Composition containing nucleic acid oligomer

Abstract

The present invention provides: a stable composition containing a nucleic acid oligomer having a phosphorothioate bond; a method for producing same; and a method for efficiently producing said nucleic acid oligomer from said composition. This composition containing a nucleic acid oligomer having a phosphorothioate bond represented by formula (1) (in the formula, each sign is as defined in the description), an alkylammonium salt, a nitrile-based organic solvent, water, and an additive that contains at least one compound selected from the group consisting of compounds represented by formulae (3a) to (3h), is a stable composition.

Description

Compositions containing nucleic acid oligomers

[0001] The present invention relates to compositions comprising nucleic acid oligomers, and more particularly to compositions comprising phosphorothioate-containing nucleic acid oligomers.

[0002] In recent years, there has been growing interest in the application of nucleic acid oligomers in the medical field, including antisense nucleic acids, aptamers, ribozymes, and nucleic acids that induce RNA interference (RNAi), such as siRNA, which are called nucleic acid drugs.

[0003] Nucleic acid oligomers are known to be synthesized by solid-phase synthesis, and nucleic acid oligomers having phosphorothioate bonds are also known as useful compounds that can be synthesized by the solid-phase method (Patent Document 1).

[0004] International Publication No. 2017 / 068377

[0005] Nucleic acid oligomers having phosphorothioate bonds may have stability problems during their production process. An object of the present invention is to provide a stable composition containing a nucleic acid oligomer having phosphorothioate bonds, a method for producing the same, and an efficient method for producing the nucleic acid oligomer from the composition.

[0006]

[0003] As a result of extensive research aimed at achieving the above-mentioned object, the present inventors have found that a composition can be stabilized by mixing a crude nucleic acid oligomer having phosphorothioate bonds, which is produced by the phosphoramidite method in solid-phase synthesis, with an alkylammonium salt, a nitrile organic solvent, water, and a certain additive, which is then subjected to reverse-phase chromatography. Therefore, the present invention provides said composition, a method for producing the same, and an efficient method for producing a nucleic acid oligomer from said composition.

[0007] The present invention includes, but is not limited to, the following aspects.

[0008] 1. Formula (1): (In the formula, B Ｃare each independently the same or different and represent a nucleobase, R are each independently the same or different and represent a hydrogen atom, a fluorine atom, or an OQ group, Q are each independently the same or different and represent a hydrogen atom, a methyl group, a 2-methoxyethyl group, a methylene group bonded to the 4' carbon atom of ribose, an ethylene group bonded to the 4' carbon atom of ribose, or an ethylidene group bonded to the 4' carbon atom of ribose, X are each independently the same or different and represent an oxygen atom or a sulfur atom (with the proviso that at least one X represents a sulfur atom), Y represents a hydrogen atom or a protecting group for a hydroxyl group, G represents an ammonium ion, an alkylammonium ion, an alkali metal ion, a hydrogen ion, or a hydroxyalkylammonium ion, and n is an integer satisfying formula (2): 15≦n (2). The composition comprises a nucleic acid oligomer having a phosphorothioate bond represented by the formula (3a), an alkylammonium salt, a nitrile-based organic solvent, water, and an additive, wherein the additive comprises at least one compound selected from the group consisting of compounds represented by the following formulas (3a) to (3h): Formula (3a): P(L １ ) ３ , Formula (3b): P(OL １ ) ３ , Formula (3c): P(L １ ) ２ (OL １ ), Formula (3d): PL(OL １ ) ２ , Formula (3e): PH(O)(OL １ ) ２ , Formula (3f): PH(O)L １ (OL １ ), Formula (3g): (P(L １ ) ２ ) ２ -L ２ , Formula (3h): , (In each of formulas (3a) to (3h), L １are each independently the same or different and represent a C6-10 aryl group optionally substituted by 1 to 3 substituents selected from the group consisting of a C1-6 alkyl group and a C1-6 alkoxy group, or a C1-6 alkyl group; L ２ are each independently the same or different and represent a C6-14 arylene group or a C1-6 alkylene group optionally substituted by 1 to 3 substituents selected from the group consisting of a C1-6 alkyl group and a C1-6 alkoxy group, and ３ represents a C6-14 arylene group optionally substituted by 1 to 3 substituents selected from the group consisting of a C1-6 alkyl group and a C1-6 alkoxy group.

[0009] 2. The composition according to item 1 above, wherein the additive is at least one compound selected from the group consisting of triphenylphosphine, diethyl phosphite, triethyl phosphite, diethoxyphenylphosphine, ethoxydiphenylphosphine, and 9,10-dihydro-9-oxa-10-phosphaphenanthrene-10-oxide.

[0010] 3. The composition according to any one of items 1 and 2 above, wherein the alkylammonium salt is at least one alkylammonium salt selected from the group consisting of monoalkylammonium salts and dialkylammonium salts.

[0011] 4. The composition according to any one of items 1 to 3 above, wherein the nitrile-based organic solvent is acetonitrile.

[0012] 5. The composition according to any one of items 1 to 4 above, wherein in formula (1), each R is independently a hydroxy group or a methoxy group.

[0013] 6. A method for producing a nucleic acid oligomer, comprising mixing the composition according to any one of items 1 to 5 above with at least one solvent selected from the group consisting of C1-4 alcohols, tetrahydrofuran, and dioxane, and isolating the precipitated nucleic acid oligomer.

[0014] 7. A method for producing the composition according to any one of items 1 to 5 above, comprising subjecting a crude product of the nucleic acid oligomer of formula (1) synthesized by solid-phase synthesis to reverse-phase column chromatography to obtain a column eluate containing the nucleic acid oligomer of formula (1), an alkylammonium salt, a water-soluble organic solvent, and water, and mixing the column eluate with an additive.

