to a 96-well PCR plate, and the remaining cells (2 / 3) were cultured in one well of a 24-well plate. The cell pellet was resuspended in 6 μl of lysis buffer (40 mM Tris, pH 8.9, 0.9% Triton X-100, 0.4 mg / ml proteinase K [NEB]) and incubated at 65°C for 30 min for cell lysis, followed by incubation at 85°C for 10 min to inactivate the proteinase K.

[0332] PCR screening for DS and large and small deletions Detection of HR repair. Long-range PCR was used to identify mutations in either CD163 or CD1D. Three different PCR assays were used to identify HR events: PCR amplification of a region spanning the CD163 or CD1D sequence in donor DNA on either the right or left side to the endogenous CD163 or CD1D sequence, and long-range PCR that amplified a large region of CD163 or CD1D encompassing the designed donor DNA. An increase in the size of the PCR product, either 1.8 kb (CD1D) or 3.5 kb (CD163), resulting from the addition of the exogenous Neo sequence, was considered evidence of HR repair of the gene. All PCR conditions included an initial denaturation at 95°C for 2 minutes, followed by 33 cycles of 94°C for 30 seconds, 50°C for 30 seconds, and 68°C for 7–10 minutes. LA taq was used for all assays according to the manufacturer's recommendations. Primers are listed in Table 2. [Table 2]

[0333] Small deletion assay (NHEJ). Small deletions were determined by PCR amplification of CD163 or CD1D flanking the protruding cutting site introduced by the CRISPR / Cas9 system. The amplicon sizes were 435 bp and 1244 bp for CD163 and CD1D, respectively. Lysates from embryonic and fetal fibroblasts were PCR amplified using LA taq. The PCR conditions for the assay were an initial denaturation at 95°C for 2 min, followed by 33 cycles of 94°C for 30 s, 56°C for 30 s, and 72°C for 1 min. For genotyping of transfected cells, insertions and deletions (INDELs) were identified by separating the PCR amplicons by agarose gel electrophoresis. For embryo genotyping, the resulting PCR products were subsequently DNA sequenced to identify small deletions using the forward primer used in PCR. Primer information is shown in Table 3. [Table 3]

[0334] Somatic cell nuclear transfer (SCNT) To generate SCNT embryos, we used either sow-derived oocytes (ART, Inc.) or gilt-derived oocytes from a local slaughterhouse. Sow-derived oocytes were transported overnight in maturation medium (TCM-199 with 2.9 mM Hepes, 5 μg / ml insulin, 10 ng / ml epidermal growth factor [EGF], 0.5 μg / ml porcine follicle-stimulating hormone [p-FSH], 0.91 mM pyruvate, 0.5 mM cysteine, 10% porcine follicular fluid, and 25 ng / ml gentamicin) and transferred to fresh medium 24 hours later. After 40–42 hours of maturation, cumulus cells were removed from the oocytes by vortexing in the presence of 0.1% hyaluronidase. Gilt-derived oocytes were matured for in vitro fertilization (IVF) as described below. During manipulation, oocytes were placed in manipulation medium (TCM-199 [Life Technologies] with 0.6 mM NaHCO3, 2.9 mM Hepes, 30 mM NaCl, 10 ng / ml gentamicin, and 3 mg / ml BSA, with an osmolality of 305 mOsm) supplemented with 7.0 μg / ml cytochalasin B. The polar body was removed along with part of the adjacent cytoplasm (presumably including the metaphase II plate), and the donor cell was placed into the perivitelline space using a thin-glass capillary. The reconstructed embryos were then fused using a BTX Electro Cell Manipulator (Harvard Apparatus) in fusion medium (0.3 M mannitol, 0.1 mM CaCl2, 0.1 mM MgCl2, and 0.5 mM Hepes) using two DC pulses (1-second intervals) at 1.2 kV / cm for 30 sec. After fusion, fused embryos were fully activated with 200 μM thimerosal for 10 min in the dark and 8 mM dithiothreitol for 30 min. Embryos were then incubated for 14–16 h in modified porcine zygote medium PZM3-MU1 with 0.5 μM Scriptaid (S7817; Sigma-Aldrich), a histone deacetylase inhibitor, as previously described.

