Method for purifying cells

Abstract

The purpose of the present invention is to provide a method in which even when a small number of mutant cells are mixed before expansive culturing, the mutant cells are detected and removed to purify normal cells, and a purified cell population can be obtained. The present invention involves a step (step 1) for fractionating the cell population and culturing same, a step (step 2) for detecting mutant cells in each cultured fraction, and a step (step 3) for culturing cells of a fraction in which no mutant cell was detected. The method makes it possible to produce purified normal cells from a cell population containing mutant cells at a mixing ratio of 1% or less.

Description

Cell purification method

[0001] The present invention relates to a method for purifying normal cells from a cell population contaminated with mutant cells. The present invention also relates to a method for identifying contaminating cells having a mutation in the EP300 gene as mutant cells, and primers and probes suitable for the method.

[0002] In recent years, cell-based drug discovery and regenerative medicine have made remarkable progress, and research and development continues. Cells are typically used as a collection of individual cells, i.e., as a cell population. However, individual cells within a cell population are not necessarily uniform. Mutant cells may be present at a certain rate. Therefore, it is desirable and even necessary to remove such mutant cells in advance to ensure experimental accuracy and reproducibility, as well as safety in medical applications. When there is a certain level of contamination, limiting dilution, for example, can remove mutant cells by limiting dilution. This is a classic method for isolating single cells. This method involves creating a dilution series that theoretically yields one cell per well, and then observing the cells in each well. Therefore, when the contamination rate is low, the process becomes cumbersome and inefficient. The presence or absence of mutations in the cells in each well is confirmed, and only the non-mutated cells are expanded and cultured (Non-Patent Document 1). Since limiting dilution requires multiplication from a single cell, which is time-consuming and inefficient, methods for efficiently ensuring single cell isolation have been explored (Patent Document 1).

[0003] JP 2018-148830 A

[0004] "Single Cell Cloning," Cellavista (CellVista Corporation), AppLication Note, searched on the Internet on July 19, 2023. URL: http: / / www.primetech.co.jp / Portals / 0 / db / product / SynenTec / Cellavista_App_Single_Cell_Cloning_J_rev00_201303.pdf

[0005] iPS cells and other cells are difficult to grow when the cell number is small, and some cells are difficult to remove mutant cells from using limiting dilution. Furthermore, if the number of mutant cells in a cell population is extremely small, limiting dilution may result in expansion without noticing the presence of mutant cells. If the mutant cells divide faster than normal cells, the proportion of mutant cells may increase with expansion, potentially affecting the efficacy and safety of the final product (drug). The present invention aims to provide a method that enables the purification of normal cells and the production of a purified cell population by detecting and removing mutant cells, even if a small number of mutant cells are present before expansion.

[0006] In view of the above problems, the present inventors have found that when the rate of mutant cell contamination in a cell population is low, the efficiency of mutant cell detection can be improved by dividing the cell population into several fractions containing a certain number of cells rather than one cell per well and culturing them, and then purifying the cell population by culturing the cells in the fractions in which no mutant cells were detected.Furthermore, based on the first-ever finding by the present inventors that cell populations, particularly pluripotent stem cells, preferably iPS cells, may be contaminated with mutant cells having a mutation in the EP300 gene, the present inventors have succeeded in designing primers and / or probes capable of detecting such mutant cells, thereby completing the present invention.

[0007] That is, the present invention provides the following. [1] A method for purifying normal cells from a cell population containing mutant cells at a contamination rate of 1% or less, comprising the following steps: Step 1: fractionating the cell population and culturing the fraction, Step 2: detecting mutant cells in each cultured fraction, and Step 3: culturing cells in fractions in which mutant cells are not detected. [2] The method of [1], which comprises one or more expansion culture steps between Steps 1 and 2. [3] The method of [1] or [2], wherein the contamination rate is 0.1 to 1%. [4] The method of any of [1] to [3], wherein the number of fractions in Step 1 is 20 to 30. [5] In Step 1, 0.05 to 2 x 10 per fraction is used. ３ cells / cm ２[6] The method according to any one of [1] to [3], wherein in step 1, the number of fractions is 90 to 100. [7] In step 1, the number of fractions is 0.03 to 3 x 10 per fraction. ３ cells / cm ２[8] The method according to any one of [1] to [7], wherein the cells are pluripotent stem cells. [9] The method according to [8], wherein the pluripotent stem cells are iPS cells.

[10] The method according to any one of [1] to [9], wherein the mutation is a mutation in the EP300 gene.

[11] The method according to

[10] , wherein the mutation in the EP300 gene is a partial deletion in the PHD (Plant homeodomain) region of the EP300 gene.

[12] A primer set for specifically detecting a mutation in the PHD region of the EP300 gene, the primer set comprising a combination of a forward primer having the nucleotide sequence of SEQ ID NO: 7 and a reverse primer having the nucleotide sequence of SEQ ID NO: 8.

[13] A probe for specifically detecting a mutation in the PHD region of the EP300 gene, the probe having the nucleotide sequence of SEQ ID NO: 9.

[14] A primer set for detecting a PHD region of the EP300 gene, the primer set comprising a combination of a forward primer having the nucleotide sequence of SEQ ID NO: 1 and a reverse primer having the nucleotide sequence of SEQ ID NO: 2.

[15] A probe for detecting a PHD region of the EP300 gene, the primer set comprising a combination of a forward primer having the nucleotide sequence of SEQ ID NO: 3 and a reverse primer having the nucleotide sequence of SEQ ID NO: 4.

[17] A probe for detecting the EP300 gene, the primer set comprising a combination of a forward primer having the nucleotide sequence of SEQ ID NO: 4 and a reverse primer having the nucleotide sequence of SEQ ID NO: 5.