[0015] The present invention provides a stable composition containing a nucleic acid oligomer having a phosphorothioate bond, and an efficient method for producing the nucleic acid oligomer using the same.

[0016] FIG. 1 shows an example of synthesis of a nucleic acid oligomer by the phosphoramidite method.

[0017] The present invention provides a composition comprising a nucleic acid oligomer having a phosphorothioate bond represented by the formula (1), an alkylammonium salt, a nitrile organic solvent, water, and an additive, wherein the additive is at least one compound selected from the group consisting of a compound having a disulfide bond and a compound having a sulfide bond. Ｃ The nucleobase represented by the formula (hereinafter sometimes referred to as "base") may be a natural or unnatural nucleobase. Examples of such unnatural nucleobases include modified analogues of natural or unnatural nucleobases. Typical examples of nucleobases include purine compounds and pyrimidine compounds, and examples thereof include those described in U.S. Pat. No. 3,687,808, "Concise Encyclopedia of Polymer Science and Engineering", pp. 858-859, edited by Kroschwitz J.I., John Wiley & Sons, 1990, and English et al., Angewandte Chemie, International Edition, 1991, Vol. 30, p. 613 are exemplified.

[0018] Specific examples include purine bases such as adenine, isoguanine, xanthine, hypoxanthine, and guanine; and pyrimidine bases such as cytosine, uracil, and thymine.

[0019] Furthermore, B Ｃ Examples of nucleic acid bases represented by the formula (I) include amino derivatives such as 2-aminoadenine, 2-aminopurine, and 2,6-diaminopurine; alkyl derivatives such as 5-methyluracil, 5-methylcytosine, 7-methylguanine, 6-methylpurine, and 2-propylpurine; 5-halouracil and 5-halocytosine; 5-propynyluracil and 5-propynylcytosine; 6-azauracil, 6-azacytosine, and 6-azathymine; 5-uracil (pseudouracil), 4-thiouracil, 5-(2-aminopropyl)uracil, and 5-aminoallyluracil; 8-halo-, aminated, thiolated, thioalkylated, hydroxylated, and other 8-substituted purines; 5-trifluoromethylated and other 5-substituted pyrimidines; 6-azapyrimidines; N-2, N-6, and O-6 substituted purines (including 2-aminopropyladenine); dihydro Uracil; 3-deaza-5-azacytosine; 7-deazaadenine; N6-methyladenine, N6,N6-dimethyladenine; 5-amino-allyl-uracil; N3-methyluracil; substituted 1,2,4-triazoles; 2-pyridinone; 5-nitroindole; 3-nitropyrrole; 5-methoxyuracil; uracil-5-oxyacetic acid; 5-methoxycarbonylmethyluracil; 2-thiouracil, 5-methyl-2 2-thiocytosine; N6-methyladenine; N6-isopentyladenine; 2-methylthio-N6-isopentenyladenine; N-methylguanine; O-alkylated bases, and the like.

[0020] When R represents an OQ group and Q represents a methylene group bonded to the 4' carbon atom of ribose, an ethylene group bonded to the 4' carbon atom of ribose, or an ethylidene group bonded to the 4' carbon atom of ribose, the structure is represented by the structures of LNA-1, LNA-2, and LNA-3 shown in the following formula (3):

[0021]

[0022] (In the formula, B ｃ represents a nucleobase as defined above.)

[0023] The hydroxyl-protecting group represented by Y can be any group that can function as a protecting group in the amidite method, and for example, a wide range of known protecting groups used for amidite compounds can be used. The hydroxyl-protecting group represented by Y is preferably the following group:

[0024]

[0025] (In the formula, R １ , R ２ and R ３ are each independently the same or different and represent hydrogen or an alkoxy group.) An example of the alkoxy group is a methoxy group.

[0026] The chain length of the nucleic acid oligomer of formula (1) is n≧15. An example of an upper limit of the chain length is n≦200. In the nucleic acid oligomer, at least one of the n X's may be a sulfur atom, or all of the X's may be sulfur atoms. For example, when n=103, the number of sulfur atoms may be 6, 12, or 20.

[0027] The nucleic acid oligomer of formula (1) may be, for example, a DNA or RNA oligomer, or these oligomers may contain unnatural nucleic acid bases. The nucleic acid oligomer is typically a single-stranded DNA or RNA oligomer. In the nucleic acid oligomer of formula (1), the substituents R are preferably each independently a hydroxy group or a methoxy group. The nucleic acid oligomer is preferably an RNA nucleic acid oligomer of formula (1) in which the substituents R are each independently a hydroxy group or a methoxy group. More specifically, a nucleic acid oligomer containing both a nucleotide in which the substituent R is a hydroxy group and a nucleotide in which the substituent R is a methoxy group is preferred.

[0028] The concentration of the nucleic acid oligomer in the composition is usually 0.05 mg / mL to 5 mg / mL, preferably 0.05 mg / mL to 1 mg / mL, and more preferably 0.1 mg / mL to 0.5 mg / mL.

[0029] As the alkylammonium salt, typically, a monoalkylammonium salt, a dialkylammonium salt, or a trialkylammonium salt is used, preferably a monoalkylammonium salt or a dialkylammonium salt, more preferably a dialkylammonium salt. The monoalkylamine forming the monoalkylammonium salt preferably has 3 to 10 carbon atoms, more preferably 4 to 6 carbon atoms, and even more preferably hexylamine. The dialkylamine forming the dialkylammonium salt preferably has 4 to 10 carbon atoms, more preferably 5 to 9 carbon atoms. A preferred dialkylamine is di-n-butylamine. The trialkylamine forming the trialkylammonium salt preferably has 6 to 12 carbon atoms, more preferably 6 to 9 carbon atoms, and a specific example is triethylamine.

[0030] Examples of acids that form the monoalkylammonium salts, dialkylammonium salts, and trialkylammonium salts include carbonic acid, acetic acid, formic acid, trifluoroacetic acid, and propionic acid.

