Wheat having short anther characteristics, and method for producing the same

By identifying and suppressing the SAN gene function in wheat using genome editing, the wheat is made resistant to Fusarium fungi and less prone to cross-pollination, addressing the susceptibility of existing wheat varieties.

JP7847878B2Active Publication Date: 2026-04-20NAT AGRI & FOOD RES ORG
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
NAT AGRI & FOOD RES ORG
Filing Date
2023-01-30
Publication Date
2026-04-20

AI Technical Summary

Technical Problem

Existing wheat varieties are susceptible to infection by Fusarium fungi due to the extraction of anthers during flowering, leading to health risks and difficulty in breeding resistant varieties, as the causative gene for the short anther trait has not been identified in cereals.

Method used

Identification of the causative gene for the short anther trait in rice (SAN gene) and its homologous genes in wheat and barley through map-based cloning and genome editing, using CRISPR/Cas9 to suppress the function of these genes, resulting in wheat with short anthers that are difficult to extract.

Benefits of technology

Wheat with short anthers exhibits resistance to Fusarium fungi infection and reduced cross-pollination, enhancing disease resistance and breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007847878000004
    Figure 0007847878000004
  • Figure 0007847878000005
    Figure 0007847878000005
  • Figure 0007847878000006
    Figure 0007847878000006
Patent Text Reader

Abstract

Provided is a method for producing wheat or the like having a short anther trait, the method comprising a step for artificially inhibiting the function of at least one gene of wheat or the like, the gene being selected from the group consisting of: (a) a gene encoding a protein comprising the amino acid sequence represented by SEQ ID NO: 10, 12, 14, or 16; (b) a gene encoding a protein comprising the amino acid sequence represented by SEQ ID NO: 10, 12, 14, or 16, with one or more amino acids substituted, deleted, added, and / or inserted; (c) a gene encoding an amino acid sequence that is at least 80% homologous to the amino acid sequence represented by SEQ ID NO: 10, 12, 14, or 16; and (d) a gene including DNA which hybridizes, under a stringent condition, with DNA comprising a nucleotide sequence encoding the amino acid sequence represented by SEQ ID NO: 10, 12, 14, or 16.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to wheat having a short anther trait and a method for producing the same.

Background Art

[0002] Wheats originating from arid regions are difficult to produce stably in rainy Japan. In particular, mold toxins caused by Fusarium fungi and the like can cause food poisoning and immunosuppression, and may damage the health of humans and livestock. Control with fungicidal pesticides and reduction by resistant varieties have been attempted, but sufficient results have not yet been obtained, and the development of effective resistant varieties is demanded.

[0003] Regarding such resistant varieties, since Fusarium fungi and the like adhere to the anthers extracted at the time of flowering and become infection sources, wheat having cleistogamy shows resistance to initial infection by such fungi.

[0004] In common wheat, the wheat intermediate female parent Nong 9, which has introduced cleistogamy derived from the cleistogamy genetic resource U24, has been developed (Non-Patent Document 1). This line is difficult to open the glumes during the fertilization period and does not extract anthers, so it shows resistance to infection by Fusarium fungi and the like. On the other hand, since it has long culms and poor lodging resistance, care is required in selection of mating progeny. Furthermore, since common wheat is hexaploid, it does not have simple inheritance like diploid rice and barley. Therefore, even if useful genetic resources for imparting resistance to infection by Fusarium fungi and the like are found, efficient breeding is difficult, and the application of mutants identified by genome editing technology, TILLING, etc. is expected.

[0005] In barley, although cleistogamous varieties are widespread, in these varieties, the anther husks are also extracted from the tips of the florets, so the sensitivity becomes high at the beginning of anther husk extraction, and pesticide spraying is required (Non-Patent Document 2).

[0006] Thus, in cereals, the trait of difficulty in extracting the anther from the glume is useful from the perspective of resistance to infection by Fusarium species and other fungi. Furthermore, as mentioned above, the causative gene is useful in the creation of mutants using genome editing technology and tilling. However, such a causative gene has not been identified in cereals.

[0007] Furthermore, regarding the trait of anthers being difficult to extract from the glume, a rice mutant called san-1 (short anther) is known, in addition to cereals. san-1 is a mutant induced by a chemical mutagen from the original variety Taichung 65 (T65), and exhibits short anthers, with anther length reduced by approximately 30% compared to the wild type (Non-Patent Literature 3). Due to the shortness of the anthers, it also exhibits the trait of being difficult to extract from the glume. However, the causative gene involved in the phenotype of this mutant has not been identified. Therefore, it has been difficult to create lines with this short anther trait in rice varieties other than T65, and even in plant species other than rice. [Prior art documents] [Non-patent literature]

[0008] [Non-Patent Document 1] Kenji Kubo et al., "Development of 'Wheat Intermediate Parent Line No. 9' (Red Mold Line No. 3) with cleistogamous flowers and excellent resistance to Fusarium head blight," Kyushu Okinawa Agricultural Research Center Report, February 2012, No. 57, pp. 21-34. [Non-Patent Document 2] Yoshida et al., Phytopathology, 2007, Vol. 97, pp. 1054-1062. [Non-Patent Document 3] Research Results Report for the 2016 Grant-in-Aid for Scientific Research, Principal Investigator: Hitoshi Yoshida, Research Project Title: Elucidation of the Control Mechanism for Rice Flower Organ Size, Publication Date: March 22, 2018 [Overview of the Initiative] [Problems that the invention aims to solve]

[0009] This invention has been made in view of the problems of the prior art described above, and aims to identify the causative gene involved in the short anther trait in san-1, and further identify the homologous gene of said causative gene in wheat. The objective is to provide a method for producing wheat having the short anther trait by targeting said gene. [Means for solving the problem]

[0010] To achieve the above objective, the inventors first crossed a rice mutant san-1 possessing the short anther trait with the rice variety Casalas and performed map-based cloning using the F2 population. As a result, the causative gene was predicted to be located between markers RM18639 and RM6841 on chromosome 5. Further narrowing down the candidate region, it was predicted that the candidate region was located between markers IRIC11 and RM18719. Twenty genes were found within this candidate region in the RAP-DB database. Next, by comparing the gene sequences, it was found that in san-1, the 236th guanine from the translation start site of the gene Os05g0421300 was replaced with adenine, resulting in the formation of an immature stop codon.

[0011] Therefore, guide RNAs were designed at two different locations in the first exon of the candidate gene (the gene encoding the amino acid sequence described in SEQ ID NO: 2), and frameshift mutations were induced using genome editing with the CRISPR / Cas9 method. As a result, both guide RNAs exhibited the same short anther characteristic as san-1, thus revealing that this gene is the causative gene (SAN gene) involved in the short anther trait in san-1.

[0012] Next, we obtained the nucleotide sequences of SAN homologous genes in barley and wheat from publicly available genome information and named them HvSAN and TaSAN-A / B / D (genes in subgenomes A, B, and D), respectively.

[0013] Then, gRNAs were designed for the N-terminal position (target 1) and the C-terminal position (target 2) of HvSAN, respectively, and genome-edited barley individuals were created. In addition, four gRNAs (targets 3, 4, 5, and 6) consisting of sequences conserved among TaSAN-A / B / D were designed for the N-terminal position of TaSAN-A / B / D, and genome-edited wheat individuals were created. As a result, genome-edited individuals using any of the target sequences exhibited short anther characteristics, demonstrating that the short anther trait can be conferred to cereals by suppressing the function of SAN homologous genes, thus completing the present invention. Therefore, the present invention provides the following. <1> A method for producing wheat having short anther characteristics, A method comprising the step of artificially suppressing the function of at least one gene in wheat selected from the group consisting of (a) to (d) below. (a) A gene encoding a protein consisting of the amino acid sequence described in SEQ ID NO: 10, 12, 14, or 16. (b) Genes encoding proteins consisting of amino acid sequences in which one or more amino acids are substituted, deleted, added, and / or inserted in the amino acid sequences described in SEQ ID NO: 10, 12, 14, or 16. (c) A gene encoding an amino acid sequence having 80% or more homology to the amino acid sequence described in SEQ ID NO: 10, 12, 14, or 16. (d) A gene containing DNA that hybridizes under stringent conditions with DNA consisting of a nucleotide sequence encoding the amino acid sequence described in SEQ ID NO: 10, 12, 14, or 16. <2> Wheat with a short anther trait, in which the function of at least one gene selected from the group consisting of (a) to (d) below is artificially suppressed. (a) A gene encoding a protein consisting of the amino acid sequence described in SEQ ID NO: 10, 12, 14, or 16. (b) Genes encoding proteins consisting of amino acid sequences in which one or more amino acids are substituted, deleted, added, and / or inserted in the amino acid sequences described in SEQ ID NO: 10, 12, 14, or 16. (c) A gene encoding an amino acid sequence having 80% or more homology to the amino acid sequence described in SEQ ID NO: 10, 12, 14, or 16. (d) A gene containing DNA that hybridizes under stringent conditions with DNA consisting of a nucleotide sequence encoding the amino acid sequence described in SEQ ID NO: 10, 12, 14, or 16. [Effects of the Invention]

[0014] According to the present invention, it is possible to produce wheat having short anthers. Because of its short anthers, the anthers are difficult to extract from the glumes, making it useful in preventing diseases caused by infection with Fusarium fungi (such as Fusarium head blight). Furthermore, since the anthers are difficult to extract from the glumes and pollen is also less likely to be dispersed, it is possible to suppress cross-pollination with other wheat varieties. [Brief explanation of the drawing]