[18] A primer set for amplifying a target nucleic acid sequence, the primer set comprising a combination of a forward primer having the nucleotide sequence of SEQ ID NO: 10 and a reverse primer having the nucleotide sequence of SEQ ID NO: 11, the target nucleic acid sequence being located within a PHD region of the EP300 gene having a mutation.

[19] The primer set according to

[18] , wherein the mutation in the EP300 gene is a partial deletion in the PHD region of the EP300 gene.

[20] The method according to [1], characterized in that in step 2, the primer set according to

[12] and the probe according to

[13] are used.

[21] The method according to [1], characterized in that the primer set according to

[18] is used in step 2. [A] A method for purifying normal cells from a cell population containing mutant cells at a contamination rate of 1% or less, the method comprising the following steps: step 1: fractionating the cell population and culturing the fraction, step 2: detecting mutant cells in each cultured fraction, and step 3: culturing cells in fractions in which mutant cells are not detected, wherein the cells are pluripotent stem cells, and in step 1, the number of fractions is 20 to 30, and the seeding density per fraction is 0.05 to 2 x 10. ３ cells / cm ２ [B] A method for purifying normal cells from a cell population containing mutant cells at a contamination rate of 1% or less, the method comprising the following steps: Step 1: fractionating the cell population and culturing the fraction; Step 2: detecting mutant cells in each cultured fraction; and Step 3: culturing cells in fractions in which mutant cells are not detected, wherein the cells are pluripotent stem cells, and in Step 1, the number of fractions is 90 to 100, and the seeding density per fraction is 0.03 to 3 x 10 ３ cells / cm ２[C] The method of [A] or [B], comprising one or more expansion culture steps between step 1 and step 2. [D] The method of any of [A] to [C], wherein the contamination rate is 0.1 to 1%. [E] The method of any of [A] to [D], wherein the pluripotent stem cells are iPS cells. [F] The method of any of [A] to [E], wherein the mutation is in the EP300 gene. [G] The method of [F], wherein the mutation in the EP300 gene is a partial deletion in the PHD (plant homeodomain) region of the EP300 gene. [H] The method of [A] or [B], wherein the primer set of

[12] and the probe of

[13] are used in step 2. [I] The method of [A] or [B], wherein the primer set of

[18] is used in step 2. [J] The method of [H] further employs a primer set and probe for detecting the PHD region of the EP300 gene, wherein the primer set is a combination of a forward primer having the nucleotide sequence of SEQ ID NO: 1 and a reverse primer having the nucleotide sequence of SEQ ID NO: 2, and the probe has the nucleotide sequence of SEQ ID NO: 3. [K] The method of [H] further employs a primer set and probe for detecting the EP300 gene, wherein the primer set is a combination of a forward primer having the nucleotide sequence of SEQ ID NO: 4 and a reverse primer having the nucleotide sequence of SEQ ID NO: 5, and the probe has the nucleotide sequence of SEQ ID NO: 6. [L] The method of [J] further employs a primer set and probe for detecting the EP300 gene, wherein the primer set is a combination of a forward primer having the nucleotide sequence of SEQ ID NO: 4 and a reverse primer having the nucleotide sequence of SEQ ID NO: 5, and the probe has the nucleotide sequence of SEQ ID NO: 6.

[0008] Because culture is performed starting from a certain number of cells, the culture time required to reach a certain number of cells can be shortened compared to limiting dilution, and mutant cells can be detected even when the contamination rate is low, allowing for efficient removal of mutant cells. By performing this method before expansion of iPS cells, mutant cells that are difficult to detect before expansion can be found and removed early, preventing contamination with mutant cells after expansion.

[0009]

[0033] Figure 1 is a schematic diagram illustrating the cell purification method of the present invention (a method for obtaining a cell population free of mutant cells). In the figure, P indicates the passage number; for example, P16 means 16 passages. "P16 → P17 in dormancy" means that cells that have been passaged 16 times were cryopreserved and the cryopreserved cells were put into dormancy (17th passage).

[0034] Figure 1 shows the positions of each primer (arrow) and each probe (oval) on the genome of the wild-type EP300 gene (WT) and the mutant EP300 gene (Mutant). 1 indicates the common region, 2 indicates the deleted region, and 3 indicates the region containing the cleavage site. VIC (registered trademark): carboxyrhodamine, FAM (trademark): Carboxyfluorescein, MGB: minor groove binder, NFQ: nonfluorescent quencher.

[0035] Figure 1 is a diagram illustrating the results of multiplex PCR performed using samples prepared from cells carrying the wild-type EP300 gene (WT) and the mutant EP300 gene (Mutant). The horizontal axis represents the cycle number, and the vertical axis represents the magnitude of the fluorescent signal (ΔRn). A region including a common region was investigated. This figure shows the results of multiplex PCR performed using samples prepared from cells having a wild-type EP300 gene (WT) and a mutant EP300 gene (Mutant). The horizontal axis represents the cycle number, and the vertical axis represents the magnitude of the fluorescent signal (ΔRn). A region including a deletion region was investigated. This figure shows the results of multiplex PCR performed using samples prepared from cells having a wild-type EP300 gene (WT) and a mutant EP300 gene (Mutant). The horizontal axis represents the cycle number, and the vertical axis represents the magnitude of the fluorescent signal (ΔRn). A region including a mutation region was investigated. This figure shows the results of performing qPCR using samples prepared from cells having a wild-type EP300 gene (WT) and a mutant EP300 gene (Mutant) to investigate the expression of the mutant region (upper row) and the deletion region (lower row). The graph shows the relative expression of the common region as an endogenous control. RT-PCR was performed using samples prepared from cells with the wild-type EP300 gene (EP300 deletion-; MCB P15) and cells with the mutant EP300 gene (EP300 deletion+; CECSi), and the results were analyzed for the expression of each region.This figure shows the results of RT-PCR performed using samples prepared from cells with a wild-type EP300 gene (EP300 deficiency-; MCB P15) and cells with a mutant EP300 gene (EP300 deficiency+; CECSi) to examine the expression of each region. Cell populations were prepared by gradually changing the contamination rate of cells with a mutant EP300 gene (EP300 deficiency+), and this graph shows the results of quantitative PCR performed using samples prepared from each sample. Contamination rates of approximately 0.1% were detected. The horizontal axis shows the contamination rate (spike rate) of EP300 deficiency+. The vertical axis shows the relative value when the value of the group with a 100% contamination rate of EP300 deficiency+ is set to 100%. This figure shows the positions of each primer on the wild-type EP300 gene (WT) and mutant EP300 gene (MT).

