Nanoparticles with a single site for template polynucleotide attachment - Patent Application 20070122999

Abstract

Nanoparticles are provided, including a scaffold, a single template site for attaching a template polynucleotide to the scaffold, and multiple accessory sites for attaching accessory oligonucleotides to the scaffold, wherein the scaffold is selected from one or more scaffold DNA molecules and one or more scaffold polypeptides, the single template site for attaching the template polynucleotide to the scaffold is selected from covalent template binding sites and non-covalent template binding sites, and the multiple accessory sites for attaching accessory oligonucleotides to the scaffold are selected from covalent accessory oligonucleotide binding sites and non-covalent accessory oligonucleotide binding sites. Methods of using the nanoparticles, particularly in decoding-by-synthesis, are also provided.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application is an international application filed pursuant to the provisions of the Patent Cooperation Treaty, and claims priority to U.S. Provisional Patent Application No. 62 / 952,799, filed December 23, 2019, and U.S. Provisional Patent Application No. 62 / 952,866, filed December 23, 2019, the entire contents of which are incorporated herein by reference. Sequence Listing

[0002] This application contains a Sequence Listing created on December 16, 2020, the file is in ASCII format, is named H1912656.txt, and is 6.8 KB in size. The file is incorporated by reference in its entirety into this application. [Background technology]

[0003] Many current sequencing platforms use "sequencing by synthesis" (SBS) technology and fluorescence-based methods for detection. In some examples, multiple target, or template, polynucleotides isolated from a library to be sequenced are attached to a substrate surface in a process known as seeding. Multiple copies of the template polynucleotides can then be attached to the surface and synthesized adjacent to the seeded template polynucleotide locations in a process called clustering. Nascent copies of the clustered polynucleotides are then synthesized under conditions that emit a signal specific to each nucleotide when attached to the nascent strand. Clustering of multiple copies of the seeded template polynucleotides adjacent to the initial seeding location results in a visible amplification of the signal generated during polymerization, improving detection.

[0004] Seeding and clustering for SBS can proceed well if as much of the available substrate surface as possible is seeded with template polynucleotides, maximizing the amount of sequence information that can be obtained during a sequencing run. In contrast, the less surface area of ​​the available substrate used for seeding and clustering, the less efficient the SBS process can be, and the more time, reactants, and costs required to obtain a particular amount of sequence information for a library can increase, potentially resulting in complex data processing.

[0005] Seeding and clustering also proceeds well when template polynucleotides from a library with different sequences are seeded or attached to locations on the surface that are sufficiently distant from each other so that clustering results in spatially distinct clusters of copied polynucleotides, each resulting from the seeding of a single template polynucleotide; this condition is commonly referred to as monoclonal. That is, a template polynucleotide library may generally contain a large number of template polynucleotide molecules whose nucleotide sequences differ from each other. If two such template polynucleotides are too close to each other on the surface of the substrate, clustering may result in a spatially mixed population of copied polynucleotides, some of which have the sequence of one of the template polynucleotides seeded nearby and others of the sequence of another template polynucleotide also seeded nearby on the surface. Alternatively, two clusters formed from two different template polynucleotides seeded too close to each other may be too close or adjacent to each other, and even if there is no or minimal spatial mixing of sequences attached to the substrate between the clusters, the imaging system used in the SBS process may not be able to distinguish them from separate clusters. Such a disadvantage may generally be referred to as polyclonality, and when present, obtaining unambiguous sequence information from polyclonal clusters can be more difficult, time-consuming, expensive, less efficient, and require more complex data analysis. Summary of the Invention

[0006] Therefore, it is desirable to perform SBS under conditions that utilize as much available surface area of ​​the substrate surface as possible for seeding and clustering, while promoting separation of seeded template polynucleotides so as to maximize the monoclonality of the clusters and minimize polyclonal clusters as much as possible. Disclosed herein are compositions and methods that can be used to advantageously increase seeding density and monoclonal clustering in SBS.

[0007] In one aspect, a nanoparticle is provided, comprising a scaffold, a single template site for attaching a template polynucleotide to the scaffold, and a plurality of accessory sites for attaching accessory oligonucleotides to the scaffold, wherein the scaffold is selected from one or more scaffold DNA molecules and one or more scaffold polypeptides, the single template site for attaching the template polynucleotide to the scaffold is selected from covalent template binding sites and non-covalent template binding sites, and the plurality of accessory sites for attaching accessory oligonucleotides to the scaffold are selected from covalent accessory oligonucleotide binding sites and non-covalent accessory oligonucleotide binding sites.

[0008] In one example, the scaffold comprises one or more scaffold DNA molecules. In another example, the scaffold comprises multiple scaffold DNA molecules, and the multiple scaffold DNA molecules comprise a DNA dendrimer. In yet another example, the DNA dendrimer comprises multiple generations of branched constitutional repeat units, the number of generations being between 2 and 100. In yet another example, each branched constitutional repeat unit comprises three constitutional repeat units of oligodeoxyribonucleotides that hybridize to each other to form an adapter comprising one upstream overhang and two downstream overhangs, wherein the upstream overhang of each second or higher generation adapter is complementary to the downstream overhang of the immediately upstream constitutional repeat unit, and the downstream overhang of the first generation adapter comprises a single template site. In a further example, the scaffold comprises single-stranded DNA.

[0009] In another example, the scaffold comprises one or more scaffold polypeptides. In another example, the scaffold polypeptide comprises green fluorescent protein.

[0010] In another example, the single template site comprises a covalent template binding site. In yet another example, the covalent template binding site is an amine-NHS ester binding site, an amine-imidoester binding site, an amine-pentofluorophenyl ester binding site, an amine-hydroxymethylphosphine binding site, a carboxyl-carbodiimide binding site, a thiol-maleimide binding site, a thiol-haloacetyl binding site, a thiol-pyridyl disulfide binding site, a thiol-thiosulfonate binding site, a thiol-vinyl sulfone binding site, an aldehyde-hydrazide binding site, an aldehyde-alkoxyamine binding site, a hydroxy-isocyanato binding site, an azide-alkyne binding site, an azide-phosphine binding site, a transcyclooctene-tetrazine binding site, a norbornene-tetrazine binding site, an azide-cyclooctyne binding site, an azide-norbornene binding site, an oxime binding site, a SpyTag-SpyCatcher binding site, a Snap-tag-O 6 -benzylguanine binding site, CLIP-tag-O2-benzylcytosine binding site, and sortase-coupled binding site.

[0011] In another example, the single template site comprises a non-covalent template binding site. In yet another example, the non-covalent template binding site comprises a polynucleotide hybridization site. In yet another example, the non-covalent template binding site comprises a non-covalent peptide binding site, the non-covalent peptide binding site being selected from a coiled-coil binding site and an avidin-biotin binding site.

[0012] In another example, the plurality of accessory sites for attaching accessory oligonucleotides to the scaffold include covalent accessory oligonucleotide attachment sites. In yet another example, the covalent accessory oligonucleotide attachment sites include amine-NHS ester attachment sites, amine-imidoester attachment sites, amine-pentofluorophenyl ester attachment sites, amine-hydroxymethylphosphine attachment sites, carboxyl-carbodiimide attachment sites, thiol-maleimide attachment sites, thiol-haloacetyl attachment sites, thiol-pyridyl disulfide attachment sites, thiol-thiosulfonate attachment sites, thiol-vinyl sulfone attachment sites, aldehyde-hydrazide attachment sites, aldehyde-alkoxyamine attachment sites, hydroxy-isocyanato attachment sites, azide-alkyne attachment sites, azide-phosphine attachment sites, transcyclooctene-tetrazine attachment sites, norbornene-tetrazine attachment sites, azide-cyclooctyne attachment sites, azide-norbornene attachment sites, oxime attachment sites, SpyTag-SpyCatcher attachment sites, Snap-tag-O 6 -benzylguanine binding site, CLIP-tag-O2-benzylcytosine binding site, sortase-coupled binding site, and any combination of two or more of the above.

[0013] In another example, the accessory oligonucleotide binding site comprises a non-covalent accessory oligonucleotide binding site. In yet another example, the non-covalent accessory oligonucleotide binding site comprises a polynucleotide hybridization site. In yet another example, the non-covalent accessory oligonucleotide binding site comprises a non-covalent peptide binding site, the non-covalent peptide binding site being selected from one or both of a coiled-coil binding site and an avidin-biotin binding site.

[0014] In another example, the nanoparticle further comprises a single template polynucleotide bound to a single template site, hi yet another example, the nanoparticle further comprises multiple accessory oligonucleotides bound to multiple accessory sites.

[0015] In another example, the nanoparticles may be at least about 10 nm in diameter, at least about 20 nm in diameter, at least about 30 nm in diameter, at least about 40 nm in diameter, at least about 50 nm in diameter, at least about 60 nm in diameter, at least about 70 nm in diameter, at least about 80 nm in diameter, at least about 90 nm in diameter, at least about 100 nm in diameter, at least about 125 nm in diameter, at least about 150 nm in diameter, at least about 175 nm in diameter, at least about 200 nm in diameter, at least about 225 nm in diameter, at least about 250 nm in diameter, at least about 275 nm in diameter, at least about 300 nm, at least about 325 nm in diameter, at least about 350 nm in diameter, at least about 375 nm in diameter, at least about 400 nm in diameter, at least about 425 nm in diameter, at least about 450 nm in diameter, at least about 475 nm in diameter, at least about 500 nm in diameter, at least about 550 nm in diameter, at least about 600 nm in diameter, at least about 650 nm in diameter, at least about 700 nm in diameter, at least about 750 nm in diameter, at least about 800 nm in diameter, at least about 850 nm in diameter, at least about 900 nm in diameter, or at least about 950 nm in diameter.

[0016] In another aspect, a method is provided that includes attaching a single template polynucleotide to a single template site on a nanoparticle.

[0017] In another aspect, a method is provided that includes attaching a plurality of accessory oligonucleotides to a plurality of accessory moieties of a nanoparticle.

[0018] In another aspect, a method is provided that includes at least one of attaching a single template polynucleotide to a single template site on a nanoparticle and attaching multiple accessory oligonucleotides to multiple accessory sites on the nanoparticle, and further includes synthesizing one or more scaffold-attached copies selected from copies of the template polynucleotide, copies of polynucleotides complementary to the template polynucleotide, and both, wherein the scaffold-attached copies extend from the accessory oligonucleotides.

[0019] In another example, the method further comprises attaching the scaffold to a substrate, wherein the attaching comprises hybridizing accessory oligonucleotides to the oligonucleotides attached to the substrate.

[0020] In yet another example of the method, the substrate comprises a plurality of nanowells, and the substrate-attached oligonucleotides are attached within the plurality of nanowells. In yet another example, a single scaffold is attached within any one of the nanowells. In yet another example, the method further comprises synthesizing one or more substrate-attached copies selected from a copy of the template polynucleotide, a copy of a polynucleotide complementary to the template polynucleotide, and copies of both, wherein the substrate-attached copies extend from the oligonucleotides attached to the substrate. In yet another example, the method further comprises sequencing at least one of the scaffold-attached copies and the substrate-attached copies, wherein sequencing comprises decoding-by-synthesis. [Brief explanation of the drawings]

[0021] These and other features, aspects, and advantages of the present disclosure will become better understood from the following detailed description when taken in conjunction with the accompanying drawings.

[0022] [Figure 1] 1 shows an example of a nanoparticle, according to an embodiment of the present disclosure.

[0023] [Figure 2A] 1 shows a portion of an example of a nanoparticle scaffold comprising DNA dendrimers, according to an embodiment of the present disclosure. [Figure 2B] 1 shows a portion of an example of a nanoparticle scaffold comprising DNA dendrimers, according to an embodiment of the present disclosure. [Figure 2C] 1 shows a portion of an example of a nanoparticle scaffold comprising DNA dendrimers, according to an embodiment of the present disclosure. [Figure 2D] 1 shows a portion of an example of a nanoparticle scaffold comprising DNA dendrimers, according to an embodiment of the present disclosure. [Figure 2E]1 shows a portion of an example of a nanoparticle scaffold comprising DNA dendrimers, according to an embodiment of the present disclosure. [Figure 2F] 1 shows a portion of an example of a nanoparticle scaffold comprising DNA dendrimers, according to an embodiment of the present disclosure.

[0024] [Figure 3] 1 shows an example of a nanoparticle comprising a single-stranded DNA scaffold, according to an embodiment of the present disclosure.

[0025] [Figure 4] 1 shows an example of a polypeptide scaffold of a nanoparticle, according to an embodiment of the present disclosure.

[0026] [Figure 5] 1 shows an example of attachment of a template to a nanoparticle, according to an embodiment of the present disclosure.

[0027] [Figure 6] 1 shows an example of synthesizing a scaffolded copy of a template polynucleotide according to an embodiment of the present disclosure.

[0028] [Figure 7] 1 shows an example of covalent attachment of a polynucleotide according to an embodiment of the present disclosure.

[0029] [Figure 8] 1 shows an example of covalent attachment of a scaffold to an amino acid, according to an embodiment of the present disclosure.

[0030] [Figure 9] 1 shows an example of non-covalent attachment of a template polynucleotide to a nanoparticle by hybridization, according to an embodiment of the present disclosure.

[0031] [Figure 10] 1 shows an example of non-covalent attachment of a template polynucleotide to a nanoparticle via a coiled-coil peptide binding moiety, according to an embodiment of the present disclosure.

[0032] [Figure 11]1 shows an example of multiple accessory sites on a nanoparticle scaffold for covalent attachment, according to an embodiment of the present disclosure.

[0033] [Figure 12] 1 shows an example of a nanoparticle within a nanowell, according to an embodiment of the present disclosure.

[0034] [Figure 13] 1 is a graph showing the number of nanoparticles per nanowell according to the surface area of ​​the nanowell, in accordance with an embodiment of the present invention.

[0035] [Figure 14A] 1 shows an example of seeding a substrate with a template polynucleotide using a DNA scaffold, according to an embodiment of the present disclosure. [Figure 14B] 1 shows an example of seeding a substrate with a template polynucleotide using a DNA scaffold, according to an embodiment of the present disclosure. [Figure 14C] 1 shows an example of seeding a substrate with a template polynucleotide using a DNA scaffold, according to an embodiment of the present disclosure. [Figure 14D] 1 shows an example of seeding a substrate with a template polynucleotide using a DNA scaffold, according to an embodiment of the present disclosure. DETAILED DESCRIPTION OF THE INVENTION

[0036] References throughout this specification to "one example," "another example," "an example," etc. mean that a particular element (e.g., a feature, structure, and / or characteristic) described in connection with an example is included in at least one example described herein and may or may not be present in other examples. Furthermore, unless the context clearly dictates otherwise, it should be understood that the described elements with respect to any example may be combined in any suitable manner in the various examples.

[0037] The present disclosure relates to compositions and methods for increasing monoclonal clustering during SBS. In one example, the principle of size exclusion is used to prevent individual template polynucleotides from seeding, thereby promoting clustering that is too close to each other. By associating each individual template polynucleotide with a nanoparticle having a given sufficient spatial dimension, the template polynucleotides can be attached to the surface of a substrate sufficiently far from each other, reducing the formation of polyclonal clusters and increasing the formation of monoclonal clusters. The nanoparticles can contain binding sites for the template polynucleotide. The nanoparticles can have only one single site for binding the template polynucleotide. Thus, only one template polynucleotide can be bound to the nanoparticle, and as a result, the attachment of a template polynucleotide to the scaffold prevents the attachment of a second template polynucleotide to the same nanoparticle, and the attached template polynucleotide occupies its single template polynucleotide binding site. Attachment of only a single template polynucleotide per nanoparticle results in a spatial distribution of template polynucleotides attached to such nanoparticles relative to each other, due directly or indirectly to the size of the attached nanoparticles, reducing the formation of polyclonal clusters.

[0038] Nanoparticles may also contain one or more other types of binding sites, referred to herein as accessory binding sites, for attaching the nanoparticles to a composition or surface in addition to the template polynucleotide. For example, in addition to a single template polynucleotide binding site, the nanoparticles may contain accessory binding sites that allow the nanoparticles to be attached to the surface of a substrate for use in an SBS process. In another example, the nanoparticles may have one or more accessory binding sites for attaching one or more surface polymers to the nanoparticles. In another example, the nanoparticles may contain one or more accessory binding sites for attaching accessory oligonucleotides to the nanoparticles, as described in more detail below, where the oligonucleotides may be attached to the termini of the template polynucleotide or copies thereof as part of the clustering process. In another example, such accessory oligonucleotides may hybridize to oligonucleotides attached to the surface of a substrate for use in an SBS process, thereby allowing nanoparticles with a single template polynucleotide attached to the surface of such a substrate.

