Piezo channel regulators

Abstract

There is provided lipidated cysteine rich polypeptides comprising the sequence C-X5-X6-X7- C-X8-X9-C-C-X10-X11-C-X12-X13-X14, and methods of using the polypeptides to potentiate Piezo channels or repress Piezo channel activity.

Description

Piezo channel regulatorsCross Reference to Related Application

[0001] This application claims the benefit of Australian Provisional Application No. 2023902096 filed 30 June 2023, the entire contents of which is incorporated by reference herein.Technical Field

[0002] The invention relates to Piezo binding polypeptides and a method of regulating Piezo channels by administering Piezo binding polypeptides or pharmaceutically acceptable salts thereof.Background

[0003] Piezo channels are evolutionarily conserved mechanosensitive cation channels located in the cell membrane and function as key cellular mechanotransducers that convert mechanical stimuli into electrochemical signals. Piezo channels are homotrimers in the cell membrane and comprise a central ion conducting pore with the arms of monomers extending into the cell membrane . This assembly is sufficient to confer mechanosensitivity and other than the surrounding lipid membrane no alternate cellular components are required for channel activation.

[0004] Structurally, Piezol comprises a peripheral mechanotransduction module and a central ion conduction pore module. The peripheral module consists of the extracellular distal blades, the peripheral helices (PHs), anchors of the transmembrane, and the intracellular beams. The central pore module includes the C-terminal extracellular domains (CEDs), the transmembrane inner helices (IHs) and outer helices (OHs), and the intracellular C-terminal domains (CTDs). The combination of three CEDs forms an extracellular cap. The intracellular beam connects the PHs to the CTD. There are numerous transmembrane helical units (THUs) in the transmembrane region, and THUs are roughly divided into IHs, OHs, and PHs. The OH is connected to the first peripheral helix near the central axis by a hairpin structure that is formed by four a helices and named the anchor. The C-terminal of each monomer is connected in order as PHs-Anchor-OH-CED-IH-CTD. On the cytoplasmic side, each monomer of Piezol has a lateral ion channel: a 'plug and a latch'. Under the pull of the latch, the plug is removed to allow the ions to pass. It has been found that the intracellular CTDs of Piezol can drive the IHs to move by contracting, which rapidly deactivates Piezol , this suggests that the structure of Piezo channels is responsiblefor its mechanotransduction.

[0005] Most vertebrates have two Piezo genes, Piezol and Piezo2, and while the function of Piezo2 is mainly restricted to the peripheral nervous system, Piezol is expressed in a wide range of tissues and contributes to mechanotransduction in various organs. Piezol is central to mechanosensitivity in the cardiovascular system, erythrocytes, neural stem cells, epithelial cells, bladder, kidney, cartilage, and periodontal cells. Piezo 1 also plays a role in cell adhesion, migration, survival, differentiation and proliferation.

[0006] Mutations in the human Piezol gene have been linked to a number of diseases such as dehydrated hereditary stomacytosis and general lymphatic dysplasia. A global knockout of Piezol is embryonically lethal.

[0007] The present inventors have identified Piezo binding polypeptides and have developed methods of regulating Piezo channels using the Piezo binding polypeptides.Summary

[0008] In a first aspect, the invention relates to a lipidated polypeptide comprising the sequence:C-X5-X6-X7-C-X8-X9-C-C-Xio-Xii-C-Xi2-Xi3-Xi4, wherein X is any amino acid, wherein the cysteine residues are lipidated, and wherein the lipidated polypeptide potentiates a Piezo channel current and / or represses Piezo channel activity.

[0009] In a second aspect, the invention relates to a lipidated polypeptide of the first aspect wherein the polypeptide comprises the sequence: C-X1-X2-X3-X4-C-X5-X6-X7-C-X8-X9-C-C- X10-X11-C-X12-X13-X14, wherein X is any amino acid.

[0010] In some embodiments, one or any combination of the following apply to the lipidated polypeptide of the first aspect or the second aspect:Xi, X6and X9are E or a conservative substitution thereof;X2and X14 are S or a conservative substitution thereof;X3is S, A or a conservative substitution thereof;X4is D or a conservative substitution thereof;X5is L or a conservative substitution thereof;X7is I or a conservative substitution thereof;X8is M or a conservative substitution thereof;X is G or a conservative substitution thereof;Xi 1 is I, L or a conservative substitution thereof; .X12 is F or a conservative substitution thereof; andX13 is P,S or a conservative substitution thereof.

[0011] In some embodiments, 1 , 2, 3, 4, or 5 of the cysteine residues of the polypeptide are palmitoylated.

[0012] In some embodiments, 1 , 2, 3, 4, or 5 of the cysteine residues of the polypeptide are palmitoylated, PEGylated, farnesylated, or a combination thereof.

[0013] In a third aspect, the invention relates to a method of potentiating a Piezo channel current and / or repressing Piezo channel activity, wherein the Piezo channel comprises a plurality of Piezo proteins, the method comprising contacting a Piezo protein with one or more of: a polypeptide of the first aspect or the second aspect; a lipidated polypeptide of SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10, wherein the lipidated polypeptide of SEQ ID NO: 1 -6 are lipidated at cysteine residues near the C-terminus, and wherein the lipidated polypeptide of SEQ ID NO: 7-10 are lipidated at each cysteine residue; or a pharmaceutically acceptable salt thereof.

[0014] In some embodiments, the polypeptide has at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10.

[0015] In some embodiments, the polypeptide is SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4 and is lipidated at one or more of Cys233, Cys237, Cys240, Cys241 and Cys244.

[0016] In some embodiments, the polypeptide is palmitoylated at Cys233, Cys237, Cys240, Cys241 and farnesylated at Cys244.

[0017] The method may further comprises administering the polypeptide to a subject.

[0018] In some embodiments, the subject has a Piezo related disease or condition. For example, distal arthrogryposis, inflammatory conditions selected from Alzheimer's disease,myocardial fibrosis, atherosclerosis, pulmonary fibrosis, osteoporosis, osteoarthritis, lumbar degeneration, obesity, diabetes, chronic cystitis, pain, and blood clotting disorders.

[0019] The Piezo protein may be Piezo 1 or Piezo 2.

[0020] In some embodiments, the Piezo protein is Piezo 1 and the polypeptide contacts Piezo 1 between the anchor domain and the outer helix of Piezo 1 .

[0021] In some embodiments, the polypeptide contacts Piezo 1 at one or more ofHis2116, Phe2010, and Gln2123 from the a1 helix of the anchor domain;Val2187, Met2191 , and Leu2195 from the outer helix; andPhe2484 and Phe2485 at the base of the inner helix that lines the Piezol pore.

[0022] In some embodiments, the polypeptide is alpha-helical or comprise a C-terminal alpha helix.

[0023] In a fourth aspect, the invention relates to use of a lipidated polypeptide comprising any one or more of: a. C-X5-X6-X7-C-X8-X9-C-C-X10-X11-C-X12-X13-X14, wherein X is any amino acid; b. C-Xi-X2-X3-X4-C-X5-X6-X7-C-X8-X9-C-C-Xio-Xii-C-Xi2-Xi3-Xi4, wherein X is any amino acid; c. SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10; or a pharmaceutically acceptable salt thereof, in the manufacture of a medicament for potentiating Piezo channel currents and / or repressing Piezo channel activity.Definitions

[0024] "Piezo channels" as used herein refers to a family of mechanosensitive ion channels directly gated by mechanical forces. The term encompasses, but is not limited to, Piezol and Piezo2 protein ion channels.As used herein, "repressing", "reducing", or "inhibiting" and like terms should not be construed to require complete repression, reduction or inhibition, although this may be desired in some embodiments. Thus, "repressing" Piezo channel activity does not require absolute repression. In one embodiment "repressing", "reducing", or "inhibiting" and like terms refer to speeding up the rate of Piezo channel inactivation (i.e., repressing Piezo channel activity may come from a) speeding up inactivation or b) reducing the channel’s sensitivity to mechanical force).The term "potentiating" as used herein refers to increasing the effect Piezo channel activation. In the context of the invention, the polypeptides or pharmaceutically acceptable salts thereof 'potentiates' or is a 'potentiator' of Piezo channels in the sense that the polypeptides or salts thereof reduce or inhibit inactivation of the channel currents. In some embodiments, the polypeptides or salts thereof described herein prolong Piezo channel activation or increase the amount of mechanical force required to activate the channel, i.e., desensitize the channel to mechanical force.

[0025] The terms "peptide", "polypeptide" and "protein" each refer to a molecule comprising two or more amino acid residues joined to each other by peptide bonds. These terms are interchangeable unless otherwise specified and encompass, e.g., native and artificial proteins, protein fragments and polypeptide analogs (such as muteins, variants, and fusion proteins) of a protein sequence as well as post-translationally, or otherwise covalently or non-covalently, modified proteins. In some embodiments, the "peptides", "polypeptides", and "proteins" are chains of amino acids whose alpha carbons are linked through peptide bonds. In some embodiments, the protein or polypeptide has a terminal amino acid at one end of the chain (amino terminal) and therefore has a free amino group, while the terminal amino acid at the other end of the chain (carboxy terminal) has a free carboxyl group. As used herein, the term "amino terminus" (abbreviated N-terminus) refers to the free a-amino group on an amino acid at the amino terminal of a protein or polypeptide or to the a-amino group (amino group when participating in a peptide bond) of an amino acid at any other location within the protein or polypeptide. Similarly, the term "carboxy terminus" (abbreviated C-terminus) refers to the free carboxyl group on the carboxy terminus of a protein or polypeptide or the carboxyl group of an amino acid at any other location within the protein or polypeptide. The proteins, peptides and polypeptides may comprise entirely L- amino acids, entirely D-amino acids, or a mixture of L and D amino acids.

[0026] The phrase "and / or" as used herein should be understood to mean "either or both" of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases.

[0027] Throughout this specification, unless the context clearly requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.

[0028] The term “consisting of” means "consisting only of", that is, including and limited to the stated element(s), integer(s) or step(s), and excluding any other element(s), integer(s)or step(s). The term “consisting essentially of” means the inclusion of the stated element(s), integer(s) or step(s), but other element(s), integer(s) or step(s) that do not materially alter or contribute to the working of the invention may also be included.

[0029] Unless the context requires otherwise or specifically stated to the contrary, integers, steps, or elements of the technology recited herein as singular integers, steps or elements clearly encompass both singular and plural forms of the recited integers, steps or elements.

[0030] In the context of the present specification, the terms "a" and "an" are used to refer to one or more than one (i.e., at least one) of the grammatical object of the article. By way of example, reference to "an element" means one element, or more than one element.

[0031] In the context of the present specification, the term "about" means that reference to a figure or value is not to be taken as an absolute figure or value, but includes margins of variation above or below the figure or value in line with what a skilled person would understand according to the art, including within typical margins of error or instrument limitation. In other words, use of the term "about" is understood to refer to a range or approximation that a person or skilled in the art would consider to be equivalent to a recited value in the context of achieving the same function or result.

[0032] The term "pharmaceutically acceptable salt" refers to those salts which, within the scope of sound medical judgement, are suitable for use in contact with the tissues of humans and animals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. S. M. Berge et al. describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 1977, 66:1-19. For a review on suitable salts, see Handbook of Pharmaceutical Salts: Properties, Selection, and Use by Stahl and Wermuth (Wiley-VCH, 2002). Methods for making pharmaceutically acceptable salts of compounds of the invention are known to one of skill in the art. The salts can be prepared in situ during the final isolation and purification of the proteins of the invention, or separately by reacting the free base function with a suitable organic acid. Suitable pharmaceutically acceptable acid addition salts of the proteins of the present invention may be prepared from an inorganic acid or from an organic acid. Examples of such inorganic acids are hydrochloric, hydrobromic, hydroiodic, nitric, carbonic, sulfuric, and phosphoric acid. Appropriate organic acids may be selected from aliphatic, cycloaliphatic, aromatic, heterocyclic carboxylic and sulfonic classes of organic acids, examples of which are formic, acetic, propionic, succinic, glycolic, gluconic, hydrochloric, lactic, malic, tartaric, citric, ascorbic, glucoronic, fumaric, maleic, pyruvic, alkyl sulfonic, arylsulfonic, aspartic, glutamic, benzoic, anthranilic, mesylic, methanesulfonic, salicylic, p-hydroxybenzoic, phenylacetic, mandelic, ambonic, pamoic,pantothenic, sulfanilic, cyclohexylaminosulfonic, stearic, algenic, p-hydroxybutyric, galactaric, and galacturonic acids. Suitable pharmaceutically acceptable base addition salts of the proteins of the present invention include metallic salts made from lithium, sodium, potassium, magnesium, calcium, aluminium, and zinc, and organic salts made from organic bases such as choline, diethanolamine, morpholine. Alternatively, suitable pharmaceutically acceptable base addition salts of the proteins of the present invention include organic salts made from N,N'-dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, ethylenediamine, meglumine (N-methylglucamine), procaine, ammonium salts, quaternary salts such as tetramethylammonium salt, amino acid addition salts such as salts with glycine and arginine. It will be understood by those skilled in the art that the proteins and salts may exist in different crystalline or polymorphic forms, all of which are intended to be within the scope of the present invention.

[0033] The term "treating" or "treats" a Piezo related disease or condition as used herein means: (1) preventing or delaying one or more symptoms of the disease or condition from developing in a subject that may be predisposed to the disease or condition but does not yet experience or display symptoms of the disease or condition, (2) inhibiting the disease or condition, i.e., arresting or reducing the development or progression of the disease or condition or at least one or more symptoms thereof, or (3) relieving the disease or condition, i.e., causing regression or reversing the disease or condition or at least one of its symptoms. The benefit to a subject to be treated is either statistically significant or at least perceptible to the subject with the disease or condition and / or to the physician. Thus, the term "treating" or "treats" and the like is to be considered in their broadest context and encompasses curing, ameliorating, or tempering the severity of the disease or condition or one or more of its associated symptoms.

[0034] "Effective amount" and "therapeutically effective amount" refer to an amount of a protein or pharmaceutically acceptable salt thereof sufficient to produce a desired therapeutic or pharmacological effect in the subject being treated. The terms are synonymous and are intended to qualify the amount of protein or salt thereof that will achieve the goal of improvement in disease severity and / or the frequency of incidence over no treatment while preferably avoiding or minimizing adverse side effects, including side effects typically associated with other therapies. The "effective amount" or "therapeutically effective amount" will vary depending on the specific protein or salt thereof used, the disease severity, and the age, weight, physical condition and responsiveness of the individual to be treated.

[0035] "Subject" includes any human or non-human mammal. Thus, in addition to being useful for human treatment, the proteins of the present invention may also be useful for veterinary treatment of mammals, including companion animals and farm animals, such as, but not limited to dogs, cats, horses, cows, sheep, and pigs. In preferred embodiments the subject is a human.

[0036] In the context of this specification, the term "administering" and variations of that term including "administer" and "administration", includes contacting, applying, delivering, or providing a protein or pharmaceutically acceptable salts thereof described herein to a subject by any appropriate means.

[0037] Any reference to or discussion of any document, act or item of knowledge in this specification is included solely for the purpose of providing a context for the present invention. It is not suggested or represented that any of these matters or any combination thereof formed, at the priority date, part of the common general knowledge, or was known to be relevant to an attempt to solve any problem with which this specification is concerned.

[0038] Those skilled in the art will appreciate that the technology described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the technology includes all such variations and modifications. For the avoidance of doubt, the technology also includes all of the steps, features, and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps, features and compounds.

[0039] In order that the present invention may be more clearly understood, preferred embodiments will be described with reference to the following drawings and examples.Brief Description of the Drawings

[0040] Figure 1. Affinity capture mass spectrometry (AC-MS) identified a new family of Piezo channel binding partners. Groups for AC-MS consisted of: (A) wild-type (WT) and Piezol knockout (KO) human dermal fibroblasts (hDF, n=2); (B) WT and Piezol -HaloTag (P1 -Halo) knockin hDF (n=2); and (C) primary human cardiac fibroblasts (hCF, n=2). (D) Affinity captured protein lysates were run on SDS-PAGE gels and sectioned into quadrants. Each quadrant was subjected to in-gel protein digestion followed by peptide extraction and liquid chromatography (LC) followed by mass spectrometry (MS). (E) Venn diagram illustrating proteins identified in each experimental group that had >2 unique peptides which were absent from negative control replicates. (F) Two proteins were identified in all positive control replicates, Piezol and MyoD Family inhibitor domain containing protein, MDFIC. Alignment of unique MDFIC peptides identified by MS.