[0010] The present invention will now be described. Terms used in this specification have the meanings commonly used in the art unless otherwise specified.

[0011] 1. Cell Purification Method The present invention provides a method for purifying normal cells from a cell population containing mutant cells (hereinafter also referred to as the purification method of the present invention). The purification method of the present invention comprises the following steps: Step 1: fractionating and culturing the cell population, Step 2: detecting mutant cells in each cultured fraction, and Step 3: culturing cells in the fraction in which mutant cells are not detected.

[0012] (Step 1) Step 1 is a step of fractionating and culturing a cell population containing mutant cells. Here, the "cell population containing mutant cells" to which step 1 is applied is a cell population that is or may be contaminated with mutant cells, but it does not necessarily have to be contaminated. A high contamination rate may result in mutant cells being contained in all fractions, making step 3 impossible to perform. Therefore, the mutant cell contamination rate is preferably 1% or less, and may be 0.9% or less, 0.8% or less, 0.7% or less, 0.6% or less, 0.5% or less, 0.4% or less, 0.3% or less, or 0.2% or less. From the perspective of ease of detection in step 2, a contamination rate of 0.1% or more is preferable. However, since it is ultimately desirable that mutant cells are not contaminated, a contamination rate of less than 0.1% may be acceptable. The fractionation of the cell population is not particularly limited in terms of the number of fractions or the number of cells per fraction, as long as steps 2 and 3 can be performed appropriately. For example, when the number of fractions is 20 to 30, each fraction may contain 0.05 to 2 x 10 ３ cells / cm ２ For example, when the number of fractions is 90 to 100, the density of each fraction is 0.03 to 3 × 10 ３ cells / cm ２ As shown in Figure 1, the number of fractions can be changed stepwise (e.g., 96 wells → 24 wells → 6 wells) during culture, and from the viewpoint of improving the yield of cells without mutation, it is preferable to carry out one or more expansion culture steps, preferably two expansion culture steps, between step 1 and step 2. The cells are not particularly limited as long as they are cells that may undergo mutation and have the ability to proliferate, but stem cells are preferred. Pluripotent stem cells are particularly preferred, and iPS cells are especially preferred. In one preferred embodiment of the present invention, the cells are pluripotent stem cells, and in step 1, the number of fractions is 20 to 30, and the seeding density per fraction is 0.05 to 2 x 10 ３ cells / cm ２ In another preferred embodiment of the present invention, the cells are pluripotent stem cells, and in step 1, the number of fractions is 90 to 100, and the seeding density per fraction is 0.03 to 3 x 10 ３ cells / cm ２ is.

[0013] Stem cells are cells that have the ability to replicate themselves and differentiate into cells of multiple lineages. Examples of stem cells include, but are not limited to, embryonic stem cells (ES cells), embryonic tumor cells, embryonic germ stem cells, induced pluripotent stem cells (iPS cells), neural stem cells, hematopoietic stem cells, mesenchymal stem cells, liver stem cells, pancreatic stem cells, muscle stem cells, germ stem cells, intestinal stem cells, cancer stem cells, hair follicle stem cells, and skin stem cells.

[0014] Pluripotent stem cells can be induced from fertilized eggs, cloned embryos, germline stem cells, tissue stem cells, somatic cells, etc. Examples of pluripotent stem cells include embryonic stem cells (ES cells), embryonic germ cells (EG cells), and induced pluripotent stem cells (iPS cells). Muse cells (Multi-lineage differentiating Stress Enduring cells) obtained from mesenchymal stem cells (MSCs) and GS cells prepared from germ cells (e.g., testes) are also included in pluripotent stem cells.

[0015] ES cells can be produced by culturing the inner cell population on feeder cells or in a medium containing leukemia inhibitory factor (LIF). They are also available from designated institutions and can be purchased commercially. Nuclear transfer ES cells (ntES cells), a type of ES cell, can be established from a cloned embryo produced by transplanting the nucleus of a somatic cell into an egg from which the nucleus has been removed.

[0016] EG cells can be produced by culturing primordial germ cells in a medium containing mouse stem cell factor (mSCF), LIF, and basic fibroblast growth factor (bFGF) (Cell, 70:841-847, 1992).

[0017] iPS cells are cells in which pluripotency has been induced by reprogramming somatic cells using known methods. Specific examples of iPS cells include cells in which pluripotency has been induced by reprogramming somatic cells differentiated into fibroblasts, peripheral blood mononuclear cells, etc., through the expression of multiple genes selected from a group of reprogramming genes including Oct3 / 4, Sox2, Klf4, Myc (c-Myc, N-Myc, L-Myc), Glis1, Nanog, Sall4, lin28, Esrrb, etc. In 2006, Yamanaka et al. established induced pluripotent stem cells using mouse cells (Cell, 2006, 126(4) pp.663-676). In 2007, induced pluripotent stem cells were established from human fibroblasts and possess the same pluripotency and self-renewal capabilities as embryonic stem cells (Cell, 2007, 131(5) pp.861-872; Science, 2007, 318(5858) pp.1917-1920; Nat. Biotechnol., 2008, 26(1) pp.101-106). In addition to direct reprogramming via gene expression, induced pluripotent stem cells can also be induced from somatic cells by the addition of chemical compounds (Science, 2013, 341, pp.651-654).