[0039] The scaffold may include a single binding site for a template polynucleotide and one or more accessory sites, for example, for attachment of accessory oligonucleotides, but the single template polynucleotide binding site may be of a different chemical or structure than the accessory binding site. Among all of the binding sites, the single template polynucleotide binding site may be the only one with a chemical or structure designed to attach to a template polynucleotide, with a corresponding chemical or structure for attachment to the template polynucleotide. In contrast, one or more accessory binding sites may have a different chemical or structure that is incompatible with binding or attachment to the template polynucleotide. Rather, one or more accessory binding sites may have a chemical or structure that is compatible with binding or attachment to other compositions or structures that the accessory binding site intends to bind, such as accessory oligonucleotides, polymers, etc., but that are incompatible with binding or attachment to the template polynucleotide. Thus, the template polynucleotide is unable to bind or attach to one or more accessory binding sites, resulting in the attachment of only one template polynucleotide per nanoparticle at the single template polynucleotide binding site of the nanoparticle.

[0040] The template polynucleotide can be a polynucleotide obtained from a sample, such as a polydeoxyribonucleic acid isolated from a sample, or a cDNA molecule copied from an mRNA molecule obtained from a sample. The SBS process can be performed, for example, to determine the nucleotide sequence of the template polynucleotide or to identify one or more polymorphisms or variations in the genetic sequence of the template polynucleotide compared to a reference sequence. A library can be prepared from one or more samples, and the library contains multiple template polynucleotides obtained from one or more samples. The template polynucleotide can be obtained by obtaining a polynucleotide sequence that is a portion of a sequence present in or copied from a sample. If sequence information for multiple template polynucleotides in the library is collected and analyzed for the sample from which the library was obtained, sequencing the multiple template polynucleotides in the SBS process can determine the sequence, genotype, or other sequence-related information for the template polynucleotide.

[0041] The template polynucleotide may be treated as part of the process of obtaining the template polynucleotide from a sample. Part of the treatment may include adding polynucleotide sequences, such as to the 5-prime, 3-prime, or both ends of the template, to aid in the subsequent SBS process. As further disclosed herein, the template polynucleotide may be further modified by adding features that promote or permit bond formation with sites on the nanoparticles.

[0042] The template polynucleotide can be of any given length suitable for obtaining sequence information in the SBS process.For example, the template polynucleotide can be about 50 nucleotides long, about 75 nucleotides long, about 100 nucleotides long, about 125 nucleotides long, about 150 nucleotides long, about 175 nucleotides long, about 200 nucleotides long, about 225 nucleotides long, about 250 nucleotides long, about 275 nucleotides long, about 300 nucleotides long, about 325 nucleotides long, about 350 nucleotides long, about 375 nucleotides long, about 400 nucleotides long, about 425 nucleotides long, about 450 nucleotides long, about 475 nucleotides long, about 500 nucleotides long, about 525 nucleotides long, about 550 nucleotides long, about 575 nucleotides long, about 600 nucleotides long, about 625 nucleotides long, about 650 nucleotides long, about 675 nucleotides long, about 700 nucleotides long, about 725 nucleotides long, about 750 nucleotides long, about 775 nucleotides long, about 800 nucleotides long, It can be about 825 nucleotides in length, about 850 nucleotides in length, about 875 nucleotides in length, about 900 nucleotides in length, about 925 nucleotides in length, about 950 nucleotides in length, about 975 nucleotides in length, about 1,000 nucleotides in length, about 1,025 nucleotides in length, about 1,050 nucleotides in length, about 1,075 nucleotides in length, about 1,100 nucleotides in length, about 1,125 nucleotides in length, about 1,150 nucleotides in length, about 1,175 nucleotides in length, about 1,200 nucleotides in length, about 1,225 nucleotides in length, about 1,250 nucleotides in length, about 1,275 nucleotides in length, about 1,300 nucleotides in length, about 1,325 nucleotides in length, about 1,350 nucleotides in length, about 1,375 nucleotides in length, about 1,400 nucleotides in length, about 1,425 nucleotides in length, about 1,450 nucleotides in length, about 1,475 nucleotides in length, about 1,500 nucleotides in length, or more.

[0043] In some instances, there may be two or more different populations of accessory binding sites on the nanoparticles, some with one type of chemistry or structure that is compatible with binding or attachment to one population of compositions or structures, and others with a second type of chemistry or structure that is compatible with binding or attachment to another population of compositions or structures. For example, one population of accessory sites may have a chemistry or structure that is compatible with binding to accessory oligonucleotides, which may bind to copies of template polynucleotides that are involved in clustering of the template polynucleotides on the nanoparticles, as described in more detail below, for example, while other accessory sites may have a different chemistry or structure that is compatible with binding or attachment to the surface of a substrate for performing SBS.

[0044] The nanoparticles may include a scaffold. The scaffold is a structural component of the nanoparticle-occupied volume, depending on the desired minimum distance between template nanoparticles or the maximum density of template nanoparticles attached to the nanoparticle that may be desired for a given application. The scaffold may include the aforementioned binding sites, such as a single template polynucleotide binding site and one or more accessory binding sites. A scaffold with binding sites may together constitute a nanoparticle. The scaffold may be synthesized to include, or once synthesized, multiple types of chemical properties or structures for attachment. That is, the scaffold may be synthesized or modified to include, a single attachment site to the template polynucleotide and one or more additional binding sites with chemical properties or structures different from the single template polynucleotide binding site corresponding to the accessory binding site.

[0045] The scaffold can be synthesized from several different substitution components. In some examples, the scaffold can be synthesized from one or more scaffold deoxyribonucleic acid (DNA) molecules. The DNA molecules can be designed and structured as further disclosed herein to include different binding sites (i.e., for the template polynucleotide and the accessory binding site) and can also provide size-exclusion properties to separate the template polynucleotides when attached to a polynucleotide. In some examples, the scaffold can include multiple DNA molecules hybridized together to form a dendrimer. For example, an adapter can be formed that includes multiple, e.g., three strands of DNA, or oligodeoxyribonucleotide (oligoDNA) molecules that can hybridize to each other by Watson-Crick base pairing to form a Y-shape, with one end of each hybridizing to one of the other two and the other end of each hybridizing to the other of the other two.

[0046] Such adaptors can form the constituent repeat units of a dendrimer. For example, each end of a Y-shaped adaptor can have a DNA overhang, with one end of the oligo DNA extending beyond the portion that hybridizes to any other oligo DNA. The adaptor of one generation of such a dendrimer can have an overhang at one end of the Y-shape, referred to herein as the upstream end, that can hybridize with the overhang of another Y adaptor that constitutes the constituent repeat unit of the immediately preceding generation of the dendrimer. The other two ends of the adaptor, referred to as the downstream ends, can each have an overhang that can hybridize with the overhang at the upstream end of a Y adaptor that constitutes the constituent repeat unit of the immediately following generation of the dendrimer. Thus, an adaptor of one generation can attach to two adaptors in the next generation, which in turn attach to four adaptors in the next generation, which in turn attach to eight adaptors in the next generation, and so on. Any one end of one of the terminal Y adaptors, any generation that does not hybridize to the upstream overhang of another adaptor, such as the downstream overhang of the last generation, or the upstream overhang of the first generation, may contain or be attached to a single template polynucleotide binding site. In some instances, a DNA oligo containing a matching first-generation upstream overhang is itself an extension of the template polynucleotide and may be added during sample preparation. The other end or overhang may contain or be attached to an accessory site.

[0047] In other examples, the scaffold may comprise one or more single-stranded DNA (ssDNA) molecules modified or structured to allow attachment of a single template polynucleotide to itself and one or more accessory binding sites of one or more accessory compositions or structures. Various methods for generating ssDNA-based scaffolds may be used. In some examples, double-stranded closed loops or plasmids may serve as the coding sequence for ssDNA scaffold molecules in the rolling circle amplification process. Replication of these strands by a strand-displacing DNA polymerase (e.g., Phi29) can generate ssDNA molecules containing concatenated copies of the copied strands of the circular coding strand. Reaction conditions can be adapted to result in the synthesis of ssDNA scaffolds of the desired size. The 5-prime or 3-prime ends may be further modified to contain, be attached to, or be attachable to a single template polynucleotide molecule as a single template site. Accessory sites may include modifications to the other end of the ssDNA scaffold molecule or to individual nucleotides of the strand, as described further below.

[0048] In another example, ssDNA scaffolds can be synthesized by using a template-independent polymerase (e.g., terminal deoxynucleotidyl transferase, or TdT). TdT incorporates deoxynucleotides at the 3-prime hydroxyl end of a single-stranded DNA strand without the need for or copying a template. The 5-prime or 3-prime end can comprise, be attached to, or be further modified to be attachable to a single template polynucleotide molecule as a single template site. Accessory sites can include modifications to the other end of the ssDNA scaffold molecule or to individual nucleotides of the strand, as described further below. As used herein, a "nucleotide" comprises a nitrogen-containing heterocyclic base, a sugar, and one or more phosphate groups. Nucleotides are the monomeric units of nucleic acid sequences. In RNA, the sugar is ribose, and in DNA, the sugar is deoxyribose, i.e., a sugar lacking the hydroxyl group present at the 2' position of the ribose. Nitrogen-containing heterocyclic bases (i.e., nucleobases) can be purine or pyrimidine bases. Purine bases include adenine (A) and guanine (G), as well as modified derivatives or analogs thereof. Pyrimidine bases include cytosine (C), thymine (T), and uracil (U), as well as modified derivatives or analogs thereof. The C-1 atom of deoxyribose is bonded to the N-1 atom of the pyrimidine or the N-9 atom of the purine.

[0049] In another example, an ssDNA scaffold can be synthesized by generating multiple single-stranded DNA molecules by any applicable method and ligating them together to form a single ssDNA molecule as a scaffold. For example, a polymerase can polymerize the formation of a nascent strand of DNA by copying a linearized DNA coding strand in a runoff polymerization reaction (i.e., the polymerase stops extending the nascent strand when it reaches the 5-prime end of the coding strand). Multiple ssDNA products can be synthesized and then ligated end-to-end to form a single ssDNA scaffold. In one example, ligation of one ssDNA product to another can be achieved with the aid of a splint. For example, a short oligo DNA may be designed such that its 3-prime end is complementary to the 5-prime end of one ssDNA product and its 5-prime end is complementary to the 3-prime end of another ssDNA product, such that hybridization of the DNA-oligo to the two ssDNA products results in the 5-prime end joining the 3-prime end of the other in a nicked double-stranded structure where they meet and hybridize to the DNA-oligo. The two ends can then be enzymatically ligated together using a DNA ligase (e.g., T4) to form a single ssDNA molecule from the two. Additional reactions can be included with DNA oligos for splinting one or both ends of the product of such a first reaction to another ssDNA product, etc., to build the ssDNA scaffold as desired.

[0050] The template polynucleotide for binding to the scaffold can be any suitable length, including sequencing in the SBS process. For example, the template polynucleotide can be about 50 nucleotides long, about 75 nucleotides long, about 100 nucleotides long, about 125 nucleotides long, about 150 nucleotides long, about 175 nucleotides long, about 200 nucleotides long, about 225 nucleotides long, about 250 nucleotides long, about 275 nucleotides long, about 300 nucleotides long, about 325 nucleotides long, about 350 nucleotides long, about 375 nucleotides long, about 400 nucleotides long, about 425 nucleotides long, about 450 nucleotides long, about 475 nucleotides long, about 500 nucleotides long, about 525 nucleotides long, about 550 nucleotides long, about 575 nucleotides long, about 600 nucleotides long, about 625 nucleotides long, about 650 nucleotides long, about It can be 675 nucleotides in length, about 700 nucleotides in length, about 725 nucleotides in length, about 750 nucleotides in length, about 775 nucleotides in length, about 800 nucleotides in length, about 825 nucleotides in length, about 850 nucleotides in length, about 875 nucleotides in length, about 900 nucleotides in length, about 925 nucleotides in length, about 950 nucleotides in length, about 975 nucleotides in length, about 1,000 nucleotides in length, about 1,100 nucleotides in length, about 1,200 nucleotides in length, about 1,300 nucleotides in length, about 1,40 nucleotides in length, about 1,500 nucleotides in length, about 1,600 nucleotides in length, about 1,700 nucleotides in length, about 1,800 nucleotides in length, about 1,900 nucleotides in length, about 2,000 nucleotides in length, or more.

[0051] Attachment of a single template polynucleotide or accessory (e.g., accessory oligonucleotide, accessory composition, or accessory structure) to a DNA scaffold can be achieved by including moieties or structures on the scaffold and template polynucleotide or accessory that are complementary to each other, meaning that they are configured to bind to each other covalently or non-covalently and form an attachment between them. These can be complementary for covalent bonding or complementary for non-covalent bonding. A DNA scaffold can include a single template site with a moiety or structure that is complementary to or has a moiety or structure attached to the template polynucleotide (single template site). A DNA scaffold can also include or be attached to other moieties or structures that are complementary to or have a moiety or structure attached to the accessory (accessory site). Cross-reactivity between the moieties or structures attached to the template polynucleotide and those of the accessory site must be avoided to prevent attachment of more than one template polynucleotide to a DNA scaffold. Cross-reactivity between moieties or structures attached to an accessory and moieties or structures of a single template site must also be avoided, preventing occupation of a single template site by an accessory that would prevent attachment to a single template polynucleotide. In some instances, such cross-reactivity can be avoided by chemically blocking a single template site or accessory site while the accessory site binds to the accessory site or while a single template polynucleotide binds to the single template site, respectively, and then unblocking the unoccupied site to allow attachment of a single template polynucleotide or accessory in its place.

[0052] A non-exclusive list of complementary binding partners is shown in Table 1. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4]

[0053] Any of the foregoing may be added to or included in the scaffolds disclosed herein for attachment to a template polynucleotide or an accessory, such as an accessory oligonucleotide, which may include or be modified to include complementary portions or structures of the foregoing pairs for binding to the scaffold.

[0054] Any suitable bioconjugation method for adding or forming a linkage between such pairs of complementary moieties or structures can be used. Examples of any of the complementary moieties or structures, modified nucleotides having examples of such examples, may be commercially available, and methods for incorporating one or more of such example moieties or structures into, attached to, or containing polymers, nucleotides, or polynucleotides are also known. Bifunctional linker molecules having a moiety or structure of one complementary pair of binding partners listed in Table 1 at one end and a moiety or structure of another complementary pair of binding partners listed in Table 1 may also be commercially available. To provide a moiety or structure for binding between any of such aforementioned features, a scaffold moiety or structure, template polynucleotide, or accessory, or oligo- or polypeptide attached to any of the aforementioned features can be attached to either end of such a linker, effectively replacing the initial moiety or structure with another linker, i.e., the moiety or structure present at the other end of the linker.

[0055] For example, a bifunctional linker can have a moiety at one end selected from those listed in Table 1, such as an NHS-ester group. The other end can have another group, such as an azide group. The ends can be linked to each other by a linker, such as one or more PEG groups, alkyl chains, or combinations thereof, in a linking sequence. If a binding site (e.g., in a scaffold, or a template polynucleotide or accessory) has an amine group for binding, the NHS ester end of the bifunctional linker can be bonded to the amine group, leaving a free azide end available for binding to a composition (e.g., a template polynucleotide or accessory, or a scaffold) having a binding partner for the azide group (e.g., an alkyne, phosphine, cyclooctyne, or norbornene). Alternatively, if the binding site (e.g., in the scaffold, or template polynucleotide or accessory) has a binding partner for the azide group (e.g., an alkyne, phosphine, cyclooctyne, or norbornene), the azide end of the bifunctional linker can be attached to the amine group, leaving a free NHS ester end available for attachment to a composition bearing the amine group (e.g., the template polynucleotide or accessory, or scaffold). Many other examples of bifunctional linkers are commercially available, containing a moiety identified in Table 1 at one end to form one type of binding site and a different moiety identified in Table 1 at the other end to form another type of binding site.

[0056] Examples of either complementary moieties or structures, and modified amino acids having examples of such examples, may be commercially available, and methods for including one or more such example moieties or structures in or attached to amino acids or polypeptides are also known. Methods for forming bonds between members of such pairs of complementary moieties or structures are known. Thus, such complementary moieties or structures can be added to or included in scaffold and template polynucleotides or scaffold and accessory to form binding sites and enable attachment therebetween.

[0057] In one example, a single template polynucleotide binding site of a scaffold can comprise a first moiety or structure from Table 1, and one or more accessory sites of the scaffold can comprise one or more other moieties or structures from Table 1. The first moiety or structure can form a binding site with a first binding partner, and the other moiety or structure can form a binding site with another binding partner, under conditions where the first binding partner does not react with the other binding partner to form a binding site, and the other moiety or structure does not react with the first binding partner to form a binding site. In another example, the first moiety or structure and the other moiety or structure are selected so that they do not form binding partners with each other.