[0041] Figure 2. Structural elucidation of the Piezol -MDFIC complex. (A-B) Cryo-EM density maps of the mouse Piezol-MDFIC complex at 3.66 A nominal resolution viewed from the top (A) and side (B) with the resolved MDFIC region colored green. (C) The distal C-terminal of MDFIC resides parallel to the bilayer between the anchor domain (a1- a3) and the outer helix (OH). The cytoplasmic constriction residues Met2493 and Phe2494 are shown in cyan. (D) The C-terminal region of MDFIC protrudes deep into the pore module of Piezol approaching the inner helix (IH). (E-G) The interactions between Piezol and MDFIC shown in membrane facing view (E), lateral view (F) and cytoplasmic facing view (G-H). Variants linked to lymphatic malformations (mPIEZOI V2187 and mMDFIC F245) are labelled bold.

[0042] Figure 3. MyoD family inhibitor proteins regulate Piezol and Piezo2 channel gating. (A-E) Representative cell-attached (c / a) patch-clamp recordings from hPiezol control and in the presence of hMDFIC, hMDFI, the conserved C-terminus of MDFIC (hMDFIC C-81) and with MDFIC lacking its C-terminal 20 amino acids (hMDFIC AC20) at a holding potential of -65mV. (F-H) Quantification of peak currents per patch, % current remaining and normalized current 1 second after pressure was released (Normalized lpost) for replicates of cell-attached recordings shown in A-E. (I-L) Representative cell-attached recordings from human Piezo2 (hPiezo2) control and in the presence of hMDFIC and hMDFI and quantification of replicates. (M-O) Representative cell-attached (c / a) patch-clamp recordings from mouse cardiac fibroblasts isolated at E16.5 from WT, heterozygous and homozygous MdficM131fs* mice. (P-R) Quantification of peak current per patch, % current remaining and normalized lpost for replicates of cell-attached recordings shown in M-O. All data displayed as mean ± SEM or as maximum to minimum box and whiskers plot; p-values determined using one-way ANOVA and Tukey’s multiple comparison.

[0043] Figure 4. C-terminal lipidation of MDFIC underlies regulation of Piezol channel gating. (A) Cryo-EM density map showing extension of density on cysteine residues within the C-terminus of MDFIC. (B) Representative immunoblot (IB) using Avidin (top) or anti-HA (bottom) from acyl biotin exchange showing lysate + / - hydroxylamine (HAM). Blots show a band at the correct size for HA-MDFIC but the biotinylated MDFIC can only be seen in the HAM treated group indicating palmitoylated-MDFIC (palm-MDFIC). (C) Mass-tagging of MDFIC using mPEGylated maleimide reveals at least three palmitoylation sites labelled 1 -3 ^represents non-specific band in all groups). (D) Membrane localized HA-MDFIC in HEK293T cells, membrane delineated using wheatgerm agglutinin (WGA). (E) Representative cell-attached recordings of hPiezol in the presence of wild-type MDFIC and mutation of the five C-terminal cysteine residues to either alanine (5C-A) or serine (5C-S)abolishes the regulatory effects of MDFIC. (F-H) Quantification of peak currents per patch, % current remaining and normalized lpost for replicate recordings of panel E. (I) All-atom molecular dynamic simulations of the mPiezol pore module in complex with unmodified (bottom), 5C-S mutant (right-hand side) and lipidated MDFIC (left-hand side) C-termini. (J- K) The lipidated MDFIC acyl chains interact selectively with inner helix residues critical for Piezol channel inactivation, p-value determined using one-way ANOVA and Tukey’s multiple comparison.

[0044] Figure 5. Generation and validation of Piezol edited human dermal fibroblast cell (hDF) lines. (A) Sanger sequencing of Piezol Knock-out (KO) human dermal fibroblasts. (B) Western blot showing wild-type (WT) compared to Piezol KO hDF probed with an anti- Piezol antibody with a Na / K-ATPase loading control shown beneath. (C) Western blot showing WT compared to Piezol -HaloTag (P1-Halo) knock-in (KI) hDF probed using an anti-Piezo1 antibody. (D) Sanger sequencing of the region where the HaloTag is inserted at the coding sequence for amino acid 1591. (E) PCR documenting full length HaloTag insert in the KI hDF. (F) Example pull down experiment from P1 -Halo KI hDF using HaloTrap resin. Example image from total internal reflection fluorescence microscopy of WT hDF (G) and P1 -Halo KI hDF (H) labelled with the HaloTag ligand JFX646. Arrows indicate significant enrichment at trailing edge focal adhesions.

[0045] Figure 6. Cellular expression profiles of human MDFIC and MDFI and validation of the Piezol interaction with MDFIC and MDFI. (A) MDFIC, Piezol and Piezo2 RNA expression in single cell types from the human protein atlas shown as normalized transcripts per million (nTPM). (B) MDFI, Piezol and Piezo2 RNA expression in single cell types from the human protein atlas. (C) Example co-immunoprecipitation of Piezol and hMDFIC overexpressed in Piezol7-HEK293T cells under different conditions including control static conditions, with Yodal 10 pM treatment and under shear stress applied with an orbital-shaker (160 rpm - max 5 dyne / cm2). The blot shows immunoprecipitation of hMDFIC using an anti-HA antibody (IP:HA, top) and immunoprecipitation using an anti- Piezol antibody (IP:Piezo1 , bottom) probed either with an anti-HA or an anti-Piezo1 antibody. Clear reciprocal co-immunoprecipitation is seen between hMDFIC and Piezol . (D) Example co-immunoprecipitation of Piezol and hMDFI overexpressed in PIEZO17-HEK293T cells. (E) Native gel showing an anti-GFP / mCherry immunoblot (left) of the same samples shown in the middle panel which shows an anti-HA immunoblot of blank cells and vector only control cells compared to Piezol -897-HA and HA-hMDFIC co-expression with Piezol , Piezo2, TREK-1 and TRPM4. Despite expression of TRPM4 and TREK-1 the HA-hMDFIC signal is only seen in the oligomeric complexes of Piezo1 / 2 channels. The right panel shows an SDS-page denaturing gel confirming the expression of HA-hMDFIC.

[0046] Figure 7. Piezo channels selectively enhance human MDFIC levels by slowing protein turnover. (A) Representative western blot showing Piezol , Piezo2, TRPM4, TRPV4 and GFP expressed with HA-MDFIC. The immunoblot (IB) shows Na / K-ATPase for normalization and HA-MDFIC. (B) Quantification of HA-MDFIC levels in PIEZO17-HEK293T cells co-expressed with Piezol , Piezo2, TRPM4, TRPV4 and GFP (n=3, compared using a one-way-ANOVA with Dunnett’s multiple comparison). (C) Representative western blot of HA-MDFIC with and without Piezol treated with the protein synthesis inhibitor cycloheximide (CHX) 10 pM for 0, 4 and 8 h. The upper panel is loaded with equal protein amounts and the lower panel is a replicate loaded to match the HA-MDFIC protein levels to identify the increased turnover more easily. (D) Quantification of the HA-MDFIC protein levels normalized to both the associated Na / K-ATPase and samples with 0 h CHX treatment (n=3). Data represents mean + / - SEM, time points compared using two-way ANOVA.

[0047] Figure 8. Flow chart for the cryo-EM data processing and structure determination of the mouse Piezol -MDFIC complex. (A) Gel filtration profile and SDS-PAGE gel of Piezol - MDFIC complex. Dash lines indicate the peak fractions collected for structural studies. (B) Area of a representative cryo-EM image of the vitrified complex. Some particles are highlighted in circles. Scale bar: 50 nm. (C) Selected 2D averages obtained with CryoSPARC. (D) Data processing workflow for 3D classification and refinement in CryoSPARC. Masks were applied during refinement to improve the local map quality for cap (cyan) and transmembrane (purple) regions. (E) Local resolution filtered map calculated with FSC 0.143 criterion (left) and FSC 0.5 criterion (right). (F) Angular distribution of the particles used for reconstructing the final map. (G) Representative cryo-EM densities for Piezol transmembrane domain, cap domain and MDFIC C-terminal helix. (H) Gold standard FSC curves calculated for the entire complex, cap domain (Local Cap), and transmembrane domain (Local TM). The FSC curve calculated between the map and the atomic model is shown (bottom dotted line). (I) Comparison of the pore module of Piezol with and without MDFIC is shown on the side (left) and top (right) view. The atomic model (PDB:7WLT) and cryo-EM density map (EMDB:32592) of a curved Piezol in a liposome (purple) were used to compare with the structure of Piezol (magenta) in complex with MDFIC (green). Only the pore module was shown. The binding of MDFIC does not induce a notable conformational change of the pore module, with a R.M.S.D of 0.489A between the two structures.

[0048] Figure 9. Human MDFIC and MDFI alone do not generate stretch evoked currents but markedly slow Piezol channel inactivation. Representative cell-attached recordings from PIEZO1 / _HEK293T cells transfected with vector alone (A) hMDFIC (B) and hMDFI alone (C) in response to a negative pressure pulse lasting 450 ms at a holding potential of - 65 mV. (D) Quantification of peak currents elicited from PIEZO17-HEK293T cells transfected with vector alone, hMDFIC, and hMDFI alone in response to a negative pressure pulse of 60 mmHg lasting 450 ms at a holding potential of -65 mV (dashed line represents the average peak current elicited from Piezol transfected cells). (E-F) Representative cell-attached recordings from PIEZO1 / _HEK293T cells expressing hPIEZOI only (E) and cells co-expressing hMDFIC (F) in response to negative pressure pulses from -10 to -70 mmHg at a holding potential of -65 mV. These recordings have an inter pulse interval of 50 s. (G) Pressure response curve showing the response of PIEZO17-HEK293T cells expressing hPIEZOI only and cells co-expressing hMDFIC. Dashed line represents the 95% confidence interval of the fitted Boltzmann curve. (H-L) Longer time scale representative cell-attached recordings of data presented in Figure 3 from PIEZO17-HEK293T cells expressing Piezol alongside hMDFIC or hMDFI showing that in almost all cases that the Piezol channels will close provided the inter pressure pulse time interval is long enough.

[0049] Figure 10. MDFIC influences the single channel properties of hPiezol but not its protein level. (A) Representative western blot illustrating the expression of hPiezol overexpressed in PIEZOT / _HEK293T cells in the presence and absence of hMDFIC using the Na / K-ATPase as a loading control. (B) Quantification of the relative hPiezol protein levels in HEK293T cells in the absence and presence of hMDFIC from five independent transfections. (C) Representative western blot illustrating the expression of native hPiezol in LNCaP prostate cancer cell line in the presence and absence of transiently transfected hHA-MDFIC using the Na / K-ATPase as a loading control. (D) Quantification of the relative hPiezol protein levels in LNCaP in the absence and presence of hMDFIC from four independent transfections. (E-F) Single channel recordings of hPiezol in the cell-attached configuration either expressed alone (E) or in the presence of human MDFIC (F). Note the strong influence on the gating behavior including the long openings of multiple channels. (G) Current-voltage relationship of Piezol channels in the absence (-MDFIC) and presence (+MDFIC) of MDFIC. Single channel amplitudes are fit with a linear regression to determine the unitary conductance.

[0050] Figure 11. Piezol current after pressure release (lpost) induced by MDFIC is dependent on hyperpolarizing membrane voltages. (A) Representative cell-attachedrecordings of hPiezol in the absence and presence of MDFIC in response to membrane stretch at three indicated holding potentials. (B) Quantification of replicate recordings from panel A illustrating the amount of lpost (current 1 s after the removal of pressure) at three voltages (data is shown as mean ± SEM). (C) Representative cell-attached recordings of hPiezol in the absence (black) and presence (blue) of MDFIC pre and post a 1 s voltage flip from a holding potential of - 65 mV to +65 mV. (D) Quantification of replicate recordings from panel C showing the magnitude of inward current pre and post voltage flip where each data point shows the current pre and post voltage flip of an individual cell (p-value determined using paired Student’s t-test).

[0051] Figure 12. MDFIC slows Piezol inactivation in whole cell mode. (A-B) Representative whole cell recordings from PIEZOT / _HEK293T cells expressing either (A) hPiezol only or (B) hPiezol with hMDFIC at a holding potential of -50 mV. (C) Quantification of the % current remaining at the end of the indentation stimulus for the same conditions shown in panels A-B (p-value determined using unpaired Student’s t-test).

[0052] Figure 13. MDFIC does not influence the mechanical gating of TREK-1 channels. Representative cell-attached recordings from PIEZO1 / _HEK293T cells of TREK-1 alone (A) or in the presence of MDFIC (B) in response to a pressure pulse at a holding potential of +60 mV. Quantification of cell-attached recordings shown in A and B at multiple negative pressures showing (C) the peak current and (D) the current remaining 1 second after the pressure is released (lpost). Hollow dots are TREK-1 only and filled dots are co-expressed with hMDFIC. Data represents mean + / - SEM, n=8-9, ns = non-significant determined using two-way ANOVA.

[0053] Figure 14. The conserved C-terminus of MDFIC mediates the binding of MDFIC to Piezol . (A) Alignment of mouse and human MDFI and MDFIC illustrating the conserved C- terminus (shaded). (B) MDFIC protein level normalized to Na / K-ATPase of transiently transfected HA-MDFIC, HA-MDFIC AC20 and HA-MDFIC C81 from PIEZO17' HEK293T cells showing the increased levels of HA-MDFIC AC20 and reduced levels of HA-MDFIC C81 indicative of their increased and reduced stability respectively. (C) Representative western blot showing immunoprecipitation (IP) of Piezol using an anti-Piezo1 antibody in the absence and presence of HA-MDFIC and the cysteine rich, conserved C-terminal of MDFIC (HA-MDFIC C-81). (D) Fold change in HA-MDFIC, HA-MDFIC AC20 and HA- MDFIC C81 when coexpressed with Piezol compared to their respective levels in PIEZOT / _HEK293T. (E) Representative western blot showing immunoprecipitation (IP) of Piezol using an anti-Piezo1 antibody in the absence and presence of HA-MDFIC and with the last 20 residues of the cysteine rich, conserved C-terminal of MDFIC deleted (HA-MDFICAC20), immunoblots (IB) of both Piezol and HA are shown. Data represents mean + / - SEM, p-values shown determined using one way ANOVA with Dunnett’s multiple comparison.

[0054] Figure 15. Human MDFIC and MDFI expression regulate mouse Piezos. (A) Representative cell-attached (c / a) patch-clamp recordings from mouse Piezol (mPiezol ) control and in the presence of hMDFIC and hMDFI, at a holding potential of -65 mV. (B-D) Quantification of peak currents per patch, % current remaining and normalized current one second after pressure was released (normalized lpost) for replicates of cell-attached recordings shown in A (p-value determined using one-way ANOVA and Dunnett’s post hoc comparison). (E) Representative cell-attached (c / a) patch-clamp recordings from mouse PIEZO2 (mPiezo2) in the absence and presence of hMDFIC or hMDFI. (F-G) Quantification of peak currents per patch and normalized current 1 second after pressure was released (normalized lpost) for replicates of cell-attached recordings shown in E (p-value determined using one-way ANOVA and Dunnett’s multiple comparison).

[0055] Figure 16. MDFIC and MDFI expression correlates with the inactivating phenotype of endogenous Piezol currents in human and mouse cells. (A) Quantitative PCR comparing the expression of MDFIC and MDFI in human cell lines used for affinity capture mass spectrometry compared to those used for patch clamping. (B) Representative cell-attached recordings from HEK293T cells over-expressing Piezol compared to prostate cancer lines LNCaP and DU145 and LNCaP expressing MDFIC. (C) Quantification of Peak current elicited from cell attached patches in panel B (data displayed as min to max box and whisker plot showing mean). (D) Quantification of the % current remaining at the end of the negative pressure pulse for replicate cell-attached recordings of those shown in panel B (data represents mean ± SEM). (E-F) Longer time scale representative cell-attached recordings of Data presented in panel b from endogenous Piezol currents in LNCaP and endogenous Piezol currents in LNCaP co-expressing hMDFIC at -65 mV holding potential. (G) Quantitative PCR comparing the expression of MDFIC and MDFI in mouse cell lines used for patch clamping (data represents mean ± SEM). (H) Representative cell-attached recordings from mouse embryonic fibroblasts (MEF) and MEF expressing Piezol (to boost current sizes showing the non-inactivating phenotype is not a reflection of the small current sizes) and recordings from C2C12 and Neuro2A (N2A) cells all at -65 mV holding potential. (I) Quantification of the % current remaining at the end of the negative pressure pulse for replicate recordings of those shown in panel H (data represents mean ± SEM).

