Nucleic acid detection device and nucleic acid detection method

Abstract

Provided are a nucleic acid detection device and a nucleic acid detection method for easily detecting a target nucleic acid at a low concentration. This nucleic acid detection device is characterized by comprising: a distribution unit for distributing a sample containing a target nucleic acid and a detection reagent, said detection reagent containing an effector protein, a crRNA binding to the target nucleic acid and a reporter molecule, into a plurality of independent separate compartments; an activation unit for activating the effector protein by the binding of the crRNA to the target nucleic acid; a fluorescence generation unit for modifying the reporter molecule by the activated effector protein to generate fluorescence; a fluorescence detection unit for detecting the fluorescence; and an identification unit for determining the fluorescence intensities of the individual independent separate compartments on the basis of the detection results obtained by the fluorescence detection unit and identifying an individual separate compartment that has a fluorescence intensity exceeding a preset threshold value.

Description

[Technical Field]

[0001] The present invention relates to a nucleic acid detection device and a nucleic acid detection method using a trans-cleavage reaction of CHRISPR-Cas technology and individual independent separation compartments. [Background technology]

[0002] Jennifer Doudna and colleagues at the University of California demonstrated that Cas12a can be used to accurately distinguish and detect different strains of human papillomavirus (HPV) in human samples (Non-Patent Document 1). A complex consisting of Cas12a and crRNA specifically recognizes and binds to the target DNA sequence, and Cas12a cleaves the bound target DNA. When a reporter molecule consisting of a fluorescent substance and a quencher linked by single-stranded DNA is added to the reaction system, Cas12a cleaves the single-stranded DNA of the reporter molecule through a trans-cleavage reaction. This separates the fluorescent substance and the quencher, resulting in fluorescence. In other words, when target DNA is present in the sample, the trans-cleavage reaction of Cas12a is activated, causing the fluorescent substance derived from the reporter molecule to fluoresce, allowing the target DNA to be detected based on this fluorescence.

[0003] Feng Zhang et al. of the Broad Institute have disclosed a method for detecting target RNA using a complex consisting of Cas13a and crRNA and a reporter molecule (Patent Document 1). The complex consisting of Cas13a and crRNA specifically recognizes and binds to the sequence of the target RNA, and Cas13a cleaves the bound target RNA. When a reporter molecule consisting of a fluorescent substance and a quencher linked by RNA is added to the reaction system, Cas13a cleaves the RNA at this link, generating fluorescence. This allows the target RNA to be detected. Patent Document 1 also describes that a sample containing target RNA may be divided into individual, independent separation compartments. [Prior art documents] [Non-patent literature]

[0004] [Non-Patent Document 1] Science 27 Apr 2018:Vol.360, Issue 6387, pp436-439 [Patent documents]

[0005] [Patent Document 1] Special Publication No. 2020-501546 Summary of the Invention [Problem to be solved by the invention]

[0006] When attempting to detect a low concentration of a target nucleic acid by the methods described in Non-Patent Document 1 and Patent Document 1, detection has been difficult or detection has required a step of amplifying the target nucleic acid. When a step of amplifying the target nucleic acid is included, there is a problem that the operation for amplification is cumbersome and time-consuming.

[0007] Therefore, an object of the present invention is to provide a nucleic acid detection device and a nucleic acid detection method for easily detecting a target nucleic acid at a low concentration.

[0008] A nucleic acid detection device according to one embodiment of the present invention is characterized by comprising: a distribution unit that distributes a sample containing a target nucleic acid and a detection reagent containing an effector protein, crRNA that binds to the target nucleic acid, and a reporter molecule into a plurality of individual, independent separation compartments; an activation unit that activates the effector protein by binding of the crRNA to the target nucleic acid; a fluorescence generation unit that modifies the reporter molecule with the activated effector protein to generate fluorescence; a fluorescence detection unit that detects the fluorescence; and an identification unit that determines the fluorescence intensity of the individual, independent separation compartments based on the detection results obtained by the fluorescence detection unit and identifies individual, independent separation compartments having a fluorescence intensity exceeding a predetermined threshold.

[0009] In addition, another aspect of the present invention provides a nucleic acid detection method, which comprises: a distribution step of distributing a sample containing a target nucleic acid and a detection reagent containing an effector protein, crRNA that binds to the target nucleic acid, and a reporter molecule into a plurality of individual, independent separation compartments; an activation step of activating the effector protein by binding of the crRNA to the target nucleic acid; a fluorescence generation step of modifying the reporter molecule with the activated effector protein to generate fluorescence; a fluorescence detection step of detecting the fluorescence; and an identification step of determining the fluorescence intensity of the individual, independent separation compartments based on the detection results obtained in the fluorescence detection step, and identifying individual, independent separation compartments having a fluorescence intensity exceeding a predetermined threshold.

[0010] A program according to yet another aspect of the present invention is a program for causing a computer included in a nucleic acid detection device to execute the nucleic acid detection method. [Effects of the Invention]

[0011] According to the present invention, it is possible to provide a nucleic acid detection device and a nucleic acid detection method for easily detecting a target nucleic acid at a low concentration. [Brief explanation of the drawings]

[0012] [Figure 1] 1 is a functional block diagram of a nucleic acid detection device according to the present invention. [Figure 2A] FIG. 1 is a cross-sectional view of a well plate. [Figure 2B] This is a cross-sectional view of a well plate whose wells are filled with composite particles in which a complex of an effector protein and crRNA is bound to the particle. [Figure 3] 1 is a functional block diagram of a nucleic acid detection device according to the present invention. [Figure 4] 1 is a block diagram showing an example of the hardware configuration of a nucleic acid detection device according to the present invention. [Figure 5] 1 is a flowchart showing the flow of a nucleic acid detection method according to the present invention. [Figure 6]10 is a flowchart showing the flow of a nucleic acid detection method when droplets are used as individual independent separation compartments. [Figure 7] 1 is a flowchart showing the flow of a nucleic acid detection method when wells are used as individual independent separation compartments. [Figure 8A] FIG. 10 is a schematic diagram showing a fluorescent image of a reference droplet. [Figure 8B] FIG. 8B is a schematic diagram showing an image obtained by processing the fluorescent image shown in FIG. 8A using image processing software. [Figure 8C] FIG. 1 is a schematic diagram showing a fluorescent image of a droplet containing a sample and a detection reagent. [Figure 8D] FIG. 8D is a schematic diagram showing an image obtained by processing the fluorescent image shown in FIG. 8C using image processing software. [Figure 9A] FIG. 10 is a diagram showing a fluorescent microscope image of a droplet in an example. [Figure 9B] FIG. 10 is a diagram showing a fluorescent microscope image of a droplet in an example. [Figure 9C] FIG. 10 is a diagram showing a fluorescent microscope image of a droplet in an example. [Figure 9D] FIG. 10 is a diagram showing a fluorescent microscope image of a droplet in an example. [Figure 10A] FIG. 10 is a diagram showing a fluorescent microscope image of a droplet in an example. [Figure 10B] FIG. 10 is a diagram showing a fluorescent microscope image of a droplet in an example. [Figure 11A] FIG. 10 is a diagram showing a fluorescent microscope image of a droplet in an example. [Figure 11B] FIG. 10 is a diagram showing a fluorescent microscope image of a droplet in an example. [Figure 12A] FIG. 10 is a diagram showing a fluorescent microscope image of a droplet in an example. [Figure 12B] FIG. 10 is a diagram showing a fluorescent microscope image of a droplet in an example. [Figure 13A] FIG. 10 is a diagram showing a fluorescent microscope image of a droplet in an example. [Figure 13B] FIG. 10 is a diagram showing a fluorescent microscope image of a droplet in an example. [Figure 14A]FIG. 1 shows a fluorescent microscope image of a well in an example. [Figure 14B] FIG. 1 shows a fluorescent microscope image of a well in an example. [Figure 14C] FIG. 1 shows a fluorescent microscope image of a well in an example. [Figure 14D] FIG. 1 shows a fluorescent microscope image of a well in an example. [Figure 15] 1 is a histogram obtained from a fluorescence microscope image of a well in an example. [Figure 16A] FIG. 1 shows a fluorescent microscope image of a well in an example. [Figure 16B] FIG. 1 shows a fluorescent microscope image of a well in an example. [Figure 17A] FIG. 1 shows bright field images of wells in an example. [Figure 17B] FIG. 1 shows a fluorescent microscope image of a well in an example. [Figure 17C] FIG. 1 shows a fluorescent microscope image of a well in an example. [Figure 18A] 1 is a graph showing the change over time in the fluorescence intensity ratio in an example. [Figure 18B] 1 is a graph showing the change over time in the fluorescence intensity ratio in an example. [Figure 18C] 1 is a graph showing the change over time in the fluorescence intensity ratio in an example. [Figure 19A] 1 is a graph showing the change over time in the fluorescence intensity ratio in an example. [Figure 19B] 1 is a graph showing the change over time in the fluorescence intensity ratio in an example. DETAILED DESCRIPTION OF THE INVENTION

[0013] Hereinafter, exemplary embodiments of the present invention will be described with reference to the drawings. In the drawings, similar or corresponding elements are designated by the same reference numerals, and descriptions thereof may be omitted or simplified.

[0014] 1 is a functional block diagram of a nucleic acid detection device 10 according to the present invention. The nucleic acid detection device 10 has a distribution unit 101, an activation unit 102, a fluorescence generation unit 103, a fluorescence detection unit 104, and an identification unit 105.

[0015] The distribution unit 101 distributes a sample containing a target nucleic acid and a detection reagent to a plurality of individual, independent separation compartments. Here, the detection reagent contains an effector protein, a crRNA that binds to the target nucleic acid, and a reporter molecule. The activation unit 102 activates the effector protein by binding of the crRNA to the target nucleic acid. The fluorescence generation unit 103 generates fluorescence by modifying the reporter molecule with the activated effector protein. The fluorescence detection unit 104 detects the fluorescence. Furthermore, the identification unit 105 determines the fluorescence intensity of the individual, independent separation compartments and identifies individual, independent separation compartments having a fluorescence intensity above a predetermined threshold. The detection reagent may contain an effector protein, a crRNA, and a reporter molecule, respectively. For example, in the distribution unit 101, before distribution to the individual independent separation compartments, the sample containing the target nucleic acid may be premixed with the effector protein and the crRNA, and then the reporter molecule may be further mixed.

[0016] The identification unit 105 includes an extraction unit 106, a determination unit 107, a judgment unit 108, a calculation unit 109, a display unit 110, and a storage unit 111. The functions of these components included in the identification unit 105 will be described later.

[0017] Specific configuration examples of the present invention will be described below, but the present invention is not limited to the examples shown below.

[0018] (effector protein) The effector protein can be, for example, either Cas12 or Cas13.

[0019] Examples of Cas12 that can be used include LbCas12a, AsCas12a, FnCas12a, and AaCas12b.

[0020] Examples of Cas13 that can be used include LwaCas13a, LbaCas13a, LbuCas13a, BzoCas13b, PinCas13b, PbuCas13b, AspCas13b, PsmCas13b, RanCas13b, PauCas13b, PsaCas13b, PinCas13b, CcaCas13b, PguCas13b, PspCas13b, PigCas13b, and Pin3Cas13b.

[0021] (crRNA) The crRNA is an RNA designed to contain a base sequence complementary to that of the target nucleic acid. The complex consisting of the effector protein and the crRNA specifically binds to the target nucleic acid sequence due to the complementarity of the crRNA. The crRNA is designed based on the type of effector protein to be used and the target region in the base sequence of the target nucleic acid.

[0022] (target nucleic acid) Examples of target nucleic acids include DNA and RNA. The target nucleic acid may be a nucleic acid that can be used for diagnosing disease states or predispositions. Examples of such disease states include cancer, autoimmune diseases, and infectious diseases. Examples of such infectious diseases include infections caused by DNA viruses and RNA viruses. The target nucleic acid can be selected arbitrarily and is not limited to the above examples.

