Transgenic soybean event LP086-1 and detection method therefor

Abstract

Provided is a nucleic acid sequence, comprising one or more selected from sequences SEQ ID NOs: 1-7 or complementary sequences thereof. The nucleic acid sequence is derived from a transgenic soybean event LP086-1, and the preservation number of a representative sample of seeds of the transgenic soybean event LP086-1 is CCTCCNO: P202325. The transgenic soybean event LP086-1 has the following advantages: avoiding the economic loss caused by lepidopteran pests; being resistant to a common commercial herbicide, i.e., glyphosate; not reducing the soybean yield; enhancing the breeding efficiency; and being capable of using molecular markers to track transgenic insertion fragments in breeding populations and offsprings thereof. In addition, the provided detection method can quickly, accurately and stably identify the presence of plant materials derived from the transgenic soybean event LP086-1.

Description

Transgenic soybean event LP086-1 and its detection method

[0001] This application claims priority to the Chinese patent application filed with the China Patent Office on July 25, 2023, with application number CN202310912450.7 and application name “Genetically modified soybean event LP086-1 and its detection method”, the entire contents of which are incorporated by reference into this application. Technical Field

[0002] The present application belongs to the field of molecular biology technology and relates to a method for detecting transgenic plants and their products, and specifically to a transgenic soybean event LP086-1 that is resistant to insects and tolerates the application of glyphosate herbicides, and a nucleic acid sequence and method for detecting the transgenic soybean LP086-1. Background Art

[0003] Soybean [Glycine max (Linn.) Merr.] is an important food crop and oil crop in many parts of the world. Biotechnology has been applied to soybean to improve its agronomic traits and quality. Insect resistance is an important agronomic trait in soybean production, especially resistance to lepidopteran insects (such as soybean borer, fall armyworm, beet armyworm, cutworm, cotton bollworm, etc.). Soybean resistance to lepidopteran insects can be obtained by expressing lepidopteran insect resistance genes in soybean plants through genetic modification. Another important agronomic trait is herbicide tolerance, especially tolerance to glyphosate herbicide. Soybean tolerance to glyphosate herbicide can be obtained by expressing glyphosate herbicide tolerance genes (such as epsps) in soybean plants through genetic modification.

[0004] In addition to the functional genes (epsps and pat genes) themselves, the selection and sequencing of regulatory elements are crucial for achieving a successful transformation event, and their technical effectiveness can be difficult to predict. Furthermore, it is known that the expression of exogenous genes in plants is influenced by their insertion location within the soybean chromosome, potentially due to chromatin structure (e.g., heterochromatin) or the proximity of transcriptional regulatory elements (e.g., enhancers) to the integration site. Therefore, it is often necessary to screen a large number of events to identify those suitable for commercialization (i.e., those in which the introduced target gene is optimally expressed). For example, it has been observed in plants and other organisms that the expression level of the introduced gene can vary significantly between events; spatial or temporal expression patterns can also vary, such as the relative expression of the transgene varies between different plant tissues. This variability manifests itself in actual expression patterns that may be inconsistent with the expected expression pattern based on the transcriptional regulatory elements in the introduced gene construct. Therefore, it is often necessary to generate hundreds or even thousands of different events and screen them for a single event that exhibits the desired transgene expression level and pattern for commercialization. Such transformation events possess excellent resistance to lepidopteran pests (such as soybean borer, fall armyworm, beet armyworm, Spodoptera litura, cotton bollworm, etc.) and glyphosate herbicide without affecting soybean yield. Conventional breeding methods can be used to backcross the transgenic traits into other genetic backgrounds through hybridization. The offspring produced by this hybridization method retain the transgenic expression characteristics and trait performance of the original transformant. The application of this strategic model can ensure reliable gene expression in many varieties, with stable resistance to lepidopteran pests (such as soybean borer, fall armyworm, beet armyworm, Spodoptera litura, cotton bollworm, etc.) and glyphosate herbicide, protecting these varieties from damage by major lepidopteran pests, and providing broad-spectrum weed control capabilities while being well adapted to local growing conditions.

[0005] It will be useful to be able to detect the existence of specific events to determine whether the offspring of sexual hybridization comprises the target gene. In addition, the method for detecting specific events will also help to comply with relevant laws and regulations, and for example the food derived from recombinant crops needs to obtain formal approval and be marked before being put on the market. It is all possible to detect the existence of transgenic by any well-known polynucleotide detection method, such as polymerase chain reaction (PCR) or DNA hybridization utilizing polynucleotide probes. These detection methods usually focus on conventional genetic elements, such as promoters, terminators, marker genes, etc. Therefore, unless the sequence of the chromosomal DNA (flanking DNA) adjacent to the transgenic DNA inserted is known, otherwise this method can not be used to distinguish different events, particularly those events produced with the same DNA construct. Therefore, at present, a pair of primers that have crossed over the junction site of the T-DNA and flanking DNA inserted are often utilized to identify transgenic specific events by PCR, specifically a first primer that is contained in the flanking sequence and a second primer that comprises the inserted sequence.

[0006] Application Contents

[0007] The purpose of this application is to provide a transgenic soybean event LP086-1 and a nucleic acid sequence and detection method for detecting the soybean plant LP086-1 event, which can accurately and quickly identify whether a biological sample contains a specific transgenic soybean event LP086-1 DNA molecule.

[0008] To achieve the above objectives, the present application provides a nucleic acid sequence comprising one or more sequences selected from SEQ ID NO: 1-7 (i.e., SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7) or their complementary sequences. In some embodiments, the nucleic acid sequence is derived from a plant, seed, or cell comprising soybean event LP086-1. Representative samples of seeds comprising the event were deposited with the China Center for Type Culture Collection (CCTCC, address: Wuhan University, 299 Bayi Road, Wuchang District, Wuhan, Hubei Province, 430072, Wuhan University Collection Center, taxonomic name: soybean (Glycine max L.). In some embodiments, the nucleic acid sequence is an amplicon that diagnoses the presence of soybean event LP086-1.

[0009] In some embodiments of the present application, the present application provides a nucleic acid sequence comprising at least 11 consecutive nucleotides of SEQ ID NO:3 or its complementary sequence, and / or at least 11 consecutive nucleotides of SEQ ID NO:4 or its complementary sequence. In some embodiments, the nucleic acid sequence comprises SEQ ID NO:1 or its complementary sequence, and / or SEQ ID NO:2 or its complementary sequence. In some embodiments, the nucleic acid sequence comprises SEQ ID NO:3 or its complementary sequence, and / or SEQ ID NO:4 or its complementary sequence. In some embodiments, the nucleic acid sequence comprises SEQ ID NO:5 or its complementary sequence.

[0010] SEQ ID NO: 1 or its complementary sequence is a 22-nucleotide sequence located near the insertion junction at the 5' end of the inserted sequence in transgenic soybean event LP086-1. SEQ ID NO: 1 or its complementary sequence spans the flanking genomic DNA sequence of the soybean insertion site and the DNA sequence at the 5' end of the inserted sequence. The presence of transgenic soybean event LP086-1 can be identified by including SEQ ID NO: 1 or its complementary sequence. SEQ ID NO: 2 or its complementary sequence is a 22-nucleotide sequence located near the insertion junction at the 3' end of the inserted sequence in transgenic soybean event LP086-1. SEQ ID NO: 2 or its complementary sequence spans the DNA sequence at the 3' end of the inserted sequence and the flanking genomic DNA sequence of the soybean insertion site. The presence of transgenic soybean event LP086-1 can be identified by including SEQ ID NO: 2 or its complementary sequence.

[0011] The nucleic acid sequence provided herein can be at least 11 or more contiguous polynucleotides of any portion of the transgenic insert sequence of SEQ ID NO: 3 or its complementary sequence (first nucleic acid sequence), or at least 11 or more contiguous polynucleotides of any portion of the 5' flanking soybean genomic DNA region of SEQ ID NO: 3 or its complementary sequence (second nucleic acid sequence). The nucleic acid sequence can further be homologous to or complementary to a portion of SEQ ID NO: 3 that includes the entire SEQ ID NO: 1. When the first nucleic acid sequence and the second nucleic acid sequence are used together, these nucleic acid sequences comprise a DNA primer pair in a DNA amplification method for producing an amplification product. When the amplification product produced in the DNA amplification method using the DNA primer pair is an amplification product comprising SEQ ID NO: 1, the presence of transgenic soybean event LP086-1 or its progeny can be diagnosed. It is well known to those skilled in the art that the first and second nucleic acid sequences do not necessarily consist solely of DNA, but may also comprise RNA, a mixture of DNA and RNA, or a combination of DNA, RNA, or other nucleotides or their analogs that do not serve as templates for one or more polymerases. In addition, the probes or primers herein should be at least about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 consecutive nucleotides in length, which can be selected from the nucleotides set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5. When selected from the nucleotides set forth in SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, the probes and primers can be about 17 to 50 or more consecutive nucleotides in length. The SEQ ID NO: 3 or its complementary sequence is a 1159-nucleotide sequence located near the insertion junction at the 5' end of the insertion sequence in the transgenic soybean event LP086-1. The SEQ ID NO: 3 or its complementary sequence consists of 641 nucleotides of soybean flanking genomic DNA sequence (nucleotides 1-641 of SEQ ID NO: 3), 334 nucleotides of pLP086 construct DNA sequence (nucleotides 642-975 of SEQ ID NO: 3), and 184 nucleotides of the 3' end DNA sequence of the pAtUbil0 promoter (nucleotides 976-1159 of SEQ ID NO: 3). The presence of SEQ ID NO: 3 or its complementary sequence can be used to identify the presence of transgenic soybean event LP086-1.

[0012] The nucleic acid sequence can be at least 11 or more contiguous polynucleotides of any portion of the transgenic insert sequence of SEQ ID NO:4 or its complementary sequence (third nucleic acid sequence), or at least 11 or more contiguous nucleotides of any portion of the 3' flanking soybean genomic DNA region of SEQ ID NO:4 or its complementary sequence (fourth nucleic acid sequence). The nucleic acid sequence can further be homologous to or complementary to a portion of SEQ ID NO:4 that includes the entire SEQ ID NO:2. When the third nucleic acid sequence and the fourth nucleic acid sequence are used together, these nucleic acid sequences include a DNA primer pair in a DNA amplification method that produces an amplification product. When the amplification product produced in the DNA amplification method using the DNA primer pair is an amplification product that includes SEQ ID NO:2, the presence of transgenic soybean event LP086-1 or its progeny can be diagnosed. The SEQ ID NO: 4 or its complementary sequence is a 1002-nucleotide sequence located near the insertion junction at the 3' end of the insertion sequence in the transgenic soybean event LP086-1. The SEQ ID NO: 4 or its complementary sequence consists of a 314-nucleotide tPsE9 terminator partial sequence (nucleotides 1-314 of SEQ ID NO: 4), a 172-nucleotide pLP086 construct DNA sequence (nucleotides 315-486 of SEQ ID NO: 4), and a 516-nucleotide soybean integration site flanking genomic DNA sequence (nucleotides 487-1002 of SEQ ID NO: 4). The presence of SEQ ID NO: 4 or its complementary sequence can be used to identify the presence of the transgenic soybean event LP086-1.

[0013] SEQ ID NO: 5 or its complementary sequence is a 17,285-nucleotide sequence characterizing transgenic soybean event LP086-1, and its specific genome and genetic elements are shown in Table 1. The presence of SEQ ID NO: 5 or its complementary sequence can be used to identify the presence of transgenic soybean event LP086-1.

[0014] Table 1. Genome and genetic elements contained in SEQ ID NO: 5

[0015] The nucleic acid sequence or its complementary sequence can be used in a DNA amplification method to produce an amplification product, and the presence of the transgenic soybean event LP086-1 or its progeny in a biological sample can be diagnosed by detecting the amplification product; the nucleic acid sequence or its complementary sequence can be used in a nucleotide detection method to detect the presence of the transgenic soybean event LP086-1 or its progeny in a biological sample.

[0016] The present application provides a DNA primer pair comprising a first primer and a second primer, wherein the first primer and the second primer each comprise a fragment of SEQ ID NO: 5 or a complementary sequence thereof, and when used in an amplification reaction together with DNA containing soybean event LP086-1, an amplification product of soybean event LP086-1 is generated in the detection sample.

[0017] In some embodiments, the first primer is selected from SEQ ID NO: 1 or its complementary sequence, SEQ ID NO: 8 or SEQ ID NO: 10; the second primer is selected from SEQ ID NO: 2 or its complementary sequence, SEQ ID NO: 11 or SEQ ID NO: 14.

[0018] In some embodiments of the present application, the amplification product includes at least 11 consecutive nucleotides in SEQ ID NO: 3 or its complementary sequence, or at least 11 consecutive nucleotides in SEQ ID NO: 4 or its complementary sequence.

[0019] Furthermore, the amplification product includes consecutive nucleotides 1-11 or 12-22 in SEQ ID NO: 1 or its complementary sequence, or consecutive nucleotides 1-11 or 12-22 in SEQ ID NO: 2 or its complementary sequence.

[0020] Furthermore, the amplification product includes SEQ ID NO: 1 or its complementary sequence, SEQ ID NO: 2 or its complementary sequence, SEQ ID NO: 6 or its complementary sequence, or SEQ ID NO: 7 or its complementary sequence.

[0021] In the above technical solution, the primers include at least one of the nucleic acid sequences. Specifically, the primers include a first primer and a second primer, wherein the first primer is selected from SEQ ID NO: 1 or its complementary sequence, SEQ ID NO: 8 or SEQ ID NO: 12, and the second primer is selected from SEQ ID NO: 9 or SEQ ID NO: 13; or the first primer is selected from SEQ ID NO: 2 or its complementary sequence, SEQ ID NO: 10 or SEQ ID NO: 15, and the second primer is selected from SEQ ID NO: 11 or SEQ ID NO: 14.

