Production method for purified dichloroacetic acid

Abstract

The present invention provides a production method for purified dichloroacetic acid and an efficient production method for nucleic acid molecules using same. Specifically, the present invention provides: a production method for purified dichloroacetic acid in which the molar ratio of formaldehyde to dichloroacetic acid is 81×10-5 or lower and the molar ratio of dichloroacetic anhydride to dichloroacetic acid is 20×10-5 or lower, wherein dichloroacetic acid having a formaldehyde and / or dichloroacetic anhydride content higher than the aforementioned ratios is brought into contact with at least one compound having a lower boiling point than dichloroacetic acid selected from the group consisting of aliphatic alcohols, aliphatic amines, and water, and a fraction including an aprotic inert solvent having a boiling point lower than that of dichloroacetic acid is distilled from the produced mixed liquid in the presence of the solvent; and a production method for nucleic acid molecules in which the purified dichloroacetic acid is used as a deprotection agent.

Description

Method for producing purified dichloroacetic acid

[0001] This application claims priority to and the benefit of Japanese Patent Application No. 2021-158346, filed on September 28, 2021, the entire contents of which are incorporated herein by reference. The present invention relates to a method for producing purified dichloroacetic acid, a method for analyzing the same, and a method for synthesizing nucleic acid molecules by the amidite method using purified dichloroacetic acid.

[0002] In recent years, there has been growing interest in the application of nucleic acid molecules in the medical field, including antisense nucleic acids, aptamers, ribozymes, and nucleic acids that induce RNA interference (RNAi), such as siRNA, which are called nucleic acid drugs.

[0003] Nucleic acid molecules can be synthesized by solid-phase synthesis, in which nucleic acid molecules synthesized by extending nucleic acids on a solid support are excised from the solid support, and then, for nucleic acid molecules containing ribose, the protecting group of the hydroxyl group at the 2'-position of the ribose is removed by deprotection to produce the desired nucleic acid molecule. In solid-phase synthesis, nucleoside phosphoramidites (hereinafter referred to as "amidites") are used as raw materials, and it is known that the protecting group of the hydroxyl group at the 5'-position is deprotected using a dichloroacetic acid solution. However, the yield of nucleic acid molecules synthesized using a dichloroacetic acid solution is not always satisfactory, and synthesis is not efficient (Patent Document 1).

[0004] International Publication No. 99 / 43694

[0005] An object of the present invention is to provide an efficient method for producing nucleic acid molecules.

[0006] As a result of extensive research conducted by the present inventors to achieve the above-mentioned object, they have provided an efficient method for producing nucleic acid molecules in which a purified dichloroacetic acid solution containing not more than a certain amount of formaldehyde and dichloroacetic anhydride is used when synthesizing nucleic acid molecules, or the dichloroacetic acid is used after improving its quality, and further, a method for analyzing said dichloroacetic acid.

[0007] The present invention includes, but is not limited to, the following embodiments: 1. The molar ratio of formaldehyde to dichloroacetic acid is 81 x 10 ―５ and the molar ratio of dichloroacetic anhydride to dichloroacetic acid is 20 × 10 ―５ A method for producing purified dichloroacetic acid having the following structure, comprising contacting dichloroacetic acid having a content of both or either of formaldehyde and dichloroacetic anhydride exceeding the above ratio with at least one compound having a boiling point lower than that of dichloroacetic acid, selected from the group consisting of aliphatic alcohols, aliphatic amines, and water, and distilling off a fraction containing an aprotic inert solvent having a boiling point lower than that of dichloroacetic acid from the resulting mixture in the presence of the solvent (hereinafter referred to as the purification method of the present invention). 2. The production method according to item 1 above, wherein the aprotic inert solvent is an aprotic inert solvent having a boiling point of 181°C or lower. 3. The production method according to item 1 or 2 above, wherein the aprotic inert solvent is dichloromethane, acetonitrile, or an aromatic organic solvent. 4. The production method according to item 3 above, wherein the aromatic organic solvent is toluene. 5. The production method according to any one of items 1 to 4 above, wherein the aliphatic alcohol is a C1-C6 aliphatic alcohol. 6. The purified dichloroacetic acid has a molar ratio of formaldehyde to dichloroacetic acid of 41 x 10 ―５ 7. The production method according to any one of items 1 to 5 above, wherein the purified dichloroacetic acid is obtained by subjecting the purified dichloroacetic acid to a molar ratio of dichloroacetic anhydride to dichloroacetic acid of 10×10 ―５ 8. The method according to any one of items 1 to 6, wherein the purified dichloroacetic acid is obtained by dissolving formaldehyde in a dichloroacetic acid solution at a molar ratio of 81×10 to 10. ―６ 8. The production method according to any one of the preceding items 1 to 7, wherein the purified dichloroacetic acid is obtained by subjecting the purified dichloroacetic acid to a molar ratio of dichloroacetic anhydride to dichloroacetic acid of 50×10 ―６ 10. The method for producing a nucleic acid molecule by the amidite method, wherein the molar ratio of formaldehyde to dichloroacetic acid is 81×10 ―５ and the molar ratio of dichloroacetic anhydride to dichloroacetic acid is 20 × 10―５ 11. A method for producing a nucleic acid molecule, comprising the steps of preparing purified dichloroacetic acid represented by the following formula: and reacting the purified dichloroacetic acid with a nucleic acid molecule having a protected hydroxyl group at its 5'-end to remove the protecting group for the hydroxyl group. 12. A method for producing a nucleic acid molecule according to the preceding item 10, wherein the preparation step is the method described in any one of the preceding items 1 to 9. 13. A method for producing a nucleic acid molecule, wherein the nucleic acid molecule having a protected hydroxyl group at its 5'-end is represented by the formula (1): (In the formula, G ２ represents a protecting group for a hydroxyl group, B ａ are each independently the same or different and represent a nucleobase which may be protected with a protecting group; R １ , R ２ and R ３ are each independently the same or different and represent a hydrogen atom or an alkoxy group; R are each independently the same or different and represent a protected hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group; Q' are each independently the same or different and represent a methylene group bonded to the 4' carbon atom of ribose, an ethylene group bonded to the 4' carbon atom of ribose, or an ethylidene group bonded to the 4' carbon atom of ribose; Y are each independently the same or different and represent an oxygen atom or a sulfur atom; n is an integer of 1 to 200; W １ represents an OZ group, and X １ represents an R group, or W １ represents an OV group, and X １ represents an OZ group, V represents a protecting group for a hydroxyl group, and Z is a group having a structure consisting of a solid phase carrier and a linking group. When n is an integer of 2 or more, the nucleic acid molecule represented by formula (1) may have a non-nucleotide linker incorporated between each nucleotide. ), and the deprotected nucleic acid molecule is a nucleic acid molecule represented by formula (2): (In the formula, G ２ , B ａ , R, Y, X １ , W １and n are as defined above, and a non-nucleotide linker may be incorporated between the nucleotides as defined in formula (1). 13. A method for producing a nucleic acid molecule represented by formula (2'): (wherein Y and n are as defined above, and B ｃ are each independently the same or different and represent a nucleic acid base; ４ are each independently the same or different and represent a hydrogen ion, an alkali metal ion, an ammonium ion, an alkylammonium ion, or a hydroxyalkylammonium ion; R' are each independently the same or different and represent a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group; Q' is as defined above; and X ３ and W ３ each independently represents a hydroxyl group, or X ３ represents an R' group, and W ３ represents a hydroxyl group. and a non-nucleotide linker may be incorporated between the nucleotides as defined in formula (1). 14. A method for producing a nucleic acid molecule represented by any one of items 10 to 13 above, wherein the nucleic acid molecule is a nucleic acid molecule containing ribonucleic acid (RNA). 15. A method for producing a nucleic acid molecule according to item 14 above, wherein the nucleic acid molecule is ribonucleic acid (RNA) and the protecting group for the hydroxyl group at the 2'-position of the ribose is a protecting group represented by formula (6). Formula (6): (wherein q represents an integer of 0 to 5; R ａ and R ｂ are each independently the same or different and represent a methyl group, an ethyl group, or a hydrogen atom, * represents the bonding point with the oxygen atom derived from the hydroxyl group at the 2'-position of ribose, and E Ｗ represents an electron-withdrawing group.) 16. R ａ Or R ｂone of which is a methyl group and the other is a hydrogen atom, and E ｗ is a cyano group. 17. The method for production according to any one of items 10 to 16, wherein the nucleic acid molecule is an oligomer having a chain length of 40 or more. 18. The method for production according to any one of items 10 to 16, wherein the nucleic acid molecule is an oligomer having a chain length of 50 or more. 19. The method for production according to any one of items 10 to 16, wherein the nucleic acid molecule is an oligomer having a chain length of 60 or more. 20. The method for production according to any one of items 10 to 16, wherein the nucleic acid molecule is an oligomer having a chain length of 80 or more. 21. The method for production according to any one of items 10 to 16, wherein the nucleic acid molecule is an oligomer having a chain length of 100 or more. 22. 23. A method for analyzing dichloroacetic anhydride contained in a dichloroacetic reagent, comprising reacting a dichloroacetic anhydride-containing dichloroacetic anhydride reagent with an arylalkylamine to convert the dichloroacetic anhydride into the corresponding 2,2-dichloro-N-arylalkylacetamide, and analyzing the resulting amide by high performance liquid chromatography. (In the formula, R １0 , R ２0 and R ３0 are each independently the same or different and represent a hydrogen atom or an alkyl group; １０ represents a hydrogen atom, an alkyl group, or an alkoxy group, and n is an integer of 1 to 5, and 2,2-dichloro-N-arylalkylacetamide is a compound of formula (II): (In the formula, R １0 , R ２0、 R ３0 , X １０ and n is as defined above. 23. The analytical method according to the above item 22, wherein the compound is an amide compound of the formula: １0 , R ２0 , or R ３0 are each independently the same or different and are a hydrogen atom or a C1-C6 alkyl group; X １０is a hydrogen atom, a C1-C6 alkyl group, or a C1-C6 alkoxy group. 25. The analytical method according to any one of the preceding items 22 to 24, wherein 0.01 to 3.0 moles of arylalkylamine are used per mole of dichloroacetic acid. 26. The analytical method according to any one of the preceding items 22 to 24, wherein 0.05 to 2.0 moles of arylalkylamine are used per mole of dichloroacetic acid. 27. The analytical method according to any one of the preceding items 22 to 24, wherein 0.08 to 1.1 moles of arylalkylamine are used per mole of dichloroacetic acid. 28. The analytical method according to any one of the preceding items 22 to 27, wherein the arylalkylamine is benzylamine and the amide compound is 2,2-dichloro-N-benzylacetamide. 29. 29. The analytical method according to any one of items 22 to 28, wherein the reaction between the dichloroacetic acid reagent containing dichloroacetic anhydride and the arylalkylamine is carried out using acetonitrile as a solvent.