[0058] As used herein, the term "polypeptide" is intended to mean a chain of amino acids linked together by peptide bonds. The terms "protein" and "polypeptide" may be used interchangeably. A polypeptide may comprise a sequence of a number of amino acids linked to each other by peptide bonds, where the number of amino acids may be about 2 or more, about 5 or more, about 10 or more, about 15 or more, about 20 or more, about 25 or more, about 30 or more, about 35 or more, about 40 or more, about 45 or more, about 50 or more, about 55 or more, about 60 or more, about 65 or more, about 70 or more, about 75 or more, about 80 or more, about 85 or more, about 90 or more, about 95 or more, about 100 or more, about 110 or more, about 120 or more, about 130 or more, about 140 or more, It may be about 150 or more, about 160 or more, about 170 or more, about 180 or more, about 190 or more, about 200 or more, about 225 or more, about 250 or more, about 275 or more, about 300 or more, about 325 or more, about 350 or more, about 375 or more, about 400 or more, about 425 or more, about 450 or more, about 475 or more, about 500 or more, about 550 or more, about 600 or more, about 650 or more, about 700 or more, about 750 or more, about 800 or more, about 850 or more, about 900 or more, about 950 or more, or about 1000 or more.

[0059] In some cases, a polypeptide or protein may adopt a structure or three-dimensional conformation to facilitate or enable binding to another binding partner, such as another polypeptide, which in turn adopts a three-dimensional conformation that facilitates such binding or other non-protein binding partners. Polypeptides may also adopt a three-dimensional conformation to facilitate the performance of an enzymatic reaction on another substrate polypeptide or other molecule, or to serve as a substrate for another enzymatic or other reaction. Polypeptides may also adopt a three-dimensional conformation such that sites such as the amino terminus, carboxyl terminus, side groups of amino acids, or modifications to amino acids may be accessible for binding to another molecule.

[0060] A variety of bioconjugation chemistries can be used to attach template polynucleotides to nucleotides of a DNA scaffold, or to 5-prime or 3-prime nucleotides (e.g., nucleotides contained in unhybridized overhangs, or other nucleotides in a dendrimer DNA scaffold, or 3-prime or 5-prime terminal nucleotides or nucleotides between them in a ssDNA scaffold). Furthermore, modifications to nucleotides contained in a DNA scaffold, such as phosphate groups, bases, or sugars, can be made to provide a single template site for attachment. Chemical moieties can be included or added to such sites that have the ability to form a covalent bond with a complementary chemical moiety, and that complementary moiety can be attached or included in the template polynucleotide. The template polynucleotide can then be conjugated to the DNA scaffold, such as through a covalent bond between complementary chemical moieties. In some examples, nucleotides modified to include an attachment moiety can be incorporated into a polynucleotide chain by a polymerase, but also include a chemical moiety with which a complementary moiety can react to form a covalent bond between them, and can be included in a polymerization reaction to form the DNA scaffold or part thereof.

[0061] In another example, a DNA scaffold may contain, or have attached thereto, as a single template site, a polypeptide sequence capable of forming a covalent bond to another polypeptide sequence or other chemical moiety. Such other polypeptide or other chemical moiety may then be included in or attached to the template polynucleotide such that the single template site of the scaffold and template polynucleotide can be covalently bonded to one another. Alternatively, the template polynucleotide may have a first such polypeptide sequence, and the single template site of the scaffold may have such other polypeptide sequence or other chemical moiety that can be covalently bonded to the polypeptide sequence of the template polynucleotide. Non-limiting examples of such pairs include the SpyTag / SpyCatcher system, Snap-tag / O 6 -Benzylguanine-based and CLIP-tag / O 2 -benzylcytosine system.

[0062] The amino acid sequences of the complementary pairs of SpyTag / SpyCatcher systems and the polynucleotides encoding them may be available. Exemplary sequences are shown in Table 1. Several amino acid site mutations of the SpyTag and SpyCatcher sequences may be available for inclusion in recombinant polypeptides. Snap-tag is a functional O-6-methylguanine-DNA methyltransferase, and CLIP-tag is a modified version of Snap-tag. Nucleotide sequences encoding Snap-tag, CLIP-tag, and SpyCatcher may be commercially available for subcloning and inclusion into engineered polypeptide sequences.

[0063] Alternatively, complementary pairs of scaffold and template polynucleotides for covalent attachment to a single template site can be covalently linked to one another via enzyme-catalyzed covalent bond formation. For example, the single template site of the scaffold and template polynucleotide can contain motifs that can be covalently linked to one another by sortase-mediated coupling, such as an LPXTG amino acid sequence on one side and an oligoglycine nucleophilic sequence (e.g., with 3-5 glycine repeats) on the other side. Sortase-mediated transpeptidation can then be performed to result in covalent attachment of the scaffold and template polynucleotide at the single template site.

[0064] In another example, a DNA scaffold may include a region for non-covalent binding of a single template polynucleotide at a single template site. For example, the unhybridized overhang of a dendrimer DNA scaffold may be hybridizable to the end of a template polynucleotide by Watson-Crick base pairing. In one example, the upstream overhang of a first-generation adapter of a dendrimer may include a nucleotide sequence complementary to the nucleotide sequence contained at the end of the template polynucleotide. Alternatively, the 3-prime or 5-prime end of an ssDNA scaffold may have a nucleotide sequence complementary to the nucleotide sequence contained at the end of the template polynucleotide. Hybridization of such complementary nucleotide sequences to each other via Watson-Crick base pairing may thereby enable non-covalent binding of a single template site of the DNA scaffold to the template polynucleotide.

[0065] In another example, the DNA scaffold and template polynucleotide may contain or be attached to complementary peptide binding sites. For example, the DNA scaffold and template polynucleotide may contain or be attached to peptide sequences that can bind to each other as a complementary pair of coiled-coil motifs. The coiled-coil motif is a structural feature of some polypeptides in which two or more polypeptide chains each form an α-helical secondary structure, and the α-helical coils together form a tight, non-covalent bond. The coiled-coil sequence may contain a heptad repeat, which is a repeating pattern of seven amino acids HPPHCPC (H represents a hydrophobic amino acid, C typically represents a charged amino acid, and P represents a polar, hydrophilic amino acid). An example of a heptad repeat is found in the leucine zipper coiled coil, where the fourth amino acid of the heptad is frequently leucine.

[0066] The DNA scaffold may comprise or be attached to one amino acid sequence that forms part of a coiled-coil binding pair, and the template polynucleotide may be attached to the DNA scaffold or another amino acid sequence that forms another part of the coiled-coil binding pair that is complementary to the one attached to the DNA scaffold, such that the two are attached to each other. For example, the DNA scaffold may be covalently attached to one amino acid sequence that forms part of a coiled-coil binding pair, and the template polynucleotide may be attached to the DNA scaffold or another amino acid sequence that forms another part of the coiled-coil binding pair that is complementary to the one attached to the DNA scaffold, such that the two are attached to each other.

[0067] In another example, the DNA scaffold and template polynucleotide may each comprise or be attached to the other complementary partner of a non-covalently bound peptide pair. An example is the biotin-avidin binding pair. Biotin and avidin peptides (e.g., avidin, streptavidin, and neutravidin, all of which are collectively referred to herein as "avidin" unless otherwise specified) form strong non-covalent bonds with each other. One member of such a pair, regardless of whether the binding moiety is biotin or avidin, may be part of or attached to either the DNA scaffold or template polynucleotide, and the complementary portion corresponds to or is attached to a portion of the DNA scaffold or template polynucleotide, allowing non-covalent binding therebetween.

[0068] Many methods exist for including or adding one or more biotin moieties to DNA molecules, template polynucleotides, DNA scaffolds, oligo-DNAs, polypeptide scaffolds, other polypeptides, or other compositions for linking molecules together (e.g., template polynucleotides to scaffolds, or accessories to scaffolds). For example, biotinylated nucleotides are commercially available for incorporation into DNA molecules by polymerases, and kits for adding biotin moieties to polynucleotides or polypeptides are commercially available. Biotin residues can also be added to amino acids or modified amino acids, or nucleotides or modified nucleotides. Biotin groups can also be added to, for example, carboxylic acid, amine, or thiol groups of proteins using the linking chemistry shown in Table 1. Several biotin ligase enzymes are also available for enzymatically targeted biotinylation of polypeptides and the like (e.g., to the lysine residue of the AviTag amino acid sequence GLNDIFEAQKIEWHE (SEQ ID NO: 3) contained in a polypeptide). Genetically engineered ascorbate peroxidase (APEX) is also available to modify biotin, allowing the biotinylation of electron-rich amino acids such as tyrosine, and possibly tryptophan, cysteine, or histidine.

[0069] In another example, a polypeptide containing the amino acid sequence DSLEFIASKLA (SEQ ID NO: 4) can be biotinylated (more N-terminal of the two S residues present in the sequence), which is a substrate for covalent attachment catalyzed by Sfp phosphopantethienyl transferase with a small molecule conjugated to coenzyme A (CoA). For example, a polypeptide containing this sequence can be biotinylated by covalent attachment with a CoA-biotin conjugate. This system can also be used to attach many other types of binding moieties or structures identified in Table 1 for use in creating binding sites on scaffolds for binding to DNA molecules or polypeptides or other molecules disclosed herein. For example, CoA conjugated to any of the reactive pair moieties identified in Table 1 can be covalently attached by Sfp phosphopantethienyl transferase to a polypeptide containing the sequence identified above, thereby enabling attachment of another composition comprising a complementary binding partner.

[0070] Other enzymes can be used to add a linking moiety to a polypeptide. For example, a lipoic acid ligase enzyme can add a lipoic acid molecule, or a modified lipoic acid molecule containing a linking moiety identified in Table 1, such as an alkyne or azide group, can be covalently attached to the amine of a lysine side group present in the amino acid sequence DEVLVEIETDKAVLEVPGGEEE (SEQ ID NO: 5) or GFEIDKVWYDLDA (SEQ ID NO: 6) contained in the polypeptide. In another example, a scaffold, template polynucleotide, or other polypeptide or DNA molecule intended to be contained therein or attached to it can contain or be attached to an active serine hydrolase enzyme. A fluorophosphonate molecule becomes covalently attached to a serine residue in the active site of the serine hydrolase enzyme. Analogs of commercially available fluorophosphonate molecules containing a linking moiety identified in Table 1, such as an azide group or a desthiobiotin group (an analog of biotin that can bind to avidin). Thus, such groups may be covalently attached to serine hydrolase enzymes contained in or attached to polypeptides or DNA molecules used in or attached to the scaffolds disclosed herein, and such binding moieties or structures may be covalently linked by using the attachment of an appropriate modified fluorophosphonate molecule to form a binding site on such proteins for a complementary binding partner of Table 1 (e.g., an azido-alkyne, azido-phosphine, azido-cyclooctyne, azido-norbornene, or desthiobiotin-avidin linkage).

[0071] Any of the aforementioned methods of biotinylating a composition to facilitate binding to or otherwise adding functional groups to a polypeptide that includes an avidin sequence (e.g., an avidin polypeptide contained in or attached to another composition) for binding between a scaffold and a template polynucleotide or between a scaffold and an accessory, as part of a scaffold, attached to a scaffold, as part of an accessory, or attached to an accessory or template polynucleotide, can be used to permit or facilitate binding between such components disclosed herein.

[0072] In another example, a scaffold may be synthesized with amino acids, such as a polypeptide or protein molecule. In one example, the single template site for attachment of a template polynucleotide may be at or attached to the N-terminus or C-terminus of such a polypeptide scaffold. In another example, the single template site for attachment of a template polynucleotide may be at or attached to an internal amino acid of the polypeptide scaffold. For example, various bioconjugation chemistries may be used to attach a template polynucleotide to the side group of an amino acid between the C-terminus and N-terminus of a polypeptide, or to one of the termini. Furthermore, modifications to the amino acids of a polypeptide scaffold, such as the side chain of one of the amino acids, may be performed to provide a single template site for attachment. A chemical moiety may be included in or added to such a site that is capable of forming a covalent bond to a complementary chemical moiety, which may then be attached to or included in the template polynucleotide. The template polynucleotide may then be conjugated to the polypeptide scaffold, such as through a covalent bond between the complementary chemical moieties.

[0073] In another example, a polypeptide scaffold may include, or have attached thereto, as a single template site, a polypeptide sequence capable of forming a covalent bond to another polypeptide sequence or other chemical moiety. Such other polypeptide or other chemical moiety may then be included in or attached to the template polynucleotide such that the single template site of the scaffold and template polynucleotide can be covalently bonded to one another. Alternatively, the template polynucleotide may have a first such polypeptide sequence, and the single template site of the scaffold may have such other polypeptide sequence or other chemical moiety that can be covalently bonded to the polypeptide sequence of the template polynucleotide. Non-limiting examples of such pairs include the SpyTag / SpyCatcher system, Snap-tag / O 6 -Benzylguanine-based and CLIP-tag / O 2-benzylcytosine systems. Alternatively, complementary pairs of scaffold and template polynucleotides for covalent attachment to a single template site can be covalently linked to each other via enzyme-catalyzed covalent bond formation. For example, the single template site of the scaffold and template polynucleotide can contain motifs that can be covalently linked to each other by sortase-mediated coupling, such as an LPXTG amino acid sequence on one side and an oligoglycine nucleophilic sequence (e.g., with 3-5 glycine repeats) on the other side. Sortase-mediated transpeptidation can then be performed to result in covalent attachment of the scaffold and template polynucleotide at the single template site.

[0074] In another example, a polypeptide scaffold may include a region for non-covalent attachment of a single template polynucleotide at a single template site. For example, an oligo-DNA may be covalently attached to a single site on the polypeptide scaffold. For example, complementary chemical moieties on the polypeptide scaffold and the oligo-DNA may allow for covalent attachment between them, as described above for direct covalent attachment of a template polynucleotide and a polypeptide scaffold. The oligo-DNA may have a nucleotide sequence complementary to a portion of the template polynucleotide, for example, the 3-prime or 5-prime end of the template polynucleotide. Such complementarity between the oligo-DNA and the template polynucleotide may allow hybridization between a portion of the template oligonucleotide and the oligo-DNA attached to the polypeptide scaffold via Watson-Crick base pairing.

[0075] In another example, the polypeptide scaffold and template polynucleotide may comprise or be attached to complementary peptide binding sites. For example, the peptide scaffold and template polynucleotide may comprise or be attached to peptide sequences that can bind to each other as a complementary pair of coiled-coil motifs. The polypeptide scaffold may comprise or be attached to one amino acid sequence that forms part of a coiled-coil binding pair, and the template polynucleotide may be attached to another amino acid sequence that forms another part of the coiled-coil binding pair that is complementary to the polypeptide scaffold or the one attached to the polypeptide scaffold, such that the two are attached to each other.

[0076] In another example, the polypeptide scaffold and template polynucleotide may each comprise or be attached to the other complementary partner of a non-covalently bound peptide pair. An example is the biotin-avidin binding pair. Biotin and avidin peptides form strong non-covalent bonds with each other. One member of such a pair, regardless of whether the binding moiety is biotin or avidin, may be part of or attached to either the polypeptide scaffold or the template polynucleotide, and the complementary portion corresponds to or is attached to a portion of the polypeptide scaffold or template polynucleotide, allowing for non-covalent binding therebetween.

[0077] For attachment to a single template site on a DNA or polypeptide scaffold, the template polynucleotide may have a complementary attachment moiety or structure added thereto. In some instances, multiple template polynucleotides may be prepared for sequencing during library sample preparation. Generally, during such sample preparation, the template polynucleotides of the library sample are modified to include specific nucleotide sequences in addition to those already included as part of the library to be sequenced. Such added nucleotide sequences may serve any of a variety of functions, including subsequent identification of the template polynucleotide or attachment to the surface of the SBS substrate as part of the seeding process. According to the present disclosure, such preparations of template polynucleotides may also include complementary attachment moieties or structures attached thereto or included therein.

[0078] For example, in the case of a dendrimer DNA scaffold, preparing the template polynucleotide can include adding to or including in the template polynucleotide an oligonucleotide having a nucleotide sequence that corresponds to the nucleotide sequence of the upstream end of the adaptor of the first-generation dendrimer. The first-generation adaptor can then include such a sequence as added to the template polynucleotide as one of the three polynucleotide sequences of which it is composed. In another example, a nucleotide sequence can be added to the template polynucleotide that is complementary to the overhang of the adaptor of the dendrimer DNA scaffold, such as the upstream overhang of the adaptor of the first-generation dendrimer DNA scaffold.