[0022] The present application also provides a DNA probe comprising a fragment of SEQ ID NO: 5 or its complementary sequence, which hybridizes with a DNA molecule comprising a nucleic acid sequence selected from SEQ ID NO: 1-7 or its complementary sequence under stringent hybridization conditions and does not hybridize with a DNA molecule not containing a nucleic acid sequence selected from SEQ ID NO: 1-7 or its complementary sequence under stringent hybridization conditions.

[0023] In some embodiments, the DNA probe comprises a sequence selected from SEQ ID NO: 1 or its complement, SEQ ID NO: 2 or its complement, SEQ ID NO: 6 or its complement, and SEQ ID NO: 7 or its complement.

[0024] In some embodiments, the DNA probe is labeled with a fluorescent group.

[0025] In some embodiments, the probe includes at least 11 consecutive nucleotides in SEQ ID NO:3 or its complementary sequence, or at least 11 consecutive nucleotides in SEQ ID NO:4 or its complementary sequence; further, the probe includes consecutive nucleotides 1-11 or 12-22 in SEQ ID NO:1 or its complementary sequence, or consecutive nucleotides 1-11 or 12-22 in SEQ ID NO:2 or its complementary sequence.

[0026] The present application also provides a marker nucleic acid molecule, which comprises a fragment of SEQ ID NO: 5 or its complementary sequence, and the marker nucleic acid molecule hybridizes with a DNA molecule comprising a nucleic acid sequence selected from SEQ ID NO: 1-7 or its complementary sequence under stringent hybridization conditions and does not hybridize with a DNA molecule not containing a nucleic acid sequence selected from SEQ ID NO: 1-7 or its complementary sequence under stringent hybridization conditions.

[0027] In some embodiments, the marker nucleic acid molecule comprises a sequence selected from SEQ ID NO: 1 or its complement, SEQ ID NO: 2 or its complement, SEQ ID NO: 6 or its complement, and SEQ ID NO: 7 or its complement.

[0028] In one embodiment, the marker nucleic acid molecule comprises at least 11 consecutive nucleotides of SEQ ID NO: 3 or its complementary sequence, or at least 11 consecutive nucleotides of SEQ ID NO: 4 or its complementary sequence;

[0029] In some embodiments, the marker nucleic acid molecule includes consecutive nucleotides 1-11 or 12-22 in SEQ ID NO: 1 or its complementary sequence, or consecutive nucleotides 1-11 or 12-22 in SEQ ID NO: 2 or its complementary sequence.

[0030] Furthermore, the present application provides a method for detecting the presence of DNA containing transgenic soybean event LP086-1 in a sample, comprising: (1) contacting the sample to be detected with the DNA primer pair in a nucleic acid amplification reaction; (2) performing a nucleic acid amplification reaction; (3) detecting the presence of an amplified product; the amplified product comprises a nucleic acid sequence selected from the sequence SEQ ID NO: 1-7 or its complementary sequence, indicating the presence of DNA containing transgenic soybean event LP086-1 in the detected sample.

[0031] The present application also provides a method for detecting the presence of DNA containing transgenic soybean event LP086-1 in a sample, comprising: (1) contacting the sample to be detected with the DNA probe and / or the marker nucleic acid molecule; (2) hybridizing the sample to be detected with the probe and / or the marker nucleic acid molecule under stringent hybridization conditions; and (3) detecting the hybridization of the sample to be detected with the probe and / or the marker nucleic acid molecule.

[0032] The stringent conditions may be hybridization in a 6×SSC (sodium citrate) and 0.5% SDS (sodium dodecyl sulfate) solution at 65° C., followed by washing the membrane once each with 2×SSC, 0.1% SDS and 1×SSC, 0.1% SDS.

[0033] The hybridization between the sample to be tested and the marker nucleic acid molecule is detected, and then marker-assisted breeding analysis is performed to determine whether insect resistance and / or herbicide tolerance is genetically linked to the marker nucleic acid molecule.

[0034] The present application also provides a DNA detection kit comprising: a DNA primer pair that produces an amplicon diagnostic for transgenic soybean event LP086-1, and a probe specific for SEQ ID NOs: 1-7 or a marker nucleic acid molecule specific for SEQ ID NOs: 1-7. Specifically, the detection kit comprises the probe, primer pair, or marker nucleic acid molecule described herein.

[0035] In some embodiments, the present application provides a DNA detection kit comprising at least one DNA molecule, wherein the DNA molecule comprises at least 11 consecutive nucleotides in a homologous sequence of SEQ ID NO: 3 or its complementary sequence, or at least 11 consecutive nucleotides in a homologous sequence of SEQ ID NO: 4 or its complementary sequence, which can be used as a DNA primer or probe specific for the transgenic soybean event LP086-1 or its progeny.

[0036] Furthermore, the DNA molecule includes the 1st to 11th or 12th to 22nd consecutive nucleotides in SEQ ID NO: 1 or its complementary sequence, or the 1st to 11th or 12th to 22nd consecutive nucleotides in SEQ ID NO: 2 or its complementary sequence.

[0037] Furthermore, the DNA molecule comprises a homologous sequence of SEQ ID NO: 1 or its complementary sequence, a homologous sequence of SEQ ID NO: 2 or its complementary sequence, a homologous sequence of SEQ ID NO: 6 or its complementary sequence, or a homologous sequence of SEQ ID NO: 7 or its complementary sequence. To achieve the above object, the present application also provides a plant cell comprising a nucleic acid sequence encoding insect-resistant Cry1Ab, Cry2Ab, and Cry1Fa proteins, a nucleic acid sequence encoding a glyphosate herbicide-tolerant EPSPS protein, and a nucleic acid sequence of a specific region, wherein the nucleic acid sequence of the specific region comprises a sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, or SEQ ID NO: 7.

[0038] The sequences provided in this application include the sequences listed in Table 2 below:

[0039] Table 2. Related sequences of this application

[0040] The present application also provides a method for protecting soybean plants from insect attack, comprising providing at least one transgenic soybean plant cell in the diet of a target insect, wherein the transgenic soybean plant genome sequentially comprises the nucleic acid sequences of SEQ ID NO:1, SEQ ID NO:5 positions 653-16758, and SEQ ID NO:2; or the transgenic soybean plant genome comprises the sequence shown in SEQ ID NO:5; and the target insect that ingests the transgenic soybean plant cell is inhibited from further ingesting the soybean plant.

[0041] The present application also provides a method for protecting soybean plants from damage caused by herbicides, comprising planting at least one transgenic soybean plant whose genome comprises, in order, the nucleic acid sequences of SEQ ID NO:1, positions 653-16758 of SEQ ID NO:5, and SEQ ID NO:2; or the transgenic soybean plant whose genome comprises the sequence of SEQ ID NO:5. In some embodiments, the method comprises applying an effective amount of glyphosate herbicide to a field in which the at least one transgenic soybean plant is planted, wherein the transgenic soybean plant is transgenic soybean event LP086-1.

[0042] The present application also provides a method for controlling weeds in a field where soybean plants are planted, comprising applying an effective dose of a glyphosate herbicide to a field where at least one transgenic soybean plant is planted, wherein the genome of the transgenic soybean plant sequentially comprises the nucleic acid sequences of SEQ ID NO: 1, positions 653-16758 of SEQ ID NO: 5, and SEQ ID NO: 2; or the genome of the transgenic soybean plant comprises the sequence shown in SEQ ID NO: 5.

[0043] The present application also provides a method for cultivating soybean plants that are resistant to insects, comprising: planting at least one soybean seed, wherein the genome of the soybean seed sequentially comprises the nucleic acid sequences of SEQ ID NO:1, SEQ ID NO:5 positions 653-16758, and SEQ ID NO:2; or the genome of the soybean seed comprises the sequence shown in SEQ ID NO:5; allowing the soybean seed to grow into a soybean plant; invading the soybean plant with target insects, and harvesting the plant having reduced plant damage compared to other plants that are not the soybean seeds.

[0044] In some embodiments, the present application provides a method for cultivating soybean plants that are resistant to insects and tolerate glyphosate herbicides, comprising: planting at least one soybean seed, wherein the genome of the soybean seed comprises SEQ ID NO:1, the nucleic acid sequences at positions 653-16758 of SEQ ID NO:5, and SEQ ID NO:2 in sequence; or the genome of the soybean seed comprises the sequence shown in SEQ ID NO:5; allowing the soybean seed to grow into a soybean plant; infesting the soybean plant with target insects, and spraying the soybean plant with an effective dose of glyphosate herbicide, and harvesting the plant with reduced plant damage compared to other plants that are not the soybean seeds, wherein the plant with reduced plant damage is also resistant to insect feeding damage.

[0045] In some embodiments, the present application also provides a method for producing an insect-resistant soybean plant, comprising introducing a transgenic soybean event LP086-1 into the genome of the soybean plant, and selecting soybean plants that exhibit reduced plant damage to insect feeding. In some embodiments, the method comprises: sexually crossing a first parent soybean plant of the insect-resistant transgenic soybean event LP086-1 with a second parent soybean plant that lacks insect resistance, thereby producing a plurality of progeny plants; infesting the progeny plants with a target insect; and selecting the progeny plants that exhibit reduced plant damage compared to other plants that do not have the transgenic soybean event LP086-1.

[0046] In some embodiments, the present application also provides a method for producing soybean plants tolerant to glyphosate herbicides, comprising introducing transgenic soybean event LP086-1 into the genome of the soybean plants and selecting glyphosate-tolerant soybean plants. In some embodiments, the method comprises: sexually crossing a first parent soybean plant of transgenic soybean event LP086-1 tolerant to glyphosate herbicides with a second parent soybean plant lacking glyphosate tolerance, thereby producing a plurality of progeny plants; treating the progeny plants with glyphosate herbicide; and selecting the progeny plants that are glyphosate-tolerant.

[0047] In some embodiments, the present application also provides a method for producing a soybean plant that is resistant to insects and tolerates application of a glyphosate herbicide, comprising: introducing transgenic soybean event LP086-1 into the genome of the soybean plant, and selecting soybean plants that are glyphosate-tolerant and insect-resistant. In some embodiments, the method comprises sexually crossing a first parent soybean plant of transgenic soybean event LP086-1 that is glyphosate-tolerant and insect-resistant with a second parent soybean plant that lacks glyphosate tolerance and / or insect resistance, thereby producing a plurality of progeny plants; treating the progeny plants with glyphosate; and selecting the progeny plants that are glyphosate-tolerant, wherein the glyphosate-tolerant progeny plants are also resistant to insect feeding damage.

[0048] This application also provides a composition derived from transgenic soybean event LP086-1, comprising soybean meal, soybean oil, soy protein, soy products, dregs, and the like. In some embodiments, the composition may be soybean meal, soybean oil, soy protein, soy products, dregs, feed, or an industrial product or commodity. If sufficient expression levels are detected in the composition, the composition is expected to contain a nucleic acid sequence that is diagnostic for the presence of transgenic soybean event LP086-1 material in the composition. Specifically, the composition includes, but is not limited to, soybean meal, soybean oil, soy protein, soy products, dregs, and any other food intended for animal consumption as a food source, or as a component of soybean oil or stearic acid for food industry applications.

[0049] The probe or primer pair-based detection method and / or kit of the present application can be used to detect the transgenic soybean event LP086-1 nucleic acid sequence such as shown in SEQ ID NO: 1 or SEQ ID NO: 2 in a biological sample, wherein the probe sequence or primer sequence is selected from the sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5 to diagnose the presence of transgenic soybean event LP086-1.

[0050] In summary, the transgenic soybean event LP086-1 of this application possesses dual insect resistance and herbicide tolerance, offering the following advantages: 1) protection from economic losses caused by Lepidoptera pests (such as cotton bollworm, fall armyworm, soybean borer, leaf moth, and beet armyworm, major pests in soybean-growing areas); 2) the ability to apply glyphosate-containing agricultural herbicides to soybean crops for broad-spectrum weed control; and 3) no reduction in soybean yield. Specifically, event LP086-1 of this application exhibits high levels of resistance to target pests, achieving up to 100% pest mortality and protecting plants from damage to a minimum of 0%. It also exhibits high tolerance to glyphosate herbicides, safely tolerating four times the amount of glyphosate, protecting plants from damage to a minimum of 0%. Plants containing this event exhibit excellent agronomic traits, with yield percentages reaching as high as 106%. Furthermore, the genes encoding insect resistance and glyphosate tolerance are linked to the same DNA segment and present at a single locus in the genome of transgenic soybean event LP086-1. This improves breeding efficiency and enables the use of molecular markers to track transgenic inserts in breeding populations and their progeny. Furthermore, the primer or probe sequences provided in the detection method of this application can produce amplification products identified as transgenic soybean event LP086-1 or its progeny, enabling rapid, accurate, and stable identification of the presence of plant material derived from transgenic soybean event LP086-1.

[0051] the term

[0052] The following definitions and methods can better define the present application and guide those skilled in the art to implement the present application. Unless otherwise specified, the terms are understood according to conventional usage by those skilled in the art.

[0053] The soybean (Glycine max) is included, and includes all plant varieties that can be crossed with soybean, including wild soybean species.

[0054] The term “comprising” means “including but not limited to.” The term “processed product” refers to a product obtained by processing raw materials such as plants and seeds, such as a composition.

[0055] The term "plant" includes whole plants, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, and intact plant cells in plants or plant parts, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, etc. It should be understood that the parts of transgenic plants within the scope of this application include, but are not limited to, plant cells, protoplasts, tissues, calli, embryos, as well as flowers, stems, fruits, leaves and roots, which are derived from transgenic plants or their progeny that have been previously transformed with the DNA molecules of the present application and are therefore at least partially composed of transgenic cells.

[0056] The term "gene" refers to a nucleic acid fragment that expresses a specific protein, including regulatory sequences preceding the coding sequence (5' non-coding sequences) and following the coding sequence (3' non-coding sequences). A "native gene" refers to a gene found in nature that has its own regulatory sequences. A "chimeric gene" refers to any gene that is not a natural gene and contains regulatory and coding sequences that are not found in nature. An "endogenous gene" refers to a natural gene that is located in its natural location in the genome of an organism. An "exogenous gene" is a foreign gene that is now present in the genome of an organism and did not originally exist, and also refers to a gene that is introduced into a recipient cell through a transgenic step. Exogenous genes can include natural genes inserted into non-natural organisms or chimeric genes. A "transgene" is a gene that has been introduced into the genome through a transformation procedure. The site in the plant genome where the recombinant DNA has been inserted can be called an "insertion site" or "target site."

