Plasmids having high payload to non-payload ratios and methods and kits for producing the same

Abstract

Disclosed herein is a method of preparing a plasmid molecule that can contain as few elements as only a phage f1 origin and a payload sequence, as well as the plasmid molecule. The method comprises contacting a parent DNA molecule including a phage f1 initiator, a payload sequence; and a phage f1 terminator; with a filamentous phage replication initiator protein GPII. Also disclosed is a kit for performing the method. Further disclosed herein is a method of expressing a protein in a host cell, such as a protein that is toxic to the host cell. The method comprises contacting GPII with a DNA molecule in a host cell. The DNA molecule comprises a phage f1 initiator; a payload sequence encoding the protein; a promoter; and a phage f1 terminator.

Description

[0001]Attorney Docket No. 387648-1002WO1 (00004) PLASMIDS HAVING HIGH PAYLOAD TO NON-PAYLOAD RATIOS AND METHODS AND KITS FOR PRODUCING THE SAME CROSS-REFERENCE TO RELATED APPLICATIONS The present application claims priority under 35 U.S.C. § 119(e) to U.S. Provisional Patent Application No. 63 / 521,566, filed June 16, 2023, which is hereby incorporated herein by reference. SEQUENCE LISTING The XML text file named "387648-1002WO1_Seq_Listing.xml" created on June 13, 2024, comprising 25,127 bytes, is hereby incorporated by reference in its entirety. BACKGROUND Circular double stranded DNA (plasmid DNA) is useful for, e.g., DNA vaccines and gene therapies against many infectious, acquired, and genetic diseases (Prazeres et al. Microbiol Spectr, 2014. 2(6)). Plasmid-based therapeutics require only microgram to gram amounts of good manufacturing practice (GMP) manufactured DNA for individual programs (Ohlson., Plasmid manufacture is the bottleneck of the genetic medicine revolution. Drug Discov Today, 2020). Plasmid DNA can be produced in almost unlimited amounts, and purification procedures thereof are well established. Conventional plasmids, however; have bacterial backbone sequences of more than 2 kb. These backbone sequences contain replication origins, antibiotic resistance markers, and diverse extraneous bacterial DNA sequences, which are needed for the production of the plasmid in bacteria cells. Such sequence elements are of no use in plasmid-based therapeutics and would significantly reduce the ratio between the payload sequence and the non-payload sequences. Moreover, bacterial backbone sequences can cause adverse effects in the 1 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) plasmid-based therapeutics. For example, these sequences can be recognized as Pathogen Associated Molecular Pattern (PAMP) and induce immune responses, such as via the activation of the toll-like receptors (TLR9) (Klinman, Expert Opin Biol Ther, 2004. 4(6): p. 937-46). Larger (>1kb) bacterial backbone sequences can induce silencing of transgene expression in the host cell, as well (Lu et al., Mol Ther, 2012. 20(11): p. 2111-9). The antibiotic resistance markers are of particular concern since it is possible for the host microbiome to acquire antibiotic resistance from these markers. Indeed, many regulatory agencies, such as the European Medicines Agency (EMA) and the Federal Drug Administration (FDA), require that antibiotic resistance genes to be avoided in the context of gene therapy (Research, F.-C.f.B.E.a., Guidance for industry: considerations for plasmid DNA vaccines for infectious disease indications., F.a.D.A. U.S. Department of Health and Human Services, Editor. 2007: New York, NY; Therapies, E.C.f.A., Guideline on the quality, non-clinical and clinical aspects of gene therapy medicinal products, E.M. Agency, Editor. 2018: Rome; and Research, F.C.f.B.E.a., Recommendations for Microbial Vectors Used for Gene Therapy Guidance for Industry, F.a.D. Administration, Editor. 2016: Rockville, MD). Accordingly, there is a need for plasmids that do not include antibiotic resistance marker, and comprise only minimal contents of non-payload sequences, as well as methods and system of making such plasmids. The present invention addresses this need. SUMMARY In some aspects, the present invention is directed to the following non-limiting embodiments: Kit In some aspects, the present invention is directed to a kit. In some embodiments, the kit is a kit for producing a circular double stranded DNA molecule (plasmid) having a small size and / or a high payload to non-payload ratio. 2 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) In some embodiments, the kit comprises a parent DNA molecule comprising a DNA strand. In some embodiments, the DNA strand comprises from a 5’ to 3’ direction: a phage f1 initiator; a payload sequence or a sequence for inserting the payload sequence; and a phage f1 terminator. In some embodiments, the kit further comprises a filamentous phage replication initiator protein GPII or a nucleic acid encoding the GPII. In some embodiments, when inside a host cell or a cell free system mimicking an inside of the host cell, the parent DNA molecule and the GPII produce a circular double stranded DNA molecule (plasmid) comprising: a phage f1 plasmid origin formed by joining the phage f1 initiator and the phage f1 terminator; and the payload sequence. In some embodiments, the phage f1 origin is a replication origin derived from a filamentous phage. In some embodiments, the phage f1 original is a replication origin derived from an F specific filamentous (Ff) phage genome. In some embodiments, the phage f1 original is a replication origin derived from an M13 phage genome. In some embodiments, the phage f1 initiator comprises a melting sequence, a β sequence, a γ sequence, and a δ sequence. In some embodiments, the phage f1 terminator comprises an α sequence and a melting sequence. In some embodiments, the parent DNA molecule is a linear double stranded DNA molecule, a circular double stranded DNA molecule, a linear single stranded DNA molecule, or a circular single stranded DNA molecule. In some embodiments, the parent DNA molecule is part of the genomic DNA of the host cell, or an extra genomic DNA. In some embodiments, the kit comprises the nucleic acid encoding the GPII. In some embodiments, the nucleic acid encoding the GPII is part of the genomic DNA of the host cell, part of an extra genomic DNA, or part of an mRNA. In some embodiments, a size of the produced plasmid minus the payload sequence thereof is about 1,000 base pairs or less. 3 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) In some embodiments, the plasmid produced by the kit does not comprise a bacterial replication origin apart from the phage f1 origin. In some embodiments, the plasmid produced by the kit does not comprise an antibiotic resistance gene. In some embodiments, the parent DNA molecule comprises, at a location outside the phage f1 initiator, the payload sequence or the sequence for inserting the payload sequence, or the phage f1 terminator, a destruction element. In some embodiments, the parent DNA molecule is destroyed by targeting the destruction element without destroying the plasmid produced by the kit. In some embodiments, the host cell is an E. coli cell. Method of producing a circular double stranded DNA molecule In some aspects, the present invention is directed to a method of producing a circular double stranded DNA molecule (plasmid). In some embodiments, the plasmid has a small size and / or a high payload to non-payload ratio. In some embodiments, the method comprises contacting a parent DNA molecule with a filamentous phage replication initiator protein GPII in a host cell or a cell free system mimicking an inside of the host cell. In some embodiments, the parent DNA molecule comprises a DNA strand, and the DNA strand comprises from a 5’ to 3’ direction: a phage f1 origin initiator; a payload sequence or a sequence for inserting the payload sequence; and a phage f1 origin terminator. In some embodiments, the plasmid comprises: a phage f1 origin formed by joining the phage f1 origin initiator and the phage f1 origin terminator; and the payload sequence. In some embodiments, the phage f1 origin is a replication origin derived from a filamentous phage. In some embodiments, the phage f1 origin is a replication origin derived from an F specific filamentous (Ff) phage genome. In some embodiments, the phage f1 origin is a replication origin derived from an M13 phage genome. In some embodiments, the phage f1 initiator comprises a melting sequence, a β sequence, a γ sequence, and a δ sequence. 4 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) In some embodiments, the phage f1 terminator comprises an α sequence and a melting sequence. In some embodiments, the parent DNA molecule is a linear double stranded DNA molecule, a circular double stranded DNA molecule, a linear single stranded DNA molecule, or a circular single stranded DNA molecule. In some embodiments, the parent DNA molecule is part of the genomic DNA of the host cell, or an extra genomic DNA. In some embodiments, the GPII is expressed from a nucleic acid encoding the GPII. In some embodiments, the nucleic acid encoding the GPII is part of the genomic DNA of the host cell, part of an extra genomic DNA, or part of an mRNA. In some embodiments, a size of the produced plasmid minus the payload sequence thereof is about 1,000 base pairs or less. In some embodiments, the plasmid produced by the method does not comprise a bacterial replication origin apart from the phage f1 origin, or the plasmid produced by the method does not comprise an antibiotic resistance gene. In some embodiments, the parent DNA molecule comprises, at a location outside the phage f1 initiator, the payload sequence or the sequence for inserting the payload sequence, or the phage f1 terminator, a destruction element. In some embodiments, the method further comprises: destroying the parent DNA molecule by targeting the destruction element without destroying the produced plasmid. In some embodiments, the host cell is an E. coli cell. Circular double stranded DNA molecule In some aspects, the present invention is directed to a circular double stranded DNA molecule (plasmid). In some embodiments, the plasmid comprises a phage f1 origin; and a payload sequence. In some embodiments, the plasmid is an isolated plasmid. In some embodiments, the plasmid comprises one phage f1 origin. 5 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) In some embodiments, the phage f1 origin is a replication origin derived from a filamentous phage genome. In some embodiments, the phage f1 origin is a replication origin derived from an F specific filamentous (Ff) phage genome. In some embodiments, the phage f1 origin comprises an α sequence, a melting sequence, a β sequence, a γ sequence, and a δ sequence. In some embodiments, a size of the plasmid minus the payload sequence is about 1,000 base pairs or less. In some embodiments, the plasmid does not comprise a bacterial replication origin apart from the phage f1 origin. In some embodiments, the plasmid does not comprise an antibiotic resistance gene. Kit In some aspects, the present invention is directed to a kit. In some embodiments, the kit is suitable for expressing a protein using a host cell or a cell free system. In some embodiments, the kit comprises a filamentous phage replication initiator protein GPII or a nucleic acid encoding the GPII; and a first DNA molecule. In some embodiments, the first DNA molecule comprises a DNA strand, and the DNA strand comprises, in a 5’- to 3’- direction: a phage f1 initiator; a payload sequence encoding a protein; a promotor; and a phage f1 terminator. In some embodiments, when in a host cell or a cell free system mimicking an inside of the host cell, the GPII and cellular machinery of the host cell joins a 3’ portion of the phage f1 initiator to a 5’ portion of the phage f1 terminator to form a phage f1 origin, thereby producing a circular double stranded second DNA molecule, and In some embodiments, in the second DNA molecule, the promotor drives the expression of the protein encoded by the payload sequence. In some embodiments, the phage f1 origin is a replication origin derived from a filamentous phage. In some embodiments, the phage f1 origin is a replication origin derived from an F specific filamentous (Ff) phage genome. In some embodiments, the phage f1 origin is a replication origin derived from an M13 phage genome. 6 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) In some embodiments, the phage f1 initiator comprises a melting sequence, a β sequence, a γ sequence, and a δ sequence. In some embodiments, the phage f1 terminator comprises an α sequence and a melting sequence. In some embodiments, the first DNA molecule is a linear double stranded DNA molecule, a circular double stranded DNA molecule, a linear single stranded DNA molecule, or a circular single stranded DNA molecule. In some embodiments, the first DNA molecule is part of the genomic DNA of the host cell, or an extra genomic DNA. In some embodiments, the kit comprises the nucleic acid encoding the GPII, and the nucleic acid encoding the GPII is part of the genomic DNA of the host cell, part of an extra genomic DNA, or part of an mRNA. In some embodiments, the first DNA molecule is a circular DNA molecule, and the first DNA molecule further comprises, between a 3’-end of the f1 terminator and a 5’-end of the f1 initiator, a blocking sequencing. In some embodiments, a length of the blocking sequence is about 100 nucleotides or longer. In some embodiments, the expression of the protein encoded by the payload sequence is harmful to the host cell. In some embodiments, the host cell is an E. coli cell. Method of expressing a protein In some aspects, the present invention is directed to a method of expressing a protein. In some embodiments, the method comprises contacting a filamentous phage replication initiator protein GPII with a first DNA molecule in a host cell or a cell free system mimicking an inside of the host cell. In some embodiments, the first DNA molecule comprises a DNA strand, and the DNA strand comprises, in a 5’- to 3’- direction: a phage f1 initiator; a payload sequence; a promotor; and a phage f1 terminator. 