[0031] The concentration of the ammonium salt is usually 1 to 200 mM, preferably 5 to 150 mM, and more preferably 20 to 100 mM.

[0032] An example of the nitrile-based organic solvent is acetonitrile. The amount of the nitrile-based organic solvent in the composition is typically 10 to 70%, preferably 20 to 60%, and more preferably 30 to 50% based on the total mass of the composition (all percentages above represent mass %). The composition may further contain an alcohol-based organic solvent. Examples of alcohol-based organic solvents include C1-4 alcohols, with C1-3 alcohols being preferred, C1-2 alcohols being more preferred, and methanol being even more preferred. The amount of the alcohol-based organic solvent in the composition is typically 0 to 20%, preferably 0 to 15%, and more preferably 0 to 10% based on the total mass of the composition (all percentages above represent mass %).

[0033] The amount of water may be any amount that strikes a balance so as to satisfy the concentration ranges of the above-mentioned components, and is usually 90% to 30%, preferably 80% to 40%, and more preferably 70% to 40% based on the total mass of the composition (all percentages above represent mass %).

[0034] At least one compound selected from the group consisting of compounds represented by the formulas (3a) to (3h) will now be described. １In the C6-10 aryl group optionally substituted with 1 to 3 substituents selected from the group consisting of C1-6 alkyl groups and C1-6 alkoxy groups represented by the formula (3a), examples of the C1-6 alkyl group include methyl, ethyl, propyl, butyl, pentyl, and hexyl groups. Of these alkyl groups, C1-4 alkyl groups are more preferred, and C1-2 alkyl groups are even more preferred. Examples of C1-6 alkoxy groups include methoxy, ethoxy, propoxy, butoxy, pentyloxy, and hexyloxy groups. Examples of C6-10 aryl groups include phenyl, 1-naphthyl, and 2-naphthyl groups, with phenyl being preferred. Examples of C6-10 aryl groups substituted with 1 to 3 substituents selected from the group consisting of C1-6 alkyl groups and C1-6 alkoxy groups include, for example, tolyl and methoxyphenyl groups. A specific example of the compound represented by formula (3a) is triphenylphosphine. L １ Examples of the C1-6 alkyl group represented by formula (3b) include the same groups as those described above. A specific example of the compound represented by formula (3b) is triethyl phosphite. A specific example of the compound represented by formula (3c) is ethoxydiphenylphosphine. A specific example of the compound represented by formula (3d) is diethoxyphenylphosphine. A specific example of the compound represented by formula (3e) is diethyl phosphite. A specific example of the compound represented by formula (3f) is ethyl phenylphosphinate.

[0035] L ２ Examples of the C6-14 arylene group, which may be substituted with 1 to 3 substituents selected from the group consisting of a C1-6 alkyl group and a C1-6 alkoxy group, include a 1,2-phenylene group, a 1,8-naphthylene group, and a 1,6-biphenylene group. ２ Examples of the C1-6 alkylene group represented by the formula (I) include a methylene group, an ethylene group, a propylene group, a butylene group, a pentylene group, and a hexylene group. ３The C6-14 arylene group optionally substituted with 1 to 3 substituents selected from the group consisting of a C1-6 alkyl group and a C1-6 alkoxy group is represented by the formula: ２ Examples of the compound represented by formula (3g) include 1,2-bis(diphenylphosphino)benzene, 1,8-bis(diphenylphosphino)naphthalene, and 2,2'-bis(diphenylphosphino)biphenyl. Examples of the compound represented by formula (3h) include 9,10-dihydro-9-oxa-10-phosphaphenanthrene-10-oxide.

[0036] The concentration of the additive is usually 0.1 μM to 100 mM, preferably 1 mM to 10 mM.

[0037] The composition of the present invention is typically obtained by subjecting a crude product of a nucleic acid oligomer of formula (1) synthesized by solid-phase synthesis to reversed-phase column chromatography using a mobile phase containing an alkylammonium salt, a water-soluble organic solvent, and water, and then adding the additive to the column eluate. Alternatively, the composition of the present invention may be prepared as an elution fraction of reversed-phase column chromatography by using a mobile phase containing the additive in advance. Here, the water-soluble organic solvent refers to an organic solvent including the nitrile-based water-soluble organic solvent and, if appropriate, a hydrophilic organic solvent commonly known in the organic field (e.g., the alcohol-based organic solvent).

[0038] The eluted fractions obtained by reversed-phase column chromatography are analyzed for composition by UV absorption at a wavelength of 260 nm under chromatographic conditions generally used for nucleic acid separation and analysis, and then selected and collected. The purified target nucleic acid oligomers having a predetermined amount of phosphorothioate linkages are obtained from the collected fractions. The analytical method can be, for example, the method described in the non-patent document (Handbook of Analysis of Oligonucleotides and Related Products, CRC Press).

[0039] Examples of packing materials for reversed-phase column chromatography include silica or polymers that serve as hydrophobic stationary phases, such as silica or polymers to which one or more groups selected from a phenyl group, an alkyl group having 1 to 20 carbon atoms, and a cyanopropyl group are immobilized. The silica or polymer used as such packing materials has a particle size of, for example, 2 μm or more, or 5 μm or more.

[0040] The mobile phase used in reversed-phase column chromatography is, for example, a mobile phase containing an aqueous solution of an ammonium salt having the above-mentioned concentration and pH, and a mobile phase containing the above-mentioned water-soluble organic solvent, the concentration of which is gradually increased over a gradient. The temperature for reversed-phase column chromatography is usually 20 to 100°C, preferably 30 to 80°C, and more preferably 40 to 70°C. The composition of the present invention is typically obtained as an eluate fraction from the above-mentioned reversed-phase column chromatography.