[0057] " flanking DNA " can comprise the genome that is naturally present in the organism of for example plant or the foreign source (heterologous) DNA that is introduced by transformation process, for example the fragment relevant to transformation event.Therefore, flanking DNA can comprise the combination of natural and foreign DNA.In the present application, " flanking region " or " flanking sequence " or " genome border zone " or " genome border sequence " refer to at least 3,5,10,11,15,20,50,100,200,300,400,1000,1500,2000,2500 or 5000 base pairs or longer sequence, and it is positioned at the direct upstream or downstream of initial external source insertion DNA molecule and is adjacent to initial external source insertion DNA molecule.When this flanking region was positioned at downstream, it also can be called " left boundary flank " or " 3 ' flank " or " 3 ' genome border zone " or " genome 3 ' border sequence " etc. When the flanking region is located upstream, it may also be referred to as the "right border flank" or the "5' flank" or the "5' genomic border region" or the "genomic 5' border sequence" or the like.

[0058] Transformation procedures that cause random integration of exogenous DNA will result in transformants containing different flanking regions, which are specifically contained in each transformant. When recombinant DNA is introduced into plants by traditional hybridization, its flanking regions are generally unchanged. Transformants will also contain unique junctions between segments of heterologous insert DNA and genomic DNA, or between two segments of genomic DNA, or between two segments of heterologous DNA. "Junction" is the point where two specific DNA fragments connect. For example, a junction is present at the position where the insert DNA connects to the flanking DNA. Junctions are also present in transformed organisms where two DNA fragments are linked together in a manner modified from that found in natural organisms. "Junction DNA" refers to the DNA that comprises a junction.

[0059] The present application provides a transgenic soybean event called LP086-1 and its progeny, wherein the transgenic soybean event LP086-1 is a soybean plant LP086-1, which includes plants and seeds of the transgenic soybean event LP086-1 and plant cells or regenerable parts thereof, and the plant parts of the transgenic soybean event LP086-1 include but are not limited to cells, pollen, ovules, flowers, buds, roots, stems, inflorescences, leaves and products from the soybean plant LP086-1, such as soybean meal, soybean flour, soybean oil, soybean pulp, soybean silk, soybean starch and biomass remaining in the soybean crop field.

[0060] The transgenic soybean event LP086-1 of the present application comprises a DNA construct that, when expressed in plant cells, confers resistance to insects and tolerance to glyphosate herbicide.

[0061] In some embodiments of the present application, the DNA construct comprises four tandem expression cassettes, the first expression cassette comprising a suitable promoter and a suitable polyadenylation signal sequence for expression in plants, the promoter being operably linked to the nucleic acid sequence of the insect-resistant Cry1Fa protein (Cry1Fa) of Bacillus thuringiensis, and the Cry1Fa protein having resistance to lepidopteran insects; the second expression cassette comprising a suitable promoter and a suitable polyadenylation signal sequence for expression in plants, the promoter being operably linked to the nucleic acid sequence of the insect-resistant Cry2Aa protein (Cry2Aa) of Bacillus thuringiensis, and the Cry2Aa having resistance to lepidopteran insects; the third expression cassette comprising a suitable promoter and a suitable polyadenylation signal sequence for expression in plants, the promoter being operably linked to the nucleic acid sequence of the Cry1Ab protein, and the nucleic acid sequence of the Cry1Ab protein mainly having resistance to lepidopteran insects. The fourth expression cassette comprises a suitable promoter for expression in plants and a suitable polyadenylation signal sequence, wherein the promoter is operably linked to a gene encoding 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), the nucleic acid sequence of which confers tolerance to glyphosate herbicide. Further, the promoter can be a suitable promoter isolated from a plant, including a constitutive, inducible and / or tissue-specific promoter, and the suitable promoter includes but is not limited to, cauliflower mosaic virus (CaMV) 35S promoter, figwort mosaic virus (FMV) 35S promoter, ubiquitin protein (Ubiquitin) promoter, actin (Actin) promoter, Agrobacterium tumefaciens nopaline synthase (NOS) promoter, octopine synthase (OCS) promoter, Cestrum yellow leaf curl virus promoter, potato tuber storage protein (Patatin) promoter, ribulose-1,5-bisphosphate carboxylase / oxygenase (RuBisCO) promoter, glutathione S-transferase (GST) promoter, E9 promoter, GOS promoter, alcA / alcR promoter, Agrobacterium rhizogenes promoter. rhizogenes) RolD promoter and Arabidopsis thaliana (Arabidopsis thaliana) Suc2 promoter.The polyadenylation signal sequence can be a suitable polyadenylation signal sequence that functions in plants, and the suitable polyadenylation signal sequence includes, but is not limited to, the polyadenylation signal sequence derived from the nopaline synthase (NOS) gene of Agrobacterium tumefaciens, the polyadenylation signal sequence derived from the 35S terminator of cauliflower mosaic virus (CaMV), the polyadenylation signal sequence derived from the proteinase inhibitor II (PIN II) gene, and the polyadenylation signal sequence derived from the α-tubulin (α-tubulin) gene.

[0062] In addition, the expression cassette may also include other genetic elements, including but not limited to enhancers and signal peptide / transit peptide nucleic acid coding sequences. The enhancers may enhance the expression level of the gene, including but not limited to tobacco etch virus (TEV) translation activator, CaMV35S enhancer, and FMV35S enhancer. The signal peptide / transit peptide may guide the transport of the Cry1Ab protein and / or EPSPS protein to a specific organelle or compartment outside or within the cell, for example, by targeting the chloroplast using a chloroplast transit peptide sequence, or by targeting the endoplasmic reticulum using a 'KDEL' retention sequence.

[0063] The Cry1Ab, Cry2Ab and Cry1Fa genes can be isolated from Bacillus thuringiensis (Bt), and the nucleic acid sequences of the Cry1Ab, Cry2Ab and Cry1Fa genes can be changed by optimizing codons or otherwise modifying them to increase the stability and availability of transcripts in transformed cells.

[0064] In some embodiments of the present application, the soybean cell, seed or plant comprising the transgenic soybean event LP086-1 comprises SEQ ID NO: 1, the nucleic acid sequence at positions 653-16758 of SEQ ID NO: 5 and SEQ ID NO: 2 in sequence in its genome, or comprises SEQ ID NO: 5.

[0065] The "Lepidoptera", scientifically known as Lepidoptera, includes two types of insects: moths and butterflies. It is the order with the most agricultural and forestry pests, such as the cotton bollworm, the fall armyworm, the armyworm, the beet armyworm and the soybean borer.

[0066] The 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) gene can be isolated from Agrobacterium tumefaciens sp. CP4 strain, and the polynucleotide encoding the EPSPS gene can be modified by optimizing codons or otherwise changing the polynucleotide encoding the EPSPS gene to increase the stability and availability of the transcript in the transformed cell. The 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) gene can also be used as a selective marker gene.

[0067] The term "glyphosate" refers to N-phosphonomethylglycine and its salts, and treatment with a "glyphosate herbicide" refers to treatment with any herbicide formulation containing glyphosate. The selection of a specific glyphosate formulation rate to achieve a biologically effective dose is within the skill of an ordinary agronomist. Treatment of a field containing plant material derived from transgenic soybean event LP086-1 with any glyphosate-containing herbicide formulation will control weed growth in the field without affecting the growth or yield of the plant material derived from transgenic soybean event LP086-1.

[0068] The DNA construct is introduced into the plant using a transformation method including, but not limited to, Agrobacterium-mediated transformation, biolistic transformation, and pollen tube pathway transformation.

[0069] Agrobacterium-mediated transformation is a common method for plant transformation. The foreign DNA to be introduced into the plant is cloned between the left and right consensus border sequences of the vector, i.e., the T-DNA region. The vector is transformed into Agrobacterium cells, which are then used to infect plant tissue, and the T-DNA region of the vector containing the foreign DNA is inserted into the plant genome.

[0070] The gene gun transformation method is to bombard plant cells with vectors containing foreign DNA (particle-mediated biolistic transformation).

[0071] The pollen tube pathway transformation method utilizes the natural pollen tube pathway (also known as pollen tube guide tissue) formed after plant pollination to carry exogenous DNA into the embryo sac through the nucellus. After transformation, transgenic plants must be regenerated from the transformed plant tissue, and offspring with the exogenous DNA must be selected using appropriate markers.

[0072] DNA construct is the combination that DNA molecule is connected to each other, and this combination provides one or more expression cassettes.DNA construct concrete can self-replicate in bacterial cell, and contains the plasmid of different restriction endonuclease sites, and contained restriction endonuclease sites are used to import and provide functional gene element, i.e. the DNA molecule of promotor, intron, leader sequence, encoding sequence, 3 ' terminator region and other sequences.Contained expression cassette comprises the necessary gene element that transcribes messenger RNA is provided in the DNA construct, and described expression cassette can be designed to express in prokaryotic cell or eukaryotic cell.The application's expression cassette is designed to the most concrete expression in plant cell.

[0073] A transgenic "event" is obtained by transforming plant cells with a heterologous DNA construct, i.e., comprising at least one nucleic acid expression cassette containing a gene of interest, transgenically inserted into the plant genome to produce a plant population, regenerate the plant population, and select for specific plants characterized by the insertion at a specific genomic locus. The term "event" refers to the original transformant that contains the heterologous DNA and the progeny of the transformant. The term "event" also refers to the progeny obtained by sexually crossing a transformant with individuals of another variety containing the heterologous DNA, wherein the inserted DNA and flanking genomic DNA from the transformant parent are present at the same chromosomal location in the progeny of the hybrid, even after repeated backcrossing with the recurrent parent. The term "event" also refers to a DNA sequence from the original transformant that contains the inserted DNA and flanking genomic sequences immediately adjacent to the inserted DNA, which is expected to be transferred to progeny produced by sexually crossing a parental line containing the inserted DNA (e.g., the original transformant and progeny resulting from selfing thereof) with a parental line that does not contain the inserted DNA, and which progeny receive the inserted DNA containing the gene of interest.

[0074] As used herein, "recombinant" refers to a form of DNA and / or protein and / or organism not normally found in nature and therefore produced by human intervention. Such human intervention can produce recombinant DNA molecules and / or recombinant plants. A "recombinant DNA molecule" is one obtained by artificially combining two otherwise separate sequence segments, for example, by chemical synthesis or manipulation of separate nucleic acid segments through genetic engineering techniques. Techniques for performing nucleic acid manipulations are well known.

[0075] The term "transgenic" includes any cell, cell line, callus, tissue, plant part or plant whose genotype is altered by the presence of heterologous nucleic acid, including the original transgenic so altered and progeny individuals generated by sexual hybridization or asexual reproduction of the original transgenic. In this application, the term "transgenic" does not include alterations (chromosomal or extrachromosomal) of the genome by conventional plant breeding methods or naturally occurring events, such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition or spontaneous mutation.

[0076] As used herein, "heterologous" means that a first molecule is not normally found in combination with a second molecule in nature. For example, a molecule can be derived from a first species and inserted into the genome of a second species. Such a molecule is thus heterologous to the host cell and has been artificially introduced into the genome of the host cell.

[0077] Cultivation of a transgenic soybean event LP086-1 that is resistant to lepidopteran insects and tolerant to glyphosate herbicides can be achieved by the following steps: first, sexually hybridizing a first parent soybean plant with a second parent soybean plant to produce a variety of first-generation progeny plants, wherein the first parent soybean plant is composed of soybean plants cultivated from the transgenic soybean event LP086-1 and its progeny, and the transgenic soybean event LP086-1 and its progeny are obtained by transformation using the expression cassette of the present application that is resistant to lepidopteran insects and tolerant to glyphosate herbicides, and the second parent soybean plant lacks resistance to lepidopteran insects and / or has tolerance to glyphosate herbicides; and then selecting progeny plants that are resistant to lepidopteran insect infestation and / or have tolerance to glyphosate herbicides, thereby cultivating soybean plants that are resistant to lepidopteran insects and have tolerance to glyphosate herbicides. These steps can further include backcrossing the progeny plants that are lepidopteran-resistant and / or glyphosate-tolerant to the second or third parent soybean plant, and then selecting the progeny by infestation with lepidopteran insects, application of glyphosate herbicide, or identification of molecular markers associated with the trait (e.g., DNA molecules comprising the junction sites identified at the 5' and 3' ends of the insertion sequence in transgenic soybean event LP086-1), thereby producing soybean plants that are resistant to lepidopteran insects and tolerant to glyphosate herbicide.

[0078] It should also be understood that two different transgenic plants can also be crossed to produce offspring containing two independent, segregating added exogenous genes. Selfing of appropriate offspring can produce offspring plants that are homozygous for both added exogenous genes. Backcrossing of the parent plants and outcrossing with non-transgenic plants as described above are also contemplated, as are asexual propagation.

[0079] The term "probe" refers to an isolated nucleic acid molecule to which a conventional detectable label or reporter molecule, such as a radioisotope, ligand, chemiluminescent agent, or enzyme, may be bound. Such a probe is complementary to a strand of a target nucleic acid, in this application, to a strand of genomic DNA from transgenic soybean event LP086-1, whether the genomic DNA is from transgenic soybean event LP086-1 or seeds, or from plants, seeds, or extracts thereof. The probes herein include not only deoxyribonucleic acids (DNAs) or RNAs, but also polyamides and other probe materials that specifically bind to a target DNA sequence and can be used to detect the presence of that target DNA sequence.

[0080] The term "primer" refers to an isolated nucleic acid molecule that anneals to a complementary target DNA strand through nucleic acid hybridization, forming a hybrid between the primer and the target DNA strand, and then extends along the target DNA strand under the action of a polymerase (e.g., DNA polymerase). The primer pairs of the present application relate to their use in amplifying a target nucleic acid sequence, for example, by polymerase chain reaction (PCR) or other conventional nucleic acid amplification methods.