[0018] Somatic cells used in producing induced pluripotent stem cells are not particularly limited, but include tissue-derived fibroblasts, blood cells (e.g., peripheral blood mononuclear cells, T cells, etc.), hepatocytes, pancreatic cells, intestinal epithelial cells, smooth muscle cells, etc.

[0019] When producing induced pluripotent stem cells, if reprogramming is performed by expressing several types of genes (e.g., four factors: Oct3 / 4, Sox2, Klf4, and Myc), the means for expressing the genes is not particularly limited. Examples of means for expressing genes include infection methods using viral vectors (e.g., retroviral vectors, lentiviral vectors, Sendai virus vectors, adenoviral vectors, and adeno-associated viral vectors), gene transfer methods using plasmid vectors (e.g., plasmid vectors and episomal vectors) (e.g., calcium phosphate method, lipofection method, retronectin method, and electroporation method), gene transfer methods using RNA vectors (e.g., calcium phosphate method, lipofection method, and electroporation method), and direct protein injection methods.

[0020] It is also possible to obtain established induced pluripotent stem cells. Specifically, iPS cells include 201B7, 201B7-Ff, 253G1, 253G4, 1201C1, 1205D1, 1210B2, 836B3, FF-I14s03, FF-I01s04, MH09s01, Ff-XT18s02, Ff-WIs03, Ff-WJs513, Ff-CLs14, Ff-KVs09, QHJI14s03, QHJI01s04, RWMH09s01, DRXT18s02, RJWIs03, YZWJs513, ILCLs14, GLKVs09, Ff-XT28s05-ABo_To, Ff-I01s04-ABII-KO, Ff-I14s04-ABII-KO (all from iPS Academia Japan, Inc. or Kyoto University iPS Research Foundation), Tic (JCRB1331 strain), Dotcom (JCRB1327 strain), Squeaky (JCRB1329 strain), Toe (JCRB1338 strain), and Lollipop (JCRB1336 strain) (all from the National Center for Child Health and Development, Department of Rare and Intractable Diseases and Disease Resources Research, National Institute of Biomedical Innovation, JCRB Cell Bank), UTA-1 and UTA-1-SF-2-2 strains (all from the University of Tokyo), 21526, 21528, 21530, 21531, 31536, and 31538 strains (all from the University of Tokyo). Alternatively, strains such as ATCC-DYP0730, ATCC-DYP0250, ATCC-HYR0103, ATCC-DYR0100, ATCC-DYR0530, ATCC-DYS0530, ATCC-DYP0530, ATCC-DYS0100, ATCC-HYS0103, ATCC-CYS0105, KYOU-DXR0109B, ATCC-BYS0110, ATCC-BYS0111, ATCC-BYS0112, ATCC-BYS0113, ATCC-BXS0114, ATCC-BXS0115, ATCC-BXS0116, and ATCC-BXS0117 (all from the non-profit American Type Culture Collection) can be used.

[0021] The induced pluripotent stem cells can be induced to differentiate into various cells, for example, corneal endothelial replacement cells (sometimes referred to as "CECSi cells" in this specification).

[0022] "Mammals" include rodents, ungulates, felines, lagomorphs, primates, etc. Rodents include mice, rats, hamsters, guinea pigs, etc. Ungulates include pigs, cows, goats, horses, sheep, etc. Felidae include dogs, cats, etc. Lagomorphs include rabbits, etc. "Primates" refers to mammals belonging to the order Primates, and includes prosimians such as lemurs, lorises, and tree shrews, and anthropoids such as monkeys, apes, and humans.

[0023] The pluripotent stem cells used in the present invention are mammalian pluripotent stem cells, preferably rodent (e.g., mouse, rat) or primate (e.g., human, monkey) pluripotent stem cells, and most preferably human pluripotent stem cells.

[0024] (Step 2) Step 2 is performed after Step 1 (or, in some cases, after the expansion step performed after Step 1), and involves detecting mutant cells in each cultured fraction. Here, "mutant cells" are not particularly limited as long as they are cells in which a genetic mutation has occurred. They may be cells in which a mutation has occurred after the subculture process, or cells in which a mutation has occurred congenitally. Mutant cells can be detected at the gene level (e.g., Northern blot, PCR) or the protein level (e.g., Western blot). However, because the genetic sequence of mutant cells is generally minimal and often differs only in a few bases, detection at the gene level is preferred. An example of a mutant cell is a cell with a mutation in the EP300 gene. EP300 (E1A binding protein 300) is a transcriptional coactivator with histone acetyltransferase activity (HAT activity). In gene promoter regions, HAT activity weakens the interaction between histones and DNA, changing the chromatin structure, which then attracts the basal transcription machinery and transcriptional regulatory factors, promoting transcription. Somatic mutations in EP300 are widely observed in cancer, and the majority of these are truncated mutations that are likely to cause functional inactivation, suggesting the possibility that they function as tumor suppressor genes. A schematic diagram illustrating each domain of the EP300 gene is shown in Figure 8. The present inventors discovered mutations in the EP300 gene in some iPS cells. Specific procedures for detecting cells with mutations in the EP300 gene are described below in Section "2. Tools for detecting defects in the EP300 gene." If mutant cells are detected in all fractions in step 2, the next step, step 3, cannot be performed. Therefore, step 1 is performed again with a reduced number of cells fractionated in step 1 (in some cases, an expansion culture step is performed after step 1).

[0025] (Step 3) Step 3 is a step of expanding the fraction of cells in which no mutation was detected in step 2. Since the culture is started from a certain number of cells, mutation-free cells can be obtained in a high yield in a short period of time.