[0015] [Figure 1] This figure shows that the rice mutant san-1 possesses the short anther trait. In the figure, (A) is a photograph showing the results of observing the glumes with the outer glume removed for the wild type (T65) and san-1. (B) is a graph showing that the anther length of san-1 is shortened by about 30% compared to the wild type. (C) is a graph showing that there is no significant difference in glume length between the wild type and san-1. [Figure 2] This is a schematic diagram showing the mapping history of the causative gene in san-1. Arrows indicate the gene regions predicted by the RAP-DB database between the candidate markers IRIC11 and RM18719, which are the causative gene regions. Of these 20 genes, gene Os05g0421300 was identified as the causative gene for san-1. [Figure 3] This diagram shows an overview of the base substitutions observed in the san-1 causative gene. In the gene Os05g0421300, the 236th guanine (G) from the translation start site was substituted with adenine (A), causing the codon that originally encoded tryptophan (W) to change into an immature stop codon. [Figure 4] It is a schematic diagram showing the structure of the rice SAN gene. The rice SAN gene encodes 601 amino acids with an ARM (Armadillo repeat) domain on the N-terminal side and a TPR (tetratricopeptide repeat) domain on the C-terminal side. [Figure 5] It is a diagram showing the schematic of a rice genome editing vector. [Figure 6] It is a schematic diagram showing the base insertion site in the rice san-CR1 genome editor. A thymine was inserted between the 392nd and 393rd bases counted from the translation start point of the rice SAN gene, resulting in a frameshift. [Figure 7] It is a schematic diagram showing the base insertion site in the rice san-CR2 genome editor. A thymine was inserted between the 153rd and 154th bases counted from the translation start point of the rice SAN gene, resulting in a frameshift. [Figure 8] It is a photograph showing the results of observing the short anther phenotype in the rice SAN genome editors. The same short anther phenotype as that of san-1 was observed in both the san-CR1 and san-CR2 genome editors. [Figure 9] It is a schematic diagram showing the structure of the barley SAN homologous gene (HvSAN gene) and the target site for genome editing. Guide RNA target 1 was designed upstream of the gene and guide RNA target 2 was designed downstream of the gene for genome editing. [Figure 10] It is a diagram showing the schematic of the barley guide RNA (target 1) expression vector. [Figure 11] It is a diagram showing the schematic of the barley guide RNA (target 2) expression vector. [Figure 12] It is a diagram showing the schematic of the SpCas9 expression vector. [Figure 13] It is a schematic diagram showing the structure of the HvSAN gene. [Figure 14] It is a gene phylogenetic tree showing the phylogenetic relationships among the rice SAN gene, the SAN homologous genes of barley and wheat, etc. [Figure 15]This is a schematic diagram showing the base insertion sites in barley HvSAN genome edited organisms. [Figure 16] These are photographs and graphs showing the results of anther shortening analysis in HvSAN target1 #11 T1 homozygotes. In the figures, "Δ5" indicates a homozygous individual with a 5-base deletion, and "1sΔ3" indicates a homozygous individual with a 1-base substitution and a 3-base deletion. [Figure 17] This photograph shows the results of anther shortening analysis in HvSAN target1 #11 T1 heterozygotes (heterozygous individuals). In the figure, "Δ5 / 1SΔ3" indicates a heterozygous individual with a 5-base deletion and a 3-base deletion with a 1-base substitution. [Figure 18] These are photographs and graphs showing the results of anther shortening analysis in HvSAN target2 #01 T1 homozygous individuals. In the figures, "+G" indicates individuals homozygous for a single guanine insertion, and "ΔTG" indicates individuals homozygous for a double thymine and guanine deletion. [Figure 19] This is a schematic diagram showing the structure of the wheat SAN homologous gene (TaSAN gene) and the target sites for genome editing. Four targets, 3, 4, 5, and 6, were designed within the gene, and genome editing was performed. [Figure 20] This figure shows a schematic diagram of a vector for expressing wheat guide RNA (targets 3, 4, 5, 6) and Cas9. [Figure 21] This is a schematic diagram showing the mutations introduced in the wheat genome editer (TaSAN#3). [Figure 22] This is a schematic diagram showing the mutations introduced in the wheat genome edited organism (TaSAN#34). [Figure 23] This is a schematic diagram showing the mutations introduced in the wheat genome edited organism (TTaSAN#46). [Figure 24] This photograph shows the results of an analysis of anther shortening in the T0 generation of TaSAN#3. [Figure 25] These are photographs and graphs showing the results of an analysis of anther shortening in the T0 generation of TaSAN #34 and #46. [Modes for carrying out the invention]

[0016] As shown in the examples described below, the inventors identified the causative gene (SAN gene) involved in the phenotype of san-1 (short anther), a rice line possessing the short anther trait, by map-based cloning and genome editing. Furthermore, they identified homologous genes of the SAN gene in cereals and succeeded in conferring the short anther trait to wild-type barley and wheat by suppressing the function of the said gene using genome editing. Therefore, the method for producing wheat with the short anther trait of the present invention is characterized by including a step of artificially suppressing the function of the said gene (short anther gene), and more specifically provides the following.

[0017] A method for producing wheat having short anther characteristics, A method comprising the step of artificially suppressing the function of at least one gene in wheat selected from the group consisting of (a) to (d) below. (a) A gene encoding a protein consisting of the amino acid sequence described in SEQ ID NO: 10, 12, 14, or 16. (b) Genes encoding proteins consisting of amino acid sequences in which one or more amino acids are substituted, deleted, added, and / or inserted in the amino acid sequences described in SEQ ID NO: 10, 12, 14, or 16. (c) A gene encoding an amino acid sequence having 80% or more homology to the amino acid sequence described in SEQ ID NO: 10, 12, 14, or 16. (d) A gene containing DNA that hybridizes under stringent conditions with DNA consisting of a nucleotide sequence encoding the amino acid sequence described in SEQ ID NO: 10, 12, 14, or 16.

[0018] In the present invention, the "short anther trait" refers to a trait in which the length of the anther of the stamen is shortened. Here, "anther length" refers to the length of the longitudinal axis of the anther, which is approximately elliptical in shape. Furthermore, "shortening" means, for example, that the length becomes 10% or more (preferably 20% or more, more preferably 30% or more) compared to before artificially suppressing the function of the short anther gene according to the present invention (for example, wild-type wheat).

[0019] In the present invention, "wheat" to which the short anther trait is to be conferred refers to plants of the cereal family belonging to the subfamily Pleuroideae of the grass family, such as wheat, barley, rye, rye wheat, and oats. It may also be a wild species or a cultivated species. Furthermore, it may be a genetically modified or genome-edited version of these wheats (for example, disease-resistant crops, herbicide-resistant crops, insect-resistant crops, crops with improved taste, crops with improved storage, or crops with improved yield). Thus, in the present invention, there are no particular restrictions on the wheat to which the short anther trait is to be conferred, but from the viewpoint of producing wheat with higher resistance to Fusarium fungi, etc., wheat with cleistogamous properties is preferred. More specifically, such wheats include barley having a cleistogamous AP2 gene (cly1.b type or cly1.c type gene) that shows resistance to cleavage by miR172, a type of microRNA, and wheats that tend to cleistogamous, such as U24, U56, IL416, or Corringin. Furthermore, from the same viewpoint, the present invention may confer the short anther trait not only to wheat that has resistance to initial infection by Fusarium fungi, such as the aforementioned cleistogamous flowering, but also to wheat that has resistance to the progression of infection after infection, or wheat that has resistance to mycotoxin accumulation.

[0020] Examples of genes encoding typical amino acid sequences that are targeted for functional suppression in this invention are shown in Table 1 below.

[0021] [Table 1]

[0022] It should be noted that mutations in nucleotide sequences can occur in nature. Consequently, the encoded amino acids can also change. Therefore, the short-anther genes of the present invention also include genes encoding proteins consisting of amino acid sequences in which one or more amino acids are substituted, deleted, added, and / or inserted in the amino acid sequences described in SEQ ID NOs: 10, 12, 14, or 16, as long as their function is suppressed to confer the short-anther trait.

[0023] Here, "multiple" usually refers to 120 amino acids or less, preferably 90 amino acids or less, more preferably 60 amino acids or less, even more preferably 55 amino acids or less, even more preferably 50 amino acids or less, even more preferably 45 amino acids or less, even more preferably 40 amino acids or less, even more preferably 35 amino acids or less, even more preferably 30 amino acids or less (for example, 25 amino acids or less, 20 amino acids or less, 15 amino acids or less), and particularly preferably 10 amino acids or less (for example, 9 amino acids or less, 8 amino acids or less, 7 amino acids or less, 6 amino acids or less, 5 amino acids or less, 4 amino acids or less, 3 amino acids or less, 2 amino acids).

[0024] Furthermore, with the current level of technology, a person skilled in the art can, once a specific gene is obtained, use its nucleotide sequence information to identify its homologous gene from the same species or other plants. Methods for identifying homologous genes include, for example, hybridization techniques (Southern, EM, J. Mol. Biol., 98:503, 1975) and polymerase chain reaction (PCR) techniques (Saiki, RK, et al. Science, 230:1350-1354, 1985; Saiki, RK et al. Science, 239:487-491, 1988). To identify homologous genes, hybridization reactions are usually performed under stringent conditions. Examples of stringent hybridization conditions include 6M urea, 0.4% SDS, 0.5x SSC, or hybridization conditions with equivalent stringency. Using conditions with higher stringency, such as 6M urea, 0.4% SDS, and 0.1x SSC, it is possible to isolate genes with higher homology. The short anther genes of the present invention include genes that, insofar as their function can confer the short anther trait, contain DNA that hybridizes under stringent conditions with DNA consisting of a nucleotide sequence encoding the amino acid sequence described in SEQ ID NOs: 10, 12, 14, or 16 (for example, the nucleotide sequence described in SEQ ID NOs: 9, 11, 13, or 15).