[0081] Methods for designing and using primers and probes are well known in the art. DNA molecules comprising the full length or fragments of SEQ ID NOs: 1-7 can be used as primers and probes for detecting soybean event LP086-1 and can be easily designed by those skilled in the art using the sequences provided herein.

[0082] The length of probes and primers is generally 11 polynucleotides or more, preferably 18 polynucleotides or more, more preferably 24 polynucleotides or more, and most preferably 30 polynucleotides or more. Such probes and primers hybridize specifically with the target sequence under highly stringent hybridization conditions. Although probes that are different from the target DNA sequence and that maintain hybridization ability to the target DNA sequence can be designed by conventional methods, preferably, the probes and primers in this application have complete DNA sequence identity with the continuous nucleic acid of the target sequence.

[0083] Primers and probes based on the flanking genomic DNA and insert sequences of the present application can be determined by conventional methods, for example, by isolating the corresponding DNA molecules from plant material derived from transgenic soybean event LP086-1 and determining the nucleic acid sequence of the DNA molecules. The DNA molecules contain the transgenic insert sequence and the soybean genomic flanking regions, and fragments of the DNA molecules can be used as primers or probes.

[0084] The nucleic acid probes and primers of the present application hybridize to target DNA sequences under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of DNA derived from transgenic soybean event LP086-1 in a sample. Nucleic acid molecules or fragments thereof are capable of specific hybridization with other nucleic acid molecules under certain circumstances. As used herein, two nucleic acid molecules are said to be capable of specific hybridization with each other if they can form an antiparallel double-stranded nucleic acid structure. If two nucleic acid molecules exhibit complete complementarity, one is said to be the "complement" of the other. As used herein, two nucleic acid molecules are said to exhibit "complete complementarity" when every nucleotide in one molecule is complementary to the corresponding nucleotide in the other. Two nucleic acid molecules are said to be "minimally complementary" if they can hybridize with sufficient stability to anneal and bind to each other under at least conventional "low stringency" conditions. Similarly, two nucleic acid molecules are said to be "complementary" if they can hybridize with sufficient stability to anneal and bind to each other under conventional "high stringency" conditions. Deviations from perfect complementarity are permissible as long as they do not completely prevent the two molecules from forming a duplex structure. In order for a nucleic acid molecule to function as a primer or probe, it is only necessary that it possess sufficient complementarity in sequence to allow a stable duplex structure to form under the particular solvent and salt concentration employed.

[0085] As used herein, a substantially homologous sequence is a nucleic acid molecule that is capable of specifically hybridizing to the complementary strand of another matching nucleic acid molecule under highly stringent conditions. Suitable stringent conditions for promoting DNA hybridization, for example, treatment with 6.0× sodium chloride / sodium citrate (SSC) at approximately 45°C, followed by washing with 2.0×SSC at 50°C, are well known to those skilled in the art. For example, the salt concentration in the washing step can be selected from about 2.0×SSC, 50°C for low stringency conditions to about 0.2×SSC, 50°C for high stringency conditions. In addition, the temperature in the washing step can be increased from room temperature, about 22°C, for low stringency conditions, to about 65°C for high stringency conditions. Both the temperature and the salt concentration can be varied, or one of them can be kept constant while the other variable is varied. Specifically, a nucleic acid molecule of the present application can specifically hybridize with one or more nucleic acid molecules of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7, or their complementary sequences, or any fragments thereof, under moderate stringency conditions, for example, at about 2.0×SSC and about 65° C. More specifically, a nucleic acid molecule of the present application can specifically hybridize with one or more nucleic acid molecules of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7, or their complementary sequences, or any fragments thereof, under highly stringent conditions. In the present application, a preferred marker nucleic acid molecule has SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, or SEQ ID NO: 7, or their complementary sequences, or any fragments thereof. Another preferred marker nucleic acid molecule of the present invention has 80% to 100% or 90% to 100% sequence identity to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6 or SEQ ID NO: 7, or its complementary sequence, or any fragment thereof. SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6 and SEQ ID NO: 7 can be used as markers in plant breeding methods to identify offspring of genetic crosses. Hybridization of the probe to the target DNA molecule can be detected by any method known to those skilled in the art, including but not limited to fluorescent labels, radioactive labels, antibody labels and chemiluminescent labels.

[0086] With respect to amplification of a target nucleic acid sequence using specific amplification primers (e.g., by PCR), "stringent conditions" refer to conditions that only allow the primers to hybridize to the target nucleic acid sequence in a DNA thermal amplification reaction, wherein the primers having a wild-type sequence corresponding to the target nucleic acid sequence (or its complementary sequence) are capable of binding to the target nucleic acid sequence and preferably produce a unique amplification product, i.e., an amplicon.

[0087] The term "specifically binds to (a target sequence)" means that the probe or primer hybridizes only to the target sequence in a sample containing the target sequence under stringent hybridization conditions.

[0088] As used herein, "amplified DNA," "amplification product," or "amplicon" refers to the product of nucleic acid amplification of a target nucleic acid sequence that is part of a nucleic acid template. For example, to determine whether a soybean plant was produced by sexual crosses containing the transgenic soybean event LP086-1 of the present invention, or whether a soybean sample collected from a field contains the transgenic soybean event LP086-1, or whether a soybean extract, such as meal, flour, or oil, contains the transgenic soybean event LP086-1, DNA extracted from the soybean plant tissue sample or extract can be subjected to a nucleic acid amplification method using a primer pair to produce an amplicon that is diagnostic for the presence of DNA from the transgenic soybean event LP086-1. The primer pair includes a first primer derived from a flanking sequence adjacent to the insertion site of the inserted exogenous DNA in the plant genome, and a second primer derived from the inserted exogenous DNA. The amplicon has a length and sequence that is also diagnostic for the transgenic soybean event LP086-1. The length of the amplicon can range from the combined length of the primer pair plus one nucleotide base pair, preferably plus about fifty nucleotide base pairs, more preferably plus about two hundred and fifty nucleotide base pairs, and most preferably plus about four hundred and fifty nucleotide base pairs or more.

[0089] Alternatively, the primer pairs can be derived from flanking genomic sequences on either side of the insert DNA to produce an amplicon that includes the entire insert nucleic acid sequence. One of the primer pairs derived from a plant genomic sequence can be positioned at a distance from the insert DNA sequence that can range from one nucleotide base pair to approximately 20,000 nucleotide base pairs. The use of the term "amplicon" specifically excludes primer dimers formed during thermal DNA amplification reactions.

[0090] Nucleic acid amplification reactions can be achieved by any nucleic acid amplification reaction method known in the art, including polymerase chain reaction (PCR). Various nucleic acid amplification methods are well known to those skilled in the art. PCR amplification methods have been developed to amplify 22 kb of genomic DNA and 42 kb of phage DNA. These methods and other DNA amplification methods in the art can be used in this application. The inserted exogenous DNA sequence and the flanking DNA sequence from the transgenic soybean event LP086-1 can be amplified by using the provided primer sequences to amplify the genome of the transgenic soybean event LP086-1, and after amplification, the PCR amplicon or cloned DNA is subjected to standard DNA sequencing.

[0091] DNA detection kits based on DNA amplification methods can contain DNA primer molecules that specifically hybridize to the target DNA under appropriate reaction conditions and amplify a diagnostic amplicon. The kit can provide agarose gel-based detection methods or many methods known in the art for detecting diagnostic amplicons. Kits containing DNA primers that are homologous or complementary to any portion of the soybean genomic region of SEQ ID NO:3 or SEQ ID NO:4, and to any portion of the transgenic insertion region of SEQ ID NO:5 are provided herein. In particular, the primer pair identified as useful in DNA amplification methods is SEQ ID NO:8 and SEQ ID NO:9, which amplify a diagnostic amplicon that is homologous to a portion of the 5' transgene / genomic region of transgenic soybean event LP086-1, wherein the amplicon includes SEQ ID NO:1. Other DNA molecules used as DNA primers can be selected from SEQ ID NO:5.

[0092] The amplicons generated by these methods can be detected using a variety of techniques. One method is Genetic Bit Analysis, in which a DNA oligonucleotide chain is designed that spans the insert DNA sequence and the adjacent flanking genomic DNA sequence. This oligonucleotide chain is immobilized in a microwell of a microplate. After PCR amplification of the target region (using one primer within the insert sequence and one primer within the adjacent flanking genomic sequence), the single-stranded PCR product can be hybridized to the immobilized oligonucleotide chain and used as a template for a single-base extension reaction using a DNA polymerase and ddNTPs specifically labeled for the next expected base. The results can be obtained using fluorescence or ELISA-type methods. The signal represents the presence of the insert / flanking sequence, indicating that the amplification, hybridization, and single-base extension reactions were successful.

[0093] Another method is Pyrosequencing technology. This method designs an oligonucleotide chain that spans the inserted DNA sequence and the adjacent genomic DNA binding site. The oligonucleotide chain is hybridized with the single-stranded PCR product of the target region (one primer is used in the inserted sequence and one primer is used in the adjacent flanking genomic sequence) and then incubated with DNA polymerase, ATP, sulfhydrylase, luciferase, apyrase, adenosine-5'-phosphosulfate and luciferin. dNTPs are added separately and the resulting light signal is measured. The light signal represents the presence of the inserted / flanking sequence, which indicates that the amplification, hybridization, and single-base or multi-base extension reaction are successful.

[0094] The fluorescence polarization phenomenon described by Chen et al. [Genome Res. 9: 492-498, 1999] is also a method that can be used to detect the amplicon of the present application. Using this method requires designing an oligonucleotide chain that spans the inserted DNA sequence and the adjacent genomic DNA binding site. The oligonucleotide chain is hybridized with the single-stranded PCR product of the target region (one primer is used in the inserted sequence and one in the adjacent flanking genomic sequence), and then incubated with DNA polymerase and a fluorescently labeled ddNTPs. Single-base extension will result in the insertion of ddNTPs. This insertion can be measured by a change in its polarization using a fluorimeter. The change in polarization represents the presence of the inserted / flanking sequence, which indicates that the amplification, hybridization, and single-base extension reactions are successful.

[0095] Taqman is described as a method for detecting and quantifying the presence of DNA sequences and is described in detail in the manufacturer's instructions. As a brief example, a FRET oligonucleotide probe is designed that spans the binding sites of an insert DNA sequence and the adjacent genomic flanking sequence. The FRET probe and PCR primers (one primer within the insert sequence and one primer in the adjacent flanking genomic sequence) are cycled in the presence of a thermostable polymerase and dNTPs. Hybridization of the FRET probe results in the cleavage of the fluorescent and quenching moieties on the FRET probe and the release of the fluorescent moiety. The generation of a fluorescent signal represents the presence of the insert / flanking sequence, indicating that amplification and hybridization were successful.

[0096] Based on the principles of hybridization, suitable techniques for detecting plant material derived from transgenic soybean event LP086-1 may also include Southern blotting, Northern blotting, and in situ hybridization. Specifically, suitable techniques include incubating the probe with the sample, washing to remove unbound probe, and detecting whether the probe has hybridized. The detection method depends on the type of label attached to the probe; for example, radiolabeled probes can be detected by exposure and development of X-ray film, or enzyme-labeled probes can be detected by color change caused by substrate conversion.

[0097] Tyangi et al. [Nat. Biotech. 14:303-308, 1996] introduced the application of molecular markers in sequence detection. A brief description is as follows: a FRET oligonucleotide probe is designed that spans the insertion DNA sequence and the adjacent genomic flanking binding site. The unique structure of the FRET probe causes it to contain a secondary structure that can maintain the fluorescent moiety and the quenching moiety in close proximity. The FRET probe and PCR primers (one primer each is used in the insertion sequence and the adjacent flanking genomic sequence) are cyclically reacted in the presence of a thermostable polymerase and dNTPs. After successful PCR amplification, hybridization of the FRET probe and the target sequence results in the loss of the probe secondary structure, thereby spatially separating the fluorescent moiety and the quenching moiety and generating a fluorescent signal. The generation of the fluorescent signal represents the presence of the insertion / flanking sequence, which indicates that the amplification and hybridization are successful.

[0098] Other described methods, such as microfluidics, provide methods and apparatus for separating and amplifying DNA samples. Optical dyes are used to detect and measure specific DNA molecules. Nanotube devices comprising electronic sensors for detecting DNA molecules or nanoparticles that bind specific DNA molecules and are thus detectable are useful for detecting the DNA molecules of the present application.

[0099] DNA detection kits can be developed using the compositions described herein and methods described or known in the art of DNA detection. Such kits can be used to identify the presence of DNA from transgenic soybean event LP086-1 in a sample and can also be used to grow soybean plants containing DNA from transgenic soybean event LP086-1. The kits can contain DNA primers or probes that are homologous to or complementary to at least a portion of SEQ ID NO: 1, 2, 3, 4, or 5, or other DNA primers or probes that are homologous to or complementary to DNA contained in transgenic genetic elements of the DNA. These DNA sequences can be used in DNA amplification reactions or as probes in DNA hybridization methods.