[0335] In vitro fertilization (IVF) For IVF, ovaries from prepubertal gilts were obtained from a slaughterhouse (Farmland Foods Inc.). Immature oocytes were aspirated from medium-sized (3-6 mm) follicles using an 18-gauge hypodermic needle attached to a 10 ml syringe. Oocytes with uniformly dense cytoplasm and intact surrounding cumulus cells were then selected for maturation. Approximately 50 cumulus-oocyte complexes were placed in wells containing 500 μl of maturation medium, TCM-199 (Invitrogen), containing 3.05 mM glucose, 0.91 mM sodium pyruvate, 0.57 mM cysteine, 10 ng / ml EGF, 0.5 μg / ml luteinizing hormone (LH), 0.5 μg / ml FSH, 10 ng / ml gentamicin (APP Pharm), and 0.1% polyvinyl alcohol, at 38.5°C, 5% CO2, and humidified air for 42-44 hours. At the end of maturation, surrounding cumulus cells were removed from the oocytes by vortexing in the presence of 0.1% hyaluronidase for 3 minutes. In vitro-matured oocytes were then placed in groups of 25–30 oocytes in a 50 μl drop of IVF medium (modified Tris-buffered medium containing 113.1 mM NaCl, 3 mM KCl, 7.5 mM CaCl2, 11 mM glucose, 20 mM Tris, 2 mM caffeine, 5 mM sodium pyruvate, and 2 mg / ml bovine serum albumin [BSA]). One 100 μl frozen semen pellet was thawed in 3 ml of Dulbecco's PBS supplemented with 0.1% BSA. Either frozen WT or fresh eGFP semen was washed by centrifugation at 3×g for 20 minutes in 60% Percoll and 10 minutes in modified Tris-buffered medium. In some cases, freshly collected semen heterozygous for the eGFP transgene as previously described was washed three times in PBS. The semen pellet was then diluted with 0.5 x 10 sperm using IVF medium. 6 The embryos were resuspended to 1000 cells / ml. 50 microliters of sperm suspension was introduced into the droplet with the oocytes. The gametes were co-incubated for 5 hours at 38.5°C in an atmosphere of 5% CO2 in air. After fertilization, the embryos were incubated in PZM3-MU1 at 38.5°C and 5% CO2 in air.

[0336] Embryo transfer Embryos generated to generate GE CD163 or CD1D pigs were transferred into surrogate mothers either on day 1 after first male acceptance (SCNT) or day 6 (zygote injection). For day 6 transfers, zygotes were cultured for an additional 5 days in PZM3-MU1 in the presence of 10 ng / ml ps48 (Stemgent, Inc.). Embryos were surgically transferred into the ampulla-isthmus junction of the oviduct of the surrogate mother.

[0337] In vitro synthesis of RNA for the CRISPR / Cas9 system Template DNA for in vitro transcription was amplified using PCR (Table 4). The CRISPR / Cas9 plasmid used for cell transfection experiments served as a template for PCR. To express Cas9 in zygotes, Cas9 mRNA was generated using the mMESSAGE mMACHINE Ultra Kit (Ambion). A poly(A) signal was then added to the Cas9 mRNA using a Poly (A) Tailing Kit (Ambion). CRISPR guide RNA was generated using MEGAshortscript (Ambion). The quality of the synthetic RNA was visualized on a 1.5% agarose gel, then diluted to a final concentration of 10 ng / μl (both gRNA and Cas9) and distributed into 3 μl aliquots. [Table 4]

[0338] Microinjection of engineered CRISPR / Cas9 systems into zygotes Cas9-encoding messenger RNA and gRNA were introduced into the cytoplasm of fertilized oocytes (presumptive zygotes) 14 hours after fertilization using a FemtoJet microinjector (Eppendorf). Microinjections were performed in operating medium on the heated stage of a Nikon inverted microscope (Nikon Corporation; Tokyo, Japan). Injected zygotes were transferred to PZM3-MU1 containing 10 ng / ml ps48 until further use.