[0041] For example, after the storage step, the composition of the present invention may be subjected to one or more post-treatment steps selected from a reprecipitation step, a separation step, an ultrafiltration step, a deprotection step, and a freeze-drying step to isolate the nucleic acid oligomer. During the storage step, the atmosphere in the storage container may be replaced with an inert gas. Examples of inert gases include nitrogen gas, argon gas, and helium gas.

[0042] In the reprecipitation step, the stabilized solution is brought into contact with a poor solvent to precipitate and isolate the nucleic acid oligomer. If necessary, the liquid portion may be removed from the solid-liquid separation, and the precipitated nucleic acid oligomer may be collected and isolated by filtration or the like. Examples of poor solvents for the reprecipitation step include C1-C4 organic solvents having at least one oxygen atom (e.g., C1-C4 alcohol, tetrahydrofuran, dioxane). Preferred such solvents are ethanol or isopropanol.

[0043] In the separation step, the stabilized solution is mixed with at least one of an acidic aqueous solution such as an aqueous acetic acid solution, water, and saline, and then a water-immiscible organic solvent is added to separate the solution into an aqueous layer and an organic layer, thereby obtaining the aqueous layer containing the desired nucleic acid oligomer.

[0044] In the ultrafiltration step, an ultrafiltration membrane can be used to separate nucleic acid oligomers present in the solution after the storage step from low molecular weight components having a molecular weight equal to or less than a desired value.

[0045] If the nucleic acid oligomer has a protecting group at the 5'-end, the protecting group of the nucleic acid oligomer can be deprotected by mixing an acidic aqueous solution such as an acetic acid solution or a solution in which an acidic substance such as acetic acid is dissolved in an organic solvent with the solution after the storage step.

[0046] In the freeze-drying process, the water in the frozen aqueous solution of nucleic acid oligomers is sublimated by reducing the pressure, and the nucleic acid oligomers can be separated from the water.

[0047] Synthesis of nucleic acid oligomers by the phosphoramidite method can be carried out by nucleic acid extension reaction according to known methods (e.g., the methods described in the aforementioned Japanese Patent No. 5157168 or Japanese Patent No. 5554881). Regarding the production of nucleic acid oligomers by the phosphoramidite method, the synthesis of RNA according to the scheme shown in Figure 1 will be taken as an example, and the method for producing nucleic acid oligomers will be explained with reference to the reaction pathways shown below (e.g., condensation reaction, oxidation, deprotection).

[0048] In the above chemical formula showing the reaction pathway, B ａ represents an optionally protected nucleic acid base, Tr represents a protecting group, X is as defined above, and SP represents the portion of the inorganic porous carrier other than the nucleoside structure.

[0049] The inorganic porous carrier having a nucleoside structure (Sp-Nu) and the nucleic acid base constituting the nucleoside of the amidite monomer (Am-1) are the above-mentioned nucleic acid bases or nucleic acid bases protected with a protecting group.

[0050] Examples of suitable amidite monomers (Am-1) include compounds represented by the following chemical formula (Am-1′): when R represents a protected hydroxyl group, specific protecting groups include TBDMS amidites (TBDMS RNA Amidites, trade name, ChemGenes) protected with a tert-butyldimethylsilyl (TBDMS) group, a bis(2-acetoxy)methyl (ACE) group, a (triisopropylsilyloxy)methyl (TOM) group, a (2-cyanoethoxy)ethyl (CEE) group, a (2-cyanoethoxy)methyl (CEM) group, a para-tolylsulfonylethoxymethyl (TEM) group, a (2-cyanoethoxy)methoxymethyl (EMM) group, or the like. Corporation), ACE amidite, TOM amidite, CEE amidite, CEM amidite, TEM amidite (reviewed by Chakhmakhcheva: Protective Groups in the Chemical Synthesis of Oligoribonucleotides, Russian Journal of Bioorganic Chemistry, 2013, Vol. 39, No. 1, pp. 1-21.), EMM amidite (described in WO 2013 / 027843), and the like.

[0051]

[0052] (wherein R represents the group as defined above, B ａ represents an optionally protected nucleobase.

[0053] [Solid-Phase Synthesis of RNA] The Tr group of the inorganic porous support (Sp-Nu) is deprotected to obtain a solid-phase support (Am-2). The amidite monomer (Am-1) and the solid-phase support (Am-2) are then subjected to a condensation reaction to obtain a reaction product (Am-3). The reaction product (Am-3) is then oxidized to obtain a product (Am-4). The product (Am-4) is then deprotected (-Tr) to obtain a product (Am-5). The amidite monomer (Am-1) and the product (Am-5) are then subjected to a further condensation reaction to extend the phosphodiester bond. In this way, a series of cycles of deprotection, condensation reaction, and oxidation are repeated as many times as necessary to obtain the hydroxyl group at the 5' position of the extended oligonucleotide chain terminal, resulting in the desired sequence. Then, the nucleic acid molecule of the desired sequence can be produced by cleaving the chain from the solid-phase support. Such synthesis may be carried out using an automatic nucleic acid synthesizer that employs the phosphoramidite method, etc. Here, RNA will be used as an example for explanation, but the present invention can also be applied to nucleic acid compounds containing nucleotides other than ribonucleotides.

[0054] In the step of deprotecting the Tr group, the protecting group of the hydroxyl group at the 5'-position of the end of the RNA strand supported on the solid support is deprotected. As the protecting group, a trityl-based protecting group (typically, a 4,4'-dimethoxytrityl group (DMTr group)) is used. Deprotection can be carried out using an acid. Examples of acids used for deprotection include trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, trifluoromethanesulfonic acid, methanesulfonic acid, hydrochloric acid, acetic acid, and p-toluenesulfonic acid.