[0100] The DNA constructs of the transgene insert sequence and the soybean genome junctions contained in the soybean genome and illustrated in FIG1 and Table 1 comprise: the soybean LP086-1 flanking genomic region at the 5' end of the transgene insert sequence, a portion of the insert sequence from the right border region (RB) of Agrobacterium tumefaciens, a first expression cassette consisting of the Arabidopsis thaliana ubiquitin gene promoter Ubi (pAtUbi10) operably linked to the insect resistance gene Cry1Fa (Cry1Fa) of Bacillus thuringiensis, and a terminator from Agrobacterium tumefaciens pTi15955. The first expression cassette is composed of the Arabidopsis thaliana actin 2 promoter (pAtAct2), operably linked to the Arabidopsis thaliana chloroplast transit peptide (spAtCTP2), operably linked to the insect resistance Cry2Ab protein (Cry2Ab) of Bacillus thuringiensis, and operably linked to the transcription terminator (tNos) of nopaline synthase; the third expression cassette is composed of the Arabidopsis thaliana promoter and leader sequence (pAtRbcS4) encoding the small subunit of 1,5-bisphosphate carboxylase / oxygenase, and the Arabidopsis thaliana E9 gene promoter. The fourth expression cassette is operably linked to the signal peptide sequence (spAtRbcS4) encoding the small subunit of 1,5-bisphosphate carboxylase / oxygenase from Arabidopsis thaliana, operably linked to the insect resistance Cry1Ab protein (Cry1Ab) of Bacillus thuringiensis, and operably linked to the 3'UTR sequence transcription terminator of the PT1 gene encoding a phosphate transporter from Medicago truncatula (tMtPt); the fourth expression cassette is operably linked to the Arabidopsis leaf promoter (pGm17gTsf1) of the Tsf1 gene of the elongation factor EF-1alpha from soybean. The invention relates to a chloroplast transit peptide (spAtCTP2) operably linked to a glyphosate-tolerant 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) from Agrobacterium CP4, and operably linked to a 3' non-transcribed sequence terminator (tPsE9) derived from the pea ribosomal 1,5-bisphosphate carboxylase small subunit (RbcS2) E9 gene, a portion of the left border region (LB) insertion sequence from Agrobacterium, and a flanking genomic region (SEQ ID NO: 5) from soybean plant LP086-1 located at the 3' end of the transgenic insertion sequence. In the DNA amplification method, the DNA molecule used as a primer can be any portion of the transgenic insertion sequence from the transgenic soybean event LP086-1, or any portion of the flanking soybean genomic DNA region from the transgenic soybean event LP086-1.

[0101] The transgenic soybean event LP086-1 can be combined with other transgenic soybean varieties, such as soybeans tolerant to herbicides (such as glufosinate and dicamba), or transgenic soybean varieties carrying other insect-resistant genes (such as beetles, white grubs, and two-spotted leaf beetles). Various combinations of all these different transgenic events, when bred together with the transgenic soybean event LP086-1 of the present application, can provide improved hybrid transgenic soybean varieties that are resistant to multiple pests and tolerant to multiple herbicides. These varieties can exhibit superior characteristics such as increased yield compared to non-transgenic varieties and single-trait transgenic varieties.

[0102] The present application provides a transgenic soybean event LP086-1, as well as nucleic acid sequences and detection methods for soybean plants containing this event. The transgenic soybean event LP086-1 is resistant to feeding damage by lepidopteran pests and tolerates the phytotoxic effects of agricultural herbicides containing glyphosate. This dual-trait soybean plant expresses the Cry1Ab, Cry2Ab, and Cry1Fa proteins of Bacillus thuringiensis, which provide resistance to feeding damage by lepidopteran pests (such as cotton bollworm, beet armyworm, Spodoptera litura, soybean borer, and fall armyworm); and expresses the glyphosate-resistant 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) protein of Agrobacterium strain CP4, which confers plant tolerance to glyphosate. BRIEF DESCRIPTION OF THE DRAWINGS

[0103] FIG1 is a schematic diagram of the structure of the transgenic insertion sequence and the soybean genome binding site for detecting the nucleic acid sequence of soybean plant LP086-1 and the detection method thereof in the present application;

[0104] FIG2 is a schematic diagram of the structure of the recombinant expression vector pLP086 used in the present application for detecting the nucleic acid sequence of soybean plant LP086-1 and the detection method thereof;

[0105] FIG3 shows the in vitro resistance effect of transgenic soybeans comprising transgenic soybean event LP086-1 of the present application to lepidopteran pests;

[0106] FIG4 is a diagram showing the effect of artificial inoculation of transgenic soybeans containing transgenic soybean event LP086-1 of the present application with cotton bollworms in the field;

[0107] FIG5 is a diagram showing the effects of the transgenic soybean event LP086-1 of the present application on the natural occurrence conditions of Spodoptera exigua;

[0108] FIG6 is a diagram showing the field effects of transgenic soybeans comprising transgenic soybean event LP086-1 of the present application under the natural occurrence conditions of fall armyworm;

[0109] FIG7 is a field effect diagram of transgenic soybeans comprising transgenic soybean event LP086-1 of the present application when sprayed with 4 times the recommended spraying concentration of glyphosate herbicide. DETAILED DESCRIPTION

[0110] The following is a further explanation of the technical solutions of the present application for detecting the nucleic acid sequence of soybean plant LP086-1 and the detection method thereof through specific examples.

[0111] Example 1 Cloning and transformation

[0112] 1.1. Vector cloning: Standard gene cloning technology was used to construct the recombinant expression vector pLP086 (as shown in FIG2 ). The vector pLP086 contains four tandem transgenic expression cassettes, the first expression cassette consisting of the Arabidopsis thaliana ubiquitin gene promoter Ubi (pAtUbi10), operably linked to the insect resistance gene Cry1Fa (Cry1Fa) of Bacillus thuringiensis, and operably linked to the terminator tORF25PolyA from Agrobacterium tumefaciens pTi15955; the second expression cassette consisting of the Arabidopsis thaliana actin 2 promoter (pAtAct2), operably linked to the Arabidopsis thaliana chloroplast transit peptide (spAtCTP2), operably linked to the insect resistance Cry2Ab protein (Cry2Ab) of Bacillus thuringiensis, and operably linked to the transcription terminator (tNos) of nopaline synthase; the third expression cassette consisting of the Arabidopsis thaliana E9 gene promoter encoding the small subunit of 1,5-bisphosphate carboxylase / oxygenase and the leader sequence (pATRbcS4), operably linked to The signal peptide sequence (spAtRbcS4) encoding the small subunit of 1,5-bisphosphate carboxylase / oxygenase from Arabidopsis thaliana is operably linked to the insect resistance Cry1Ab protein (Cry1Ab) of Bacillus thuringiensis, which is operably linked to the 3'UTR sequence transcription terminator of the PT1 gene encoding a phosphate transporter from Medicago truncatula (tMtPt); the fourth expression cassette consists of the Tsf1 gene from the elongation factor EF-1alpha of soybean. The promoter of pLP086 (pGm17gTsf1) was operably linked to the Arabidopsis thaliana chloroplast transit peptide (spAtCTP2), the glyphosate-tolerant 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) of Agrobacterium tumefaciens strain CP4, and the 3'-terminator non-transcribed sequence (tPsE9) from the pea ribosomal 1,5-bisphosphate carboxylase small subunit (RbcS2) E9 gene. The vector pLP086 was transformed into Agrobacterium tumefaciens LBA4404 (Invitrogen, Chicago, USA; Cat. No. 18313-015) using the liquid nitrogen method, and transformed cells were screened using 5-enol-pyruvylshikimate-3-phosphate synthase as a selectable marker.

[0113] 1.2. Plant transformation: Conventional Agrobacterium infection was used for transformation. Aseptically cultured soybean (soybean variety JACK) immature embryos were co-cultured with the Agrobacterium described in Example 1.1 to transfer the T-DNA in the constructed recombinant expression vector pLP086 into the soybean chromosome to produce a transgenic soybean event.

[0114] For Agrobacterium-mediated soybean transformation, briefly, immature embryos are isolated from soybeans and contacted with an Agrobacterium suspension, wherein the Agrobacterium is capable of transferring the nucleic acid sequences of the cry1Ab, cry2Ab, cry1Fa genes and the nucleic acid sequence of the epsps gene to at least one cell of one of the embryos (step 1: infection step). In this step, the embryos are specifically immersed in the Agrobacterium suspension (OD 660 = 0.4-0.6, and inoculated with infection medium [MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 68.5 g / L, glucose 36 g / L, acetosyringone (AS) 40 mg / L, and 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, pH 5.3]. The immature embryos are co-cultivated with Agrobacterium for a period of three days (Step 2: Co-cultivation Step). Specifically, after the infection step, the immature embryos are cultured on solid medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 20 g / L, glucose 10 g / L, acetosyringone 100 mg / L, 2,4-dichlorophenoxyacetic acid 1 mg / L, and agar 8 g / L, pH 5.8). This co-cultivation period can be followed by an optional "recovery" step. During the "recovery" step, the recovery medium (4.3 g / L MS salts, MS vitamins, 300 mg / L casein, 30 g / L sucrose, 1 mg / L 2,4-dichlorophenoxyacetic acid, and 3 g / L phytagel, pH 5.8) contains at least one antibiotic (cephalosporin) known to inhibit Agrobacterium growth, and no selective agent for plant transformants is added (Step 3: Recovery Step). Specifically, immature embryos are cultured on solid medium containing antibiotics but no selective agent to eliminate Agrobacterium and provide a recovery period for infected cells. Subsequently, the inoculated immature embryos are cultured on medium containing the selective agent [N-(phosphonomethyl)glycine] to select for growing transformed callus (Step 4: Selection Step). Specifically, immature embryos are cultured on a selective solid medium containing a selective agent [MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, N-(phosphonomethyl)glycine 0.25 mol / L, 2,4-dichlorophenoxyacetic acid 1 mg / L, and phytagel 3 g / L, pH 5.8], resulting in the selective growth of transformed cells. Callus tissue is then regenerated into plants (step 5: regeneration step). Specifically, callus tissue grown on the medium containing the selective agent is cultured on solid media (MS differentiation medium and MS rooting medium) to regenerate plants.

[0115] The resistant calli obtained by screening were transferred to the MS differentiation medium [MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, 6-benzyladenine 2 mg / L, N-(phosphonomethyl)glycine 0.125 mol / L, and phytagel 3 g / L, pH = 5.8] and cultured at 25°C for differentiation. The differentiated seedlings were transferred to the MS rooting medium (MS salts 2.15 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, indole-3-acetic acid 1 mg / L, and agar 8 g / L, pH = 5.8), cultured at 25°C to a height of approximately 10 cm, and then transferred to a greenhouse for cultivation until fruiting. In the greenhouse, the seedlings were cultured at 28°C for 16 hours and at 20°C for 8 hours each day.

[0116] 1.3 Identification and Screening of Transgenic Events: A total of 1,500 independent transgenic T0 plants were generated. All T0 plants were subjected to molecular testing (including target gene copy number and insertion location), target traits (insect resistance and herbicide tolerance), and agronomic performance evaluation. After eliminating abnormal transformants, LP086-1 was selected.

[0117] Example 2 Detection of transgenic soybean event LP086-1 using TaqMan

[0118] Approximately 100 mg of leaves from transgenic soybean event LP086-1 were sampled and genomic DNA was extracted using the Qiagen DNeasy Plant Maxi Kit. The copy numbers of cry1Ab, cry2Ab, cry1Fa, and epsps were determined by quantitative PCR using Taqman probes. Wild-type soybean plants (non-transgenic, recipient) were also used as controls and analyzed using the same method. Three replicates were performed, and the average value was calculated.

[0119] The specific method is as follows:

[0120] Step 11: 100 mg of leaves from transgenic soybean event LP086-1 were homogenized in a mortar with liquid nitrogen, with three replicates obtained for each sample. Step 12: Genomic DNA was extracted from the samples using the Qiagen DNeasy Plant Mini Kit. For details, refer to the product manual. Step 13: The genomic DNA concentrations of the samples were determined using a NanoDrop 2000 (Thermo Scientific). Step 14: The genomic DNA concentrations of the samples were adjusted to a uniform concentration range of 80-100 ng / μl. Step 15: The copy number of the samples was determined using Taqman probe-based quantitative PCR, using a sample with a known copy number as a standard and a sample of a wild-type soybean plant (non-transgenic, transgenic recipient) as a control. Three replicates were obtained for each sample, and the average values ​​were calculated. The primer and probe sequences for the quantitative PCR were:

[0121] The following primers and probes were used to detect the cry1Ab gene sequence:

[0122] Primer 1: TGGGAGGACGGAATGATATTG, as shown in SEQ ID NO: 16 in the sequence listing;

[0123] Primer 2: AACTCGTCCGTGAGCATCATC, as shown in SEQ ID NO: 17 in the sequence listing;

[0124] Probe 1: AACTCCGCGCTGCGATGAATCC, as shown in SEQ ID NO: 18 in the sequence listing;

[0125] The following primers and probes were used to detect the cry2Ab gene sequence:

[0126] Primer 3: GGACAGAGGCACCGCATT, as shown in SEQ ID NO: 19 in the sequence listing;

[0127] Primer 4: CGGGTCTGCAAGCAAACG, as shown in SEQ ID NO: 20 in the sequence listing;

[0128] Probe 2: TCCACTTGGCGGTTGAACTCCTCC, as shown in SEQ ID NO: 21 in the sequence listing;

[0129] The following primers and probes were used to detect the cry1Fa gene sequence:

[0130] Primer 5: GCTATGTCCAGTCCCCAACCT, as shown in SEQ ID NO: 22 in the sequence listing;

[0131] Primer 6: CAAGCTGCTAACCTGCACTTGT, as shown in SEQ ID NO: 23 in the sequence listing;

[0132] Probe 3: CCCAAACGACACAGCGTCGCG, as shown in SEQ ID NO: 24 in the sequence listing;

[0133] The following primers and probes were used to detect the epsps gene sequence:

[0134] Primer 7: GCAAATCCTCTGGCCTTTCC, as shown in SEQ ID NO: 25 in the sequence listing;

[0135] Primer 8: TGAAGGACCGGTGGGAGAT, as shown in SEQ ID NO: 26 in the sequence listing;

[0136] Probe 4: CGTCCGCATTCCCGGCGA, as shown in SEQ ID NO: 27 in the sequence listing;

[0137] PCR reaction system: JumpStart TM TaqReadyMix TM (Sigma) 10 μL, 50× primer / probe mix 1 μL, genomic DNA 3 μL and water (ddH 2 O) 6 μL.

[0138] The 50× primer / probe mixture contained 45 μL of each primer at 1 mM concentration, 50 μL of probe at 100 μM concentration, and 860 μL of 1× TE buffer and was stored in amber tubes at 4°C.