[0008] The present invention provides a method for producing purified dichloroacetic acid and an efficient method for producing nucleic acid molecules using the same. The production method of the present invention is expected to improve the yield of produced nucleic acid molecules.

[0009] FIG. 1 is a scheme A showing a typical example of producing a nucleic acid molecule represented by formula (5) from a nucleic acid molecule represented by formula (1). １ As the protecting group for the hydroxyl group to be removed by dichloroacetic acid, any protecting group can be used without any particular limitation, and a wide range of known protecting groups used in amidite compounds can be used. ３ are each independently the same or different and represent an alkyl group, or two G ３ may be bonded to each other to form a cyclic structure. ３ are each independently the same or different and are preferably an alkyl group, such as a methyl group, an ethyl group, a propyl group, or an isopropyl group, and more preferably both are an isopropyl group. Other symbols are as defined above.

[0010] The molar ratio of formaldehyde to dichloroacetic acid is 81 x 10 ―５and the molar ratio of dichloroacetic anhydride to dichloroacetic acid is 20 × 10 ―５ The method for producing purified dichloroacetic acid will be described below.

[0011] The dichloroacetic acid used in the method for producing purified dichloroacetic acid, in which the content of both or either of formaldehyde and dichloroacetic anhydride exceeds the above ratio, can be, for example, a commercially available dichloroacetic acid reagent or one produced by a known method. The amounts of formaldehyde and dichloroacetic anhydride contained in these dichloroacetic acid reagents can be analyzed and used.

[0012] The dichloroacetic acid to be purified in the present invention is a dichloroacetic acid having a molar ratio of formaldehyde to dichloroacetic acid of 81 x 10 ―５ and the molar ratio of dichloroacetic anhydride to dichloroacetic acid is greater than 20 x 10 ―５ 2) the molar ratio of formaldehyde to dichloroacetic acid is greater than 81 x 10 ―５ and the molar ratio of dichloroacetic anhydride to dichloroacetic acid is 20 × 10 ―５ 3) the molar ratio of formaldehyde to dichloroacetic acid is greater than 81 x 10 ―５ and the molar ratio of dichloroacetic anhydride to dichloroacetic acid exceeds 20 × 10 ―５ Examples include the following dichloroacetic acids: According to the purification method of the present invention, these dichloroacetic acids can be purified to reduce the content of formaldehyde and dichloroacetic anhydride to within the desired ratio range of the purification method of the present invention.

[0013] In the purification method of the present invention, at least one compound having a boiling point lower than that of dichloroacetic acid, selected from the group consisting of aliphatic alcohols, aliphatic amines, and water, may be added to dichloroacetic acid in which the content of both or either of formaldehyde and dichloroacetic anhydride exceeds the aforementioned ratio, and then an aprotic inert solvent having a boiling point lower than that of dichloroacetic acid may be added; alternatively, an aprotic inert solvent having a boiling point lower than that of dichloroacetic acid may be added in advance to the dichloroacetic acid reagent to be produced, and then at least one compound having a boiling point lower than that of dichloroacetic acid, selected from the group consisting of aliphatic alcohols, aliphatic amines, and water, may be added.

[0014] Examples of aliphatic alcohols and aliphatic amines having a boiling point lower than that of dichloroacetic acid include C1-C6 aliphatic alcohols and C1-C6 aliphatic amine compounds. Examples of C1-C6 aliphatic alcohols include methanol, ethanol, n-propanol, i-propanol, n-butanol, i-butanol, sec-butanol, t-butanol, n-pentanol, and n-hexanol. Examples of aliphatic amines having a boiling point lower than that of dichloroacetic acid include C1-C6 aliphatic amine compounds. Specific examples include methylamine, ethylamine, propylamine, butylamine, pentylamine, and hexylamine.

[0015] The amounts of the aliphatic alcohol, the aliphatic amine, and water or a mixture thereof used are not particularly limited as long as they are effective for reducing the dichloroacetic anhydride content to the desired range. The effective amounts can be determined by analyzing the amount of dichloroacetic anhydride contained in the dichloroacetic acid reagent using the following method for analyzing dichloroacetic anhydride.

[0016] Examples of aprotic inert solvents having a boiling point lower than that of dichloroacetic acid include aprotic inert solvents having a boiling point of 181° C. or lower, and specific examples include aromatic organic solvents (e.g., toluene, xylene, monochlorobenzene, o-dichlorobenzene, etc.), acetonitrile, dichloromethane, etc. The amount of such solvents used is not particularly limited, but is typically about 0.5 to 20 times by weight relative to the amount of dichloroacetic acid.

[0017] The bath temperature during distillation is usually 20°C to 120°C, and the distillation may be carried out under atmospheric pressure or reduced pressure. The distillation of low-boiling components, mainly consisting of the solvent, does not require the complete removal of the solvent; only a portion of the solvent may be removed. The distillation is usually carried out so that the amount of the solvent removed is in the range of 50% to 75% of the amount of the solvent added. In this way, a purified dichloroacetic acid solution having the desired amounts of dichloroacetic anhydride and formaldehyde is obtained.