[0023] (reporter molecule) Examples of reporter molecules include molecules in which a fluorescent substance and a quencher are linked by single-stranded DNA, or molecules in which a fluorescent substance and a quencher are linked by RNA. When Cas12 is used as the effector protein, a molecule in which a fluorescent substance and a quencher are linked by single-stranded DNA is suitable as the reporter molecule. DNaseAlert (IDT) can be used as an example of a molecule in which a fluorescent substance and a quencher are linked by single-stranded DNA. When Cas13 is used as the effector protein, a molecule in which a fluorescent substance and a quencher are linked by RNA is suitable as the reporter molecule.

[0024] (amino compounds) The detection reagent preferably further contains an amino compound, in which the DNA cleavage activity of the effector protein is enhanced, thereby shortening the time required to detect the target nucleic acid. The detection reagent may contain the amino compound separately from other components, or may contain the amino compound in a mixed state with any of the components. An amino compound is a compound containing an amino group, and in the present invention, any of primary amines, secondary amines, and tertiary amines can be used as the amino compound.

[0025] Examples of the amino compounds include pentaethylenehexamine (formula (a1) below), spermine (formula (a2) below), spermine tetrahydrochloride, triethylenetetramine (formula (a3) ​​below), spermidine (formula (a4) below), spermidine trihydrochloride, diethylenetriamine (formula (a5) below), 1,3-diaminopropane (formula (a6) below), 1,4-diaminobutane (formula (a7) below), 1,5-diaminopentane (formula (a8) below), 1,6-diaminohexane (formula (a9) below), 1,8-diaminooctane (formula (a10) below), 1,3-diaminopropane (formula (a11) below), 1,4-diaminobutane (formula (a12) below), 1,5-diaminopentane (formula (a13) below), 1,6-diaminohexane (formula (a14) below), 1,8-diaminooctane (formula (a15) below), 1,5-diaminopentane (formula (a16) below), 1,6-diaminohexane (formula (a17) below), 1,8-diaminooctane (formula (a18) below), 1,8-diaminooctane (formula (a19 ... Formula (a10)), ethylenediamine (formula (a11) below), ethylamine (formula (a12) below), propylamine (formula (a13) below), N,N'-dimethylethylenediamine (formula (a14) below), N,N-dimethylethylenediamine (formula (a15) below), N-ethylethylenediamine (formula (a16) below), N-methylethylenediamine (formula (a17) below), and amino compounds containing a polyethylene glycol (PEG) structure. Examples of amino compounds containing a PEG structure include compounds represented by formula (a18) below, compounds represented by formula (a19) below, and compounds represented by formula (a20) below.

[0026] Examples of compounds represented by the following formula (a18) include commercially available Blockmaster (registered trademark) CE210 (PEG molecular weight 2000, n=45) and Blockmaster (registered trademark) CE510 (PEG molecular weight 5000, n=114). Examples of compounds represented by the following formula (a19) include the SUNBRIGHT (registered trademark) EA series. Examples of compounds represented by the following formula (a20) include the SUNBRIGHT (registered trademark) PA series.

[0027] <Pentaethylenehexamine> [ka]

[0028] <Spermin> [ka]

[0029] <Triethylenetetramine> [ka]

[0030] <Spermidine> [ka]

[0031] <Diethylenetriamine> [ka]

[0032] <1,3-diaminopropane> [ka]

[0033] <1,4-diaminobutane> [ka]

[0034] <1,5-diaminopentane> [ka]

[0035] <1,6-diaminohexane> [ka]

[0036] <1,8-diaminooctane> [ka]

[0037] <Ethylenediamine>

Chem.

[0038] <Ethylamine>

Chem.

[0039] <Propylamine>

Chem.

[0040] <N,N’-Dimethylethylenediamine>

Chem.

[0041] <N,N-Dimethylethylenediamine> [[ID=()]]

Chem.

[0042] <N-Ethylethylenediamine> 〕

Chem.

[0043] <N-Methylethylenediamine>

Chem.

[0044] <Amino compound containing a PEG structure> 〕

Chem.

[0045] The amino compound preferably has -NH2. Furthermore, the amino compound more preferably has multiple -NH2, or multiple -NH-, or has one or more -NH2 and one or more -N(CH3)-, or has one or more -NH2 and one or more -NH- in one molecule. Furthermore, the amino compound more preferably has one or more -NH2 and two or more -NH-, or has two or more -NH2 and one or more -NH-.

[0046] (reaction buffer) The detection reagent preferably contains a reaction buffer. The detection reagent may contain a reaction buffer separate from the effector protein, crRNA, reporter molecule, and amino compound. Alternatively, in the detection reagent, at least one selected from the group consisting of the effector protein, crRNA, reporter molecule, and amino compound may be dispersed in the reaction buffer.

[0047] Examples of reaction buffers include Tris-based buffers and HEPES-based buffers that have been used in enzymatic reactions using Cas12a or Cas13a. Specific examples include binding buffer (20 mM Tis-HCl (pH 7.6), 100 mM KCl, 5 mM MgCl, 1 mM DTT, 5% glycerol, 50 μg / mL heparin), NEBuffer (registered trademark) 2.1 (10 mM Tris-HCl, 50 mM NaCl, 10 mM MgCl, 100 μg / mL BSA, pH 7.9), and FZ buffer (20 mM HEPES, 60 mM NaCl, 6 mM MgCl, pH 6.8).

[0048] (particle) Preferably, the effector protein is associated with the particle. The type of particle bound to the effector protein is not particularly limited as long as it can bind to the effector protein. The particles may be primary particles or secondary particles formed by aggregation of primary particles.

[0049] The bond between the effector protein and the particle is preferably formed by a reaction utilizing the carboxy group originally possessed by the particle, since this facilitates the binding of the effector protein or a linker (described below). That is, the bond between the effector protein and the particle preferably has a structure derived from the carboxy group bound to the particle.

[0050] The effector protein and the particle may be bound via an amide bond, in which the amide bond is formed between a C═O derived from a carboxy group contained in the particle and an NH derived from an amino group contained in the protein.

[0051] The effector protein and the particle may be bound via a linker, where the linker refers to a structure that forms a bond between the effector protein and the particle. The linker preferably contains a peptide consisting of 6 to 11 consecutive histidine residues. In this case, the linker may further contain an antibody (e.g., an anti-His tag antibody) that binds to the peptide through an antigen-antibody reaction. That is, for example, when an effector protein having the peptide is reacted with a particle having an antibody that binds to the peptide to bind the particle to the effector protein, the linker will contain the peptide and the antibody. Here, the particle and the antibody can be bound, for example, via an amide bond formed by reacting a carboxy group originally present on the particle with an amino group present on the antibody. Furthermore, commercially available effector proteins having the peptide can be used, such as EnGen LbaCas12a (Cpf1) (trade name: M0653T, manufactured by NEB, 100 μM).

[0052] The linker may further have a metal complex that binds to the peptide. That is, the effector protein having the peptide may be reacted with a particle having a metal complex to bind the effector protein to the particle. Examples of the metal complex that binds to the peptide include a complex of nitrilotriacetic acid or iminodiacetic acid with a divalent nickel ion. The above peptide is particularly preferably a peptide consisting of six consecutive histidine residues (hereinafter, sometimes referred to as a His tag).

[0053] Examples of the binding site between the effector protein and the effector protein-side linker include the ε-amino group of a lysine residue in the effector protein, the α-amino group at the N-terminus of the effector protein, and various tag peptide sequences or tag proteins artificially inserted at the N-terminus of the effector protein. Examples of tag peptides include His tag, HA tag, DDDDK tag (FLAG (registered trademark)), etc. Examples of tag proteins include Halo-tag (registered trademark).

[0054] The bonding portion between the particle and the linker may be various depending on the type of linker. For example, when binding to the ε-amino group of a lysine residue in an effector protein or the α-amino group at the N-terminus of the effector protein, examples of structures used for binding to the linker on the particle include a carboxy group and an aldehyde group. Furthermore, for example, when forming an amide bond between an amino group contained in an effector protein and a carboxy group contained in a particle, a condensation reaction using N-hydroxysuccinimide (NHS) / water-soluble carbodiimide (WSC) can be used.

[0055] As another example, when a particle is bound to a His tag artificially inserted at the N-terminus of an effector protein, an anti-His tag antibody can be used as a linker. In this case, the particle's carboxyl group, for example, is used as the particle-side linker, and the anti-His tag antibody is bound to the particle surface by a condensation reaction between the amino group of the anti-His tag antibody and NHS / WSC. This allows the effector protein to be bound to the particle via an antigen-antibody reaction between the His tag at the N-terminus of the effector protein and the anti-His tag antibody.

[0056] In addition to anti-His tag antibodies, metal chelating ligands such as iminodiacetic acid and nitrilotriacetic acid can be attached to the particles as linkers to form coordinate bonds via metal ions such as nickel and cobalt ions, allowing effector proteins to be immobilized on the particles.

[0057] Other examples of linkers include various tag peptide sequences, tag proteins and their affinity moieties, avidin-biotin complexes, PEGs with various functional groups at the terminus, etc. Furthermore, effector proteins can also be bound by physical adsorption between the particle surface and the effector protein.

[0058] The particle-binding site on the effector protein is preferably a site that does not inhibit the activity of the effector protein. For example, effector proteins are known to have an active site on the carboxy-terminus (C-terminus), and a site away from the C-terminus is preferred. For example, the N-terminus is particularly preferred because it is far from the C-terminus and allows for the insertion of various tag peptides or tag proteins.

[0059] In the present invention, an effector protein may be bound to a crRNA to form a complex, and then the effector protein may be bound to a particle to form a composite particle. Alternatively, an effector protein may be bound to a particle, and then crRNA may be bound to the effector protein to form a composite particle.

[0060] Examples of particle materials include polymer resin (styrene resin, acrylic resin, etc.) particles, silica particles, resin particles, agarose carrier resin particles, metal particles, and latex particles. For example, commercially available particles that can be used include Magnosphere® MS300, Magnosphere® MS160, and PureProteome® Nickel Magnetic Beads. Particle materials that contain paramagnetic materials such as iron, nickel, and magnetite, ferromagnetic materials, and supermagnetic materials are preferred, but other materials are also acceptable. The use of magnetic particles makes it easy to control the position of the effector protein by applying a magnetic field.

[0061] The particle size is preferably 10 nm or more, and more preferably 1 μm or more and 10 μm or less.

[0062] When the effector protein is bound to the particle, the target nucleic acid can be recovered using the properties of the particle. That is, the distribution unit of the nucleic acid detection device according to the present invention may have a recovery unit, and the recovery unit recovers the target nucleic acid using composite particles formed by the binding of the particle-bound effector protein and crRNA.

[0063] In the recovery section, after the target nucleic acid is recovered from the sample, it can be dispersed in a medium with a volume smaller than that of the original sample, thereby substantially concentrating the target nucleic acid. For example, by providing a recovery section, even if the target nucleic acid is discarded without being loaded into the individual independent separation compartments, the target nucleic acid can be recovered by applying the composite particles. After recovery, the target nucleic acid can be detected by loading the composite particles that have captured the target nucleic acid into the individual independent separation compartments. Furthermore, for example, trace amounts of target nucleic acid dissolved in a sample such as blood or an aqueous solution can be captured by the composite particles and recovered.

[0064] Furthermore, for example, when a sample containing a target nucleic acid is a large-volume solution, the target nucleic acid can be captured by the composite particles before being enclosed in the minute individual separation compartments, and the composite particles holding the target nucleic acid can be enclosed in the individual separation compartments. This allows the target nucleic acid to be distributed to the individual separation compartments while minimizing loss, enabling highly sensitive detection of the target nucleic acid. Furthermore, if magnetic particles are used as the particles, the target nucleic acid can be easily recovered by utilizing magnetism.