[0139] The PCR reaction conditions were: 95°C for 5 minutes; 95°C for 30 seconds, 60°C for 1 minute, repeated 40 times.

[0140] The data were analyzed using SDS2.3 software (Applied Biosystems), and a single-copy transgenic soybean event LP086-1 was obtained.

[0141] Example 3 Detection of Transgenic Soybean Event LP086-1

[0142] 3.1 Genomic DNA Extraction

[0143] DNA extraction was performed according to the conventional CTAB (cetyltrimethylammonium bromide) method: 2 g of young leaves of transgenic soybean event LP086-1 were ground into powder in liquid nitrogen, and then 0.5 mL of DNA extraction CTAB buffer (20 g / L CTAB, 1.4 M NaCl, 100 mM Tris-HCl, 20 mM EDTA (ethylenediaminetetraacetic acid)], adjust the pH to 8.0 with NaOH, mix thoroughly, and extract at 65°C for 90 minutes; add 0.5 times the volume of phenol and 0.5 times the volume of chloroform, mix by inversion; centrifuge at 12000 rpm (revolutions per minute) for 10 minutes; aspirate the supernatant, add 1 volume of isopropanol, gently shake the centrifuge tube, and let it stand at -20°C for 30 minutes; centrifuge at 12000 rpm for another 10 minutes; collect DNA to the bottom of the tube; discard the supernatant, wash the precipitate with 0.5 mL of 70% ethanol; centrifuge at 12000 rpm for 5 minutes; vacuum dry or blow dry in a clean bench; dissolve the DNA precipitate in an appropriate amount of TE buffer (10mM Tris-HCl, 1mM EDTA, pH 8.0) and store at -20°C.

[0144] 3.2 Analysis of flanking DNA sequences

[0145] The concentration of the extracted DNA sample was measured to ensure that the concentration of the sample to be tested was between 80-100 ng / μL. The genomic DNA was digested with the selected restriction endonucleases SpeI, PstI, BssHII (5' end analysis) and SacI, KpnI, XmaI, NheI (3' end analysis). 26.5 μL of genomic DNA, 0.5 μL of the selected restriction endonuclease and 3 μL of digestion buffer were added to each digestion system and digested at an appropriate temperature for 1 hour. After the digestion was completed, 70 μL of anhydrous ethanol was added to the digestion system, ice-bathed for 30 minutes, centrifuged at 12000 rpm for 7 minutes, the supernatant was discarded, and the solution was dried. 8.5 μL of double-distilled water (ddH2O), 1 μL of 10×T4Buffer and 0.5 μL of T4 ligase were then added and ligated overnight at 4°C. PCR amplification was performed using a series of nested primers to separate the 5' and 3' transgenic / genomic DNA. Specifically, the primer combination for isolating the 5' transgene / genomic DNA included SEQ ID NO:13 and SEQ ID NO:34 as first primers, SEQ ID NO:35 and SEQ ID NO:36 as second primers, and SEQ ID NO:13 as a sequencing primer. The primer combination for isolating the 3' transgene / genomic DNA included SEQ ID NO:15 and SEQ ID NO:37 as first primers, SEQ ID NO:38 and SEQ ID NO:39 as second primers, and SEQ ID NO:15 as a sequencing primer. PCR reaction conditions are shown in Table 3.

[0146] The obtained amplicons were electrophoresed on a 2.0% agarose gel to separate the PCR products, and the target fragments were subsequently isolated from the agarose matrix using a QIAquick Gel Extraction Kit (Catalog # 28704, Qiagen Inc., Valencia, CA). The purified PCR products were then sequenced (e.g., ABIPrism™ 377, PE Biosystems, Foster City, CA) and analyzed (e.g., DNASTAR sequence analysis software, DNASTAR Inc., Madison, WI).

[0147] Standard PCR methods were used to confirm the 5' and 3' flanking sequences and junction sequences. The 5' flanking and junction sequences can be confirmed using SEQ ID NO:8 or SEQ ID NO:12 in combination with SEQ ID NO:9, SEQ ID NO:13, or SEQ ID NO:34. The 3' flanking and junction sequences can be confirmed using SEQ ID NO:11 or SEQ ID NO:14 in combination with SEQ ID NO:10, SEQ ID NO:15, or SEQ ID NO:37. The PCR reaction system and amplification conditions are shown in Tables 3 and 4. Those skilled in the art will appreciate that other primer sequences can also be used to confirm the flanking and junction sequences.

[0148] DNA sequencing of the PCR products provides DNA that can be used to design other DNA molecules that serve as primers and probes for identification of soybean plants or seeds derived from transgenic soybean event LP086-1.

[0149] The soybean genomic sequence is found flanking the right border (5' flanking sequence) of the insertion sequence of transgenic soybean event LP086-1 at nucleotides 1-641 of SEQ ID NO: 5, and the soybean genomic sequence is found flanking the left border (3' flanking sequence) of the insertion sequence of transgenic soybean event LP086-1 at nucleotides 16770-17285 of SEQ ID NO: 5. The 5' junction sequence is set forth in SEQ ID NO: 1, and the 3' junction sequence is set forth in SEQ ID NO: 2.

[0150] 3.3. PCR zygosity determination

[0151] Junction sequences are relatively short polynucleotide molecules that are novel DNA sequences that, when detected in a polynucleotide detection assay, are diagnostic for the DNA of transgenic soybean event LP086-1. The binding sequence of SEQ ID NO:1 consists of 11 bp on either side of the T-DNARB region insertion site of transgenic soybean event LP086-1 and the soybean genomic DNA insertion site. The binding sequence of SEQ ID NO:2 consists of 11 bp on either side of the T-DNALB region insertion site of transgenic soybean event LP086-1 and the soybean genomic DNA insertion site. Longer or shorter polynucleotide junction sequences can be selected from SEQ ID NO:3 or SEQ ID NO:4. The junction sequences (5' junction region of SEQ ID NO:1 and 3' junction region of SEQ ID NO:2) are useful as DNA probes or primers in DNA detection methods. Junction sequences SEQ ID NO:6 and SEQ ID NO:7 are also novel DNA sequences in transgenic soybean event LP086-1 and can also be used as DNA probes or primers to detect the presence of transgenic soybean event LP086-1 DNA. The SEQ ID NO: 6 (nucleotides 642-1159 of SEQ ID NO: 3) spans the LP086 construct DNA sequence and the pAtUbil0 transcription promoter sequence, and the SEQ ID NO: 7 (nucleotides 1-486 of SEQ ID NO: 4) spans the tPsE9 transcription termination sequence and the LP086 construct DNA sequence.

[0152] Additionally, an amplicon was generated by using primers from at least one of SEQ ID NO: 3 or SEQ ID NO: 4 that, when used in a PCR method, produced an amplicon diagnostic for transgenic soybean event LP086-1.

[0153] Specifically, a PCR product was generated from the 5' end of the transgenic insert sequence, which PCR product is a portion of genomic DNA flanking the 5' end of the T-DNA insert sequence in the genome of plant material derived from transgenic soybean event LP086-1. This PCR product comprises SEQ ID NO: 3. For PCR amplification, primer 11 (SEQ ID NO: 8) was designed to hybridize to the genomic DNA sequence flanking the 5' end of the transgenic insert sequence, and primer 12 (SEQ ID NO: 9) was paired with primer 11, which is located in the transcriptional promoter sequence of the transgenic pAtUbil0.

[0154] A PCR product was generated from the 3' end of the transgenic insert sequence. This PCR product comprises a portion of genomic DNA from plant material of transgenic soybean event LP086-1 that flanks the 3' end of the T-DNA insert sequence. This PCR product comprises SEQ ID NO: 4. For PCR amplification, primer 14 (SEQ ID NO: 11) was designed to hybridize to the genomic DNA sequence flanking the 3' end of the transgenic insert sequence. Primer 13 (SEQ ID NO: 10) was paired with primer 14 to hybridize to the tNos transcriptional terminator sequence located at the 3' end of the insert.

[0155] The DNA amplification conditions described in Tables 3 and 4 can be used in the above-described PCR zygosity assay to generate diagnostic amplicons for transgenic soybean event LP086-1. Detection of the amplicons can be performed using a Stratagene Robocycle, MJ Engine, Perkin-Elmer 9700, or Eppendorf Mastercycler Gradient thermocycler, or other methods and equipment known to those skilled in the art.

[0156] Table 3. PCR steps and reaction mixture conditions for identification of the 5' transgenic insert / genomic junction region of transgenic soybean event LP086-1.

[0157] Table 4. Perkin-Elmer 9700 Thermal Cycler Conditions

[0158] Mix gently and add 1-2 drops of mineral oil above each reaction solution if there is no insulation cap on the thermal cycler. Use the above cycling parameters (Table 4) to perform PCR on a Stratagene Robocycler (Stratagene, La Jolla, CA), an MJ Engine (MJ R-Biorad, Hercules, CA), a Perkin-Elmer 9700 (Perkin Elmer, Boston, MA), or an Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler. The MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should be run in a calculated mode. The Perkin-Elmer 9700 thermal cycler should be run with the ramp speed set to maximum.

[0159] The experimental results showed that: primers 11 and 12 (SEQ ID NOs: 8 and 9) produced an amplification product of an 1159 bp fragment when used in the PCR reaction of the genomic DNA of the transgenic soybean event LP086-1, and no fragment was amplified when used in the PCR reaction of the untransformed soybean genomic DNA and the non-LP086-1 soybean genomic DNA; primers 13 and 14 (SEQ ID NOs: 10 and 11) produced an amplification product of an 1002 bp fragment when used in the PCR reaction of the genomic DNA of the transgenic soybean event LP086-1, and no fragment was amplified when used in the PCR reaction of the untransformed soybean genomic DNA and the non-LP086-1 soybean genomic DNA.

[0160] PCR zygosity assays can also be used to identify whether material from transgenic soybean event LP086-1 is homozygous or heterozygous. Primer 15 (SEQ ID NO: 12), primer 16 (SEQ ID NO: 13), and primer 17 (SEQ ID NO: 14), or primer 16 (SEQ ID NO: 13), primer 17 (SEQ ID NO: 14), and primer 18 (SEQ ID NO: 15) are used in an amplification reaction to generate a diagnostic amplicon for transgenic soybean event LP086-1. The DNA amplification conditions described in Tables 5 and 6 can be used in the above zygosity assays to generate a diagnostic amplicon for transgenic soybean event LP086-1.

[0161] Table 5. Zygosity assay reaction solution

[0162] Table 6. Zygosity determination conditions for Perkin-Elmer 9700 thermal cycler

[0163] PCR was performed using the above cycling parameters (Table 6) on a Stratagene Robocycler (Stratagene, La Jolla, CA), an MJ Engine (MJ R-Biorad, Hercules, CA), a Perkin-Elmer 9700 (Perkin Elmer, Boston, MA), or an Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler. The MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should be run in calculated mode. The Perkin-Elmer 9700 thermal cycler should be run with the ramp speed set to maximum.

[0164] In the amplification reaction, the biological sample containing template DNA contains DNA diagnostic for the presence of transgenic soybean event LP086-1 in the sample. Alternatively, the reaction will produce two distinct DNA amplicons from a biological sample containing DNA derived from a soybean genome that is heterozygous for the allele corresponding to the inserted DNA present in transgenic soybean event LP086-1. These two distinct amplicons will correspond to a first amplicon derived from a wild-type soybean genomic locus and a second amplicon diagnostic for the presence of transgenic soybean event LP086-1 DNA. A soybean DNA sample that produces only a single amplicon corresponding to the second amplicon described for a heterozygous genome can be diagnostic for the presence of transgenic soybean event LP086-1 in the sample, and the sample is produced from soybean seeds that are homozygous for the allele corresponding to the inserted DNA present in the transgenic soybean plant LP086-1.

[0165] It should be noted that primer pairs specific to transgenic soybean event LP086-1 were used to generate amplicons diagnostic for genomic DNA from transgenic soybean event LP086-1. These primer pairs, including but not limited to primers 11 and 12 (SEQ ID NOs: 8 and 9), and primers 13 and 14 (SEQ ID NOs: 10 and 11), were used in the described DNA amplification method. Additionally, control primers 9 and 10 (SEQ ID NOs: 28 and 29), used to amplify endogenous soybean genes, were included as an internal standard for reaction conditions. Analysis of transgenic soybean event LP086-1 DNA extracts should include a positive control DNA extract from transgenic soybean event LP086-1, a negative control DNA extract from a non-transgenic soybean event LP086-1, and a negative control containing no template soybean DNA. In addition to these primer pairs, any primer pair derived from SEQ ID NO: 3 or SEQ ID NO: 4, or their complements, can be used that, when used in a DNA amplification reaction, produces an amplicon comprising SEQ ID NO: 1 or SEQ ID NO: 2, respectively, that is diagnostic for tissue derived from transgenic soybean event LP086-1. The DNA amplification conditions described in Tables 4 to 6 can be used to generate diagnostic amplicons for transgenic soybean event LP086-1 using appropriate primer pairs. Extracts presumed to contain soybean plant or seed DNA comprising transgenic soybean event LP086-1, or products derived from transgenic soybean event LP086-1, that produce an amplicon diagnostic for transgenic soybean event LP086-1 when tested in a DNA amplification method can be used as templates for amplification to determine the presence of transgenic soybean event LP086-1.