[0079] In another example, preparation of a template polynucleotide can include attaching a nucleotide sequence to the template polynucleotide, e.g., extending from one of its ends, that is complementary to another sequence contained in or attached to a single template site of the scaffold. Hybridization by Watson-Crick base pairing results in binding between the two. In another example, an accessory, such as an accessory oligonucleotide, can be modified to allow covalent attachment to a complementary moiety or structure. For example, modifications to the phosphate group, base, or sugar of a nucleotide contained in an accessory, such as an accessory oligonucleotide, can be included to provide a site for covalent attachment to the accessory site of the scaffold. The accessory site of the scaffold can then contain a complementary moiety or structure that allows attachment to an accessory, such as an oligo-DNA accessory. In one example, a nucleotide modified to contain an attachment moiety that includes the complementary portion of the accessory binding site of the scaffold is included in a polynucleotide sequence added to the template polynucleotide during sample preparation. Numerous modified nucleotides with such chemical moieties are commercially available for covalent attachment of compositions to DNA molecules incorporating such modified nucleotides.

[0080] In another example, a template polynucleotide can be modified, for example, during sample preparation, by attaching it to a polypeptide. Such a polypeptide can have an amino acid sequence and structure that is complementary to the amino acid structure of a single template site of a scaffold, such that the template polynucleotide can be attached to the single template site of a scaffold via the attached polypeptide. Examples of polypeptide pairs for covalent or non-covalent bonding between a single template site of a scaffold and a template polynucleotide are provided above, and non-limiting examples include an α-helical amino acid sequence with heptad repeats for the formation of a coiled-coil bond with each other, a biotin-avidin binding pair, a SpyTag / SpyCatcher system, and an LPXTG / oligoglycine nucleophile pair for sortase-mediated transpeptidation binding. In another example, a template polynucleotide can be modified during sample preparation to include a Snap-tag sequence or an O-tag sequence. 6 -benzylguanine, and the single template site of the scaffold may contain the other of the two, and Snap-tag / O 6 In another example, the template polynucleotide is modified during sample preparation to include a CLIP-tag sequence or an O-benzylguanine system, allowing for covalent bonding between the two. 2 -benzylcytosine, and the single template site of the scaffold may contain the other of the two, 2 -benzylcytosine system allows for covalent bonding between the two. 2 -Benzylcytosine series.

[0081] Any of the above examples can similarly be used to attach one or more accessories to one or more accessory sites on a scaffold. For attachment to an accessory site on a DNA or polypeptide scaffold, the accessory (e.g., accessory oligo DNA) can have a complementary attachment moiety or structure added thereto. In some instances, a nucleotide sequence can be included in or attached to an accessory, and can include a complementary attachment moiety or structure attached thereto or included therein.

[0082] For example, in the case of a dendrimer DNA scaffold, a nucleotide sequence may be included in or attached to an accessory, the sequence of which may be complementary to an adaptor of the dendrimer DNA scaffold, such as the downstream overhang of an adaptor of the final generation dendrimer DNA scaffold, or the downstream overhang of an adaptor of an otherwise hybridized dendrimer of another generation.

[0083] In another example, an accessory (e.g., an accessory oligo DNA) can comprise or be attached to one of its ends, e.g., in the case of an accessory oligo DNA, a nucleotide sequence that is complementary to another sequence contained in or attached to the accessory site of the scaffold. Watson-Crick base pairing between the complementary sequences results in hybridization and binding between the two, thereby attaching the accessory to the accessory binding site. In another example, an accessory can comprise a covalent modification thereof to enable covalent binding to a complementary moiety or structure. For example, modifications to, e.g., the phosphate group, base, or sugar of a nucleotide contained in a template polynucleotide can be included to provide a site for covalent binding to the accessory site of the scaffold. The accessory site of the scaffold can then comprise a complementary moiety or structure that enables attachment to an accessory, such as an oligo DNA accessory. In one example, a nucleotide modified to include an attachment moiety that includes the complementary portion of the accessory binding site of the scaffold can be included in a polynucleotide sequence that is added to or contained in an accessory, such as an accessory oligo DNA, to enable binding therebetween. Many modified nucleotides bearing such chemical moieties are commercially available for covalent attachment of the composition to a DNA molecule incorporating such modified nucleotides.

[0084] In another example, an accessory can be modified by attaching it to a polypeptide. Such a polypeptide can have an amino acid sequence and / or structure that is complementary to the amino acid structure of the accessory site of the scaffold, such that the accessory can be attached to the accessory site of the scaffold via the attached polypeptide. Examples of polypeptide pairs for covalent or non-covalent bonding between the accessory site and the accessory are provided above, and non-limiting examples include alpha-helical amino acid sequences with heptad repeats for the formation of coiled-coil bonds with each other, biotin-avidin binding pairs, SpyTag / SpyCatcher systems, and LPXTG / oligoglycine nucleophilic pairs for sortase-mediated transpeptidation binding. In another example, an accessory, such as an accessory oligo-DNA, can be modified to include a Snap-tag sequence or O 6 -benzylguanine, and the accessory site of the scaffold may contain the other of the two; 6 In another example, the accessory molecule is a CLIP-tag sequence or an O-benzylguanine system, which allows for a covalent bond between the two. 2 -benzylcytosine, and the scaffold accessory site may contain the other of the two, 2 -benzylcytosine system allows for covalent bonding between the two.

[0085] Attachment of a template polynucleotide to a template site of a scaffold or attachment of an accessory, such as an accessory oligo-DNA, to an accessory site of a scaffold may be via a direct bond between them. In other examples, a spacer, polymer, or other chemical composition linking the nucleotides of a DNA scaffold or the amino acids of a polypeptide scaffold may be included in a single template site or accessory site, or both. In some examples, moieties or structures for attachment between a template polynucleotide or accessory may be incorporated into modified amino acids of a polypeptide scaffold or modified nucleotides of a DNA scaffold, and may be directly attached to complementary moieties or structures directly attached to the template polynucleotide or accessory. In other examples, spacers, polymers, or other chemical compositions may extend from the nucleotides of a DNA scaffold or the amino acids of a polypeptide scaffold, or both, and moieties or structures for attachment of a template polynucleotide or accessory may reside on a spacer, polymer, or other chemical moiety at a distance from the spacer, polymer, or other chemical moiety to the scaffold. In another example, a spacer, polymer, or other chemical composition may extend from the template polynucleotide or the accessory, or both, and a moiety or structure for binding the scaffold may be present on the spacer, polymer, or other chemical moiety at a distance from such spacer, polymer, or other chemical moiety to the template polynucleotide or accessory. In one example, such a spacer, polymer, or other chemical composition may extend from the scaffold to a single template site, from the template polynucleotide or scaffold to an accessory site, from the accessory or scaffold to a single template site, from the template polynucleotide and scaffold to an accessory site, and from the accessory. In another example, such a spacer, polymer, or other chemical composition may extend from any one or any combination of two or more of the scaffold to a single template site, the template polynucleotide, the scaffold to an accessory site, and the accessory.

[0086] A spacer, polymer, or chemical composition can extend from a spacer to a single template moiety, a template polynucleotide, a spacer to an accessory moiety, or any one or any combination of two or more of the accessories, and two such spacers, polymers, or chemical compositions can, but should not, be the same spacer, polymer, or chemical composition as each other. In some examples, a spacer, polymer, or other chemical composition can extend from a DNA scaffold or a polypeptide scaffold, and the spacer, polymer, or other chemical composition can include two or more accessory moieties.

[0087] In some examples, the polymer by which an accessory, such as an accessory oligo-DNA, is attached to a scaffold containing an accessory moiety may be a random, block, linear, and / or branched copolymer comprising two or more repeating monomer units in any order or configuration, and may be linear, cross-linked, or branched, or a combination thereof. In examples, the polymer may be a heteropolymer, wherein the heteropolymer is [ka] or substituted analogs thereof ("substituted" refers to the replacement of one or more hydrogen atoms in a specified group with another atom or group). In examples, the polymer is a heteropolymer and may further comprise an azide-containing acrylamide monomer. In some embodiments, the heteropolymer is [ka] and optionally [ka] wherein each R z are independently H or C 1~4 It is alkyl.

[0088] In one example, the polymer used may be poly(N-(5-azidoacetamidylpentyl)acrylamide-co-acrylamide), also known as PAZAM; [ka] Examples include the following, in which n is an integer ranging from 1 to 20,000, and m is an integer ranging from 1 to 100,000.

[0089] In some instances, the acrylamide monomer is azidoacetamidopentylacrylamide monomer [ka] In some examples, the acrylamide monomer may include N-isopropylacrylamide. [ka] may include: In some embodiments, the heteropolymer has the following structure: [ka] (wherein x is an integer ranging from 1 to 20,000 and y is an integer ranging from 1 to 100,000), or [ka] wherein y is an integer ranging from 1 to 20,000, where each x and z is an integer such that the sum of x and z is in the range of 1 to 100,000, and each R z are independently H or C 1~4alkyl, and the ratio of x:y can be about 10:90 to about 1:99, or can be about 5:95, or the ratio of (x:y):z can be about 85:15 to about 95:5, or can be about 90:10 (where x:(y:z) can be about 1:(99) to about 10:(90), or can be about 5:(95)). In these examples, "about" means that the relative amounts of something can vary by up to 5% from the amounts stated in the recited ratio.

[0090] A "heteropolymer" is a large molecule of at least two different repeating subunits (monomers). An "acrylamide monomer" has the structure [ka] or a substituted analog thereof (e.g., methacrylamide or N-isopropylacrylamide). An example of a monomer containing an acrylamide group and an azide group is azidoacetamidopentylacrylamide, shown above. "Alkyl" refers to a straight or branched hydrocarbon chain that is fully saturated (i.e., contains no double or triple bonds). Exemplary alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, and tertiary butyl. For example, the notation "C 1~4 "Alkyl" indicates that there are 1 to 4 carbon atoms in the alkyl chain, i.e., the alkyl chain is selected from the group consisting of methyl, ethyl, propyl, isopropyl, n-butyl, isobutyl, sec-butyl, and t-butyl.

[0091] Any one or more of the aforementioned polymers can be attached to a DNA or polypeptide scaffold as one or more accessories, or to attach one or more accessories, such as accessory oligo-DNA molecules, to the scaffold. For example, the scaffold can contain one or more alkyne groups or one or more other groups that can react with and bond to an azide group, such as a norbornene group, and the azide of the polymer can be covalently bonded to the alkyne, norbornene, or other group of the scaffold via a cycloaddition click chemistry reaction. In a further example, other compositions or structures, including other compositions or additional accessories, such as exemplary oligo-DNA molecules, can also contain or be modified to contain one or more other groups that can react with and bond to an azide group, such as a norbornene group, and the azide of the polymer can be covalently bonded to the alkyne, norbornene, or other group of the scaffold of such other compounds or additional accessories via a cycloaddition click chemistry reaction. Thus, one or more polymers can be attached to a scaffold, and one or more such attached polymers can be further attached to additional accessories, such as one or more further compositions, such as oligo-DNA molecules, etc. In another example, reactive chemistries can be used to attach polymers to the scaffold and polymeric accessories, such as oligo-DNA molecules.

[0092] In some examples, a single template polynucleotide can be attached to a single template site on a scaffold, and multiple accessory nucleotides, such as accessory oligo-DNA molecules, can be attached to the accessory sites on the scaffold (either directly or via the above-described or other polymers, or spacers, or other compositions). An example of such an oligo-DNA molecule can be a primer for clustering on the scaffold. As part of a conventional clustering process, copies of the template polynucleotide or its complement are generated on the surface of a substrate. As explained above, in some examples, such on-surface clustering can result in the formation of one or more unfavorable polyclonal clusters. As disclosed herein, clustering can be performed on the scaffold, such as in solution, without pre-attaching the scaffold to a surface. In other examples, a scaffold with a single template polynucleotide attached can be attached to the surface of a substrate, and then clustering can be performed on the surface of the substrate, on the scaffold, or on the scaffold and the surface of the substrate.

[0093] In the clustering procedure, a template polynucleotide can be modified, such as during sample preparation, to include one or more nucleotide sequences at one or both of its 3-prime and 5-prime ends. Copies of the template nucleotide and nucleotide sequences complementary to the template nucleotide can then be synthesized on a scaffold as disclosed herein to form clusters. Such clustering on a scaffold can result in the formation of monoclonal clusters.

[0094] For example, a template polynucleotide can bind to a single template attachment site with its 5-prime end facing toward the scaffold and its 3-prime end facing away from the attachment site to the scaffold. The 3-prime end can contain a nucleotide sequence complementary to a nucleotide sequence contained in a first primer. A "primer" is defined as a single-stranded nucleic acid sequence (e.g., single-stranded DNA or single-stranded RNA) that serves as a starting point for DNA or RNA synthesis. Primers can be any number of bases in length and can contain a variety of non-natural nucleotides. In examples, primers are short strands ranging from 20 to 40 bases or 10 to 20 bases. The copy of the primer complementary to the 3-prime end of the template polynucleotide can be further attached to an accessory site on the scaffold directly or by attachment to a polymer (e.g., as a non-limiting example, PAZAM or related polymers disclosed herein), a spacer, or other chemical composition, as disclosed herein.

[0095] A polymerization reaction can then be carried out, in which the 3-prime end of the template polynucleotide hybridizes via Watson-Crick base pairing with a first primer attached to a complementary scaffold. A polymerase in the polymerization reaction can generate a nascent strand complementary to the template polynucleotide attached to the scaffold, starting from the primer attached to the scaffold to which the 3-prime end of the template polynucleotide hybridizes. The template polynucleotide and its complement can then be dehybridized.

[0096] The complement to the template polynucleotide at the 3-prime end of the complement can contain a nucleotide sequence complementary to the second primer sequence. A copy of the second primer complementary to the 3-prime end of the complement to the template polynucleotide can be further attached to the accessory site of the scaffold. A second polymerization reaction can then be carried out, in which the 3-prime end of the template polynucleotide hybridizes with a first primer attached to its complementary scaffold via Watson-Crick base pairing, and the 3-prime end of the complement to the template polynucleotide hybridizes with a second primer attached to its complementary scaffold via Watson-Crick base pairing. The polymerase in the second polymerization reaction can start from the first primer attached to the scaffold to which the 3-prime end of the template polynucleotide hybridizes, and generate another nascent strand complementary to the template polynucleotide attached to the scaffold. The polymerase in the second polymerization reaction can then generate additional nascent strand copies of the template polynucleotide attached to the scaffold, starting from a second primer attached to the scaffold to which the 3-prime end of the complement to the template polymerized in the previous polymerization reaction hybridizes. The template polynucleotide and its copy and its complement can then be dehybridized.

[0097] Subsequent polymerization reactions can then be carried out in an iterative process. The 3-prime ends of the scaffold-bound template polynucleotide and its copies hybridize to a first primer attached to the complementary scaffold, and the 3-prime end of the scaffold-bound complement of the template polynucleotide hybridizes to a second primer attached to the complementary scaffold. Nascent strands are polymerized by a polymerase, initiated by the first and second primers attached to the scaffold, to which the scaffold-bound template polynucleotide and its complement and its copies hybridize. Following dehybridization of the polymerized strands, successive polymerization reactions are carried out, thereby increasing the copy number of the template polynucleotide and its complement attached to the scaffold. In this way, the copies and complements of the template polynucleotide are amplified, and the amplified copies bind to the scaffold, forming clusters. As disclosed herein, this clustering process can be carried out on the scaffold, such as in solution, as opposed to traditional clustering, which is carried out on the surface of a substrate in a conventional SBS process. Monoclonal clusters are present on the scaffold because there are copies and complements of only a single template polynucleotide clustered on the scaffold.

[0098] In such an example, when a sequence at or attached to the 5-prime end of a template polynucleotide is bound to a single template site, the 3-prime end of the template polynucleotide is oriented away from the scaffold, and the template polynucleotide can bind to a single template site on the scaffold by hybridization to a primer sequence attached to or attached to a portion of the single template site, referred to as the template site primer. In some examples, when prepared by a sample preparation process, the template polynucleotide can have a nucleotide sequence at its 5-prime end that is complementary to the template site primer, or attached to it. When such a nucleotide sequence complementary to the template site primer is made 3-prime, the template polynucleotide can contain a nucleotide sequence corresponding to the nucleotide sequence of the second primer described above (the second primer is a primer attached to the scaffold to which the 3-prime end of its complement to the template polynucleotide can hybridize by complementary Watson-Crick base pairing). The inclusion of such a sequence in the template polynucleotide means that the complement to the template polynucleotide synthesized during the polymerization step has a polynucleotide sequence toward its 3-prime end that is complementary to the sequence of such a second primer. Having such a sequence toward the 3-prime end of the complement to the template polynucleotide allows hybridization of the 3-prime end of the complement to such a second primer during the subsequent polymerization reaction during clustering.