[0026] Culture conditions for the culture step in step 1, the expansion culture step carried out between steps 1 and 2, and the culture step in step 3 are appropriately selected depending on the type of target cells, and known culture conditions can be used. For example, a known basal medium can be used as the medium used in each step, and is not particularly limited as long as it does not inhibit the growth of the target cells, preferably pluripotent stem cells, more preferably iPS cells. Media for pluripotent stem cell culture are preferred, such as DMEM, DMEMHG, EMEM, IMDM (Iscove's Modified Dulbecco's Medium), GMEM (Glasgow's MEM), RPMI-1640, α-MEM, Ha's Medium F-12, Ham's Medium F-10, Ham's Medium F12K, Medium 199, ATCC-CRCM30, DM-160, DM-201, BME, Fischer, McCoy's 5A, Leibovitz's L-15, RITC80-7, MCDB105, MCDB107, MCDB131, MCDB153, MCDB201, NCTC109, NCTC135, Waymouth's MB752 / 1, CMRL-1066, Williams' medium E, Brinster's BMOC-3 Medium, and E8 medium (Nature Methods, 2011, 8, 424-429), ReproFF2 medium (ReproCell), StemFit (registered trademark) AK medium (Ajinomoto), and a mixed medium thereof are examples of such medium.

[0027] The medium may contain additives known per se. The additives are not particularly limited as long as they do not inhibit the proliferation of cells, particularly pluripotent stem cells, preferably iPS cells. Examples of such additives include growth factors (e.g., insulin, etc.), iron sources (e.g., transferrin, etc.), polyamines (e.g., putrescine, etc.), minerals (e.g., sodium selenate, etc.), sugars (e.g., glucose, etc.), organic acids (e.g., pyruvic acid, lactic acid, etc.), amino acids (e.g., L-glutamine, etc.), reducing agents (e.g., 2-mercaptoethanol, etc.), vitamins (e.g., ascorbic acid, d-biotin, etc.), steroids (e.g., β-estradiol, progesterone, etc.), antibiotics (e.g., streptomycin, penicillin, gentamicin, etc.), buffers (e.g., HEPES, etc.), lipids (e.g., linoleic acid, etc.), and nucleic acids (e.g., thymidine, etc.). Furthermore, known additives that have traditionally been used in the culture of pluripotent stem cells may also be appropriately contained. It is preferable that each additive is contained within a known concentration range.

[0028] The medium may contain serum. The serum is not particularly limited as long as it is derived from an animal and does not inhibit the growth of cells, particularly pluripotent stem cells, preferably iPS cells. However, serum derived from a mammal (e.g., fetal bovine serum, human serum, etc.) is preferred, and human serum is more preferred. The concentration of the serum may be within a known concentration range.

[0029] The culture vessel used for cell culture is not particularly limited as long as it is capable of culturing the target cells, particularly pluripotent stem cells, preferably iPS cells, and examples thereof include flasks, tissue culture flasks, dishes, Petri dishes, tissue culture dishes, multi-dishes, microplates, microwell plates, multi-plates, multi-well plates, microslides, chamber slides, Petri dishes, tubes, trays, culture bags, and roller bottles. In the culture step of step 1 and the expansion culture step between steps 1 and 2, the cell population is fractionated and cultured, so a culture vessel capable of simultaneously culturing multiple wells, such as a microplate, microwell plate, multi-plate, or multi-well plate, is preferred.

[0030] The culture vessel may be cell-adhesive or cell-non-adhesive, and is appropriately selected depending on the purpose. A cell-adhesive culture vessel may be coated with any cell-supporting substrate, such as an extracellular matrix (ECM), for the purpose of improving adhesion of cells to the surface of the culture vessel. The cell-supporting substrate may be any substance intended for cell adhesion.

[0031] The culture temperature is not particularly limited, but may be about 30 to 40°C, preferably about 37°C. ２ The concentration may be about 1 to 10%, preferably about 2 to 5%. The oxygen partial pressure may be 1 to 10%.

[0032] 2. Tool for detecting defects in the EP300 gene One embodiment of the present invention is to provide a tool for detecting mutant cells that can be used in step 2 of the cell purification method of the present invention. Examples of such a tool include a primer set (a pair of a forward primer and a reverse primer) used in a method utilizing a DNA amplification reaction (PCR method) and a probe used in a hybridization method. When detection at the protein level is possible, examples of such a tool include an antibody.

[0033] (1) Methods Using Amplification Reactions (PCR Methods) In the present invention, mutant cells (or mutant genes therein) can be detected simply and with high accuracy using, for example, polymerase chain reaction (PCR). First, primers capable of distinguishing between the base sequence of a mutant gene and the base sequence of a wild-type gene are designed by comparing the base sequence of the mutant gene and the base sequence of a wild-type gene. Primer sets may be designed based on the cDNA sequence of the wild-type gene or the cDNA sequence of the mutant gene, or may be designed based on the genomic sequence of the wild-type gene or the genomic sequence of the mutant gene. Primer design techniques are well known in the art, and primers usable in the present invention are designed to satisfy conditions for specific annealing, for example, to have a length and base composition (melting temperature) that enable specific annealing. For example, the length that functions as a primer is preferably 10 bases or more, more preferably 15 to 50 bases, and even more preferably 15 to 30 bases. Furthermore, during design, it is preferable to confirm the GC content and melting temperature (Tm) of the primer. Tm refers to the temperature at which 50% of any nucleic acid strand forms a hybrid with its complementary strand. The annealing temperature must be optimized to allow the template DNA and primer to form a double strand and anneal. On the other hand, if the temperature is lowered too much, nonspecific reactions occur, so it is desirable to keep the temperature as high as possible. Known primer design software can be used to confirm the Tm. The designed primer can be chemically synthesized using known oligonucleotide synthesis techniques, but is usually synthesized using a commercially available chemical synthesizer.