[0018] In the synthesis of nucleic acid molecules by the amidite method, the molar ratio of dichloroacetic anhydride to dichloroacetic acid is 10 × 10 ―５ The molar ratio of dichloroacetic anhydride to dichloroacetic acid is preferably 50×10 ―６ The following is more preferred: Purified dichloroacetic acid, in which the molar ratio of formaldehyde to dichloroacetic acid is 41 x 10 ―５ and the molar ratio of formaldehyde to dichloroacetic acid is 81×10 ―６ The following is more preferred:

[0019] A method for analyzing dichloroacetic anhydride contained in a dichloroacetic acid reagent is described below. The analytical method is carried out by reacting a predetermined amount of a sample of the dichloroacetic acid reagent containing dichloroacetic anhydride with an arylalkylamine, usually in an inert solvent, to convert the dichloroacetic anhydride to the corresponding 2,2-dichloro-N-arylalkylacetamide, and analyzing the resulting amide by high-performance liquid chromatography (HPLC).

[0020] The arylalkylamine is exemplified by the compound of formula (I) above, and the resulting 2,2-dichloro-N-arylalkylacetamide is exemplified by the compound of formula (II) above.

[0021] In formulas (I) and (II), R １０ , R ２０ , R ３０ or X １０ The alkyl group in X is preferably a C1-C6 alkyl group, more preferably a methyl group. １０ The alkoxy group in R is preferably a C1-C6 alkoxy group, more preferably a methoxy group. １０ , R ２０ , R ３０ or X １０ is preferably a hydrogen atom, and n = 1. The arylalkylamine is preferably benzylamine.

[0022] The amount of the arylalkylamine used is typically 0.01 to 3.0 mol, preferably 0.05 to 2.0 mol, more preferably 0.08 to 1.1 mol, per 1 mol of dichloroacetic acid.

[0023] The reaction of dichloroacetic acid reagents, including dichloroacetic anhydride, with arylalkylamines is typically carried out in acetonitrile as a solvent.

[0024] Analysis of 2,2-dichloro-N-arylalkylacetamides by HPLC is usually performed using an ODS column. The mobile phase is, for example, a gradient of aqueous formic acid as mobile phase A and acetonitrile as mobile phase B. The UV detection wavelength is typically 254 nm.

[0025] Next, a method for producing nucleic acid molecules by the amidite method, in which the molar ratio of formaldehyde to dichloroacetic acid is 81 × 10 ―５ and the molar ratio of dichloroacetic anhydride to dichloroacetic acid is 20 × 10 ―５A method for producing a nucleic acid molecule will be described below, which includes the steps of preparing purified dichloroacetic acid and reacting the purified dichloroacetic acid with a nucleic acid molecule having a protected hydroxyl group at the 5' end to remove the protecting group.

[0026] The purified dichloroacetic acid used is prepared by the process described above. If it is obtained by a method other than the above, it may be selected from among those obtained by the method described above.

[0027] The protecting group for the hydroxyl group at the 5' position of the nucleic acid molecule is the following G ５ An example of a nucleic acid compound in which the hydroxyl group at the 5'-position is protected is the nucleic acid compound of formula (1). An example of a nucleic acid compound produced by reacting the purified dichloroacetic acid solution is the nucleic acid compound of formula (2). In formulas (1) and (2), examples of compounds represented by Q', which are independently the same or different and represent a methylene group bonded to the carbon atom at the 4'-position of ribose, an ethylene group bonded to the carbon atom at the 4'-position of ribose, or an ethylidene group bonded to the carbon atom at the 4'-position of ribose, include structures represented by LNA-1, LNA-2, or LNA-3 of formula (7) below.

[0028] (In the formula, B a represents an optionally protected nucleobase.

[0029] More specifically, the group represented by Z having a structure consisting of a solid phase carrier and a linking group connecting the solid phase carrier and the oxygen atom of the hydroxyl group at the 2'-position or 3'-position of ribose at the 3'-end of the nucleic acid molecule includes a structure represented by the following formula (8): In formula (8), Sp represents a spacer. Examples of the spacer (Sp) include those having the structural formula shown in formula (9) below.

[0030]

[0031] The linker may have, for example, a structure shown in the following formula (10), or a structure in which the structure of formula (10) does not have a hexamethyleneamino group portion and an aminopropyl group is bonded to Si. Alternatively, the linker may have a structure shown in the following formula (11). (In the formula, A may be any of a hydroxyl group, an alkoxy group, or an alkyl group. Examples of alkoxy groups include a methoxy group and an ethoxy group. Examples of alkyl groups include a methyl group, an ethyl group, an isopropyl group, and an n-propyl group. Si indicates that it is bonded to the oxygen of a hydroxyl group on the surface of the support.) Examples of solid supports include inorganic porous supports and organic resin supports. Examples of inorganic porous supports include controlled pore glass (CPG). Examples of organic resin supports include supports made of polystyrene.

[0032] Nucleosides (ribose and deoxyribose) contained in the nucleic acid molecules used in the present invention include, but are not limited to, DNA, RNA, 2'-O-MOE (2'-O-methoxyethyl), 2'-O-Me, 2'-F RNA, and the above-mentioned LNA.

[0033] The method for synthesizing a nucleic acid molecule by solid phase synthesis, which includes the deprotection step using the purified dichloroacetic acid solution, typically includes the following steps: (1) a step of deprotecting the 5'-hydroxyl group of a nucleoside whose hydroxyl group is protected and bound to a solid-phase support via a linker; (2) a step of coupling the 5'-hydroxyl group produced in the above step with a phosphoramidite compound to obtain a phosphite triester compound; (3) a step of oxidizing the phosphite triester produced in the above step to convert it into a phosphate triester to produce an extended nucleic acid molecule, or an optional step of converting it into a thiophosphate triester; (4) a step of synthesizing a nucleic acid molecule on a solid-phase support by repeating a series of reaction cycles consisting of steps (1) to (3), i.e., a step of deprotecting the 5'-hydroxyl group of the produced nucleic acid molecule, a step of coupling the 5'-hydroxyl group with an amidite compound, and a step of oxidizing the produced phosphite triester, any number of times; and (5) a step of subjecting the nucleic acid molecule on the solid-phase support produced in step (4) to excision and deprotection steps to release it from the solid-phase support to produce a nucleic acid molecule from which the protecting groups have been removed. However, the method for synthesizing a nucleic acid molecule may include, following step (2) or (3), a step of capping the hydroxyl group at the 5'-position that has not undergone the coupling reaction with the phosphoramidite compound, or a capping step may be added between any of the steps in the series of reaction cycles that constitute step (4).

[0034] More specifically, step (5) is carried out by subjecting the nucleic acid molecule on the solid support produced in step (4) to the following steps (5-1) and (5-2) in this order, followed by the reaction in step (5-3). The reaction in step (5-1) may be carried out arbitrarily, and the reaction in step (5-2) may be carried out using the method described in Japanese Patent No. 4705716. As a result, a nucleic acid molecule from which a protecting group has been removed from a nucleic acid molecule released from the solid support, or a nucleic acid molecule in which the hydroxyl group at the 5'-end is protected, can be produced. (5-1) A reaction to deprotect the protecting group at the hydroxyl group at the 5'-end of the nucleic acid molecule; (5-2) A reaction to cleave and release the nucleic acid molecule from the solid support; and (5-3) A reaction to deprotect the protecting group at the 2'-position of the ribose or the 3'-position of the 3'-end of the ribose constituting the nucleic acid molecule.

[0035] The scheme of steps (1) to (5) is shown in Figure 1. The deprotection reaction in step (1) or step (4) shown in Figure 1 is carried out using the purified dichloroacetic acid solution. The definitions of the substituents in the chemical formula in Scheme A are as defined above.

[0036] The nucleic acid compound of formula (1) can be further extended to any desired chain length using a nucleotide or non-nucleotide linker by the amidite method and used to produce the nucleic acid compound of formula (3). The nucleic acid compound alone can also be excised from the nucleic acid compound of formula (3) bound to a solid support, and further deprotected to obtain the nucleic acid molecule of formula (5). The substituents in each formula are explained in more detail below.