[0099] At the 3-prime end of the template polynucleotide, directed away from the 5-prime end of the template polynucleotide bound to a single template site, the template polynucleotide may contain a sequence complementary to the first primer, as described above. As described above, during the first polymerization step, such a nucleotide sequence at the 3-prime end of the template polynucleotide may hybridize to the first primer, followed by polymerization of the nascent complement to the template polynucleotide. It may be advantageous for the polymerization of the complement to the template polynucleotide to be terminated between the portion of the template polynucleotide hybridized to the template site primer and the nucleotide sequence located at 3-prime in the template polynucleotide containing the sequence of the second primer. That is, it may be advantageous for the complement of the template polynucleotide to have a sequence complementary to the second primer at its 3-prime end. However, if polymerization is not terminated after adding a nucleotide sequence complementary to the sequence corresponding to the second primer to the nascent complement to the template polynucleotide, the 3-prime end of the complement to the template polynucleotide will not terminate there.

[0100] For example, if the nucleotide sequence complementary to the template site primer is 5-prime and contiguous with the sequence complementary to the second primer, the 3-prime end of the complement to the template polynucleotide may contain a nucleotide sequence contained in the template site primer. For example, when polymerizing the complement to the template polynucleotide, the DNA polymerase may move the template site primer from the hybridization site to the 5-prime end of the template polynucleotide and add and polymerize the corresponding nucleotide sequence to the 3-prime end of the complement to the template polynucleotide. Such a result may be undesirable if hybridization to the second primer at the accessory site impairs the ability of the 3-prime end of the complement to the template polynucleotide.

[0101] Thus, in some instances, when such a 5-prime end of a template polynucleotide is bound to a single template site by hybridizing to a template site primer, it may be desirable to incorporate a termination of polymerization from the 3-prime to the 5-prime end of the template polynucleotide. For example, a linker such as a PEG linker, alkyl linker, or other chemical moiety can be included to connect the nucleotide sequence that hybridizes to the template site primer to the 5-prime end of the template polynucleotide. The presence of such a linker, rather than connecting a contiguous nucleotide sequence, will prevent the polymerase from adding a nucleotide sequence corresponding to the template site primer to the 3-prime end of the complement of the template polynucleotide, and instead, as may be desirable, will terminate with a nucleotide sequence complementary to the nucleotide sequence of the second primer.

[0102] In another example, the template polynucleotide may have a polynucleotide sequence at or attached to the 3-prime end of the template polynucleotide that is complementary to a primer attached to or is part of a single template site of the scaffold, referred to as the template site primer. Following hybridization of the 3-prime end of the template polynucleotide to the template site primer, or such a sequence attached thereto, a polymerization process can be carried out, in which a DNA polymerase initiates from the template site primer and polymerizes to form a nascent polynucleotide complementary to the template polynucleotide. The template polynucleotide is then dehybridized from its complement attached to the scaffold to the template polynucleotide. The 3-prime end of the complement attached to the scaffold to the template polynucleotide is oriented away from the attachment site to the scaffold and may contain a nucleotide sequence complementary to the second primer sequence described above (the second primer is a primer attached to the scaffold to which the 3-prime end of the complement to the template polynucleotide can hybridize by complementary Watson-Crick base pairing). A copy of a second primer complementary to the 3-prime end of the complement to the template polynucleotide can be further attached to the accessory site of the scaffold. Then, a second polymerization reaction can be carried out, in which the 3-prime end of the complement to the template polynucleotide hybridizes with the second primer attached to its complementary scaffold through Watson-Crick base pairing. The polymerase in the second polymerization reaction can start from the second primer attached to the scaffold with which the 3-prime end of the complement to the template polymerized in the previous polymerization reaction hybridizes, to generate a nascent strand copy of the template polynucleotide (i.e., the complement of the complement attached to the template polynucleotide). Then, a dehybridization step can be carried out to dehybridize the complement attached to the scaffold to the template polynucleotide and the copy of the template polynucleotide from each other.

[0103] The template polynucleotide copy at the 3-prime end of the copy can contain a nucleotide sequence complementary to the first primer sequence. The first primer copy complementary to the 3-prime end of the template polynucleotide copy can be further attached to the accessory site of the scaffold. A third polymerization reaction can then be performed, in which the 3-prime end of the template polynucleotide copy hybridizes with the first primer attached to the complementary scaffold via Watson-Crick base pairing, and the 3-prime end of the complement to the template polynucleotide hybridizes with the second primer attached to the complementary scaffold via Watson-Crick base pairing. The polymerase in the third polymerization reaction can start from the first primer attached to the scaffold to which the 3-prime end of the template polynucleotide copy hybridizes, and generate another nascent strand complementary to the template polynucleotide attached to the scaffold. The polymerase in the third polymerization reaction can then generate additional nascent strand copies of the template polynucleotide, starting from a second primer attached to a scaffold to which the 3-prime end of the complement to the template polymerized in the previous polymerization reaction hybridizes. A dehybridization step can then be performed to dehybridize the copy of the template polynucleotide and the corresponding complement.

[0104] Subsequent polymerization reactions can then be carried out in an iterative process. The 3-prime end of the scaffold-bound copy of the template polynucleotide hybridizes to a first primer bound to its complementary scaffold, and the 3-prime end of the scaffold-bound complement of the template polynucleotide hybridizes to a second primer bound to its complementary scaffold. Nascent strands are polymerized by a polymerase, initiated by the first and second primers bound to the scaffold, and the scaffold-bound template polynucleotide, its complement, and its copy hybridize. Dehybridization of the strands occurs after polymerization, followed by successive polymerization reactions and further dehybridization. In this way, the copy and complement of the template polynucleotide are amplified, and the amplified copy and complement bind to the scaffold, forming clusters. As disclosed herein, this clustering process can be carried out on the scaffold, such as in solution, as opposed to traditional clustering, which is carried out on the surface of a substrate in traditional SBS processes. Monoclonal clusters are present on the scaffold because there are copies and complements of only a single template polynucleotide clustered on the scaffold.

[0105] In some instances, an end of the template polynucleotide contains or is attached to a nucleotide sequence that is complementary to a nucleotide sequence contained in or attached to a single template site of the scaffold, referred to as a third template site primer. In some instances, a complement to the template polynucleotide can be synthesized on the scaffold starting with the third template site primer.

[0106] In an example of scaffold-based clustering as disclosed herein, the scaffold can be a DNA scaffold or a polypeptide scaffold as disclosed herein. A template polynucleotide can be bound to a single template site of the scaffold by any of the various covalent or non-covalent bonds disclosed herein. For example, either end of the template polynucleotide can contain a portion or structure of a binding site pair, as identified in Table 1, and the complementary portion or structure of the same pair can be present in a single template site of the scaffold. A sequential polymerization process can then be continued as described above. For example, at or toward the 5-prime end of the template polynucleotide, the 3-prime end of the template polynucleotide bound to a single template site of the scaffold can hybridize to an oligonucleotide primer bound to an accessory site of the scaffold and its complement synthesized by a DNA polymerase. A sequential polymerization process can then be continued as described above, resulting in the polymerization of multiple copies of the template polynucleotide and its complement arising from the accessory site of the scaffold. Because only a single template polynucleotide was bound to the scaffold, the scaffold will have only a single template polynucleotide site, and such copies will constitute a monoclonal cluster on the scaffold.

[0107] In another example, the scaffold can be attached to the surface of a substrate, such as the surface of a substrate for use in an SBS procedure. For example, the accessory site of the scaffold can comprise a site attached to the surface of the substrate, or a composition that binds to the surface of the substrate, or can itself be attached thereto. In one example, the surface of the substrate can be bound to a primer, such as, for example, a copy of a primer complementary to the first primer or second primer described above, or both, as a non-limiting example. Such complementary primers can be attached directly to the surface of the substrate, or to a modified surface, such as the surface of a polymer molecule (e.g., PAZAM or related polymer) attached by a primer attached to such a polymer. The aforementioned first and second primers can be attached to the accessory site of the scaffold (either directly, or via a PAZAM or other PAZAM-like polymer, as disclosed above, or a spacer or other composition, as a non-limiting example). Such first and second primers of or attached to the scaffold can hybridize to their complementary primers when attached to the surface of the substrate, thereby binding the scaffold to the surface of the substrate.

[0108] Examples of the first and second primers described above may include primers used in existing SBS processes. Specific examples of suitable primers include the P5 and / or P7 primers used on the surface of commercially available flow cells sold by Illumina Inc. for sequencing on HISEQ™, HISEQX™, MISEQ™, MISEQDX™, MINISEQ™, NEXTSEQ™, NEXTSEQDX™, NOVASEQ™, GENOME ANALYZER™, ISEQ™, and other instrument platforms. Furthermore, the portion of the template polynucleotide containing a nucleotide sequence corresponding to or complementary to the first or second primer described above may have a sequence corresponding to or complementary to the P5 primer (containing the nucleotide sequence AATGATACGGCGACCACCGAGATCTACAC (SEQ ID NO: 7)), the P7 primer (containing the nucleotide sequence CAAGCAGAAGACGGCATACGAGAT (SEQ ID NO: 8)), or both, according to the primer sequences used in the SBS platform described above, for example.

[0109] Substrates for SBS processes can include, by way of non-limiting example, substrates used in any of the aforementioned SBS platforms. As a non-limiting example, such a substrate can be a flow cell. As used herein, the term "flow cell" is intended to mean a container having a chamber (i.e., a flow channel) in which a reaction can occur, an inlet for delivering reagents to the chamber, and an outlet for removing reagents from the chamber. In some examples, the chamber allows for detection of a reaction or signal occurring within the chamber. For example, the chamber can include one or more transparent surfaces that allow for optical detection of arrays, optically labeled molecules, and the like within the chamber. As used herein, a "flow channel" or "flow channel region" can be a region defined between two coupled components that can selectively receive a liquid sample. In some examples, the flow channel can be defined between a patterned support and a lid and, therefore, can be in fluid communication with one or more recesses defined in the patterned support. In other examples, the flow channel can be defined between an unpatterned support and a lid.

[0110] As used herein, the term "recess" refers to a discrete, concave feature in a patterned support having a surface opening that is completely surrounded by a gap region of the patterned support surface. The recess can have a variety of shapes at the surface opening, such as, for example, a circle, an ellipse, a square, a polygon, a star (with any number of vertices), etc. The cross section of the recess taken perpendicular to the surface can be a curved shape, a square, a polygon, a hyperbola, a cone, an angled shape, etc. As an example, the recess can be a well. Also, as used herein, a "functionalized recess" refers to a discrete, concave feature to which a primer is attached, and in some instances, is attached to the surface of the recess by a polymer (such as PAZAM or a similar polymer).

[0111] The term "support" or "substrate" of a flow cell refers to a support or substrate to which surface chemistries may be added. The term "patterned substrate" refers to a support having recesses defined therein. The term "unpatterned substrate" refers to a substantially planar support. The substrate may also be referred to herein as a "support," a "patterned support," or an "unpatterned support." The support may be a wafer, a panel, a rectangular sheet, a die, or any other suitable configuration. The support is generally rigid and insoluble in aqueous liquids. The support may be inert to chemicals used to modify the recesses. For example, the support may be inert to chemicals used to form a polymer coating layer, to attach a primer to an attached polymer coating layer, etc. Examples of suitable supports include epoxy siloxanes, glass, modified or functionalized glass, polyhedral oligomeric silsesquioxanes (POSS) and their derivatives, plastics (such as polystyrene and copolymers of acrylics, styrenes and other materials, polypropylene, polyethylene, polybutylene, polyurethane, polytetrafluoroethylene (such as TEFLON® from Chemours), cyclic olefin / cycloolefin polymers (COP) (such as ZEONOR® from Zeon), polyimides, nylon, ceramic / ceramic oxides, silica, fused silica, or silica-based materials, aluminum silicate, silicon and modified silicon (e.g., boron-doped P+ silicon), silicon nitride (Si3N4), silicon oxide (SiO2), tantalum pentoxide (TaO5), or other tantalum oxides (TaO x ), hafnium oxide (HaO2), carbon, metal, inorganic glass, etc. The support may also be glass, or silicon, or a silicon-based polymer, such as a POSS material, optionally having a coating layer of tantalum oxide or another ceramic oxide on the surface. The POSS material may be one disclosed in Kejagoas et al., Microelectronic Engineering 86 (2009) 776-668, which is incorporated herein by reference in its entirety.

[0112] In some examples, the recesses can be wells, where the patterned substrate includes an array of wells on its surface. The wells can be microwells or nanowells. The size of each well can be characterized by its volume, well opening area, depth, and / or diameter.

[0113] Each well 2 can have any volume capable of containing a liquid. The minimum or maximum volume can be selected to accommodate, for example, the expected throughput (e.g., multiplexing), resolution, analyte composition, or analyte reactivity for downstream use of the flow cell. For example, the volume can be at least about 1×10 -3 μm 3 , about 1×10 -2 μm 3 , about 0.1μm 3 , about 1μm 3 , about 10μm 3 , about 100μm 3 Alternatively or additionally, the volume may be at most about 1×10 4 μm 3 , about 1×10 3 μm 3 , about 100μm 3 , about 10μm 3 , about 1μm 3 , about 0.1μm 3 , or even less.

[0114] The area occupied by each well opening can be selected based on criteria similar to the well volume described above. For example, the area of ​​each well opening on the surface should be at least about 1×10 -3 μm 2 , about 1×10 -2 μm 2 , about 0.1μm 2 , about 1μm 2 , about 10μm 2 , about 100μm 2 Alternatively or additionally, the area may be at most about 1×10 3 μm 2 , about 100μm 2 , about 10μm 2 , about 1μm2 , about 0.1μm 2 , about 1×10 -2 μm 2 The area occupied by the opening of each recess may be greater than, less than, or anything in between.

[0115] The depth of each well can be at least about 0.1 μm, about 1 μm, about 10 μm, about 100 μm, or more. Alternatively, or in addition, the depth can be at most about 1×10 3 The depth of each well 14' may be greater than, less than, or between the values ​​indicated above.

[0116] In some cases, the diameter of each well can be at least about 50 nm, about 0.1 μm, about 0.5 μm, about 1 μm, about 10 μm, about 100 μm, or more. Alternatively, or in addition, the diameter can be at most about 1×10 3The diameter can be about 150 nm, about 200 nm, about 250 nm, about 300 nm, about 350 nm, about 400 nm, about 450 nm, about 500 nm, about 550 nm, about 600 nm, about 650 nm, about 700 nm, about 750 nm, about 800 nm, about 900 nm, about 950 nm, about 1 μm, about 1.25 μm, about 1.5 μm, about 1.74 μm, about 2 μm, about 2.25 μm, about 2.5 μm, about 2.75 μm, about 3 μm, about 3.25 μm, about 3 μm, about 3.25 μm, about 3 μm, about 3.5 ... The diameter of each well may be greater than, less than, or between the values ​​indicated above. As used herein, the term nanowell is intended to mean a well having a round opening with a maximum diameter of about 1 μm or less.

[0117] Ranges provided herein should be understood to include the stated range and any value or subrange within the stated range. For example, a range of about 100 nm to about 1 μm (1000 nm) should be interpreted to include not only the explicitly stated limits of about 100 nm to about 1 μm, but also individual values, such as about 708 nm, about 945.5 nm, etc., and subranges, such as about 425 nm to about 825 nm, about 550 nm to about 940 nm, etc. Furthermore, when "about" and / or "substantially" are used to describe values, they are meant to encompass slight variations (up to ±10%) from the stated value.

[0118] In some instances, the size of nanoparticles can be such that their presence in a well, such as a nanowell, occupies the volume of the well such that other nanoparticles cannot simultaneously occupy it. The size of nanoparticles can be designed or determined by reference to wells of known size on the surface of a substrate, such that they can enter the well when no other nanoparticles are present, but can be prevented from entering the well if another nanoparticle is already present and still present in the well. Nanoparticles sized so that more than two nanoparticles cannot fit into the well can promote monoclonality of clusters within the well. For example, in a conventional SBS process, template polynucleotides can be introduced into a flow cell patterned with wells in solution at a concentration calibrated to maximize the number of wells seeded with the template polynucleotide (i.e., bound to primers attached to the wells, either directly or via a surface-attached polymer complementary to the nucleotide sequence of a portion of the template polynucleotide), but low enough to minimize the formation of polyclonal clusters.