[0339] statistical analysis Colonies with modified genomes were numbered 1, and colonies without genome modifications were numbered 0. Differences were determined by using PROC GLM (SAS), and a P value of 0.05 was considered significant. Means were calculated as least squares means. Data are presented as number means ± SEM.

[0340] result CRISPR / Cas9-mediated knockout of CD163 and CD1D in somatic cells The efficiency of four different CRISPR plasmids targeting CD163 (guide 10, 131, 256, and 282) was tested using a donor DNA amount of 2 μg / μl (Table 5). CRISPR282 resulted in significantly higher average colony formation than CRISPR10 and 256 treatments (P<0.05). The long-range PCR assay described above revealed large deletions ranging from 503 bp to 1506 bp instead of the originally intended HR deletions (Figure 3, panel A). This was unexpected, as previous reports using other DNA editing systems have shown much smaller deletions of 6 to 333 bp using ZFNs in pigs. CRISPR10 and a mixture of all four CRISPRs resulted in a higher number of colonies with modified genomes than CRISPR256 and 282 (Table 5, P<0.002). Transfection of a plasmid containing CRISPR10 and Neo but not homologous to CD163 did not yield colonies displaying large deletions. Interestingly, one monoallelic deletion was also detected when donor DNA was introduced without CRISPR. This assay likely represents an underestimate of the mutation rate, as transfected somatic cells were not screened for any possible small deletions by sequencing that were not detectable on agarose gels. [Table 5] *The 4 mix + donor DNA represents an equal mix of 0.5µg of each CRISPR and 1µg of donor DNA. The donor DNA treatment served as a no-CRISPR control, and the 10 + Neo treatment demonstrates that the large deletion observed with CRISPR treatment was only present when CD163 donor DNA was also present. †ANOVA was performed comparing the mean number of colonies / plate to estimate CRISPR toxicity and the percent of colonies with modified genomes. P values ​​were 0.025 and 0.0002, respectively. n / a = there were no replicates for this treatment, so statistical analysis was not performed. ‡One colony with HR represents a partial HR event. a-c Superscripts indicate significant differences between treatments for both the mean number of colonies / plate and the percent of colonies with modified genomes (P<0.05).

[0341] Although the initial goal was to obtain domain swap (DS)-targeting events for CD163 by HR, CRISPR did not increase the efficiency of targeting CD163. It should be noted that various combinations of this targeting vector have been used to modify CD163 by HR and traditional transfection, resulting in 0 targeting events after screening 3,399 colonies (Whitworth and Prather, unpublished results). Two pigs were obtained with a complete DS resulting from HR, containing all 33 mutations attempted to be introduced by transfection using CRISPR10 and the DS targeting vector as donor DNA.

[0342] Next, we tested the efficiency of CRISPR / Cas9-induced mutations without drug selection; the fetal fibroblast cell line used in this study already contained the Neo resistance cassette and SIGLEC1 knockout. We also tested whether the ratio of CRISPR / Cas9 to donor DNA increased genome modification or exerted toxic effects at high concentrations. CRISPR131 was chosen for this trial because previous experiments had yielded high total colony numbers and an increased percentage of colonies with modified genomes. Increasing the amount of CRISPR131 DNA from 3:1 to 20:1 did not have a significant effect on fetal fibroblast viability. The percentage of colonies with genome modification via NHEJ did not differ significantly between various CRISPR concentrations, although a 10:1 ratio had the highest number of NHEJs (Table 6, P = 0.33). Even at the highest ratio of CRISPR DNA to donor DNA (20:1), no HR was observed. [Table 6] a There was a significant difference between treatments for the percentage of colonies with NHEJ repair (P>0.05). b There was no significant difference in the number of genome-modified colonies with increasing CRISPR concentration (P>0.33).