[0065] (Blocking agent) The test reagent may further contain a blocking agent. That is, when binding particles to an effector protein, the portion of the particle's linker binding site to which the effector protein does not bind can be filled with a blocking agent. For example, when the amino group of the effector protein or anti-His tag antibody and the carboxy group of the particle are subjected to a condensation reaction using NHS / WSC, the particle may have unreacted carboxy groups after the reaction. Therefore, the carboxy groups that are not bound to the effector protein can be reacted with a blocking agent such as ethanolamine or PEG having an amino group.

[0066] (Individual independent separated compartments) The nucleic acid detection device of the present invention performs a trans-cleavage reaction using CHRISPR-Cas technology in individual, independent separation compartments. By distributing a sample containing a target nucleic acid into the individual, independent separation compartments, the sample appears concentrated, allowing the target nucleic acid to be detected without an amplification step and shortening the time it takes for the fluorescent signal to saturate. Furthermore, by sufficiently reducing the volume of each individual, independent separation compartment, it is possible to configure each compartment to contain one or fewer target nucleic acid molecules. By counting the number of compartments from which a fluorescent signal is obtained, the concentration of the target nucleic acid in the sample can be calculated.

[0067] The individual, independent separation compartments can be droplets or wells. A water-in-oil emulsion (W / O emulsion) is preferably used as the droplets. The wells can be, for example, wells in a well plate having the configuration shown in Figures 2A and 2B.

[0068] 2A is a cross-sectional view of a well plate 200, and FIG. 2B is a cross-sectional view of the well plate 200 in which wells 204 are filled with composite particles 206, in which a complex of an effector protein and crRNA is bound to the particle. The well plate 200 includes a lower substrate 201, an upper substrate 202, an inlet (not shown), and an outlet (not shown). A hydrophobic partition 203 is formed on the lower substrate 201. The lower substrate 201 has multiple wells 204 separated from each other by the partition 203.

[0069] The lower substrate 201 preferably has a hydrophilic surface, and examples of materials that can be used for the lower substrate 201 include glass, silicon, and polymer resins. The surface of the upper substrate 202 (the surface facing the lower substrate 201) is preferably hydrophobic. Examples of materials that can be used for the partition wall 203 include hydrophobic resins, water-repellent resins, and fluorine-based polymer resins. Because the bottom surface of the well 204 is hydrophilic and the top surface of the partition wall 203 is hydrophobic, the solution can be efficiently filled into the well 204, and the hydrophobic solvent can be prevented from entering the well 204 during the step of removing excess solution with the hydrophobic solvent.

[0070] The wells 204 are recesses that contain a solution and are separated from one another by partitions 203. The bottom surface of each well 204 is the lower substrate 201, and the shape of the area surrounded by the bottom and side surfaces of each well 204 may be, for example, a cylindrical or prismatic shape. In the well plate 200 shown in Figures 2A and 2B, the depth of each well 204 is the same as the height of the partitions 203.

[0071] When well 204 has a cylindrical shape, it is preferable that the diameter of well 204 is 1 μm or more and 11 μm or less, and the depth of well 204 is 0.1 μm or more and 10 μm or less. It is even more preferable that the diameter of well 204 is 1 μm or more and 7 μm or less, and the depth of well 204 is 1 μm or more and 8 μm or less.

[0072] The upper substrate 202 faces the opening of the well 204 and the upper surface of the partition wall 203 across a space 205. This space 205 serves as a flow path for various liquids, allowing them to flow from the inlet to the outlet. That is, after the well 204 is filled with a solution, the space 205 is filled with a hydrophobic solvent. When using composite particles 206 in which a complex of an effector protein and crRNA is bound to the particle, the composite particles 206 are filled in the well 204, and the space 205 is filled with a hydrophobic solvent. Examples of hydrophobic solvents that can be used include fluorinated oils and aliphatic hydrocarbons.

[0073] The volume of each individual independent separation compartment is preferably 0.1 fL or more and 1000 fL or less, and more preferably 0.5 fL or more and 400 fL or less.

[0074] If the volume of the individual independent separation compartment is 0.1 fL or more, droplets or wells having that volume can be formed without difficulty. Also, if the volume of the individual independent separation compartment is 1000 fL or less, the detection time can be sufficiently shortened.

[0075] (Distribution section) When the individual independent separation compartments are droplets, the distribution unit 101 has, for example, an emulsification membrane or a microchannel. When the distribution unit 101 has an emulsification membrane, droplets can be prepared by using, for example, a direct membrane emulsification method using an SPG (Shirasu Porous Glass) membrane from SPG Techno or a pumping method. When using a distribution unit 101 with an emulsification membrane, droplets with a diameter of 0.6 to 12 μm can be prepared, for example, by combining Isopar L (aliphatic hydrocarbon, manufactured by ExxonMobil) and KF-6038 (surfactant, manufactured by Shin-Etsu Chemical Co., Ltd.).

[0076] When the distribution unit 101 has a microchannel, for example, a microchannel manufactured by Dolomite, Inc. can be used as the microchannel. When the distribution unit 101 having a microchannel is used, droplets having a diameter of 2 to 10 μm can be prepared, for example, by the following two combinations. A combination of Isopar L (aliphatic hydrocarbon, manufactured by ExxonMobil) and KF-6038 (surfactant, manufactured by Shin-Etsu Chemical Co., Ltd.) A combination of mineral oil (aliphatic hydrocarbon) and SPAN-80 (surfactant, manufactured by Tokyo Chemical Industry Co., Ltd.)

[0077] When the individual independent separation compartments are wells, the distribution section 101 has an injection section, and the injection section is used to inject a solution into the wells from an injection port section of the well plate via, for example, a nozzle.

[0078] In the distribution unit 101, the sample containing the target nucleic acid and the detection reagent may be mixed in advance before being distributed to the individual independent separation compartments and distributed as a reaction solution, or may be distributed separately and mixed in the individual independent separation compartments. It is preferable to mix the sample containing the target nucleic acid and the detection reagent in advance before being distributed to the individual independent separation compartments, as this makes it easier to obtain a uniformly mixed reaction solution.

[0079] (Activation part) The activation unit 102 adjusts the environment, such as temperature, appropriately depending on the sample, the sequence of the crRNA, and the type of effector protein, thereby binding the crRNA to the target nucleic acid and activating the effector protein. The activation unit 102 can be, for example, an incubator.

[0080] (Fluorescence generation unit) The fluorescence generating unit 103 modifies the reporter molecule with the effector protein and generates fluorescence by adjusting the environment, such as temperature, appropriately according to the sample, the type of effector protein, the type of reporter molecule, etc. An incubator, for example, can be used as the fluorescence generating unit 103. The activation unit 102 and the fluorescence generation unit 103 may be the same component in the nucleic acid detection device.

[0081] (Fluorescence detection unit) The fluorescence detection unit 104 detects the fluorescence generated in the fluorescence generation unit 103. Any device can be used as the fluorescence detection unit 104 as long as it can detect fluorescence in the individual independent separation compartments, and examples of such devices include a plate reader and a fluorescence microscope.

[0082] (Specific part) In the identification unit 105, the extraction unit 106 extracts information on the number and relative positional relationship of multiple individual independent separation compartments from the detection results obtained by the fluorescence detection unit 104. The determination unit 107 determines the fluorescence intensity of each individual independent separation compartment identified by the extraction unit 106 based on the detection results obtained by the fluorescence detection unit 104. The judgment unit 108 judges individual independent separation compartments having fluorescence intensities exceeding a predetermined threshold based on the fluorescence intensities determined by the determination unit 107. In this way, individual independent separation compartments having fluorescence intensities exceeding the predetermined threshold are identified.

[0083] The identification unit 105 is preferably configured to identify individual independent separation compartments having a fluorescence intensity exceeding a predetermined threshold based on the ratio of the fluorescence intensity in the reference compartment to the fluorescence intensity in the individual independent separation compartment. Furthermore, the fluorescence intensity in the reference compartment is preferably a fluorescence intensity obtained using a sample that does not contain the target nucleic acid and a detection reagent. The fluorescence intensity of the reference compartment can be determined in the same manner as the individual independent separation compartment, except that the reference compartment does not contain the target nucleic acid.

[0084] The ratio of the fluorescence intensity in the reference section to the fluorescence intensity in the individual independent separation section is calculated, for example, by using the fluorescence intensity in the reference section as the denominator and the fluorescence intensity of the individual independent separation section as the numerator. If the ratio of the fluorescence intensity in the reference section to the fluorescence intensity of the individual independent separation section is less than a predetermined threshold, the determination unit 108 considers the fluorescence intensity of the individual independent separation section to be equivalent to that of the reference section and determines it to be negative. Furthermore, if the ratio of the fluorescence intensity in the reference section to the fluorescence intensity of the individual independent separation section is equal to or greater than a predetermined threshold, the determination unit 108 determines that the individual independent separation section is positive.

[0085] The calculation unit 109 calculates the concentration of the target nucleic acid in the sample based on the identified number of individual independent separation compartments having a fluorescence intensity exceeding a predetermined threshold. If the concentration of the target nucleic acid in the sample is not to be calculated, the identification unit 105 does not need to be equipped with the calculation unit 109.

[0086] The display unit 110 displays information acquired or extracted by the extraction unit 106, the determination unit 107, the judgment unit 108, and the calculation unit 109. The storage unit 111 stores data acquired or extracted by the extraction unit 106, the determination unit 107, the judgment unit 108, and the calculation unit 109.

[0087] In the nucleic acid detection device according to the present invention, the fluorescence detection unit 104 may be an image acquisition unit. Fig. 3 is a functional block diagram showing a nucleic acid detection device 20 having a configuration similar to that of the nucleic acid detection device 10 described above, but having an image acquisition unit 112 as the fluorescence detection unit 104.

[0088] The image acquisition unit 112 acquires images including individual independent separation compartments and composite particles in which a complex of an effector protein and crRNA is bound to a particle. The images acquired by the image acquisition unit 112 include the fluorescence generated by the fluorescence generation unit 103 as image information. For example, a fluorescence microscope can be used as the image acquisition unit 112.

[0089] In the nucleic acid detection device 20, the extraction unit 106 included in the identification unit 105 preferably extracts information on the number and relative positional relationships of a plurality of individual independent separation compartments based on the image acquired by the image acquisition unit 112. That is, in the nucleic acid detection device 20, the identification unit 105 preferably processes the image acquired by the image acquisition unit 112 to identify individual independent separation compartments having a fluorescence intensity exceeding a predetermined threshold.

[0090] For example, the extraction unit 106 extracts information about the individual, independent, and separated sections using a region extraction method that uses brightness information. In particular, if the individual, independent, and separated sections are droplets, the regions corresponding to the droplets on the image have contours, and the extraction unit 106 may extract the edges of the contours as closed curves. Alternatively, the extraction unit 106 may extract the regions corresponding to the droplets on the image by binarizing the image based on brightness information.

[0091] Furthermore, the determination unit 107 determines the fluorescence intensity of the individual independent separation sections based on the brightness information of each individual independent separation section on the image.

[0092] 4 is a block diagram showing an example of the hardware configuration of a nucleic acid detection device 10 according to the present invention. The nucleic acid detection device 10 includes a distribution device 401, an activation device 402, a fluorescence generation device 403, a fluorescence detection device 404, and an information processing system 405. The information processing system 405 may be, for example, an individual independent separation compartment identification device.

[0093] The distribution device 401, activation device 402, fluorescence generation device 403, and fluorescence detection device 404 are devices for performing the functions of the distribution section 101, activation section 102, fluorescence generation section 103, and fluorescence detection section 104, respectively.