[0037] B ａ and a nucleobase optionally protected by a protecting group represented by ｃThe nucleic acid base represented by the formula (I) is not particularly limited. Examples of the nucleic acid base include adenine, cytosine, guanine, uracil, thymine, 5-methylcytosine, pseudouracil, and 1-methylpseudouracil. The nucleic acid base may also be substituted with a substituent. Examples of such substituents include halogen atoms such as fluoro, chloro, bromo, and iodo groups, acyl groups such as acetyl groups, alkyl groups such as methyl and ethyl groups, arylalkyl groups such as benzyl groups, alkoxy groups such as methoxy groups, alkoxyalkyl groups such as methoxyethyl groups, cyanoalkyl groups such as cyanoethyl groups, hydroxy groups, hydroxyalkyl groups, acyloxymethyl groups, amino groups, monoalkylamino groups, dialkylamino groups, carboxy groups, cyano groups, and nitro groups, as well as combinations of two or more of these substituents.

[0038] B ａ The protecting group for the nucleic acid base, which may be protected by a protecting group represented by the formula (I), is not particularly limited, and any protecting group known in nucleic acid chemistry can be used. Examples of such protecting groups include a benzoyl group, a 4-methoxybenzoyl group, a 4-methylbenzoyl group, an acetyl group, a propionyl group, a butyryl group, an isobutyryl group, a phenylacetyl group, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, and a (dimethylamino)methylene group, as well as combinations of two or more of these protecting groups.

[0039] B ａ More specifically,

[0040] (In the above formula, R ４ represents a hydrogen atom, a methyl group, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group, or a benzoyl group; R ５ represents a hydrogen atom, an acetyl group, an isobutyryl group, or a benzoyl group; R ６represents a hydrogen atom, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group, or an isobutyryl group; R ７ represents a 2-cyanoethyl group, R ８ represents a hydrogen atom, a methyl group, a benzoyl group, a 4-methoxybenzoyl group, or a 4-methylbenzoyl group, and R ９ represents a dimethylaminomethylene group.

[0041] B ｃ More specifically, the above B ａ Specific examples include groups obtained by removing the protecting group from the above.

[0042] G １ and G ５ is preferably the following group: (In the formula, R １ , R ２ and R ３ are each independently the same or different and represent a hydrogen atom or an alkoxy group.

[0043] R １ , R ２ and R ３ Preferably, one of G is a hydrogen atom and the remaining two are the same or different (preferably the same) alkoxy groups, and a methoxy group is particularly preferred as the alkoxy group. ５ is a 4,4'-dimethoxytrityl group (DMTr group).

[0044] G ２ There are no particular limitations on the protective group G as long as it can function as a protective group for a hydroxyl group, and a wide range of known protective groups used in amidite compounds can be used. ２Examples of the alkyl group include an alkyl group, an alkenyl group, an alkynyl group, a cycloalkyl group, a haloalkyl group, an aryl group, a heteroaryl group, an arylalkyl group, a cycloalkenyl group, a cycloalkylalkyl group, a cyclylalkyl group, a hydroxyalkyl group, an aminoalkyl group, an alkoxyalkyl group, a heterocyclylalkenyl group, a heterocyclylalkyl group, a heteroarylalkyl group, a silyl group, a silyloxyalkyl group, a mono-, di-, or trialkylsilyl group, and a mono-, di-, or trialkylsilyloxyalkyl group, which may be substituted with one or more electron-withdrawing groups.

[0045] G ２ is preferably an alkyl group substituted with an electron-withdrawing group, such as a cyano group, a nitro group, an alkylsulfonyl group, a halogen atom, an arylsulfonyl group, a trihalomethyl group, or a trialkylamino group, and is preferably a cyano group.

[0046] G ２ Particularly preferred as are the following groups:

[0047] The R １ , R ２ , R ３ and G ２ The alkyl group in the definition may be either linear or branched, and is preferably an alkyl group having 1 to 12 carbon atoms, more preferably an alkyl group having 1 to 6 carbon atoms. Specific examples of the alkyl group include a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, a tert-butyl group, an n-pentyl group, an isopentyl group, and a hexyl group. The alkyl group moiety constituting the alkoxy group in the definition of the substituent has the same definition as the alkyl group herein.

[0048] In the method of the present invention, the amidite compound can be used in its free state or in its salt state. Examples of salts of the amidite compound include, but are not limited to, base addition salts and acid addition salts. Specific examples of base addition salts include salts with inorganic bases such as sodium salts, magnesium salts, potassium salts, calcium salts, and aluminum salts; salts with organic bases such as methylamine, ethylamine, and ethanolamine; salts with basic amino acids such as lysine, ornithine, and arginine; and ammonium salts. Specific examples of acid addition salts include salts with mineral acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, nitric acid, and phosphoric acid; organic acids such as formic acid, acetic acid, propionic acid, oxalic acid, malonic acid, malic acid, tartaric acid, fumaric acid, succinic acid, lactic acid, maleic acid, citric acid, methanesulfonic acid, trifluoromethanesulfonic acid, and ethanesulfonic acid; and acidic amino acids such as aspartic acid and glutamic acid. The amidite compounds also include salts, hydrates, solvates, and crystalline polymorphs.

[0049] R preferably represents a protected hydroxyl group. When R represents a protected hydroxyl group, the protecting group of the hydroxyl group represented by V may be any that can be used in the amidite method, for example, 2'-tert-butyldimethylsilyl (TBS) group, 2'-bis (2-acetoxy) methyl (ACE) group, 2'- (triisopropylsilyloxy) methyl (TOM) group, 2'- (2-cyanoethoxy) ethyl (CEE) group, 2'- (2-cyanoethoxy) methyl (CEM) group, 2'-para - toluylsulfonylethoxymethyl (TEM) group, 2'-EMM group (WO 2006 / 022323), in addition to those described in WO 2013 / 027843 and WO 2019 / 208571 can be used. V is preferably a 2'-tert-butyldimethylsilyl (TBS) group. When the nucleic acid molecule produced by the method of the present invention is a ribonucleic acid (RNA), for example, and contains ribose, the protecting group represented by the formula (6) is a preferred example of a protecting group for the hydroxyl group at the 2'-position of the ribose. More preferably, E ＷAn example of such a protecting group is a protecting group represented by formula (12) having a cyano group as the electron-withdrawing group. (In the formula, q, R ａ and R ｂ has the same meaning as in the formula (6). More preferably, in the group represented by the formula (12), q is 1 and R ａ and R ｂ are simultaneously hydrogen atoms, and q is 1, and R ａ Or R ｂ and the other is a hydrogen atom.

[0050] The protecting group represented by formula (12) can be synthesized, for example, according to the description in WO 2013 / 027843 and WO 2019 / 208571, and an amidite compound having such a protecting group can be used for producing a nucleic acid compound. For the nucleic acid elongation reaction, an amidite compound represented by formula (13) shown in Scheme A in Figure 1 is used.

[0051] Examples of non-nucleotide linkers include linkers consisting of an amino acid backbone (for example, linkers consisting of an amino acid backbone described in Japanese Patent No. 5157168 or Japanese Patent No. 5554881). Specific, non-limiting examples include linkers represented by formula (A14-1) or (A14-2) or (A14-3) (for example, as described in WO 2019 / 074110). In addition to these linkers, examples include the linkers described in WO 2012 / 005368, WO 2018 / 182008, or WO 2019 / 074110. (In the formula, Y is as defined above.)

[0052] Nucleotides and amidites in which the R group in formula (13) and the R′ group in formula (5) are substituents other than a hydroxyl group can be produced from nucleosides synthesized by known methods described in Japanese Patent No. 3745226, WO 2001 / 053528, JP 2014-221817 A, and known methods cited therein. Furthermore, they can be produced using commercially available products in accordance with the methods described in the Examples below or by methods with appropriate modifications to these methods.

[0053] G ４ represents a hydrogen atom, an alkali metal ion, an ammonium ion, an alkylammonium ion, or a hydroxyalkylammonium ion. Examples of alkali metal ions include sodium ions and lithium ions. Specific examples of alkyl groups in the alkylammonium ions include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl, and hexyl groups, and more specific examples include diethylammonium ion, triethylammonium ion, tetrabutylammonium ion, hexylammonium ion, and dibutylammonium ion. Specific examples of hydroxyalkyl moieties in the hydroxyalkylammonium ions include hydroxymethyl, hydroxyethyl, hydroxy-n-propyl, hydroxyisopropyl, hydroxy-n-butyl, and trishydroxymethyl, and more specific examples of hydroxyalkylammonium ions include trishydroxymethylammonium ions. G ４ preferably represents a hydrogen atom.