[0343] Based on this experience, we attempted targeted disruption of CD1D in somatic cells. Four different CRISPRs were designed and tested in both male and female cells. CD1D modifications were detectable with three of the applied CRISPRs, but the use of CRISPR5350 did not result in CD1D modifications with deletions large enough to be detected by agarose gel electrophoresis (Table 7). Interestingly, although donor DNA was provided, no genetic modifications were obtained by HR. However, large deletions similar to those observed in the CD163 knockout experiment were observed (Figure 3, panel B). When CRISPR / Cas9 was not used with donor DNA, targeted CD1D modifications with large deletions were not detected. CD1D modifications resulting from CRISPR / Cas9-guided targeting were 4 / 121 and 3 / 28 in male and female colonies, respectively. Only INDELs detectable by agarose gel electrophoresis were included in the transfection data. [Table 7]

[0344] Generation of CD163 and CD1D pigs by SCNT using GE cells Cells displaying CD163 or CD1D modifications were used for SCNT to generate CD163 and CD1D knockout pigs (Figure 3). Seven embryo transfers (CD163 Table 8), six embryo transfers (without CD163-Neo), and five embryo transfers (CD1D) into recipient gilts were performed using SCNT embryos derived from male and female fetal fibroblasts transfected with the CRISPR / Cas9 system. Six (CD163), two (without CD163-Neo), and four (CD1D) recipient gilts (Table 9) maintained pregnancies to term, resulting in pregnancy rates of 85.7%, 33.3%, and 80%, respectively. Of the CD163 recipients, five delivered healthy piglets by cesarean section. One (O044) gave birth naturally. Litter sizes ranged from one to eight. Four pigs were euthanized due to postnatal growth failure. One piglet was euthanized due to a severe cleft palate. All remaining piglets appeared healthy (Figure 3, panel C). Two litters of male piglets obtained from fetal fibroblasts transfected with CRISPR10 and donor DNA, as described in Figure 3, panel B, had a 30-bp deletion in exon 7 adjacent to CRISPR10 and an additional 1476-bp deletion in the preceding intron, thus removing the intron 6 / exon 7 junction of CD163 (Figure 3, panel E). Genotypes and predicted translations are summarized in Table 10. One male piglet and one female litter (four piglets) were obtained from transfection of previously modified SIGLEC1 cells without CD163-Neo. All five piglets were double knockouts for SIGLEC1 and CD163. The male piglet had biallelic modifications of CD163, with a 28 bp deletion in exon 7 and a partial deletion of exon 7 on one allele and a 1387 bp deletion on the other allele that included a complete deletion of exon 8 and the previous intron, thereby removing the intron-exon junction. The female piglet had biallelic mutations of CD163, including a 1382 bp deletion and an 11 bp insertion on one allele and a 1720 bp deletion of CD163 on the other allele. A summary of the CD163 modifications and predicted translation can be found in Table 10.A summary of the CD1D modifications and predicted translation due to CRISPR modification can be found in Table 11. Briefly, one female and two male litters were born, resulting in 13 piglets. One piglet died shortly after birth. Twelve of the 13 piglets contained biallelic or homozygous deletions of CD1D (Figure 3, panel F). One piglet was WT. [Table 8] * CD163 CRISPR NT lines represent embryos generated by NT using a transfected fetal fibroblast cell line. CRISPR-injected embryos were IVF embryos injected with CD163 guide RNA along with CAS9 RNA at the one-cell stage. CD163 CRISPR NT-No Neo fetal lines represent embryos generated by NT using previously modified fetal fibroblasts that were already transfected without the use of a selectable marker and were Neo-resistant lines. †MU indicates gilt oocytes aspirated and matured at the University of Missouri as described in the IVF section of Materials and Methods. ART indicates purchased gilt oocytes matured as described in the SCNT section of Materials and Methods. [Table 9] * The CD1D CRISPR NT line represents embryos generated using a fetal fibroblast line transfected with NT. The CRISPR-injected embryos were IVF embryos injected with CD1D guide RNA along with CAS9 RNA at the one-cell stage. †MU indicates gilt oocytes aspirated and matured at the University of Missouri as described in the IVF section of Materials and Methods. ART indicates purchased gilt oocytes matured as described in the SCNT section of Materials and Methods. [Table 10] TIFF0007808875000011.tif235160 TIFF0007808875000012.tif238160 * KO, knockout ** Piglets were not included as they were euthanized. †The SEQ ID NO. in this column indicates the SEQ ID NO. for the sequence showing the INDEL relative to SEQ ID NO:47. a The inserted sequence was TACTACT (SEQ ID NO:115) b The inserted sequence was AG. c The inserted sequence was a single adenine (A) residue. d The inserted sequence was TGTGGAGAATTC (SEQ ID NO:116). e The inserted sequence was AGCCAGCGTGC (SEQ ID NO:117). [Table 11] * KO, knockout