[0055] In the condensation step, a nucleoside phosphoramidite is bound to the 5'-hydroxyl group of the RNA chain terminus deprotected in the deprotection step to generate a phosphite. The nucleoside phosphoramidite used has the 5'-hydroxyl group protected with a protecting group (e.g., DMTr group).

[0056] The condensation step can be carried out using an activator that activates the nucleoside phosphoramidite. Examples of the activator include 5-benzylthio-1H-tetrazole (BTT), 1H-tetrazole, 4,5-dicyanoimidazole (DCI), 5-ethylthio-1H-tetrazole (ETT), N-methylbenzimidazolium triflate (N-MeBIT), benzimidazolium triflate (BIT), N-phenylimidazolium triflate (N-PhIMT), imidazolium triflate (IMT), 5-nitrobenzimidazolium triflate (NBT), 1-hydroxybenzotriazole (HOBT), and 5-(bis-3,5-trifluoromethylphenyl)-1H-tetrazole (Activator-42).

[0057] After the condensation step, any unreacted hydroxyl group at the 5'-position may be capped, if necessary, using a known capping solution such as an acetic anhydride-tetrahydrofuran solution or a phenoxyacetic anhydride / N-methylimidazole solution.

[0058] The oxidation step is a step of oxidizing the phosphite formed in the condensation step. The oxidation step can be carried out using an oxidizing agent. Examples of the oxidizing agent include iodine, m-chloroperbenzoic acid, tert-butyl hydroperoxide, 2-butanone peroxide, bis(trimethylsilyl) peroxide, 1,1-dihydroperoxycyclododecane, and hydrogen peroxide.

[0059] When converting a phosphite triester group into a thiophosphate triester group, examples of the "oxidizing agent" that can be used include sulfur, 3H-1,2-benzodithiol-3-one-1,1-dioxide (Beaucage reagent), 3-amino-1,2,4-dithiazole-5-thione (ADTT), 5-phenyl-3H-1,2,4-dithiazol-3-one (POS), [(N,N-dimethylaminomethylidene)amino]-3H-1,2,4-dithiazoline-3-thione (DDTT), and phenylacetyl disulfide (PADS). The oxidizing agent can be diluted with an appropriate solvent to a concentration of 0.001 to 2 M before use. The solvent used in the reaction is not particularly limited as long as it is inert to the reaction, and examples include dichloromethane, acetonitrile, pyridine, and a mixed solvent of two or more of these in any ratio.

[0060] The oxidation step may be carried out after the capping step, or conversely, the capping step may be carried out after the oxidation step, and this order is not limited.

[0061] After the oxidation step, the process returns to the deprotection step, and by repeating the above-mentioned series of steps of condensation reaction, oxidation, and deprotection depending on the nucleotide sequence of the nucleic acid oligomer to be synthesized, RNA having the desired sequence can be synthesized.

[0062] After the synthesis of a nucleic acid oligomer having a desired sequence is completed, the RNA strand is cleaved from the solid support using ammonia or an amine compound and recovered.

[0063] Examples of the amine compound include methylamine, ethylamine, isopropylamine, ethylenediamine, diethylamine, and triethylamine.

[0064] The chain length of the nucleic acid oligomer thus obtained is, for example, n≧60, n≧80, or n≧100, and n≦200. Preferably, n≧60. Specifically, n=67, 100, or 120, for example.

[0065] After the synthesis of a nucleic acid having a desired sequence is completed, the step of deprotecting the phosphate protecting group involves the action of an amine compound to deprotect the protecting group of the phosphate moiety, such as diethylamine.

[0066] If there is a protecting group on the 2'- or 3'-hydroxyl group of ribose, it can be removed according to the methods described in WO 2006 / 022323, WO 2013 / 027843, or WO 2019 / 208571.

[0067] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

[0068] Measurement methods The measurement methods used in the following tests are as follows. (Measurement method 1: Method for measuring RNA purity) The purity of RNA in the solution after fractionation was measured by HPLC. The fractionated RNA was analyzed by HPLC (wavelength 260 nm, column DNAPac ＴＭ The components were separated using a column (e.g., PA200, 4.0 mm x 250 mm, 8.0 μm), and the purity of the RNA was calculated from the area of ​​the main product peak in the total area of ​​the peaks in the resulting chromatogram. The HPLC measurement conditions are shown in Table 1 below.

[0069]

[0070] Reference Example 1 1. Solid-phase synthesis of RNA by the amidite method RNA having the nucleic acid sequence of strand I shown below was synthesized. The strand was 103 bases long.

[0071] Strand I: A*U*A*ACUCAAUUUGUAAAAAAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU*U*U*U(5'-3') (SEQ ID NO: 1) In the sequence notation, the symbol * between nucleotides indicates that the phosphate bond connecting the nucleotides is phosphorothioate. The RNA was synthesized from the 3' to 5' end using a nucleic acid synthesizer (AKTA Oligopilot Plus 100, GE Healthcare) based on the phosphoramidite method. Synthesis was performed on a 63 μmol scale. The synthesis was carried out using the following RNA amidites: uridine EMM amidite (described in Example 2 of WO 2013 / 027843), cytidine EMM amidite (described in Example 3 of the same publication), adenosine EMM amidite (described in Example 4 of the same publication), and guanosine EMM amidite (described in Example 5 of the same publication), each represented by the following formulas; porous glass as the solid support; a dichloroacetic acid toluene solution as the deblocking solution; 5-benzylthio-1H-tetrazole as the condensing agent; an iodine solution as the oxidizing agent; 3-amino-1,2,4-dithiazole-5-thione as the sulfurizing agent; and a phenoxyacetic anhydride solution and an N-methylimidazole solution as the capping solution. After nucleic acid elongation was completed, the cyanoethyl protecting groups of the phosphate moieties were selectively deprotected by applying a diethylamine solution to the nucleic acid on the support. Here, EMM is an abbreviation for (2-cyanoethoxy)methoxymethyl group.