[0056] Figure 17. MDFIC regulates Piezol inactivation kinetics in mouse embryonic fibroblasts (MEF). (A-B) Representative cell-attached recordings from PIEZO1+ / +andPIEZ017-mouse embryonic fibroblasts (MEF) at -65 mV holing potential. (C) Quantification of peak currents elicited from PIEZO1+ / +and PIEZO1 / _(p-value determined using unpaired Student’s t-test). (D-F) Representative cell-attached recordings from PIEZO1+ / +MEF treated with scrambled control siRNA, MDFIC siRNA and MDFIC plus MDFI siRNA. (G) Quantitative PCR illustrating successful knockdown of MDFIC and MDFI and the specificity of the siRNAs using the normalized gene expression of MDFIC and MDFI in MEF. (H-J) Quantification of replicate cell-attached recordings from two independent siRNA transfections documenting the peak current (H), the remaining current at the end of the pressure pulse (I) and the normalized lpost (J), p-value determined using one-way ANOVA with Dunnett’s post hoc comparison, ns = non-significant.

[0057] Figure 18. Flow chart for the cryo-EM data processing and structure determination of the mouse Piezo1-MDFIC(C240) complex. (A) Coomassie Blue-stained SDS-PAGE gel showing the bands corresponding to Piezol and MDFIC(C240A). (B) Area of a representative cryo-EM image of the vitrified complex. Some particles are highlighted in white circles. Scale bar: 50 nm. (C) Selected 2D averages obtained with CryoSPARC. (D) Data processing workflow for 3D classification and refinement in CryoSPARC. Masks were applied during refinement to improve the local map quality for central transmembrane (cyan) regions. (E) Local resolution filtered map calculated with FSC 0.143 criterion (left) and FSC 0.5 criterion (right). (F) Angular distribution of the particles used for reconstructing the final map. (G) Gold standard FSC curves calculated for the entire complex (blue), and central transmembrane domain (green). (H) Representative cryo-EM densities for Piezol transmembrane domain, cap domain and MDFIC(C240A) C-terminal helix. (I) A zoomed-in view of the C-terminal density of MDFIC, indicating the presence of lipidation density at C240 in the wild-type complex (upper), while it is absent in the C240A mutated complex (bottom).

[0058] Figure 19. C-terminal cysteines of MDFIC are lipidated but not essential for Pizeol binding. (A) Alignment of the C-terminal conserved region of human and mouse MDFIC and MDFI in orange. All cysteines predicted to be lipidated are red or purple. (B) Representative mass tagging with pegylated maleimide 10 kDa for control (Ctrl) lysate without MDFIC expressed, wild-type (WT) MDFIC, MDFIC 10C to A (all red highlighted residues mutated to alanine) and 15C to A (both red highlighted and purple highlighted cysteines mutated to alanine) with and without hydroxylamine (HAM) treatment. Represents a non-specific band seen in all groups. (C) FLAG pulldown illustrating that WT MDFIC and MDFIC mutations 5C-A and 5C-S can pulldown Piezol . The upper panel displays Piezol -GFP signal under blue light, and the bottom panel presents the Coomassie blue stained SDS-PAGE gel. Thebands for Piezo1 -GFP and FLAG-MDFIC are labeled. The first four lanes illustrate FLAG pulldown from 30 mL cells transfected with 30 pg of each plasmid. The last three lanes show FLAG pulldown from 30 mL cells transfected with 30 pg of Piezo1-GFP plasmid alone with either 15 pg of WT FLAG-MDFIC or the mutant FLAG-MDFIC plasmids.

[0059] Figure 20. All atom molecular dynamic simulations of the Piezol pore module in complex with the MDFIC C-terminus. (A) Root mean square deviation (RMSD) plots of Piezol and MDFIC monomers throughout the 500 ns simulation. (B) Root mean square fluctuation (RMSF) plots of each residue in the MDFIC monomers. (C) Overlay of lipidated MDFIC from a representative simulation snapshot (taken from most populous cluster across the 3 trajectories) with the cryo-EM map. (D) Contact occupancies of lipid tails attached to C223, C237, C240, C241 and C244 with L2475 of the Piezol inner helix. (E) Representative MD snapshot showing the lipid tails attached to C240, C241 and C244 interacting with L2475. (F) All-atom molecular dynamics simulations of unmodified MDFIC C-termini with the flattened structure of Piezol (left). Root mean square deviation (RMSD) plots of the flattened Piezol and lipidated MDFIC monomers (right). (G) Contacts between flattened Piezol inner helix and either lipidated or unmodified MDFIC. (H) All-atom molecular dynamics simulations of lipidated MDFIC c-termini with the flattened structure of Piezol (left). Root mean square deviation (RMSD) plots of the flattened Piezol and lipidated MDFIC monomers (right).

[0060] Figure 21. Influence of MDFIC-related proteins on a model sensory cell containing Piezo2. (A) Whole-cell patch clamping of human MCC13 Merkel cells showing indentation dependent currents at -50 mV. Currents are carried by endogenous Piezo2 channels and markedly slowed by the presence of MDFL (B) Quantification of the current remaining at the end of the indentation stimulus of 150 ms as a function of indentation depth showing no depth dependence to the slowing of currents. (C) Quantification of the current remaining at the end of the indentation stimulus of 150 ms at the peak currents elicited per cell. (D) The inactivation time constant (tau) fit with a single exponential function at the peak current per cell.

[0061] Figure 22. Influence of MDFIC-related proteins on a model adipocyte-like cell containing Piezol . (A) Whole-cell patch clamping of mouse 3T3-L1 cells showing indentation dependent currents at -50 mV. Currents are carried by endogenous Piezol channels and markedly slowed by the presence of MDFIC. (B) Quantification of the current remaining at the end of the indentation stimulus of 150 ms as a function of indentation depth showing no depth dependence to the slowing of currents. (C) Quantification of the currentremaining at the end of the indentation stimulus of 150 ms at the peak currents elicited per cell (““ = p-value<0.0001 , determined using T-test).

[0062] Figure 23. C-terminal sequence of MDFIC tolerates numerous mutations and retains functional influence on Piezol . (A) Alignment of the end sequence of human hMDFI, mouse mMDFIC, human hMDFIC, xenopus xMDFIC, bovine bMDFIC, rat MDFIC. (B) Quantification of normalized current remaining at the end of a pressure pulse of human Piezol alone and in the presence of MDFIC, MDFIC S229A, MDFIC D232K, MDFIC C239S, MDFIC I242A, MDFIC C243A and MDFIC 5C / F (* = p-value<0.0001 , determined using one-way ANOVA). The effect on Piezol inactivation is retained in all mutants despite their conservation including single cysteine mutants but not when all 5 cysteines are mutated to phenylalanine (5C / F).

[0063] Description of EmbodimentsPiezo binding polypeptides

[0064] The present inventors have identified that MyoD family inhibitor proteins (MDFIC and MDFI) bind Piezo 1 and regulate Piezo channel gating (Table 1). The inventors have determined that the cysteine-rich conserved C-terminus of MDFIC and MDFI (Table 2) is required to regulate Piezo channel gating by potentiating Piezo channel currents or repressing Piezo channel activity. Further, lipidation of the C-terminus is required for regulation. The inventors have further determined that sequences comprising specific lipidated cysteine residues critically potentiate Piezo channels (Tables 3 and 4). Accordingly, the present invention relates to polypeptides that potentiate Piezo channels and methods of potentiating Piezo channels by administering the Piezo binding polypeptides or pharmaceutically acceptable salts thereof. The present invention further relates to polypeptides that repress Piezo channel activity and methods of repressing Piezo channel activity by administering the Piezo binding polypeptides or pharmaceutically acceptable salts thereof.

[0065] MyoD family inhibitor proteins comprise a C-terminal helix which interacts with the Piezo pore module. Exemplary embodiments of MDFIC and MDFI amnio acid sequences are provided in Table 1. In some embodiments, Piezo binding protein refers to a polypeptide comprising SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4 or a pharmaceutically acceptable salt thereof.Table 1. Amino acid sequences of MyoD family inhibitor proteins.

[0066] In some embodiments, the Piezo binding polypeptide comprises or consists of the cysteine-rich conserved C-terminus (C-81) of MDFIC and MDFI for example SEQ ID NO: 5 or SEQ ID NO: 6, or a pharmaceutically acceptable salt thereof. Exemplary embodiments of the conserved C-terminus (C-81) of MDFIC and MDFI amnio acid sequences are provided in Table 2.Table 2. Conserved C-terminus (C-81) of MyoD family inhibitor proteins.

[0067] Polypeptide and peptide sequences are indicated using standard one- or three-letter abbreviations (e.g., Cysteine is abbreviated 'C or 'Cys'). Unless otherwise indicated, polypeptide sequences have their amino termini at the left and their carboxy termini at the right. A particular section of a polypeptide or peptide can be designated by amino acid residue number such as amino acids 80 to 119, or by the actual residue at that site such as Ser80 to Seri 19.

[0068] In some embodiments, the Piezo binding polypeptide is a polypeptide comprising a sequence having at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1 %, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% identical to SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6 or a pharmaceutically acceptable salt thereof. In a preferred embodiment, the Piezo binding polypeptide is a polypeptide comprising a sequence having at least about 80% sequence identity to SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6 or a pharmaceutically acceptable salt thereof. In another preferred embodiment, the Piezo binding polypeptide is a polypeptide comprising a sequence having at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6 or a pharmaceutically acceptable salt thereof.

[0069] The term "about" as used herein in relation to % sequence identity of a protein or polypeptide (amino acid) sequence means up to and including ±1.0% in 0.1% increments. For example, "about 90%" sequence identity includes 89.0%, 89.1%, 89.2%, 89.3%, 89.4%, 89.5%, 89.6%, 89.7%, 89.8%, 89.9%, 90%, 90.1 %, 90.2%, 90.3%, 90.4%, 90.5%, 90.6%, 90.7%, 90.8%, 90.9%, and 91%.

[0070] The terms "sequence identity" and "percent identity", for example a "polypeptide comprising a sequence having at least about 80% sequence identity to" as used herein refer to the extent that sequences are identical on an amino acid-by-amino acid basis over a window of comparison. The percentage (%) of sequence identity may be calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical amino acid residue (e.g., Ala, Pro, Ser, Thr, Gly, Vai, Leu, Phe, Tyr, Trp, Lys, Arg, Cys etc.) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total numberof positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity.

[0071] Exemplary computer programs which can be used to determine identity between two sequences include, but are not limited to, the suite of BLAST programs, e.g., BLASTN, publicly available on the Internet at the NCBI website. See also Altschul et aL, 1990, J. Mol. Biol. 215:403-10 (with special reference to the published default setting, i.e., parameters w=4, t=17) and Altschul et aL, 1997, Nucleic Acids Res., 25:3389-3402. Sequence searches are typically carried out using the BLASTP program when evaluating a given amino acid sequence relative to amino acid sequences in the GenBank Protein Sequences and other public databases. In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (e.g., Karlin & Altschul, Proc. Nat'L Acad. Sci. USA, 90:5873-5787 (1993)). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.

[0072] In some embodiments, the Piezo binding polypeptide comprises or consists of SEQ ID NO: 7 or SEQ ID NO: 8, or a pharmaceutically acceptable salt thereof. In some embodiments, the Piezo binding polypeptide comprises or consists of C-X1-X2-X3-X4-C-X5- X6-X7-C-X8-X9-C-C-X10-X11-C-X12-X13-X14 or a pharmaceutically acceptable salt thereof, wherein X is any amino acid. In some embodiments, Xi, Xe and X9 are E or a conservative substitution thereof. In some embodiments, X2and X14 are S or a conservative substitution thereof. In some embodiments, X3 is S, A or a conservative substitution thereof. In some embodiments, X4 is D or a conservative substitution thereof. In some embodiments, X5is L or a conservative substitution thereof. In some embodiments, X7is I or a conservative substitution thereof. In some embodiments, Xs is M or a conservative substitution thereof. In some embodiments, X is G or a conservative substitution thereof. In some embodiments, Xu is I, L or a conservative substitution thereof. In some embodiments, X12 is F or a conservative substitution thereof. In some embodiments, X13is P,S or a conservative substitution thereof. Exemplary embodiments of peptides comprising C-X1-X2-X3-X4-C-X5- X6-X7-C-X8-X9-C-C-X10-X11-C-X12-X13-X14 are provided in Table 3.Table 3. C-terminus 20 amino acids of MyoD family inhibitor proteins.

[0073] In some embodiments, the Piezo binding polypeptide comprises or consists of SEQ ID NO: 9 or SEQ ID NO: 10, or a pharmaceutically acceptable salt thereof. In some embodiments, the Piezo binding polypeptide comprises or consists of C-X5-X6-X7-C-X8-X9- C-C-X10-X11-C-X12-X13-X14 or a pharmaceutically acceptable salt thereof, wherein X is any amino acid. In some embodiments, X6and X9are E or a conservative substitution thereof. In some embodiments, X14 is S or a conservative substitution thereof. In some embodiments, X5is L or a conservative substitution thereof. In some embodiments, X7is I or a conservative substitution thereof. In some embodiments, Xs is M or a conservative substitution thereof. In some embodiments, X is G or a conservative substitution thereof. In some embodiments, Xu is I, L or a conservative substitution thereof. In some embodiments, X12 is F or a conservative substitution thereof. In some embodiments, X13is P,S or a conservative substitution thereof. Exemplary embodiments of polypeptides comprising C-X5-X6-X7-C-X8-X9-C-C-X10-X11-C-X12-X13-X14 with at least five cysteine residues are provided in Table 4.Table 4. Polypeptides containing 5 cysteine residues of MyoD family inhibitor proteins.

[0074] Polypeptides (e.g., SEQ ID NO: 1 to SEQ ID NO: 10) include those that have been modified in any way and for any reason, for example, to: (1 ) reduce susceptibility to proteolysis, (2) reduce susceptibility to oxidation, (3) alter binding affinity for forming protein complexes, (4) alter binding affinities, and (5) confer or modify other physicochemical or functional properties. For example, single or multiple amino acid substitutions may be made in the peptide and polypeptide sequences without adversely affecting binding and biological activity. A skilled person will be able to determine suitable amnio acid substitutions using well-known techniques. In some embodiments, one skilled in the art may identify suitable areas of the molecule that may be modified while maintaining binding or regulating specificity for the Piezo channel, for example, by targeting regions that do not directly contribute to binding occupancy or regulation of the Piezo channel. In some embodiments, the skilled person can identify residues and portions of the molecules that are conserved among similar polypeptides. In further embodiments, even areas that may be important forbiological activity or for structure may be subject to conservative amino acid substitutions without adversely affecting biological activity or without adversely affecting the polypeptide structure.

[0075] Alternatively or in addition, one skilled in the art can review structure-function studies identifying residues in similar polypeptides or peptides that are important for activity. In view of such a comparison, the skilled person can predict the importance of amino acid residues in a polypeptide or peptide that correspond to amino acid residues important for activity or structure in similar polypeptides or peptides. One skilled in the art may opt for chemically similar amino acid substitutions for such predicted important amino acid residues. Based on information gathered from routine experiments, one skilled in the art can readily determine the amino acids where substitutions and / or modifications should be avoided either alone or in combination with other substitutions and / or modifications.

[0076] The amino acid sequences disclosed herein (e.g., SEQ ID NO: 1 to SEQ ID NO: 10) may be modified by individual substitutions, deletions or additions to alter, add or delete a single amino acid or a small percentage of amino acids. A "conservative substitution" refers to the replacement of a first amino acid by a second amino acid that has chemical and / or physical properties (e.g., charge, structure, polarity, hydrophobicity / hydrophilicity) that are similar to those of the first amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. Exemplary amino acid substitutions are set forth below.Amino Acid SubstitutionsOriginal Residues Exemplary Substitutions Preferred SubstitutionsAla Vai, Leu, lie VaiArg Lys, Gin, Asn LysAsn GinAsp GluCys Ser, Ala SerGin Asn AsnGlu Asp AspGly Pro, Ala AlaHis Asn, Gin, Lys, Arg Arg lie Leu, Vai, Met, Ala, LeuPhe, NorleucineLeu Norleucine, lie, lieVai, Met, Ala, PheLys Arg, 1 ,4 Diamino-butyric ArgAcid, Gin, AsnMet Leu, Phe, lie LeuPhe Leu, Vai, lie, Ala, Tyr LeuPro Ala GlySer Thr, Ala, Cys ThrThr SerTrp Tyr, Phe TyrTyr Trp, Phe, Thr, Ser PheVai lie, Met, Leu, Phe, LeuAla, Norleucine

[0077] Similarly contemplated is replacing a basic amino acid with another basic amino acid (e.g., replacement among Lys, Arg, His), replacing an acidic amino acid with another acidic amino acid (e.g., replacement among Asp and Glu), replacing a neutral amino acid with another neutral amino acid (e.g., replacement among Ala, Gly, Ser, Met, Thr, Leu, lie, Asn, Gin, Phe, Pro, Trp, Tyr, Vai).