[0345] Efficiency of the CRISPR / Cas9 system in porcine zygotes Based on the targeted disruption of CD163 and CD1D in somatic cells using the CRISPR / Cas9 system, this approach was applied to porcine embryogenesis. First, we tested the effectiveness of the CRISPR / Cas9 system in developing embryos. The eGFP-targeting CRISPR / Cas9 system was introduced into zygotes fertilized with semen from a boar heterozygous for the eGFP transgene. After injection, subsequent embryos expressing eGFP were monitored. Various concentrations of the CRISPR / Cas9 system were tested, and cytotoxicity of the delivered CRISPR / Cas9 system was observed (Figure 4, Panel A); embryo development after CRISPR / Cas9 injection was lower than that of controls. However, all tested CRISPR / Cas9 concentrations were effective in generating eGFP modifications, as no embryos with eGFP expression were found in the CRISPR / Cas9-injected group (Figure 4, Panel B); 67.7% of uninjected control embryos were green, indicating eGFP expression. Genotyping of individual blastocysts allowed the identification of small mutations near the CRISPR binding site (Figure 4, panel C). Based on toxicity and efficacy, 10 ng / μl of gRNA and Cas9 mRNA were used for the following experiments.

[0346] When CRISPR / Cas9 constructs designed to target CD163 were introduced into presumptive zygotes, targeted gene modification was observed in the resulting blastocysts. When individual blastocysts were genotyped for CD163 mutations, specific mutations were found in all embryos (100% GE efficiency). More importantly, embryos with homozygous or biallelic modifications were found (8 / 18 and 3 / 18, respectively) (Figure 5), but mosaic (single-allelic modification) genotypes were also detected (4 / 18 embryos). Several embryos (8 / 10) from this pool were injected with 2 ng / μl Cas9 and 10 ng / μl CRISPR, and no difference in mutagenesis efficiency was observed. Based on the in vitro results, we then introduced two CRISPRs representing different gRNAs to disrupt CD163 or CD1D during embryogenesis, inducing specific deletion of the target gene. As a result, we were able to successfully introduce designed deletions of CD163 and CD1D by introducing two guides. An engineered deletion is defined as a deletion that removes the genomic sequence between the two introduced guides. Among embryos that received two CRISPRs targeting CD163, all but one embryo achieved targeted modification of CD163. Additionally, 5 / 13 embryos were found to have the engineered deletion in CD163 (Figure 6, Panel A), and 10 / 13 embryos appeared to have CD163 modification in either a homozygous or biallelic manner. Targeting CD1D with two CRISPRs was also effective, as all embryos (23 / 23) showed CD1D modification. However, the engineered deletion of CD1D could only be found in two embryos (2 / 23) (Figure 6, Panel B). Five of the 23 embryos were also found to have a mosaic genotype, while the remainder had either homozygous or biallelic modifications of CD1D. Finally, we tested whether multiple genes could be targeted in the same embryo with the CRISPR / Cas9 system by targeting both CD163 and eGFP in zygotes fertilized with heterozygous eGFP sperm.Blastocysts derived from injected embryos were genotyped for CD163 and eGFP, and it was found that CD163 and eGFP were successfully targeted during embryogenesis. Sequencing results demonstrated that multiple genes could be targeted by introducing multiple CRISPRs with Cas9 (Figure 6, panel C).