[0119] In some examples, a flow cell may contain nanoscale regions that are not recesses or nanowells but are otherwise spatially isolated, into which template polynucleotides or scaffolds can be attached or seeded, referred to herein as nanopads. In some examples, the flow cell surface includes nanopads separated from one another by areas of the surface to which template polynucleotides or scaffolds cannot be attached. The nanopads may be spaced apart to promote the formation of monoclonal clusters. For example, nanopads may be separated from one another so that a cluster formed in one nanopad seeded with a single template polynucleotide is sufficiently separated from another such nanopad seeded with only one template polynucleotide. However, because it is difficult to prevent a nanopad from being seeded with more than one template polynucleotide, the formation of more than one polyclonal cluster may occur. In examples disclosed herein, nanoparticles may promote the formation of monoclonal clusters in favor of polyclonal clusters by preventing the seeding or attachment of more than one template polynucleotide into a particular nanopad. For example, the size of the nanoparticles may be such that there is not enough space on the nanopad for more than one nanoparticle to bind, and the template polynucleotide binds to a single template polynucleotide site on the scaffold.

[0120] In some cases, polyclonal clusters may occur when two or more template polynucleotides with different nucleotide sequences are bound or seeded in the same well. Molecules may be distributed in the wells based on their concentration in the applied solution according to a Poisson distribution, which balances minimizing the number of wells occupied by multiple different template polynucleotides while minimizing the number of unoccupied wells (to increase the efficiency of SBS runs). The difference between the minimum well size and the size of the template polynucleotide (e.g., the diameter of a B-DNA molecule can be about 2 nm) can result in the selection of concentrations that do not utilize as much substrate surface, such as the surface within the well, as is available or desirable, resulting in the formation of an undesired or unnecessarily large number of polyclonal clusters.

[0121] As disclosed herein, template polynucleotides can be bound to nanoparticles with only one template polynucleotide bound per nanoparticle. Nanoparticles can be sized so that they can enter wells of a flow cell where no other nanoparticles are present, but not where other nanoparticles are already present. Clustering, such as monoclonal clustering, can occur on the nanoparticles before they enter the well and monoclonal clusters are present in the well. Alternatively, template polynucleotides can be bound to template sites on the nanoparticles, and the nanoparticles can enter and bind within the well (e.g., by attachment to the surface of an accessory site or modification to the surface of the well), thereby seeding the well with only a single nanoparticle, and then clustering can proceed within the well, resulting in monoclonal clusters present in the well. In some instances, some degree of clustering can occur on the nanoparticles before they enter the well, and further clustering can occur after the nanoparticles enter the well. All such instances include instances in which monoclonal clusters are formed within the well. Furthermore, by adjusting the size of the nanoparticles to reduce, minimize, or in some instances eliminate the simultaneous presence of more than one nanoparticle in a well at a time, the formation of polyclonal clusters can be reduced, minimized, or in some instances eliminated.

[0122] The size of nanoparticles can be adjusted by varying the size of the scaffold, varying the size of the accessory moieties, e.g., polymers attached thereto, or both. The size of nanoparticles can also be varied by the amount of clustering that has or has not occurred on the nanoparticles, for example, by varying the number of sites on the nanoparticles to which copies and complements of the template polynucleotide can bind during the polymerization process during clustering; fewer such sites may result in a lower upper size limit for the nanoparticles, while more such sites may result in a higher upper size limit for the nanoparticles. The number of polymerization processes during clustering also varies the size of the nanoparticles; a higher number of times may result in more copies and complements of the template polynucleotide bound to the nanoparticles, resulting in a higher upper size limit; a lower number of times may result in fewer copies and complements of the template polynucleotide bound to the nanoparticles, resulting in a lower upper size limit. The size of nanoparticles can be determined according to their size before clustering on the scaffold occurs or after clustering on the scaffold occurs.

[0123] As used herein, the term "nanoparticle" is intended to mean a particle having a maximum dimension up to about 1,000 nm in size. Depending on the geometric shape, the dimension may refer to length, width, height, diameter, etc. Although "diameter" is commonly used to describe dimensions as an example herein, the nanoparticles described herein need not be spherical or circular. The nanoparticles disclosed herein may have a diameter of about 2 nm, about 5 nm, about 7 nm, about 10 nm, about 12 nm, about 15 nm, about 17 nm, about 20 nm, about 22 nm, about 25 nm, about 27 nm, about 30 nm, about 32 nm, about 35 nm, about 40 nm, about 42 nm, about 45 nm, about 47 nm, about 50 nm, about 52 nm, about 55 nm, about 57 nm, about 60 nm, about 62 nm, about 65 nm, about 67 nm, about 70 nm, about 72 nm, about 75 nm, about 77 nm, about 80 nm, about 82 nm, about 85 nm, about 87 nm, about 90 nm, about 92 nm, about 95 nm, about 97 nm, about 100 nm, about 125 nm, about The diameter may be 150 nm, about 175 nm, about 200 nm, about 225 nm, about 250 nm, about 275 nm, about 300 nm, about 325 nm, about 350 nm, about 375 nm, about 400 nm, about 425 nm, about 450 nm, about 475 nm, about 500 nm, about 525 nm, about 550 nm, about 575 nm, about 600 nm, about 625 nm, about 650 nm, about 675 nm, about 700 nm, about 725 nm, about 750 nm, about 775 nm, about 800 nm, about 825 nm, about 850 nm, about 875 nm, about 900 nm, about 925 nm, about 950 nm, about 975 nm, or about 1,000 nm. The diameter of the nanoparticles is measured by dynamic light scattering (DLS), also known as quasi-elastic light scattering, expressed as twice the hydrodynamic radius (Rh), which can be determined with a DLS system or other systems equipped with DLS and other capabilities (e.g., ZETASIZER®, Malvern Instruments Limited).

[0124] The nanoparticles disclosed herein may have a diameter of about 2 nm to about 10 nm, about 5 nm to about 15 nm, about 7 nm to about 20 nm, about 10 nm to about 25 nm, about 15 nm to about 30 nm, about 20 nm to about 50 nm, about 40 nm to about 60 nm, about 50 nm to about 75 nm, about 60 nm to about 100 nm, about 70 nm to about 100 nm, about 75 nm to about 100 nm, about 80 nm to about 110 nm, about 90 nm to about 130 nm, about 100 nm to about 150 nm, about 100 nm to about 200 nm, about 150 nm to about 225 nm, about 200 nm to about 250 nm, about 200 nm to about 300 nm, about 300 nm to about 400 nm, about 400 nm to about 500 nm, about 500 nm to about 600 nm, about 60 ... Approx. 300nm, approx. 225nm ~ approx. 275nm, approx. 250nm ~ approx. 300nm, approx. 275nm ~ approx. 325nm, approx. 300nm ~ approx. 40 0nm, about 300nm to about 350nm, about 325nm to about 375nm, about 350nm to about 400nm, about 375nm to about 425nm , about 400nm to about 500nm, about 400nm to about 450nm, about 425nm to about 475nm, about 450nm to about 500nm, about 4 75nm ~ approx. 525nm, approx. 500nm ~ approx. 600nm, approx. 500nm ~ approx. 550nm, approx. 525nm ~ approx. 575nm, approx. 550nm ~600nm, approximately 575nm ~ approximately 625nm, approximately 600nm ~ approximately 700nm, approximately 600nm ~ approximately 625nm, approximately 625nm ~ approximately 6 75nm, about 650nm to about 700nm, about 675nm to about 725nm, about 700nm to about 800nm, about 700nm to about 725n m, about 725nm to about 775nm, about 750nm to about 800nm, about 775nm to about 825nm, about 800nm ​​to about 900nm, about 800nm ​​to about 850nm, about 825nm to about 875nm, about 850nm to about 900nm, about 875nm to about 925nm, about 900n The diameter may be within the range of about 1,000 nm, about 900 nm to about 950 nm, about 925 nm to about 975 nm, about 950 nm to about 1,000 nm, about 300 nm to about 450 nm, about 350 nm to about 500 nm, about 400 nm to about 550 nm, about 450 nm to about 600 nm, about 500 nm to about 650 nm, about 550 nm to about 700 nm, about 600 nm to about 750 nm, about 650 nm to about 800 nm, about 700 nm to about 850 nm, about 750 nm to about 900 nm, about 800 nm to about 950 nm, or about 850 nm to about 1,000 nm. Non-limiting Examples

[0125] The following examples are intended to illustrate certain embodiments of the present disclosure, but are not intended to limit its scope in any way.

[0126] FIG. 1 shows a diagram of a non-limiting example of a nanoparticle disclosed herein. In this non-limiting example, a single template polynucleotide moiety is shown as a wedge-shaped portion of the scaffold portion of the nanoparticle, as disclosed. A single template polynucleotide is shown bound to the single template moiety. Also shown in this non-limiting example are multiple accessories extending from the accessory moiety of the scaffold. In the center diagram, the accessories are shown as polymers. In the left diagram, multiple copies of a polynucleotide complementary to the template polynucleotide and copies of the template polynucleotide are shown attached to and extending from the scaffold. In this example, they extend from the polymer, which in turn extends from the scaffold.

[0127] The right image shows nanoparticles with a template polynucleotide bound at a single template site within a well of a substrate. Multiple accessory oligonucleotides are shown extending from the scaffold. Although not shown in the right image, in this example, the accessory oligonucleotides extend from a polymer attached to the scaffold. In other examples, the accessory oligonucleotides may extend directly from the scaffold without an intervening polymer between them. The nucleotide sequence of the accessory oligonucleotide is complementary to the primer attached to the surface of the well. The accessory oligonucleotide thereby hybridizes to the primer attached to the well and attaches to the surface of the well. Here, due to the size of the nanoparticle relative to the size of the well, only one nanoparticle can be present in the well at a time. Therefore, clustering initiated from a single template polynucleotide within the well will result in the formation of a monoclonal cluster within the well.

[0128] Figure 2A shows a non-limiting working example of a DNA scaffold. In this non-limiting example, the DNA scaffold includes multiple scaffold DNA molecules, which form a DNA dendrimer. The DNA dendrimer includes many generations of branched constituent repeat units, also referred to as adapters. The first generation is shown upstream of the second generation. The first generation adapter is shown at the bottom, and the second generation adapter is shown at the top. Each adapter includes the constituent repeat unit, oligodeoxyribonucleotides, hybridized to each other to form an adapter with one upstream overhang and two downstream overhangs. For each generation adapter, three oligo-DNA molecules hybridize to each other as shown (here, cooled from 90°C to 20°C in 50 nM NaCl) to form an adapter with one upstream overhang and two downstream overhangs.

[0129] In this example, the upstream overhang of the first-generation adapter is identified as a capture site, representing a single template site for attaching a single template polynucleotide to the scaffold. The downstream overhang of first-generation adapter 1 has a nucleotide sequence complementary to and hybridizable with the upstream overhang of the second-generation adapter 1'. The first- and second-generation adapters are then hybridized to each other, attaching the upstream overhang of second-generation adapter 1' to the downstream overhang of first-generation adapter 1 by Watson-Crick base pairing hybridization. The sequences are then ligated together in the presence of T4 DNA ligase, 1 mM ATP, and 10 mM MgCl2, in this example for 10 minutes at room temperature. Subsequent generations can be added and ligated to this structure as shown, with the downstream overhang of the adapter of additional generation N' being complementary to the downstream overhang of the adapter of the immediately preceding generation N+1. In some instances, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, or more generations can be formed as part of a dendrimer DNA scaffold. The size, e.g., diameter, of a DNA dendrimer scaffold can be controlled in part by controlling the number of generations included in the scaffold, with more generations corresponding to larger nanoparticles relative to scaffolds containing fewer generations.

[0130] In a non-limiting example, a first generation adapter (G 1 ) was synthesized from the following oligonucleotide sequence (5 prime to 3 prime):

[0131] TIFF0007812663000014.tif36161G 1 a and G 1 The underlined part in b represents the downstream overhang, and G 1 The underlined portion of c represents the upstream overhang. 1The upstream overhang of c can contain a single template nucleotide site. For example, the template polynucleotide can extend from its 5-prime end with the following sequence (5-prime to 3-prime): AATGATACGGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO: 12). The 5-prime end of this sequence can be terminated with a G 1 c hybridized to the 3-prime upstream overhang, forming the structure shown in the non-limiting working example shown in Figure 2B.

[0132] 2nd generation adapter (G 2 A non-limiting example of ) was synthesized from the following oligonucleotide sequence (5 prime to 3 prime):

[0133] TIFF0007812663000015.tif21140G 2 b and G 2 The underlined part in c represents the downstream overhang, and G 2 The underlined part of a represents the upstream overhang. 2 Each ACTG upstream overhang in the a sequence is G 1 a and G 1 b hybridized to the downstream CATG overhang, forming the structure shown in the non-limiting working example shown in Figure 2C.

[0134] 3rd generation adapter (G 3 A non-limiting example of ) was synthesized from the following oligonucleotide sequence (5 prime to 3 prime):

[0135] TIFF0007812663000016.tif21141G 3 b and G 3 The underlined part in c represents the downstream overhang, and G 3 The underlined portion of a represents the upstream overhang. These oligonucleotide sequences were hybridized together to form the structure shown in the non-limiting working example shown in Figure 2D. 3Each upstream ATCG overhang in the a sequence is G 2 b and G 2 Hybridized with the downstream CGAT overhang of c.

[0136] 4th generation adapter (G 4 A non-limiting example of ) was synthesized from the following oligonucleotide sequence (5 prime to 3 prime):

[0137] TIFF0007812663000017.tif21140G 4 b and G 4 The underlined part in c represents the downstream overhang, and G 4 The underlined portion of a represents the upstream overhang. These oligonucleotide sequences were hybridized together to form the structure shown in the non-limiting working example shown in Figure 2E. In this example, two G 4 Each upstream ATGC overhang in the a sequence is G 3 B and G 3 Hybridized with the downstream GCAT overhang of C.

[0138] 5th generation adapter (G 5 A non-limiting example of ) was synthesized from the following oligonucleotide sequence (5 prime to 3 prime):

[0139] TIFF0007812663000018.tif21140G 5 b and G 5 The underlined part in c represents the downstream overhang, and G 5 The underlined portion of a represents the upstream overhang. These oligonucleotide sequences were hybridized together to form the structure shown in the non-limiting working example shown in Figure 2F. In this example, two G 5 Each upstream GCAA overhang in the a sequence is G 4 b and G 4 In this non-limiting example, G 5A fluorophore (ALEXA FLUOR 647®, Thermo Fisher Scientific) was attached to the 3-prime end of c to allow visualization of the nanoparticles by fluorescence imaging.

[0140] In another embodiment, a polynucleotide or other spacer (e.g.,

[0141] TIFF0007812663000019.tif6128) is prepared by conjugating a fluorophore with a G 5 c can be included between the 3-prime end of the oligonucleotide.

[0142] For dendrons with six or more generations, the fifth generation adapter (and every subsequent third generation adapter associated therewith) is an oligonucleotide G 5 a, G 2 b, and G 2 c), and two subsequent generation adapters are made with oligonucleotides having sequences for generations 3 and 4, respectively.

[0143] Dendrimer DNA scaffolds may be constructed from one generation to the next by sequential assembly of adapters of a given generation, hybridizing to the preceding generation (for adapters of the second or higher generations), and ligating the ends of the oligonucleotides together, where the ends meet by sticky end-to-end hybridization at the boundary between the upstream adapter of one generation and the downstream adapter of the next generation.

[0144] A non-limiting example for assembling adapters and DNA dendrimers follows. To create adapters, the three oligonucleotides for adapter assembly were suspended at a concentration of 200 μM in assembly buffer (10 mM TRIS pH 8.0, 1 mM EDTA, 50 mM NaCl) using the relevant sequences of each generation of adapters from the non-limiting examples above. 10 μL of each solution was then mixed with 20 μL of assembly buffer. The mixture was denatured at 95°C for 2 minutes, cooled to 65°C for 2 minutes, and then annealed at 60°C for 6 minutes. Thirty-nine annealing cycles were continued, with the temperature decreasing in 0.1°C increments (starting at 59.1°C), for 30 seconds each.

[0145] To attach second-generation adapters to first-generation adapters, a 150 μL solution was prepared by adding 15 μL of 10x ligase buffer containing T4 DNA ligase (NEB M0202M), 0.5 μM first-generation adapters, and 2 μM second-generation adapters to a total volume of 150 μL. 100 μL of this reaction mixture was then mixed with 450 μL of assembly buffer and transferred to a 50 kDa MWCO filter. The sample was then centrifuged at 15,000 × g for 1 minute, and the filtration was repeated 10 times, adding 400 μL of assembly buffer after each centrifugation step. The dendrimers were eluted from the filter by adding a new 400 μL of assembly buffer, placing the filter upside down in a new tube, and centrifuging at 5,000 × g for 3 minutes. The volume was then adjusted to 100 μL by adding assembly buffer.