[0078] Methods of producing the Piezo binding polypeptides described herein are well known to one of ordinarily skill in the art. Knowing the amino acid sequences (e.g., SEQ ID NOs: 1 to SEQ ID NO: 10) of the desired polypeptide, one skilled in the art can readily produce a polypeptide or a functional part of the polypeptide by standard techniques for production of proteins. For instance, they can be synthesized using well-known solid phase method, preferably using a commercially available protein synthesis apparatus (such as that made by Applied Biosystems, Foster City, California) and following the manufacturer's instructions.

[0079] Alternatively, the Piezo binding polypeptides described herein can be produced using recombinant DNA techniques as is well-known in the art. For example, host cells (e.g., eukaryotic or prokaryotic host cells) transformed or transfected with suitable expression or cloning vectors for protein production are cultured in conventional nutrient media, modified as appropriate for inducing or constitutive promoters, the transformants areselected and / or maintained, and the nucleic acid encoding the desired protein sequence is expressed. The culture conditions such as media, temperature, pH and the like, can be selected by the skilled artisan without undue experimentation. In general, principles, protocols, and practical techniques for maximizing the productivity of cell cultures can be found in, for example, Mammalian Cell Biotechnology: A Practical Approach, M. Butler, ed. (IRL Press, 1991 ) and Molecular Cloning: A Laboratory Manual (Sambrook, et al, 1989, Cold Spring Harbor Laboratory Press).

[0080] In some embodiments, the invention relates to nucleic acids encoding the Piezo binding polypeptides described herein.

[0081] The polypeptides may include one or more modifications to enhance the stability of polypeptides. The modifications may include swapping L-amino acids with their D- enantiomers, and may involve sequence retro-inversion. Other modifications may include hydrocarbon stapling or stitching to improve helical stability. The polypeptides described herein may also be PEGylated and / or one or more peptide bonds may be N-alkylated (e.g. methylated.

[0082] In some embodiments, the Piezo binding polypeptides described herein (e.g., SEQ ID NO: 1 to SEQ ID NO: 10 or peptides comprising C-X1-X2-X3-X4-C-X5-X6-X7-C-X8-X9-C-C- X10-X11-C-X12-X13-X14 or C-X5-X6-X7-C-X8-X9-C-C-X10-X11-C-X12-X13-X14, wherein X is any amino acid) are PEGylated, preferably at one or more cysteine residues. This allows hydrophobic chains to be added to the cysteines through chemical means. In one embodiment, the PEG chain has a molecular weight of 200-200,000 daltons, preferably 200 daltons to 2,000 daltons. In one embodiment, the PEG chain has a molecular weight of about 200 daltons, about 300 daltons, about 400 daltons, about 500 daltons, about 600 daltons, about 700 daltons, about 800 daltons, about 900 daltons, about 1 ,000 daltons, about 1 ,100 daltons, about 1 ,200 daltons, about 1 ,300 daltons, about 1 ,400 daltons, about 1 ,500 daltons, about 1 ,600 daltons, about 1 ,700 daltons, about 1 ,800 daltons, about 1 ,900 daltons, or about 2,000 daltons. PEGs of various molecular weights, optionally conjugated to various groups, can be obtained commercially, and any method of PEGylation known in the art may be used.

[0083] The present invention also contemplates pharmaceutically acceptable salts of the Piezo binding polypeptides or peptides described herein. The term "pharmaceutically acceptable salt" includes both acid and base addition salts and refers to salts which retain the biological effectiveness and properties of the free bases or acids, and which are not biologically or otherwise undesirable. Pharmaceutically acceptable salts of peptides andpolypeptides can be prepared by any suitable technique. The pharmaceutically acceptable salts are formed with inorganic or organic acids or bases and can be prepared in situ during the final isolation and purification of the proteins, or by separately reacting a purified protein in its free base or acid form with a suitable organic or inorganic acid or base, and isolating the salt thus formed. It is to be understood that the term "pharmaceutically acceptable salt" also embraces pharmaceutically acceptable salts of the corresponding protein in any solvated form.

[0084] In some embodiments, the Piezo binding polypeptide or a portion thereof may be a helix. In some embodiments, the Piezo binding polypeptide (e.g., SEQ ID NO: 1 to SEQ ID NO: 4) comprises a C-terminus helix. In some embodiments, the Piezo binding polypeptide (e.g., SEQ ID NO: 5 to SEQ ID NO: 10) is a helix.

[0085] The Piezo binding polypeptide described herein may bind to Piezol and / or Piezo 2 and is used for one or more of potentiating Piezol , Piezo 2 channel currents, and / or repressing Piezo channel activity. In some embodiments, the Piezo binding polypeptide acts to potentiate Piezol channel currents and / or repress Piezo channel activity by contacting Piezol at one or more of the following sites:1 ) His2116, Phe2010, and Gln2123 from the a1 helix of the anchor domain;2) Val2187, Met2191 , and Leu2195 from the outer helix; and3) Phe2484 and Phe2485 at the base of the inner helix that lines the Piezol pore.

[0086] The term "lipidation" as used herein refers to the attachment of lipid molecules, such as fatty acids, phospholipids, or isoprenoids, to a peptide or polypeptide at any residue thus resulting in a lipidated protein. Lipidation can play a crucial role in protein function, localization, and interaction with cellular membranes. In the context of this invention, lipidation of polypeptides enhances the functional properties of the polypeptides. For example, lipidation may enhance stability, biological activities and interaction with cellular membranes.

[0087] Several types of fatty acids may be attached during the process of lipidation. Examples include palmitic acid, myristic acid, stearic acid, arachidonic acid, oleic acid, linoleic acid, docosahexaenoic acid (DHA), and eicosapentaenoic acid (EPA). Lipidation can occur through various mechanisms, including prenylation, myristoylation, palmitoylation, and glycosylphosphatidylinositol (GPI) anchor addition. Each type of lipidation involves the attachment of lipid molecules to specific amino acid residues. For example, prenylationinvolves the addition of prenyl groups, such as farnesyl or geranylgeranyl, to cysteine residues near the C-terminus. This modification enables protein anchoring to cell membranes. Myristoylation involves the attachment of a myristoyl group to an N-terminal glycine residue, and palmitoylation adds palmitic acid to cysteine residues.

[0088] In some embodiments, the Piezo binding polypeptides described herein (e.g., SEQ ID NO: 1 to SEQ ID NO: 10 or peptides comprising C-X1-X2-X3-X4-C-X5-X6-X7-C-X8-X9-C-C- X10-X11-C-X12-X13-X14 or C-X5-X6-X7-C-X8-X9-C-C-X10-X11-C-X12-X13-X14, wherein X is any amino acid) are lipidated.

[0089] In some embodiments, the Piezo binding polypeptides described herein (e.g., SEQ ID NO: 1 to SEQ ID NO: 10 or peptides comprising C-X1-X2-X3-X4-C-X5-X6-X7-C-X8-X9-C-C- X10-X11-C-X12-X13-X14 or C-X5-X6-X7-C-X8-X9-C-C-X10-X11-C-X12-X13-X14, wherein X is any amino acid) are lipidated at one or more of the cysteine residues. In some embodiments, the polypeptides described herein (e.g., SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO:4) are lipidated at the C-terminus. In preferred embodiments, the polypeptides described herein (e.g., SEQ ID NO: 5 or SEQ ID NO: 6) are lipidated at cystine residues. In further preferred embodiments, the polypeptides described herein (e.g., SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO:4) are lipidated at one or more of Cys233, Cys237, Cys240, Cys241 and Cys244. In some embodiments, the polypeptides described herein (e.g., SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO:4) are palmitoylated at one or more of Cys233, Cys237, Cys240, Cys241 and optionally farnesylated at Cys244.Methods

[0090] The methods described herein involve potentiating Piezo channel currents and / or repressing Piezo channel activity by contacting a Piezo protein with any one or more of: a) an effective amount of a Piezo binding polypeptide described herein comprisingC-X5-X6-X7-C-X8-X9-C-C-Xio-Xii-C-Xi2-Xi3-Xi4 or a pharmaceutically acceptable salt thereof, wherein X is any amnio acid, and wherein the polypeptide is lipidated; b) an effective amount of a Piezo binding polypeptide described herein comprisingC-X1 -X2-X3-X4-C-X5-X6-X7-C-X8-X9-C-C-Xi 0-X11 -C-X12-X13-X14 or a pharmaceutically acceptable salt thereof, wherein X is any amnio acid, and wherein the polypeptide is lipidated;c) an effective amount of a Piezo binding polypeptide described herein (e.g., SEQ ID NO: 7 to SEQ ID NO: 10) or a pharmaceutically acceptable salt thereof, wherein the polypeptide is lipidated; and / or d) an effective amount of a Piezo binding polypeptide described herein (e.g., SEQ ID NO: 1 to SEQ ID NO: 6 or a sequence having at least about 80% sequence identity to SEQ ID NO: 1 to SEQ ID NO: 6) or a pharmaceutically acceptable salt thereof, wherein the polypeptide is lipidated.

[0091] Piezo channels have been implicated in controlling key biological activities such as touch perception, hearing, and blood pressure regulation. Most vertebrates have two Piezo genes, Piezol and Piezo2. The function of Piezo2 is mainly restricted to the peripheral nervous system while Piezol is expressed in a wide range of tissues and has been shown to contribute to mechanotransduction in various organs. The biological processes that Piezol is involved in includes cardiovascular mechanosensitivity, erythrocyte mechanosensitivity, neural stem cell mechanosensitivity, epithelial cell mechanosensitivity, bladder mechanosensitivity, kidney mechanosensitivity, cartilage mechanosensitivity, periodontal cell mechanosensitivity, cell adhesion, migration, survival, differentiation and proliferation. Accordingly, provided herein are also methods for treating or preventing a Piezo related disease or condition such as a disease or condition with an altered Piezo channel activity by administering the peptides or polypeptides as described herein.

[0092] The peptides or polypeptides as described herein regulate Piezo channels. In some embodiments, the peptides or polypeptides as described herein potentiates Piezo channel currents, thus increasing the effect Piezo channel activation. In some embodiments, the peptides or polypeptides as described herein represses Piezo channel activity, thus reducing the effect Piezo channel activation.

[0093] In some embodiments, the Piezo related disease or condition is dehydrated hereditary stomatocytosis, distal arthrogryposis type 5, Gordon syndrome, Marden-Walker syndrome, or generalized lymphatic dysplasia, inflammatory conditions including but not limited to Alzheimer's disease, myocardial fibrosis, atherosclerosis, pulmonary fibrosis, osteoporosis, osteoarthritis, lumbar degeneration, obesity, diabetes, chronic cystitis, pain including chronic inflammatory pain, particularly conditions characterised by mechanical allodynia, and blood clotting disorders including thrombophilia.

[0094] Pharmaceutical formulations are provided herein which comprise one or more of Piezo binding polypeptides described herein, or a pharmaceutically acceptable salt thereof, and an acceptable carrier or excipient. The pharmaceutical formulation may be formulated for various routes of administration such as for oral, parenteral, intradermal orsubcutaneous administration. Parenteral administration may be by injection, infusion, or implantation, and includes but is not limited to intravenous, intraarterial, intraperitoneal, intrathecal, intraventricular, intraurethral, intramuscular, and intrasynovial administration.

[0095] As used herein a "pharmaceutical formulation" or "formulation" refers to a preparation of the polypeptide of the disclosure (e.g., SEQ ID NO: 1 to SEQ ID NO: 10 or polypeptides comprising C-X1-X2-X3-X4-C-X5-X6-X7-C-X8-X9-C-C-X10-X11-C-X12-X13-X14 or C-X5-X6- X7-C-X8-X9-C-C-X10-X11-C-X12-X13-X14) with other components such as a physiologically suitable carrier and / or excipient. The pharmaceutical formulation may contain at least one pharmaceutically acceptable carrier or excipient, depending on the intended route of administration, e.g., a solid for oral administration or liquid for intravenous or parenteral administration. As used herein, "an acceptable carrier" includes any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents and / or antifungal agents), isotonic agents, absorption delaying agents, stabilizers, gels, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes and combinations thereof, as would be known to a skilled person in the art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, pp. 1289- 1329, incorporated herein by reference).The "pharmaceutically acceptable carrier" and "acceptable carrier" are used interchangeably and does not cause significant irritation to the subject and does not abrogate the biological activity and properties of the administered genetically engineered bacterium. An adjuvant or excipient are included under these phrases. Examples of an excipient include, but are not limited to, calcium bicarbonate, sodium bicarbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils, polyethylene glycols, and surfactants, including, for example, polysorbate 20.

[0096] In some embodiments the polypeptides described herein are formulated as an injectable solution. In some embodiments, the polypeptides described herein is formulated for intravenous injection.

[0097] In some embodiments, the polypeptides described herein are formulated for oral administration. Solid formulations such as the tablets or capsules may contain any number of suitable pharmaceutically acceptable excipients or carriers described above. For example, the formulation may be formulated in a suitable dosage form selected from liquids, capsules, hard capsules, soft capsules, tablets, enteric coated tablets, suspension powders, granules, or sachet.

[0098] Tablets and capsules for oral administration may be in unit dose presentation form, and may contain conventional excipients such as binding agents, for example, acacia,gelatin, sorbitol, tragacanth, or polyvinylpyrollidone; fillers, for example lactose, sugar, maize-starch, calcium phosphate, sorbitol or glycine; tabletting lubricants, for example, magnesium stearate, talc, polyethylene glycol or silica; disintegrants, for example, potato starch; or acceptable wetting agents such as sodium lauryl sulphate. The tablets may be coated according to methods well known in normal pharmaceutical practice.

[0099] The proteins described herein may also be formulated for sustained delivery. In some embodiments, the peptide or polypeptide described herein is formulated in a sustained release formulation or depot. Exemplary sustained release formulations or depots include a microsphere; matrix; emulsion; lipid-based; polymer-based; nanomicelle; micelle; nanovesicle such as a liposome, noisome, transfersome, discome, pharmacosome, emulsome or spanlastic, especially a liposome; microparticle; nanoparticle such as a nanocapsule or nanosphere composed of e.g. lipids, proteins, natural or synthetic polymers such as albumin, sodium alginate, chitosan, PLGA, PLA and / or polycaprolactone; or in situ gel such as an in situ hydrogel drug delivery system.

[0100] The amount of the polypeptide described herein that is to be administered and the dosage regimen for potentiating Piezo channel currents and / or repressing channel activity depends on a variety of factors, including the age, weight, sex, and medical condition of the subject, the severity of the disease or condition, the route and frequency of administration, as well as the pharmacokinetic properties of the polypeptide or formulation such as adsorption, distribution, metabolism, and excretion in the individual treated, and thus may vary widely. Such treatments may be administered as often as necessary and for the period of time judged necessary by the treating physician. One of skill in the art will appreciate that the dosage regime or therapeutically effective amount of the polypeptide to be administrated may need to be optimized for each individual.

[0101] The pharmaceutical formulation as described herein may contain the polypeptide in the range of about 0.1 mg to 2000 mg, typically in the range of about 100 mg to 800 mg and more typically between about 200 mg and 400 mg. A daily dose of about 100 mg / day to 1000 mg / day, typically about 400 mg / day to 800 mg / day may be appropriate, depending on the route and frequency of administration. The daily dose will typically be administered in one or multiple, e.g., two, three or four, doses per day. In some embodiments, the proteins or formulations described herein may be administered to a subject daily, every two days, every three days, every four days, or every 5 days, once weekly, or once monthly.

[0102] In some embodiments, the polypeptide, or pharmaceutically acceptable salts thereof, or formulations thereof, may be administered in combination with one or more additional therapeutical agents for the treatment of Piezo related diseases or conditions.