[0094] The information processing system 405 has computer functions. For example, the information processing system 405 may be integrated with a desktop personal computer (PC), laptop PC, tablet PC, smartphone, or the like. The information processing system 405 has a function to identify individual independent separation compartments having a fluorescence intensity exceeding a predetermined threshold. The information processing system 405 may further have a function to control the operations of the dispensing device 401, the activation device 402, the fluorescence generating device 403, and the fluorescence detecting device 404 according to a predetermined program.

[0095] The information processing system 405 includes a CPU (Central Processing Unit) 406, a RAM (Random Access Memory) 407, a ROM (Read Only Memory) 408, and an HDD (Hard Disk Drive) 409 to function as a computer that performs calculations and storage. The information processing system 405 also includes a communication I / F (Interface) 410, a display device 411, and an input device 412. The CPU 406, RAM 407, ROM 408, HDD 409, communication I / F 410, display device 411, and input device 412 are connected to one another via a bus 413. The display device 411 and input device 412 may be connected to the bus 413 via a drive device (not shown) for driving these devices.

[0096] 4, the components constituting the information processing system 405 are illustrated as an integrated device, but some of these functions may be configured by external devices. For example, the display device 411 and the input device 412 may be external devices separate from the components constituting the functions of the computer, including the CPU 406, etc.

[0097] The CPU 406 performs predetermined operations in accordance with programs stored in the RAM 407, HDD 409, etc., and also has the function of controlling each part of the information processing system 405. The RAM 407 is made up of a volatile storage medium and provides a temporary memory area necessary for the operation of the CPU 406. The ROM 408 is made up of a non-volatile storage medium and stores necessary information such as programs used in the operation of the information processing system 405. The HDD 409 is made up of a non-volatile storage medium and is a storage device that stores information regarding the number and positions of individual independent separation compartments, fluorescent light intensity, etc.

[0098] The communication I / F 410 is a communication interface based on standards such as Wi-Fi (registered trademark) and 4G, and is a module for communicating with other devices. The display device 411 is a liquid crystal display, an OLED (Organic Light Emitting Diode) display, or the like, and is used to display moving images, still images, characters, and the like. The input device 412 is a button, a touch panel, a keyboard, a pointing device, or the like, and is used by a user to operate the information processing system 405. The display device 411 and the input device 412 may be integrally formed as a touch panel.

[0099] The hardware configuration shown in FIG. 4 is an example, and other devices may be added, or some devices may not be provided. Also, some devices may be replaced with other devices having similar functions. Furthermore, some functions may be provided by other devices via a network, or the functions constituting this embodiment may be distributed and realized among multiple devices. For example, the HDD 409 may be replaced with an SSD (Solid State Drive) using semiconductor elements such as flash memory, or may be replaced with cloud storage.

[0100] The CPU 406 loads a program stored in the ROM 408 or the like into the RAM 407 and executes it, thereby realizing the functions of the extraction unit 106, the determination unit 107, the judgment unit 108, and the calculation unit 109. The CPU 406 also controls the display device 411 to realize the function of the display unit 110. The CPU 406 also controls the HDD 409 to realize the function of the storage unit 111.

[0101] An example of the hardware configuration of the nucleic acid detection device 20 according to the present invention is the hardware configuration example of the nucleic acid detection device 10 described above, in which an image acquisition device for performing the function of the image acquisition unit 112 is provided as the fluorescence detection device 404. Otherwise, the hardware configuration of the nucleic acid detection device 20 can be the same as that of the nucleic acid detection device 10.

[0102] Next, a nucleic acid detection method according to the present invention, which is executed in the nucleic acid detection device described above, will be described below. Fig. 5 is a flowchart showing the flow of the nucleic acid detection method according to the present invention.

[0103] The nucleic acid detection method of the present invention includes a distribution step S101 of distributing a sample containing a target nucleic acid and a detection reagent containing an effector protein, a crRNA that binds to the target nucleic acid, and a reporter molecule into a plurality of individual, independent separation compartments; an activation step S102 of activating the effector protein by binding of the crRNA to the target nucleic acid; a fluorescence generation step S103 of modifying the reporter molecule with the activated effector protein to generate fluorescence; a fluorescence detection step S104 of detecting the fluorescence; and an identification step S105 of determining the fluorescence intensity of the individual, independent separation compartments and identifying individual, independent separation compartments having a fluorescence intensity exceeding a predetermined threshold. When the effector protein is bound to a particle, the distribution step can include a recovery step of recovering the target nucleic acid using a composite particle formed by binding the particle-bound effector protein and the crRNA.

[0104] Specific examples of the nucleic acid detection method according to the present invention will be described below for the cases where the individual, independent separation compartments are droplets and where the individual, independent separation compartments are wells.

[0105] FIG. 6 is a flowchart showing the flow of the nucleic acid detection method according to the present invention when the individual independent separation compartments are droplets.

[0106] (Process S201) Droplets containing the sample and detection reagent are prepared, preferably water-in-oil emulsions.

[0107] (Step S202) Droplets containing the sample and the detection reagent are placed in a tube and incubated in an incubator at 37° C. However, the reaction temperature can be set arbitrarily and is not limited to 37° C. This incubation allows the CHRISPR-Cas trans-cleavage reaction to proceed, resulting in the emission of fluorescence from the fluorescent substance contained in the reporter molecule.

[0108] (Step S203) After the incubation is completed at a preset reaction time, the droplets are loaded into an observation chamber, preferably a sediment plate.

[0109] (Step S204) A fluorescence microscope is used to acquire fluorescence images of each droplet filled in the observation chamber. Fluorescence images of the droplets are acquired using an imaging device such as a CCD camera attached to the fluorescence microscope. Fluorescence is detected by acquiring the fluorescence images of the droplets.

[0110] (Step S205) Based on the fluorescence detection results, the fluorescence intensity of the droplets is determined, and droplets having a fluorescence intensity above a predetermined threshold are identified.

[0111] Droplets having a fluorescence intensity above a predetermined threshold can be identified based on the ratio of the fluorescence intensity in a reference droplet to the fluorescence intensity in a droplet containing the sample and the detection reagent, where the fluorescence intensity in the reference droplet refers to the fluorescence intensity obtained for a droplet containing the detection reagent but not the target nucleic acid.

[0112] The fluorescence intensity of the droplets is determined by performing predetermined image processing on the fluorescence image of the droplets captured by the imaging device. For example, the fluorescence intensity of the droplets can be determined by using image processing software such as Image J (manufactured by the National Institutes of Health, USA).

[0113] Fig. 8A is a schematic diagram showing a fluorescent image (grayscale image) of a reference droplet, and Fig. 8B is a schematic diagram showing an image in which the fluorescent image shown in Fig. 8A is binarized by predetermined image processing to determine the fluorescent intensity. Fig. 8C is a schematic diagram showing a fluorescent image (grayscale image) of a droplet containing a sample and a detection reagent, and Fig. 8D is a schematic diagram showing an image in which the fluorescent image shown in Fig. 8C is binarized by predetermined image processing to determine the fluorescent intensity. The predetermined image processing has the function of binarizing the fluorescent image based on brightness information.

[0114] Negative droplets 801 are droplets that do not contain target nucleic acid and do not emit fluorescence due to the fluorescent substance contained in the reporter molecule. Positive droplets 802 are droplets that contain target nucleic acid and emit fluorescence due to the fluorescent substance contained in the reporter molecule. The fluorescence intensity of each droplet can be determined by binarizing the fluorescent image (grayscale image) using specified image processing.

[0115] (Step S206) After the trans-cleavage reaction by incubation in step S202, the concentration of the target nucleic acid is calculated from the number of droplets that emit fluorescence. If the sample contains a large number of target nucleic acids, one droplet may contain two or more molecules of target nucleic acid. Therefore, the number of target nucleic acid molecules may not match the number of droplets that emit fluorescence.

[0116] For the above reasons, it is preferable to calculate the concentration of the target nucleic acid using a calculation that takes into account the Poisson distribution. In the Poisson distribution, when the average number of molecules per droplet is λ, the proportion of droplets that emit fluorescence, P(k), can be expressed by the following equation (1): P(k)=(λk / k!)e-λ (k=0, 1, 2,...)...Equation (1)

[0117] From the number of droplets that emit fluorescence, P(k) can be found, and λ can be calculated. Therefore, by using equation (1), the concentration of the target nucleic acid can be calculated from the number of droplets from which fluorescence was detected among all droplets.

[0118] FIG. 7 is a flowchart showing the flow of the method for detecting nucleic acid according to the present invention when the individual independent separation compartments are wells.

[0119] (Step S301) 2A and 2B is used as the well plate. Well plate 200 has an inlet (not shown) and an outlet (not shown) that are open, and a reaction liquid consisting of a sample and a detection reagent is sent from the inlet to space 205.

[0120] (Step S302) The reaction solution is filled into the wells 204. One method for filling the reaction solution is to leave the well plate 200 under reduced pressure and degas the space 205. Specifically, it is preferable to leave the well plate 200 in a vacuum desiccator at 0.1 atmospheres for a predetermined period of time. By degassing, air is removed from the wells 204, allowing the reaction solution to be filled into the wells 204 efficiently. The degassing time is not particularly limited and can be set as desired. The method for filling the reaction solution is not limited to degassing.

[0121] (Step S303) A hydrophobic solvent is pumped into the space 205 to seal it. That is, the reaction liquid present in the space 205 above the well 204 is replaced with the hydrophobic solvent. Examples of hydrophobic solvents that can be used include fluorine-based oils, saturated aliphatic hydrocarbons, unsaturated aliphatic hydrocarbons, aromatic hydrocarbons, and silicone oils. Examples of fluorine-based oils include Fluorinert (manufactured by 3M), Asahiklin AE-3000 (manufactured by AGC), and Fomblin (manufactured by Solvay). Examples of saturated hydrocarbons include Isopar (manufactured by ExxonMobil) and mineral oil.

[0122] (Step S304) The well plate 200 filled with the reaction solution is incubated in an incubator at 37° C. However, the reaction temperature can be set arbitrarily and is not limited to 37° C. This incubation allows the CHRISPR-Cas trans-cleavage reaction to proceed, resulting in the generation of fluorescence from the fluorescent substance contained in the reporter molecule.

[0123] (Step S305) The incubation is completed after a preset reaction time, and a fluorescent image of each well 204 is acquired using a fluorescent microscope.

[0124] (Step S306) The fluorescence intensity of the wells 204 is determined, and wells 204 having a fluorescence intensity above a predetermined threshold are identified. The wells 204 having a fluorescence intensity above a predetermined threshold can be identified based on the ratio of the fluorescence intensity in the reference wells to the fluorescence intensity in the wells 204 containing the sample and the detection reagent. The fluorescence intensity in the reference wells refers to the fluorescence intensity obtained for the wells 204 containing the detection reagent but not the target nucleic acid. Predetermined image processing is used to determine the fluorescence intensity of each well 204. The image processing software can be Image J as described above, and the fluorescence intensity of each well 204 can be determined by the same operation as when the individual independent separation compartments are droplets.

[0125] (Step S307) The concentration of the target nucleic acid can be calculated by the same operation as when the individual independent separation compartments are droplets.