[0025] The proteins encoded by the identified homologous genes typically have high homology (high similarity), preferably high identity, with those encoded by the specific genes. Here, "high" means at least 80%, preferably 85%, more preferably 90%, and even more preferably 95% (for example, 96%, 97%, 98%, or 99%). The short anther genes of the present invention include genes that encode amino acid sequences having 80% or more homology (similarity) or 80% or more identity with the amino acid sequences described in Sequence ID No. 10, 12, 14, or 16, insofar as their function can confer the short anther trait.

[0026] Sequence homology can be determined using the BLAST program (Altschul et al. J.Mol.Biol., 215:403-410, 1990). This program is based on the BLAST algorithm by Karlin and Altschul (Proc.Natl.Acad.Sci.USA, 87:2264-2268, 1990, Proc.Natl.Acad.Sci.USA, 90:5873-5877, 1993). For example, when analyzing amino acid sequences using BLAST, the parameters should be, for example, score=50 and wordlength=3. When analyzing amino acid sequences using the Gapped BLAST program, it can be done as described by Altschul et al. (Nucleic Acids Res. 25:3389-3402, 1997). When using the BLAST and Gapped BLAST programs, use the default parameters of each program. The specific methods for these analyses are publicly known.

[0027] The "artificial suppression of short anther gene function" of the present invention includes both complete suppression (inhibition) and partial suppression of said function. In addition to artificial suppression of short anther gene expression, it also includes artificial suppression of the activity of the protein encoded by the short anther gene. Such artificial suppression can be achieved, for example, by introducing mutations into the coding region, non-coding region, transcriptional regulatory region (promoter region), etc., of the short anther gene.

[0028] In the present invention, there are no particular restrictions on the mutations introduced into the short anther gene, as long as they suppress the function of the gene. Examples include nucleotide substitutions, deletions, additions, and / or insertions, but frameshift mutations, nonsense mutations, null mutations, in-frame mutations, inversions, and translocations are preferred. Furthermore, in the present invention, the mutations introduced into the short anther gene may also be mutations in epigenetic regulation that do not involve such nucleotide mutations. Examples of epigenetic regulation include DNA methylation and histone chemical modifications (acetylation, methylation, phosphorylation, ubiquitination, etc.). There are also no particular restrictions on the number of mutations introduced into the short anther gene, as long as they suppress the function of the gene. It may be one mutation or multiple mutations (for example, two, three or fewer, five or fewer, ten or fewer, twenty or fewer, thirty or fewer, forty or fewer, fifty or fewer).

[0029] Examples of such mutations include nucleotide mutations involving changes or deletions of amino acids from position 130 or 131 onwards (approximately 78% of the total) in the amino acid sequence described in SEQ ID NO: 16, and nucleotide mutations involving changes or deletions of amino acids from position 555 or 556 onwards (approximately 9% of the total) in the amino acid sequence described in SEQ ID NO: 16. Such deletions suppress the function of the short anther gene of the present invention, making it possible to obtain wheat with the short anther trait.

[0030] Therefore, the mutation introduced into a short anther gene does not need to result in the loss of the entire amino acid sequence of the protein encoded by that gene; it may be introduced into the gene in such a way that only a part of the sequence is lost or altered.

[0031] In addition, when a portion of the expressed protein is deleted due to a gene mutation, it is usually sufficient for 5% or more of the total amino acids (for example, 6% or more, 7% or more, 8% or more, or 9% or more) to be changed or deleted, preferably 10% or more, more preferably 20% or more, even more preferably 25% or more, more preferably 30% or more, even more preferably 35% or more, more preferably 40% or more, even more preferably 45% or more, more preferably 50% or more, even more preferably 55% or more, more preferably 60% or more, even more preferably 65% ​​or more, more preferably 70% or more, even more preferably 75% or more, more preferably 80% or more, even more preferably 85% or more, even more preferably 90% or more, and even more preferably 95% or more (for example, 96% or more, 97% or more, 98% or more, or 99% or more) to be changed or deleted.

[0032] There are no particular limitations on the regions in which the amino acid sequence is altered or deleted, but for example, as shown in the examples described later, the C-terminal region can be cited. In addition, regions in the amino acid sequence encoded by the short anserine gene of the present invention that are suggested to be important for exerting their function (protein-protein interactions, etc.) (ARM (armadillo repeat) domain and / or TPR (tetratricopeptide repeat)) can also be cited as examples of regions in which the amino acid sequence is altered or deleted.

[0033] Furthermore, in the present invention, as shown in the examples described later, it is possible to control the degree of anther shortening by adjusting the site of mutation introduction, the type of mutation introduced, or the region in the amino acid sequence that is changed or deleted as a result in the short anther gene. For example, introducing a mutation upstream of the short anther gene (the region corresponding to positions 1 to 400 in the coding amino acid sequence) results in strong anther shortening, while introducing a mutation downstream (the region corresponding to position 401 and beyond in the coding amino acid sequence) results in weak anther shortening. It is also possible to induce weak anther shortening by weakening the activity of the coding protein through in-frame mutations, etc.

[0034] The introduction of mutations into short anserine genes can be achieved by mutation introduction methods known to those skilled in the art. Such known methods include, but are not limited to, genome editing, physical mutation introduction, methods using chemical mutagens, methods introducing transposons into genomic DNA, and methods targeting transcripts using siRNA, antisense RNA, and RNA with ribozyme activity.

[0035] Among these methods, genome editing, methods targeting transcripts, and the tilling method described later are preferred from the perspective of being able to artificially introduce mutations by targeting short anther genes.

[0036] Genome editing is a method of modifying target genes using site-specific nucleases (e.g., zinc finger nucleases (ZFNs), transcription-activating effector nucleases (TALENs), and DNA double-strand cleavage enzymes such as CRISPR-Cas enzymes). For example, fusion proteins such as ZFNs (US Patents 6,265196, 8,524500, 7,888121, European Patent 1,720995), TALENs (US Patents 8,470973, 8,586363), PPR (pentatricopeptide repeat) with a fused nuclease domain (Nakamura et al., Plant Cell Physiol 53:1171-1179 (2012)), CRISPR-Cas9 (US Patent 8,697359, International Publication 2013 / 176772), CRISPR-Cpf1 (Zetsche B. et al., Cell, 163(3):759-71, (2015)), and Target-AID (K. Nishida et al., Targeted nucleotide editing using hybrid prokaryotic and Examples include methods using guide RNA-protein complexes, such as those described in "vertebrate adaptive immune systems" (Science, DOI:10.1126 / science.aaf8729, (2016)), or protein complexes.

[0037] There are no particular restrictions on the "Cas enzyme," and it can be appropriately selected depending on the purpose. Examples include type I CRISPR enzymes, type II CRISPR enzymes, type III CRISPR enzymes, etc., but type II CRISPR enzyme Cas9 is preferred. There are no particular restrictions on the "Cas9," and it can be appropriately selected depending on the purpose. Examples include Cas9 from Streptococcus pneumoniae, Cas9 from Streptococcus pyogenes, Cas9 from S. thermophilus, Cas9 from Staphylococcus aureus, etc., but Cas9 from Streptococcus pyogenes (SpCas9) is preferred. Furthermore, the Cas9 mutant derived from these organisms may also be a Cas9 D10A mutant known to function as a nickase (a DNA-cutting enzyme that inserts a nick into only one DNA strand), or it may be a Cas9 homolog or orthologue.

[0038] Examples of physical mutagenesis methods include heavy ion beam (HIB) irradiation, fast neutron irradiation, gamma ray irradiation, and ultraviolet irradiation (see Hayashi et al., Cyclotrons and Their Applications, 2007, 18th International Conference, pp. 237-239, and Kazama et al., Plant Biotechnology, 2008, Vol. 25, pp. 113-117).

[0039] Methods using chemical mutagens include, for example, treating seeds with chemical mutagens (see Zwar and Chandler, Planta, 1995, Vol. 197, pp. 39-48, etc.). There are no particular restrictions on the chemical mutagens, but examples include N-methyl-N-nitrosourea (MNU), ethylmethanesulfate (EMS), N-ethyl-N-nitrosourea (ENU), sodium azide, sodium bisulfite, hydroxylamine, N-methyl-N'-nitro-N-nitroguanidine (MNNG), N-methyl-N'-nitrosoguanidine (NTG), O-methylhydroxylamine, nitrite, formic acid, and nucleotide analogs.

[0040] Methods for introducing transposons, etc., into genomic DNA include, for example, T OS Methods include inserting transposons such as 17, T-DNA, etc., into the plant's genomic DNA (see Kumar et al., Trends Plant Sci., 2001, Vol. 6, No. 3, pp. 127-134, and Tamara et al., Trends in Plant Science, 1999, Vol. 4, No. 3, pp. 90-96).

[0041] For wheat in which mutations have been introduced using the methods described above, the presence of mutations in the short anther gene can be confirmed by known methods. Examples of such known methods include DNA sequencing (next-generation sequencing, etc.), PCR, microarray analysis, Southern blotting, and Northern blotting. Using these methods, it is possible to determine whether or not a mutation has been introduced in the short anther gene by comparing the sequence or length of the gene before and after the introduction of the mutation. Furthermore, by using Northern blotting, RT-PCR, Western blotting, ELISA, microarray analysis, etc., if a decrease in the expression level of the transcript or translation product of the short anther gene is observed in wheat in which mutations have been introduced in the transcriptional regulatory region, it can be confirmed that the wheat has had mutations introduced into its short anther gene.