7 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) In some embodiments, the GPII and cellular machinery of the cell joins a 3’ portion of the phage f1 initiator to a 5’ portion of the phage f1 terminator to form a phage f1 origin, thereby producing a circular double stranded second DNA molecule. In some embodiments, in the second DNA molecule, the promotor drives the expression of the protein encoded by the payload sequence. In some embodiments, the phage f1 origin is a replication origin derived from a filamentous phage. In some embodiments, the phage f1 origin is a replication origin derived from an F specific filamentous (Ff) phage genome. In some embodiments, the phage f1 origin is a replication origin derived from an M13 phage genome. In some embodiments, the phage f1 initiator comprises a melting sequence, a β sequence, a γ sequence, and a δ sequence. In some embodiments, the phage f1 terminator comprises an α sequence and a melting sequence. In some embodiments, the first DNA molecule is a linear double stranded DNA molecule, a circular double stranded DNA molecule, a linear single stranded DNA molecule, or a circular single stranded DNA molecule. In some embodiments, the first DNA molecule is part of the genomic DNA of the host cell, or an extra genomic DNA. In some embodiments, the method uses the nucleic acid encoding the GPII, and the nucleic acid encoding the GPII is part of the genomic DNA of the host cell, part of an extra genomic DNA, or part of an mRNA. In some embodiments, the first DNA molecule is a circular DNA molecule, and the first DNA molecule further comprises, between a 3’-end of the f1 terminator and a 5’-end of the f1 initiator, a blocking sequencing. In some embodiments, a length of the blocking sequence is about 100 nucleotides or longer. In some embodiments, the expression of the protein encoded by the payload sequence is harmful to the host cell. In some embodiments, host cell is an E. coli cell. 8 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) BRIEF DESCRIPTION OF THE DRAWINGS The following detailed description of exemplary embodiments will be better understood when read in conjunction with the appended drawings. For the purpose of illustrating, non-limiting embodiments are shown in the drawings. It should be understood, however, that the instant specification is not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings. Fig. 1 illustrates the circular single-stranded DNA (cssDNA) production by co- transformation of engineered phagemid with M13-f1 helper plasmid, according to some embodiments. The phagemid system utilizes separated minimum synthetic initiators and terminators derived from F1 phage origin of replication sequence to allow the generation of uniform cssDNA molecules. The insert (payload) sequence was flanked by synthetic initiator and terminator. Production of the single stranded DNA requires co-transformation of a “helper plasmid” to express the necessary phage proteins. GPII encoded by the helper plasmid nicks the double stranded form of phagemid at initiator region of the F1 origin of replication and recruits bacterial polymerase III to initiate replication of the plus (+) strand, resulting in single-stranded DNA (ssDNA) generation. The replication cycle is then completed again by GPII nicking at the terminator region of F1 origin. ssDNA was then circularized to form cssDNA by GPII. The replicated cssDNA containing the complete F1 origin and payload sequence is sequestered by encoded GPV proteins, assembled with capsid proteins in cell membranes, and phage particles are extruded from the host cells. cssDNA are then purified from phage particles. Fig. 2 illustrates examples of engineered initiator and terminator sequences from bacteriophage F1, in accordance with some embodiments. Top, the core region of the wild-type F1 origin contains about 40 bp which consists of four key elements: α- AGTCCACGTT, melting-TTTAATA, β-TGGAC, γ-GTTCCA, and δ-TGGAAC. Bottom, the pFC-G phagemid was adopted from pScaf and Inho constructs. pFC-G contains the pSCAF terminator sequence which contains the δ element (TGGTTT) and a changed β element (CTGTT instead of TGGAC), while α, γ and melting sequences are unchanged from the wild type. pFC-G contains the Inho initiator sequence where the α element and 9 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) the last 50 bp in the downstream initiation enhancer region were removed. A 1.8 kilobases payload sequence was flanked between a synthetic F1 origin initiator and a synthetic F1 origin terminator. The sequences shown in Fig. 2: Wild-type f1 core origin GAGTCCACGTTCTTTAATAGTGGACTCTTGTTCC AAACTGGAACAACACT (SEQ ID NO:3) G Figs. 3A-3B illustrate a non-limiting pDSg2McHis (KanaR) plasmid contains L- Rhamnose-inducible rhaBAD promoter driving expression of GPII to allow GPII expression under tight control, in accordance with some embodiments. BL21(DE3) E. coli cells were co-transformed with pDSg2McHis and pFC-G (AmpR) phagemid that contains M13 derived initiator / terminator flanking customized DNA donor payloads (Figs. 2 and 3) and selected on LB plate with carbenicillin and kanamycin. A single colony was inoculated in LB media containing carbenicillin and kanamycin, and cultured overnight at 37 °C. The seed culture was then diluted in 1:100 into fresh media either with or without 0.5% (w / v) L-Rhamnose and cultured overnight at 37 °C. Total plasmid DNA were extracted with ZR Plasmid Miniprep – Classic kit (Zymo Research) following manufacture’s instruction. Total DNA yield was quantified by DNA amount measurement by NanoDrop. Plasmid DNAs were resolved and visualized in 1.5% agarose gel containing ethidium bromide. The target pLeSS bands were extracted and purified from the gel. Complete sequences of the pLeSS DNA were confirmed by 10 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) Sanger Sequencing with both forward and reverse sequencing primers. The purity of the target pLeSS DNA was quantified by the densitometric analysis of DNA bands on the gel. Fig. 4 illustrates the generation of stable E. coli strains integrated with GPII expression cassette using TN5 transposon system, in accordance with some embodiments. The pKD-TN5-ISceI-gp2 plasmid contains temperature sensitive repA101-ts origin from pKD46, rhamnose inducible TN5 transposase and mosaic ends enclosed kanamycin resistance gene, lambda pL heat inducible I-SceI gene, and rhamnose inducible GPII. pKD-TN5-ISceI-gp2 was transformed into Mach1 cells (Thermofisher) and incubated in LB / Carbenicillin media at 30 °C overnight. Cell culture was diluted 1:100 in LB / Kanamycin media and incubated at 42 °C for 2 hours and plated on LB / Kanamycin agar plates at 37 °C overnight. 24 colonies were plated on either Kanamycin or Carbenicillin plates, and 8 Kanamycin resistant only colonies were grown in LB / Kanamycin media and made competent with Mix & Go E. coli Transformation Buffer (Zymo) following manufacturer’s protocol. Figs. 5A-5B illustrate using pKD-I-SceI-sfGFP reporter plasmid to screen stable E. coli clones with GPII expression cassette integrated into the genome, in accordance with some embodiments. In pKD-I-SceI-sfGFP reporter phagemid, riboJ-sfGFP was placed in front of bfJ23101 promoter and enclosed in initiator and terminator sequences in pFC-G phagemid. The fragments were cloned together with the temperature sensitive origin repA101-ts of pKD46 by Golden Gate cloning. The recognition sequence of Intron-encoded endonuclease I (I-SceI) was introduced into the resulting vector between the ampicillin resistance gene and repA101-ts by inverse PCR and restriction ligation. 50 ng of pKD-I-SceI-sfGFP reporter plasmid was transformed into all 8 competent cells integrated with rhamnose-inducible GPII expression cassette and plated on LB / Carbenicillin plates with 0.5% rhamnose. Single colonies were inoculated in LB / Carbenicillin plates with 0.5% rhamnose and cultured overnight at 37 °C. Cell pellets were collected and GFP fluorescence were visualized under blue light. Five representative cell pellets were shown in Figure 5B. Stable strain M15 with the brightest green fluorescence and fastest growth rate were selected as the preferred host. 11 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) Figs. 6A-6B illustrate the engineering of synthetic M13 initiator and terminator to define the minimal pLeSS fairing length, in accordance with some embodiments. Fig. 6A: Engineered pFC phagemids with additional truncations on synthetic initiator and terminator derived from pFC-G. Diagram of core and the surrounding regions of initiator synthetic initiator and terminator was displayed. Red triangles indicate the GPII nicking at initiators and terminators. Red lines represent the pLeSS DNA fairing from initiator regions and terminator regions. The total pLeSS fairing lengths were calculated by adding the fairing derived from initiator region and fairing derived from terminator region. Dashed black lines indicate the unidirectional leading strand replication of the insert payload DNA. Fig. 6B: Engineered pFC phagemids were transformed into the competent cells of M15 strain integrated with Rhamnose-inducible GPII expression cassette. Colonies were selected on LB agar plates with Carbenicillin and Kanamycin. The resulting single colonies were inoculated in LB media with Carbenicillin and Kanamycin and cultured for 8 hrs at 37 °C. Seed culture was diluted 1:100 in fresh LB media with Carbenicillin and Kanamycin and incubated at 37 °C overnight in the presence of 0.5% Rhamnose. Total plasmid DNAs were extracted with ZR Plasmid Miniprep – Classic kit (Zymo Research) following manufacture’s instruction. Total plasmid DNA was quantified by NanoDrop. Plasmid DNAs were resolved and visualized in 1.5% agarose gel containing ethidium bromide. The purity of the target pLeSS DNA was quantified by the densitometric analysis of DNA bands on the gel. Figs. 7A-7B illustrate the strategy to generation of stable E. coli strains integrated with template sequence flanked by synthetic initiator and terminator using FLP-FRT recombination system, in accordance with some embodiments. Fig. 7A: The GPII expression cassette I-SceI expression cassette in pKD-TN5-ISceI-gp2 plasmid constructed in Fig. 4 were replaced with payload sequence flanked by synthetic initiator and terminator derived from pFC-G phagemid and reporter GFP expression cassette flanked by FRT1 and FRT3 sequences. Payload sequence flanked by synthetic initiator and terminator together with FRT1-GFP-FRT3 will be integrated into E. coli genome by TN5 expression under rhaBAD promoter. Fig. 7B: A flippase expression construct that 12 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) also contains FRT1-Initiator-Payload-Terminator-FRT3 will be transformed to the GPII-FRT1-GFP-FTR3 stable strain, the GFP will be replaced by Initiator-Payload- Terminator-chloramphenicol resistance gene (CmR) sequence by flippase excision and insertion process. The stable strain will be selected with chloramphenicol, while GFP can be served as another marker for successful excision and insertion by FLP-FRT recombination. The stable E. coli strain with both GPII and payload sequence flanked by initiator and terminator integrated into the genome will be generated with these experimental approaches. Fig. 8 illustrates the pLeSS DNA production in plasmid free system, in accordance with some embodiments. In the E. coli strain with stable integration of GPII expression cassette and payload sequence flanked by synthetic initiator and terminator. Rhamnose-inducible GPII expression under rhaBAD promoter will nick the DNA at initiator and trigger leading strand replication, resulting in pLeSS DNA production. The pLeSS DNA in this plasmid-free system will be extracted and purification following regular plasmid DNA purification method, without additional steps to remove the parental phagemid. Fig. 9 illustrates the production of the plasmid, in accordance with some embodiments. Fig. 10 illustrates the protein expression, in accordance with some embodiments. Fig. 11 demonstrate that the I-SceI recognition sites can be used as destruction elements to remove parental plasmid, in according to some embodiments. A plasmid similar to 100’ illustrated in Fig. 9 was prepared, which contains two I-SceI cutting sites outside the initiator-load-terminator section (i.e., section 107’). Two E.coli clones containing this parental plasmid were selected and the pLeSS picoplasmids production was induced with rhamnose (which activates the rhaBAD promoter and drives the GPII expression) at 30 °C overnight. Afterwards, the E.coli cells were either remained at 30 °C or subjected to an elevated temperature of 42 °C which activates the thermo- responsive λ-pL / cl857 promoter that drives the expression of the I-SceI. Plasmid in the E.coli cells were miniprepped and cut with PvuII which only cut once in the picoplasmid, and subjected to gel electrophoresis and nanopore sequencing. The 13 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) expression of I-SceI was confirmed to have removed the parental plasmid by both the gel electrophoresis (“42” for both C5 and C6 clones) and the nanopore sequencing, DETAILED DESCRIPTION The following disclosure provides many different embodiments, or examples, for implementing different features of the provided subject matter. Specific examples of components and arrangements are described below to simplify the present disclosure. These are, of course, merely examples and are not intended to be limiting. For example, the formation of a first feature over or on a second feature in the description that follows may comprise embodiments in which the first and second features are formed in direct contact, and may also comprise embodiments in which additional features may be formed between the first and second features, such that the first and second features may not be in direct contact. In addition, the present disclosure may repeat reference numerals and / or letters in the various examples. This repetition is for the purpose of simplicity and clarity and does not in itself dictate a relationship between the various embodiments and / or configurations discussed. Solutions have been proposed to reduce the presence of bacterial backbone element sequences, as well as to eliminate antibiotic resistance marker in plasmids. In DNA minicircles, the bacterial backbone sequence with the antibiotic resistance and the origin is removed by a recombination process during production in E. coli cells (Darquet, et al., Gene Ther, 1997. 