[0034] In a specific embodiment, primer sets that can be used to detect the EP300 gene and / or a mutation in the EP300 gene (deletion of the exon 22 region of the EP300 gene on chromosome 22) include, but are not limited to, the following primer sets: a primer set for detecting a deleted region of the EP300 gene, consisting of a forward primer represented by the nucleotide sequence of SEQ ID NO: 1 (AAACTATTTTCAGTTCTTTGGTCATGAC) and a reverse primer represented by the nucleotide sequence of SEQ ID NO: 2 (CCTTAACCAAATGAAAACTTGCAA); a primer set for detecting an EP300 common region, consisting of a forward primer represented by the nucleotide sequence of SEQ ID NO: 4 (ATGCTGCTGGCATGAATAGGT) and a reverse primer represented by the nucleotide sequence of SEQ ID NO: 5 (GCTGTTCCTGCCCTAACCAA); A primer set for detecting a mutant region of the EP300 gene, consisting of a forward primer represented by the nucleotide sequence of SEQ ID NO: 7 (AAACTATTTTCAGTTCTTTGGTCATGAC) and a reverse primer represented by the nucleotide sequence of SEQ ID NO: 8 (GCCAAACCCAAAGAAAACAATT). When a primer set designed in this way is used, the amplification product obtained from the mutant gene differs in length and / or nucleotide sequence from the amplification product obtained from the wild-type gene. Therefore, whether or not the EP300 gene has a mutation can be determined from the difference in length and / or nucleotide sequence of the amplification product obtained by an amplification reaction using the primer set.

[0035] The amplification reaction is not particularly limited, but examples thereof include known methods utilizing the principles of the polymerase chain reaction (PCR). Amplification is carried out until the amplified product reaches a detectable level. Optimal PCR conditions can be easily determined by those skilled in the art. In the RT-PCR method, first, cDNA is prepared by reverse transcriptase reaction using mRNA as a template, and then PCR is carried out using the prepared cDNA as a template and a pair of primers. Examples of primer sets for the RT-PCR method include the following: A primer set for detecting the mutant region of the EP300 gene, consisting of a forward primer represented by the base sequence of SEQ ID NO: 10 (GATGACCCTTCCCAGCCTCAAAC) and a reverse primer represented by SEQ ID NO: 11 (CTTTAAACAGCCATCACAGACGAATAGTT).

[0036] To detect whether a specific amplification reaction has occurred after the above-mentioned amplification reaction, known means capable of specifically recognizing the amplification product obtained by the amplification reaction can be used. For example, a specific amplification reaction can be detected by using agarose gel electrophoresis or the like to confirm whether an amplified fragment of a specific size has been amplified. The size of the amplified product can be estimated based on the base sequence between the designed primers.

[0037] Alternatively, the presence or absence of amplification of a nucleic acid fragment can be detected based on a label attached to a primer or a substrate. For example, a label such as a radioisotope, a fluorescent substance, or a luminescent substance can be reacted with the dNTP incorporated during the amplification reaction, and the label can be detected. Examples of radioisotopes include: ３２ P. １２５ I, ３５S, etc. can be used. Fluorescent substances include, for example, fluorescein (FITC), sulforhodamine (TR), and tetramethylrhodamine (TRITC). Luciferin, etc. can be used as a luminescent substance. There are no particular limitations on the type of label or the method of introducing the label, and various conventionally known means can be used. For example, a method of introducing a label includes the random prime method using a radioisotope.

[0038] The method for observing the amplification product incorporating the labeled dNTP may be any method known in the art for detecting the above-mentioned label. For example, when a radioisotope is used as the label, the radioactivity can be measured using, for example, a liquid scintillation counter, a γ-counter, or the like. Furthermore, when a fluorescent label is used, the fluorescence can be detected using a fluorescent microscope, a fluorescent plate reader, or the like.

[0039] (2) Hybridization Method Mutations in the EP300 gene can also be detected using the hybridization method.

[0040] First, the base sequence of the mutant EP300 gene is compared with the base sequence of the wild-type EP300 gene, and a probe capable of hybridizing to the two genes is designed. Whether or not a sample contains the mutant EP300 gene can be detected based on the presence or absence of hybridization using such a probe.

[0041] Probe design techniques are well known in the art, and probes that can be used in the present invention are designed to satisfy conditions that enable specific hybridization, for example, to have a length and base composition (melting temperature) that enable specific hybridization. The length of the probe is preferably 10 bases or more, more preferably 20 to 50 bases, and even more preferably 20 to 30 bases.

[0042] In a specific embodiment, probes that can be used to detect the EP300 gene and / or a mutation in the EP300 gene (deletion of the exon 22 region of the EP300 gene on chromosome 22) include, but are not limited to, the following probes: - a probe for detecting the deleted region of the EP300 gene represented by the base sequence of SEQ ID NO: 3 (CTTTGTCAGAAGTCATGGGA); - a probe for detecting the common region of the EP300 gene represented by the base sequence of SEQ ID NO: 6 (CCTGGTAAGGGTCACCA); - a probe for detecting the mutant region of the EP300 gene represented by the base sequence of SEQ ID NO: 9 (CTTTGTCAGGTTTTTTATTC).

[0043] In this method, a hybridization reaction is performed using a probe, and the presence of a mutant EP300 gene is detected by detecting the specific binding (hybrid). The hybridization reaction must be performed under stringent conditions. Such stringent conditions are well known in the art and are not particularly limited.

[0044] When hybridization is performed in this method, the probe may be fluorescently labeled (fluorescein, rhodamine, VIC, etc.), radioactively labeled ( ３２ Suitable labels such as phospholipids (phospholipids, etc.), enzyme labels (alkaline phosphatase, horseradish peroxidase, etc.), and biotin labels can be added.

[0045] The regions of the EP300 gene to which each primer and probe corresponds are shown in FIGS.