[0347] Generation of CD163 and CD1D mutants from CRISPR / Cas9-injected zygotes Based on the success of previous in vitro studies, several CRISPR / Cas9-injected zygotes were generated and 46–55 blastocysts were implanted per recipient (as this number has been shown to be effective for generating pigs from in vitro-derived embryos). Four embryo transfers were performed, resulting in pregnancies for each modification: two each for CD163 and CD1D. Four healthy piglets carrying the CD163 modification were generated (Table 8). All piglets from recipient sow IDO083, litter 67, showed homozygous or biallelic modifications of CD163 (Figure 7). Two piglets showed engineered deletion of CD163 due to the two delivered CRISPRs. All piglets were healthy. For CD1D, one pregnancy also produced four piglets (litter 166 from recipient sow identification number O165): one female and three males (Table 9). One piglet (166-1) carried a mosaic mutation in CD1D, including a 362-bp deletion that completely removed exon 3, including the start codon (Figure 8). One piglet contained a 6-bp insertion, a 2-bp mismatch on one allele, and a large deletion on the other allele. Two additional piglets had single-bp insertions on both alleles. No mosaic mutations were detected for CD163.

[0348] Essay Increasing the efficiency of GE pig production can have a broad impact by providing more GE pigs for agricultural and biomedical applications. The data described above demonstrate that the CRISPR / Cas9 system can be used to generate GE pigs with specific mutations with high efficiency. The CRISPR / Cas9 system has been successfully applied to modify genes in both somatic cells and preimplantation embryos.

[0349] When the CRISPR / Cas9 system was introduced into somatic cells, it successfully induced targeted disruption of the target gene by NHEJ, but did not increase the targeting ability by HR. The targeting efficiency of individual CRISPR / Cas9 vectors in somatic cells varied, indicating that the guide design can affect targeting efficiency. Specifically, when CRISPR5350 and Cas9 were introduced into somatic cells, targeted modification of CD1D was not observed. This suggests that it may be beneficial to design multiple gRNAs and validate their efficiency before generating pigs. The reason for the lack of HR repair due to the presence of donor DNA remains unclear. After screening 886 colonies transfected with CRISPR and donor DNA (both CD163 and CD1D), only one colony had evidence of a partial HR event. The results demonstrated that the CRISPR / Cas9 system worked with the introduced donor DNA to cause unexpected large deletions in the target gene, but did not increase HR efficiency for these two specific targeting vectors. However, the specific mechanism for the observed large deletions remains unknown. Previous reports from our group suggested that donor DNA can be effectively used with ZFNs to induce HR repair. Similarly, increased targeting efficiency was observed when donor DNA was used with the CRISPR / Cas9 system, but complete HR repair was not observed. Previous studies using ZFNs observed that targeted modification can occur through a combination of HR and NHEJ, since partial recombination of the introduced donor DNA was observed after ZFN-induced DSBs. One explanation is that the HR and NHEJ pathways are not independent but can act together to complete the repair process after DSBs induced by homing endonucleases. Although higher CRISPR concentrations improved targeting efficiency in somatic cells, no statistical difference was observed in the results of these experiments.This suggests that CRISPR is a limiting factor in the CRISPR / Cas9 system, but further validation is required. Target cells were successfully used to generate GE pigs by SCNT, indicating that the application of CRISPR / Cas9 does not affect the ability of cells to be cloned. A few piglets were euthanized due to health issues; however, this is rare in SCNT-derived piglets.