[0042] Another method for confirming the introduction of mutations into the short anther gene is TILLING (Targeting Induced Local Lesions in Genomes) (see Slade et al., Transgenic Res., 2005, Vol. 14, pp. 109-115, and Comai et al., Plant J., 2004, Vol. 37, pp. 778-786). In particular, when non-selective mutations are introduced into the wheat genome using heavy ion beam irradiation or chemical mutagens, the short anther gene or a part thereof can be amplified by PCR, and then individuals with mutations in the amplified product can be selected by TILLING or the like.

[0043] Furthermore, by crossbreeding wheat into which mutations have been introduced using the method described above with wild-type wheat and then performing a backcross, it is possible to remove mutations introduced into genes other than the target gene.

[0044] In some cases, wheat in which the function of the short anther gene is suppressed by introducing a mutation into the short anther gene may be a heterozygous for the short anther gene. In such cases, for example, by crossing such heterozygotes to obtain F1 plants, homozygotes possessing the short anther gene into which the mutation was introduced can be selected from these F1 plants. In this case, "wheat that is a homozygous for the short anther gene into which the mutation was introduced" includes not only wheat that has two alleles of the short anther gene with identical mutations, but also wheat that has a first short anther gene that has the first mutation and codes for a protein with suppressed activity, and a second short anther gene that has the second mutation and codes for a protein with suppressed activity.

[0045] In the present invention, in addition to the above-mentioned introduction of mutations, other methods for artificially suppressing the function of the short anther gene include methods that target the transcript of the short anther gene, such as using DNA encoding dsRNA (double-stranded RNA, e.g., siRNA) complementary to the transcript of the short anther gene, using DNA encoding antisense RNA complementary to the transcript of the short anther gene (antisense DNA), and using DNA encoding RNA having ribozyme activity that specifically cleaves the transcript of the short anther gene (ribozyme method).

[0046] In the present invention, artificial suppression of the function of short anther genes can be performed on wheat plants, seeds, or plant cells according to the methods described above. Plant cells include not only cultured cells derived from wheat, but also cells within the plant body. Furthermore, various forms of wheat-derived cells are included, such as suspension culture cells, protoplasts, leaf sections, callus, immature embryos, pollen, etc.

[0047] Furthermore, in the present invention, the above-mentioned site-specific nucleases, fusion proteins or DNA encoding a complex of guide RNA and protein, DNA encoding transposons, DNA encoding double-stranded RNA, DNA encoding antisense RNA, DNA encoding ribozyme-active RNA, etc., may be introduced into wheat cells in the form of an inserted vector.

[0048] The vector into which the DNA for artificially suppressing the function of a short anther gene is inserted is not particularly limited as long as it is capable of expressing the inserted gene in wheat cells, but it may contain a promoter for constitutive or inductive expression of the DNA. Examples of promoters for constitutive expression include the rice ubiquitin promoter, the cauliflower mosaic virus 35S promoter, the rice actin promoter, and the maize ubiquitin promoter. Examples of promoters for inductive expression include promoters known to be expressed by external factors such as infection or invasion by filamentous fungi, bacteria, or viruses, low temperature, high temperature, drought, ultraviolet irradiation, and spraying of specific compounds. Furthermore, as a promoter for expressing DNA encoding short RNA such as guide RNA or siRNA as the DNA of the present invention, polIII-type promoters such as the U6 promoter are preferably used.

[0049] Various methods known to those skilled in the art can be used to introduce the aforementioned DNA or a vector containing the inserted DNA into wheat cells, such as particle bombardment, Agrobacterium-mediated methods (Agrobacterium method), polyethylene glycol method, and electroporation.

[0050] Furthermore, even without taking the form of DNA, mutations can be introduced into wheat cells by introducing the aforementioned site-specific nucleases, fusion proteins, and transposons as proteins, and by introducing the aforementioned guide RNA, double-stranded RNA, antisense RNA, and RNA with ribozyme activity as RNA.

[0051] Thus, in the present invention, the short-anther trait can be conferred to wheat by using substances that target the short-anther gene, such as the DNA, the vector into which the DNA is inserted, the protein, and the RNA. Accordingly, the present invention can also provide a drug for conferring the short-anther trait to wheat, which contains as an active ingredient at least one substance that targets the short-anther gene, selected from the group consisting of the DNA, the vector into which the DNA is inserted, the protein, and the RNA.

[0052] Such a drug may be configured to contain two active ingredients in a single composition, or it may be configured to contain two active ingredients in separate compositions (a so-called kit). In addition, the drug of the present invention may contain other components such as buffer solutions, stabilizers, preservatives, and antiseptics in addition to the above-mentioned substances.

[0053] Furthermore, by regenerating wheat plants from cells whose gene function has been artificially suppressed using the methods described above, wheat with short anther characteristics can be obtained.

[0054] For example, methods for producing transgenic wheat plants include those described by Tingay et al. (Tingay S. et al. Plant J. 11:1369-1376, 1997), Murray et al. (Murray F et al. Plant Cell Report 22:397-402, 2004), Travalla et al. (Travalla S et al. Plant Cell Report 23:780-789, 2005), Vasil et al. (Vasil V. et al. Nat Biotechnology 10:667-674, 1992), and Ishida et al. (Ishida Y. et al. Methods in Molecular Biology 1223:189-193, 2015). Furthermore, transformation and regeneration into plants can be performed using the methods described in Tabei et al. (ed., Yutaka Tabei, "Transformation Protocols [Plant Edition]", Kagaku Dojin Co., Ltd., published September 20, 2012).

[0055] (Wheat with short anther characteristics) By the methods described above, wheat having the short anther trait can be obtained in which the function of the short anther gene of the present invention is artificially suppressed. Therefore, the present invention is Wheat with a short anther trait, in which the function of at least one gene selected from the group consisting of (a) to (d) below is artificially suppressed. (a) A gene encoding a protein consisting of the amino acid sequence described in SEQ ID NO: 10, 12, 14, or 16. (b) Genes encoding proteins consisting of amino acid sequences in which one or more amino acids are substituted, deleted, added, and / or inserted in the amino acid sequences described in SEQ ID NO: 10, 12, 14, or 16. (c) A gene encoding an amino acid sequence having 80% or more homology to the amino acid sequence described in SEQ ID NO: 10, 12, 14, or 16. (d) A gene containing DNA that hybridizes under stringent conditions with DNA consisting of a nucleotide sequence encoding the amino acid sequence described in SEQ ID NO: 10, 12, 14, or 16. To provide.

[0056] As mentioned above, the short anther gene, the artificial suppression of its function, and the wheat and other plants that acquire the short anther trait through such suppression are as described. Furthermore, once a plant in which the function of the short anther gene has been artificially suppressed is obtained, it is possible to obtain offspring from this plant through sexual or asexual reproduction. Moreover, it is possible to obtain reproductive materials (e.g., seeds, scions, stems, callus, protoplasts, etc.) from the plant, its offspring, or clones, and mass-produce the plant based on these materials. Therefore, the present invention includes offspring and clones of wheat possessing the short anther trait, as well as their reproductive materials. Examples of reproductive materials include seeds, stems, callus, and protoplasts.

[0057] <Method for determining whether or not the short anther trait is present> The present invention provides a method for determining whether or not a grain possesses the short anther trait, characterized by analyzing the nucleotide sequence of the short anther gene or its expression regulatory region in the test grain. More specifically, it is as follows:

[0058] A method for determining whether or not wheat possesses the short anther trait, characterized by analyzing the nucleotide sequence of the short anther gene or its expression regulatory region in the test wheat. The short anther gene to be detected in the determination method of the present invention is as described above.

[0059] As shown in the examples described later, the insertion or deletion of nucleotides in the short anther gene shortens the anther length. Therefore, by analyzing the nucleotide sequence of the short anther gene region, it is possible to determine whether or not a plant possesses the short anther trait.

[0060] Furthermore, by analyzing the expression level of the short anther gene, as well as the nucleotide sequence of the transcriptional regulatory region (enhancer, promoter, silencer, insulator, etc.) that controls its expression level, it is possible to determine whether or not a plant possesses the short anther trait.

[0061] When analyzing the nucleotide sequence of the short anther gene or its regulatory region, an amplified product obtained by PCR of the short anther gene or its regulatory region of the present invention can be used. When performing the PCR, the primers used are not limited as long as they can specifically amplify the short anther gene or its regulatory region, and can be appropriately designed based on the sequence information of the short anther gene or its regulatory region.

[0062] Furthermore, the method for determining whether or not the short anther trait is present may include, for example, a step of comparing with a "control nucleotide sequence." The "control nucleotide sequence" to be compared with the nucleotide sequence of the short anther gene or its expression regulatory region in the test wheat is, for example, the nucleotide sequence of the gene encoding the amino acid sequence described in SEQ ID NOs: 10, 12, 14, or 16, or its expression regulatory region in wheat.

[0063] By comparing the nucleotide sequence of the short anther gene or its expression regulatory region in the determined test wheat with the nucleotide sequence of the control, it is possible to determine whether or not the test wheat possesses the short anther trait. For example, if there is a significant difference in the nucleotide sequence compared to the control nucleotide sequence (e.g., SEQ ID NOs: 9, 11, 13, or 15) (especially if the appearance of a new stop codon or a frameshift causes a significant change in the molecular weight or amino acid sequence of the encoded protein), the test wheat is likely to possess the short anther trait.

[0064] Furthermore, in the determination method of the present invention, the preparation of DNA from the test wheat can be carried out by conventional methods, such as the CTAB method. Not only mature plants, but also seeds and young plants can be used as the wheat for DNA preparation. The nucleotide sequence can be determined by conventional methods, such as the dideoxy method or the Maxam-Gilbert method. Commercially available sequencing kits and sequencers can be used for nucleotide sequence determination.