4(12): p. 1341-9; and Kay et al., Nat Biotechnol, 2010. 28(12): p. 1287-9). The expression cassette (payload) in the production plasmid is flanked by recombination sites and contains an inducible integrase / recombinase gene. Upon induction of the recombinase, intramolecular recombination between attB and attP results in the formation of two circular DNA molecules, one containing the expression cassette (“minicircle product”), and the other the bacterial DNA backbone as a recombination byproduct (“miniplasmid”). The residual miniplasmid circles formed by the backbone can be degraded in bacteria by the inclusion of the endonuclease I-SceI gene with its recognition site in the template plasmids (Chen et al., Hum Gene Ther, 2005. 16(1): p. 126-31). Minicircle DNA is 14 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) significantly smaller than the normal plasmid DNA, resulting in higher transfection efficacies (Mitdank, et al., Eur J Pharm Sci, 2022. 170: p. 106107). However, the induction and complicated propagation steps make minicircle production time- consuming and cost-intensive, and production yields highly variable. Another significant development in the field was the nanoplasmid technology by Nature Technology (Luke et al., Vaccine, 2009. 27(46): p. 6454-9; Luke et al., Methods Mol Biol, 2014. 1143: p. 91-111; and Williams, Viral and Non-Viral nanoplasmid vectors with improved production, W.I. Property, Editor. 2019). Nanoplasmids are small circular dsDNA constructs that allow the propagation of plasmid DNA with small bacterial backbone sequences (500 bp). They can be produced with large yields, while showing up to 10 times higher transgene expression compared to minicircle vectors (Lu et al., Hum Gene Ther, 2017. 28(1): p. 125-134). Antibiotic resistance genes are replaced with a small RNA selectable marker (RNA-OUT) (Luke et al., Vaccine, 2009. 27(46): p. 6454-9). This allows antibiotics-free selection, and an enhancer effect which dramatically improves gene expression compared to plasmids with antibiotic resistance markers. In addition, the nanoplasmid’s origin of replication (R6K) has host-restricted replication (Rakowski et al., Plasmid, 2013. 69(3): p. 231-42) and requires a specific E. coli strain for replication, thus preventing propagation of the nanoplasmids in the environment. This feature enhances safety for therapeutic applications, as opposed to the promiscuity of first-generation plasmids for gram negative host bacteria. Moreover, nanoplasmids show higher expression levels and resistance to gene silencing. However, while bacterial elements in nanoplasmids are optimized for non-interference for payload expression, they are still present in the end product. MIDGE (minimalistic, immunological-defined gene expression) vectors require nonstandard procedures, as well. This technology requires in vitro ligation of annealed primers to restriction digested vector (Schakowski et al., Mol Ther, 2001. 3(5 Pt 1): p. 793-800). Newer technologies, such as Doggybone™ linear closed DNA (dbDNA™) are synthesized in vitro using enzymatic processes that requires a dedicated manufacturing setup that is different from existing cell-based production facilities (Scott et al., Hum Vaccin Immunother, 2015. 11(8): p. 1972-82). 15 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) In the study described herein (“the present study”), a novel method of producing a plasmid DNA having only minimal numbers of non-payload nucleotides was developed. Specifically, the present study discovered that, when subjecting a parent plasmid including a phage f1 initiator, a phage f1 terminator and a payload sequence therebetween to a filamentous phage replication initiator protein gpII in a host cell in the absence of some other filamentous phage proteins, the combined action of the gpII and the cellular machinery intrinsic to the host cell is able to produce a plasmid DNA which comprises only the payload sequence and a phage f1 replication origin (formed by the joining of the 3’-section of the initiator and the 5’-section of the terminator). Accordingly, in some aspects, the present invention is directed to a plasmid, such as a plasmid having few non-payload nucleotides. In some aspects, the present invention is directed to a system and a method of producing this plasmid. Definitions As used herein, each of the following terms has the meaning associated with it in this section. Unless defined otherwise, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Generally, the nomenclature used herein and the laboratory procedures in molecular biology, microbiology, biochemistry, cell biology, animal pharmacology, pharmaceutical science, peptide chemistry, and organic chemistry are those well-known and commonly employed in the art. It should be understood that the order of steps or order for performing certain actions is immaterial, so long as the present teachings remain operable. Any use of section headings is intended to aid reading of the document and is not to be interpreted as limiting; information that is relevant to a section heading may occur within or outside of that particular section. All publications, patents, and patent documents referred to in this document are incorporated by reference herein in their entirety, as though individually incorporated by reference. In the application, where an element or component is said to be included in and / or selected from a list of recited elements or components, it should be understood 16 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) that the element or component can be any one of the recited elements or components and can be selected from a group consisting of two or more of the recited elements or components. In the methods described herein, the acts can be carried out in any order, except when a temporal or operational sequence is explicitly recited. Furthermore, specified acts can be carried out concurrently unless explicit claim language recites that they be carried out separately. For example, a claimed act of doing X and a claimed act of doing Y can be conducted simultaneously within a single operation, and the resulting process will fall within the literal scope of the claimed process. In this document, the terms "a," "an," or "the" are used to comprise one or more than one unless the context clearly dictates otherwise. The term "or" is used to refer to a nonexclusive "or" unless otherwise indicated. The statement "at least one of A and B" or "at least one of A or B" has the same meaning as "A, B, or A and B." "About" as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20% or ±10%, in certain embodiments ±5%, in certain embodiments ±1%, in certain embodiments ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods. Kit and Method for Preparing Plasmid In some aspects, the present invention is directed to a kit for preparing a plasmid. In some embodiments, the kit comprises a parent DNA molecule. In some embodiments, the parent DNA molecule comprises a DNA strand which comprises, from a 5’ to 3’ direction: a phage f1 initiator (such as a synthetic phage f1 initiator); a payload sequence or a sequence for inserting the payload sequence; and a phage f1 terminator (such as a synthetic phage f1 terminator). In some embodiments, the kit further comprises a filamentous phage replication initiator protein GPII or a nucleic acid encoding the GPII. In some embodiments, the GPII protein described in the specification is a genetically engineered GPII protein, such as a GPII protein engineered via directed evolution methods. 17 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) In some embodiments, when inside a host cell, the parent DNA molecule and the GPII produce a circular double stranded DNA molecule (plasmid) including: a phage f1 plasmid origin formed by joining the phage f1 initiator and the phage f1 terminator; and the payload sequence. It is worth noting that the parent DNA molecule included in the kit does not have to comprise the payload sequence. Rather, the payload sequence can be inserted into the parent DNA molecule at a later time. In some embodiments, the parent DNA molecule in the kit comprises a sequence for inserting the payload sequence, such as a multiple cloning site, to simplify the insertion of the payload sequence. Referring to the non-limiting embodiment illustrated in Fig. 9, the parent DNA molecule (100 / 100’) can be either a linear DNA molecule 100 or a circular DNA molecule 100’. The parent DNA molecule comprises, from a 5’ to 3’ direction, a phage f1 initiator (101 / 101’), a payload sequence (103 / 103’), and a phage f1 terminator (105 / 105’). Without wishing to be bound by theory, it is hypothesized that, in the host cell (or a cell free system having similar environment) and in the presence of GPII protein, the GPII protein introduces a nick in the positive strand of the phage f1 initiator (101 / 101’) and a nick in the positive strand of the phage f1 terminator (105 / 105’). The positive chain of the parent DNA molecule (100 / 100’) between the two nicks then leaves the parent DNA molecule (100 / 100’) and forms a circular single stranded DNA molecule via the joining of the two ends. Since one or more of the phage proteins responsible for packaging the circular single stranded DNA molecule into a phage particle and exporting the same out of the host cell in the host cells is absent in the host cell (or the cell free system), the cellular machinery converts this circular single stranded DNA molecule into a circular double stranded DNA molecule, i.e., plasmid 200. In plasmid 200, the remining portions of f1 initiator (101 / 101’) and f1 terminator (105 / 105’) joins to form the phage f1 replication origin 201. The payload sequence 203 is derived directly from the payload sequence 103 / 103’ in the parent DNA molecule 100 / 100’. 18 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) It is further hypothesized that, after the section positive chain of the parent DNA molecule (100 / 100’) between the two nicks then leaves the parent DNA molecule (100 / 100’), the host cell cellular machinery remakes this section of the positive chain using the remaining negative chain as a template, thus allowing the continuous production of the plasmid 200 from the parent DNA molecule 100 / 100’. Since the procedures of isolating one plasmid is likely to isolate another also presented in the system, in the case where the parent plasmid is the circular DNA molecule100’, there is sometimes a need to remove the circular DNA molecule100’ from the product plasmid 200. In some embodiments, the additional sequence 107’ between the 3’-end of the f1 terminator 105’ and the 5’-end of the f1 initiator comprises a destruction element, such as an enzyme cutting site, such as a restriction enzyme cutting site. In some embodiments, the phage f1 origin is a replication origin derived from a filamentous phage, such as an F specific filamentous (Ff) phage genome, or an M13 phage genome. In some embodiments, the phage f1 origin includes all replication origins of filamentous phages, as well as sequences derived therefrom, as long as such sequences are able to support the "rolling circle replication” of a filamentous phage. In some embodiments, the phage f1 origin is replaced with another rolling circle replication origin, such as a phi29 phage replication origin, a lambda phage replication origin, a phiX174 phage replication origin, or a mammalian circovirus replication origin, or sequences derived therefrom (as long as such sequences are able to support the rolling circle replication of the viral genomes). In some embodiments, the phage f1 initiator and / or the phage f1 terminator is replaced with an initiator / terminator derived from the phi29 phage replication origin, lambda phage replication origin, phiX174 phage replication origin, or mammalian circovirus replication origin. In some embodiments, the phage f1 initiator comprises a melting sequence, a β sequence, a γ sequence, and a δ sequence. In some embodiments, the phage f1 terminator comprises an α sequence and a melting sequence. 