[0103] It will be appreciated by persons skilled in the art that numerous variations and / or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.

[0104] Embodiments of the invention will now be discussed in more detail with reference to specific examples which are provided for exemplification only and which should not be considered as limiting the scope of the invention in any way.ExamplesExample 1 : Piezo channel binding polypeptides

[0105] To identify new binding partners for Piezo channels two complementary affinity capture mass spectrometry (AC-MS) strategies were used in conjunction with two CRISPR / cas9 edited Piezol human dermal fibroblast (hDF) lines (Fig. 1A-F; Fig. 5). Fibroblasts were utilized as Piezol expressed in fibroblasts from numerous tissue origins exhibit slower inactivation kinetics. Three comparator groups were used: 1) hDF with Piezol ablated using CRISPR / cas9 compared to wild-type cells where Piezol was enriched through a conventional anti-Piezo1 antibody strategy; 2) hDF with a HaloTag knocked in to the endogenous Piezol loci (P1 -Halo) where Piezol was enriched using HaloTrap resin; and 3) primary human cardiac fibroblasts (hCF) where Piezol was enriched through a conventional anti-Piezo 1 antibody strategy. The resulting mass spectrometry data were stringently analyzed to identify Piezol interacting proteins present in all 3 groups but were not present in any of their respective negative controls. Using these criteria only two proteins were identified, the first of which was Piezol (Fig. 1 E). This provided strong validation for both affinity capture strategies. The second was the sparsely studied transcriptional regulator MDFIC (MyoD family inhibitor domain containing protein). Mass spectrometry provided 39 ± 14 % coverage of MDFIC averaged over the 3 groups (Fig. 1 F).

[0106] First, using RNA expression data, many cell types were identified, in addition to fibroblasts, that co-express Piezo channels and the MyoD family inhibitor proteins, MDFIC or MDFI (Fig. 6A-B). The interaction was validated by expressing N-terminally HA-tagged MDFIC with Piezol in HEK293T cells. Using co-immunoprecipitation (co-IP), Piezol and MDFIC could be reciprocally capture and the complex was present under mechanical (shear stress) or chemical (10 pM Yoda-1 ) activation of Piezol (Fig. 6C), indicating the stability of the interaction. It was also confirmed that Piezol interacted with the closely related MDFI (Fig. 6D). Next, it was demonstrated that MDFIC selectively interacted with Piezo1 / 2 channels using native gels, identifying MDFIC at the size of the respectivePiezo 1 / 2 trimers but not in oligomeric complexes of TRPM4 or TREK-1 (Fig. 6E). In doing so, it was noticed that co-expression with Piezol enhanced the protein levels of both MDFIC and MDFI (>3-4 fold; Fig. 6C-E). To probe the specificity of this effect, MDFIC was co-expressed with Piezol and Piezo2 and MDFIC levels were compared when expressed alongside other ion channels. Co-expression of MDFIC with GFP, TRPM4, TRPV4 or TREK-1 did not enhance MDFIC protein levels (Fig. 7A-B). Treating cells expressing MDFIC only or MDFIC and Piezol with cycloheximide illustrated that this increase in MDFIC protein level was due to decreased MDFIC turnover, meaning MDFIC is stabilized within the complex (Fig. 7C-D).Piezo channels reduce MDFIC turnover

[0107] On co-expression of both Piezol and Piezo2 an increase in MDFIC protein levels was observed. This was illustrated by an increase in MDFIC levels when normalized to total protein, probed using the Na+ / K+-ATPase as a loading control (Fig. 7A-B). This effect was specific to Piezo channels and did not happen with a GFP only control or with other ion channels including TREK-1 , TRPV4 and TRPM4 (Fig. 7A-B). To understand the mechanism of this increase the protein synthesis inhibitor cycloheximide and a standard cycloheximide chase assay were utilised. As cycloheximide inhibits protein synthesis if cells are then lysed at sequential time points it is possible to observe the degradation time course of a protein using western blotting. Naive cells were compared with cells treated with cycloheximide (CHX: 10 pM) for 4 and 8 h and the protein levels of MDFIC in the presence and absence of Piezol (Fig. 7C) was tested. Longer treatments at this dose of CHX generally caused significant cellular toxicity. Normalizing the protein level of N-terminally tagged HA-MDFIC in the presence and absence of Piezol it was observed that the protein level of MDFIC fell much more rapidly in the absence of Piezol (Fig. 7D). As cycloheximide prevents new protein being made this must be the result of increased turnover of MDFIC protein. After 8 h the MDFIC protein level had fallen to 68 ± 6 % of the original level whereas in the presence of Piezol after 8 h the protein level was similar to the untreated time point (100 ± 12 %). This slow turnover of MDFIC in Piezol expressing cells is reminiscent of the very slow turnover of Piezol protein.Example 2: MDFIC binds Piezol pore module

[0108] To provide molecular detail of the interaction, mouse Piezol was co-expressed with N-terminally FLAG-tagged mouse MDFIC and the complex was purified using FLAG resin. Using single-particle cryo-EM, the structure of the Piezol -MDFIC complex was determined at an overall resolution of 3.66 A (Fig. 2A-B; Fig. 8). The C-terminal 21 amino acids of MDFIC (Fig. 2A-D) were resolved while the N-terminal portion displayed little or no density,presumably due to local dynamics. The resolved region of MDFIC (residues 225-246) consisted of an amphipathic helix that sits parallel to the membrane at the membrane interface (Fig. 2C). This helix inserted laterally into the Piezo pore module, nestling between the anchor domain and the outer helix of Piezol (Fig. 2C-D) making significant contacts with His2116, Phe2010, and Gln2123 from the a1 helix of the anchor domain, Val2187, Met2191 , and Leu2195 from the outer helix and Phe2484 and Phe2485 at the base of the inner helix that lines the Piezol pore (Fig. 2E). The amphipathic helix of MDFIC consists of a sequence of five cysteines that point towards the bilayer interior (Fig. 2E-F) and a sequence of four negatively charged residues that point towards the solvent, forming salt bridges with multiple lysine residues (Fig. 2F-G). The MDFIC C-terminus penetrates far enough that it comes close to the cytoplasmic constriction formed by Met2493 / Phe2494 (Fig. 2H) and residues critical for voltage-dependent inactivation (Lys2479 / Arg2482). Despite its central location, MDFIC binding did not noticeably influence the closed structure of the Piezol pore module (Fig. 81).

[0109] As both Piezol and MDFIC are essential for lymphatic development in mice and humans it was investigated using the ClinVar database whether any disease-causing mutations were located within this binding interface. A mutation in both Piezol (Fig. 2E,G, human V2171 F) and MDFIC (Fig. 2E,H, human F244L) was found to be associated with human lymphatic disease.Example 3: MDFIC and MDFI regulate Piezo gating

[0110] Given the location of MDFIC binding, it was next investigated whether human MDFIC and MDFI modified human Piezol (hPiezol ) gating in HEK293T cells. MDFIC and MDFI expressed alone did not generate stretch -activated currents (Fig. 9A-D). Compared with hPiezol alone, co-expression with MDFIC or MDFI resulted in a mild right-shift in the pressure response curve, a marked increase in the peak stretch-evoked currents, a significant slowing of channel inactivation and continued channel gating even after the pressure was released (Fig. 3A-H; Fig. 9). The latter of these effects was quantified using the current remaining one second post application of stretch (lpost). MDFIC did not influence Piezol protein levels, but it did increase Piezol single-channel conductance (Fig. 10). Thus, the increase in stretch -activated currents in the presence of MDFIC is likely driven by changes in conductance and its strong effect on inactivation. The slow 'closure' after pressure release (signified by increased lpost) was more pronounced at hyperpolarizing voltages, suggesting an effect on the structural transition governing voltage-dependent inactivation (Fig. 11 A-B). Consistent with this, the channel could be rapidly closed by flipping the voltage to depolarizing potentials (C-D). Slower inactivation was observed inboth cell-attached and whole-cell modes (Fig. 12). Importantly, MDFIC expression did not influence the function of mechanosensitive TREK-1 channels ruling out non-specific effects (Fig. 13).

[0111] Given the C-terminus of MDFIC was resolved in the structure and is highly homologous in MDFI (whereas the N-termini of MDFIC and MDFI bear little resemblance and have no known function, Fig. 14A) it was investigated whether the MyoD inhibitor domain of MDFIC (amino acid 165-246, named C-81) expressed alone could modify Piezol function. Indeed, despite being unstable this domain reduces channel inactivation (Fig. 3D,G; Fig. 14B). Moreover, the C-81 protein could bind to Piezol with the level of C-81 protein being dramatically increased by co-expression with Piezol (Fig. 14C-D). Conversely, truncation of the C-terminal 20 residues (AC20) prevented MDFIC from regulating Piezol gating (Fig. 3E-G). This truncation reduced the interaction with Piezol , and its protein levels were only marginally affected by Piezol (Fig. 14 D-E). Thus, functional regulation of the Piezol -MDFIC complex depends on the conserved C-terminus of MDFIC.

[0112] Given the homology of Piezol and Piezo2 in the MDFIC-binding region, it was additionally showed that the same regulation occurs for both human Piezo2 and mouse Piezo orthologues (Fig. 31-L; Fig. 15). Moreover, the expression of MDFIC and MDFI correlated with the native inactivating phenotype of Piezol in multiple human and mouse cell types (Fig. 16). To explore this correlation, it was investigated whether genetic loss of MDFIC could modify the kinetics of native Piezol currents. To do this, a mouse model of a recurrent MDFIC variant found in patients with the complex lymphatic anomaly known as central conducting lymphatic anomaly was utilized. This truncating variant lacks the complete conserved C-terminal region but retains the N-terminal region (A. B. Byrne et al., Sci Transl Med 14, 2022). Assessment of Piezol activity in embryonic cardiac fibroblasts isolated from E16.5 wild-type (WT / WT), heterozygous (WT / M131fs*) and homozygous mice (M131fs7M131fs*), revealed that fibroblasts harboring C-terminally truncated MDFIC had Piezol currents which were smaller and inactivated more rapidly (Fig. 3M-R). This effect on inactivation was phenocopied by knocking down MDFIC in fibroblasts using siRNA (Fig. 17D-J).MDFIC-mediated increase in Piezol currents

[0113] Larger Piezol currents in cells expressing MDFIC and MDFI was noted (Fig. 3). These larger currents are congruent with the strong effects observed on inactivation but could also be explained by MDFIC influencing Piezol mechanosensitivity, protein levels or single channel conductance. MDFIC caused a mild rightward shift in the pressure response curve of hPiezol indicated by a shift in the P50 (pressure at which 50% of the channelpopulation are activated) from 14.5 ± 3.2 mmHg (n=9) to 23.9 ± 3.9 mmHg (n=6) (Fig. 9E- G). This shift cannot account for the larger peak currents. Next, Piezol alone or with MDFIC was expressed and western blotting was used to examine the protein levels after 2 days transfection. A significant increase in Piezol protein levels could not be identified either in HEK293T cells transiently transfected with Piezol and MDFIC or in native Piezol levels from LNCaP cells transfected with MDFIC (Fig. 10A-D). Given the location of MDFIC binding in the PIEZO1 pore region, the single channel behavior of Piezol in the presence of MDFIC was then examined. Long openings of multiple Piezol channels in the presence of MDFIC were observed as seen in macro-currents from cell-attached patches. An increase in single-channel conductance from 26 ± 3 pS (n=4) to 48 ± 8 pS (n=4) was also measured (Fig. 10E-G). Thus, the larger currents likely originated from changes in single channel behavior and the strong influence on channel inactivation.MDFIC influences mouse Piezos

[0114] It was further investigated whether human MDFIC (hMDFIC) and MDFI (hMDFI) could also regulate mouse Piezo (mPiezo) orthologues as seen for human Piezos (Fig. 15). For mPiezol , it was found that hMDFIC and hMDFI potently regulated gating in a similar manner to human Piezol (Fig. 15A-D). This included an almost complete abolition of inactivation in cell-attached patches indicated by increased remaining current at the end of the pressure pulse and an increase in normalized lpost (Fig. 15C-D). For mPiezo2, stretchactivation was much less often than in the codon optimized human Piezo2 experiments (Fig. 3) with only 9 / 49 patches displaying stretch activated currents >10 pA. A noticeable increase in the proportion of cells expressing mPiezo2 was seen that elicited stretch- activated currents >10 pA in the presence of hMDFIC (11 / 34 patches) and hMDFI (8 / 17 patches) (Fig. 15E-F). A larger peak currents from these patches and an increase in lpost were also measured, as observed with hPiezo2 (Fig. 15E-F).MDFIC / MDFI correlate with native Piezol inactivation

[0115] The expression of MDFIC and MDFI in cells previously used for mass spectrometry were compared. hCF and hDF were difficult to study using patch-clamp electrophysiology so the expression of MDFIC and MDFI in these cells were compared to several cell lines previously characterized using electrophysiology. This included HEK293T where fast Piezol inactivation was seen and prostate cancer lines (LNCaP and DU 145) where differential stretch-activated kinetics were previously reported (Fig. 16A). Both LNCaP and HEK293T cells had very low to almost undetectable levels of MDFIC and MDFI using qPCR. DU145 had detectable levels of MDFIC and high levels of MDFI. The mechanogated currents in these cells were then assessed. It was identified that Piezol over-expressed in HEK293T and native stretch-activated Piezol currents in LNCaP displayed rapid inactivation in cell-attached patches (Fig. 16B-D). The percentage of current remaining at the end of each pressure pulse was used to assess the relative inactivation. DU145 cells exhibited slowly inactivating currents where channels continued to gate after the pressure was released. To show the ubiquity of the MDFIC effects on Piezol gating, MDFIC was over-expressed in LNCaP cells and the inactivation was markedly slowed as illustrated by an increase in the percentage current remaining at the end of the pressure pulse (Fig. 16D). The expanded versions of these traces were shown to provide clear evidence that after pressure is removed ultimately the channel closes after a prolonged period of -10-60 s (Fig. 16E-F).

[0116] To show these effects can be replicated in other species, several mouse cell types were tested including another fibroblast type, namely mouse embryonic fibroblasts (MEF) (Fig. 16G). These primary isolated cells were compared to two cell lines, neuro2a (N2A) and C2C12. Native Piezol channels in these cells displayed very different kinetics. MDFIC expression at the mRNA level in both MEF and C2C12 were identified but both MDFI and MDFIC were completely absent from N2A cells. Consistent with data demonstrating that MDFIC slows Piezol channel inactivation it was noted that both MEF and C2C12 displayed slower inactivation, as indicated by a larger percentage current remaining at the end of the pressure pulse (Fig. 16H-I). N2A cells exhibited rapid Piezol channel inactivation. It was also shown that the influence of MDFIC on Piezol channel gating is likely to depend on the cellular ratio of Piezol to MDFIC. Piezol was over-expressed in MEF to increase current density and while inactivation remained slow, a trend toward less percentage current remaining at the end of the pressure pulse was observed (Fig. 16H-I).MDFIC knockdown phenocopies genetic MDFIC mouse model

[0117] To complement the data above, a genetically engineered mouse that harbored a truncated version of MDFIC was used and knockdown experiments were performed to further corroborate a role of MDFIC in regulating endogenous Piezol channel inactivation. Firstly, MEF from PIEZO17-embryos was isolated and it was shown that in PIEZO1 / _MEF there was almost no stretch-activated current confirming that almost all stretch -activated currents recorded in MEF came from Piezol channels (Fig. 17A-C). It was confirmed again that these native channels as shown in Fig. 17 inactivate more slowly than Piezol channels in HEK293T, N2A or LNCaP. siRNA was used to knockdown MDFIC and MDFI to investigate whether this influenced Piezol inactivation kinetics. siRNA treatment was compared with a scrambled control siRNA and siRNA specific for MDFIC and MDFI (Fig. 17D-J). The knockdown efficiency was tested using qPCR and cell-attached patch clamping(Fig. 17G). It was observed that the peak current per patch in scrambled siRNA treated control samples was 63 ± 8.7 pA, this was higher than that of either MDFIC siRNA alone (44 ±12 pA) or MDFIC and MDFI siRNA treated samples (33.7 ± 5.3 pA) (Fig. 17D-J). While this reduction in peak currents was not statistically significant, significant changes in both the percentage current remaining at the end of the pressure pulse and the lpost in cells treated with MDFIC specific siRNA (Fig. 17H-J) were observed. The addition of MDFI siRNA marginally enhanced the response suggesting that MDFI expression is low in native MEF. The knockdown data is consistent with a role for MDFIC in regulating the kinetics of native Piezol channels.Piezo regulation in other cell types

[0118] It was shown that MDFIC / MDFI related proteins were able to regulate native Piezo2 currents in sensory cells, ie, Merkel cell model (MCC13) (Fig. 21). These sensory cells express Piezo2 in the stomach lining and are targets for satiety signaling, relevant for obesity. It was further shown that MDFIC / MDFI related proteins were able to regulate native Piezol currents in adipocyte-like cells, ie, a mouse pre-adipocyte (3T3-L1 pre-adipocytes) (Fig. 22). Adipocytes expressing Piezol are also a cell type target for obesity.Mutations at the C-terminal sequence of MDFIC

[0119] To validate the conserved residues throughout the C-terminus of MDFIC, mutations were introduced. Fig. 23 shows that the C-terminal sequence of MDFIC tolerates numerous mutations and retains functional influence on Piezol . However, it is necessary to retain the cysteines in this peptide as mutation of all cysteines even to bulky residues like Phenylalanine (F) completely lose all activity against Piezol .Example 4: Piezol regulation requires MDFIC lipidation

[0120] Cryo-EM maps of MDFIC revealed extra densities on Cys233, 237, 240, 241 and 244 (Fig. 4A). Given this helix is situated at the membrane interface, and contains motifs for cysteine lipidation, it was hypothesized that these extra densities resulted from lipidation, which is the covalent addition of acyl chains to amino acids. A second cryo-EM complex of the MDFIC mutant Cys240Ala at 3.68 A specifically lacked the extra density at Cys240, consistent with post translational modification (Fig. 18). Acyl biotin exchange confirmed that MDFIC was palmitoylated (Fig. 4B). Mass tagging with PEGylated maleimide (increases mass per palmitoylated site) showed there was at least 3 sites for lipidation on MDFIC (Fig. 4C), that two were in the distal C-terminus (Fig. 19) and, like most lipidated proteins, MDFIC associated with the plasma membrane (Fig. 4D).