[0046] (3) Protein-Level Detection Detection of mutant cells at the protein level can be performed, for example, by detecting proteins specifically expressed in mutant cells or denatured proteins. Detection can be performed by immunoassay (immunological measurement). That is, the expression of a protein specifically expressed in mutant cells or a denatured protein in a sample is measured based on the reaction between the protein and an antibody that specifically binds to the protein. The immunoassay can be performed using either a liquid-phase system or a solid-phase system, as long as it is a method commonly used in the field. Furthermore, the format of the immunoassay is not limited, and can include a direct solid-phase method, a sandwich method, a competitive method, a Western blotting method, an ELISA (enzyme-linked immunosorbent assay), and the like.

[0047] The binding (reaction) of an antibody with a protein specifically expressed in mutant cells or a denatured protein can be measured according to well-known methods. Those skilled in the art can determine an effective and optimal measurement method for each assay, depending on the type and format of the immunoassay employed, the type of label used, and other factors. For example, to easily detect binding between an antibody and a protein in a sample, the antibody can be labeled to directly detect the binding, or a labeled secondary antibody, biotin-avidin complex, or the like can be used to indirectly detect the binding.

[0048] As a label for labeling an antibody used in an immunoassay, an enzyme, a radioisotope, a fluorescent dye, or an avidin-biotin system can be used. As an enzyme, an enzyme used in a conventional enzyme immunoassay (EIA), such as peroxidase, β-galactosidase, alkaline phosphatase, etc. can be used. As a radioisotope, １２５ I and ３ The fluorescent dye may be one used in a conventional radioimmunoassay (RIA), such as Fluorescein isothiocyanate (FITC) or tetramethylrhodamine isothiocyanate (TRITC), which are used in a conventional fluorescent antibody technique.

[0049] Detection of the label signal can also be carried out according to methods known in the art. For example, when an enzyme label is used, a substrate that is decomposed by the action of the enzyme to develop a color is added, and the amount of decomposition of the substrate is measured optically to determine the enzyme activity, which is converted into the amount of bound antibody, and the amount of antibody is calculated by comparing it with a standard value. The substrate varies depending on the type of enzyme used; for example, when peroxidase is used as the enzyme, 3,3',5,5'-tetramethylbenzidine can be used, and when alkaline phosphatase is used as the enzyme, paranitrophenol or the like can be used. When a radioactive label is used, the amount of radiation emitted by the radioactive label is measured using a scintillation counter or the like. Fluorescent labels can be detected and quantified using, for example, a fluorescence microscope, a plate reader, or the like.

[0050] The present invention will be described in detail below using examples, but the present invention is not limited thereto. Furthermore, the reagents and materials used are commercially available unless otherwise specified. Abbreviations used in this specification are the same as those commonly used in the art unless otherwise specified.

[0051] Example 1: Cell purification iPS cells were cultured in StemFit® AK03N medium (Ajinomoto) containing Y-27632 (Fujifilm Wako Pure Chemical Industries, Ltd.) and iMatrix-511 (0.6 μg / cm ２ )-coated 96-well plates at a density of 100 cells / well. After 1 day of culture, the medium was replaced with AK03N medium without Y-27632 (Day 1). After 4 days of culture (Day 4), 5 days of culture (Day 5), and 6 days of culture (Day 6), the medium was replaced with AK03N medium, and after 7 days of culture (Day 7), the medium was replaced with AK03N medium (with Y-27632) containing iMatrix-511 (0.6 μg / cm ２ The cells were subcultured onto a 24-well plate coated with iMatrix-511 (0.6 μg / cm ) (the entire colony content in one well of the 96-well plate was seeded onto one well of the 24-well plate). The following day (Day 1′), and 4 and 5 days later (Day 4′ and 5′) after subculture, the medium was replaced with AK03N medium. Six days later (Day 6′), the cells were subcultured onto a 24-well plate coated with iMatrix-511 (0.6 μg / cm ) using AK03N (Y-27632-supplemented) medium.２ ) coated 6-well plates (half of the colonies in one well of a 24-well plate were seeded into one well of a 6-well plate). The day after passaging (Day 1''), the medium was replaced with AK03N medium. Thereafter, the medium was replaced as appropriate, and once the cells became confluent, the cells were recovered using AK03N (Y-27632-supplemented) medium. Wells in which no EP300 mutation was observed were evaluated as wells containing a cell population free of mutant cells, and the cells were recovered. The results of quantitative PCR of the recovered cells (method was the same as in Example 5, primer set F1+R6 used) showed that all recovered cells were normal cells.

[0052]