[0126] (Other processes) The method for detecting nucleic acids in this embodiment may include steps other than the steps listed above. An example of the other step is a step of acquiring a reference fluorescent image (hereinafter abbreviated as a reference fluorescent image). For example, if the fluorescence image acquired in S204 or S305 contains fluorescence derived from a substance other than the fluorescent substance for detecting nucleic acids, the concentration of nucleic acids may not be calculated correctly. Fluorescence derived from a substance other than the fluorescent substance for detecting nucleic acids may include, for example, fluorescence emitted from the wells. In this case, the timing for acquiring the reference fluorescence image in the step of acquiring the reference fluorescence image may be any timing before the reporter molecule is cleaved by the presence of nucleic acid and emits fluorescence. For example, the reference fluorescence image may be acquired before the sample or detection reagent is filled into the wells or droplets, before sealing oil is filled to seal the individual, independent separation compartments such as the wells or droplets, or before incubation (heating) in S202 or S304. Furthermore, if the timing for acquiring the reference fluorescence image is after the detection reagent is filled into the wells or droplets but before incubation (heating), the reference fluorescence image may be acquired a predetermined time after the start of filling the wells or droplets with the detection reagent. If the timing for acquiring the reference fluorescence image is before incubation (heating), the heating means may acquire the reference fluorescence image before starting the heating operation upon receiving the drive signal. Furthermore, the timing for acquiring the reference fluorescence image may be determined by using a means for monitoring the state of filling the wells or droplets with the sample or detection reagent. The reference fluorescent image can be used as a reference for calculating the fluorescence intensity based on the presence of nucleic acid in each well or droplet in the fluorescent image obtained in steps S204 or S305. That is, by calculating the degree to which the fluorescence intensity has increased from the fluorescence intensity of the previously acquired reference fluorescent image, the fluorescence intensity derived from components other than the fluorescent substance used to detect nucleic acid in the well or droplet can be excluded. This allows for a more accurate determination of the fluorescence intensity derived from the fluorescent substance used to detect nucleic acid. For example, for the fluorescent image obtained in steps S204 or S305, it is possible to more accurately determine whether the pixel value (fluorescence intensity) of the target well or droplet is equal to or greater than a predetermined threshold or less than the predetermined threshold. This predetermined threshold may be determined prior to determining the number of wells or droplets. For example, this predetermined threshold may be a value fixed in the nucleic acid detection device or a value set by a user. A determination that the value is equal to or greater than the predetermined threshold can be referred to as a positive determination, and a determination that the value is less than the predetermined threshold can be referred to as a negative determination. Furthermore, a reference fluorescence image may be acquired to detect a state in which the sample or detection reagent is not filled due to, for example, a defect in the well or droplet, or an improper filling operation. In this case, for example, a substance (hereinafter referred to as a reference substance) that emits light at a wavelength different from the fluorescent substance used for nucleic acid detection may be filled into the well or droplet, and a fluorescence image may be acquired to obtain the fluorescence distribution. Here, the difference between the center wavelength of the emission wavelength (fluorescence wavelength) of the reference substance and the center wavelength of the emission wavelength (fluorescence wavelength) of the fluorescent substance used for nucleic acid detection is preferably 30 nm or more, more preferably 50 nm or more, and even more preferably 100 nm or more. If no fluorescence is detected after acquiring the reference fluorescence image, the process may be restarted from the beginning, an error message may be displayed, or a decision may be made as to whether to restart or continue the measurement depending on the number of wells or droplets for which no fluorescence is detected. If the number of wells or droplets for which no fluorescence is detected is equal to or less than a predetermined threshold, the fluorescence of those wells or droplets may not be counted. This predetermined threshold may be determined prior to determining the number of wells or droplets. For example, this predetermined threshold may be a value fixed in the nucleic acid detection device or a value set by a user. Furthermore, for example, in a nucleic acid detection device that performs the nucleic acid detection method of this embodiment, the user may be able to appropriately select the operation to be performed when no fluorescence is detected after acquiring the reference fluorescence image. In the nucleic acid detection device that performs the nucleic acid detection method of this embodiment, it may be possible to switch between a mode that includes the step of acquiring the reference fluorescent image and a mode that does not include the step of acquiring the reference fluorescent image. As described above, the step of acquiring a reference fluorescence image has been described in the nucleic acid detection method according to this embodiment, but it can also be applied to the nucleic acid detection device according to this embodiment. In this case, the reference fluorescence image may be acquired using the fluorescence detection unit or image acquisition unit in the nucleic acid detection device according to this embodiment, or the reference fluorescence image may be acquired by other means (for example, a reference fluorescence image acquisition unit).

[0127] A program according to the present invention is a program to be executed by a computer included in a nucleic acid detection device, in order to cause the nucleic acid detection device to execute the above-described nucleic acid detection method. [Example]

[0128] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to the examples shown below.

[0129] Example 1 (Preparation of Reagents) Preparation of Cas12a stock solution (400 nM) Cas12a was used as EnGen LbaCas12a (Cpf1) (product name: M0653T, manufactured by NEB, 100 μM) (hereinafter simply referred to as Cas12a). Cas12a was diluted with nuclease-free water (product name: B1500S, manufactured by NEB) (hereinafter simply referred to as purified water) to prepare a Cas12a stock solution (400 nM).

[0130] Preparation of crRNA stock solution (500 nM) The crRNA used was Lb.Cas12a-crRNA1 (custom-made, SIGMA, 100 μM) (hereinafter simply referred to as crRNA). The crRNA was diluted with purified water to prepare a crRNA stock solution (500 nM). The base sequence of crRNA is shown below (SEQ ID NO: 1). uaauuucuacuaaguguagaugucuggccuuaauccaugcc

[0131] Preparation of DNA solution Synthetic DNA (hereinafter referred to as DNA_113bp) was used as the target nucleic acid. DNA_113bp was diluted with purified water to prepare a DNA stock solution (4 nM), and the concentration was measured and confirmed using a Qubit 2.0 Fluorometer (Life Technologies). The DNA stock solution (4 nM) was diluted with purified water to prepare a DNA solution (0.684 nM) (final concentration: 0.171 nM). The DNA solution (0.684 nM) was further serially diluted 1 / 3 with purified water to prepare DNA solution 1 (0.228 nM), DNA solution 2 (0.076 nM), and DNA solution 3 (0.025 nM).

[0132] The base sequence of DNA_113bp is shown below (SEQ ID NO: 2). ctcacgccttatgactgcccttatgtcaccgcttatgtctcccgatatcacacccgttatctcagccctaatctctgcggtttagtctggccttaatccatgcctcatagcta

[0133] Preparation of reporter molecule solution (12 μM) The reporter molecule used was a reporter molecule contained in a commercially available kit (trade name: DNaseAlert (registered trademark) Substrate Nuclease Detection System 11-02-01-04, manufactured by IDT). This reporter molecule contains HEX, a fluorescent substance, and a quencher. HiLyte® Fluor 488 (AnaSpec), used as a standard fluorescent substance for confirming droplets (described later), was dissolved in purified water to prepare a standard fluorescent substance solution (800 nM). Each reporter molecule-containing tube included in the kit contained 50 pmol of reporter molecule. Using 12 reporter molecule-containing tubes, the reporter molecules from each tube were dissolved in 50 μL of the standard fluorescent substance solution (800 nM). This resulted in a reporter molecule solution (12 μM).

[0134] (Preparation of sample for droplet formation) Samples 1 to 4 were prepared to form droplets as individual, independent, separated compartments. Specifically, 20 μL of Cas12a stock solution (400 nM), 20 μL of crRNA stock solution (500 nM), and 40 μL of DNA solutions 1 to 3 prepared above were mixed. Purified water was used instead of DNA solution for sample 1. The resulting mixture was incubated at 37°C for 30 minutes to induce the formation of Cas12a-crRNA-DNA complexes.

[0135] Next, 20 μL of the reporter molecule solution (12 μM) and 20 μL of 4× binding buffer having the composition shown below were mixed in advance in a 1.5 mL microtube. 4x Binding buffer composition: 80 mM Tris-HCl (pH 7.6), 400 mM KCl, 20 mM MgCl2, 4 mM dithiothreitol (DTT), 20% glycerol, 200 μg / mL heparin To this mixed solution, 40 μL of the solution mixed and reacted above was added to prepare a sample for droplet formation.

[0136] The concentrations of DNA_113bp contained in the droplet formation samples 1 to 4 prepared above are shown below. Sample 1: 0 pM Sample 2: 6.3 pM Sample 3: 19 pM Sample 4: 57 pM

[0137] The concentrations of components other than DNA contained in droplet formation samples 1 to 4 were Cas12a: 50 nM, crRNA: 62.5 nM, reporter molecule: 3 μM, and HiLyte488: 200 nM, respectively.

[0138] (Preparation of droplets) The droplets were prepared by the SPG emulsion membrane pumping method using the droplet formation samples 1 to 4 prepared above. The dispersed phase and continuous phase are shown below. Dispersed phase: 80 μL of sample 1 to 4 for each droplet formation Continuous phase: 2.5 mL of aliphatic hydrocarbon (trade name: Isopar L, manufactured by ExxonMobil Corporation) in which a surfactant (trade name: KF-6038, manufactured by Shin-Etsu Chemical Co., Ltd.) was dissolved at a concentration of 4%. An SPG pumping connector (pore diameter 20 μm, manufactured by SPG Techno Co., Ltd.) was used as the SPG emulsification membrane, and the number of pumping cycles was set to 10. This resulted in droplets with a diameter of approximately 5 μm (volume approximately 65 fL).

[0139] (Fluorescence microscope observation) The droplets prepared above were incubated at 37°C to promote the reaction and fluorescence generation, then loaded onto a sediment plate (product name: MUR-300, manufactured by Matsunami Glass Industry Co., Ltd.) and observed under a fluorescence microscope (product name: ECLIPS TE2000-U, manufactured by Nikon Corporation). The fluorescence from each fluorescent substance was observed under the following conditions, and a fluorescent image was obtained. HEX: ex 533nm, em 559nm, EM gain 250 Standard fluorescent substance (HiLyte® Fluor 488): ex 499 nm, em 523 nm, EM gain 250

[0140] 9A to 9D show fluorescence microscope images of droplets prepared using each sample after 6 hours of reaction. Fig. 9A shows a fluorescence microscope image of Sample 1, Fig. 9B shows a fluorescence microscope image of Sample 2, Fig. 9C shows a fluorescence microscope image of Sample 3, and Fig. 9D shows a fluorescence microscope image of Sample 4.

[0141] Figures 10A to 13B show the time-dependent changes in droplet fluorescence for Samples 1 to 4, respectively. Figures 10A, 11A, 12A, and 13A show fluorescence microscope images containing both HEX fluorescence derived from the reporter molecule and background fluorescence of the reporter molecule. Figures 10B, 11B, 12B, and 13B show fluorescence microscope images containing fluorescence from a standard fluorescent substance, respectively.

[0142] As shown in Figures 10B, 11B, 12B, and 13B, the droplets were confirmed based on the fluorescence of the standard fluorescent substance. Furthermore, as shown in Figures 11A, 11B, 12A, 12B, and 13A, 13B, the droplets in which HEX fluorescence was observed also showed fluorescence of the standard fluorescent substance. This confirmed that the droplets were filled with the sample and detection reagent, and that the Cas12a trans-cleavage reaction was functioning.

[0143] Furthermore, as shown in FIGS. 9A to 13B, it was confirmed that the number of positive droplets increased as the DNA concentration increased. For example, as shown in Figure 51 of Patent Document 1, it was difficult to detect a target nucleic acid at a low concentration of 6.3 pM using CHRISPR-Cas technology without undergoing an amplification step using conventional technology. The results of the above examples demonstrate that the present invention makes it possible to detect a target nucleic acid at a concentration of 6.3 pM without undergoing an amplification step.

[0144] Next, the fluorescence microscope images obtained in the above examples were used to determine the fluorescence intensity of each droplet, and droplets having a fluorescence intensity above a predetermined threshold were identified. The droplets obtained for Sample 1 were used as reference droplets, and droplets with fluorescence intensities exceeding a predetermined threshold were identified based on the ratio of the fluorescence intensity in the reference droplet to the fluorescence intensity in the droplet containing the sample and the detection reagent. Here, the fluorescence intensity in the droplet containing the sample and the detection reagent is the fluorescence intensity of each droplet obtained for Samples 2 to 4.