19 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) In some embodiments, the GPII protein nicks the melting sequence in the phage f1 initiator, and nick the melting sequence in the phage f1 terminator at the same location. In some embodiments, the phage f1 origin formed in the produced plasmid comprise an α sequence, a melting sequence, a β sequence, a γ sequence, and a δ sequence. In some embodiments, the parent DNA molecule is a linear double stranded DNA molecule, a circular double stranded DNA molecule, a linear single stranded DNA molecule, or a circular single stranded DNA molecule. It is worth noting that, while the nicking by GPII, as well as the subsequent processes, requires the parent DNA molecule to be double stranded, the cellular machinery inside the host cell is able to convert the single stranded DNA molecules to double stranded molecules. In some embodiments, the parent DNA molecule is part of the genomic DNA of the host cell. In some embodiments, the parent DNA molecule is genetically engineered into the genomic DNA of the host cell. In some embodiments, the parent DNA molecule is an extra genomic DNA, such as a plasmid. In some embodiments, the method of the kit herein uses a nucleic acid encoding the GPII. In some embodiments, the nucleic acid encoding the GPII is part of the genomic DNA of the host cell (such as engineered into the genome). In some embodiments, the nucleic acid encoding the GPII is part of an extra genomic DNA (such as a plasmid), or part of an mRNA. In some embodiments, a size of the produced plasmid minus the payload sequence thereof is about 2,000 base pairs or less, such as about 1,500 base pairs or less, about 1,000 base pairs or less, about 800 base pairs or less, about 600 base pairs or less, about 500 base pairs or less, about 400 base pairs or less, about 300 base pairs or less, about 200 base pairs or less, about 100 base pairs or less, about 80 base pairs or less, or 60 base pairs or less. In some embodiments, the plasmid produced by the kit does not comprise a origin of replication apart from the phage f1 origin. In some embodiments, the plasmid produced by the kit does not comprise a bacterial origin of replication, but comprises 20 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) one or more replication origins that functions in a non-bacterial cell, such as a mammalian cell, such as a human cell. In some embodiments, the terms “bacterial origin of replication” and “bacterial replication origin” refers to a replication origin that allows the initiation of DNA replication in a bacterial cell, and include replication origins that found in bacteriophages that infect bacteria but not found in the bacteria per se. In some embodiments, the plasmid produced by the kit does not comprise an antibiotic resistance gene. In some embodiments, the host cell is an E. coli cell. In some embodiments, the kit comprises the host cell. In some embodiments, the kit does not use a host cell but a cell free system mimicking the inside of the host cell. In some embodiments, the kit comprises the cell free system. In some aspects, the present invention is directed to a method of preparing the product plasmid. In some embodiments, the method uses a kit, such as the kit described elsewhere herein. In some embodiments, the method further comprises introducing the parent DNA into the host cell or the cell free system. In some embodiments, the method further comprises transforming, electroporation, transfecting, injecting, or otherwise introducing the parent DNA into the host cell, or the cell free system. Plasmid In some aspects, the present invention is directed to a plasmid. In some embodiments, the plasmid is a plasmid prepared by the kit and / or method herein. In some embodiments, the plasmid does not include a bacterial backbone element, such as the bacterial replication origins or antibiotic resistance markers. In some embodiments, a size of the plasmid minus the payload sequence thereof is about 2,000 base pairs or less, such as about 1,500 base pairs or less, about 1,000 21 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) base pairs or less, about 800 base pairs or less, about 600 base pairs or less, about 500 base pairs or less, about 400 base pairs or less, about 300 base pairs or less, about 200 base pairs or less, about 100 base pairs or less, about 80 base pairs or less, or 60 base pairs or less. In some embodiments, the minimalistic nature of the plasmid results in significantly improved payload sequence to non-payload sequence ratio. In some embodiments, the plasmid comprises a phage f1 origin; and a payload sequence. In some embodiments, the plasmid is an isolated plasmid. In some embodiments, the plasmid comprises one phage f1 origin. In some embodiments, the phage f1 origin is a replication origin derived from a filamentous phage genome, such as an F specific filamentous (Ff) phage genome. In some embodiments, the phage f1 origin comprises an α sequence, a melting sequence, a β sequence, a γ sequence, and a δ sequence. In some embodiments, the plasmid does not comprise a replication origin apart from the phage f1 origin. In some embodiments, the plasmid does not comprise a bacterial replication origin, but comprises one or more replication origin that functions in other cell types, such as mammalian cells, such as human cells. In some embodiments, the plasmid does not include an antibiotic resistance gene. Kit and Method for Expressing Protein In some aspects, the present invention is directed to a kit, such as a kit for expressing a protein. In some embodiments, the kit comprises a filamentous phage replication initiator protein GPII or a nucleic acid encoding the GPII. In some embodiments, the kit further comprises a first DNA molecule. In some embodiments, the first DNA molecule comprises a DNA strand, and the DNA strand comprises, in a 5’- to 3’- direction: a phage f1 initiator; a payload sequence encoding a protein; a promotor; and a phage f1 terminator. 22 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) In some embodiments, when in a host cell or a cell free system mimicking the inside of the host cell, the GPII and cellular machinery of the host cell joins a 3’ portion of the phage f1 initiator to a 5’ portion of the phage f1 terminator to form a phage f1 origin, thereby producing a circular double stranded second DNA molecule. In some embodiments, in the second DNA molecule, the promotor drives the expression of the protein encoded by the payload sequence. Referring to the non-limiting embodiment illustrated in Fig. 10, the first DNA molecule can be either a linear DNA molecule 300 or a circular DNA molecule 300’ (such as a plasmid). In the linear first DNA molecule 300, the promoter 305 is downstream of the payload sequence 303, thereby unable to drive the expression of the protein encoded by the payload sequence 303. In the circular first DNA molecule 300’, the 3’-end of the promoter 305’ is separated from the 5’-end of the payload sequence 303’ by the f1 terminator 307’, the blocking sequence 309’, and the f1 initiator 301’. Due to the significant distance between the promoter 305’ and the payload sequence 303’, the promoter 305’ has limited or no ability to drive the expression of the protein encoded by the payload sequence 303’. In some embodiments, the blocking sequence 309’ comprises bacterial backbone sequences. When the first DNA molecule 300 / 300’ is in the host cell (or a cell free system having similar environment) and in the presence of GPII protein, the GPII protein introduces a nick in the positive strand of the phage f1 initiator (301 / 301’) and a nick in the positive strand of the phage f1 terminator (307 / 307’). The positive strand of the parent DNA molecule 300 / 300’ between the two nicks then leaves the parent DNA molecule 300 / 300’ and forms a circular single stranded DNA molecule via the joining of the two ends generated by the nicking. Since one or more of the phage proteins responsible for packaging the circular single stranded DNA molecule into a phage particle and exporting the same out of the host cell in the host cells is absent in the host cell (or the cell free system), the cellular machinery converts this circular single stranded DNA molecule into a circular double stranded DNA molecule, i.e., plasmid 23 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) 400. In plasmid 400, the remining portions of f1 initiator (301 / 301’) and f1 terminator (307 / 307’) join to form the phage f1 replication origin 401. In plasmid 400, the promoter 405 is in the upstream of the protein encoding payload sequence 403 and these two are separated by only the f1 origin 401. Due to the limited size of the phage f1 origin, the transcription factors are able to slide pass this section and effectively transcribe the payload sequence 403. Since the expression system exemplified in Fig. 10, as well as other expression systems herein, provides a novel switch to the expression of the payload protein, this expression system is suitable for, e.g., the expression of proteins toxic to the host cells. This novel expression switch mechanism can be combined with conventional expression controlling mechanisms. For example, the expression of the GPII protein can be switched on / off by with an inducible promotor (such as the rhaBAD promoter which is inducible by rhamnose) or a reversible transcription suppressor (such as the lac operator which is suppressed by Lac repressor LacI, which is in turn removed by lactose or mimics there of such as IPTG). The above expression regulatory elements can also be incorporated into the payload sequence, which would provide one additional layer of expression control. In some embodiments, the phage f1 origin is a replication origin derived from a filamentous phage, such as an F specific filamentous (Ff) phage genome, such as an M13 phage genome. In some embodiments, the phage f1 initiator comprises a melting sequence, a β sequence, a γ sequence, and a δ sequence. In some embodiments, the phage f1 terminator comprises an α sequence and a melting sequence. In some embodiments, the GPII protein nicks the melting sequence in the phage f1 initiator, and nick the melting sequence in the phage f1 terminator at the same location. In some embodiments, the phage f1 origin formed in the produced plasmid comprise an α sequence, a melting sequence, a β sequence, a γ sequence, and a δ sequence. 24 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) In some embodiments, the first DNA molecule is a linear double stranded DNA molecule, a circular double stranded DNA molecule, a linear single stranded DNA molecule, or a circular single stranded DNA molecule. In some embodiments, the first DNA molecule is part of the genomic DNA of the host cell, or an extra genomic DNA. In some embodiments, the nucleic acid encoding the GPII is part of the genomic DNA of the host cell, part of an extra genomic DNA, or part of an mRNA. In some embodiments, the expression of the GPII is inducible. In some embodiments, the first DNA molecule is a circular DNA molecule, and the first DNA molecule further comprises, between a 3’-end of the f1 terminator and a 5’-end of the f1 initiator, a blocking sequencing. In some embodiments, a length of the blocking sequence is about 100 nucleotides or longer, such as about 200 nucleotides or longer, about 300 nucleotides or longer, about 500 nucleotides or longer, about 750 nucleotides or longer, about 1,000 nucleotides or longer, about 1,500 nucleotides or longer, about 2,000 nucleotides or longer, or about 3,000 nucleotides or longer. In some embodiments, the blocking sequence comprises a transcription terminator, such as a double terminator sequence. In some embodiments, the expression of the protein encoded by the payload sequence is harmful to the host cell. In some embodiments, the host cell is an E. coli cell. Examples The instant specification further describes in detail by reference to the following experimental examples. These examples are provided for purposes of illustration only, and are not intended to be limiting unless so specified. Thus, the instant specification should in no way be construed as being limited to the following examples, but rather, should be construed to encompass any and all variations which become evident as a result of the teaching provided herein. 25 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) Example 1 In some non-limiting embodiments, the present study developed a DNA production system, sometimes termed “plasmid from Leading Strand Synthesis (pLeSS)” herein. This pLeSS DNA production system in accordance with some embodiments allows the high-yield production of circular DNA molecules of defined sequence length and composition via the inducible synthesis of the leading (+) strand. The production of DNA with pLeSS is regulable, allowing timely separation of culture expansion from the production process. pLeSS production requires two genetic components in the same bacterial cell: (1) Inducible expression of a protein that initiates and terminates DNA replication at defined sequence elements; and (2) a DNA template that contains these defined sequence elements acting as separated initiators and terminators. pLeSS enables the inducible and scalable production of large amounts of DNA using procedures that were established for high yield protein expression. In some embodiments, expression and template constructs are co-transformed into E. coli host cells. Upon induction of bacteriophage M13 replication initiator protein (GPII protein), single-stranded DNA (ssDNA) is synthesized in a leading strand replication process in the 5’ to 3’direction (relative to M13 viral strand) starting from the initiation site and stopping at the termination site. Single copies of the displaced strand are then circularized, and a new replication cycle is initiated. The circular single-stranded DNA (cssDNA) from the initial leading strand synthesis is further converted into a mini- circular dsDNA which is named pLeSS picomid herein. pLeSS picomids have uniform lengths and compositions that are defined by the location of initiator and terminator elements on the template. Multiple replication cycles result in the accumulation of a large amount of DNA circles. pLeSS picomid products retain only minimal, non-cargo sequences from the template, obviating the need for further downstream processing of the product. The noncoding sequences can be minimized to a core sequence of 51 bp. Hence, pLeSS picomid production will impact and transform DNA manufacturing for applications in gene therapy, DNA vaccination and other potential uses. 26 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) Example 2 Plasmid DNA is used for DNA vaccines and gene therapies against many infectious, acquired, and genetic diseases (Prazeres et al. Microbiol Spectr, 2014. 2(6)). These therapeutics require microgram to gram amounts of good manufacturing practice (GMP) manufactured DNA for individual programs (Ohlson., Plasmid manufacture is the bottleneck of the genetic medicine revolution. Drug Discov Today, 2020). While plasmid DNA can be produced in almost unlimited amounts and purification procedures are well established, standard plasmids have >2 kb bacterial backbones that contain replication origins, antibiotic resistance markers, and diverse extraneous bacterial DNA sequences. These sequence elements are required for the production process in bacteria but are of no use in mammalian cells and are known to have adverse effects. Bacterial backbone sequences can induce an immune reaction when recognized as Pathogen Associated Molecular Pattern (PAMP) by the activation of toll-like receptors (TLR9) (Klinman, Expert Opin Biol Ther, 2004. 4(6): p. 937-46). Larger (>1kb) bacterial backbone sequences can also induce silencing of transgene expression in the host cell (Lu et al., Mol Ther, 2012. 20(11): p. 2111-9). In addition, a very important risk for therapeutic application is the possibility of uptake of the antibiotic resistance by the host microbiome. Hence, regulatory agencies such as the European Medicines Agency (EMA) and the Federal Drug Administration (FDA) require avoidance of resistance genes in the context of gene therapy (Research, F.-C.f.B.E.a., Guidance for industry: considerations for plasmid DNA vaccines for infectious disease indications. , F.a.D.A. U.S. Department of Health and Human Services, Editor. 