[0072]

[0073] Excision and deprotection from the solid support after solid-phase synthesis were performed according to the method described in International Publication No. 2013 / 027843. Specifically, aqueous ammonia and ethanol were added, and after leaving the solution for a while, the solid support was filtered and the solvent was distilled off. Subsequently, hydroxyl groups were deprotected using tetrabutylammonium fluoride. The resulting RNA was dissolved in distilled water for injection to the desired concentration.

[0074] 2. Preparative purification of RNA Column chromatography purification was carried out under the conditions in Table 2 below. However, prior to purification, mobile phase A was passed through the column at a flow rate of 4.7 mL / min for 12.5 minutes, and then the sample was added. An aliquot from retention time 94.2 minutes to 95.8 minutes was collected, and the resulting solution was analyzed by HPLC. The purity was calculated using the method described in Measurement Method 1 above. The result was that the purity was 87.7%. This preparatively purified RNA solution was used to carry out the experiments in the following Examples and Comparative Examples.

[0075]

[0076] Example 1: 99 μL of the RNA solution purified by reverse-phase column chromatography in Reference Example 1 was placed in a 300 mL polypropylene vial (Thermo Fisher Scientific) and mixed with 1 μL of triphenylphosphine in acetonitrile as an additive solution to prepare a sample of a predetermined concentration. The vial containing the mixed solution was placed in an incubator (Kenis Biosciences) temperature-controlled at 60°C and allowed to stand for 8 hours. After standing, the headspace vial was removed from the incubator and cooled to room temperature, and the purity was calculated using the method described in Measurement Method 1 above. The results are shown in Table 3.

[0077] A composition prepared with a triphenylphosphine concentration of 3 mM (0.09%) has the following calculated composition: water: 63.79%, acetonitrile: 34.87%, dibutylamine: 0.84%, acetic acid: 0.39% (1.23% as dibutylammonium acetate), nucleic acid concentration: 0.21 mg / mL (0.02%).

[0078] Comparative Example 1 100 μL of the RNA solution separated and purified by reverse-phase column chromatography in Reference Example 1 was placed in a 300 mL polypropylene vial (Thermo Fisher), and the vial containing the solution was placed in an incubator (Kennis) temperature-controlled at 60°C and allowed to stand for 8 hours. After standing, the headspace vial was removed from the incubator and cooled to room temperature, and the purity was calculated using the method described in Measurement Method 1 above. The results are shown in Table 3.

[0079] 1) This represents the purity of the nucleic acid (purity 87.7%) prepared in Reference Example 1 after standing at 60°C for 8 hours. 2) Nucleic acid retention rate (%) = nucleic acid purity after standing / nucleic acid purity before standing

[0080] Reference Example 2 Solid-phase synthesis of RNA by the amidite method RNA was synthesized having the nucleic acid sequence of strand II shown below: The strand was 67 bases long.

[0081] Strand II: Am*Gm*Cm*AmUmAmGmCAAGUUAmAAAUAAGGmC*U*AmG*U*C*CmGUUAUCAAmCmUmUmGmAmAmAmAmAmGmUmGGCACmCmGmAGUCGGmUmGmCm*Um*Um*U (5'-3') (SEQ ID NO: 2) In the sequence notation, the symbol * between nucleotides indicates that the phosphate bond connecting the nucleotides is phosphorothioate. The letters Am, Um, Cm, and Gm represent nucleotides in which the 2' hydroxyl group is replaced with a methoxy group. The RNA was synthesized from the 3' to 5' end using the phosphoramidite method using a nucleic acid synthesizer (AKTA Oligopilot Plus 100, GE Healthcare). Synthesis was performed on a 53 μmol scale. The synthesis was carried out using uridine EMM amidite (described in Example 2 of WO 2013 / 027843), cytidine EMM amidite (described in Example 3 of the same), adenosine EMM amidite (described in Example 4 of the same), and guanosine EMM amidite (described in Example 5 of the same) as the RNA amidites, as well as uridine 2'OMe amidite, cytidine 2'OMe amidite, adenosine 2'OMe amidite, and guanosine 2'OMe amidite, respectively, of the following formulae, porous glass as the solid phase support, a dichloroacetic acid toluene solution as the deblocking solution, 5-benzylthio-1H-tetrazole as the condensing agent, an iodine solution as the oxidizing agent, and 3-amino-1,2,4-dithiazole-5-thione as the sulfurizing agent, and a phenoxyacetic anhydride solution and an N-methylimidazole solution as the capping solutions. After completion of nucleic acid elongation, the nucleic acid on the carrier was treated with a diethylamine solution to selectively deprotect the cyanoethyl protecting group of the phosphate moiety, where EMM is an abbreviation for (2-cyanoethoxy)methoxymethyl group.

[0082]

[0083] Excision and deprotection from the solid support after solid-phase synthesis were performed according to the method described in International Publication No. 2013 / 027843. Specifically, aqueous ammonia and ethanol were added, and after leaving the solution for a while, the solid support was filtered and the solvent was distilled off. Subsequently, hydroxyl groups were deprotected using tetrabutylammonium fluoride. The resulting RNA was dissolved in distilled water for injection to the desired concentration.

[0084] Preparative purification of RNA Column chromatography purification was carried out under the conditions in Table 4 below. However, prior to purification, mobile phase A was passed through the column at a flow rate of 4.7 mL / min for 12.5 minutes, and then the sample was added. A fraction was collected from retention times 66.7 minutes to 70.9 minutes, and the resulting solution was analyzed by HPLC. The purity was calculated using the method described in Measurement Method 1 above. The result was a purity of 94.2%. This preparatively purified RNA solution was used to carry out the experiments in the following Examples and Comparative Examples.