[0145] Specifically, the fluorescence intensity of each droplet was determined using a specified image processing program (image processing software). The fluorescence intensity of each droplet (negative droplet) obtained for Sample 1 after 6 hours of reaction was 100. The fluorescence intensity of each positive droplet obtained for Samples 2 to 4 after 6 hours of reaction was in the range of 200 to 250. The ratio of the fluorescence intensity of each droplet obtained for Samples 2 to 4 to the fluorescence intensity of the droplet obtained for Sample 1 (the reference droplet) was calculated, and a threshold value of 2 was set. Droplets with this ratio exceeding 2 were identified as positive droplets.

[0146] Furthermore, using the above formula (1), the concentration of the target nucleic acid can be calculated from the total number of droplets and the number of droplets having a fluorescence intensity exceeding a predetermined threshold.

[0147] Example 2 (Preparation of wells) The well 204 shown in FIGS. 2A and 2B was fabricated through a CYTOP coating process, a photolithography process, and an etching and resist removal process. In the CYTOP coating process, a quartz substrate (synthetic quartz substrate AQ grade, thickness 1 mm, manufactured by AGC) was used as the lower substrate 201, which was treated with a silane coupling agent (KBE-903, manufactured by Shin-Etsu Silicones), and then coated with CYTOP (CTL-809A, manufactured by AGC). In the photolithography process, a positive photoresist (AZ P4903, AZ Electronic Materials) was applied. Next, UV light was applied from above through a photomask with the desired pattern, and an alkaline development process was performed. During this development process, the photoresist dissolved only in the areas irradiated with UV light, exposing the hydrophobic resin layer. In the etching and resist removal process, a part of the resin layer was removed by etching with oxygen plasma through the partially dissolved photoresist to form a hydrophobic partition wall. Finally, the photoresist was dissolved in an organic solvent to form the desired wells 204. The wells 204 had a diameter of 5 μm, a depth of 4 μm, a pitch of 10 μm, and the number of wells was approximately 1 million.

[0148] (Preparation of well plates) 2A and 2B was fabricated to include a lower substrate 201 in which the above-described wells 204 were formed, an upper substrate 202, an inlet port (not shown), and an outlet port (not shown). Polycarbonate (thickness: 1 mm) was used as the upper substrate 202, and the upper substrate 202 faced the opening of the wells 204 and the upper surface of the partition wall 203 with a space 205 between them. The distance of the space 205 from the upper surface of the partition wall 203 to the upper substrate 202 was 250 μm.

[0149] (Preparation of reaction solution for wells) A reaction solution was prepared for filling well 204. Specifically, 15 μL of Cas12a stock solution (400 nM), 15 μL of crRNA stock solution (500 nM), and 30 μL of DNA solution 3 (0.025 μM) were mixed. The resulting mixture was reacted at 37°C for 30 minutes to induce the formation of a Cas12a-crRNA-DNA complex. Next, 25 μL of reporter molecule solution (12 μM) containing 800 nM HiLyte488, 10 μL of Tween 20 (5%), 1 μL of BSA (30%), 4 μL of purified water, and 10 μL of 10× binding buffer were mixed in a 1.5 mL microtube. 50 μL of the mixture prepared above was added to this mixture to prepare the reaction solution for the wells. The final DNA concentration was 6.3 pM.

[0150] (Filling reaction solution into wells) The reaction solution was injected from an injection port on the upper substrate 202 and delivered so as to cover the wells 204. Next, the well plate 200 was left under reduced pressure to evacuate the space 205 and fill the wells with the reaction solution. After that, a hydrophobic solvent was delivered into the space 205 to seal it. Fluorine-based oils Asahiklin AE-3000 (manufactured by AGC) and Fomblin Y-25 (manufactured by Solvay) were used as the hydrophobic solvent.

[0151] (Fluorescence microscope observation) The well plate prepared above was incubated at 37°C to promote the generation of fluorescence, and then observed under a fluorescence microscope. The fluorescence from each fluorescent substance was observed under the following conditions, and a fluorescent image was obtained. HEX: ex 533nm, em 559nm, EM gain 210 Standard fluorescent substance (HiLyte® Fluor 488): ex 499 nm, em 523 nm, EM gain 210

[0152] Figures 14A to 14D show fluorescence microscope images of the wells. Figure 14A shows a fluorescence microscope image after 2 hours of reaction, including both HEX fluorescence derived from the reporter molecule and background fluorescence of the reporter molecule. Figure 14B shows a fluorescence microscope image after 2 hours of reaction, including fluorescence from the standard fluorescent substance. Figure 14C shows a fluorescence microscope image after 19 hours of reaction, including both HEX fluorescence derived from the reporter molecule and background fluorescence of the reporter molecule. Figure 14D shows a fluorescence microscope image after 19 hours of reaction, including fluorescence from the standard fluorescent substance.

[0153] As shown in Figures 14B and 14D, the wells could be confirmed based on the fluorescence of the standard fluorescent substance. Furthermore, as shown in Figures 14A to 14D, the fluorescence of the standard fluorescent substance was also observed in wells where HEX fluorescence was observed. This confirmed that the sample and detection reagent were filled into the wells and that the Cas12a trans-cleavage reaction was functioning. Furthermore, as shown in Figure 51 of Patent Document 1, it was difficult to detect a target nucleic acid at a low concentration of 6.3 pM using CHRISPR-Cas technology without an amplification step using conventional technology. The results of the above examples demonstrate that the present invention makes it possible to detect a target nucleic acid at a concentration of 6.3 pM without an amplification step.

[0154] Next, a predetermined image processing (image processing software) was performed on the fluorescence microscope image of the above example after 19 hours of reaction, and the histogram shown in FIG. 15 was obtained. The histogram shown in FIG. 15 shows the number of wells that exhibited a fluorescence intensity contained in each fraction of the fluorescence intensity obtained by dividing the fluorescence intensity into fixed value fractions. In this histogram, three peaks A, B, and C were observed, which corresponded to the ranges where the counts showed maximum values, as shown in Figure 15. Of these, peak A, which had the smallest fluorescence intensity, was due to the background fluorescence of the reporter molecule. Additionally, wells in the peak B section were identified as positive wells B, and wells in the peak C section were identified as positive wells C. Comparing the fluorescence intensity of positive wells B and C, the fluorescence intensity of positive wells C was stronger, suggesting that positive wells B contained one DNA per well, and positive wells C contained two DNAs per well.

[0155] Furthermore, the concentration of the target nucleic acid can be calculated using the above formula (1) from the total number of wells and the number of positive wells identified from the histogram.

[0156] Example 3 (Preparation of reaction solution for wells) A reaction solution was prepared for filling well 204. Specifically, 20 μL of Cas12a stock solution (400 nM), 20 μL of crRNA stock solution (500 nM), and 40 μL of DNA solution 1 (0.228 μM) were mixed. The resulting mixture was reacted at 37°C for 30 minutes to induce the formation of a Cas12a-crRNA-DNA complex. Next, 25 μL of a reporter molecule solution (12 μM) containing 800 nM HiLyte488, 10 μL of Tween 20 (5%), 1 μL of BSA (30%), 4 μL of spermine solution (50 mM), and 10 μL of 10× binding buffer were mixed in a 1.5 mL microtube. 50 μL of the mixture prepared above was added to this mixture to prepare the reaction solution for the wells. The final DNA concentration was 57 pM.

[0157] (Filling reaction solution into wells) The reaction solution was filled into the wells in the same manner as in Example 2.

[0158] (Fluorescence microscope observation) The well plate prepared above was incubated at 37°C to promote the generation of fluorescence, and then observed under a fluorescence microscope. The fluorescence from each fluorescent substance was observed under the following conditions, and a fluorescent image was obtained. HEX: ex 533nm, em 559nm, EM gain 210 Standard fluorescent substance (HiLyte® Fluor 488): ex 499 nm, em 523 nm, EM gain 210

[0159] Figures 16A and 16B show fluorescence microscopy images acquired after 0.5 hours of reaction. Figure 16A shows a fluorescence microscopy image that includes both HEX fluorescence derived from the reporter molecule and background fluorescence of the reporter molecule. Figure 16B shows a fluorescence microscopy image that includes fluorescence from a standard fluorescent substance. As shown in Figure 16B, the wells could be confirmed based on the fluorescence of the standard fluorescent substance. Furthermore, as shown in Figures 16A and 16B, the fluorescence of the standard fluorescent substance was also observed in the wells where HEX fluorescence was observed. This confirmed that the sample and detection reagent were filled into the wells and that the Cas12a trans-cleavage reaction was functioning. Furthermore, in Example 3, which used a reaction solution containing spermine, HEX fluorescence could be observed after 0.5 hours. On the other hand, in Example 2, HEX fluorescence could not be confirmed after 0.5 hours. This confirmed that the inclusion of spermine in the detection reagent promotes the trans-cleavage reaction of Cas12a, enabling a shorter detection time than in Example 2, which used a detection reagent containing no amino compound.

[0160] Example 4 (Preparation of composite particles in which the complex of Cas12a and crRNA is bound to the particle) First, a dispersion of magnetic particles (Magnosphere (registered trademark) MS300 / Carboxyl) was placed in a microtube and the magnetic particles were precipitated with a magnet. After removing the supernatant, the magnetic particle pellet was re-dispersed in MES buffer (100 mM, pH 5.4), and N-hydroxysulfosuccinimide (sulfo-NHS) and water-soluble carbodiimide (WSC) were added. The mixture was then stirred at 25°C for 1 hour, and the magnetic particles were collected with a magnet. The collected magnetic particles were then washed with MES buffer, dispersed in MES buffer, and an arbitrary amount of anti-His tag antibody (Anti-His-tag mAb, MBL Life Sciences) was added, followed by stirring at 25°C for 2 hours. Subsequently, a large excess of ethanolamine was added to deactivate the active groups on the surface of the magnetic particles.The magnetic particles were collected using a magnet and washed with MES buffer to prepare antibody-immobilized particles. A storage buffer (10 mM HEPES-NaOH (pH 7.9), 50 mM KCl, 1 mM EDTA, 10% glycerol) was added to the obtained antibody-immobilized particles to prepare an antibody-immobilized particle solution. The antibody-immobilized particle solution was stored at 4°C until use. Next, the diluted Cas12a and crRNA were mixed at a concentration ratio (molar ratio) of 1:1.25 and incubated at 37°C for 30 minutes to prepare the Cas12a-crRNA complex.

[0161] The antibody-immobilized particle solution (1 wt%) thus prepared was dispensed into a 2 mL sample tube (VIOLAMO, model number: 1-1600-04). After stirring, the sample tube was placed on a magnetic stand (Magical Trapper, TOYOBO, model number: MGS-101) and left to stand for 1 minute, after which the supernatant was removed to remove the solution. PBS containing 0.05% Tween 20 (PBS-T) was added as a particle washing solution, and after stirring, the solution was removed in the same manner as above. The above procedure was repeated twice for washing. After washing, the antibody-immobilized particles were suspended in PBS-T, and the Cas12a-crRNA solution prepared above was added to the desired concentration. After stirring, the mixture was allowed to react for 1 hour on a shaker. Since the Cas12a used here has a His tag at its N-terminus, the His tag on Cas12 binds to the antibody-immobilized particles via an antigen-antibody reaction between the His tag on Cas12 and the anti-His tag antibody on the antibody-immobilized particles. This resulted in the creation of composite particles in which the Cas12a-crRNA complex was bound to the particles. After the reaction, the solution was removed and the mixture was washed with PBS-T. After washing, the mixture was suspended in purified water, stirred, and stored at 4°C until use.