[0054] G ５ represents a hydrogen atom or a protecting group for the hydroxyl group, and when it represents a protecting group, it is G １ also represent the same protecting group. ５ is a hydrogen atom when deprotected, and the nucleotide compound in this state is also subjected to a series of steps in a nucleic acid elongation reaction.

[0055] Y is preferably an oxygen atom.

[0056] W １ and X １ is preferably W １ represents an OZ group, and X １ represents the R group.

[0057] W ２ and X ２ is preferably W ２ represents a hydroxyl group, and X ２ represents the R group.

[0058] W ３ and X ３ Preferably, each independently represents a hydroxyl group.

[0059] R' is preferably a hydroxyl group.

[0060] In the synthesis of a nucleic acid compound by the amidite method in steps (1) to (5), nucleic acid extension reaction can be carried out according to a generally known method (e.g., the method described in the aforementioned Japanese Patent No. 5,157,168 or Japanese Patent No. 5,554,881), except for the deprotection step related to the present invention in step (1) or step (5) in the scheme of Figure 1. Each step will be described below.

[0061] (Nucleic acid extension reaction) In this specification, the term "nucleic acid extension reaction" refers to a reaction in which nucleotides are sequentially linked via phosphodiester bonds to extend an oligonucleotide. The nucleic acid extension reaction can be carried out according to the general procedure of the phosphoramidite method. The nucleic acid extension reaction may be carried out using an automatic nucleic acid synthesizer or the like that employs the phosphoramidite method.

[0062] The chain length of the nucleic acid molecule may be, for example, 20 mer or more (i.e., n≧19), 40 mer or more (i.e., n≧39), 50 mer or more (i.e., n≧49), 60 mer or more (i.e., n≧59), 80 mer or more (i.e., n≧79), 100 mer or more (i.e., n≧99), 2 to 200 mer (i.e., 1≦n≦199), 10 to 150 mer (i.e., 9≦n≦149), or 15 to 110 mer (i.e., 14≦n≦109).

[0063] The deprotection step of step (1) is a step of deprotecting the protecting group of the 5'-hydroxyl group at the end of the oligonucleotide chain supported on the solid phase support. Common protecting groups include a 4,4'-dimethoxytrityl group (DMTr group), a 4-monomethoxytrityl group, and a 4,4',4"-trimethoxytrityl group. Deprotection can be carried out using an acid. Examples of acids for deprotection include trifluoroacetic acid, dichloroacetic acid, trifluoromethanesulfonic acid, trichloroacetic acid, methanesulfonic acid, hydrochloric acid, acetic acid, and p-toluenesulfonic acid.

[0064] The condensation step of step (2) is a reaction in which a nucleoside phosphoramidite represented by the following formula (13) described in Scheme A of Figure 1 is bonded to the 5' hydroxyl group at the end of the oligonucleotide chain deprotected in the deprotection step. Examples of phosphoramidites used for nucleic acid elongation include formula (13), the uridine EMM amidite described in Example 2 of Japanese Patent No. 5554881, the cytidine EMM amidite described in Example 3, the adenosine EMM amidite described in Example 4, and the guanosine EMM amidite described in Example 5, and the uridine PMM amidite, cytidine PMM amidite, adenosine PMM amidite, and guanosine PMM amidite described in WO 2019 / 208571. Other usable phosphoramidites include 2'-OMe, 2'-F, 2'-O-tert-butyldimethylsilyl, 2'-O-methoxyethyl, 2'-bis(2-acetoxy)methyl (ACE), 2'-(triisopropylsilyloxy)methyl (TOM), 2'-(2-cyanoethoxy)ethyl (CEE), 2'-(2-cyanoethoxy)methyl (CEM), 2'-para-tolylsulfonylethoxymethyl (TEM), 2'-H, and 2'-fluoro-2'-deoxy-β-D-arabinofuranosyl. The nucleoside phosphoramidite used has its 5' hydroxyl group protected with a protecting group (e.g., a DMTr group). The condensation step can be carried out using an activating agent or condensing agent that activates the nucleoside phosphoramidite. Examples of the activating agent or condensing agent include 5-benzylthio-1H-tetrazole (BTT) (also referred to as 5-benzylmercapto-1H-tetrazole), 1H-tetrazole, 4,5-dicyanoimidazole (DCI), 5-ethylthio-1H-tetrazole (ETT), N-methylbenzimidazolium triflate (N-MeBIT), benzimidazolium triflate (BIT), N-phenylimidazolium triflate (N-PhIMT), imidazolium triflate (IMT), 5-nitrobenzimidazolium triflate (NBT), 1-hydroxybenzotriazole (HOBT), and 5-(bis-3,5-trifluoromethylphenyl)-1H-tetrazole.

[0065] The nucleoside phosphoramidite (hereinafter referred to as amidite) represented by formula (13) in Scheme A of Figure 1 is as follows: (In the formula, G １ , G ２ , G ３ , B ａ and R is as defined above.

[0066] After the condensation step, any unreacted 5' hydroxyl groups may be capped, if desired, using a known capping solution such as an acetic anhydride-tetrahydrofuran solution or a phenoxyacetic anhydride / N-methylimidazole solution.

[0067] The oxidation step (3) is a step of converting the phosphite group formed in the condensation step into a phosphate group or a thiophosphate group. This step is a reaction of converting trivalent phosphorus to pentavalent phosphorus using an oxidizing agent, and can be carried out by reacting the oxidizing agent with an oligonucleic acid derivative supported on a solid phase support. When converting a phosphite group into a phosphate group, for example, iodine can be used as the "oxidizing agent." The oxidizing agent can be prepared to a concentration of 0.005 to 2 M. Water can be used as the oxygen source for oxidation, and pyridine, N-methylimidazole (NMI), N-methylmorpholine, triethylamine, or the like can be used as the base to promote the reaction. Furthermore, the solvent is not particularly limited as long as it does not participate in the reaction, and examples thereof include acetonitrile, tetrahydrofuran (THF), and mixed solvents of these in any ratio. For example, iodine / water / pyridine / acetonitrile, iodine / water / pyridine, iodine / water / pyridine / NMI, or iodine / water / pyridine / THF can be used. The reaction temperature is preferably 5°C to 50°C. The reaction time is usually 1 minute to 30 minutes. The amount of the reagent used is preferably 1 to 100 mol, more preferably 1 to 10 mol, per mol of the compound supported on the solid phase carrier.

[0068] When converting a phosphite triester group into a thiophosphate triester group, examples of the "oxidizing agent" that can be used include sulfur, 3H-1,2-benzodithiol-3-one-1,1-dioxide (Beaucage reagent), 3-amino-1,2,4-dithiazole-5-thione (ADTT), 5-phenyl-3H-1,2,4-dithiazol-3-one (POS), [(N,N-dimethylaminomethylidene)amino]-3H-1,2,4-dithiazoline-3-thione (DDTT), and phenylacetyl disulfide (PADS). The oxidizing agent can be diluted with an appropriate solvent to a concentration of 0.001 to 2 M before use. The solvent used in the reaction is not particularly limited as long as it is inert to the reaction, and examples include dichloromethane, acetonitrile, pyridine, and mixed solvents of these in any ratio. The oxidation step may be carried out after the capping step, or conversely, the capping step may be carried out after the oxidation step, and this order is not limited.

[0069] In step (5-1), the protecting group for the 5'-hydroxyl group of the nucleotide introduced at the end of elongation may be used for column purification using the protecting group for the 5'-hydroxyl group as a tag after cleavage from the solid phase support and deprotection of the protecting group, as described below, or the protecting group for the 5'-hydroxyl group may be deprotected after column purification.

[0070] In step (5-2), after the synthesis of a nucleic acid having a desired sequence is completed, an amine compound is reacted with the nucleic acid to remove the protecting group of the phosphate moiety. Examples of the amine compound include diethylamine, which is described in Japanese Patent No. 4705716.

[0071] In step (5-2), the nucleic acid molecule that has been elongated to a desired chain length on the solid support is usually excised from the solid support using concentrated aqueous ammonia as an excision agent.