[0085]

[0086] Example 2: 99 μL of the RNA solution purified by reverse-phase column chromatography in Reference Example 2 was placed in a 300 mL polypropylene vial (Thermo Fisher Scientific) and mixed with 1 μL of a triphenylphosphine acetonitrile solution as an additive solution to prepare a sample with a triphenylphosphine concentration of 3 mM. The vial containing the mixed solution was placed in an incubator (Kennis Biosciences) temperature-controlled at 60°C and allowed to stand for 8 hours. After standing, the polypropylene vial was removed from the incubator and cooled to room temperature, and the purity was calculated using the method described in Measurement Method 1 above. The results are shown in Table 5.

[0087] A composition prepared with a triphenylphosphine concentration of 3 mM (0.09%) has the following calculated composition: water: 62.02%, acetonitrile: 33.06%, methanol: 3.60%, dibutylamine: 0.82%, acetic acid: 0.38% (1.20% as dibutylammonium acetate), nucleic acid concentration: 0.31 mg / mL (0.03%).

[0088] [Example 3] The experiment was carried out under the same conditions as in Example 2, except that a diethyl phosphite acetonitrile solution was used as the additive solution instead of a triphenylphosphine acetonitrile solution, and the diethyl phosphite concentration was prepared as a 3 mM (0.05%) solution, and the purity of the RNA after the experiment was measured. The results are shown in Table 5.

[0089] [Example 4] The experiment was carried out under the same conditions as in Example 2, except that instead of a triphenylphosphine acetonitrile solution, a triethyl phosphite acetonitrile solution was used as the additive solution, and the concentration of triethyl phosphite was prepared as a 3 mM (0.05%) solution, and the purity of the RNA after the experiment was measured. The results are shown in Table 5.

[0090] [Example 5] The experiment was carried out under the same conditions as in Example 2, except that instead of a triphenylphosphine acetonitrile solution, a diethoxyphenylphosphine acetonitrile solution was used as the additive solution, and the diethoxyphenylphosphine concentration was prepared as a solution of 3 mM (0.07%), and the purity of the RNA after the experiment was measured. The results are shown in Table 5.

[0091] [Example 6] The experiment was carried out under the same conditions as in Example 2, except that an acetonitrile solution of ethoxydiphenylphosphine was used as the additive solution instead of an acetonitrile solution of triphenylphosphine, and the concentration of ethoxydiphenylphosphine was prepared as a 3 mM (0.08%) solution, and the purity of the RNA after the experiment was measured. The results are shown in Table 5.

[0092] Example 7 An experiment was carried out under the same conditions as in Example 2, except that an acetonitrile solution of 9,10-dihydro-9-oxa-10-phosphaphenanthrene-10-oxide was used as the additive solution instead of an acetonitrile solution of triphenylphosphine, and the concentration of 9,10-dihydro-9-oxa-10-phosphaphenanthrene-10-oxide was prepared as a 3 mM (0.07%) solution, and the purity of the RNA after the experiment was measured. The results are shown in Table 5.

[0093] Comparative Example 2: 100 μL of the RNA solution separated and purified by reverse-phase column chromatography in Reference Example 2 was placed in a 300 mL polypropylene vial (Thermo Fisher Scientific), and the vial containing the solution was placed in an incubator (Kennis Biosciences) temperature-controlled at 60°C and allowed to stand for 8 hours. After standing, the polypropylene vial was removed from the incubator and cooled to room temperature, and the purity was calculated using the method described in Measurement Method 1 above. The results are shown in Table 5.

[0094] 1) This represents the purity of the nucleic acid (purity 94.2%) prepared in Reference Example 2 after standing at 60°C for 8 hours. 2) Nucleic acid retention rate (%) = nucleic acid purity after standing / nucleic acid purity before standing

[0095] Reference Example 3: Preparative Purification of RNA The RNA obtained in Reference Example 2, whose hydroxyl groups had been deprotected using tetrabutylammonium fluoride, was purified by column chromatography under the conditions in Table 6 below. However, prior to purification, mobile phase A was passed through the column at a flow rate of 4.7 mL / min for 12.5 minutes, and then the sample was added. A fraction was collected from retention times 91.7 minutes to 94.2 minutes, and the resulting solution was analyzed by HPLC. The purity was calculated using the method described in Measurement Method 1 above. The result was a purity of 95.1%. This preparatively purified RNA solution was used to carry out the experiments in the following Examples and Comparative Examples.

[0096]

[0097] Example 8: 99 μL of the RNA solution purified by reverse-phase column chromatography in Reference Example 3 was placed in a 300 mL polypropylene vial (Thermo Fisher Scientific) and mixed with 1 μL of a triphenylphosphine acetonitrile solution as an additive solution to prepare a sample with a triphenylphosphine concentration of 3 mM. The vial containing the mixed solution was placed in an incubator (Kennis Biosciences) temperature-controlled at 60°C and allowed to stand for 14 hours. After standing, the polypropylene vial was removed from the incubator and cooled to room temperature, and the purity was calculated using the method described in Measurement Method 1 above. The results are shown in Table 7.

[0098] A composition prepared with a triphenylphosphine concentration of 3.0 mM (0.09%) has the following calculated composition: water: 59.70%, acetonitrile: 35.36%, methanol: 3.84%, hexylamine: 0.61%, acetic acid: 0.36% (0.97% as hexylammonium acetate), nucleic acid concentration: 0.35 mg / mL (0.04%).

[0099] Comparative Example 3 100 μL of the RNA solution separated and purified by reverse-phase column chromatography in Reference Example 3 was placed in a 300 mL polypropylene vial (Thermo Fisher), and the vial containing the solution was placed in an incubator (Kennis) temperature-controlled at 60°C and allowed to stand for 14 hours. After standing, the polypropylene vial was removed from the incubator and cooled to room temperature, and the purity was calculated using the method described in Measurement Method 1 above. The results are shown in Table 7.