[0146] The third-generation dendrimer adapters were then added to the first- and second-generation dendrimers in a 4 μM to 0.5 μM solution containing T4 DNA ligase and ligase buffer, and brought to a volume of approximately 60 μL with assembly buffer. The fourth-generation adapters were added to the first- and third-generation dendrimers in a 8 μM to 0.5 μM solution containing T4 DNA ligase and ligase buffer, and brought to a volume of approximately 63 μL with assembly buffer. The fifth-generation adapters were added to the first- and fourth-generation dendrimers in a 15 μM to 0.5 μM solution containing T4 DNA ligase and ligase buffer, and brought to a volume of approximately 69 μL with assembly buffer. The sixth-generation adapters were added to the first- and fifth-generation dendrimers in a 22.5 μM to 0.5 μM solution containing T4 DNA ligase and ligase buffer, and brought to a volume of approximately 75 μL with assembly buffer. The 6th generation adapters were added to the 1st-5th generation dendrimers in a solution containing T4 DNA ligase and ligase buffer in a ratio of 22.5 μM to 0.25 μM, and brought to a volume of approximately 75 μL with assembly buffer.

[0147] In some instances, the size of a DNA dendrimer scaffold can be determined as a function of the number of generations of adaptors it contains. For example, dendron DNA scaffolds with 2 to 9 generations were synthesized as described above, and their diameters were measured by DLS. The results are shown in Table 2. [Table 2]

[0148] Figure 3 shows a non-limiting example of an ssDNA scaffold. In this non-limiting example, different methods for synthesizing ssDNA scaffolds are shown. A single template site is present at the end of the ssDNA scaffold. The four-pointed star represents an accessory site on the scaffold. P5 and P7 represent accessory oligonucleotides, and the five-pointed star represents a moiety or structure complementary to the accessory site. In the example shown in the upper left, a circular DNA template is used as a template for synthesis of ssDNA molecules by a DNA polymerase in a rolling circle amplification process. For example, strand replication by a strand-displacing DNA polymerase (e.g., Phi29) can generate ssDNA molecules containing concatemerized copies of the copied strand of the circular coding strand. The size of the ssDNA scaffold can be determined in part by controlling the size of the circular template and the time of the rolling circle amplification process (longer polymerization times during the rolling circle amplification process result in longer ssDNA scaffolds).

[0149] Another non-limiting example, shown at the top center, involves the synthesis of ssDNA templates by the use of a template-independent polymerase (e.g., terminal deoxynucleotidyl transferase, or TdT). Template-independent polymerases such as TdT incorporate deoxynucleotides at the 3-prime hydroxyl end of a single-stranded DNA strand without the need for or copying a template. The size of the ssDNA synthesized by the use of a template-independent polymerase can be controlled by varying the time of the polymerization process during which the scaffold is synthesized.

[0150] Another non-limiting example of a method for synthesizing an ssDNA scaffold is shown in the upper right. In this example, several single-stranded DNA molecules are synthesized by any desired method. In one example, the ssDNA molecules are synthesized in a runoff polymerization process, in which a polymerase proceeds along the coding strand from a linearized plasmid, synthesizing a complementary nascent strand until it reaches the end of the linear coding strand. Upon reaching the end, the polymerase flows from the end of the coding strand, completing the synthesis of the ssDNA molecule. Multiple ssDNA products can be synthesized and then ligated end-to-end to form a single ssDNA scaffold containing each of the multiple products. In one example, as shown, ligation of one ssDNA product to another can be achieved with the aid of a splint. For example, short oligo-DNAs may be designed such that their 3-prime ends are complementary to the 5-prime ends of one ssDNA product and the 5-prime ends are complementary to the 3-prime ends of another ssDNA product, such that hybridization of the DNA-oligo to the two ssDNA products results in the 5-prime ends joining the 3-prime ends of the other in a nicked double-stranded structure where they meet and hybridize to the DNA-oligo. The two ends can then be enzymatically ligated together using a DNA ligase (e.g., T4) to form a single ssDNA molecule from the two. Additional reactions can be included with DNA oligos for splinting one or both ends of the product of such a first reaction to another ssDNA product, etc., to build an ssDNA scaffold as desired. The size of the ssDNA produced in this way can be controlled by controlling the number and size of the ssDNA molecules ligated together to form the ssDNA scaffold. These examples are not exhaustive. They are also not mutually exclusive, as two or more or all three can be used together in the synthesis of an ssDNA scaffold.

[0151] In this non-limiting example, accessory oligonucleotides are shown attached to an ssDNA scaffold. Accessory oligonucleotides can be attached to accessory sites by any of a variety of methods for accomplishing the tasks disclosed herein. The 5-prime end of the template is then shown attached to a single template site by non-covalent Watson-Crick base pairing hybridization with a complementary 3-prime end of the scaffold. A clustering process is then performed on the scaffold. The ends of the portion of the template polynucleotide that does not hybridize to the ssDNA scaffold contain sequences corresponding to or complementary to the P5 and P7 accessory oligonucleotides. Following multiple polymerization processes, scaffold-bound complements to the template polynucleotide and scaffold-bound copies of the template polynucleotide are found, extending from the 5-prime ends of the P5 and P7 accessory oligonucleotides. In this example, the first polymerization failed to prevent the 5-prime end of the template polynucleotide from hybridizing to the 3-prime end of the scaffold. Thus, sequences complementary to the portion of the 5-prime end of the template polynucleotide that was complementary to the hybridized end of the ssDNA scaffold were not included in the scaffold-attached complement to the synthesized template polynucleotide.

[0152] The moieties or structures described above for attaching accessories, such as template polynucleotides or accessory oligonucleotides, to DNA scaffolds as disclosed herein can then be used to attach template polynucleotides or accessories to the scaffolds. In some examples, commercially available nucleotides bearing such moieties or structures, including azide, alkyne, cyclooctyne, biotin, or thiol groups, that can be incorporated into nascent DNA strands can be included in the DNA scaffold. For example, in the polymerase reaction in which the DNA scaffold is synthesized, modified nucleotides can be seeded into the polymerization reaction at a concentration selected relative to the concentration of unmodified nucleotides present. Depending on such concentration, a specific proportion of the nucleotides incorporated into the DNA scaffold will be modified nucleotides. Two or more types of modified nucleotides can be seeded into the reaction to include two or more types of moieties or structures for binding to the DNA scaffold through compositions with complementary moieties or structures. By incorporating modified nucleotides into the DNA scaffold, i.e., modified nucleotides that can be further modified to add moieties or structures as disclosed herein for binding between the scaffold and the accessory or template polynucleotide, a single template site and accessory site can be included in the DNA scaffold.

[0153] In some examples, a nucleotide can be modified to include a linker, such as polyethylene glycol or other linker, to another nucleotide, such as a nucleotide of a polynucleotide, to which it is linked. In other examples, a nucleotide can be modified to include a linker, such as polyethylene glycol or other linker, to an amino acid of a polypeptide to which it is linked. Such a linker to a polynucleotide or a linker to a polypeptide can be a binding site for a template polynucleotide or an accessory, e.g., by examples of non-covalent bonds disclosed herein.

[0154] Figure 4 shows a diagram of a non-limiting working example of a polypeptide scaffold. In this example, green fluorescent protein (GFP) was used, having the amino acid sequence and three-dimensional structure shown in Figure 4. GFP contains three cysteine ​​residues. When GFP adopts the three-dimensional structure shown in Figure 4, only one of the cysteines, shown as C137 in the sequence shown in Figure 4, is exposed outward from the molecule as shown in Figure 4. The cysteine ​​residues C125 and C195 may be buried within the three-dimensional structure of GFP and not exposed to the outside of the structure as shown, and therefore may not be available for bond formation. When only a single cysteine ​​residue is available for bond formation (e.g., the outward-facing C137 in the structure shown in Figure 4), the thiol group can serve as a single template polynucleotide site for the GFP protein scaffold.

[0155] In two other examples, C125 and C195 were mutated by standard recombinant methods, both to alanine in one example and to valine in the other, leaving only a single thiol site at C137 as a scaffold-templated nucleotide binding site. Such a single cysteine ​​residue with its thiol group can be a single template nucleotide site because the GFP protein scaffold has only one of them and lacks other thiol groups. Any moiety or structure capable of forming a bond with such a thiol group as a complementary moiety or structure can be used to bind to the template polynucleotide. The GFP protein scaffold can also contain multiple lysine residues (e.g., 19 positions, as shown in the sequence shown in Figure 4). Lysine residues contain amine groups on their side chains. Therefore, the amine groups of the lysine residues in the GFP scaffold serve as accessory sites, and accessories, such as oligo-DNA molecules or polymers containing moieties or structures capable of binding to such amine groups, can be present on such accessories for binding to the lysine amine group accessory site.

[0156] In another example, the amine groups of a polypeptide scaffold, such as GFP, can be effectively converted into other attachment sites. 24Bifunctional linkers bearing an NHS-ester at one end and an azide group at the other, separated by a sequence, were attached to amine sites on the GFP polypeptide scaffold. The NHS-ester end of the bifunctional linker, coupled to the amine group on the GFP polypeptide scaffold, exposed the azide group and left it available as an accessory attachment site. The addition resulted in an approximately 20 kDa increase in size of the GFP polypeptide scaffold as measured by gel electrophoresis, consistent with the addition of 20 bifunctional linkers (each 1157 Da in size), one to each of the amine groups of the 19 lysine residues and one to the N-terminus of the GFP polyprotein scaffold. In other examples, different bifunctional linkers could be used to effectively replace thiol sites or amine or thiol groups with different moieties or structures.

[0157] Figure 5 is a diagram of different methods for attaching a template polynucleotide to a scaffold. At the top, a scaffold with a single template polynucleotide site is shown. On the left, a template site primer is included in the single template polynucleotide site, with its end complementary to the end of the template polynucleotide, allowing non-covalent attachment of the template polynucleotide to the scaffold via Watson-Crick base pairing hybridization. In the center, the template polynucleotide and the single template polynucleotide site each have complementary portions or structures that result in the formation of a covalent bond between the template polynucleotide and the scaffold. On the right, a polypeptide is included in the single template site, with the complementary polypeptide attached to the end of the template polynucleotide. The non-covalent bond between the polypeptides of the single template site and the template polynucleotide attaches the template polynucleotide to the scaffold.

[0158] Figure 6 shows a non-limiting example in which a template polynucleotide was attached to a protein scaffold by hybridization to a primer extending from a single template site on the scaffold, and the primer was then extended by a polymerase to form a scaffold-bound complement to the template polynucleotide. A maleimide moiety was attached to the 5-prime end of a P5 oligonucleotide. The P5 oligonucleotide was attached to a single accessible template site on the GFP polypeptide scaffold by a thiol-maleimide bond between the maleimide group of the oligo and the thiol group of an accessible cysteine ​​residue on the GFP scaffold. The migration band indicated by the arrow (tagging) in the polyacrylamide gel electrophoresis (PAGE) blot on the left indicates the thiol-maleimide bond between the scaffold and the P5 oligonucleotide. A template polynucleotide whose 3-prime end is complementary to the P5 oligonucleotide was attached to the scaffold by non-covalent hybridization to the P5 oligonucleotide. A polymerization reaction was then carried out to form a scaffold-bound complement to the template polynucleotide.

[0159] The PAGE blots on the right show the results of polymerization reactions performed under three different conditions. In condition A, the P5 oligonucleotide was attached to the scaffold via a thiol-maleimide bond. The band (first strand) indicated by the arrow in column A indicates that a scaffold-attached complement to the template polynucleotide was formed on the scaffold during polymerization. In column B, extension of the P5 oligonucleotide was blocked by attaching a Cy5 fluorophore to a blocking position on the 3-prime nucleotide of the P5 oligonucleotide, preventing it from being extended by the polymerase. The arrow in column B indicates that a scaffold-based complement to the template polynucleotide was not formed, confirming the positive result shown in column A. In column C, Cy5 was attached to the P5 oligonucleotide via hexathymidine (T6) without blocking extension. The arrow in column C, which coincides with the arrow in column A, again confirms that a scaffold-attached complement to the template polynucleotide was formed, and its absence in column B was not a false-negative result simply due to the presence of Cy5.

[0160] Figure 7 shows a non-limiting example of a bioconjugation reaction involving (PLP)-mediated transamination specific to the N-terminus of a protein, which oxidizes the N-terminal amine to a ketone or aldehyde, followed by the formation of a stable oxime bond with an alkoxyamine.

[0161] Figure 8 shows non-limiting examples of bonds that can be formed with natural amino acids for attachment to accessory sites on scaffolds, as described herein or for single template sites. Examples include thiol-maleimide bonds to cysteine ​​residues, amine-NHS bonds at lysine residues, rhodium carbenoid bonds to tryptophan residues, α,β-dicarbonyl bonds to arginine residues, and PLP-mediated transamination of the protein N-terminus followed by oxime bond formation. On the right, examples of site-specific modification of proteins at modified unnatural amino acid residues are shown. One example shows an unnatural ketone amino acid reacting with hydroxylamine to form an oxime. The second reaction shows an unnatural norbornene (or other strained alkene / alkyne) reacting with tetrazine.

[0162] Figure 9 shows an example of a template polynucleotide bound to a single template site on a protein scaffold by hybridization to a template site primer, represented by PX (GFP-oligoconjugate). Two examples of library template polynucleotides are shown: a standard library molecule with sequences P5 and P7, a region complementary to the PX template site primer (labeled PX') at its 3-prime end, or a modified version in which the PX' sequence is separated from the P5 sequence by a PEG linker. An ether chain is attached to the single template site on the scaffold. The standard library sequence can be used in a first chain-extension polymerization reaction, with the PX primer serving as the initiating primer for polymerizing a nascent strand complementary to the template polynucleotide.

[0163] FIG. 10 shows an example of non-covalent binding, specifically coiled-coil peptide non-covalent binding (in this example, K D picomolar range, <1 x 10 -10M). Two amino acid sequences of α-helical polypeptide structures that form two complementary binding partners for the coiled-coil attachment are shown. By attaching one such sequence to a scaffold such as the polynucleotide scaffold shown in FIG. 10 (GFP-peptide fusion) and the other to a template polynucleotide (peptide oligoconjugate) or library template polynucleotide, the template polynucleotide can be linked to the scaffold via a non-covalent bond between the α-helices. In another example, one of the α-helical sequences complementary to the one attached to the scaffold can be attached to an accessory, such as an accessory oligonucleotide for attaching an accessory oligonucleotide to an accessory site.

[0164] Figure 11 shows the selective bioconjugation of the lysine side chain of a polypeptide scaffold using an activated NHS-ester. Lysine was attached to dibenzocyclooctyne (DBCO). The alkyne moiety of DBCO can then be added to an azide-containing molecule via a strain-promoted [3 + 2] cycloaddition click reaction. Molecules that can subsequently be added to the DBCO motif include, by way of non-limiting examples, oligonucleotides and polymers. A GFP polypeptide scaffold was readily labeled with DBCO, generating a mixture of DBCO-labeled scaffolds. Unlabeled GFP was detected by SDS-PAGE gel analysis of the reaction products (not shown).

[0165] Figure 12 shows an illustrative diagram of a non-limiting example of a scaffold with a single template polynucleotide attached to the surface of a flow cell well. In this non-limiting example, the scaffold is a DNA dendrimer. A single template site extends from the upstream overhang of a first-generation adapter, and an adapter site extends from the downstream overhang of the last generation of adapter. Figure 13 shows a graph (seeding events vs. nanowell surface area) of a non-limiting example of the test number of scaffolds of a given size that can be present in a nanowell (dendrimer / nanowell) of a given nanowell surface area (SA) or diameter (D). DNA dendrimer nanoparticles approximately 100 nm in diameter were seeded into nanowells of 185, 285, or 375 nm diameter, and the number of dendrimers per nanowell was determined. Extrapolation from the best fit curve of the results (y=3E-0.5x-3.4874, R 2 =0.9991), in this example, shows that using nanoparticles with diameters of about 100 nm and nanowells with diameters of about 100 nm results in single nanoparticle seeding of the nanowells.

[0166] Figures 14A-14D show examples of seeding a template polynucleotide onto a substrate using a DNA scaffold according to an embodiment of the present disclosure. Figure 14A shows a depiction of a scaffold DNA molecule comprising a DNA dendrimer according to the present disclosure. The scaffold had a diameter of 50 nm to 150 nm. The scaffold contains a single template site (Pa) for binding the template polynucleotide and multiple accessory sites (cPX). Figure 14B shows the template polynucleotide and its complement, with primer sequences added to each end (P5 / cP5 and P7 / cP7). The P5-primer end of the template polynucleotide is linked to a primer (cPa) by a PEG linker. The cPa primer is complementary to the single template site (Pa) of the scaffold DNA molecule shown in Figure 14A. Figure 14C is a diagram of the scaffold DNA molecule shown in Figure 14A hybridized through its single template site (Pa) to the template polynucleotide and its complement shown in Figure 4B via the cPa primer. The scaffold is attached to a substrate. The substrate is attached to a primer (PX) that is complementary to the accessory site (cPX) of the scaffold. The substrate is also attached to a primer that allows hybridization of the template ends, allowing clustering on the substrate.