[0072] Furthermore, the oligonucleotide chain is cleaved from the solid support and recovered using ammonia or an amine compound, etc. Examples of the amine compound include methylamine, ethylamine, isopropylamine, ethylenediamine, and diethylamine.

[0073] In step (5-3), the protecting group for the hydroxyl group at the 2'- or 3'-position of ribose in the nucleic acid compound (4) cleaved from the solid phase carrier in step (5-2) can be removed according to the method described in WO 2006 / 022323), WO 2013 / 027843, or WO 2019 / 208571, to obtain a deprotected nucleic acid molecule (5).

[0074] Nucleic acid molecules that can be produced using the production method of the present invention include, but are not limited to, nucleic acid molecules in which the nucleosides contained therein are RNA, DNA, RNA having 2'-O-MOE, 2'-O-Me, or 2'-F, and LNA. Examples of various nucleosides include those described in Xiulong, Shen et al., Nucleic Acids Research, 2018, Vol. 46, No. 46, 1584-1600, and Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558. Preferably, the nucleic acid molecule produced by the method of the present invention is RNA.

[0075] In addition to the examples described in the Examples, typical examples of nucleic acid molecules that can be used in the production method of the present invention are shown below, but are not limited to these. In the following sequence descriptions, U represents uridine, C represents cytidine, A represents adenosine, and G represents guanosine. Examples include nucleic acid molecules having the following sequences (A) and (B) described in WO 2019 / 060442. Sequence (A): 5'-AUGGAAUmACUCUUGGUUmACdTdT-3' (Antisense) (SEQ ID NO: 1) 21mer Sequence (B): 5'-GUmAACmCmAAGAGUmAUmUmCmCmAUmdTdT-3' (Sense) (SEQ ID NO: 2) 21mer In sequences (A) and (B), Um represents 2'-O-methyluridine, Cm represents 2'-O-methylcytidine, and dT represents thymidine. Examples include the nucleic acid molecule described in Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558 (see page 553). A typical example is a nucleic acid molecule having the following sequence (C): Sequence (C): 5'-AGAGCCAGCCUUCUUAUUGUUUUAGAGCUAUGCUGU-3' (SEQ ID NO: 3) 36mer. Examples include the nucleic acid molecule described in Japanese Patent No. 4,965,745. A typical example is a nucleic acid molecule having the following sequence (D): Sequence (D): 5'-CCAUGAGAAGUAUGACAACAGCC-P-GGCUGUUGUCAUACUUCUCAUGGUU-3' (SEQ ID NO: 4, 5) 49mer. In sequence (D), "P" is represented by the partial structure separated by a wavy line in the following formula (A5). In addition, the description of sequence number 4 in the sequence listing indicates the base sequence of the following sequence (D1) from the 5' end to before "P" of sequence (D), and the description of sequence number 5 indicates the base sequence of the following sequence (D2) from after "P" to the 3' end of sequence (D).Sequence (D1): 5'-CCAUGAGAAGUAUGACAACAGCC-3' (SEQ ID NO: 4) 23mer Sequence (D2): 5'-GGCUGUUGUCAUACUUCUCAUGGUU-3' (SEQ ID NO: 5) 25mer Examples include nucleic acid molecules having the following sequence (E) described in Nucleic Acids Research, 2019, Vol. 47, No. 2: 547. Sequence (E): 5'-ACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU-3' (SEQ ID NO: 6) 67mer Examples include nucleic acid molecules having the following sequence (F) described on page 173 of JP 2015-523856 A. Sequence (F): 5'-GUUUUCCCUUUUCAAAGAAAUCUCCUGGGCACCUAUCUUCUUAGGUGCCCUCCCUUGUUUAAACCUGACCAGUUAACCGGCUGGUUAGGUUUUU-3' (SEQ ID NO: 7) 94mer Examples include the nucleic acid molecules described in JP-A No. 2017-537626. Typical examples include nucleic acid molecules having the following sequences (G), (H), (K), and (J).Sequence (G): 5'-AGUCCUCAUCUCCCUCAAGCGUUUUAGAGCUAGUAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3' (SEQ ID NO: 8) 100mer Sequence (H): 5'-GCAGAUGUAGUGUUUCCACAGUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU-3' (SEQ ID NO: 9) 113mer Sequence (K): 5'-dAdGdTdCdCdTdCdAdTdCdTdCdCdCdTdCdAdAdGdCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU-3' (SEQ ID NO: 10) 113 mer In sequence (K), dT represents thymidine, dC represents 2'-deoxycytidine, dA represents 2'-deoxyadenosine, and dG represents 2'-deoxyguanosine. Sequence (J): 5'-AmsGmsUmsCCUCAUCUCCCUCAAGCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUmsUmsU-3' (SEQ ID NO: 11) 113mer In sequence (J), Um represents 2'-O-methyluridine, Am represents 2'-O-methyladenosine, Gm represents 2'-O-methylguanosine, and s represents a phosphorothioate modification.

[0076] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples. <Measurement methods> First, the various measurement methods used in the following tests are shown below. Oligonucleotide purity was measured using HPLC. The HPLC measurement conditions are shown in Table 1 below. (Measurement method 1: Measurement of oligonucleotide purity)

[0077] (Measurement Method 2: Measurement of Oligonucleotide Yield) OD of Crude Product ２６０The OD was measured. ２６０ represents the UV 260 nm absorbance per 10 mm path length in 1 mL of solution (pH = 7.5). It is generally known that 1 OD = 40 μg for RNA. ２６０ The yield was calculated based on the measured values.

[0078] (Measurement Method 3: Measurement of Formaldehyde Concentration) One method for measuring the formaldehyde concentration in a dichloroacetic acid solution is high performance liquid chromatography. In high performance liquid chromatography, formaldehyde is reacted with acetylacetone, the amount of the resulting 3,5-diacetyl-1,4-dihydrolutidine is measured, and the formaldehyde concentration is calculated. The HPLC measurement conditions are shown in Table 2 below.

[0079] (Measurement Method 4: Measurement of Dichloroacetic Anhydride Concentration) One method for measuring the concentration of dichloroacetic anhydride in a dichloroacetic acid solution is high performance liquid chromatography. In high performance liquid chromatography, dichloroacetic anhydride is reacted with benzylamine, the amount of the resulting N-benzyl-2,2-dichloroacetamide is measured, and the concentration of dichloroacetic anhydride is calculated. The HPLC measurement conditions are shown in Table 3 below.

[0080] <Preparation of Dichloroacetic Acid Solution> The dichloroacetic acid solution used in the following Examples 4 to 6 was prepared by mixing dichloroacetic acid and formaldehyde in a molar ratio of 16×10 ―４ and the molar ratio of dichloroacetic anhydride to dichloroacetic acid is 25×10 ―５Commercially available dichloroacetic acid having a molecular weight of 1000 or less was treated as described in Examples 1 to 3, and toluene was added to the resulting dichloroacetic acid to prepare the dichloroacetic acid. The molar ratio of dichloroacetic acid to formaldehyde (mol formaldehyde / mol dichloroacetic acid) and the molar ratio of dichloroacetic anhydride to dichloroacetic acid in the prepared toluene solution of dichloroacetic acid are shown in Table 5. The number of moles of dichloroacetic acid was calculated based on the weighed amount of the reagent. The absence of chloral was confirmed by GC-MS. For reference, the molar ratios of formaldehyde and dichloroacetic anhydride for other commercially available dichloroacetic acids are shown in the table below.

[0081] Example 1: 92.4 g of the commercially available dichloroacetic acid was mixed with 1.17 g of methanol and 51.2 g of toluene, and the mixture was stirred at 40°C for 2 hours. The mixture was then reduced in pressure to 33 hPa using an evaporator to remove low-boiling components. Toluene was added to the resulting dichloroacetic acid to prepare a 3 v / v% dichloroacetic acid solution. This solution was used in Example 4. Table 5 shows the formaldehyde (mol) / dichloroacetic acid (mol) and dichloroacetic anhydride (mol) / dichloroacetic acid (mol).