2007: New York, NY; Therapies, E.C.f.A., Guideline on the quality, non-clinical and clinical aspects of gene therapy medicinal products, E.M. Agency, Editor. 2018: Rome; and Research, F.C.f.B.E.a., Recommendations for Microbial Vectors Used for Gene Therapy Guidance for Industry, F.a.D. Administration, Editor. 2016: Rockville, MD). Removal of the bacterial backbone from a standard plasmid after purification requires enzymatic digestion and re-ligation of the construct which makes the production process impractical for large-scale manufacturing. For this reason, different approaches have been developed to exclude or minimize bacterial vector sequences in 27 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) the final DNA product. Minimal vectors, which are devoid of the bacterial backbone and consist exclusively of the eukaryotic expression cassette demonstrate better performance in terms of expression levels, bioavailability, transfection rates and increased therapeutic effects than standard plasmids. In DNA minicircles, the bacterial backbone sequence with the antibiotic resistance and the origin is removed by a recombination process during production in E. coli cells. The expression cassette (payload) in the production plasmid is flanked by recombination sites and contains an inducible integrase / recombinase gene. Upon induction of the recombinase, intramolecular recombination between attB and attP results in the formation of two circular DNA molecules, one the expression cassette (minicircle product), and the other the bacterial DNA backbone as a recombination byproduct (miniplasmid). The residual miniplasmid circles formed by the backbone can be degraded in bacteria by the inclusion of the endonuclease I-SceI gene with its recognition site in the template plasmids. Minicircle DNA is significantly smaller than the normal plasmid DNA, resulting in higher transfection efficacies. However, the induction and complicated propagation steps make minicircle production time-consuming and cost-intensive, and production yields highly variable. Another significant development in the field was the nanoplasmid technology by Nature Technology. Nanoplasmids are small circular dsDNA constructs that allow the propagation of plasmid DNA with minimum bacterial backbone sequences (<500 bp), they can be produced with large yields, while showing up to 10 times higher transgene expression compared to minicircle vectors. Antibiotic resistance genes are replaced with a small RNA selectable marker (RNA-OUT). This allows antibiotics-free selection, and an enhancer effect which dramatically improves gene expression compared to plasmids with antibiotic resistance markers. In addition, the Nanoplasmid’s origin of replication (R6K) has host-restricted replication and requires a specific E.coli strain for replication, thus preventing propagation of the nanoplasmids in the environment. This feature enhances safety for therapeutic applications, as opposed to the promiscuity of first-generation plasmids for gram negative host bacteria. Moreover, nanoplasmids show higher expression levels and resistance to gene silencing. However, while 28 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) bacterial elements in nanoplasmids are optimized for non-interference for payload expression, ~500 bp bacterial sequence are still part of the end product. To address the growing need for customized vector-free DNA, a simple and flexible DNA production system is needed that allows the efficient and scalable manufacture of defined DNA sequences that are free of (or with minimal) undesired functional elements. Existing methods to produce therapeutic plasmids in bacteria, such as minicircles and nanoplasmids require nonstandard procedures. The same is true for MIDGE (minimalistic, immunological-defined gene expression) vectors, which require in vitro ligation of annealed primers to restriction digested vector. Newer technologies, such as Doggybone™ linear closed DNA (dbDNA™) are synthesized in vitro using enzymatic processes that requires a dedicated manufacturing setup that is different from existing cell-based production facilities. Filamentous bacteriophages such as single-stranded M13 bacteriophage provide an alternative approach to produce DNA at high fidelity and purity in the form of single stranded circles. Upon phage infection of the E. coli host, the single stranded phage genome is converted into dsDNA by the endogenous replication machinery from secondary structures and RNA priming sites. Out of the encoded 10 functional M13 proteins, the GPII protein plays a role in the amplification of the M13 genome. GPII binds to specific sequence sites in F1-ori (α-AGTCCACGTT, melting-TTTAATA, β- TGGAC, γ-GTTCCA, and δ-TGGAAC) and induces a single strand break at the nicking site (Meyer et al., J Biol Chem, 1979. 254(24): p. 12636-41). The free 3’-hydroxyl end of the nick serves as a primer for single stranded DNA (ssDNA) synthesis, which proceeds through displacement of the nicked strand as ssDNA by DNA polymerase III and the rep helicase in the presence of ssDNA binding proteins (Geider et al., J Biol Chem, 1982. 257(11): p. 6488-93; and Meyer et al., Nature, 1982. 296(5860): p. 828- 32). ssDNA replication terminates by GPII cleavage of ssDNA at the second downstream nicking site (Harth et al., Eur J Biochem, 1981. 119(3): p. 663-8.). The ssDNA is circularized, bound by GPV proteins for transport to the cell membrane, and wrapped by the major phage coat and capsid proteins during extrusion of the phage particle. 29 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) Phagemid derived circular single-stranded DNA (cssDNA) products are commonly used for DNA origami scaffolds and complex nanostructures, and diverse other applications. Recently, it was demonstrated that phagemid-derived cssDNAs harboring transgene payload are superior donor templates for gene engineering. Phagemids are chimeric vectors derived from the single-stranded bacteriophage M13 or f1 and can replicate as plasmids in bacterial hosts vectors. The phagemid system utilizes separated synthetic initiators and terminators derived from F1 phage origin of replication sequence to allow the generation of uniform cssDNA molecules. The insert (payload) sequence between the synthetic initiator and terminator does not contain undesired sequences from the phagemid backbone and can accommodate up to 50 kilobases DNA. Phagemids encode only for the sequence elements of the phage required for replication and assembly but not the structural components of the phage. Production of the single stranded DNA requires therefore co-infection of the host with a “helper phage” or co-transformation of a “helper plasmid” to express the necessary phage proteins. The M13 phage proteins (including GPII, GPV and GPX, etc.) encoded by the helper phage or helper plasmid will initiate a leading strand replication and generate phage particles packaged with ssDNA. Fig. 1 illustrates the cssDNA-packaged phage particle production process when engineered phagemid was co-transformed with M13-f1 helper plasmid. Early on, it was demonstrated that the initiator and terminator functions in the F1 origins can be separated by duplication and further mutation of the duplicated origins (Dotto et al., J Mol Biol, 1981. 153(1): p. 169-76; Dotto et al., Proc Natl Acad Sci U S A, 1982. 79(23): p. 7122-6; and Specthrie et al., J Mol Biol, 1992. 228(3): p. 720-4). However, the separation was not complete which resulted in unwanted ssDNA products. Nafisi et al. developed an optimized ssDNA pScaf phagemid by deleting the last 50 bp in the downstream initiation enhancer region and, in addition, substitution of 3 bases in the δ element of the terminator (Nafisi et al., Synth Biol (Oxf), 2018. 3(1)). Subsequently, separation of function was then further refined with a construct that has a deletion of the δ element in the terminator and the deletion of the alpha element in the initiator (Inho phagemid) (Dotto et al., Proc Natl Acad Sci U S A, 1982. 30 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) 79(23): p. 7122-6; Cha et al., Advanced Functional Materials, 2021. 31(35)). Purified cssDNA generated from these phagemids is of uniform length (>97.5%) without bacterial backbone sequences. Precise circularization from the synthetic terminators ensures minimal extraneous base pair incorporation to the final phage cssDNA, with ~ 500 bases (“fairing”) leftover F1 origin of replication DNA sequence in a “phage scar”. Furthermore, these phagemid vectors allow the production of ssDNA of 20 kB and potentially larger in size (Xie et al., Circular single-stranded DNA is a superior homology-directed repair donor template for efficient genome engineering. bioRxiv, 2022; and Cha et al., Advanced Functional Materials, 2021. 31(35)). Example 3 GPII is the only phage protein that is responsible for initiating leading strand replication and circularization of the ssDNA. It was hypothesized that modifying the ssDNA production system by removing phage proteins other than GPII from would result in the produced ssDNA being concentrated in the host cell rather than packaged and exported out of the host cells, thus reducing the energy expenditure and improving yield. Surprisingly, the present study discovered that, in the absence of phage DNA sequence for packaging and / or for minus strand synthesis, and capsid proteins, the DNA molecules produced by the modified system were all circular double stranded DNA, i.e., plasmids. Without wishing to be bound by theory, it is hypothesized that modified system still produced cssDNA in the host cell. The cssDNA, however; was not packaged in phage particles and therefore converted into dsDNA by the endogenous replication machinery from secondary structures and RNA priming sites (Rakowski et al., Plasmid, 2013. 69(3): p. 231-42). Example 4 The present study first cloned an engineered phagemid pFC-G (Fig. 2) adopted from pScaf and Inho constructs. pFC-G contains the pSCAF terminator sequence in the δ element (TGGTTT) and a changed β element (CTGTT instead of TGGAC), while α, γ 31 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) and melting sequences are unchanged from the wild type. The α element of initiator and the last 50 bp in the downstream initiation enhancer region were removed. In addition, the packaging sequence was removed in pFC-G phagemid. A 1.8 Kb of DNA insert payload was cloned between synthetic initiator and terminator in pFC-G phagemid. For the trans-acting replication factor GPII expression, the present study originally constructed a plasmid with GPII expression under control of the T7 promoter and lac Operator (LacO). IPTG (Isopropyl β-D-1-thiogalactopyranoside) was used to induce GPII expression. However, it is documented that T7 promoter can be leaky and express protein without induction by IPTG. The leaking expression could result in inconsistent levels of expression upon induction (Muller-Hill et al., Proc Natl Acad Sci U S A, 1968. 59(4): p. 1259-64) and the uncontrolled expression of GPII compromised the bacterial growth, resulting in variable performance (data not shown). So, the present study switched to rhamnose-inducible rhaBAD promoter (Fig. 3A), which allows for tighter control of GPII expression and has low leaky expression (Kelly et al., ACS Synth Biol, 2018. 7(4): p. 1056-1066). The present study first tested the hypothesis in BL21 (DE3) bacterial strain by co-transforming engineered pFC-G phagemid with GPII expression plasmid under control of Rhamnose-inducible rhaBAD promoter. Total plasmids were extracted from the culture after overnight growth. As shown in Fig. 3B, a dominant DNA band at 1.0- 1.5 kb size (much smaller than the transformed pFC-G and GPII plasmids) was observed in the co-transformation condition after L-Rhamnose induction. DNA was extracted from this gel band. Sanger sequencing with both forward and reverse primers confirmed DNA as the pLeSS double-stranded circular picomid DNA. The junction sequence of GPII-mediated circularization at initiator and terminator after leading strand replication was also confirmed as expected. Besides the 1.8 kb of the insert payload, pLeSS picomid contained 256 bp of fairing sequence derived from the synthetic initiator and terminator and their surroundings from pFC-G phagemid. The migration of the pLeSS DNA is faster than its total DNA length (~2 kb) suggests the majority of pLeSS picomid products were in their supercoiled form. DNA agarose gel band intensity analysis showed pLeSS dsDNA picomid represented ~90% of the total 32 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) plasmids generated upon GPII induction. The estimated yield of pLeSS picomid was between 8-10 µg per milliliter of culture. Interestingly, when bacterial cells were co- transformed with pFC-G and GPII plasmids, pLeSS picomids were also produced in the absence of L-Rhamnose induction, but at much lower yield (~ 2 µg per milliliter of culture) and lower purity (~70%). This could be attributed to leaky expression of GPII under rhaBAD promoter in the absence of L-Rhamnose. Unlike T7 promoter, the protein leaky expression under rhaBAD promoter was demonstrated to be low (Kelly et al., ACS Synth Biol, 2018. 7(4): p. 1056-1066). This suggests that low level of GPII was sufficient to produce pLeSS plasmid in this system. Overnight induction pf GPII expression by L-Rhamnose resulted in at least 4-5-fold higher yield of pLeSS picomid compared to non-induced condition. The pLeSS picomids were absent when E. Coli. cells were transformed only with GPII plasmid or parental phagemid alone. These data supported the hypothesis that GPII was sufficient to initiate leading strand replication using parental phagemid with synthetic initiator and terminator, which leads to cssDNA synthesis. In the absence of phage packing and capsid proteins, cssDNA will be converted into double-stranded form (pLeSS picomid DNA) inside of the cells by endogenous mechanism (Horiuchi, Genes Cells, 1997. 