[0121] To check if MDFIC lipidation was functionally relevant, all five C-terminal cysteines to alanine or serine were investigated. MDFIC with Cys233 / 237 / 240 / 241 / 244Ala (5C-A) or Cys233 / 237 / 240 / 241 / 244Ser (5C-S) bound to Piezol but neither mutant influenced Piezol activity, suggesting that the lipidation of the MDFIC C-terminus is critical for Piezol regulation (Fig. 4E-H; Fig 19C).

[0122] To investigate the role of lipidation, an all-atom molecular dynamics simulations of the Piezol pore module (1956-2547) in complex with the MDFIC C-terminus was conducted (Fig. 4I-K; Fig. 20). Simulations consisted of three MDFIC monomers: one unmodified, one lipidated at all five cysteine residues in the helix, and one where each cysteine was mutated to serine (Fig 4I). All variations of the MDFIC C-terminus remained stably bound (Fig. 20A- B). Overlay of a snapshot from simulations showed that the acyl chains coincide with the additional MDFIC cryo-EM densities (Fig. 20C). All interactions occurring in either unmodified or lipidated MDFIC monomers were compared to those in the 5C-S mutant that is known to bind but does not modulate Piezol function (Fig 4J; Fig. 20). Interactions between the unmodified and 5C-S MDFIC were indistinguishable, supporting the importance of MDFIC lipidation in modulating Piezol function. In contrast, the lipidated MDFIC had multiple unique interactions with the inner helix residues (Fig 4J-K; Fig. 20D-E). Some of these residues within the inner helix are critical for inactivation including Leu2475 making this the likely pathway for functional modification. Given MDFIC would need to stay bound throughout the Piezol conformational cycle it was also examined if MDFIC could bind to the flattened state of Piezol . When MDFIC was aligned to the same pocket, simulations showed it interacted with the inner helix and remained stably bound (Fig. 20F- H).Lipidation of the MDFIC C-terminus

[0123] It was shown that MDFIC undergoes palmitoylation using acyl biotin exchange and that there are at least three sites for this modification using mass tagging (Fig. 4). Given the C-terminal is essential for the regulation of Piezol by MDFIC it was tested whether any of these sites can be localized to the C-terminal 20 amino acids of MDFIC. To do this, two constructs were made: one where all 15 cysteines in the conserved C-terminus were mutated which were predicted to be lipidated, and a second where 10 cysteines to alanine mutations were created and the distal five cysteines identified in the cryo-EM structure were left untouched (highlighted purple; Fig. 19A). With all cysteines mutated to alanine (15C to A) only one palmitoylation site could be identified. In both the WT and the mutant that retained the last 5 cysteines (10C to A) three sites modified by the PEGylated maleimidecould be clearly seen (labelled 1 -3 in Fig. 19B). This identified that at least two of the last five cysteines are palmitoylated.Example 5: Discussion

[0124] The present inventors identified a family of Piezo channel binding partners, the MyoD family inhibitor proteins MDFI and MDFIC. These proteins bind to Piezol pore module via their conserved C-terminus and regulate channel inactivation. The regulation of Piezo channel inactivation critically involves lipidation of the C-terminus, particularly involving palmitoylation of the C-terminal of MDFIC.Materials and MethodsAntibodies and plasmid constructs

[0125] Sources and details of all antibodies used are summarized in Table 5. Sources and details of all plasmid constructs used are summarized in Table 6. To generate plasmids expressing MDFIC and MDFI with an N-terminal HA tag the coding sequences were directly synthesized as gBIocks (IDT). The DNA fragments were then digested and annealed into plasmid backbones. To generate truncated versions of MDFIC, site-directed mutagenesis was undertaken using a custom protocol with the high-fidelity polymerase Pfullltra. All mutations were confirmed using sanger sequencing.Table 5. Antibody detailsTable 6. Plasmid constructsCell culture and transfection

[0126] PIEZO1- / - HEK293T cells were from Dr. Ardem Patapoutian (The Scripps Research Institute, La Jolla, CA, United States); Human cardiac fibroblasts (hCF) were purchased from Sigma (306-05A); human dermal fibroblasts (hDF - BJ-5ta-hTERT) were provided by Dr. Michael Sheetz (UTMB, Galveston, TX, USA); LNCaP and DU145 were provided from Dr Nigel Turner (VCCRI, Sydney, Australia); C2C12 cells were from Dr Diane Fatkin (VCCRI, Sydney, Australia); Neuro2A (N2A) cells were from Dr Kate Poole (UNSW, Sydney, Australia); MCC13 were purchased from CellBank Australia; 3T3-L1 preadipocytes were from Dr Renjing Liu (VCCRI, Sydney, Australia).

[0127] Cell lines were not authenticated and were not listed in the Database of commonly misidentified cell lines maintained by ICLAC (http: / / iclac.org) and NCBI Biosample (http: / / www.ncbi.nlm.nih.gov / biosample). All cell lines were confirmed to be mycoplasma free. HEK293T and LNCaP were transfected with polyethylenimine (PEI) or Lipofectamine 3,000 transfection reagent (Thermo Fisher Scientific); hDF and MEF were transfected with the Neon electroporation system (Invitrogen) according to manufacturer’s instructions; 3T3- L1 pre-adipocytes were cultured in DMEM supplemented with 10% FBS; and MCC13 were cultured in RMPI supplemented with 15% FBS.Affinity capture and mass spectrometry

[0128] hCF, hDF or transfected HEK293T cells were lysed in CHAPS lysis buffer (1% w / v CHAPS, 0.6% w / v soy PC, 140 mM NaCI, 1 mM EDTA, 25 mM NaPIPES) supplemented with 2 mM 1 ,4-Dithiothreitol (DTT; Sigma) and 1 x protease-inhibitor cocktail (Roche). Lysates were centrifuged at 13,200 rpm for 20 min at 4°C. The expression of each protein of interest was confirmed by immunoblotting 5% of the collected supernatants, and the remaining supernatants were incubated with indicated antibodies and Protein G Dynabeads (Thermo Fisher Scientific) at 4°C overnight. The recovered beads were washed three times with CHAPS wash buffer (25 mM NaPIPES, 140 mM NaCI, 0.6% w / v CHAPS, 0.14% PC) supplemented with 2 mM 1 ,4-Dithiothreitol (Sigma) and 1 x protease-inhibitor cocktail (Roche), and heated in 2x sodium dodecyl sulphate (SDS)-PAGE loading buffer containing 1 M urea and 10 mM tris(2-carboxyethyl) phosphine (TCEP) at 95°C for 5 min. Both the total cell lysate (input) and the eluted proteins were subjected to western blot analysis.

[0129] For HaloTag affinity capture experiments, PIEZOI -HaloTag hDF or PIEZO1 - HaloTag transfected HEK293T cells were lysed and centrifuged using the exact same conditions as documented for the affinity capture above. The supernatants were incubated with Halo-Trap magnetic agarose (ChromoTek) at 4°C overnight. Beads were washed with CHAPS wash buffer three times, and the total protein lysate and eluted proteins were subjected to western blot analysis.

[0130] Mass spectrometry was carried by the Bioanalytical Mass Spectrometry Facility, University of New South Wales from two independent affinity capture experiments. Digested peptides from gel portions were separated by nanoLC using an Ultimate nanoRSLC UPLC and autosampler system (Dionex, Amsterdam, Netherlands). Samples (2.5 pl) were concentrated and desalted onto a micro C18 precolumn (300 pm x 5 mm, Dionex) with H2O:CH3CN (98:2, 0.2 % TFA) at 15 pl / min. After a 4 min wash the pre-column was switched (Valeo 10 port UPLC valve, Valeo, Houston, TX) into line with a fritless nano column (75p x ~15cm) containing C18AQ media (1.9p, 120 A Dr Maisch, Ammerbuch- Entringen Germany). Peptides were eluted using a linear gradient of H2O:CH3CN (98:2, 0.1 % formic acid) to H2O:CH3CN (64:36, 0.1 % formic acid) at 200 nl / min over 30 min. High voltage (2000 V) was applied to low volume Titanium union (Valeo), and the tip was positioned ~ 0.5 cm from the heated capillary (T=275°C) of an Orbitrap Fusion Lumos (Thermo Electron, Bremen, Germany) mass spectrometer. Positive ions were generated by electrospray and the Fusion Lumos operated in Data-dependent acquisition mode (DDA).

[0131] A survey scan m / z 350-1750 was acquired in the orbitrap (resolution = 120,000 at m / z 200, with an accumulation target value of 400,000 ions) and lockmass enabled (m / z 445.12003). Data-dependent tandem MS analysis was performed using a top-speedapproach (cycle time of 2s). MS2 spectra were fragmented by HCD (NCE=30) activation mode and the ion-trap was selected as the mass analyzer. The intensity threshold for fragmentation was set to 25,000. A dynamic exclusion of 20 s was applied with a mass tolerance of 10ppm.

[0132] Peptide ions (>2.5x104 counts, charge states +2 to +5) were sequentially selected for MS / MS using Data dependent acquisition, with the total number of dependent scans maximized within 2 s cycle times. Product ions were generated via higher energy collision dissociation (collision energy = 30; maximum injection time = 250 ms; MSn AGC = 5x104; inject ions for all available parallelizable time enabled) and mass analyzed in the linear ion trap. Dynamic exclusion was enabled and set to: n times =1 , exclusion duration 20 s, ± 10ppm.

[0133] Peak lists were generated using Mascot Daemon / Mascot Distiller (Matrix Science, London, England) using default parameters, and submitted to the Database search program Mascot (version 2.8.0, Matrix Science). Search parameters were: Precursor tolerance 4 ppm and product ion tolerances ± 0.5 Da; Met (O) carboxyamidomethyl-Cys specified as variable modification, enzyme specificity was trypsin, 1 missed cleavage was possible and the Uniprot human sequences were searched.Western blotting

[0134] Cells were solubilized in a modified RIPA buffer [Tris buffer 10 mM, ethylenediaminetetraacetic acid (EDTA) 1 mM, NaCI 140 mM, in (% w / v): Sodium deoxycholate 0.1 , SDS 0.1 , Triton X-100 1 .0, pH 7.2] supplemented with 1 x EDTA-free protease inhibitor cocktail tablets (Sigma-Aldrich) and 2 mM DTT for 30 min on a rotating wheel at 4 °C. Cell lysates were cleared by centrifugation at 13,200 rpm at 4 °C for 10 min. Supernatant was mixed with SDS loading buffer and subjected to 3-8% Tris-Acetate or 4- 12% Bis-Tris SDS PAGE (Invitrogen). Proteins were transferred to nitrocellulose membranes (Bio-rad) and the membrane was blocked with 4% non-fat milk in TBST for 1 h. The membrane was then blotted with primary antibody overnight at 4°C and subsequently with a secondary antibody for 1 h (all antibodies can be found in Table 5). Protein bands were detected with Li-Cor Odyssey Infrared Imaging System 9120 (Li-Cor) and band intensity was quantified with Li-Cor Image Studio (Li-Cor).Native gel electrophoresis and western blotting

[0135] Transfected HEK293T cells were lysed with a low salt lysis buffer (1% w / v CHAPS, 0.6% w / v soy PC, 50 mM NaCI, 1 mM EDTA, 25 mM NaPIPES) supplemented with 2 mM 1 ,4-Dithiothreitol (DTT; Sigma) and 1 x protease-inhibitor cocktail (Roche). Lysates werecentrifuged at 13,200 rpm for 20 min at 4°C. Native gel electrophoresis and western blotting were conducted according to manufacturer’s instructions. In brief, supernatant was mixed with NativePage sample buffer (Thermo Fisher Scientific) and G-250 sample additive (Thermo Fisher Scientific) was then loaded to a 4-16% NativePage (Thermo Fisher Scientific). After gel electrophoresis, marker lane was cut and stained with Coomassie blue reagent, and protein samples were transferred to a nitrocellulose membrane. Proteins on the membrane were fixed with 8% acetic acid for 10 min at room temperature. The membrane was then subjected to immunoblotting following the protocol as suggested above except for that an HRP-conjugated secondary antibody was used. The membrane was then briefly incubated with Pierce™ ECL Western Blotting Substrate (Thermo Fisher Scientific) and protein bands were detected with a ChemiDoc MP Imaging System (Bio-Rad).Protein labelling and total internal reflection fluorescence (TIRF) microscopy

[0136] Cells were dissociated with enzyme-free dissociation agent (StemCell Technologies) and 2,000 cells plated on #1.5 coverslips with 3.3 pg / ml fibronectin (Sigma) in Dulbecco’s modified Eagle’s Medium (DMEM). To label Piezol in the PIEZOI-HaloTag hDF, the cells were incubated in 200 nM JFX646 HaloTag ligand in culture media overnight (Janelia Research Campus, Howard Hughes Medical Institute, USA). The next day, cells were fixed with 4% paraformaldehyde in PBS for 30 minutes at room temperature. Samples were then washed with PBS then quenched with 0.1 M Glycine in Tris-buffered saline (TBS) for 10 min. The cells were then permeabilized with 0.05% Saponin in TBS for 10 min and blocked with 5% bovine serum albumin for 1 h at room temperature.

[0137] To label HA-MDFIC in HEK293T cells, transfected cells were seeded onto a fibronectin-coated CellCarrier Ultra microplate (PerkinElmer). Cells were washed with PBS and fixed with 4% PFA for 15 min. Cells were then permeabilized with 0.5% Triton-X100 in TBS for 2.5 min and blocked with 1% bovine serum albumin (BSA) in TBS for 1 h. Cells were then incubated with an anti-HA antibody (Sigma, H9658) overnight at 4°C then Alexa Fluor 647-conjugated secondary antibody (Thermo Fisher Scientific) for 1 h at room temperature. Cells were then washed three times with TBS and labelled with 1 pg / ml of Hoechst 33342 (Thermo Fisher Scientific) and 2 pg / ml of wheat germ agglutinin-CF488A (Biotium) for 20 min at room temperature and subsequently imaged using confocal microscopy (Zeiss LSM900 inverted).Generation of Piezol knock-out (KO) and PIEZOI -HaloTag knock-in dermal fibroblasts

[0138] Protocols for generating gene-edited cell lines were modified from previous work (A. Paix et al., Proc Natl Acad Sci USA 114, 2017). Briefly, a target sequence in the sixth exon of human Piezol (CAACGCTGGCCCCTACACGG) was selected using online software(www.crispr.mit.edu), and the corresponding oligonucleotide was cloned into the BsmBI site of lentiCRISPR v2 (Addgene Plasmid #52961 )(43); this Piezo 1 -targeting plasmid was transfected into hDF using the Neon electroporation system (Invitrogen). At 48 h post transfection, cells were selected for resistance to 1.25 pg / ml puromycin for 48 h and then resuspended (at 70 cells / ml) in the DMEM containing 10% FBS. Cells were subsequently seeded onto 96-well plates at a density of 0.7 cell / well. Single colonies were trypsinized and seeded onto 24-well plates at 21 days after initial seeding. Piezol KO was identified by DNA sequencing and western blotting.