[0082] Comparative Example 1: 93.1 g of the commercially available dichloroacetic acid was mixed with 1.17 g of methanol and 1,687 g of toluene to prepare a 3 v / v % dichloroacetic acid solution, which was then allowed to stand at room temperature. This solution was used in Comparative Example 4.

[0083] Example 2: 92.7 g of the commercially available dichloroacetic acid was mixed with 1.17 g of water and 50.6 g of toluene, and the mixture was stirred at 40°C for 2 hours. The mixture was then reduced in pressure to 33 hPa using an evaporator to remove low-boiling components. Toluene was added to the resulting dichloroacetic acid to prepare a 3 v / v% dichloroacetic acid solution. This solution was used in Example 5.

[0084] Comparative Example 2 92.5 g of the commercially available dichloroacetic acid was mixed with 1.17 g of water and 1,687 g of toluene to prepare a 3 v / v % dichloroacetic acid solution, which was then allowed to stand at room temperature. This solution was used in Comparative Example 5.

[0085] Example 3: 92.0 g of the commercially available dichloroacetic acid was mixed with 1.17 g of propylamine and 52.3 g of toluene, and the mixture was stirred at 40°C for 2 hours. The mixture was then reduced in pressure to 33 hPa using an evaporator to remove low-boiling components. Toluene was added to the resulting dichloroacetic acid to prepare a 3 v / v% dichloroacetic acid solution. This solution was used in Example 6.

[0086] Comparative Example 3: 217.0 g of the commercially available dichloroacetic acid was heated in an oil bath at 120°C and distilled at 40 hPa until the fraction exceeded 50%. Toluene was added to the residue to prepare a 3 v / v % dichloroacetic acid solution. This solution was used in Comparative Example 6.

[0087] <Solid-phase synthesis of 50-mer oligonucleotide> Sequence (I): 5'-AAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3' (SEQ ID NO: 12) In sequence (I), "A" is represented by the partial structure separated by a wavy line in formula (A1) below. "C" is represented by the partial structure separated by a wavy line in formula (A2) below. "G" is represented by the partial structure separated by a wavy line in formula (A3) below. "U" at the 3'-terminus is represented by the partial structure separated by a wavy line in formula (A8) below. In addition, "A" at the 5'-terminus in sequence (I) is represented by the partial structure separated by a wavy line in formula (A7) below.

[0088]

[0089]

[0090]

[0091]

[0092]

[0093]

[0094]

[0095] For the synthesis, uridine PMM amidite, cytidine PMM amidite, adenosine PMM amidite, and guanosine PMM amidite described in the above-mentioned International Publication No. 2019 / 208571 were used.

[0096] The uridine derivatives described in the following examples and comparative examples refer to compounds represented by the following structural formula: The circle illustrated in the following structural formula is a schematic representation of CPG.

[0097]

[0098] Example 4: Using controlled pore glass (CPG) loaded with 1.0 μmol of a uridine derivative and PMM amidite, nucleic acid molecules were automatically synthesized from the 3' to the 5' end using an NTS M-4MX-E (manufactured by Nippon Techno Service Co., Ltd.). The automated synthesis procedure was as follows: first, the 3% dichloroacetic acid toluene solution prepared in Example 1 was pumped through the CPG, and the trityl protecting group at the 5' position was deprotected. Subsequently, various amidites and 5-benzylmercapto-1H-tetrazole as a condensing agent were pumped through the CPG, and a coupling reaction with the hydroxyl group at the 5' position proceeded. Subsequently, an oxidation solution containing 50 mM iodine was pumped through the CPG, converting the phosphite group to a phosphate group. Next, 0.1 M phenoxyacetic anhydride acetonitrile solution and 10% N-methylimidazole / 10% 2,6-lutidine acetonitrile solution were used as capping solutions to cap reaction sites where coupling did not proceed. After repeating these steps a total of 49 times, the protecting group (DMTr group) at the 5'-terminal base was deprotected with a 3% dichloroacetic acid toluene solution, and nucleic acid oligonucleotides were synthesized on the CPG support. Then, 1.5 mL of 28% aqueous ammonia and 0.5 mL of ethanol were poured into the CPG support carrying 1.0 μmol of oligonucleotide, and the mixture was incubated at 40°C for 4 hours to release the nucleic acid molecules from the solid support, after which the solvent was removed by concentration. Next, the free oligonucleotide was dissolved in 1.5 mL of dimethyl sulfoxide, followed by the addition of 1.0 mL of acetonitrile, 20 μL of nitromethane, and a stirrer. Then, 2.08 mL of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) that had been dehydrated using molecular sieves 4A was poured into the solution at room temperature while stirring with a stirrer. The mixture was then incubated at 33°C for 4 hours to deprotect the 2'-position protecting group. The nucleic acid molecule product was then obtained by precipitation. The purity of the resulting product was measured using the method described in Measurement Method 1, and was found to be 67%. Furthermore, the yield of the oligonucleotide was measured using the method described in Measurement Method 2, and was found to be 6,068 μg. The results are shown in Table 5.

[0099] Comparative Example 4 Nucleic acid molecules were obtained in the same manner as in Example 4, except that the 3% dichloroacetic acid toluene solution prepared in Comparative Example 1 was used instead. The purity of the oligonucleotide was measured using the method described in Measurement Method 1, and the product purity was found to be 51%. Furthermore, the yield of the oligonucleotide was measured using the method described in Measurement Method 2, and the yield was found to be 5,303 μg. The results are shown in Table 5.

[0100] Example 5 Nucleic acid molecules were obtained in the same manner as in Example 4, except that the 3% dichloroacetic acid toluene solution prepared in Example 2 was used instead. The purity of the oligonucleotide was measured using the method described in Measurement Method 1, and the product purity was found to be 70%. Furthermore, the yield of the oligonucleotide was measured using the method described in Measurement Method 2, and the yield was found to be 6034 μg. The results are shown in Table 5.

[0101] Comparative Example 5 Nucleic acid molecules were obtained in the same manner as in Example 4, except that the 3% dichloroacetic acid toluene solution prepared in Comparative Example 2 was used instead of the 3% dichloroacetic acid toluene solution. The purity of the oligonucleotide was measured using the method described in Measurement Method 1, and the product purity was found to be 37%. Furthermore, the yield of the oligonucleotide was measured using the method described in Measurement Method 2, and the yield was found to be 4003 μg. The results are shown in Table 5.

[0102] Example 6 Nucleic acid molecules were obtained in the same manner as in Example 4, except that the 3% dichloroacetic acid toluene solution prepared in Example 3 was used instead. The purity of the oligonucleotide was measured using the method described in Measurement Method 1, and the product purity was found to be 65%. Furthermore, the yield of the oligonucleotide was measured using the method described in Measurement Method 2, and the yield was found to be 6,144 μg. The results are shown in Table 5.

[0103] (Comparative Example 6) Nucleic acid molecules were obtained in the same manner as in Example 4, except that the 3% dichloroacetic acid toluene solution prepared in Comparative Example 3 was used instead of the 3% dichloroacetic acid toluene solution. The purity of the oligonucleotide was measured using the method described in Measurement Method 1 above, and the purity of the product was found to be 43%. The yield of the oligonucleotide was also measured using the method described in Measurement Method 2 above, and was found to be 4492 μg. The results are shown in Table 5.

[0104]

[0105] From the results in Table 5 above, in Examples 4 to 6 in which dichloroacetic acid of the present invention was used, nucleic acid molecules were obtained in higher yield and purity than in Comparative Examples 4 to 6 in which dichloroacetic acid was used.

[0106] The present invention provides a method for producing purified dichloroacetic acid and an efficient method for producing nucleic acid molecules using the same. Furthermore, an improvement in the yield of nucleic acid molecules produced by the method is expected.

[0107] SEQ ID NOs: 1 to 12 in the sequence listing represent the base sequences of the oligonucleotides produced according to the production method of the present invention.

Claims

1. The molar ratio of formaldehyde to dichloroacetic acid is 81×10 ―５ or less, and the molar ratio of dichloroacetic anhydride to dichloroacetic acid is 20×10 ―５ or less, which is a method for producing purified dichloroacetic acid Dichloroacetic acid, in which the content of either or both of formaldehyde and dichloroacetic anhydride exceeds the above ratio, is contacted with at least one compound having a lower boiling point than dichloroacetic acid selected from the group consisting of aliphatic alcohols, aliphatic amines, and water, and in the presence of an aprotic inert solvent having a lower boiling point than dichloroacetic acid, a fraction containing the solvent is distilled off from the resulting mixture. A method for producing the purified dichloroacetic acid.