[0162] (Preparation of reaction solution for wells) A reaction solution was prepared to be filled into the well 204. Specifically, first, the composite particles (3.1 × 10 8 7.3 μL of DNA solution 1 (0.228 μM / mL), 22.7 μL of water, and 30 μL of DNA solution 1 (0.228 μM) were mixed together. The resulting mixed solution was reacted at 37° C. for 30 minutes to form a complex between the composite particles and DNA. Next, the following materials were prepared: 25 μL of reporter molecule solution (12 μM) containing 800 nM HiLyte488 Tween 20 (5%): 10 μL BSA (30%): 1 μL Spermine aqueous solution (50 mM): 4 μL 10×Binding buffer: 10 μL These were mixed in advance in a 1.5 mL microtube. 50 μL of the composite particle-DNA complex was added to this mixed solution to prepare a reaction solution for the well. The final concentration of DNA was 57 pM.

[0163] (Filling reaction solution into wells) The reaction solution was filled into the wells in the same manner as in Example 2.

[0164] (Fluorescence microscope observation) The well plate prepared above was incubated at 37°C to promote the generation of fluorescence, and then observed under a fluorescence microscope. The fluorescence from each fluorescent substance was observed under the following conditions, and a fluorescent image was obtained. HEX: ex 533nm, em 559nm, EM gain 210 Standard fluorescent substance (HiLyte® Fluor 488): ex 499 nm, em 523 nm, EM gain 210

[0165] 17A to 17C show bright-field and fluorescence microscope images of the wells acquired after 1 hour of reaction. FIG. 17A shows a bright-field image of the wells. FIG. 17B shows a fluorescence microscope image that includes both HEX fluorescence derived from the reporter molecule and background fluorescence of the reporter molecule. FIG. 17C shows a fluorescence microscope image that includes fluorescence from a standard fluorescent substance. From FIG. 17A, it was confirmed that the wells were filled with particles. 17A to 17C, HEX fluorescence was observed from the wells filled with particles. This confirmed that DNA was captured by Cas12a bound to the particles and that the trans-cleavage reaction of Cas12a was functioning. The DNA concentration of 57 pM in this example is the concentration at which all individual, independent separation compartments are predicted to be positive.

[0166] Example 5 (Immobilization of anti-His tag antibodies to magnetic particles) A magnetic particle (Magnosphere® MS300 / Carboxyl) dispersion was placed in a microtube and the magnetic particles were precipitated with a magnet. After removing the supernatant, the magnetic particle pellet was re-dispersed in MES buffer (100 mM, pH 5.4), and N-hydroxysulfosuccinimide (sulfo-NHS) and water-soluble carbodiimide (WSC) were added. The mixture was stirred at 25°C for 1 hour, and the magnetic particles were collected with a magnet. The recovered magnetic particles were washed with MES buffer, dispersed in MES buffer, and an arbitrary amount of anti-His tag antibody (Anti-His-tag mAb, MBL Life Sciences) was added. The mixture was stirred at 25°C for 2 hours. Two subsequent experiments were performed: with and without blocking. For blocking, a large excess of PEG amine with a molecular weight of 5000 was added relative to the carboxyl groups on the surface of the magnetic particles, and the mixture was stirred at room temperature for 45 minutes. Regardless of whether or not blocking was performed, a large excess of ethanolamine was then added to deactivate the active groups on the particle surface.The magnetic particles were then collected using a magnet and washed with MES buffer to prepare antibody-immobilized particles (with and without blocking). A storage buffer (10 mM HEPES-NaOH (pH 7.9), 50 mM KCl, 1 mM EDTA, 10% glycerol) was added to the antibody-immobilized particles to prepare an antibody-immobilized particle solution, which was stored at 4°C until use.

[0167] (Reaction of Cas12a-crRNA with antibody-immobilized particles) The diluted Cas12a and crRNA were mixed at a concentration ratio (molar ratio) of 1:1.25 and incubated at 37°C for 30 minutes to prepare the Cas12a-crRNA complex. The antibody-immobilized particle solution (1 wt%) thus prepared was dispensed into a 2 mL sample tube (VIOLAMO, model number 1-1600-04). After stirring, the sample tube was placed on a magnetic stand (Magical Trapper, TOYOBO, model number MGS-101) and left to stand for 1 minute, after which the supernatant was removed to remove the solution. PBS-T was added as a particle washing solution, and after stirring, the solution was removed in the same manner as above. The above procedure was repeated twice. The particles were suspended in PBS-T, and the Cas12a-crRNA solution prepared above was added to the desired concentration. After stirring, the mixture was allowed to react for 1 hour on a shaker. After the reaction, the solution was removed and the mixture was washed with PBS-T. After washing, the mixture was suspended in purified water to produce composite particles in which the Cas12a-crRNA complex was bound to the antibody-immobilized particles. After stirring, the mixture was stored at 4°C until use. Of the resulting composite particles, those that underwent blocking were designated composite particles AntBL, and those that did not were designated composite particles Ant.

[0168] (Reaction of Cas12a-crRNA with nickel particles) The diluted Cas12a and crRNA were mixed at a concentration ratio (molar ratio) of 1:1.25 and incubated at 37°C for 30 minutes to prepare the Cas12a-crRNA complex. A commercially available nickel particle solution (PureProteome® Nickel Magnetic Beads, Merck, 3 wt%) was dispensed into a 2 mL sample tube (VIOLAMO, model number: 1-1600-04). After stirring, the sample tube was placed upright on a magnetic stand (Magical Trapper, TOYOBO, model number: MGS-101) and allowed to stand. The supernatant was then removed to remove the solution. PBS-T was added as a particle washing solution, and after stirring, the solution was removed. This procedure was repeated twice. The particles were suspended in PBS-T, and the Cas12a solution prepared above was added to the desired concentration. After stirring, the mixture was reacted for 1 hour on a shaker. After the reaction, the solution was removed and the particles were washed with PBS-T. After washing, the particles were suspended in purified water to produce composite particles in which the Cas12a-crRNA complex was immobilized on nickel particles. After stirring, the mixture was stored at 4°C until use. The resulting composite particles were designated composite particles Ni.

[0169] (Evaluation of the activity of composite particles in wells) Using a 96-well plate (Thermo Fisher Scientific, model number: 137101), the activity of the composite particles prepared above was evaluated in the presence and absence of added amino compounds. Each particle was mixed in water so that the final concentration of Cas12a was 10 nM, and the DNA solution was mixed in water so that the final concentration of DNA was 2 nM, and the mixture was left to stand at 37°C for 30 minutes or more to form a complex with DNA.

[0170] Then, the following materials were prepared: Complex of each particle and DNA (for composite particles AntBL and Ant, the amount required to obtain a final Cas12a concentration of 5 nM; for composite particles Ni, the amount required to obtain a final Cas12a concentration of 3.7 nM) 125nM reporter molecule 8 nM HiLyte 488 as an internal standard dye 2 mM spermine as an amino compound (Nacalai Tesque, Inc., product number: 32111-31) These were added to a reaction buffer in a 96-well plate to adjust the total volume to 80 μL. Note that spermine was not used in the conditions without the addition of an amino compound. Two reaction buffers were used: one using a binding buffer and the other using NEBuffer (registered trademark). Fluorescence intensity was then measured every 2 minutes for 2 hours at 37°C using a fluorescent plate reader (Synergy MX, BioTek). For HiLyte488, excitation wavelength was 485±20 nm, emission wavelength was 528±20 nm. For reporter molecules, excitation wavelength was 535±20 nm, emission wavelength was 595±20 nm. A 10x binding buffer was prepared and added in an amount 1 / 10 of the reaction solution. NEBuffer (registered trademark) 2.1 was used by adding 10× NEBuffer (registered trademark) 2.1 included with EnGen LbaCas12a (Cpf1) (NEB, M0653T) in an amount 1 / 10 the volume of the reaction solution. The obtained fluorescence intensity was evaluated as the ratio of the fluorescence intensity of the reporter molecule to the fluorescence intensity of the internal standard dye (fluorescence intensity of the reporter molecule / fluorescence intensity of the internal standard dye).

[0171] 18A to 18C show the time-dependent changes in the fluorescence intensity ratio (fluorescence intensity of reporter molecule / fluorescence intensity of internal standard dye) when each composite particle was used. Fig. 18A shows the results when composite particle Ant was used, Fig. 18B shows the results when composite particle AntBL was used, and Fig. 18C shows the results when composite particle Ni was used. As shown in FIGS. 18A to 18C, it can be seen that the reaction was promoted by adding spermine, which is an amino compound, regardless of which composite particle or reaction buffer was used.

[0172] Example 6 (Preparation of 500nM crRNA) The crRNA (referred to as crRNA_T790M) included with EnGen LbaCas12a(Cpf1) (NEW ENGLAND BioLabs, M0653T) was diluted with purified water to prepare a 500 nM stock solution. The sequence of crRNA_T790M is shown below (SEQ ID NO: 3). uaauuucuacuaaguguagauaucaugcagcucaugcc

[0173] (Preparation of composite particles immobilizing the Cas12a-crRNA complex) The diluted Cas12a and crRNA were mixed at a concentration ratio (molar ratio) of 1:1.25 and incubated at 37°C for 30 minutes to prepare the Cas12a-crRNA complex. Anti-His tag antibody particles (Anti-His-tag mAb-Magnetic Beads (registered trademark), MBL Life Sciences, 1 wt%) were dispensed into a 2 mL sample tube (VIOLAMO, model number: 1-1600-04). After stirring, the sample tube was placed upright on a magnetic stand (Magical Trapper, TOYOBO, model number: MGS-101) and left to stand for 1 minute, and the supernatant was removed to remove the solution. PBS containing 0.5% Tween 20 was added as a particle washing solution, and after stirring, the solution was removed. The above procedure was repeated twice. The particles were suspended in PBS containing 0.5% Tween 20, and the Cas12a-crRNA complex prepared above was added to the desired concentration. After stirring, the mixture was reacted for 1 hour on a shaker. After the reaction, the solution was removed and the mixture was washed with purified water. After washing, the mixture was suspended in purified water to prepare composite particles. After stirring, the mixture was stored at 4°C until use.

[0174] (DNA preparation) Genomic DNA, 100% EGFR wildtype (50 ng / μL, Riken Genesis, product number: HD709) and 50% EGFR T790M (50 ng / μL, Riken Genesis, product number: HD258), were used as templates in PCR. The product amplified by PCR using 100% wild-type EGFR as a template was designated as contaminant DNA_WT. The product amplified by PCR using 50% EGFR T790M as a template was designated as target DNA_T790M. After purification, the concentrations of both PCR products were measured using a Qubit 2.0 Fluorometer (Life Technologies). The PCR amplification products using 50% EGFR T790M as a template were assumed to have the same mutant allele ratio as 50% EGFR T790M, and subsequent concentrations were calculated based on this assumption. Each PCR product was diluted with purified water to prepare a 4 nM stock solution, and the 4 nM stock solution was further diluted with purified water to prepare DNA solutions of various concentrations.

[0175] The sequences of the primers used in PCR are shown below. EGFR primer (Forward) (SEQ ID NO: 4) tcacctccaccgtgcatttcatca EGFR primer (reverse) (SEQ ID NO: 5) ttgcgatctgcacacaccagttga

[0176] The sequences of the PCR products, contaminant DNA_WT and target DNA_T790M, are shown below. The underlined parts indicate the target sequences of the crRNA. DNA_WT (SEQ ID NO: 6) tcacctccaccgtgcatttcatcacgcagctcatgcccttcggctgcctcctggactatgtccgggaacacaaagacaatattggctcccagtacctgctcaactggtgtgtgcagatcgcaa DNA_T790M (SEQ ID NO: 7) tcacctccaccgtgcatttc atcatgcagctcatgcc cttcggctgcctcctggactatgtccgggaacacaaagacaatattggctcccagtacctgctcaactggtgtgtgcagatcgcaa

[0177] Next, the efficiency of recovering and concentrating DNA was evaluated for the composite particles prepared above. First, the following materials were prepared: The number of Cas12a immobilized was 6.7 × 10 5 Number of particles / composite particle (composite particle A): 2.7 x 10 -11 mol The number of Cas12a immobilized was 1.5 × 10 4 Number of particles / composite particle (composite particle B): 6.0 × 10 -13 mol ·Target DNA_T790M: 1.5×10 -13 mol DNA_WT as contaminating DNA: 1.5×10 -12 mol ·Tween20: Final concentration 0.5% Composite particles A or B, target DNA_T790M, DNA_WT, and Tween 20 were added to a 2 mL tube (Eppendorf) to prepare a total solution volume of 1.1 mL. The resulting mixture was shaken at room temperature for 1 hour. The particles were then collected with a magnet, the supernatant removed, and washed with 1 mL of purified water. The particles were then collected again with a magnet, the supernatant removed, and suspended in 50 μL of purified water to obtain a DNA-collected particle solution. Furthermore, the same procedure was carried out without using DNA_WT to provide a case in which no contaminating DNA was contained.