[0350] When the CRISPR / Cas9 system was introduced into developing embryos by zygote injection, nearly 100% of the embryos and pigs contained INDELs in the targeted gene, demonstrating that the technique is highly effective during embryogenesis. The efficiency observed in this study exceeds the reported frequency in other studies using homing endonucleases during embryogenesis. The reduced number of embryos that reached the blastocyst stage suggests that the concentration of CRISPR / Cas9 introduced in this study may be toxic to the embryos. Further optimization of the delivery system may increase embryo viability and thus improve the overall efficiency of the process. The nearly 100% mutagenesis rate observed here differs from previous reports of CRISPR / Cas9-mediated knockout in pigs; however, the difference in efficiency between studies may be due to the guide and target combinations selected. In this study, lower concentrations of CRISPR / Cas9 (10 ng / μl each) were effective in generating mutations in developing embryos and generating GE pigs. This concentration is lower than that previously reported in pig zygotes (125 ng / μl Cas9 and 12.5 ng / μl CRISPR). Lower concentrations of CRISPR / Cas9 components may be beneficial to the developing embryo, as introducing excess nucleic acid into a developing embryo can be toxic. Some mosaic genotypes were observed in CRISPR / Cas9-injected embryos from in vitro assays; however, only one piglet generated by this approach had a mosaic genotype. Potentially, injection of CRISPR / Cas9 components may be more effective than introduction of other homing endonucleases, as mosaic genotypes were thought to be a major hurdle in using the CRISPR / Cas9 system in zygotes. Another advantage of using the CRISPR / Cas9 system demonstrated by the present results is that no CD163 knockout pigs generated from IVF-derived zygotes injected with the CRISPR / Cas9 system were lost, whereas two or three piglets obtained from SCNT were euthanized after a few days.This suggests that the technique could not only circumvent the need for SCNT to generate knockout pigs, but also overcome the common health problems associated with SCNT. Now that injection of CRISPR / Cas9 mRNA into zygotes has been optimized, further experiments will include co-injection of donor DNA as well.

[0351] This study demonstrates that introducing two CRISPRs into zygotes with Cas9 can induce chromosomal deletions in developing embryos, generating pigs with the intended deletion—i.e., the specific deletion between the two CRISPR guides. This designed deletion can be beneficial because it allows for the size of the deletion to be specified rather than relying on random events caused by NHEJ. Specifically, when there are insertions / deletions of multiples of three nucleotides caused by homing endonucleases, the mutation may result in a hypomorphic mutation because frameshifts do not occur. However, introducing two CRISPRs allows for larger deletions, which may increase the likelihood of generating a nonfunctional protein. Interestingly, the CD1D CRISPRs were designed to span a larger area of ​​the genome than CD163; CD163 CRISPRs 10 and 131 were separated by 124 bp, while CD1D CRISPRs 4800 and 5350 were separated by 550 bp. Longer distances between CRISPRs were less effective at creating deletions, as shown in this study. However, because this study included limited observations and the efficacy of individual CRISPRs (not addressed here) needs to be considered, further research is needed to verify the relationship between the distance between CRISPRs and the probability of creating the intended deletion.

[0352] The CRISPR / Cas9 system was also effective in simultaneously targeting two genes in the same embryo, with the only extra step being the introduction of one additional CRISPR and crRNA. This demonstrates the ease with which multiple genes can be disrupted c...

Claims

1. 1. A method for increasing porcine reproductive and respiratory syndrome virus (PRRSV) resistance in a porcine animal, its progeny, or cells thereof relative to a wild-type porcine animal, its progeny, or cells thereof, comprising: The method comprises modifying at least one chromosomal sequence of a gene encoding a CD163 protein in the porcine animal, its offspring, or its cells; The modification is an 11-bp deletion from nucleotide 3137 to nucleotide 3147 relative to reference sequence SEQ ID NO: 47; On the same allele, a 377 bp deletion from nucleotide 2573 to nucleotide 2949 and a 2 bp addition between nucleotides 3149 and 3150 compared to reference sequence SEQ ID NO: 47; On the same allele, a 1930 bp deletion from nucleotide 488 to nucleotide 2,417, a 12 bp insertion in the deletion beginning at nucleotide 488, and a 129 bp deletion from nucleotide 3044 to nucleotide 3172 relative to reference sequence SEQ ID NO:47; a 1,467 bp deletion from nucleotide 2,431 to nucleotide 3,897 relative to reference sequence SEQ ID NO: 47; a 1280 bp deletion from nucleotide 2818 to nucleotide 4097 relative to reference sequence SEQ ID NO: 47; and combinations thereof, selected from the group consisting of method.

2. 2. The method of claim 1, wherein the porcine animal, offspring, or cells are heterozygous for the modification.

3. 2. The method of claim 1, wherein the porcine animal, offspring, or cells are homozygous for the modification.

4. 10. The method of claim 1, wherein the modification is generated by the action of a CRISPR, TALEN, or ZFN nuclease.