[0065] In addition to the direct sequencing described above, the nucleotide sequence of the short anther gene or its regulatory region in the test wheat can be indirectly analyzed by various methods to determine whether it differs from the control nucleotide sequence. Examples of such methods include PCR-SSCP (single-strand conformation polymorphism), RFLP and PCR-RFLP methods utilizing restriction fragment length polymorphism (RFLP), denaturant gradient gel electrophoresis (DGGE), allele-specific oligonucleotide (ASO) hybridization, and ribonuclease A mismatch cleavage.

[0066] Another method for determining whether or not a grain possesses the short anther trait according to the present invention is characterized by detecting the expression or amplification product of the short anther gene or the molecular weight of the expression product in the test grain. More specifically, it is as follows:

[0067] A method for determining whether or not wheat has a short anther trait, characterized by detecting the expression or amplification product of the short anther gene or the molecular weight of the expression product in the test wheat. The short anther genes to be detected in the determination method of the present invention are as described above.

[0068] As shown in the examples described later, the insertion or deletion of nucleotides in the short anther gene reduces the molecular weight of the expression product and shortens the anther length. Therefore, the presence or absence of the short anther trait can be determined by detecting the molecular weight of the amplified or expressed product of the short anther gene. Furthermore, the presence or absence of the short anther trait can be determined by detecting the expression of the short anther gene.

[0069] Here, "detection of short anther gene expression" includes both detection at the transcriptional level and detection at the translational level. Furthermore, "detection of expression" includes not only the detection of whether or not expression is present, but also the detection of the degree of expression.

[0070] The detection of short anther genes at the transcriptional level can be performed by conventional methods, such as RT-PCR or Northern blotting. The primers used when performing the PCR are not limited as long as they can specifically amplify the DNA to be detected in the present invention, and can be appropriately designed based on the sequence information of the short anther genes that has already been determined.

[0071] On the other hand, detection at the translational level can be carried out by conventional methods, such as Western blotting. The antibodies used in Western blotting may be polyclonal or monoclonal antibodies, and the methods for preparing these antibodies are well known to those skilled in the art.

[0072] The results of gene expression detection showed that in the tested wheat species, the expression level of the short anther gene was, for example, higher than that of Chinese Spring wheat, and in barley, If the expression level is significantly lower than that of Golden Promise (for example, if the short anther gene is not substantially expressed), it is determined that there is a high probability that the wheat has the short anther trait. Furthermore, if the molecular weight of the amplified or expressed product of the short anther gene is significantly different from, for example, the molecular weight of Chinese Spring wheat, or the molecular weight of Golden Promise barley, it is determined that there is a high probability that the wheat has the short anther trait.

[0073] <Method for breeding wheat with short anther traits> The present invention provides a method for breeding wheat having the short-anther trait. This breeding method includes the steps of (a) crossing wheat having the short-anther trait with an arbitrary variety, (b) The process includes selecting wheat from among the individuals obtained by crossbreeding in step (a) that are determined to have the short anther trait by the method described above.

[0074] "Wheat possessing the short anther trait" refers, for example, to wheat that possesses the short anther trait due to the suppression of the function of the short anther gene described above. "Any variety" to be crossed with this wheat could, for example, be a wheat variety that does not possess the short anther trait because the function of the short anther gene is not suppressed, but is not limited to this. Furthermore, from the viewpoint of producing wheat with higher resistance to Fusarium fungi, a preferred variety is barley possessing a cleistostatic AP2 gene (a cly1.b or cly1.c type gene) that exhibits resistance to cleavage against the miR172 gene, or wheat exhibiting a tendency towards cleistostasis such as U24, U56, IL416, or Corringin. By utilizing the breeding method of the present invention, it becomes possible to appropriately select wheat varieties possessing the short anther trait at the young plant stage, and to develop varieties possessing this trait in a short period of time. [Examples]

[0075] The present invention will be described more specifically below based on examples, but the present invention is not limited to the following examples.

[0076] (Example 1) Search for candidate causative genes of rice short anther mutants The rice san-1 (short anther) mutant was obtained from a population of mutants induced by the chemical mutagenesis substance N-Methyl-N-nitrosourea (MNU) using the rice variety T65 (Taichung 65) as the parent variety. The san-1 mutant exhibits anther shortening, with an anther length approximately 30% shorter than that of the wild type, while showing no difference in glume length (Figure 1, Non-Patent Literature 1).

[0077] However, the causative gene for this short-anther trait had not been identified. Therefore, we first crossed san-1 with the rice variety Kasalath and performed map-based cloning using the F2 population. As a result, we predicted that the causative gene is located between markers RM18639 and RM6841 on chromosome 5 (Figure 2).

[0078] After further intensive investigation and narrowing down the candidate region, it was predicted that the candidate region would be located between the markers IRIC11 and RM18719. Twenty genes were found within this candidate region in the RAP-DB database (https: / / rapdb.dna.affrc.go.jp / index.html). By comparing the gene sequences, it was found that in san-1, an immature stop codon is generated by the substitution of adenine at the 236th guanine position from the translation start site of the gene Os05g0421300 (Figure 3). This gene encodes a protein of unknown function, possessing a nuclear localization signal and an ARM (Armadillo repeat) domain at the N-terminus and a TPR (tetratricopeptide repeat) domain at the C-terminus (Figure 4).

[0079] (Example 2) Anther shortening by genome editing targeting gene Os05g0421300 To determine whether the candidate genes identified above are the causative genes for rice short-anther mutants, genome editing targeting these genes was performed using the method described below, and the expression of the short-anther trait was verified.

[0080] <Construction of vectors for expressing guide RNA and SpCas9, etc.> The genome sequence of gene Os05g0421300 was obtained from the RAP-DB database (https: / / rapdb.dna.affrc.go.jp / index.html). From the sequences predicted to be the first exon, two locations were selected as guide RNA sequences (20 bp long) to be targeted for genome editing. These were named SAN-CR1 (position: 376-395, sequence 5'-CCATTGGTTGAACTCTTACG-3', SEQ ID NO: 3) and SAN-CR2 (position: 137-156, sequence 5'-TTCTCCCTATTAGTGGTCTT-3', SEQ ID NO: 4).

[0081] Then, vectors (genome editing expression vectors) for expressing each guide RNA and SpCas9 were prepared according to standard methods. The vector was based on the pZNH2GTR-‐U6CR vector (Figure 5), with the DNA encoding the guide RNA inserted between the OsU6-2 promoter and the scaffold sequence. Furthermore, the DNA encoding SpCas9 was inserted between the rice Ubi1b promoter and the rice Ubi1b terminator sequence. This genome editing expression vector also contains a cassette sequence for expressing a hygromycin resistance gene for the selection of transformants.

[0082] <Creation and analysis of genome-edited rice> (1) Transformation into rice callus The genome editing expression vector prepared as described above was introduced into callus derived from rice embryodiscs of the rice variety Nipponbare by Agrobacterium-mediated transformation, according to the method described by Oikawa et al., Plant Mol. Biol. 55, 687-700 (2004). The transformed calluses were then selected by culturing them in a medium containing hygromycin.

[0083] (2) Extraction of genomic DNA from leaves Transgenic rice plants selected and redifferentiated using hygromycin were transplanted into culture medium (Bonsol No. 1). Approximately two weeks later, the tips of the elongated leaves (about 5 mm) were collected, placed in 1.5 mL plastic tubes, and DNA was extracted and subjected to PCR.

[0084] (3) Amplification of DNA fragments at the SAN target mutation site by PCR. The primer sequences used to amplify the target mutation site in plants that underwent genome editing using guide RNA SAN-CR1 or SAN-CR2 are as follows: Primers for SAN-CR1 analysis SAN_CR1_seqF 5'-TCAACTTGGGGATATTTGAATG-3'(Sequence ID: 5) SAN_CR1_seqR 5'-ACTTCTCCATGGTCAGCAACT-3' (Sequence ID: 6) Primers for SAN-CR2 analysis SAN_CR2_seqF 5'-TCATTTGTCTCTCACGATGGA-3' (Sequence ID: 7) SAN_CR2_seqR 5'-TGTGCTGCATAATATGGGATG-3' (Sequence ID: 8).

[0085] Tks Gflex DNA Polymerase (TAKARA Corporation) was used as the PCR enzyme, and the reaction mixture for a total volume of 10 μL was prepared as follows and carried out in an 8-tube strip with a volume of 0.2 mL. 2×Gflex PCR Buffer 5μL 100 μM Forward Primer 0.2 μL 100 μM Reverse Primer 0.2 μL Tks Gflex DNA Polymerase (1.25U / μL) 0.2μL Pure water 3.4μL DNA extract solution 1μL.

[0086] The PCR machine used was a TaKaRa PCR Thermal Cycler Dice and was operated under the following conditions. 94°C for 1 minute, then 98°C for 10 seconds, 55°C for 15 seconds, and 68°C for 30 seconds, repeated for 40 cycles.

[0087] (4) Sequencing analysis of PCR-amplified fragments PCR products from the region containing SAN-CR1 (wild-type, fragment length 301 bp) and the region containing SAN-CR2 (wild-type, fragment length 321 bp) were developed by 1% agarose gel electrophoresis, and amplification was confirmed. The amplified PCR products were purified using ExoSAP-IT Express (ThermoFisher Scientific), and direct sequencing analysis was performed using the forward primers used for amplification.

[0088] (5) Observation of anther length Anther length was observed in SAN genome-edited plants in the genetically fixed T1 generation. Pre-flowering glumes were collected, with the anthers extending to the middle of the glume. The outer glume of the collected glume was removed with tweezers to expose the anther, and the anther length was observed using a stereomicroscope.