[0100] 1) This represents the purity of the nucleic acid (purity 95.1%) prepared in Reference Example 2 after standing at 60°C for 14 hours. 2) Nucleic acid retention rate (%) = nucleic acid purity after standing / nucleic acid purity before standing

[0101] Example 9 (Recovery of RNA from Preparatively Purified RNA Solution) The solution prepared in Example 8, prepared by mixing triphenylphosphine to a concentration of 3 mM and allowing to stand at 60°C for 14 hours, was subjected to the following treatment. 60 μL of the solution was placed in a 15 mL polypropylene conical tube (Corning), and 30 μL of aqueous sodium acetate solution (3 M, pH = 5.2) and 180 μL of ethanol were added. The resulting slurry solution was centrifuged for 10 minutes at 3000 g and 25°C, and the supernatant was removed. Subsequently, 150 μL of 70% aqueous ethanol solution was added, and the mixture was centrifuged for 10 minutes at 3000 g and 25°C, followed by removal of the supernatant. This procedure was repeated twice to obtain RNA. The resulting RNA was dissolved in 60 μL of water, and the purity of the RNA in the fraction was calculated using the method described in Measurement Method 1 above. The purity was 93.1%.

[0102] Comparative Example 4: The solution from Comparative Example 3, which had been left standing at 60°C for 14 hours, was treated as follows. 60 μL of the solution was placed in a 15 mL polypropylene conical tube (Corning), and 30 μL of aqueous sodium acetate solution (3 M, pH 5.2) and 180 μL of ethanol were added. The resulting slurry solution was centrifuged for 10 minutes at 3000 g and 25°C, and the supernatant was removed. Subsequently, 150 μL of 70% aqueous ethanol solution was added, and the mixture was centrifuged for 10 minutes at 3000 g and 25°C, followed by removal of the supernatant. This procedure was repeated twice to obtain RNA. The resulting RNA was dissolved in 60 μL of water, and the purity of the RNA in the fraction was calculated using the method described in Measurement Method 1 above. The purity was 83.0%.

[0103] According to the method of the present invention, nucleic acid oligomers having phosphorothioate bonds can be stabilized and efficiently produced.

[0104] SEQ ID NOs: 1 and 2 in the sequence listing represent the base sequences of oligonucleotides produced according to the production method of the present invention.

Claims

1. Formula (1): (In the formula, B C each independently represents the same or different nucleobase, R are each independently the same or different and each independently represent a hydrogen atom, a fluorine atom, or an OQ group; Q are each independently the same or different and each represent a hydrogen atom, a methyl group, a 2-methoxyethyl group, a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position of ribose, or an ethylidene group bonded to the carbon atom at the 4' position of ribose; X's are each independently the same or different and represent an oxygen atom or a sulfur atom (provided that at least one X represents a sulfur atom); Y represents a hydrogen atom or a protecting group for a hydroxyl group; G represents an ammonium ion, an alkylammonium ion, an alkali metal ion, a hydrogen ion, or a hydroxyalkylammonium ion; and n is represented by formula (2): 15≦n (2) are integers that satisfy the following: a nucleic acid oligomer having a phosphorothioate bond represented by the formula (I), an alkyl ammonium salt, a nitrile-based organic solvent, water, and an additive, wherein the additive comprises at least one compound selected from the group consisting of compounds represented by the formulas (3a) to (3h) below: Formula (3a): P(L 1 ) 3 , Formula (3b): P(OL 1 ) 3 , Formula (3c): P(L 1 ) 2 (OL 1 )、 Formula (3d): PL (OL 1 ) 2 , Formula (3e): PH(O)(OL 1 ) 2 , Formula (3f): PH(O)L 1 (OL 1 ) Formula (3g): (P (L 1 ) 2 ) 2 -L 2 , Formula (3h): 、 (In each of formulas (3a) to (3h), L 1 each independently represents the same or different, a C6-10 aryl group optionally substituted by 1 to 3 substituents selected from the group consisting of a C1-6 alkyl group and a C1-6 alkoxy group, or a C1-6 alkyl group; L 2 each independently represents the same or different a C6-14 arylene group optionally substituted by 1 to 3 substituents selected from the group consisting of a C1-6 alkyl group and a C1-6 alkoxy group, or a C1-6 alkylene group, and L 3 represents a C6-14 arylene group optionally substituted by 1 to 3 substituents selected from the group consisting of a C1-6 alkyl group and a C1-6 alkoxy group.

2. 2. The composition of claim 1, wherein the additive is at least one compound selected from the group consisting of triphenylphosphine, diethyl phosphite, triethyl phosphite, diethoxyphenylphosphine, ethoxydiphenylphosphine, and 9,10-dihydro-9-oxa-10-phosphaphenanthrene-10-oxide.

3. 2. The composition of claim 1, wherein the alkyl ammonium salt is at least one alkyl ammonium salt selected from the group consisting of monoalkyl ammonium salts and dialkyl ammonium salts.

4. 2. The composition of claim 1, wherein the nitrile organic solvent is acetonitrile.

5. The composition according to claim 1 , wherein, in formula (1), each R is independently a hydroxy group or a methoxy group.

6. A method for producing a nucleic acid oligomer, comprising mixing the composition according to any one of claims 1 to 5 with at least one solvent selected from the group consisting of C1-C4 alcohols, tetrahydrofuran, and dioxane, and isolating the precipitated nucleic acid oligomer.

7. A method for producing the composition according to any one of claims 1 to 5, comprising mixing a column eluate containing a nucleic acid oligomer represented by formula (1), an alkylammonium salt, a water-soluble organic solvent, and water, which is obtained by subjecting a crude product of the nucleic acid oligomer represented by formula (1) synthesized by a solid-phase synthesis method to reverse-phase column chromatography, with an additive.

Images