[0139] For PIEZOI-HaloTag knock-in, we used Cas9 protein (Integrated DNA Technologies; IDT, Singapore) in combination with two target sequences (CCCAAGCACCGTGTCCAGGT; ACCGTGTCCAGGTAGGTGCG) in the thirty-sixth exon of Piezol spanning the codon encoding a.a 1591 in Piezol . Primers for PCR amplification of the homology dependent repair templates for knocking in the HaloTag and the sgRNAs were synthesized by IDT. Genome-edited cells were enriched by fluorescence activated cell sorting JFX646 labelled live cells. Cells were subsequently seeded onto 96-well plates at a density of 0.7 cells / well. Single colonies were trypsinized and seeded onto 24-well plates at 21 days after initial seeding. PIEZOI-HaloTag colony was validated by DNA sequencing and western blotting. siRNA mediated knockdown

[0140] To knock down MDFIC and MDFI protein expression, mouse embryonic fibroblasts were transfected with dsiRNAs (IDT) targeting MDFIC (GUCCGUGGAGAAUCACAAGAUAUCA) and / or MDFI (CUGAACAGCAUUGACCUCGAUGUCC) to a final concentration of 10 nM each mixed with RNAiMAX (Thermo Fisher Scientific). A non-targeting dsiRNA (IDT, Cat 51 -01-14-03) was used as control. Upon 48 h of the first transfection, cells were lifted and transfected again with the same amount of transfection reagents. Cells were then cultured for another 48 h before being seeded for electrophysiological recordings.Electrophysiology

[0141] Cells were plated on either 35 mm dishes or 10 mm glass coverslips for patch-clamp analysis. For cell-attached patch-clamping configuration, the extracellular solution was: 90 mM K+Aspartate, 50 mM KCI, 2 mM MgCI2 and 10 mM HEPES (pH 7.2) adjusted with KOH in order to zero the membrane potential. The pipette solution contained either: 90 mM CsCI, 40 mM CsF, 1 mM EGTA with 10 mM HEPES (pH 7.2) adjusted with CsOH or for TREK-1 recordings only 140 mM KCI, 1 mM CaCI2, 1 mM MgCI2 and 10 mM HEPES adjusted to pH7.2 using KOH. Negative pressure was applied to patch pipettes using a High-SpeedPressure Clamp-1 (ALA Scientific Instruments, Farmingdale, NY, United States) and recorded in millimetres of mercury (mmHg) using a piezoelectric pressure transducer (WPI, Sarasota, FL, United States). For cell-attached patch-clamp recording of Piezo1 / 2 due to the profound effects of MDFIC and MDFI each pressure pulse sweep was separated by a 50 s rest interval to maximize the chance for all channels to close between sweeps. Borosilicate glass pipettes (Sigma-Aldrich) were pulled with a vertical pipette puller (PP-83, Narashige, Tokyo, Japan) to produce electrodes with a resistance of 2.0-3.1 MO. The currents for Piezol were amplified using an AxoPatch 200B amplifier (Molecular Devices, LLC), and data were sampled at a rate of 10 kHz with 1 kHz filtration and analyzed using pCLAMPIO software (Molecular Devices, LLC).

[0142] For whole-cell recordings transfected cells were plated onto poly-L-lysine (Sigma) coated coverslips prior to electrophysiological experiments. To generate mechanical stimuli, we used a fire-polished glass probe (using an MF-830 microforge, Narishige Co.) driven by an LS-MM3A micromanipulator (Kleindiek Nanotechnik, Germany). Serial indentations were applied using this fire polished glass probe (3-4 pm) at 500 pm / s to produce stimuli ranging from 2 pm to 14 pm in either 0.5 or 1 pm steps. The electrical activity of the cells was simultaneously monitored using whole-cell patch-clamp electrophysiology. Recording pipettes were made from filamented, thick-walled glass capillaries, using a programmable pipette puller (Sutter Instruments Co., CA) to a resistance range of 2-3 MQ.

[0143] Electrophysiological recordings were acquired at 20 kHz using a Digidata 1440A digitizer (Molecular Devices, LLC), an Axopatch 200B amplifier (Molecular Devices, LLC) filtering (4-pole Bessel filter) at 10 kHz using the patch software pCLAMPI O (Molecular Devices, LLC). Clampfit 10 / 11.1 (Molecular Devices, LLC) was used to analyze the data. The extracellular bath solution contained 140 mM NaCI, 4 mM KCI, 2 mM CaCI2, 1 mM MgCI2, 4 mM glucose, and 10 mM HEPES and was adjusted to a pH of 7.4 with NaOH. The intracellular solution contained 133 CsCI, 10 HEPES, 1 EGTA, 2 MgCI2, 4 MgATP (pH adjusted to 7.4 with CsOH). All data were acquired from at least three independent cell transfections. All patch-clamp recordings were performed at room temperature >48 h after transfection.

[0144] For cell-attached recordings to estimate unitary conductance the bath solution contained 90 mM K+ Aspartate, 50 mM KCI, 2 mM MgCI2 and 10 mM HEPES (pH 7.2) adjusted with KOH in order to zero the membrane potential. The pipette solution contained: 140 mM NaCI, 3 KCI, 1 mM CaCI2, 1 mM MgCI2 and 10 mM HEPES adjusted to pH7.2 using NaOH. Single-channel amplitude at a given potential was measured from all points histograms using manual application of pressure that gave the optimal conditions tomeasure single-channel amplitudes. Single-channel conductance was calculated from linear regression curves fit to single-channel l-V plots spanning 5 voltages from -40 to -80 mV. Consistent long openings of multiple Piezol channels were observed in the presence of MDFIC regardless of pressure magnitude but focused analysis on the smallest most prevalent amplitude.

[0145] The Boltzmann plots were obtained by fitting Piezol channel open probability Po~l / lmax versus negative pressure using the expression Po / (1-Po)=exp [a(P-P50)], where P is the negative pressure [mmHg], P50 is the pressure at which Po=0.5, and a [mmHg-1] is the slope of the plot In [Po / (1-Po)=[a(P-P1 / 2)] which reflects channel mechanosensitivity.Quantitative PCR

[0146] Total RNA was extracted using an RNA extraction kit (Qiagen RNA Extraction Kit), and cDNA was synthesized using Superscript III reverse transcriptase (Invitrogen).Quantitative PCR (qPCR) amplifications of various genes were performed using SYBR Green (Takara) and a CFX384 Touch Real-Time PCR Detection System (Bio-Rad); GAPDH / HPRT were used as normalization controls. After initial denaturation (30 s, 95 °C), amplification was performed using 40 cycles of 5 s at 95 °C and 30 s at 60 °C. All qPCR data represent the means ± SEM.

[0147] The sequences of the primers used for qPCR were the following: hMDFIC (F: GGAAATCCTTCGGATGGTGAACTC, R: CAAGCAAGCCAGGATACAGTGGACAC); hMDFI (F: CTGGAGGTAGTAACAGGATCCACTC, R: CGATGTTGCACAGCGTCAGGAACTC); hHPRT (F: TGAGGATTTGGAAAGGGTGT, R: TAATCCAGCAGGTCAGCAAA); mMDFI (F: GTAGCAAGATCCACTCACCCT, R: CTGGAGCCATTTGGCAGTAGT); mMDFIC (F: ACCCGAAGACTGCTGTGTC, R: GTCTGACGATTCACAACAGGC); mGAPDH (F: TATGTCGTGGAGTCTACTGG, R: AGTG ATGGCATGG ACTGTGG) .Isolation of mouse embryonic cardiac fibroblasts (mECFs) and mouse embryonic fibroblasts (MEFs)

[0148] All experimental procedures were approved by the University of South Australia Animal Ethics Committee and the Garvan Institute / St. Vincent’s Hospital Animal Experimentation Ethics Committee (No. 22 / 11 and 22 / 18). All experiments were conducted in accordance with the Australian code for the care and use of animals for scientific purposes. Mice were housed on a 12-h light / 12-h dark cycle and provided with normal chow diet and water ad libitum. Mdfic M131fs7WT mice have been previously described (A.B. Byrne et al., Sci Transl Med 14, 2022). Timed matings were established using adult Mdfic M131fs7WT mice and scored by the presence of vaginal plugs, with 9:00 am on the day of plug detection designed 0.5 days post-coitum. To isolate embryonic cardiac fibroblasts, hearts were dissected from E16.5 embryos and placed directly into 1 ml of 0.25% Trypsin- EDTA (Gibco, Life Technologies). Hearts were incubated at 37°C for 10 min and dissociated by pipetting up and down. Following dissociation, tissue suspensions were transferred to 10 ml tubes containing 6 ml of MEF culture medium (DMEM containing 10% FBS+1% Pen / Strep) and left to stand for 5 min to allow for large tissue fragments to settle. Cell suspensions were then transferred to T25 flasks and cultured at 37°C with 5% CO2. After 24 h, media and cell debris were removed and replaced with fresh MEF media, after which cells were routinely propagated.

[0149] For MEF isolation, the Piezo1 -null allele was generated by crossing CMV-Cre (Jackson Laboratory, stock no 006054) and Piezol -floxed mice (Jackson Laboratory, stock no. 029214). Timed matings were established using adult Piezol + / - mice, pregnant females were sacrificed at E9.5, embryos were dissected out and yolk sac was used for genotyping. To isolate MEFs, individual embryos were placed directly into 200pl of 0.25% TrypLE™ Express Enzyme (Gibco, Life Technologies) in a 12-well plate and incubated at 37°C for 5 min and dissociated by pipetting up and down. Following dissociation, 1 ml of MEF culture medium was added and cell suspensions were then transferred to gelatin-coated 12-well plates. MEFs were cultured in a humidified incubator at 37°C with 2% 02 and 5% CO2. Medium was replaced the next day and MEFs were routinely propagated. Piezol + / + and Piezol- / - MEF were seeded for patch-clamping 6 days after isolation. >25 cells from three embryos over two passages were included for analysis.Protein expression and purification

[0150] The mouse Piezol gene was cloned into the pEG Bacmam expression vector with a HRV-3C cleavable eGFP tag at the c-terminus. Mouse MDFIC was cloned into the pEG Bacmam vector with HRV-3C cleavable FLAG tag at the N-terminus. The plasmids were transformed into DHI OBac cells to generate bacmids. The bacmids were then transfected into Spodoptera Frugiperda 9 (Sf9) cells with Fugene HD Transfection Reagent (Promega) in ESF921 medium (Expression Systems) to produce recombinant baculovirus at 27 °C. Suspension adapted HEK293S GnTI- cells were cultured in SMM 293-TII Expression Medium (Sino Biological) in a Herocell C1 orbital shaker incubator (Radobio) set at 37 °C, 110 rpm, and 8% CO2. When the cell density reached 2.5 x 106 cells / ml, Piezol P2 virus and MDFIC P2 virus were added to the cells at a ratio of 1 :1 :25. After 16 h, 10 mM sodium butyrate was added to boost protein expression and the temperature was changed to 30 °C.After 48 h, cells were harvested at 3,000 g for 10 min in a JLA 8.1000 rotor (Beckman coulter), washed with 30 mM Tris-HCI, pH 7.9, 150 mM NaCI, and immediately used for protein purification.

[0151] The cell pellets were resuspended and lysed in buffer containing 30 mM Tris-HCI, pH 7.9, 300 mM NaCI, 1% C12E10 (Anatrace), 2.5 mM MgCI2, 0.5 mM CaCI2, 0.5 mM ZnCI2, 1 mM PMSF, 1 pg / ml pepstatin, 1 pg / ml aprotinin, 1 pg / ml leupeptin, 20 pg / ml trypsin inhibitor, 1 mM benzamidine, 2 pg / ml Dnasel, and 5 mM 2-Mercaptoethanol at 4 °C for 2 h. The lysate was centrifuged at 16000 rpm for 30 min in a JA 25.50 rotor (Beckman coulter) to remove cell debris. The supernatant was collected and incubated with Anti-FLAG affinity bead (Smart-Lifesciences) for 2 h at 4 °C. After extensive washes, the proteins were eluted with 30 mM Tris-HCI, pH 7.9, 150 mM NaCI, 0.05 % GDN and 0.2 mg / ml FLAG peptide (Sangon Biotech). The elution was incubated with GST-3C protease for 15 h to cleave the tags, concentrated with Ultra-15 100-kDa cut-off centrifugal filter (MilliporeSigma), and loaded onto a Superose 6 increase 10 / 300 GL column (Cytiva) in 30 mM Tris-HCI, pH 7.9, 150 mM NaCI, 0.05 % GDN. Peak fractions containing the Piezol - MDFIC complex were pooled, concentrated, and used immediately for cryo-EM sample preparation.

[0152] To prepare the Piezo1-MDFIC(C240A) complex, 0.6 mg flag tagged MDFIC(C240A) pEG Bacmam plasmids were co-transfected with 40 mL Piezol P2 virus into 1 L HEK293S GnTI- cells at a density of 2.5 x106 cells / ml using PEI (MAX MW40000, Polysciences). The protein expression and purification protocols are the same as documented for the WT complex, except that after flag peptide elution, Piezol -MDFIC(C240A) complex was concentrated and directly used for EM sample preparation without tag cleavage and gel filtration.

[0153] To assess the interaction between Piezol and MDFIC mutants, flag tagged MDFIC WT, 5C-A, and 5C-S pEG Bacmam plasmids were transiently transfected or co-transfected with Piezol -GFP pEG Bacmam plasmids into 30 ml HEK293S GnTI- cells at a density of 2.5 x106 cells / ml using PEI (MAX MW40000, Polysciences). After 16 h, 10 mM sodium butyrate was added to the cells and the temperature was changed from 37 °C to 30 °C. After 48 h, the cells were harvested by centrifugation at 3,000 g for 30 min at 4 °C and immediately used for pull-down assay. The collected cells were resuspended and lysed with 30 mM Tris-HCI, pH 7.9, 300 mM NaCI and 1% C12E10, supplemented with 1 mM PMSF, 1 pg / ml pepstatin, 1 pg / ml aprotinin, 1 pg / ml leupeptin, 20 ug / ml trypsin inhibitor, 1 mM benzamidine, 2 pg / ml Dnasel, 2.5 mM MgCI2, 0.5 mM CaCI2, 0.5 mM ZnCI2, and 5 mM beta-ME at 4 °C for 2 h. Cell debris were removed by centrifugation at 30,966 g for 30 min at4 °C. The supernatant was incubated with 50 pl Anti-FLAG beads for 2h at 4°C. The beads were washed with 20 CV buffer containing 30 mM Tris-HCI, pH 7.9, 150 mM NaCI, 0.05 % GDN. The proteins were eluted with five aliquots of 50 pl 30 mM Tris-HCI, pH 7.9, 150 mM NaCI, 0.05% GDN (Anatrace) and 500 pg / ml flag peptide. 12 pl sample from the second fraction were loaded to 12% SDS-Page gel without pre-boiling. The gel was first imaged under blue light in Gel Imaging System 2500B (Tanon) to check the Piezo1-GFP signal and then stained with Coomassie brilliant blue.Crvo-EM specimen preparation and data collection

[0154] The homogeneity of the samples was first examined by negative staining with 2% uranyl acetate on a Tecnai T12 Transmission Electron Microscope (Thermo Fisher Scientific). For cryo-EM, the protein concentration was measured with a spectrophotometer NP80 (Implen) and adjusted to 4.2 mg / ml. Aliquots of 3.5 pl were loaded onto glow- discharged (Harrick Plasma) 200 mesh holey carbon Au 2 / 1 grids (Quantifoil). After 5 s, grids were blotted for 1 .5 s with a blot force of -2 in the chamber of Vitrobot Mark IV (Thermo Fisher Scientific) set at 4 °C and 100% humidity, and then plunged into pre-cooled liquid ethane.