2(7): p. 425-32). Two plasmids (pFC-G and GPII) co-transformation methods were used to produce pLeSS picomid DNA. The pFC-G and GPII plasmids were also expected to propagate under their own replication origins during culturing. However, the pFC-G and GPII plasmids only represented ~10% (or less) of the total extracted plasmids in the presence of L-Rhamnose induction. It was reasoned that the pLeSS picomid production process was the major / dominant energy consuming activity, which limited the pFC-G and GPII plasmids propagation. Although pLeSS picomid can be produced and extracted at high yield and high purity. Separation of pLeSS picomid from pFC-G and GPII plasmids contaminants is needed to get high purity. A couple of strategies can be implemented for this purpose. 1) Engineer E. coli strain to integrate GPII expression cassette and / or phagemid parental sequence for pLeSS picomid production (DNA insert and the franking synthetic initiator and terminator) into the chromosome. 2) Use restriction enzymes and exonucleases to specifically degrade the GPII and / or parental 33 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) phagemid. These approaches can be combined with utilizing temperature sensitive replication origin in GPII and / or parental phagemids to limit undesired plasmid propagation. To explore these directions, the present study first designed pKD-TN5-I-SceI- GP2 plasmid to integrate the GPII expression cassette and intron-encoded endonuclease (I-SecI) expression cassette using TN5 transposons system. As shown in Fig. 4, heat sensitive replication origin repA101-ts from pKD46 plasmid was used to allow low copy replication of the plasmid and to denature at temperature above 37 °C. TN5 expression is under inducible rhaBAD promoter. The GPII expression cassette and heat- inducible I-SceI expression cassette, together with KanaR gene were flanked with TN5 recognition inverted repeat sequence, mosaic end (ME). It was reasoned that I-SceI is a good candidate for restriction enzyme to cleave the GPII and or parental phagemid because it recognizes an 18-base pair sequence (5'-TAGGGATAACAGGGTAAT-3', SEQ ID NO:1) that occurs very rarely in the genome. Thus I-SceI could be a universal tool for cleaving and degrading the transformed plasmids with its recognition site. GPII expression was under control of inducible rhaBAD promoter, while I-SceI expression was under tight control of thermo-responsive λ-pL / cl857 promoter. The I-SceI restriction enzyme expression was repressed under normal culture condition (30 °C -35 °C) and will be turned on above a certain temperature threshold (42 °C). The pKD-TN5- I-SceI-gp2 plasmid was transformed into Mach1 cells (Thermo Fisher) with carbenicillin selection and 30 °C growth condition. Cells were selected with kanamycin culture media for TN5 mediated genome integration and were grown at 42 °C to allow denaturing of pKD-TN5-I-SceI-gp2 plasmid. Eight colonies growth with kanamycin selection were made competent to examine the integration of GPII and I-SecI expression cassettes. To test the and screen bacterial strains that were integrated with GPII and I-SecI expression cassettes in their genome, a pFC-G derived pKD-I-SceI-sfGFP reporter phagemid was generated. As shown in Fig. 5A, the ColE1 replication origin was replaced with heat-sensitive replication origin repA101-ts in pKD-I-SceI-GFP. The I- SceI recognition site was cloned into the vector between the ampicillin resistance gene 34 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) and repA101-ts origin. The riboswitch and superfolder GFP (riboJ-sfGFP) fusion protein expression was placed in front of BfJ23101 promoter. The reversely placed riboj-sfGFP-BfJ23101 was flanked with synthetic M13 initiator and terminator sequence from pFC-G phagemid. The correct BfJ23101-riboj-sfGFP expression cassette will be enclosed in the pLeSS picomid products by the circularization of synthetic initiator and terminator in the presence of GPII. As expected, no GFP fluorescence in the bacterial pellet can be detected when the reporter phagemid was transformed into control Mach 1 strain (data not shown). When the reporter phagemid was transformed into the Marh 1 E. coli stable clones with GPII and I-SecI integration that were generated from kanamycin selection in Fig. 4. Bright GFP green fluorescence was observed in the bacterial pellets when exposed to blue light (Fig. 5B). All eight colonies integrated with GPII and I-SecI expression cassettes showed GFP fluorescence after transformation of the reporter phagemid. Five representative cell pellets were shown in Fig. 5B. M15 clone with the brightest green fluorescence and fastest growth rate was selected as the preferred GPII and I-SceI stable host for future use. To further minimize the remaining excess sequence (phage scar or fairing) in the pLeSS picomid, the present study performed a series of engineering at the synthetic M13 initiator and terminator to identify minimal essential sequence in the core and surrounding regions. The same 1.8 Kb of DNA insert payload as in pFC-G phagemid was cloned between the initiator and terminator regions in these engineered phagemids. Engineered phagemids were transformed into M15 stable clones with GPII and I-SceI integrations to determine the yields of pLeSS picomids from templates that contain phage scar sequences between 81 bp and 256 bps (Fig. 6A). Yields were somewhat variable depending on the sequence compositions, but a strong correlation was observed with size. Once the sequence length in the scar dropped below 200 bp, yield seems to drop significantly. It was found that the 27 bp downstream of the 43 bp core initiator region was not required for pLeSS picomid production, while could increase the pLeSS picomid yield around 2-fold. The immediate duplicated 44 bp sequence upstream of both the core initiator and / or terminator were critical for pLeSS picomid production. The upstream 131 bp sequence beyond the 44 bp duplicated sequence in the terminator 35 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) region will also help pLeSS picomid production, as small truncation resulted in decreased pLeSS picomid yield. Additionally, although some sequence modifications were made in the core region of initiators and terminators to facilitate the uniform cssDNA production, pScaf or Inho constructs overall have duplicated F1 origin sequence in both initiator and terminator. The present study identified a phagemid pFC-V that with decent pLeSS picomid yield. The core region of the terminator of pFC-V phagemid has the most extensive deletions and has a minimal 19 bp sequence (GAGTCCACGTTCTTTAATAG, SEQ ID NO:2) which only contains the α-melting motifs in the terminator core region. pFC-V has melting-β-γ-δ motifs in the initiator core region. Further truncations were made completely removing the upstream sequence of this minimal 19 bp sequence in the terminator region (pFC-E). Although production yield is low, pLeSS picomid DNA with only 81 bp of faring size were successfully produced with this extreme modification. To the best knowledge of the inventors, this is the first time to demonstrate that splitting wild type F1 origin elements into initiator (melting-β-γ-δ motifs) and terminator (α-melting) is sufficient for GPII initiated leading strand synthesis, resulting in pLeSS picomid production, and the phage scar (fairing) sequence in the enclosed pLeSS picomid is as low as 81 bp. This sequence is substantially smaller than the minimal backbone sequence in nanoplasmids, and the minimum sequence that can be realistically achieved. After circularization by GPII, full wild-type F1 core origin sequence was reconstituted in the pLeSS picomid product. To achieve the minimal phage scar in the pLeSS picomid, the phagemid pFC-F where the payload DNA sequence is flanked by 43 bp core initiator region (melting-β-γ-δ) and 48 bp core terminator region (α-melting-β-γ-δ), is expected to produce pLeSS picomid, which has theoretically minimal 51 bp phage scar. The pLeSS invention conceives the inducible generation of pLeSS picomid of a defined length (custom insert payload) from a larger DNA template such as a phagemid. The pLeSS replication process is initiated and completed by the GPII phage replicator protein analogous to the naturally occurring ssDNA replication process. The key finding is that the M13 GPII protein is sufficient and necessary to initiate and complete 36 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) the replication from phage origin elements without the need for other phage proteins. It is hypothesized that, without the expression of the other phage proteins, the accumulating ssDNA products are not incorporated into phage particles but are instead converted by the bacterial replication machinery into double-stranded pLeSS picomid. The production of the pLeSS picomids is controlled by regulatable GPII expression. After extended induction of GPII expression, pLeSS picoplasmids are produced in large excess over the template plasmid and can easily be purified by standard plasmid extraction procedures. GPII expression cassette integrated stable E. coli clone could further simply the pLeSS picomid production procedure, while offering more reliable pLeSS picomid production. In some embodiments, the insert template sequence flanked by synthetic initiator and terminator is integrated into E. coli genome via various bacterial engineering methods. Figs. 7A-7B illustrate a representative strategy using the FLP-FRT recombination method. Other E. coli engineering toolkits such as CRISPR-Cas9, Lambda Red system, transposon system, etc. With both GPII and insert template sequence integrated into E. coli genome, pLeSS picomid could be produced without the need of plasmid transformation. This could streamline extraction and purification process even further (Fig. 8). Purification of the pLeSS picomids is comparable in ease and cost-efficiency to normal plasmid DNA production and standard plasmid extraction methods can be used. In contrast to the earlier minicircle solution, no costly post-purification processing is required to eliminate bacterial backbone sequences from pLeSS picomids. Moreover, pLeSS picomid production requires standard growth conditions, common antibiotics resistance markers and a conventional protein expression method are applied, which makes adoption of the production process easier when compared with minicircles, nanoplasmids and linearly covalently closed vectors (MIDGE, Doggybone) that require expensive and specialized production methods. The pLeSS system allows a separation of the growth phase from the production phase, hence resource utilization by the production system during the growth phase is 37 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) kept low. Therefore, with optimized growth and culturing of the bacteria in batch fermentation processes, high yield of pLeSS picomid production is expected. Primarily, pLeSS picomids could provide ideal non-viral vectors for gene therapy and vaccines, enabling an excellent safety profile and ease and economy of purification. pLeSS picomids retain a vector sequence which is 256 bp fairing sequences with good production yields. The fairing sequence can be further decreased to 51 bp minimal sequences, although with comprised yield. Most importantly, the small remaining pLeSS scars do not contain functional and structural bacterial sequences that could affect transgene expression or induce immunogenicity. This compares well to the nanoplasmid product which despite a minimal backbone size, retains two functional bacterial elements, the R6K replicator and RNA-OUT (antisense RNA encoding sequence) in a 500 bp vector sequence. While no extra post-purification process is required to eliminate bacterial backbone sequences from the pLeSS circles, the plasmid prep in the extraction still contains two other plasmids (if using co-transformation of GPII plasmid and parental phagemid) and one parental phagemid (if using GPII integrated stable strain) in the current workflow. While the overall amount of these plasmids in a standard preparation is much lower than the pLeSS product, the removal of these plasmids is nevertheless unavoidable to get high purity pLeSS picomid product. Hence, for the current implementation of the pLeSS procedure, additional fractionation / separation or digestion methods may be required to remove the remaining parental template and expression constructs. Since the pLeSS picomid products are smaller than the template plasmid and potentially the expression plasmid, an additional size separation step could be applied to further isolate pLeSS circles. Alternatively, the undesired plasmids could be digested by unique restriction enzyme followed by exonuclease digestion. Additional modification of the plasmid vectors has already been implemented to comprise a very rare cutting site of I-SceI.In some embodiments, after production of pLeSS picoplasmids but before cell lysis, I-SceI expression is induced to cut the parental vector containing 1,2 or multiple I-SceI recognition sites outside of the picomid sequences, thereby linearizing the parental DNA. The linearized parental DNA will then 38 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) be degraded by other nucleases native to the host cell and thus removed from the final product. For example, referring to Fig. 11, a parental plasmid for the production of pLess picoplasmid was prepared, which contains two I-SceI recognition sites outside the initiator-terminator region (which is used as a template to produces pLess by the combined actions of GPII and host cell cellular machinery, see e.g., Fig. 3A). After inducing pLeSS picoplasmids production with rhamnose (with activates the rhaBAD promoter and drives the GPII expression) at 30 °C overnight, expression of I-SceI was induced by subjecting the cells to 42 °C (which activates the thermo-responsive λ- pL / cl857 promoter, which drives the expression of the I-SceI). The expression of I-SceI was confirmed to have removed the parental plasmid. . An optimal solution could be the integration of both parental construct and GPII expression cassette into the bacterial genome. Thus, growth conditions could be free of antibiotic selection, and additional purification steps to remove parental plasmids are not needed, ensuring maximal and reliable production yields of pLeSS DNA. These strategies were all designed to simplify and streamline the pLeSS DNA purification step. The pLeSS system allows flexible production of desired sequences from a given template