2. The production method according to claim 1, wherein the aprotic inert solvent is an aprotic inert solvent having a boiling point of 181 ° C or lower.

3. The production method according to claim 1, wherein the aprotic inert solvent is dichloromethane, acetonitrile, or an aromatic organic solvent.

4. The production method according to claim 3, wherein the aromatic organic solvent is toluene.

5. The production method according to claim 1, wherein the aliphatic alcohol is a C1-C6 aliphatic alcohol.

6. The molar ratio of formaldehyde to dichloroacetic acid in the purified dichloroacetic acid is 41×10 ―５ The production method according to any one of claims 1 to 5, wherein the ratio is 41×10 ―５ or less.

7. The purified dichloroacetic acid has a molar ratio of dichloroacetic anhydride to dichloroacetic acid of 10×10 ―５ The production method according to any one of claims 1 to 5, wherein the ratio is 10×10 or less. ―５

8. The molar ratio of formaldehyde to dichloroacetic acid in the purified dichloroacetic acid is 81×10 ―６ The production method according to any one of claims 1 to 5, wherein the ratio is 81×10

9. The molar ratio of dichloroacetic anhydride to dichloroacetic acid in the purified dichloroacetic acid is 50×10 ―６ The production method according to any one of claims 1 to 5, wherein the molar ratio is 50×10

10. A method for producing a nucleic acid molecule by the amidite method, wherein the molar ratio of formaldehyde to dichloroacetic acid is 81×10 ―５ or less, and a step of preparing purified dichloroacetic acid in which the molar ratio of dichloroacetic anhydride to dichloroacetic acid is 20×10 ―５ or less, and a step of reacting the purified dichloroacetic acid with a nucleic acid molecule having a protected hydroxyl group at the 5'-end to remove the protecting group of the hydroxyl group.

11. The production method according to claim 10, wherein the preparation step is the method according to any one of claims 1 to 5.

12. A nucleic acid molecule having a protected hydroxyl group at the 5'-end is represented by the formula (1): 【Chemical 1】 (In the formula, G ２ represents a protecting group for a hydroxyl group, B ａ each independently represents a nucleobase which may be protected with a protecting group and which may be the same or different R １ , R ２ and R ３ each independently represents the same or different hydrogen atom or alkoxy group, R each independently represents, identically or differently, a protected hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group, Q' each independently represents, identically or differently, a methylene group bonded to the 4'-carbon atom of ribose, an ethylene group bonded to the 4'-carbon atom of ribose, or an ethylidene group bonded to the 4'-carbon atom of ribose, Y each independently represents, identically or differently, an oxygen atom or a sulfur atom, n represents any integer from 1 to 200, W １ represents an OZ group and X １ represents an R group or W １ represents an OV group and X １ represents an OZ group, V represents a protecting group for a hydroxyl group, Z is a group having a structure composed of a solid-phase carrier and a linking group. And when n is an integer of 2 or more, in the nucleic acid molecule represented by the formula (1), a non-nucleotide linker may be incorporated between each nucleotide.) is a nucleic acid molecule represented by The deprotected nucleic acid molecule is represented by the formula (2): 【Chemical 2】 (In the formula, G ２ 、B ａ 、R, Y, X １ 、W １ and n are as described above, and, As defined in formula (1), a non-nucleotide linker may be incorporated between nucleotides.) The production method according to claim 10, which is a nucleic acid molecule represented by

13. The process according to claim 12, further comprising the step of removing the group represented by Z from the nucleic acid molecule represented by formula (2) generated in the said process, and the step of removing the protecting groups of the hydroxyl group and the nucleobase, to obtain a nucleic acid molecule represented by formula (2'): 【Chemical Formula 3】 (In the formula, Y and n are as defined above, B ｃ each independently represents the same or a different nucleobase, G ４ each independently represents the same or different hydrogen ion, alkali metal ion, ammonium ion, alkylammonium ion, or hydroxyalkylammonium ion, each R' independently represents the same or different hydroxyl group, hydrogen atom, fluorine atom, methoxy group, 2-methoxyethyl group, or OQ' group, Q' is as defined above, and X ３ and W ３ each independently represents a hydroxyl group or X ３ represents an R' group and W ３ represents a hydroxyl group. And as defined in formula (1), a non-nucleotide linker may be incorporated between the nucleotides.) A method for producing a nucleic acid molecule represented by the formula.

14. The production method according to any one of claims 10, 12, and 13, wherein the nucleic acid molecule is a nucleic acid molecule containing ribonucleic acid (RNA).

15. The production method according to claim 14, wherein the nucleic acid molecule is ribonucleic acid (RNA), and the protecting group of the hydroxyl group at the 2'-position of the ribose is the protecting group represented by formula (6). Formula (6): 【Chemical Formula 4】 (In the formula, q represents any integer from 0 to 5, R ａ and R ｂ each independently represents the same or different methyl group, ethyl group or hydrogen atom, the * mark represents the bonding point with the oxygen atom derived from the hydroxyl group at the 2'-position of the ribose, and E Ｗ represents an electron-withdrawing group.)

16. R ａ Alternatively, R ｂ either one is a methyl group and the other is a hydrogen atom, and E ｗ is a cyano group, the production method according to claim 15.

17. The production method according to any one of claims 10, 12, and 13, wherein the nucleic acid molecule is an oligomer having a chain length of 40 or more.

18. The production method according to any one of claims 10, 12, and 13, wherein the nucleic acid molecule is an oligomer having a chain length of 50 or more.

19. The production method according to any one of claims 10, 12, and 13, wherein the nucleic acid molecule is an oligomer having a chain length of 60 or more.

20. The production method according to any one of claims 10, 12, and 13, wherein the nucleic acid molecule is an oligomer having a chain length of 80 or more.

21. The production method according to any one of claims 10, 12, and 13, wherein the nucleic acid molecule is an oligomer having a chain length of 100 or more.

22. A method for analyzing dichloroacetic anhydride contained in a dichloroacetic acid reagent, which comprises reacting the dichloroacetic acid reagent containing dichloroacetic anhydride with an arylalkylamine to convert the dichloroacetic anhydride into the corresponding 2,2-dichloro-N-arylalkylacetamide, and analyzing the produced amide by high performance liquid chromatography.

23. The arylalkylamine is a compound of formula (I): [Chemical Formula 5] (In the formula, R １0 , R ２0 and R ３0 each independently represents the same or different hydrogen atom or alkyl group, X １０ represents a hydrogen atom, an alkyl group or an alkoxy group, n is any integer from 1 to 5.) and 2,2-dichloro-N-arylalkylacetamide is Formula (II): [Chemical Formula 6] (wherein R １0 , R ２0 , R ３0 , X １０ and n are as described above.) The analysis method according to claim 22, which is an amide compound.

24. R １0 , R ２0 and R ３0 are each independently the same or different and are a hydrogen atom or a C1-C6 alkyl group, and X １０ is a hydrogen atom, a C1-C6 alkyl group, or a C1-C6 alkoxy group, the analysis method according to claim 23.

25. The analysis method according to any one of claims 22 to 24, wherein 0.01 to 3.0 moles of arylalkylamine is used per mole of dichloroacetic acid.

26. The analysis method according to any one of claims 22 to 24, wherein 0.05 to 2.0 moles of arylalkylamine is used per mole of dichloroacetic acid.

27. The analysis method according to any one of claims 22 to 24, wherein 0.08 to 1.1 moles of arylalkylamine is used per mole of dichloroacetic acid.

28. The analysis method according to any one of claims 22 to 24, wherein the arylalkylamine is benzylamine and the amide compound is 2,2-dichloro-N-benzylacetamide.

29. The analysis method according to any one of claims 22 to 24, wherein the reaction of the dichloroacetic acid reagent containing dichloroacetic anhydride and the arylalkylamine is carried out using acetonitrile as a solvent.

Images