[0155] Grids were screened and imaged on a 300-kV Titan Krios G4 Electron Microscope Thermo Fisher Scientific), equipped with Biocontinuum K3 Direct Electron Detector with GIF filter (Gatan). The movie stacks were recorded at a nominal magnification of 81 ,000x with a pixel size of 0.5275 A / pixel in super resolution mode and a defocus range from -1 .2 ~ -2.4 pm. To accelerate data collection, movies were collected with beam image-shift inside a range of 8 pm using EPU software package. Exposure of 2.2 s were dose-fractionated into 40 frames with a dose rate of 25 electrons / pixel / s.Table 7. Cryo-EM data collection, refinement and validation statisticsImage processing

[0156] Image processing was mainly performed in CryoSPARC unless noted otherwise. Movie stacks were motion corrected and dose weighted with Patch Motion Correction algorithm. Contrast Transfer Function (CTF) parameters were determined with Patch CTF Estimation.

[0157] For the Piezol -MDFIC(WT) complex, 869,357 particles were picked from 5,402 micrographs by Template Picker using the 2D averages from a small subset of the data as templates, extracted into boxes of 400 x 400 pixels, and subjected to 2D classification. 197,261 particles in the classes showing clear Piezol features were selected for 3D classification using the ab initial model from the small subset as a reference. 102,644 particles in the class showed clear structural features and were selected and subjected to Non-uniform Refinement with C3 symmetry, resulting in a density map at an overall resolution of 3.75 A. After Local Motion Correction and Local CTF Refinement, the overall resolution was improved to 3.66 A. The cap region exhibited lower resolution and appeared to be more dynamic. To further improve the density in the cap and transmembrane regions, soft masks were generated in RELION and subjected to Local Refinement in CryoSPARC. This resulted in a density map of the cap region at a resolution of 3.86 A and a density map of the transmembrane region at a resolution of 3.56 A.

[0158] For the Piezo1 -MDFIC(C240A) complex, 472,000 particles were picked from 3660 micrographs by Template Picker using the 2D averages from a small subset of the data as templates, extracted into boxes of 400 x 400 pixels, and subjected to 2D classification. 116,897 particles in the classes showed clear Piezol features and were selected for 3D classification using the ab initial model from a small subset as reference. 57,916 particles in the class showing clear structural features were selected and subjected to Non-uniform Refinement with C3 symmetry, resulting in a density map at an overall resolution of 3.77 A. After Local Motion Correction, the overall resolution was improved to 3.68 A. To further improve the density in the central transmembrane regions, soft masks were generated in RELION and subjected to Local Refinement in CryoSPARC. This resulted in a density map of the central transmembrane region at a resolution of 3.59 A.

[0159] Local resolution was estimated with Local Resolution Estimation and the resolution filtered map was generated by Local Filtering tool. The maps were visualized and analysed in UCSF chimeraX.Model building and refinement

[0160] The curved Piezol structure in a liposome (PDB: 7WLT) (X. Yang et al., Nature 604, 377-383, 2022) was used as the starting model and fitted into the cryo-EM map. A difference map was calculated against Piezol, showing three symmetric and extra a-helices which were assigned as MDFIC density. To guide the model building in Coot, two Alphafold2 predicted a-helices in MDFIC were fitted separately into the density map from both directions and starting positions as initial assignments. After careful analysis, a tentative sequence (227-247) was assigned for MDFIC based on the sizes of side chain density. This sequence was then compared with all other unassigned segments in the sample. All the other segments contained more or less obviously unreasonable fittings. The assignment of residue 227-247 was further supported by the following: 1 ) The amphipathic helical nature of this assignment matches the orientation of this helix that sits at the membrane interface. 2) There are six elongated side-chain densities that are clearly longer than any side chain of the 20 amino acids. Five of the six were cysteines (Cys 233, 237, 240, 241 and 244) in this sequence assignment, which can be lipidated and insert in the membrane. The other one was assigned as Serine (Ser 230) which can also be lipidated or phosphorylated. This assignment well explained all the elongated densities in the map, while none of the other segments can, and again matches with the membrane anchoring orientation of this helix. 3) This helix is oriented towards the pore module, where the space is limited, consistent with the sequence being assigned to the distal C-terminus. Thus, the extra helical densities against Piezol were assigned as MDFIC residues 227-247 in themodel. This was further confirmed by the Piezo1-MDFIC(C240A) complex which lacked extra density in this residue but retained extra densities on the other noted residues. The Piezol and MDFIC models were further improved by interactive cycles of phenix. real_space_refine in Phenix and manual adjustment in Coot.Molecular dynamics simulations

[0161] To investigate atomistic level interactions between Piezol and the MDFIC C- terminus and the impact of lipidation on this, we carried out molecular dynamics simulations. Systems were prepared with CHARMM-GUI and contained the pore module of Piezol (residues 1956-2547) in complex with three MDFIC C-terminal peptides (residues 228-247). To understand the effect of lipidation, one MDFIC peptide was lipidated (palmitoylated at C233, C237, C240, C241 and farnesylated at C244) based on GPS-Lipid and PrePS webserver predictions. Another MDFIC peptide contained cysteine to serine mutations at these positions and one MDFIC peptide was left unmodified.

[0162] To examine whether MDFIC could also bind to Piezol in the flattened state, and the effect of lipidation on the dynamics of a flattened Piezol structure, the pore module of the flattened Piezol (PDB ID: 7wlu) was aligned to the Piezol -MDFIC structure. Two systems were generated where either three unmodified or three lipidated MDFIC peptides were placed in the same binding pockets in which they sat in the flattened state structure and relaxed the system using energy minimization.

[0163] Both Piezol -MDFIC complexes (curved and flattened) were embedded in a POPC bilayer, solvated, and ionised with 150 mM NaCL The CHARMM36m forcefield was used and simulations carried out using GROMACS 2022.4. The system was equilibrated for a total of 5.375 ns during which position restraints on the protein backbone, sidechains and lipids were gradually reduced from starting restraints of 4000 kJ / mol (backbone), 2000 kJ / mol (sidechains) and 1000 kJ / mol (lipids). Production simulations were performed in the NPT ensemble, maintained at a temperature of 310 K using the Nose-Hoover thermostat (55, 56) and 1 bar using the semi-isotropic Parrinello-Rahman barostat. Simulations of the curved Piezol -MDFIC complex were carried out for 500 ns, and the flattened complex for 300 ns, both in triplicate and using a 2 fs timestep.

[0164] Simulations were visualised and figures produced using Visual Molecular Dynamics (VMD). Analysis was performed with in-house python scripts using the MDAnalysis library. To assess protein movement throughout the simulation, the root mean square deviation (RMSD) of Piezol and each of the MDFIC peptides over the simulation was calculated after aligning to Piezol . The root mean square fluctuation (RMSF) values for each MDFIC residue was calculated and averaged across the last 400 ns of all replicates (the first 100 nswas discarded as equilibration) to investigate whether lipidation / mutation to serine leads to differences in peptide mobility. Differences in the mean RMSF values between peptides were assessed using a one-way ANOVA with Tukey’s post-hoc test, significance was ascribed to p<0.05. A 5-angstrom cut-off was used to identify interactions occurring between Piezol and the MDFIC monomer throughout the simulation. Differences in contact occupancies on Piezol between MDFIC monomers were identified using a one-way ANOVA with Tukey’s post-hoc test, significance was ascribed to p<0.05. To generate the cryo-EM map lipid overlay (Fig. 9C), clustering analysis was performed using gmx cluster with a cutoff value of 0.2 nm on a concatenated trajectory containing the last 400 ns of each replicate trajectory.Acyl-biotin exchange and mass tagging

[0165] Acyl-biotin exchange experiments were performed as described previously (W. Zheng etal., J Biol Chem 291 , 25678-25691 , 2016). Transfected HEK293T cells were lysed in 500 pl of CHAPS lysis buffer (1% w / v CHAPS, 0.6% w / v soy PC, 140 mM NaCI, 1 mM EDTA, 25 mM NaPIPES) supplemented with 2 mM 1 ,4-Dithiothreitol (DTT; Sigma), 40 mM freshly made N-ethylmaleimide (Thermo Fisher Scientific) and 1 x protease-inhibitor cocktail (Roche), and the lysates were centrifuged at 13,200 rpm for 20 min at 4°C. HA tagged MDFIC in the supernatant were immunoprecipitated with rabbit anti-HA antibody (Cell Signaling) and protein G magnetic beads (Thermo Fisher Scientific). After washing five times with binding buffer A (50 mM Tris-HCI pH 7.2, 1% Tween-20), each sample of beads was split into two with one incubated with 500 pl of binding buffer A, and the other with the same volume of binding buffer A containing 1 M hydroxylamine (Sigma) to cleave the thioester bond. The samples were rotated at room temperature for 1 h. After the beads were washed five times with binding buffer B (50 mM Tris-HCI pH 6.2, 1% Tween-20), the samples were incubated with 3 pM biotin-maleimide (Sigma) in binding buffer B for 1 h at 4°C, to label the unmasked free thiol groups of cysteine residues. The biotin-conjugated proteins were then eluted with 2x SDS loading buffer, subjected to SDS-PAGE, and blotted with streptavidin-IR800 antibody (Licor) or anti-HA antibody (Cell Signaling).

[0166] Mass tagging with Pegylated maleimide was carried out as previously reported with minor amendments (A. Percher etal., Proc Natl Acad Sci USA 113, 4302-4307, 2016). In brief, cell samples were incubated with a modified RIPA buffer [Tris buffer 10 mM, ethylenediaminetetraacetic acid (EDTA) 1 mM, NaCI 140 mM, in (% w / v): Sodium deoxycholate 0.1 , SDS 0.1 , Triton X-100 1 .0, pH 7.2] supplemented with 1 x EDTA-free protease inhibitor cocktail tablets (Sigma-Aldrich), 1 mM (phenylmethylsulfonyl fluoride) PMSF, 5 mM TCEP, and 40 mM N-ethylmaleimide (NEM) overnight at 4°C. Protein werethen precipitated by methanol-chloroform-H20 precipitation (4:1.5:3) with sequential addition of methanol (400 pL), chloroform (150 pL), and distilled H2O (300 pL) (all prechilled on ice). The reactions were then mixed by inversion and centrifuged (Centrifuge 5417R, Eppendorf) at 20,000 x g for 5 min at 4 °C. To pellet the precipitated proteins, the aqueous layer was removed, 1 mL of prechilled MeOH was added, the Eppendorf tubes were inverted several times and centrifuged at 20,000 x g for 3 min at 4 °C. The supernatant was then decanted, and the protein pellets were dried with an N2 stream. To completely remove the NEM, the protein pellets were resuspended with 4% SDS in Tris buffer (50 mM Tris-HCI pH 7.2) and re-precipitated three times. For hydroxylamine (HAM) cleavage and mPEG- maleimide alkylation, the protein pellet was resuspended in 60 pL Tris buffer containing 4% SDS, 4 mM EDTA and 30 pL resuspended protein was treated with 90 pL of 1 M neutralized HAM to obtain a final concentration of 0.75 M HAM. The other 30 pL resuspended protein was diluted in 90 pL Tris buffer containing 250 mM NaCI as control samples. Samples were incubated at room temperature for 1 h with nutation. The samples were then subjected to methanol-chloroform-H20 precipitation, as described above, and resuspended in 30 pL Tris buffer containing 4% SDS, 4 mM EDTA then treated with 90 pL binding buffer A containing 1 .33 mM 10 kDa mPEG-Mal (Sigma) for a final concentration of 0.5-1 mM mPEG-Mal. Samples were incubated for 1 -1 .5 h at room temperature with nutation before a final methanol-chloroform-H20 precipitation. Dried protein pellets were resuspended in 50 pL 1 x SDS loading buffer and then heated for 5 min at 95 °C. Typically, 25 pL of the sample was subjected to western blot analysis. All acyl biotin exchange and mass tagging were carried out with material from at least three independent transfections.Statistical analysis

[0167] Statistical analyses were performed, and significance was computed using GraphPad Prism 9. The specific test used is stated in the respective figure legend. All exact p-values <0.05 are shown, for values greater than 0.05 they are denoted by n.s (nonsignificant). Student’s t-test was used when comparison was made between two groups. One-way ANOVA with multiple comparison (Dunnett’s or Tukey’s) test was used when comparing three groups. Two-way ANOVA with multiple comparison test was performed when comparing two groups, at multiple time points. All data are displayed as means ± SEM or maximum to minimum box and whiskers plots.

Claims

Claims:1 . A lipidated polypeptide comprising the sequence:C-X5-X6-X7-C-X8-X9-C-C-Xio-Xii-C-Xi2-Xi3-Xi4, wherein X is any amino acid, wherein the cysteine residues are lipidated, and wherein the lipidated polypeptide potentiates a Piezo channel current and / or represses Piezo channel activity.

2. A lipidated polypeptide of claim 1 wherein the polypeptide comprises the sequence:C-X1-X2-X3-X4-C-X5-X6-X7-C-X8-X9-C-C-X10-X11-C-X12-X13-X14, wherein X is any amino acid.

3. The lipidated polypeptide of claim 1 or 2, wherein one or any combination of the following apply:Xi, X6and X9are E or a conservative substitution thereof;X2and X14 are S or a conservative substitution thereof;X3is S, A or a conservative substitution thereof;X4is D or a conservative substitution thereof;X5is L or a conservative substitution thereof;X7is I or a conservative substitution thereof;X8is M or a conservative substitution thereof;X is G or a conservative substitution thereof;Xu is I, L or a conservative substitution thereof; .X12 is F or a conservative substitution thereof; andX13 is P,S or a conservative substitution thereof.

4. The lipidated polypeptide of any one of claims 1 to 3, wherein 1 , 2, 3, 4, or 5 of the cysteine residues are palmitoylated.

5. The lipidated polypeptide of any one of claims 1 to 3, wherein 1 , 2, 3, 4, or 5 of the cysteine residues are palmitoylated, PEGylated, farnesylated, or a combination thereof.

6. A method of potentiating a Piezo channel current and / or repressing Piezo channel activity, wherein the Piezo channel comprises a plurality of Piezo proteins, the method comprising contacting a Piezo protein with one or more of: a polypeptide of any one of claims 1 to 5; a lipidated polypeptide of SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10, wherein the lipidated polypeptide of SEQ ID NO: 1 -6 are lipidated at cysteine residues near the C-terminus, and wherein the lipidated polypeptide of SEQ ID NO: 7-10 are lipidated at each cysteine residue; or a pharmaceutically acceptable salt thereof.

7. The method of claim 6, wherein the polypeptide has at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10.

8. The method of claim 6 or 7, wherein the polypeptide is SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4 and is lipidated at one or more of Cys233, Cys237, Cys240, Cys241 and Cys244.

9. The method of claim 8, wherein the polypeptide is palmitoylated at Cys233, Cys237, Cys240, Cys241 and farnesylated at Cys244.

10. The method of any one of claims 6 to 9, wherein the method further comprises administering the polypeptide to a subject.11 . The method of claim 10, wherein the subject has a Piezo related disease or condition.

12. The method of claim 11 , wherein the disease or condition is distal arthrogryposis, inflammatory conditions selected from Alzheimer's disease, myocardial fibrosis, atherosclerosis, pulmonary fibrosis, osteoporosis, osteoarthritis, lumbar degeneration, obesity, diabetes, chronic cystitis, pain, and blood clotting disorders.

13. The method of any one of claims 6 to 12, wherein the Piezo protein is Piezo 1 or Piezo 2.

14. The method of any one of claims 6 to 13, wherein the Piezo protein is Piezo 1 and the polypeptide contacts Piezo 1 between the anchor domain and the outer helix of Piezo 1 .

15. The method of claim 14, wherein the polypeptide contacts Piezo 1 at one or more of His2116, Phe2010, and Gln2123 from the a1 helix of the anchor domain;Val2187, Met2191 , and Leu2195 from the outer helix; andPhe2484 and Phe2485 at the base of the inner helix that lines the Piezol pore.

16. The method of any one of claims 6 to 15, wherein the polypeptide is alpha-helical or comprise a C-terminal alpha helix.

17. Use of a lipidated polypeptide comprising any one or more of: a. C-X5-X6-X7-C-X8-X9-C-C-X10-X11-C-X12-X13-X14, wherein X is any amino acid; b. C-Xi-X2-X3-X4-C-X5-X6-X7-C-X8-X9-C-C-Xio-Xii-C-Xi2-Xi3-Xi4, wherein X is any amino acid; c. SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10; or a pharmaceutically acceptable salt thereof, in the manufacture of a medicament for potentiating Piezo channel currents and / or repressing Piezo channel activity.

Images