construct. By adding flanking initiator and terminator sequences, desired sequences can be selected and then amplified and produced in a circularized stable form for further use. The synthetic replicator initiators / terminators can be placed at any given place in a construct or sequence region, thereby including or excluding certain sequence elements from the final product. Hence different end products can be derived from complex payloads, allowing the rapid generation of permutations of sequence elements for complex screening and metabolic engineering applications. Another interesting use in bioengineering could be pLeSS picomid DNA production from integrated initiator and terminator elements in a targeted genomic region at defined times or upon induction by external stimuli. With this potential, pLeSS picomid opens a new paradigm and will become an important component in its expanding toolbox for DNA manufacturing. Example 5 The sequences used in the present study are listed below: 39 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) Wild-type F1 replicaiton orgin gAGTCCACGTTcTTTAATAgTGGACtcttGTTCCAaacTGGAACaacact (SEQ ID NO:3) t Phagemid Complete sequence at initiator Complete sequence at terminator in pLeSS d 40 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) GTTTaacactaagctttaatgcggtagtttat cacagttaaat (SEQ ID NO:13) Enumerated Embodiments In some aspects, the present invention is directed to the following non-limiting embodiments: Embodiment 1: A kit, comprising: a parent DNA molecule comprising a DNA strand, wherein the DNA strand comprises from a 5’ to 3’ direction: a phage f1 initiator; a payload sequence or a sequence for inserting the payload sequence; and a phage f1 terminator; and 41 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) a filamentous phage replication initiator protein GPII or a nucleic acid encoding the GPII, wherein, when inside a host cell or a cell free system mimicking an inside of the host cell, the parent DNA molecule and the GPII produce a circular double stranded DNA molecule (plasmid) comprising: a phage f1 plasmid origin formed by joining the phage f1 initiator and the phage f1 terminator; and the payload sequence. Embodiment 2: The kit of Embodiment 1, wherein the phage f1 origin is a replication origin derived from a filamentous phage, optionally an F specific filamentous (Ff) phage genome, optionally an M13 phage genome. Embodiment 3: The kit of Embodiment 1 or 2, wherein the phage f1 initiator comprises a melting sequence, a β sequence, a γ sequence, and a δ sequence. Embodiment 4: The kit of any one of Embodiments 1-3, wherein the phage f1 terminator comprises an α sequence and a melting sequence. Embodiment 5: The kit of any one of Embodiments 1-4, wherein the parent DNA molecule is a linear double stranded DNA molecule, a circular double stranded DNA molecule, a linear single stranded DNA molecule, or a circular single stranded DNA molecule. Embodiment 6: The kit of any one of Embodiments 1-5, wherein the parent DNA molecule is part of the genomic DNA of the host cell, or an extra genomic DNA. Embodiment 7: The kit of any one of Embodiments 1-6, which comprises the nucleic acid encoding the GPII, wherein the nucleic acid encoding the GPII is part of the genomic DNA of the host cell, part of an extra genomic DNA, or part of an mRNA. Embodiment 8: The kit of any one of Embodiments 1-7, wherein a size of the produced plasmid minus the payload sequence thereof is about 1,000 base pairs or less. Embodiment 9: The kit of any one of Embodiments 1-8, wherein the plasmid produced by the kit does not comprise a bacterial replication origin apart from the phage f1 origin, or wherein the plasmid produced by the kit does not comprise an antibiotic resistance gene. 42 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) Embodiment 10: The kit of any one of Embodiments 1-9, wherein the parent DNA molecule comprises, at a location outside the phage f1 initiator, the payload sequence or the sequence for inserting the payload sequence, or the phage f1 terminator, a destruction element, and the parent DNA molecule is destroyed by targeting the destruction element without destroying the plasmid produced by the kit. Embodiment 11: The kit of any one of Embodiments 1-10, wherein host cell is an E. coli cell. Embodiment 12: A method of producing a circular double stranded DNA molecule (plasmid), the comprising contacting a parent DNA molecule with a filamentous phage replication initiator protein GPII in a host cell or a cell free system mimicking an inside of the host cell, wherein the parent DNA molecule comprises a DNA strand, and the DNA strand comprises from a 5’ to 3’ direction: a phage f1 origin initiator; a payload sequence or a sequence for inserting the payload sequence; and a phage f1 origin terminator, and wherein the plasmid comprises: a phage f1 origin formed by joining the phage f1 origin initiator and the phage f1 origin terminator; and the payload sequence. Embodiment 13: The method of Embodiment 12, wherein the phage f1 origin is a replication origin derived from a filamentous phage, optionally an F specific filamentous (Ff) phage genome, optionally an M13 phage genome. Embodiment 14: The method of Embodiment 12 or 13, wherein the phage f1 initiator comprises a melting sequence, a β sequence, a γ sequence, and a δ sequence. Embodiment 15: The method of any one of Embodiments 12-14, wherein the phage f1 terminator comprises an α sequence and a melting sequence. Embodiment 16: The method of any one of Embodiments 12-15, wherein the parent DNA molecule is a linear double stranded DNA molecule, a circular double 43 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) stranded DNA molecule, a linear single stranded DNA molecule, or a circular single stranded DNA molecule. Embodiment 17: The method of any one of Embodiments 12-16, wherein the parent DNA molecule is part of the genomic DNA of the host cell, or an extra genomic DNA. Embodiment 18: The method of any one of Embodiments 12-17, wherein the GPII is expressed from a nucleic acid encoding the GPII. Embodiment 19: The method of Embodiment 18, wherein the nucleic acid encoding the GPII is part of the genomic DNA of the host cell, part of an extra genomic DNA, or part of an mRNA. Embodiment 20: The method of any one of Embodiments 12-19, wherein a size of the produced plasmid minus the payload sequence thereof is about 1,000 base pairs or less. Embodiment 21: The method of any one of Embodiments 12-20, wherein the plasmid produced by the method does not comprise a bacterial replication origin apart from the phage f1 origin, or the plasmid produced by the method does not comprise an antibiotic resistance gene. Embodiment 22: The method of Embodiments 12-21, wherein the parent DNA molecule comprises, at a location outside the phage f1 initiator, the payload sequence or the sequence for inserting the payload sequence, or the phage f1 terminator, a destruction element, and wherein the method further comprises: destroying the parent DNA molecule by targeting the destruction element without destroying the produced plasmid. Embodiment 23: The method of any one of Embodiments 12-22, wherein the host cell is an E. coli cell. Embodiment 24: A circular double stranded DNA molecule (plasmid), comprising: a phage f1 origin; and a payload sequence. Embodiment 25: The plasmid of Embodiment 24, which is an isolated plasmid. 44 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) Embodiment 26: The plasmid of Embodiment 24 or 25, which comprises one phage f1 origin. Embodiment 27: The plasmid of any one of Embodiments 24-26, wherein the phage f1 origin is a replication origin derived from a filamentous phage genome, such as an F specific filamentous (Ff) phage genome. Embodiment 28: The plasmid of any one of Embodiments 24-27, wherein the phage f1 origin comprises an α sequence, a melting sequence, a β sequence, a γ sequence, and a δ sequence. Embodiment 29: The plasmid of any one of Embodiments 24-28, wherein a size of the plasmid minus the payload sequence is about 1,000 base pairs or less. Embodiment 30: The plasmid of any one of Embodiments 24-29, which does not comprise a bacterial replication origin apart from the phage f1 origin, or does not comprise an antibiotic resistance gene. Embodiment 31: A kit, comprising: a filamentous phage replication initiator protein GPII or a nucleic acid encoding the GPII; and a first DNA molecule comprising a DNA strand, and the DNA strand comprises, in a 5’- to 3’- direction: a phage f1 initiator; a payload sequence encoding a protein; a promotor; and a phage f1 terminator, wherein, when in a host cell or a cell free system mimicking an inside of the host cell, the GPII and cellular machinery of the host cell joins a 3’ portion of the phage f1 initiator to a 5’ portion of the phage f1 terminator to form a phage f1 origin, thereby producing a circular double stranded second DNA molecule, and wherein, in the second DNA molecule, the promotor drives the expression of the protein encoded by the payload sequence. 45 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) Embodiment 32: The kit of Embodiment 31, wherein the phage f1 origin is a replication origin derived from a filamentous phage, optionally an F specific filamentous (Ff) phage genome, optionally an M13 phage genome. Embodiment 33: The kit of Embodiment 31 or 32, wherein the phage f1 initiator comprises a melting sequence, a β sequence, a γ sequence, and a δ sequence. Embodiment 34: The kit of any one of Embodiments 31-33, wherein the phage f1 terminator comprises an α sequence and a melting sequence. Embodiment 35: The kit of any one of Embodiments 31-34, wherein the first DNA molecule is a linear double stranded DNA molecule, a circular double stranded DNA molecule, a linear single stranded DNA molecule, or a circular single stranded DNA molecule. Embodiment 36: The kit of any one of Embodiments 31-35, wherein the first DNA molecule is part of the genomic DNA of the host cell, or an extra genomic DNA. Embodiment 37: The kit of any one of Embodiments 31-36, which comprises the nucleic acid encoding the GPII, wherein the nucleic acid encoding the GPII is part of the genomic DNA of the host cell, part of an extra genomic DNA, or part of an mRNA. Embodiment 38: The kit of any one of Embodiments 31-37, wherein the first DNA molecule is a circular DNA molecule, and wherein the first DNA molecule further comprises, between a 3’-end of the f1 terminator and a 5’-end of the f1 initiator, a blocking sequencing. Embodiment 39: The kit of Embodiment 38, wherein a length of the blocking sequence is about 100 nucleotides or longer. Embodiment 40: The kit of any one of Embodiments 31-39, wherein the expression of the protein encoded by the payload sequence is harmful to the host cell. Embodiment 41: The kit of any one of Embodiments 31-40, wherein host cell is an E. coli cell. Embodiment 42: A method of expressing a protein, comprising contacting a filamentous phage replication initiator protein GPII with a first DNA molecule in a host cell or a cell free system mimicking an inside of the host cell, wherein the first DNA 46 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) molecule comprises a DNA strand, and the DNA strand comprises, in a 5’- to 3’- direction: a phage f1 initiator; a payload sequence; a promotor; and a phage f1 terminator; and wherein the GPII and cellular machinery of the cell joins a 3’ portion of the phage f1 initiator to a 5’ portion of the phage f1 terminator to form a phage f1 origin, thereby producing a circular double stranded second DNA molecule, and wherein, in the second DNA molecule, the promotor drives the expression of the protein encoded by the payload sequence. Embodiment 43: The method of Embodiment 42, wherein the phage f1 origin is a replication origin derived from a filamentous phage, optionally an F specific filamentous (Ff) phage genome, optionally an M13 phage genome. Embodiment 44: The method of Embodiment 42 or 43, wherein the phage f1 initiator comprises a melting sequence, a β sequence, a γ sequence, and a δ sequence. Embodiment 45: The method of any one of Embodiments 42-44, wherein the phage f1 terminator comprises an α sequence and a melting sequence. Embodiment 46: The kit of any one of Embodiments 42-45, wherein the first DNA molecule is a linear double stranded DNA molecule, a circular double stranded DNA molecule, a linear single stranded DNA molecule, or a circular single stranded DNA molecule. Embodiment 47: The method of any one of Embodiments 42-46, wherein the first DNA molecule is part of the genomic DNA of the host cell, or an extra genomic DNA. Embodiment 48: The method of any one of Embodiments 42-47, which uses the nucleic acid encoding the GPII, wherein the nucleic acid encoding the GPII is part of the genomic DNA of the host cell, part of an extra genomic DNA, or part of an mRNA. Embodiment 49: The method of any one of Embodiments 42-48, wherein the first DNA molecule is a circular DNA molecule, and wherein the first DNA molecule further 47 52481671.2 Attorney Docket No. 387648-1002WO1 (00004) comprises, between a 3’-end of the f1 terminator and a 5’-end of the f1 initiator, a blocking sequencing. Embodiment 50: The kit of Embodiment 49, wherein a length of the blocking sequence is about 100 nucleotides or longer. Embodiment 51: The method of any one of Embodiments 42-50, wherein the expression of the protein encoded by the payload sequence is harmful to the host cell. Embodiment 52: The method of any one of Embodiments 42-51, wherein host cell is an E. coli cell. The foregoing outlines features of several embodiments so that those skilled in the art may better understand the aspects of the present disclosure. Those skilled in the art should appreciate that they may readily use the present disclosure as a basis for designing or modifying other processes and structures for carrying out the same purposes and / or achieving the same advantages of the embodiments introduced herein. Those skilled in the art should also realize that such equivalent constructions do not depart from the spirit and scope of the present disclosure, and that they may make various changes, substitutions, and alterations herein without departing from the spirit and scope of the present disclosure. 48 52481671.2