[0167] Figure 14D shows an example according to the previous example of seeding a substrate with template polynucleotides using a scaffold with a single template site, followed by clustering. The scaffold was attached to a template polynucleotide according to the present disclosure and Figures 14A-14C. The dendrimer scaffold was combined with the template polynucleotide (library) at the indicated molar ratios and seeded onto a substrate (a flow cell with nanowells for seeding), followed by clustering according to a recombinase-driven cluster amplification process (ExAmp cluster amplification). Negative controls included a scaffold without a template and a template without a scaffold. As a positive control (+ control), clustering was performed on a substrate without dendrons, using clustering on a substrate after hybridization of template molecules to primers attached to the substrate without a scaffold.

[0168] The left panel shows a diagram of the flow cell after the clustering process according to the above conditions (two negative controls, five conditions with various scaffold:template molar ratios, and one positive control). The fluorescence in all conditions except the negative control indicates that scaffolds with a single template-binding site can be seeded onto the substrate with template polynucleotides and support the clustering process. The bar graphs are quantitative measurements of the clustering results for the eight conditions. In the top panel, C1 intensity is the intensity of cycle 1, as an indirect measure of cluster size or yield (intensity is directly proportional to cluster size or yield). In the bottom panel, %PF is % filter pass, which is the percentage of nanowells that pass the threshold filter and indicates the purity of the clusters formed therein; i.e., it is directly proportional to the number of nanowells with monoclonal clusters.

[0169] It should be understood that all combinations of the foregoing concepts and additional concepts discussed in more detail herein (unless such concepts are mutually inconsistent) are contemplated as being part of the inventive subject matter disclosed herein. In particular, all combinations of claimed subject matter appearing at the end of this disclosure are contemplated as being part of the inventive subject matter disclosed herein and may be used to achieve the benefits and advantages described herein. The present application also includes the following aspects. [Aspect 1] A nanoparticle, a scaffold, a single template site for attaching a template polynucleotide to the scaffold, and a plurality of accessory sites for attaching accessory oligonucleotides to the scaffold; the scaffold is selected from one or more scaffold DNA molecules and one or more scaffold polypeptides; the single template site for attaching a template polynucleotide to the scaffold is selected from a covalent template binding site and a non-covalent template binding site; A nanoparticle, wherein the plurality of accessory sites for attaching accessory oligonucleotides to the scaffold are selected from covalent accessory oligonucleotide binding sites and non-covalent accessory oligonucleotide binding sites. [Aspect 2] 2. The nanoparticle of embodiment 1, wherein the scaffold comprises one or more scaffold DNA molecules. [Aspect 3] 3. The nanoparticle of embodiment 2, wherein the scaffold comprises a plurality of scaffold DNA molecules, the plurality of scaffold DNA molecules comprising a DNA dendrimer. [Aspect 4] 4. The nanoparticle of claim 3, wherein the DNA dendrimer comprises constitutional repeat units that are branched over multiple generations, the number of generations being 2 to 100. [Aspect 5] 5. The nanoparticle of embodiment 4, wherein each of the branched constitutional repeat units comprises three constitutional repeat units of an oligodeoxyribonucleotide that hybridize to each other to form an adapter comprising one upstream overhang and two downstream overhangs, wherein the upstream overhang of each second or higher generation adapter is complementary to the downstream overhang of the immediately upstream constitutional repeat unit, and wherein the downstream overhang of the first generation adapter comprises the single template site. [Aspect 6] 3. The nanoparticle of embodiment 2, wherein the scaffold comprises single-stranded DNA. [Aspect 7] 2. The nanoparticle of embodiment 1, wherein the scaffold comprises one or more scaffold polypeptides. [Aspect 8] 8. The nanoparticle of embodiment 7, wherein the scaffold polypeptide comprises green fluorescent protein. [Aspect 9] Aspect 9. The nanoparticle of any one of aspects 1 to 8, wherein the single template site comprises a covalent template binding site. [Aspect 10] The covalent template binding site is selected from the group consisting of an amine-NHS ester binding site, an amine-imidoester binding site, an amine-pentofluorophenyl ester binding site, an amine-hydroxymethylphosphine binding site, a carboxyl-carbodiimide binding site, a thiol-maleimide binding site, a thiol-haloacetyl binding site, a thiol-pyridyl disulfide binding site, a thiol-thiosulfonate binding site, a thiol-vinyl sulfone binding site, an aldehyde-hydrazide binding site, an aldehyde-alkoxyamine binding site, a hydroxy-isocyanato binding site, an azide-alkyne binding site, an azide-phosphine binding site, a transcyclooctene-tetrazine binding site, a norbornene-tetrazine binding site, an azide-cyclooctyne binding site, an azide-norbornene binding site, an oxime binding site, a SpyTag-SpyCatcher binding site, a Snap-tag-O 6 -benzylguanine binding site, CLIP-tag-O 2 10. The nanoparticle according to embodiment 9, wherein the benzylcytosine binding moiety is selected from a benzylcytosine binding moiety and a sortase-conjugated binding moiety. [Aspect 11] Aspect 9. The nanoparticle of any one of aspects 1 to 8, wherein the single template site comprises a non-covalent template binding site. [Aspect 12] 12. The nanoparticle of embodiment 11, wherein the non-covalent template binding site comprises a polynucleotide hybridization site. [Aspect 13] 12. The nanoparticle of embodiment 11, wherein the non-covalent template binding site comprises a non-covalent peptide binding site, the non-covalent peptide binding site being selected from a coiled-coil binding site and an avidin-biotin binding site. [Aspect 14] 14. The nanoparticle of any one of aspects 1 to 13, wherein the plurality of accessory moieties for attaching accessory oligonucleotides to the scaffold comprise covalent accessory oligonucleotide attachment sites. [Aspect 15] The covalent accessory oligonucleotide attachment site is selected from the group consisting of an amine-NHS ester attachment site, an amine-imidoester attachment site, an amine-pentofluorophenyl ester attachment site, an amine-hydroxymethylphosphine attachment site, a carboxyl-carbodiimide attachment site, a thiol-maleimide attachment site, a thiol-haloacetyl attachment site, a thiol-pyridyl disulfide attachment site, a thiol-thiosulfonate attachment site, a thiol-vinyl sulfone attachment site, an aldehyde-hydrazide attachment site, an aldehyde-alkoxyamine attachment site, a hydroxy-isocyanato attachment site, an azide-alkyne attachment site, an azide-phosphine attachment site, a transcyclooctene-tetrazine attachment site, a norbornene-tetrazine attachment site, an azide-cyclooctyne attachment site, an azide-norbornene attachment site, an oxime attachment site, a SpyTag-SpyCatcher attachment site, a Snap-tag-O 6 -benzylguanine binding site, CLIP-tag-O 2 15. The nanoparticle of embodiment 14, wherein the benzylcytosine binding moiety is selected from a benzylcytosine binding moiety, a sortase-conjugated binding moiety, and any combination of two or more of the foregoing. [Aspect 16] Aspect 14. The nanoparticle of any one of aspects 1 to 13, wherein the accessory oligonucleotide binding site comprises a non-covalent accessory oligonucleotide binding site. [Aspect 17] 17. The nanoparticle of embodiment 16, wherein the non-covalent accessory oligonucleotide binding site comprises a polynucleotide hybridization site. [Aspect 18] 17. The nanoparticle of embodiment 16, wherein the non-covalent accessory oligonucleotide binding site comprises a non-covalent peptide binding site selected from one or both of a coiled-coil binding site and an avidin-biotin binding site. [Aspect 19] 19. The nanoparticle of any one of aspects 1 to 18, further comprising a single template polynucleotide bound to the single template site. [Aspect 20] 20. The nanoparticle of any one of aspects 1 to 19, further comprising a plurality of accessory oligonucleotides bound to said plurality of accessory moieties. [Aspect 21] 21. The nanoparticle of any one of aspects 1 to 20, wherein the nanoparticle is at least about 10 nm in diameter. [Aspect 22] A method comprising attaching a single template polynucleotide to a single template site of a nanoparticle of any one of embodiments 1 to 21. [Aspect 23] A method comprising attaching a plurality of accessory oligonucleotides to a plurality of accessory moieties of a nanoparticle of any one of embodiments 1-22. [Aspect 24] 24. The method of embodiment 22 or 23, further comprising synthesizing one or more scaffold-attached copies selected from a copy of the template polynucleotide, a copy of a polynucleotide complementary to the template polynucleotide, and copies of both, wherein the scaffold-attached copies extend from the accessory oligonucleotide. [Aspect 25] 25. The method of any one of aspects 22-24, further comprising attaching the scaffold to a substrate, wherein the attaching comprises hybridizing accessory oligonucleotides to the oligonucleotides attached to the substrate. [Aspect 26] 26. The method of embodiment 25, wherein the substrate comprises a plurality of nanowells, and wherein the oligonucleotides attached to the substrate are attached within the plurality of nanowells. [Aspect 27] 27. The method of embodiment 26, wherein only one scaffold is bound within any one of said nanowells. [Aspect 28] 28. The method of any one of aspects 25 to 27, further comprising synthesizing one or more substrate-attached copies selected from a copy of the template polynucleotide, a copy of a polynucleotide complementary to the template polynucleotide, and copies of both, wherein the substrate-attached copies extend from the substrate-attached oligonucleotide. [Aspect 29] 29. The method of embodiment 24 or 28, further comprising sequencing at least one of the scaffold-attached copy and the substrate-attached copy, wherein sequencing comprises decoding-by-synthesis.

Claims

1. A nanoparticle, (i) a scaffold comprising a DNA dendrimer, the DNA dendrimer comprising constitutional repeat units branched at 2 to 100 generations; (ii) a single template site for attaching a template polynucleotide to the scaffold; and (iii) a plurality of accessory sites for attaching accessory oligonucleotides to the scaffold. where: the plurality of accessory sites for attaching accessory oligonucleotides to the scaffold comprise a different chemical nature or structure than the single template site, such that the plurality of accessory sites for attaching accessory oligonucleotides to the scaffold cannot bind or attach to the template polynucleotide; the single template site for attaching a template polynucleotide to the scaffold is selected from a covalent template binding site and a non-covalent template binding site; a plurality of accessory sites for attaching accessory oligonucleotides to the scaffold selected from covalent accessory oligonucleotide attachment sites and non-covalent accessory oligonucleotide attachment sites; the scaffold is configured to attach one template polynucleotide to the single template site and prevent attachment of a second template polynucleotide to the same nanoparticle; The nanoparticles.

2. 2. The nanoparticle of claim 1, wherein each of the branched constituent repeat units comprises three constituent repeat units of an oligodeoxyribonucleotide that hybridize to each other to form an adapter comprising one upstream overhang and two downstream overhangs, wherein the upstream overhang of each second or higher generation adapter is complementary to the downstream overhang of the immediately upstream constituent repeat unit, and wherein the downstream overhang of the first generation adapter comprises the single template site.

3. The nanoparticle of claim 1 , wherein the scaffold comprises single-stranded DNA.

4. The nanoparticle of claim 1 , wherein the scaffold comprises one or more scaffold polypeptides.

5. The nanoparticle of claim 4 , wherein the scaffold polypeptide comprises green fluorescent protein.

6. The nanoparticle of any one of claims 1 to 5, wherein the single template site comprises a covalent template binding site.

7. The covalent template binding site is an amine-NHS ester binding site, an amine-imidoester binding site, an amine-pentofluorophenyl ester binding site, an amine-hydroxymethylphosphine binding site, a carboxyl-carbodiimide binding site, a thiol-maleimide binding site, a thiol-haloacetyl binding site, a thiol-pyridyl disulfide binding site, a thiol-thiosulfonate binding site, a thiol-vinyl sulfone binding site, an aldehyde-hydrazide binding site, an aldehyde-alkoxyamine binding site, a hydroxy-isocyanato binding site, an azide-alkyne binding site, an azide-phosphine binding site, a transcyclooctene-tetrazine binding site, a norbornene-tetrazine binding site, an azide-cyclooctyne binding site, an azide-norbornene binding site, an oxime binding site, a SpyTag-SpyCatcher binding site, a Snap-tag-O ６ -benzylguanine binding site, CLIP-tag-O ２ 7. The nanoparticle of claim 6, wherein the carboxyl group is selected from the group consisting of a benzylcytosine binding site, a benzylcytosine binding site, and a sortase-coupled binding site.

8. The nanoparticle of any one of claims 1 to 5, wherein the single template site comprises a non-covalent template binding site.

9. The nanoparticle of claim 8 , wherein the non-covalent template binding site comprises a polynucleotide hybridization site.

10. 9. The nanoparticle of claim 8, wherein the non-covalent template binding site comprises a non-covalent peptide binding site, the non-covalent peptide binding site being selected from a coiled-coil binding site and an avidin-biotin binding site.

11. The nanoparticle of any one of claims 1 to 10, wherein the plurality of accessory sites for attaching accessory oligonucleotides to the scaffold comprises covalent accessory oligonucleotide attachment sites.

12. The covalent accessory oligonucleotide attachment site is selected from the group consisting of an amine-NHS ester attachment site, an amine-imidoester attachment site, an amine-pentofluorophenyl ester attachment site, an amine-hydroxymethylphosphine attachment site, a carboxyl-carbodiimide attachment site, a thiol-maleimide attachment site, a thiol-haloacetyl attachment site, a thiol-pyridyl disulfide attachment site, a thiol-thiosulfonate attachment site, a thiol-vinyl sulfone attachment site, an aldehyde-hydrazide attachment site, an aldehyde-alkoxyamine attachment site, a hydroxy-isocyanato attachment site, an azide-alkyne attachment site, an azide-phosphine attachment site, a transcyclooctene-tetrazine attachment site, a norbornene-tetrazine attachment site, an azide-cyclooctyne attachment site, an azide-norbornene attachment site, an oxime attachment site, a SpyTag-SpyCatcher attachment site, a Snap-tag-O ６ -benzylguanine binding site, CLIP-tag-O ２ 12. The nanoparticle of claim 11, wherein the benzylcytosine binding site is selected from a benzylcytosine binding site, a sortase-coupled binding site, and any combination of two or more of the foregoing.

13. The nanoparticle of any one of claims 1 to 10, wherein the plurality of accessory sites for attaching accessory oligonucleotides to the scaffold comprises non-covalent accessory oligonucleotide attachment sites.

14. The nanoparticle of claim 13 , wherein the non-covalent accessory oligonucleotide binding site comprises a polynucleotide hybridization site.

15. 14. The nanoparticle of claim 13, wherein the non-covalent accessory oligonucleotide binding site comprises a non-covalent peptide binding site selected from one or both of a coiled-coil binding site and an avidin-biotin binding site.

16. The nanoparticle of any one of claims 1 to 15, further comprising a single template polynucleotide bound to the single template site.

17. The nanoparticle of any one of claims 1 to 16, further comprising a plurality of accessory oligonucleotides attached to a plurality of accessory moieties for attaching accessory oligonucleotides to the scaffold.

18. The nanoparticle of any one of claims 1 to 17, wherein the nanoparticle is at least about 10 nm in diameter.

19. 1. A method for increasing seeding density and monoclonal clustering in sequencing by synthesis (SBS), comprising: a. Attaching a single template polynucleotide to a single template site of a nanoparticle of any one of claims 1 to 15; b. attaching a plurality of accessory oligonucleotides to a plurality of accessory moieties of the nanoparticle; and c. synthesizing one or more scaffold-attached copies selected from a copy of the template polynucleotide, a copy of a polynucleotide complementary to the template polynucleotide, and a copy of both. Including, the scaffold-attached copies extend from the accessory oligonucleotides; The method.

20. 20. The method of claim 19, further comprising attaching the scaffold to a substrate, wherein the attaching comprises hybridizing accessory oligonucleotides to the oligonucleotides attached to the substrate.

21. 21. The method of claim 20, wherein the substrate comprises a plurality of nanowells, and the oligonucleotides attached to the substrate are attached within the plurality of nanowells.

22. 22. The method of claim 21 , wherein only one scaffold is bound within any one of said nanowells.

23. 23. The method of any one of claims 20-22, further comprising synthesizing one or more substrate-attached copies selected from a copy of the template polynucleotide, a copy of a polynucleotide complementary to the template polynucleotide, and copies of both, wherein the substrate-attached copies extend from the substrate-attached oligonucleotides.

24. 24. The method of claim 19 or 23, further comprising sequencing at least one of the scaffold-attached copy and the substrate-attached copy, wherein sequencing comprises decoding-by-synthesis.

Images