[0089] <Analysis results of genome-edited rice> As described above, genome editing expression vectors were introduced into rice callus, and transformants were selected using hygromycin. Plants redifferentiated from the callus were transplanted into pots filled with growing medium and grown in an isolated greenhouse. Genomic DNA was extracted from the elongated leaves, and PCR amplification and sequencing analysis were performed to determine whether genome editing had occurred in each guide RNA region of the gene Os05g0421300.

[0090] As a result, as shown in Table 2, genome editing occurred in 83-85% of the T0 generation seedlings that were analyzed.

[0091] [Table 2]

[0092] Next, the plants in which genome editing was detected were transplanted into pots and cultivated in an isolated greenhouse to obtain progeny seeds. T1 generations were cultivated for line #20-1 (using SAN-CR1 as guide RNA) and line #14-1 (using SAN-CR2), and sequence analysis was performed on each individual to select individuals showing genome editing as homozygotes. As a result, it was found that in genome-edited plant san-CR1 #20-1, a single thymine base was inserted between the 392nd and 393rd bases from the translation start site of the gene Os05g0421300 (Figure 6), and in san-CR2 #14-1, a single thymine base was inserted between the 153rd and 154th bases (Figure 7), resulting in a frameshift.

[0093] Next, genome-edited individuals san-CR1 #20-1 and san-CR2 #14-1, which are homozygous for a frameshift-inducing mutation in the gene Os05g0421300, as well as individuals without genome editing, were grown in an isolated greenhouse, and glumes were collected before flowering. The outer glumes were then removed under a stereomicroscope to expose the anthers, and the anther lengths were compared.

[0094] As a result, approximately 30% shortening of the anthers was observed in both san-CR1 #20-1 and san-CR2 #14-1 individuals compared to individuals without genome editing (Figure 8).

[0095] Therefore, it was revealed that the gene Os05g0421300 is the causative gene (SAN gene) for anther shortening in san-1, and by targeting this gene and suppressing its function, it became possible to confer the anther shortening trait to rice.

[0096] (Example 3) Shortening of the stamen of barley HvSAN gene by genome editing <Obtaining of barley HvSAN genomic information> The barley genomic sequence predicted to be involved in shortening, which is the basis for performing genome editing, was investigated and obtained by the following procedure.

[0097] Based on the sequence of the rice SAN gene, the sequences of the SAN homologous genes (TaSAN-A / B / D (genes of each A, B, and D subgenomes)) of wheat (cultivar "Chinese Spring") were obtained from the publicly available information. Subsequently, the TaSAN-A gene assumed to be the homologous gene on the wheat A genome was used as the query sequence to search the barley genomic sequence. The database used was "Golden Promise Genome (https: / / ics.hutton.ac.uk / gmapper / index.html)", which stores the genomic sequence of the barley cultivar Golden Promise. A BLAST search was performed in this database, and a 5,213-bp nucleotide sequence was obtained.

[0098] <Construction of guide RNA expression vector> Two sites were selected as the sequences (20 bp in length) to be targeted for genome editing (Figure 9). They were designated as HvSAN target1 (position: 2243 - 2262) and HvSAN target2 (4176 - 4195), respectively. For HvSAN target1, it was inserted between the HvU3 promoter and the Scaffold sequence of the HvU3-sgRNA vector (Figure 10), and for HvSAN target2, it was inserted between the HvU6 promoter and the Scaffold sequence of the HvU6-sgRNA vector (Figure 11) to construct each guide RNA expression vector.

[0099] <Construction of SpCas9 expression vector> The SpCas9 sequence was used with the previously reported OsCas9 ver.3 to create the pNEB193-ZmUbi-OsCas9 ver.3 vector (Figure 12). This vector was ligated downstream of the maize Ubi promoter and the 5'UTR sequence of the rice alcohol dehydrogenase gene. Further downstream, the nuclear localization signal sequence of the SV40 virus, the cauliflower mosaic virus 35S terminator, and the Agrobacterium NOS terminator sequence were ligated to create the SpCas9 expression vector.

[0100] <Creation and analysis of genome-edited barley> 1) Culture of immature barley embryos Five seeds of the barley variety Golden Promise were sown in pots (approximately 15 cm in diameter and 20 cm in height) filled with potting soil (a 1:1 mixture of Bonsol No. 2 and Hanazanmai), and the plants were cultivated at 20°C with a 12-hour day length. Immature seeds were collected after heading (the flowering date could not be determined as it is a cleistogamous variety). The developmental stage was considered to be when the longest diameter of the immature embryo was approximately 2 mm.

[0101] After removing the outer glume of the collected immature embryos, approximately 50 embryos were wrapped in gauze and sterilized. Sterilization was performed by immersing them in 70% ethanol for 30 seconds, then in 10% antiformin solution for 30 minutes, followed by agitation. After sterilization, the embryos were washed three times with sterile water to remove the antiformin. Under a stereomicroscope in a clean bench, the growth point was removed with a scalpel, and the immature embryos were removed and placed on MSE3M medium with the blastocyst tissue side facing upwards. Approximately 50 immature embryos were placed in the center of each medium sheet. Composition of MSE3M medium: Murashige & Skoog (1962) Inorganic salts and vitamins, 150 mg / L asparagine, 150 g / L maltose monohydrate, 2.5 mg / L 2,4-D, 8 g / L agar, pH 5.8.

[0102] 2) Particle bombardment treatment of immature embryos and subsequent culture 2 mg of 0.6 micron diameter gold particles manufactured by Bio-Rad were suspended in 50 μL of 99.5% ethanol. 6 μg of guide RNA expression vector and 5 μg of SpCas9 expression vector were adsorbed onto these particles using a standard method, precipitated by centrifugation, and then resuspended in 100 μL of 99.5% ethanol for treatment.

[0103] Bombardment was performed using the Bio-Rad PDS-1000 / He system. A 10-microliter suspension of vector-adsorbed gold particles was applied to a plastic disc called a macrocarrier, and immobilized by evaporating ethanol. Subsequently, gold particles were fired into the immature embryo blastodisc using a standard method to introduce the vector into the cells. The firing pressure during introduction was set to 900 psi, and the distance between the disc stop position and the immature embryo was set to 5 cm. After treatment, the petri dish was sealed with Parafilm and cultured at 26°C in the dark.

[0104] The following day, the immature embryos were transferred to MSE3 medium and cultured for 14 days at 26°C in the dark. Composition of MSE3 medium: MS inorganic salts and vitamins (Murashige & Skoog, Physiol.Plant.15, 473-497), 150 mg / L asparagine, 30 g / L sucrose, 2.5 mg / L 2,4-D, 8 g / L agar, pH 5.8.

[0105] After 14 days, the cultured plants were transplanted into SR7 medium and cultured at 26°C under a 12-hour photoperiod to promote plant regeneration. Composition of SR7 medium: 20mM KNO3, 2.5mM (NH4)2SO4, 1mM CaCl2, 1mM MgSO4, 2mM KH2PO4, R2 trace mineral salts (Ohira et al., Plant Cell Physiol.14, 1113-1121), B5 vitamins (Gamborg et al. al.Exp.Cell.Res., 50, 151-158), 30g / L maltose monohydrate, 1mg / L BA, 8g / L agar, pH5.8.

[0106] 3) Extraction of genomic DNA from leaves After transplanting into SR7 medium, approximately 3 weeks later, about 1 cm of the tip of a leaf that had grown was collected and placed in a 2 mL plastic tube. This tube was then immersed in a DNA extract (composition: 20 mM Tris-HCl, 25 mM NaCl, 2.5 mM EDTA, 0.5% SDS, pH 7.5), and ground in a multi-bead shocker (Yasui Kikai) at 2000 rpm for 7 seconds. Subsequently, it was centrifuged at 15,000 rpm for 5 minutes to obtain the supernatant, which was then subjected to PCR.

[0107] 4) Amplification of DNA fragments at the HvSAN target mutation site by PCR. The primer sequences used to amplify the target mutation sites of HvSAN target1 and HvSAN target2 are as follows. HvSAN target1 analysis primer HvSAN_t1_FW1 5'-GCAGCTCTAATATGGAAGGG-3'(Sequence ID: 19) HvSAN_t1_RV1 5'-GCAGGGAATGTACTAGGGTATG-3'(Sequence ID: 20) HvSAN target2 analysis primer HvSAN_t234_FW1 5'-GCATTGTGCCTTCATAGTCC-3'(Sequence ID: 21) HvSAN_t234_RV1 5'-ACTGTCTCCCACTCTGAGTCAT-3'(Sequence ID: 22).

[0108] The PCR enzyme used was KOD FX Neo (manufactured by TOYOBO), and the reaction mixture for a total volume of 10 μL was as follows. The reaction was carried out in an 8-tube strip with a volume of 0.2 mL. 2×KOD Fx Neo buffer 5μL 2 mM dNTP mix, 2 μL 10 μM FW primer 0.3 μL 10 μM RV primer 0.3 μL KOD FX Neo (1U / μL) 0.1μL Pure water 1.3μL DNA extract solution 1μL.

[0109] The PCR machine used was the ABI9700, and it was operated under the following conditions. 94°C for 2 minutes, then 98°C for 10 seconds, 60°C for 10 seconds, and 68°C for 15 seconds, repeating this cycle 32 times.

[0110] 5) Restriction enzyme treatment and electrophoresis of PCR-amplified fragments 254 bp PCR products from the HvSAN target1 region and 320 bp PCR products from the HvSAN target2 region were subjected to restriction enzyme treatment with AflII and BslI, respectively. After restriction enzyme treatment, electrophoresis was performed on a 2% agarose gel.