[0166] Example 4 Detection of Transgenic Soybean Event LP086-1 by Southern Blot Hybridization

[0167] 4.1 DNA Extraction for Southern Blot Hybridization

[0168] Southern blot analysis was performed using homozygous transformation events from the T4 and T5 generations. Approximately 5 to 10 g of plant tissue was ground in liquid nitrogen using a mortar and pestle. The plant tissue was resuspended in 12.5 mL of extraction buffer A (0.2 M Tris pH = 8.0, 50 mM EDTA, 0.25 M NaCl, 0.1% v / v β-mercaptoethanol, 2.5% w / v polyvinyl pyrrolidone) and centrifuged at 4000 rpm for 10 minutes (2755 g). After discarding the supernatant, the pellet was resuspended in 2.5 mL of extraction buffer B (0.2 M Tris pH = 8.0, 50 mM EDTA, 0.5 M NaCl, 1% v / v β-mercaptoethanol, 2.5% w / v polyvinyl pyrrolidone, 3% sarkosyl, 20% ethanol) and incubated at 37° C. for 30 minutes. During the incubation period, the sample was mixed once with a sterile loop. After incubation, an equal volume of chloroform / isoamyl alcohol (24:1) was added, gently mixed by inversion, and centrifuged at 4000 rpm for 20 minutes. The aqueous layer was collected and centrifuged at 4000 rpm for 5 minutes after adding 0.54 volumes of isopropanol to precipitate the DNA. The supernatant was discarded and the DNA pellet was resuspended in 500 μL TE. In order to degrade any RNA present, the DNA was incubated with 1 μL 30 mg / mL RNAase A at 37°C for 30 minutes, centrifuged at 4000 rpm for 5 minutes, and precipitated by centrifugation at 14000 rpm for 10 minutes in the presence of 0.5 volumes of 7.5 M ammonium acetate and 0.54 volumes of isopropanol. After discarding the supernatant, the precipitate was washed with 500 μL of 70% ethanol by mass and resuspended in 100 μL TE after drying.

[0169] 4.2 Restriction enzyme digestion

[0170] DNA concentration was quantitatively detected using a spectrophotometer or fluorometer (using 1×TAE and GelRED dye). 5 μg of DNA was digested at a time in a 100 μL reaction system. Genomic DNA was digested with restriction endonucleases EcoRV and MfeI, respectively, using partial sequences of Cry2Ab and Cry1Ab on T-DNA as probes; genomic DNA was digested with restriction endonucleases AvrII and MfeI, respectively, using partial sequences of Cry1Fa and EPSPS on T-DNA as probes. For each enzyme, the digest was incubated overnight at an appropriate temperature. The sample was spun using a speed vacuum to reduce the volume to 30 μL.

[0171] 4.3 Gel Electrophoresis

[0172] Bromophenol blue loading dye was added to each sample from Example 4.2, and each sample was loaded onto a 0.7% agarose gel containing ethidium bromide and separated by electrophoresis in TBE running buffer. The gel was run at 20 volts overnight.

[0173] Wash the gel for 15 minutes in 0.25M HCl to depurinate the DNA, then wash with water. Set up Southern blot hybridization as follows: place 20 thick dry blotting papers in a dish, and place 4 thin dry blotting papers on it. In 0.4M NaOH, pre-wet 1 thin blotting paper and place it on the paper stack, then place 1 Hybond-N+ transfer membrane (Amersham Pharmacia Biotech, #RPN303B) pre-wetted in 0.4M NaOH. The gel is placed on the top to ensure that there are no bubbles between the gel and the membrane. 3 other pre-soaked blotting papers are placed on the top of the gel and fill the buffer tray with 0.4M NaOH. Connect the gel stack and buffer tray with a wick pre-soaked in 0.4M NaOH and transfer the DNA to the membrane. Carry out DNA transfer for about 4 hours at room temperature. After the transfer, rinse the Hybond membrane for 10 seconds in 2×SSC, and the DNA is bound to the membrane by UV cross-linking.

[0174] 4.4 Hybridization

[0175] Use PCR to amplify the appropriate DNA sequence for probe preparation. The DNA probe is SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32 and SEQ ID NO:33, or is partially homologous or complementary to the above sequences. Boil 25ng of probe DNA in 45μL TE for 5 minutes, place on ice for 7 minutes, and then transfer to a RediprimeⅡ (Amersham Pharmacia Biotech, #RPN1633) test tube. After adding 5μl 32P-labeled dCTP to the Rediprime test tube, incubate the probe at 37°C for 15 minutes. Purify the probe by centrifugation through a microcentrifuge G-50 column (Amersham Pharmacia Biotech, #27-5330-01) according to the manufacturer's instructions to remove unincorporated dNTPs. Probe activity is measured using a scintillation counter. Prehybridize the Hybond membrane by wetting it with 20 mL of prewarmed Church's prehybridization solution (500 mM Na3PO4, 1 mM EDTA, 7% SDS, 1% BSA) at 65°C for 30 minutes. Boil the labeled probe for 5 minutes and place on ice for 10 minutes. Add an appropriate amount of probe (1 million counts per 1 mL of prehybridization buffer) to the prehybridization buffer and hybridize overnight at 65°C. The next day, discard the hybridization buffer, rinse with 20 mL of Church's wash solution 1 (40 mM Na3PO4, 1 mM EDTA, 5% SDS, 0.5% BSA), and then wash the membrane in 150 mL of Church's wash solution 1 at 65°C for 20 minutes. Repeat this process twice with Church's wash solution 2 (40 mM Na3PO4, 1 mM EDTA, 1% SDS). Expose the membrane to a phosphor screen or X-ray film to detect probe binding sites.

[0176] Two control samples were included on each Southern run: (1) DNA from a negative (untransformed) segregant to identify any endogenous soybean sequences that hybridized to the element-specific probe; and (2) DNA from a positive segregant into which HindIII-digested pLP086 was introduced in an amount equivalent to one copy number based on the probe length to illustrate the sensitivity of the assay in detecting a single gene copy within the soybean genome.

[0177] Hybridization data provide conclusive evidence supporting TaqMan TMPCR analysis showed that soybean plant LP086-1 contained single copies of the Cry2Ab, Cry1Fa, Cry1Ab, and EPSPS genes. Using the Cry2Ab probe, digestion with EcoRV and MfeI yielded single bands of approximately 16.0 kb and 13.1 kb, respectively. Using the Cry1Fa probe, digestion with MfeI and AvrII yielded single bands of approximately 13.1 kb and 9.3 kb, respectively. Using the Cry1Ab probe, digestion with MfeI and EcoRV yielded single bands of approximately 13.1 kb and 16.0 kb, respectively. Using the EPSPS probe, digestion with EcoRV and AvrII yielded single bands of approximately 16.0 kb and 18.4 kb, respectively. This indicates that one copy each of Cry1Ab, Cry2Ab, Cry1Fa, and EPSPS is present in soybean transformation event LP086-1.

[0178] Example 5 Insect Resistance Detection

[0179] 5.1. Bioassay of soybean plant LP086-1

[0180] Transgenic soybean event LP086-1 and wild-type soybean plants [non-transgenic, transformed recipient control (CK-)] were bioassayed against soybean borer (Leguminivora glycinivorella), fall armyworm (Spodoptera frugiperda), cutworm (Spodoptera litura), cotton bollworm (Helicoverpa armigera), and beet armyworm (Spodoptera exigua) as follows:

[0181] Fresh leaves (V3-V4 stage) from transgenic soybean event LP086-1 and wild-type soybean plants (non-transgenic, transformed recipient control (CK-)) were washed with sterile water and dried with absorbent paper. The leaves were then deveined and cut into approximately 1 cm x 2 cm strips. One to three (the number of leaves was determined based on insect feeding) strips were placed on filter paper moistened with distilled water at the bottom of a circular plastic Petri dish. Ten newly hatched larvae were placed in each dish. The test dishes were covered and incubated for 5 days at a temperature of 26-28°C, a relative humidity of 70%-80%, and a photoperiod (light / dark ratio) of 16:8. The results were then counted. Mortality was calculated (mortality = (number of dead insects / number of test insects) x 100%) to assess resistance levels. The results are shown in Table 7 and Figure 3.

[0182] Table 7. In vitro insect resistance bioassay results of transgenic soybean event LP086-1 - mortality (%)

[0183] 5.2. Field Insect Resistance Evaluation of Transgenic Soybean Event LP086-1

[0184] (1)Bollworm

[0185] The transgenic soybean event LP086-1 was artificially inoculated twice during the soybean seedling stage. Twenty newly hatched larvae were artificially reared and inoculated into the silks of each soybean plant. Three days after inoculation, the second inoculation was performed with the same number of insects as the first. 14-21 days after inoculation, the leaf damage rate, number of surviving larvae per leaf, and leaf damage length were assessed plant by plant. Investigations typically began 14 days after inoculation. If the negative control (CK-) reached susceptible or highly susceptible damage, the inoculation was considered effective. If it did not, the investigation was postponed. However, if it still did not reach the corresponding level 21 days after inoculation, the inoculation was considered ineffective. Based on the leaf damage rate and number of surviving larvae, the average leaf damage level of cotton bollworms at the soybean seedling stage was calculated for each plot according to the criteria in Table 8. The resistance level of soybean seedlings to cotton bollworms was determined according to the criteria in Table 9. The results of the transgenic soybean event LP086-1's resistance to cotton bollworms at the seedling stage are shown in Figure 4 and Table 10. The results showed that the transgenic soybean event LP086-1 had a high level of resistance to cotton bollworm, and the leaf damage rate, larval survival number and leaf damage level of the transgenic soybean event LP086-1 were significantly lower than those of the transformed receptor control (CK-).

[0186] Table 8. Grading standards for the degree of damage to soybean leaves by cotton bollworms

[0187] Table 9. Evaluation criteria for soybean leaf resistance to cotton bollworm

[0188] Table 10. Resistance results of transgenic soybean event LP086-1 to cotton bollworm at the seedling stage

[0189] (2) Beet armyworm

[0190] In March 2021, a natural field susceptibility test against Spodoptera exigua was conducted on transgenic soybeans in Yazhou District, Sanya City, Hainan Province. Ten to 15 days after the initial infestation, when the control (CK-) plants were mostly infested by 4-6-year-old larvae, the damage rate of Spodoptera exigua to soybean plants was investigated plant by plant. The results of the resistance of transgenic soybean event LP086-1 to Spodoptera exigua are shown in Figure 5 and Table 11. The results showed that under the natural occurrence of Spodoptera exigua, the damage rate of Spodoptera exigua to transgenic soybean event LP086-1 was significantly reduced compared to the control (CK-), indicating that transgenic soybean event LP086-1 has a high resistance to Spodoptera exigua.

[0191] Table 11. Resistance results of transgenic soybean event LP086-1 to beet armyworm under natural insect infestation conditions

[0192] (3) Fall armyworm

[0193] In March 2021, a natural field susceptibility test of fall armyworm was conducted at a transgenic soybean planting base in Yazhou District, Sanya City, Hainan Province. 10-15 days after the initial occurrence of insect infestation, and when the transformed receptor control (CK-) was mostly damaged by 4-6-year-old larvae, the damage rate of fall armyworm to soybean plants was investigated plant by plant. The results of the resistance of the transgenic soybean event LP086-1 to fall armyworm are shown in Figure 6 and Table 12. The results showed that under the natural occurrence conditions of fall armyworm, the damage rate of fall armyworm to the transgenic soybean event LP086-1 was significantly reduced compared with the control (CK-), indicating that the transgenic soybean event LP086-1 has a high resistance to fall armyworm.

[0194] Table 12. Resistance results of transgenic soybean event LP086-1 to Spodoptera frugiperda under natural insect infestation conditions

[0195] (4) Spodoptera litura

[0196] In March 2021, a field natural insect susceptibility test of Spodoptera litura was conducted at a transgenic soybean planting base in Yazhou District, Sanya City, Hainan Province. 10-15 days after the initial occurrence of insect infestation, and when the transformed recipient control (CK-) was mostly damaged by 4-6-year-old larvae, the damage rate of Spodoptera litura to soybean plants was investigated plant by plant. The results of the resistance of the transgenic soybean event LP086-1 to Spodoptera litura are shown in Table 13. The results showed that under the natural occurrence conditions of Spodoptera litura, the damage rate of Spodoptera litura to the transgenic soybean event LP086-1 was significantly reduced compared with the control (CK-), indicating that the transgenic soybean event LP086-1 has a high resistance to Spodoptera litura.

[0197] Table 13. Resistance results of transgenic soybean event LP086-1 to L. litura under natural insect infestation conditions

[0198] (5) Soybean borer

[0199] In March 2021, a natural field infestation test against soybean borer was conducted at a transgenic soybean planting base in Yazhou District, Sanya City, Hainan Province. Ten to 15 days after the initial infestation, when the transformed recipient control (CK-) was mostly 4-6-year-old larvae, the soybean borer damage rate on each soybean plant was investigated. The results of the transgenic soybean event LP086-1's resistance to soybean borer are shown in Table 14. The results showed that under naturally occurring conditions of soybean borer, the soybean borer damage rate on the transgenic soybean event LP086-1 was significantly reduced compared to the control (CK-), indicating that the transgenic soybean event LP086-1 has a high resistance to soybean borer.

[0200] Table 14. Resistance results of transgenic soybean event LP086-1 to soybean borer under natural insect infestation conditions

[0201] Example 6 Herbicide Tolerance Testing of Soybean Transformation Events

[0202] This experiment used Roundup herbicide (41% glyphosate isopropyl ammonium salt solution) for spraying. A randomized block design was used with 3 replicates. The plot area was 20m 2 Plots were plotted in a 5m x 4m plot with 340 seedlings and conventional cultivation management, with 1m-wide isolation strips between plots. Transgenic soybean event LP086-1 and a transgenic control (CK-) were treated with the following two treatments: 1) spraying with water; 2) spraying with Roundup herbicide at a dose of 3360 g.ae / ha at the V3 leaf stage, followed by a second spray at the V8 stage. It should be noted that the following conclusions were based on the conversion of different glyphosate herbicide concentrations and formulations to equivalent amounts of glyphosate acid. Pesticide injury symptoms were assessed one and two weeks after application, and plot yields were measured at harvest. The grading criteria for phytotoxicity symptoms are shown in Table 15. The herbicide damage rate was used as an evaluation metric to assess herbicide tolerance in transformation events. Specifically, herbicide damage rate (%) = ∑ (number of affected plants in the same class × number of classes) / (total number of plants × highest class) × 100. The herbicide damage rate refers to the glyphosate damage rate, which was determined based on the results of a two-week phytotoxicity survey. Soybean yield in each plot was calculated by weighing the total soybean yield (weight) of the three central rows of each plot. Yield differences between treatments were measured as yield percentages: yield percentage (%) = yield after glyphosate application / yield after water application × 100. The herbicide tolerance and soybean yield results for transgenic soybean event LP086-1 are shown in Figure 7 and Table 16.