[0178] Next, the following materials were prepared: 40 μL of DNA recovery particle solution (final concentration of composite particles: 4 × 10 -13 M) Reporter molecule (final concentration: 125 nM) 8 nM HiLyte 488 as an internal standard dye 2mM spermine These were added to binding buffer in a 96-well plate (Thermo Fisher Scientific, model number: 137101) to adjust the total volume to 80 μL. Fluorescence intensity was then measured every 2 minutes for 2 hours at 37°C using a fluorescent plate reader, Synergy MX (BioTek). The measurement wavelengths used for HiLyte488 were an excitation wavelength of 485±20 nm and an emission wavelength of 528±20 nm, and for the reporter molecule, an excitation wavelength of 535±20 nm and an emission wavelength of 595±20 nm.

[0179] As a control for evaluating the DNA recovery efficiency, target DNA_T790M was added without performing the recovery procedure, and the fluorescence intensity was measured in the same manner as above. Specifically, composite particles A or B were added to the same molar concentration as above (final concentration of composite particles: 4 × 10 -13 The final concentration was 1.5 nM, which corresponds to the expected final concentration for 100% recovery of target DNA_T790M. In addition to these, a reporter molecule (final concentration: 125 nM), 8 nM HiLyte488, and 2 mM spermine were added to the binding buffer in a 96-well plate to a total volume of 80 μL. The fluorescence intensity was then measured as described above. The obtained fluorescence intensity was evaluated as the ratio of the fluorescence intensity of the reporter molecule to the fluorescence intensity of the internal standard dye (fluorescence intensity of the reporter molecule / fluorescence intensity of the internal standard dye).

[0180] Figure 19A shows the change over time in the fluorescence intensity ratio when the recovery procedure was performed without and without contaminating DNA, and Figure 19B shows the change over time in the fluorescence intensity ratio when the recovery procedure was performed with and without contaminating DNA. As shown in Figure 19A, it was confirmed that DNA could be recovered and concentrated with high recovery rates regardless of the composite particle used. It was also suggested that the recovery rate tended to increase as the number of composite particles immobilized increased. Furthermore, as shown in Figure 19B, it was confirmed that the composite particles can recover and concentrate DNA even when contaminating DNA coexists, and that the higher the number of composite particles immobilized, the higher the DNA recovery rate. The above examples demonstrate that the inclusion of an amino compound in the detection reagent of the present invention promotes the trans-cleavage reaction of the effector protein, thereby shortening the detection time. Furthermore, it has been demonstrated that even target nucleic acids that are discarded without being loaded into individual independent separation compartments can be recovered by using composite particles in which a complex between an effector protein and crRNA is bound to the particles. The recovered target nucleic acid can be detected by loading the composite particles that have captured the target nucleic acid into individual independent separation compartments.

[0181] Embodiments of the present invention can also be realized by a computer in a system or apparatus (e.g., an application-specific integrated circuit (ASIC)) that reads and executes computer-executable instructions (e.g., one or more programs) recorded on a storage medium to perform one or more functions of the above-described embodiments, and / or by a computer in a system or apparatus that includes one or more circuits that perform one or more functions of the above-described embodiments, and by a method implemented by the computer in the system or apparatus, e.g., by reading and executing the computer-executable instructions from a storage medium to perform one or more functions of the above-described embodiments, and / or by controlling one or more circuits to perform one or more functions of the above-described embodiments. The computer can include one or more processors (e.g., a central processing unit (CPU), a microprocessor unit (MPU)), and can include a separate computer or a network of separate processors to read and execute the computer-executable instructions. The computer-executable instructions may be provided to the computer, for example, from a network or a storage medium. The storage medium may include, for example, one or more of a hard disk, a random access memory (RAM), a read-only memory (ROM), a storage device of a distributed computing system, an optical disk (compact disk (CD), digital versatile disk (DVD), Blu-ray disk (BD), etc.), a flash memory device, a memory card, etc.

[0182] The present invention is not limited to the above-described embodiments, and various modifications and variations can be made without departing from the spirit and scope of the present invention. Therefore, the following claims are appended to apprise the public of the scope of the present invention.

[0183] This application claims priority based on Japanese Patent Application No. 2020-172561 filed on October 13, 2020, and Japanese Patent Application No. 2021-091877 filed on May 31, 2021, the entire contents of which are incorporated herein by reference. [Explanation of symbols]

[0184] 10, 20 Nucleic acid detection device 101 Distribution section 102 Activation part 103 Fluorescence generation unit 104 Fluorescence detection unit 105 Specific part 106 Extraction part 107 Decision Section 108 Judgment section 109 Calculation Unit 110 Display section 111 Storage section 112 Image acquisition unit 200-well plate 201 Lower board 202 Upper board 203 Bulkhead 204 wells 205 Space 206 Complex particles in which the effector protein and crRNA complex are bound to the particles 801 Negative Droplets 802 Positive Droplets

Claims

1. a distribution section that distributes a sample containing a target nucleic acid, an effector protein, a crRNA that binds to the target nucleic acid, a reporter molecule, and an amino compound into a plurality of individual, independent separation compartments; an activation portion that activates the effector protein upon binding of the crRNA to the target nucleic acid; a fluorescence generating unit that modifies the reporter molecule by the activated effector protein to generate fluorescence; a fluorescence detection unit that detects the fluorescence; an identifying unit that determines the fluorescence intensity of the individual independent separation compartments based on the detection result obtained by the fluorescence detection unit, and identifies the individual independent separation compartments having a fluorescence intensity exceeding a predetermined threshold; A nucleic acid detection device comprising:

2. The nucleic acid detection device according to claim 1 , wherein the fluorescence detection unit is an image acquisition unit that acquires an image including the individual independent separation compartments.

3. The nucleic acid detection device according to claim 2 , wherein the identifying unit identifies the individual independent separation compartments having a fluorescence intensity exceeding the predetermined threshold by processing the image acquired by the image acquiring unit.

4. The nucleic acid detection device according to claim 1 , wherein the effector protein is either Cas12 or Cas13.

5. The amino compound is —NH ２ The nucleic acid detection device according to claim 1 , further comprising:

6. The amino compound is —NH ２ 6. The nucleic acid detection device according to claim 5, wherein the nucleic acid detection device has one or more of each of --NH-- and --NH--.

7. 7. The nucleic acid detection device according to claim 6, wherein the amino compound is spermine.

8. The nucleic acid detection device according to claim 1 , wherein the effector protein is bound to a particle.

9. The nucleic acid detection device according to claim 8 , wherein the binding site between the effector protein and the particle has a structure derived from a carboxy group bound to the particle.

10. 10. The nucleic acid detection device according to claim 8, wherein the effector protein is bound to the particle via the N-terminus of the effector protein.

11. The nucleic acid detection device according to claim 8 , wherein the effector protein and the particle are bonded via an amide bond.

12. The nucleic acid detection device according to claim 8 , wherein the effector protein and the particle are bound to each other via a linker.

13. The nucleic acid detection device according to claim 12 , wherein the linker has a peptide consisting of 6 to 11 consecutive histidines.

14. The nucleic acid detection device according to claim 13 , wherein the linker has an antibody that binds to the peptide through an antigen-antibody reaction.

15. The nucleic acid detection device according to claim 13 , wherein the linker has a metal complex that binds to the peptide.

16. 16. The nucleic acid detection device according to claim 15, wherein the metal complex is a complex of nitrilotriacetic acid or iminodiacetic acid with a divalent nickel ion.

17. The nucleic acid detection device according to claim 12 , wherein the linker comprises polyethylene glycol.

18. The nucleic acid detection device according to claim 12 , wherein the linker comprises a complex of biotin and avidin.

19. 19. The nucleic acid detection device according to claim 8, wherein the particle diameter is 1 μm or more and 10 μm or less.

20. The distribution section has a collection section, The nucleic acid detection device according to any one of claims 8 to 19, wherein the recovery unit recovers the target nucleic acid using a composite particle formed by binding the effector protein bound to the particle and the crRNA.

21. The nucleic acid detection device according to any one of claims 1 to 20, wherein the individual independent separation compartments are droplets.

22. The nucleic acid detection device according to any one of claims 1 to 20, wherein the individual independent separation compartments are wells.

23. 23. The nucleic acid detection device according to claim 1, wherein the volume of each of the individual independent separation compartments is 0.1 fL or more and 1000 fL or less.

24. 24. The nucleic acid detection device according to claim 1, wherein the volume of each of the individual independent separation compartments is 0.5 fL or more and 400 fL or less.

25. The nucleic acid detection device according to any one of claims 1 to 24, wherein the identification unit is configured to identify an individual independent separation compartment having a fluorescence intensity exceeding the predetermined threshold based on the ratio between the fluorescence intensity in the reference compartment and the fluorescence intensity in the individual independent separation compartment.

26. The nucleic acid detection device of claim 25, wherein the fluorescence intensity in the reference section is a fluorescence intensity obtained using a sample not containing the target nucleic acid, the effector protein, crRNA that binds to the target nucleic acid, the reporter molecule, and the amino compound.

27. A method for detecting a target nucleic acid comprising the steps of: (a) distributing a sample containing a target nucleic acid, an effector protein, a crRNA that binds to the target nucleic acid, and a reporter molecule into a plurality of individual, independent separation compartments; an activation portion that activates the effector protein upon binding of the crRNA to the target nucleic acid; a fluorescence generating unit that modifies the reporter molecule by the activated effector protein to generate fluorescence; a fluorescence detection unit that detects the fluorescence; an identifying unit that determines the fluorescence intensity of the individual independent separation compartments based on the detection result obtained by the fluorescence detection unit, and identifies the individual independent separation compartments having a fluorescence intensity exceeding a predetermined threshold; and The nucleic acid detection device is characterized in that the effector protein is bound to the particle via a linker, and the linker has a peptide consisting of 6 to 11 consecutive histidines.

28. a partitioning step of partitioning a sample containing a target nucleic acid, an effector protein, a crRNA that binds to the target nucleic acid, a reporter molecule, and an amino compound into a plurality of individual, independently separated compartments; an activation step of activating the effector protein upon binding of the crRNA to the target nucleic acid; a fluorescence generating step in which the reporter molecule is modified by the activated effector protein to generate fluorescence; a fluorescence detection step of detecting the fluorescence; an identifying step of determining the fluorescence intensity of the individual independent separation compartments based on the detection results obtained in the fluorescence detecting step, and identifying the individual independent separation compartments having a fluorescence intensity exceeding a predetermined threshold; A method for detecting nucleic acid, comprising:

29. the effector protein is associated with a particle; The method for detecting nucleic acids described in claim 28, wherein the distribution process includes a recovery process of recovering the target nucleic acid using a composite particle formed by binding the effector protein bound to the particle and the crRNA.

30. 30. A program for causing a computer included in a nucleic acid detection device to execute the nucleic acid detection method according to claim 28 or 29.

Images