Claims

Attorney Docket No. 387648-1002WO1 (00004) CLAIMS WHAT IS CLAIMED IS:

1. A kit, comprising: a parent DNA molecule comprising a DNA strand, wherein the DNA strand comprises from a 5’ to 3’ direction: a phage f1 initiator; a payload sequence or a sequence for inserting the payload sequence; and a phage f1 terminator; and a filamentous phage replication initiator protein GPII or a nucleic acid encoding the GPII, wherein, when inside a host cell or a cell free system mimicking an inside of the host cell, the parent DNA molecule and the GPII produce a circular double stranded DNA molecule (plasmid) comprising: a phage f1 plasmid origin formed by joining the phage f1 initiator and the phage f1 terminator; and the payload sequence.

2. The kit of claim 1, wherein the phage f1 origin is a replication origin derived from a filamentous phage, optionally an F specific filamentous (Ff) phage genome, optionally an M13 phage genome.

3. The kit of claim 1 or 2, wherein the phage f1 initiator comprises a melting sequence, a β sequence, a γ sequence, and a δ sequence.

4. The kit of any one of claims 1-3, wherein the phage f1 terminator comprises an α sequence and a melting sequence.

5. The kit of any one of claims 1-4, wherein the parent DNA molecule is a linear double stranded DNA molecule, a circular double stranded DNA molecule, a linear single stranded DNA molecule, or a circular single stranded DNA molecule. 49 52481671.2Attorney Docket No. 387648-1002WO1 (00004) 6. The kit of any one of claims 1-5, wherein the parent DNA molecule is part of the genomic DNA of the host cell, or an extra genomic DNA.

7. The kit of any one of claims 1-6, which comprises the nucleic acid encoding the GPII, wherein the nucleic acid encoding the GPII is part of the genomic DNA of the host cell, part of an extra genomic DNA, or part of an mRNA.

8. The kit of any one of claims 1-7, wherein a size of the produced plasmid minus the payload sequence thereof is about 1,000 base pairs or less.

9. The kit of any one of claims 1-8, wherein the plasmid produced by the kit does not comprise a bacterial replication origin apart from the phage f1 origin, or wherein the plasmid produced by the kit does not comprise an antibiotic resistance gene.

10. The kit of any one of claims 1-9, wherein the parent DNA molecule comprises, at a location outside the phage f1 initiator, the payload sequence or the sequence for inserting the payload sequence, or the phage f1 terminator, a destruction element, and the parent DNA molecule is destroyed by targeting the destruction element without destroying the plasmid produced by the kit.

11. The kit of any one of claims 1-10, wherein host cell is an E. coli cell.

12. A method of producing a circular double stranded DNA molecule (plasmid), the comprising contacting a parent DNA molecule with a filamentous phage replication initiator protein GPII in a host cell or a cell free system mimicking an inside of the host cell, wherein the parent DNA molecule comprises a DNA strand, and the DNA strand comprises from a 5’ to 3’ direction: 50 52481671.2Attorney Docket No. 387648-1002WO1 (00004) a phage f1 origin initiator; a payload sequence or a sequence for inserting the payload sequence; and a phage f1 origin terminator, and wherein the plasmid comprises: a phage f1 origin formed by joining the phage f1 origin initiator and the phage f1 origin terminator; and the payload sequence.

13. The method of claim 12, wherein the phage f1 origin is a replication origin derived from a filamentous phage, optionally an F specific filamentous (Ff) phage genome, optionally an M13 phage genome.

14. The method of claim 12 or 13, wherein the phage f1 initiator comprises a melting sequence, a β sequence, a γ sequence, and a δ sequence.

15. The method of any one of claims 12-14, wherein the phage f1 terminator comprises an α sequence and a melting sequence.

16. The method of any one of claims 12-15, wherein the parent DNA molecule is a linear double stranded DNA molecule, a circular double stranded DNA molecule, a linear single stranded DNA molecule, or a circular single stranded DNA molecule.

17. The method of any one of claims 12-16, wherein the parent DNA molecule is part of the genomic DNA of the host cell, or an extra genomic DNA.

18. The method of any one of claims 12-17, wherein the GPII is expressed from a nucleic acid encoding the GPII.

19. The method of claim 18, wherein the nucleic acid encoding the GPII is part of the genomic DNA of the host cell, part of an extra genomic DNA, or part of an mRNA. 51 52481671.2Attorney Docket No. 387648-1002WO1 (00004) 20. The method of any one of claims 12-19, wherein a size of the produced plasmid minus the payload sequence thereof is about 1,000 base pairs or less.

21. The method of any one of claims 12-20, wherein the plasmid produced by the method does not comprise a bacterial replication origin apart from the phage f1 origin, or the plasmid produced by the method does not comprise an antibiotic resistance gene.

22. The method of claims 12-21, wherein the parent DNA molecule comprises, at a location outside the phage f1 initiator, the payload sequence or the sequence for inserting the payload sequence, or the phage f1 terminator, a destruction element, and wherein the method further comprises: destroying the parent DNA molecule by targeting the destruction element without destroying the produced plasmid.

23. The method of any one of claims 12-22, wherein the host cell is an E. coli cell.

24. A circular double stranded DNA molecule (plasmid), comprising: a phage f1 origin; and a payload sequence.

25. The plasmid of claim 24, which is an isolated plasmid.

26. The plasmid of claim 24 or 25, which comprises one phage f1 origin.

27. The plasmid of any one of claims 24-26, wherein the phage f1 origin is a replication origin derived from a filamentous phage genome, such as an F specific filamentous (Ff) phage genome. 52 52481671.2Attorney Docket No. 387648-1002WO1 (00004) 28. The plasmid of any one of claims 24-27, wherein the phage f1 origin comprises an α sequence, a melting sequence, a β sequence, a γ sequence, and a δ sequence.

29. The plasmid of any one of claims 24-28, wherein a size of the plasmid minus the payload sequence is about 1,000 base pairs or less.

30. The plasmid of any one of claims 24-29, which does not comprise a bacterial replication origin apart from the phage f1 origin, or does not comprise an antibiotic resistance gene.

31. A kit, comprising: a filamentous phage replication initiator protein GPII or a nucleic acid encoding the GPII; and a first DNA molecule comprising a DNA strand, and the DNA strand comprises, in a 5’- to 3’- direction: a phage f1 initiator; a payload sequence encoding a protein; a promotor; and a phage f1 terminator, wherein, when in a host cell or a cell free system mimicking an inside of the host cell, the GPII and cellular machinery of the host cell joins a 3’ portion of the phage f1 initiator to a 5’ portion of the phage f1 terminator to form a phage f1 origin, thereby producing a circular double stranded second DNA molecule, and wherein, in the second DNA molecule, the promotor drives the expression of the protein encoded by the payload sequence.

32. The kit of claim 31, wherein the phage f1 origin is a replication origin derived from a filamentous phage, optionally an F specific filamentous (Ff) phage genome, optionally an M13 phage genome. 53 52481671.2Attorney Docket No. 387648-1002WO1 (00004) 33. The kit of claim 31 or 32, wherein the phage f1 initiator comprises a melting sequence, a β sequence, a γ sequence, and a δ sequence.

34. The kit of any one of claims 31-33, wherein the phage f1 terminator comprises an α sequence and a melting sequence.

35. The kit of any one of claims 31-34, wherein the first DNA molecule is a linear double stranded DNA molecule, a circular double stranded DNA molecule, a linear single stranded DNA molecule, or a circular single stranded DNA molecule.

36. The kit of any one of claims 31-35, wherein the first DNA molecule is part of the genomic DNA of the host cell, or an extra genomic DNA.

37. The kit of any one of claims 31-36, which comprises the nucleic acid encoding the GPII, wherein the nucleic acid encoding the GPII is part of the genomic DNA of the host cell, part of an extra genomic DNA, or part of an mRNA.

38. The kit of any one of claims 31-37, wherein the first DNA molecule is a circular DNA molecule, and wherein the first DNA molecule further comprises, between a 3’- end of the f1 terminator and a 5’-end of the f1 initiator, a blocking sequencing.

39. The kit of claim 38, wherein a length of the blocking sequence is about 100 nucleotides or longer.

40. The kit of any one of claims 31-39, wherein the expression of the protein encoded by the payload sequence is harmful to the host cell.

41. The kit of any one of claims 31-40, wherein host cell is an E. coli cell. 54 52481671.2Attorney Docket No. 387648-1002WO1 (00004) 42. A method of expressing a protein, comprising contacting a filamentous phage replication initiator protein GPII with a first DNA molecule in a host cell or a cell free system mimicking an inside of the host cell, wherein the first DNA molecule comprises a DNA strand, and the DNA strand comprises, in a 5’- to 3’- direction: a phage f1 initiator; a payload sequence; a promotor; and a phage f1 terminator; and wherein the GPII and cellular machinery of the cell joins a 3’ portion of the phage f1 initiator to a 5’ portion of the phage f1 terminator to form a phage f1 origin, thereby producing a circular double stranded second DNA molecule, and wherein, in the second DNA molecule, the promotor drives the expression of the protein encoded by the payload sequence.

43. The method of claim 42, wherein the phage f1 origin is a replication origin derived from a filamentous phage, optionally an F specific filamentous (Ff) phage genome, optionally an M13 phage genome.

44. The method of claim 42 or 43, wherein the phage f1 initiator comprises a melting sequence, a β sequence, a γ sequence, and a δ sequence.

45. The method of any one of claims 42-44, wherein the phage f1 terminator comprises an α sequence and a melting sequence.

46. The kit of any one of claims 42-45, wherein the first DNA molecule is a linear double stranded DNA molecule, a circular double stranded DNA molecule, a linear single stranded DNA molecule, or a circular single stranded DNA molecule.

47. The method of any one of claims 42-46, wherein the first DNA molecule is part of the genomic DNA of the host cell, or an extra genomic DNA. 55 52481671.2Attorney Docket No. 387648-1002WO1 (00004) 48. The method of any one of claims 42-47, which uses the nucleic acid encoding the GPII, wherein the nucleic acid encoding the GPII is part of the genomic DNA of the host cell, part of an extra genomic DNA, or part of an mRNA.

49. The method of any one of claims 42-48, wherein the first DNA molecule is a circular DNA molecule, and wherein the first DNA molecule further comprises, between a 3’-end of the f1 terminator and a 5’-end of the f1 initiator, a blocking sequencing.

50. The kit of claim 49, wherein a length of the blocking sequence is about 100 nucleotides or longer.

51. The method of any one of claims 42-50, wherein the expression of the protein encoded by the payload sequence is harmful to the host cell.

52. The method of any one of claims 42-51, wherein host cell is an E. coli cell. 56 52481671.2

Images