[0203] Table 15. Grading standards for the degree of damage caused by glyphosate herbicides to soybeans

[0204] Table 16. Results of glyphosate herbicide tolerance and soybean yield of transgenic soybean event LP086-1

[0205] The results showed that in terms of herbicide (glyphosate) damage rate: 1) the transgenic soybean event LP086-1 had a damage rate of essentially zero when treated with glyphosate herbicide (3360 g.ae / ha), indicating that the transgenic soybean event LP086-1 had good glyphosate herbicide tolerance.

[0206] In terms of yield: There was no significant difference in the yield of the transgenic soybean event LP086-1 under the two treatments of spraying with pure water and spraying with 3360g ae / ha of glyphosate. After spraying with glyphosate herbicide, the yield of the transgenic soybean event LP086-1 was slightly increased compared with the treatment of spraying with pure water, which further demonstrated that the transgenic soybean event LP086-1 has good tolerance to glyphosate herbicide.

[0207] In summary, TaqMan TM Regenerated transgenic soybean plants were analyzed (see Example 2) for the presence of the cry1Ab, cry2Ab, cry1Fa, and epsps genes, and the copy number of insect-resistant and glyphosate-tolerant lines was characterized. Based on the copy number of the target gene, good insect resistance, glyphosate herbicide tolerance, and agronomic performance (see Examples 5 and 6), event LP086-1 was selected as superior, possessing a single copy of the transgene, good insect resistance, glyphosate herbicide tolerance, and excellent agronomic performance.

Claims

1. A nucleic acid sequence, characterized in that It includes one or more of the sequences SEQ ID NO: 1-7 or their complementary sequences, wherein the nucleic acid sequence is derived from the transgenic soybean event LP086-1, and a representative sample of the seeds of the transgenic soybean event LP086-1 has been deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO: P202325.

2. The nucleic acid sequence according to claim 1, characterized in that The nucleic acid sequence includes one or more groups of sequences from the first group of sequences to the third group of sequences; the first group of sequences includes a first small group of sequences and / or a second small group of sequences; the first small group of sequences is at least 11 consecutive nucleotides in SEQ ID NO:3 or its complementary sequence; the second small group of sequences includes at least 11 consecutive nucleotides in SEQ ID NO:4 or its complementary sequence; the second group of sequences includes a third small group of sequences and / or a fourth small group of sequences; the third small group of sequences includes SEQ ID NO:1 or its complementary sequence, and the fourth small group of sequences includes SEQ ID NO:2 or its complementary sequence; the third group of sequences includes SEQ ID NO:5 or its complementary sequence.

3. The nucleic acid sequence according to claim 1 or 2, characterized in that The nucleic acid sequence is shown in one or more of SEQ ID NO: 1-2, SEQ ID NO: 3-4, SEQ ID NO: 5 or their complementary sequences.

4. A DNA primer pair, comprising a first primer and a second primer, characterized in that: The first primer and the second primer each contain a partial sequence of SEQ ID NO:5 or its complementary sequence; when the first primer and the second primer are used for an amplification reaction together with DNA containing the transgenic soybean event LP086-1, an amplicon of the transgenic soybean event LP086-1 in the detection sample is generated; a representative sample of seeds of the transgenic soybean event LP086-1 has been deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO:P202325.

5. The DNA primer pair according to claim 4, characterized in that: The first primer is selected from SEQ ID NO:1 or its complementary sequence, SEQ ID NO:8 or SEQ ID NO:12; the second primer is selected from SEQ ID NO:2 or its complementary sequence, SEQ ID NO:11 or SEQ ID NO:

14.

6. The DNA primer pair according to claim 4, characterized in that: The first primer is selected from SEQ ID NO:1 or its complementary sequence, SEQ ID NO:8 or SEQ ID NO:12, and the second primer is selected from SEQ ID NO:9 or SEQ ID NO:13; or the first primer is selected from SEQ ID NO:2 or its complementary sequence, SEQ ID NO:10 or SEQ ID NO:15, and the second primer is selected from SEQ ID NO:11 or SEQ ID NO:

14.

7. A DNA probe, characterized in that A DNA probe comprising a partial sequence of SEQ ID NO: 5 or a complementary sequence thereof; the DNA probe hybridizes with a DNA molecule comprising a nucleic acid sequence selected from claim 1 under stringent hybridization conditions, and does not hybridize with a DNA molecule not containing a nucleic acid sequence selected from claim 1 under stringent hybridization conditions.

8. The DNA probe according to claim 7, characterized in that The DNA probe comprises a sequence selected from SEQ ID NO: 3 or its complementary sequence, SEQ ID NO: 4 or its complementary sequence.

9. The DNA probe according to claim 8, characterized in that The DNA probe includes at least 11 consecutive nucleotides in SEQ ID NO: 3 or its complementary sequence, or at least 11 consecutive nucleotides in SEQ ID NO: 4 or its complementary sequence.

10. The DNA probe according to claim 7, characterized in that The DNA probe includes the 1st to 11th or 12th to 22nd consecutive nucleotides in SEQ ID NO: 1 or its complementary sequence, or the 1st to 11th or 12th to 22nd consecutive nucleotides in SEQ ID NO: 2 or its complementary sequence.

11. The DNA probe according to claim 10, characterized in that The DNA probe comprises a sequence selected from SEQ ID NO: 1 or a complementary sequence thereof, SEQ ID NO: 2 or a complementary sequence thereof, SEQ ID NO: 6 or a complementary sequence thereof, and SEQ ID NO: 7 or a complementary sequence thereof.

12. The DNA probe according to any one of claims 7 to 11, characterized in that The DNA probe is labeled with a fluorescent group.

13. A marker nucleic acid molecule, characterized in that A partial sequence of SEQ ID NO: 5 or its complementary sequence; the marker nucleic acid molecule hybridizes with a DNA molecule comprising a nucleic acid sequence selected from claim 1 under stringent hybridization conditions, and does not hybridize with a DNA molecule not containing a nucleic acid sequence selected from claim 1 under stringent hybridization conditions.

14. The marker nucleic acid molecule according to claim 13, characterized in that The marker nucleic acid molecule includes at least 11 consecutive nucleotides in SEQ ID NO:3 or its complementary sequence, or at least 11 consecutive nucleotides in SEQ ID NO:4 or its complementary sequence; or the marker nucleic acid molecule includes the 1st to 11th or 12th to 22nd consecutive nucleotides in SEQ ID NO:1 or its complementary sequence, or the 1st to 11th or 12th to 22nd consecutive nucleotides in SEQ ID NO:2 or its complementary sequence.

15. The marker nucleic acid molecule according to claim 14, characterized in that The marker nucleic acid molecule comprises a sequence selected from SEQ ID NO: 3 or its complementary sequence, SEQ ID NO: 4 or its complementary sequence.

16. The marker nucleic acid molecule according to claim 13, characterized in that The marker nucleic acid molecule comprises a sequence selected from SEQ ID NO: 1 or its complementary sequence, SEQ ID NO: 2 or its complementary sequence, SEQ ID NO: 6 or its complementary sequence and SEQ ID NO: 7 or its complementary sequence.

17. A method for detecting the presence of DNA comprising transgenic soybean event LP086-1 in a sample, characterized in that: include: (1) contacting a sample to be tested with the DNA primer pair according to any one of claims 2 to 6 in a nucleic acid amplification reaction; (2) performing a nucleic acid amplification reaction; (3) detecting the presence of amplification products; The amplification product includes a nucleic acid sequence selected from the sequence SEQ ID NO: 1-7 or its complementary sequence, indicating that the sample to be detected contains the DNA of the transgenic soybean event LP086-1; a representative sample of the seeds of the transgenic soybean event LP086-1 has been deposited in the China Center for Type Culture Collection with the deposit number CCTCCNO: P202325.

18. A method for detecting the presence of DNA comprising transgenic soybean event LP086-1 in a sample, characterized in that: include: (1) contacting a sample to be tested with the DNA probe according to any one of claims 7 to 12, and / or the marker nucleic acid molecule according to any one of claims 13 to 16; (2) hybridizing the sample to be detected with the DNA probe and / or the marker nucleic acid molecule under stringent hybridization conditions; (3) detecting the hybridization between the sample to be detected and the DNA probe and / or the marker nucleic acid molecule; Representative samples of seeds of the transgenic soybean event LP086-1 have been deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO: P202325.

19. The method according to claim 18, characterized in that The stringent hybridization conditions include: hybridization in a 6× sodium citrate, 0.5% sodium dodecyl sulfate solution at 65° C., and then washing the membrane once with 2× sodium citrate, 0.1% sodium dodecyl sulfate and once with 1× sodium citrate, 0.1% sodium dodecyl sulfate.

20. A DNA detection kit, characterized in that: include: The DNA primer pair and detection reagent according to any one of claims 2-6; the detection reagent is the DNA probe according to any one of claims 7-12 and / or the marker nucleic acid molecule according to any one of claims 13-16.

21. [Corrected 12.08.2024 in accordance with Rule 91] A soybean transgenic plant cell, characterized in that: The invention comprises a nucleic acid sequence encoding insect-resistant Cry1Ab, Cry2Ab and Cry1Fa proteins, a nucleic acid sequence encoding glyphosate herbicide-tolerant EPSPS protein and a nucleic acid sequence in a specific region; the nucleic acid sequence in the specific region comprises a sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 or SEQ ID NO:

7.

22. [Corrected 12.08.2024 in accordance with Rule 91] A method for protecting soybean plants from insect attack, characterized in that The method comprises providing at least one transgenic soybean plant cell in the diet of the target insect, wherein the genome of the transgenic soybean plant cell sequentially comprises SEQ ID NO:1, the nucleic acid sequences at positions 653-16758 of SEQ ID NO:5 and SEQ ID NO:2; or the genome of the transgenic soybean plant cell comprises the sequence shown in SEQ ID NO:5; the target insect that ingests the transgenic soybean plant cell is inhibited from further ingesting the soybean plant; and the seeds of the transgenic soybean plant have been deposited in the China Center for Type Culture Collection with the deposit number CCTCCNO:P202325.

23. [Corrected 12.08.2024 in accordance with Rule 91] A method for protecting soybean plants from damage caused by herbicides, characterized in that Planting at least one transgenic soybean plant, wherein the genome of the transgenic soybean plant sequentially comprises SEQ ID NO: 1, the nucleic acid sequences at positions 1530-16758 of SEQ ID NO: 5 and SEQ ID NO: 2; or the genome of the transgenic soybean plant comprises the sequence shown in SEQ ID NO: 5; the seeds of the transgenic soybean plant have been deposited in the China Center for Type Culture Collection with the deposit number CCTCCNO: P202325.

24. [Corrected 12.08.2024 in accordance with Rule 91] A method for controlling weeds in a field growing soybean plants, characterized in that The method comprises applying an effective dose of glyphosate herbicide to a field planted with at least one transgenic soybean plant, wherein the genome of the transgenic soybean plant sequentially comprises SEQ ID NO:1, the nucleic acid sequences at positions 1530-16758 of SEQ ID NO:5 and SEQ ID NO:2; or the genome of the transgenic soybean plant comprises the sequence shown in SEQ ID NO:5; and the seeds of the transgenic soybean plant have been deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO:P202325.

25. [Corrected 12.08.2024 in accordance with Rule 91] A method for growing soybean plants resistant to insects, characterized in that include: Planting at least one soybean seed, wherein the genome of the soybean seed sequentially comprises SEQ ID NO:1, the nucleic acid sequences at positions 653-16758 of SEQ ID NO:5, and SEQ ID NO:2; or the genome of the soybean seed comprises the sequence shown in SEQ ID NO:5; allowing the soybean seed to grow into a soybean plant; invading the soybean plant with target insects, and harvesting the plant with reduced plant damage compared to other plants other than the soybean seed.

26. [Corrected 12.08.2024 in accordance with Rule 91] A method for growing soybean plants that are resistant to insects and tolerant to glyphosate herbicides, characterized in that include: Planting at least one soybean seed, wherein the genome of the soybean seed sequentially comprises SEQ ID NO:1, the nucleic acid sequence at positions 653-16758 of SEQ ID NO:5, and SEQ ID NO:2; or the genome of the soybean seed comprises the sequence shown in SEQ ID NO:5; allowing the soybean seed to grow into a soybean plant; invading the soybean plant with target insects, and spraying the soybean plant with an effective dose of glyphosate herbicide, and harvesting plants with reduced plant damage compared to other plants other than the soybean seeds, wherein the plants with reduced plant damage are also resistant to insect feeding damage.

27. [Corrected 12.08.2024 in accordance with Rule 91] A method for producing soybean plants resistant to insects, characterized in that The method comprises introducing transgenic soybean event LP086-1 into the genome of the soybean plant, and selecting soybean plants with reduced plant damage to target insect feeding; representative samples of seeds of the transgenic soybean event LP086-1 have been deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO: P202325.

28. [Corrected 12.08.2024 in accordance with Rule 91] A method according to claim 27, characterized in that The method comprises: sexually crossing a first parent soybean plant of a transgenic soybean event LP086-1 that is resistant to insects with a second parent soybean plant that lacks insect resistance to produce a plurality of progeny plants; infesting the progeny plants with target insects; and selecting the progeny plants that have reduced plant damage compared to other plants that do not have the transgenic soybean event LP086-1.

29. [Corrected 12.08.2024 in accordance with Rule 91] A processed product produced from transgenic soybean event LP086-1, characterized in that: The processed products are soybean oil, dregs and feed; the seeds of the transgenic soybean event LP086-1 have been deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO: P202325.

30. [Corrected 12.08.2024 according to Rule 91] A product produced from transgenic soybean event LP086-1, including soybean meal, soybean protein, soybean products, and other foods to be consumed by animals as a food source, or as a component of soybean oil or stearic acid for food industry use; the seeds of the transgenic soybean event LP086-1 have been deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO: P202325.

Images