[0111] 6) Sequence analysis PCR products showing mutations via CAPS analysis were inserted into the cloning site in the pCR-BluntII-Topo vector using the Zero Blunt TOPO PCR Cloning kit (Invitrogen), and then introduced into E. coli for cloning. Colonies were formed using standard methods. Colony PCR was performed using M13 universal primers (M13-47 and RV-M), and the obtained PCR products were sequenced using the same M13 universal primers. In the case of T1 generation individuals, instead of cloning the PCR product using the Zero Blunt TOPO PCR Cloning kit, the PCR product from (2) was directly sequenced using the primers used for PCR.

[0112] 7) Observation of anther length Anther length was observed in the genetically fixed T1 generation. Spikes were collected from individuals at roughly the same stage of growth, using the length between the head node (the base of the rachis) and the flag node (the base of the flag leaf) as a guideline. Floral organs were removed from the collected spikes, and the flowers were dissected with tweezers to expose the anthers, whose length was then measured.

[0113] <Analysis results of genome-edited barley> As described above, a BLAST search was performed in the "Golden Promise Genome" database using the TaSAN-A gene as the reference sequence, and a 5,213 bp nucleotide sequence was obtained. When compared with the wheat TaSAN-A cDNA sequence, it was inferred that this gene consists of four exons and three introns, with the second exon containing a translation start codon and the third exon containing a stop codon (Figure 13). Furthermore, the putative proteins of these SAN homologous genes all showed high homology to SAV4 (SHADE AVIDANCE4), which is involved in the shade avoidance response in Arabidopsis thaliana (Figure 14).

[0114] Then, guide RNA expression vectors and Cas9 expression vectors were simultaneously injected into immature barley embryos using a particle gun. Plant bodies were then regenerated from these immature embryos through tissue culture, and CAPS analysis was used to determine whether or not genome editing had occurred.

[0115] As a result, as shown in Table 3, genome editing occurred in 1.7-6.0% of the analyzed seedlings. Although some individuals were lost during the culture process, we were able to obtain 3 genome-edited individuals targeting HvSAN target1 and 4 individuals targeting HvSAN target2.

[0116] [Table 3]

[0117] The obtained plants were transplanted into pots and cultivated in an artificial climate chamber, and all showed good growth. Sequence analysis was performed on the grown individuals. As a result, frameshift mutations were found in individual #11 of HvSAN target1 and in individual #01 of target2 (Figure 15). In HvSAN target1 individual #11, one of the pair of chromosomes had a 5-base deletion frameshift mutation, and the other had an in-frame mutation of a 3-base deletion and a 1-base substitution. In HvSAN target2 individual #01, both chromosomes were frameshifted and had mutations of a 2-base deletion and a 1-base insertion.

[0118] Next, T1 seeds from HvSAN target1 #11 individuals and HvSAN target2 #01 individuals were sown, and the genotype of the T1 individuals was determined by direct sequencing analysis. After cultivation continued until heading, the panicles were collected just before flowering, the flower pods were dissected, and the anther length was measured to investigate the relationship between the introduced mutation and the anther length.

[0119] As a result, genome-edited individuals using any of the target sequences exhibited shortened anthers. Specifically, approximately 40% shortening was observed in homozygous frameshift individuals with a 15-base deletion of target1 (Figure 16), while 20% shortening was observed in homozygous individuals with frameshift mutations (2-base deletion and 1-base insertion) of target2 (Figure 18). Furthermore, when target1 was targeted, even in homozygous individuals with a 3-base deletion and 1-base substitution, despite being in-frame, showed 18% shortening (Figure 16), and heterozygous individuals with a 5-base deletion / 3-base deletion and 1-base substitution of target1 showed 25% shortening (Figure 17). These results suggest that anther length can be controlled in genome editing on the HvSAN gene by selecting the site and type of mutation.

[0120] (Example 4) Anther shortening by genome editing of the wheat TaSAN gene Similar to the barley example, genome editing was performed using the method described below to confirm that the short anther trait can be conferred to wheat by suppressing the function of the SAN gene. The anthers of the resulting genome-edited individuals were then analyzed.

[0121] <Construction of genome editing vectors> As described above, the TaSAN-A / B / D genes were extracted from the database of the wheat variety "Chinese Spring" as homologous genes to the rice SAN gene. A genome editing vector was constructed with the aim of genome editing the TaSAN-A / B / D genes, including a guide RNA expression cassette, a Cas9 expression cassette, and a cassette for expressing a hygromycin resistance gene. Specifically, four target gRNA sequences (20 bp long) were designed within the exon region of the TaSAN-A / B / D gene (targets 3, 4, 5, and 6) (Figure 19). The sequences of each gRNA are as follows. target 3 5'―CATGGCAGCTCTAATATGGA―3'(Sequence ID: 23) target 4 5'―CCATTAGTTGAACTCTTAAG―3'(Sequence ID: 24) target 5 5'―GAGTTGCTGTCAGAGCTTTG―3'(Sequence ID: 25) target 6 5'―CTCCATGATCAGCAACAGCA―3' (Sequence number: 26). Each gRNA was inserted between the wheat U6 (TaU6) promoter and the tracrRNA sequence to construct a guide RNA expression cassette. Additionally, a Cas9 expression cassette was constructed by connecting a codon-optimized SpCas9 for maize downstream of the maize Ubi1 promoter (ZmUbi1p) and then connecting a terminator sequence downstream of that. Finally, sequences for the expression cassette of the hygromycin resistance gene for transformant selection were added to these expression cassettes to create vectors for TaSAN-A / B / D genome editing (Figure 20).

[0122] <Creation and Analysis of Wheat-Edited Barley> 1) Preparation of immature wheat embryos Six seeds of the wheat variety Fielder were sown in 18cm diameter poly pots filled with a potting mix (Sakata Super Mix A and Nippi Horticultural Potting Soil mixed in a 2:1 ratio, with 1g / L of slow-release fertilizer Osmocote Exact Mini added). The plants were grown for about 12 weeks in a glasshouse at 16°C / 10°C with a 10-hour photoperiod, and then cultivated in an artificial growth chamber at 23°C / 16°C with a 14-hour photoperiod just before flowering. Immature seeds were collected from the ears approximately 16 days after flowering. Approximately 100 of the collected immature seeds were wrapped in gauze and sterilized. Sterilization was performed by immersing them in 70% ethanol for 1 minute, then in 10% antiformin solution for 15 minutes, and stirring. After sterilization, the seeds were washed three times with sterile water to remove the antiformin. Under a stereomicroscope in a clean bench, the immature embryos were carefully removed using tweezers and collected in 2mL microcentrifuge tubes containing 2mL of MS infection solution. Composition of MS infection fluid: 1 / 10 MS inorganic salts and vitamins (Murashige & Skoog, 1962), 10 g / L glucose, 0.5 g / L 2-(N-morpholino)-ethanesulfonic acid (MES), pH 5.8.

[0123] 2) Transformation of Agrobacterium 500 ng of the above TaSAN-A / B / D genome editing vector was introduced into Agrobacterium (EHA101 strain) using the freeze-thaw method. The cells were then cultured in LB medium (selective medium) containing spectinomycin and kanamycin at 28°C for 48 hours to obtain colonies. The obtained colonies were cultured in liquid in LB medium at 28°C for 24 hours, glycerol was added to a final concentration of 30%, and the cells were frozen for storage until use.

[0124] 3) Preparation of Agrobacterium infection fluid 10 ml of MG / L liquid medium was placed in a 50 ml centrifuge tube, 10 μl of Agrobacterium glycerol stock solution was added, and the culture was incubated at 28°C and 175 rpm for 20 hours with shaking. MG / L liquid medium: 5g / L mannitol, 1g / L glutamic acid, 250mg / L KH2PO4, 100mg / L NaCl, 100mg / L MgSO4·7H2O, 5g / L tryptone, 2.5g / L yeast extract, 1μg / L biotin, pH to 7.0. Then, 1 ml of Agrobacterium suspension was placed in a 1.5 ml microcentrifuge tube, centrifuged at 4°C and 6000 rpm for 5 minutes, discarded the supernatant, and acetosyringone was added to 1 ml of MS infection fluid to a concentration of 100 μM.

[0125] 4) Infection of immature embryos with Agrobacterium Immature embryos collected in microcentrifuge tubes were centrifuged at 4°C and 15,000 rpm for 10 minutes. After centrifugation, the liquid was aspirated with a pipette, 1 ml of the prepared Agrobacterium infection solution was added, vortexed for 30 seconds, and then allowed to stand for 3 minutes. The immature embryos, along with the solution, were transferred to a 6 cm sterile petri dish, and using tweezers, they were placed on MS infection solid medium with the blastodisc side facing up. The petri dish was sealed with Parafilm and co-cultured at 23°C in the dark for 2 days. MS infection solid medium: 1 / 10 MS inorganic salts and vitamins, 10 g / L glucose, 0.5 g / L MES, 1.25 mg / L CuSO4·5H2O, pH 5.8, 8 g / L agarose (type I). After autoclaving, add 100 μM acetosyringone, 0.85 g / L AgNO3.

[0126] 5) Tissue culture After co-culture, the hypocotyls were cut from the immature embryos with a scalpel, arranged on MS Resting solid medium with the blastodisc side facing up, sealed with surgical tape, and rested in culture at 25°C in the dark for 5 days. MS Resting Solid Medium: MS inorganic salts, MS vitamins, 0.5 g / L, glutamine, 0.1 g / L, casamino acids, 40 g / L, maltose, 1.95 g / L, MES, 750 mg / L, MgCl2·6H2O, pH 5.8, 5 g / L, agarose (type I). After autoclaving, add 0.5 mg / L, 2,4-D, 2.2 mg / L, picoram, 100 mg / L, ascorbic acid, 0.85 mg / L, AgNO3, 250 mg / L, carbenicillin, 100 mg / L, and cefotaxime. After resting culture, the culture was transferred to MS primary selection solid medium, sealed with surgical tape, and incubated at 25°C in the dark for 2 weeks. MS primary selection solid medium: MS resting solid medium with cefotaxime removed and 15 mg / L of hygromycin B added.