5. 1. A method for producing a porcine animal having increased resistance to porcine reproductive and respiratory syndrome (PRRS) relative to a wild-type porcine animal, the method comprising: Enucleating the oocyte, fusing the oocyte with a donor somatic cell to produce a fused cell, wherein the genome of the somatic cell comprises an alteration in at least one chromosomal sequence of a gene encoding a CD163 protein, the alteration comprising: an 11-bp deletion from nucleotide 3137 to nucleotide 3147 relative to reference sequence SEQ ID NO: 47; On the same allele, a 377 bp deletion from nucleotide 2573 to nucleotide 2949 and a 2 bp addition between nucleotides 3149 and 3150 compared to reference sequence SEQ ID NO: 47; On the same allele, a 1930 bp deletion from nucleotide 488 to nucleotide 2,417, a 12 bp insertion in the deletion beginning at nucleotide 488, and a 129 bp deletion from nucleotide 3044 to nucleotide 3172 relative to reference sequence SEQ ID NO:47; a 1,467 bp deletion from nucleotide 2,431 to nucleotide 3,897 relative to reference sequence SEQ ID NO: 47; a 1280 bp deletion from nucleotide 2818 to nucleotide 4097 relative to reference sequence SEQ ID NO: 47; and combinations thereof, generating a fused cell selected from the group consisting of: and activating the fused cells to produce an embryo. A method comprising:

6. 6. The method of claim 5, further comprising implanting the embryo into the reproductive tract of a surrogate porcine animal that has initiated estrus but has not yet completed ovulation, and wherein pregnancy and full-term birth produces a genetically modified porcine animal whose genome comprises a modification in at least one chromosomal sequence of a gene encoding a CD163 protein, wherein the modification comprises: an 11-bp deletion from nucleotide 3137 to nucleotide 3147 relative to reference sequence SEQ ID NO: 47; On the same allele, a 377 bp deletion from nucleotide 2573 to nucleotide 2949 and a 2 bp addition between nucleotides 3149 and 3150 compared to reference sequence SEQ ID NO: 47; On the same allele, a 1930 bp deletion from nucleotide 488 to nucleotide 2,417, a 12 bp insertion in the deletion beginning at nucleotide 488, and a 129 bp deletion from nucleotide 3044 to nucleotide 3172 relative to reference sequence SEQ ID NO:47; a 1,467 bp deletion from nucleotide 2,431 to nucleotide 3,897 relative to reference sequence SEQ ID NO: 47; a 1280 bp deletion from nucleotide 2818 to nucleotide 4097 relative to reference sequence SEQ ID NO: 47; and combinations thereof, selected from the group consisting of method.

7. The method of claim 5 or 6, wherein the somatic cells comprise fibroblasts.

8. 1. A method for producing a genetically modified porcine animal comprising an alteration in at least one chromosomal sequence of a gene encoding a CD163 protein, said porcine animal exhibiting increased resistance to Porcine Reproductive and Respiratory Syndrome Virus (PRRSV), said method comprising: mating a genetically modified sow pig animal produced by the method of claim 5 or 6 with a genetically modified boar pig animal produced by the method of claim 5 or 6 to produce F1 offspring; and screening the F1 progeny to identify pig animals in which both alleles of the CD163 gene contain said modification; A method comprising:

9. The method of claim 8, wherein the modification includes an insertion, deletion, frameshift mutation, point mutation, or any combination thereof.

10. The method described in claim 8, wherein the porcine animal exhibiting increased resistance to porcine reproductive and respiratory syndrome virus (PRRSV) comprises a mutation that alters the expression or activity of CD163.

11. 9. The method of claim 8, wherein the modification in at least one chromosomal sequence of the gene encoding the CD163 protein results in a CD163 protein that reduces susceptibility to porcine reproductive and respiratory syndrome virus (PRRSV).

Citation Information

Patent Citations

  • Porcine genital respiratory syndrome virus-resistant animals

    JP2014519323A

  • Domain 5 of CD163 for use in antiviral compositions against PRRS, and transgenic animals

    WO2015011483A1