[0127] Next, the cultures selected in the primary selection were transferred to MS secondary selection solid medium, sealed with surgical tape, and incubated at 25°C in the dark for 3 weeks. MS secondary selection solid medium: The hygromycin B content of the MS primary selection solid medium has been doubled to 30 mg / L.

[0128] Next, the cultures after secondary selection were transferred to MS redifferentiation solid medium, sealed with Parafilm, and cultured at 25°C with a 14-hour photoperiod for two weeks. MS redifferentiation solid medium: MS inorganic salts, MS vitamins, 20 g / L; sucrose, 0.5 g / L; MES, 2.5 mg / L; CuSO4·5H2O, pH 5.8, 3 g / L; gellan gum. After autoclaving, add 5 mg / L zeatin, 30 mg / L; hygromycin B, 125 mg / L; carbenicillin, 100 mg / L; and cefotaxime.

[0129] Next, the redifferentiated green shoots were planted in MS rooting medium, sealed with Parafilm, and cultured for two weeks at 25°C with a 14-hour photoperiod. MS rooting solid medium: MS inorganic salts, MS vitamins, 15 g / L; sucrose, 0.5 g / L; MES, 0.1 mg / L; indole-3-butyric acid (IBA), pH 5.8, 3 g / L; gellan gum. After autoclaving, add 15 mg / L hygromycin B. Then, the plants that had developed roots were transplanted into pots and grown in a closed-system cultivation room.

[0130] 6) Genome extraction from wheat leaves Approximately 1 cm of the tip of selected wheat leaves was collected, placed in a 2 mL plastic tube containing one 6 mm diameter bead, frozen with liquid nitrogen, and then ground in a grinder for 30 seconds. Then, 400 μL of DNA buffer (100 mM Tris-HCl (pH 8.0), 10 mM EDTA, 1 M KCl) was added, and the mixture was centrifuged at 8,000 rpm for 15 minutes using a micro-high-speed centrifuge. 100 μL of the resulting supernatant was transferred to a tube containing 100 μL of isopropanol and mixed. The mixture was centrifuged at 14,000 rpm for 10 minutes, and the supernatant was discarded. 200 μL of 70% ethanol was added to the precipitate and mixed, and the mixture was centrifuged at 14,000 rpm for 3 minutes. After drying the precipitate, 50 μL of sterile water was added to dissolve it, and the mixture was subjected to PCR.

[0131] 7) Amplification of DNA fragments at the TaSAN-A / B / D target mutation site by PCR. The primer sequences used to amplify the target mutation sites of target3,4,5,6 of the guide RNA in each TaSAN-A / B / D are as follows: For TaSAN-A: TaSAN_A_seqF 5'―CGTTTTGCTGATACTATGGT―3' (Sequence ID: 27) TaSAN_A_seqR1 5'―CACAGTGGTAGCCAAGTCTT―3' (Sequence ID: 28) For TaSAN-B: TaSAN_B_seqF 5'―CATTTTGTTGATACTATGGT―3' (Sequence ID: 29) TaSAN_B_seqR1 5'―CACAGTGGTAGCCAAGCCTT―3' (Sequence ID: 30) For TaSAN-D: TaSAN_D_seqF 5'―CGTTTTGCTGATAATATGAT―3' (Sequence ID: 31) TaSAN_D_seqR1 5'―CACAGTGGTAGCCAAGTCTC―3' (Sequence ID: 32).

[0132] The PCR enzyme used was Quick Taq HS DyeMix (manufactured by TOYOBO), and the reaction mixture composition for a total volume of 10 μL was as follows. The reaction was carried out in an 8-tube strip with a volume of 0.2 mL. 2x Quick Taq HS DyeMix 5μL 10 μM FW primer 0.2 μL 10 μM RV primer 0.2 μL Pure water 3.6μL DNA extract solution 1μL.

[0133] The PCR machine used was a TP600 TaKaRa PCR Thermal Cycler, operated under the following conditions. 94°C for 2 minutes, then 94°C for 30 seconds, 55°C for 30 seconds, and 68°C for 15 seconds for 40 cycles. The obtained PCR products were then subjected to electrophoresis on a 2% agarose gel to confirm the PCR amplification fragments. Furthermore, the PCR products were subjected to direct sequencing analysis using the same primers used in the PCR.

[0134] 8) Observation of wheat anther length Anther length was observed in T0 generation individuals in which genome-edited mutations were confirmed in all TaSAN-A / B / D strains. Floral organs were removed from the spikes before flowering, the flowers were dissected with tweezers, the anthers were extracted, and their lengths were measured.

[0135] <Analysis results of genome-edited wheat> As described above, the TaSAN-A / B / D genes were extracted from the database of the wheat variety "Chinese Spring" as homologous genes to the rice SAN gene. Based on the sequences of the obtained genes, vectors for TaSAN-A / B / D genome editing were designed and constructed (Figures 19 and 20). The constructed vectors were introduced into immature embryos of the wheat variety Fielder via Agrobacterium-mediated transformation. Transformed wheat plants were selected by culturing them in a medium containing hygromycin. The selected wheat plants were transplanted into culture medium, and DNA was extracted from the newly elongated leaves and subjected to PCR to confirm the presence or absence of genome editing.

[0136] As a result, genome-edited mutations were detected in at least one TaSAN-A / B / D gene in 14 of the 46 transformed individuals selected. Furthermore, genome-edited mutations were detected in all of the TaSAN-A / B / D genes in 8 of those 14 individuals. When the nucleotide sequences of TaSAN-A / B / D were compared in individuals #3, #34, and #46 of these 8 individuals, deletions, translocations, and inversions were detected in the regions between the designed gRNAs (Figures 21, 22, and 23). When the anther length was measured in these individuals, anther shortening of approximately 20-30% was observed (Figures 24 and 25). [Industrial applicability]

[0137] As described above, the present invention makes it possible to produce wheat having short anthers. Because of its short anthers, the anthers are difficult to extract from the glumes, making it useful in preventing diseases caused by infection with Fusarium fungi (such as Fusarium head blight). Furthermore, since the anthers are difficult to extract from the glumes and pollen is also less likely to be dispersed, it is possible to suppress cross-pollination with other wheat varieties. Therefore, the present invention is useful in the agricultural field related to wheat.

Claims

1. A method for producing wheat having short anther characteristics, A method comprising the step of artificially suppressing the function of three genes in wheat as described in (a) or (c) below. (a) A gene encoding a protein consisting of the amino acid sequence described in SEQ ID NO: 10, a gene encoding a protein consisting of the amino acid sequence described in SEQ ID NO: 12, and a gene encoding a protein consisting of the amino acid sequence described in SEQ ID NO: 14 (c) A gene encoding a protein having an amino acid sequence that is 90% or more identical to the amino acid sequence described in Sequence ID No. 10 and that has the function of suppressing the conferral of short anther traits; a gene encoding a protein having an amino acid sequence that is 90% or more identical to the amino acid sequence described in Sequence ID No. 12 and that has the function of suppressing the conferral of short anther traits; and a gene encoding a protein having an amino acid sequence that is 90% or more identical to the amino acid sequence described in Sequence ID No. 14 and that has the function of suppressing the conferral of short anther traits.

2. A method for producing barley having short anther characteristics, A method comprising the step of artificially suppressing the function of a gene in barley described in (a) or (c) below. (a) A gene encoding a protein consisting of the amino acid sequence described in Sequence ID No. 16, (c) A gene encoding a protein having an amino acid sequence that is 90% or more identical to the amino acid sequence described in Sequence ID No. 16 and that has the function of suppressing the conferral of the short anther trait.

3. Wheat with short anther phenotype in which the function of the three genes described in (a) or (c) below is artificially suppressed. (a) A gene encoding a protein consisting of the amino acid sequence described in SEQ ID NO: 10, a gene encoding a protein consisting of the amino acid sequence described in SEQ ID NO: 12, and a gene encoding a protein consisting of the amino acid sequence described in SEQ ID NO: 14 (c) A gene encoding a protein having an amino acid sequence that is 90% or more identical to the amino acid sequence described in Sequence ID No. 10 and that has the function of suppressing the conferral of short anther traits; a gene encoding a protein having an amino acid sequence that is 90% or more identical to the amino acid sequence described in Sequence ID No. 12 and that has the function of suppressing the conferral of short anther traits; and a gene encoding a protein having an amino acid sequence that is 90% or more identical to the amino acid sequence described in Sequence ID No. 14 and that has the function of suppressing the conferral of short anther traits.

4. Barley having a short-anther trait, in which the function of the gene described in (a) or (c) below is artificially suppressed. (a) A gene encoding a protein consisting of the amino acid sequence described in Sequence ID No. 16, (c) A gene encoding a protein having an amino acid sequence that is 90% or more identical to the amino acid sequence described in Sequence ID No. 16 and that has the function of suppressing the conferral of the short anther trait.

Citation Information

Patent Citations

  • Process for controlling apoptosis of plant tissue or organ and dedicated expression vector therefor

    CN1699580A

  • Method for producing scab-resistant plant and utilization thereof

    JP2011172562A

  • Nucleic acid sequences encoding cell wall-degrading enzymes and use to engineer resistance to fusarium and other pathogens

    US20030131376A1

  • Molecular markers for various traits in wheat and methods of use

    US20140020128A1