[0053] Example 2: Taqman PCR To detect the EP300 gene on the chromosome, three primers were designed and Taqman probe sequences specific to the regions flanked by the primers were created, targeting three sequences: the deletion region in the EP300 expression region on the chromosome, a region independent of the presence or absence of the deletion (common region), and a region linked after the deletion (mutant region). VIC dye was used for the probe of the common region, and FAM dye was used for the deletion region and mutant region, enabling multiplex PCR. The relative positions of the primers and probes in each region are shown in Figure 2. The sequences are as follows: <For detection including deleted sequence (deleted region)> Forward primer: AAACTATTTTCAGTTCTTTGGTCATGAC (SEQ ID NO: 1) Reverse primer: CCTTAACCAAATGAAAACTTGCAA (SEQ ID NO: 2) Probe: CTTTGTCAGAAGTCATGGGA (SEQ ID NO: 3) <Designed using a common region regardless of whether there is a deletion (common region)> Forward primer: ATGCTGCTGGCATGAATAGGT (SEQ ID NO: 4) Reverse primer: GCTGTTCCTGCCCTAACCAA (SEQ ID NO: 5) Probe: CCTGGTAAGGGTCACCA (SEQ ID NO: 6) <For detection of sequence after deletion (mutant region)> Forward primer: AAACTATTTTCAGTTCTTTGGTCATGAC (SEQ ID NO: 7) Reverse primer: GCCAAACCCAAAGAAAACAATT (SEQ ID NO: 8) Probe: CTTTGTCAGGTTTTTTATTC (SEQ ID NO: 9) As a positive control, two sequences from each region between the primers were joined together, and the sequences before and after were added to adjust the length to 300 bp. (1) The mutant region and the common region, and (2) the deletion region and the common region were combined and synthesized using ThermoFisher's Strings DNA Fragments synthesis service to create the GeneArt Strings DNA Fragment Positive Control. A calibration curve was created using this product as shown below. The synthesized product was diluted to 1 x 10 with DNase-free water. １０ Adjust to 1 x 10 copies / μl ８The working solution is diluted to copies / μl, and then diluted 1 / 10 from there to prepare a standard curve sample. The sequences are as follows: (1) Mutant region and common region ATAGAAACTTTATTAAAACTATTTTCAGTTCTTTGGTCATGACCTTGGCTGTCTTTGTCAGGTTTTTTATTCTATGCAATTGACTGTATTATATCTTCAAAGTTACTATCTTTAAATTGTTTTCTTTGGGTTTGGCCACGATAATTATAGGGATCATGCTGCTGGCATGAATAGGTCTGGCCCTGGTAAGGGTCACCATTTGGTTAGGGCAGGAACAGCAAGTTATAAGGCTGCAGTCATAGTGTAATTGCCTAGTAAAAGGGAGGGGCCATCGCTCTGTACAAGAGGAACTAATCCCAG (SEQ ID NO: 12) (2) Deletion region and common region AGAAACTTTATTAAAACTATTTTCAGTTCTTTGGTCATGACCTTGGCTGTCTTTGTCAGAAGTCATGGGAAATATTGCAAGTTTTCATTTGGTTAAGGTTTGGGGTTAATTTTGGAATTGGCTCTGCTCTTCCAGGTTTGTTGAATGTACGGATCATGCTGCTGGCATGAATAGGTCTGGCCCTGGTAAGGGTCACCATTTGGTTAGGGCAGGAACAGCAAGTTATAAGGCTGCAGTCATAGTGTAATTGCCTAGTAAAAGGGAGGGGCCATCGCTCTGTACAAGAGGAACTAATCCCAG (SEQ ID NO: 13) The reaction mixture was adjusted to 900 nM primers and 250 nM probe, and Taqman PCR was performed using 1 to 20 ng of template. Using a StepOnePlus™ Real Time PCR System (Applied Biosystems), the reaction was performed at 95°C for 20 seconds, followed by 40 cycles of 95°C for 1 second and 60°C for 20 seconds. The templates used were genome extracted samples of two mutants (Samples A and B) and two WTs (Samples C and D). The results of qPCR using 8 ng of template are shown in Figure 3.The mutant and wild-type (WT) genes were successfully detected. After qPCR, dCT values ​​were calculated using the common region as an endogenous control, and ddCT values ​​were calculated to examine relative expression. The results are shown in Figure 4. No mutant region was detected in the WT sample. Since the deleted region was also detected in the mutant sample, this mutant sample is considered to be heterozygous for the WT. Samples A and B were CECSi cells derived from iPS cells contaminated with EP300 mutant cells as mutants, while Samples C and D were CECSi cells derived from iPS cells without EP300 mutant cells as wild-type (WT). Genome extraction was performed using the PureLink Genomic DNA Kit (Invitrogen, K1820-01). After extraction, genome concentration was measured and stored at -20°C.

[0054] Reference Example 1: RNA was extracted from CECSi derived from iPS cells with or without the EP300 mutation using QIAGEN's RNeasy mini kit (#74106), and cDNA was synthesized using TOYOBO's ReverTra-plus (#PCR501). Primers: Random primers. Reaction scale: 20 μL. Reaction conditions: 42°C for 20 minutes x 1, 99°C for 5 minutes x 1. RT-PCR was performed on the cDNA using TaKaRa's TaKaRa Ex Taq® (registered trademark) (#RR001A) in a thermal cycler. Reaction scale: 20 μL. Reaction conditions: (98°C for 3 seconds, 60°C for 30 seconds) x 40. After the reaction was completed, the gel was applied to a 3.5% agarose gel, electrophoresed, and then stained with ethidium bromide solution. The sequences of the main primers used in RT-PCR are shown in the table below. The relative positions of the targets of primers F1, R1, R2, and R3 are shown in Figure 8.

[0055]

[0056] The results are shown in Figure 5.

[0057] Example 3: RNA was extracted from corneal endothelial cells with 0% EP300 mutation contamination (lane 1, negative control: B4G12), iPS cells with 6.3% mutation contamination (lane 2: MCB P15), and corneal endothelial substitute cells with 75% mutation contamination (lane 3, positive control: TR1 CECSi) using QIAGEN's RNeasy mini kit (#74106), and cDNA was synthesized using TOYOBO's ReverTra-plus (#PCR501). Primers: Random primers. Reaction scale: 20 μL. Reaction conditions: 42°C for 20 minutes x 1, 99°C for 5 minutes x 1. The cDNA thus prepared was subjected to RT-PCR using TOYOBO's THUNDERBIRD SYBR qPCR Mix (#QPS201) in a thermal cycler. Reaction scale: 20 μL. Reaction conditions: (95°C for 3 seconds, 62°C for 30 seconds) x 40. After the reaction was completed, the mixture was applied to a 3.5% agarose gel, electrophoresed, and then stained with ethidium bromide solution. The sequences of the primers used for RT-PCR are shown in the table below. The relative positions of the targets of the F1 and R6 primers are shown in Figure 8.

[0058]

[0059] The results are shown in Figure 6. There was a correlation between the rate of mutation contamination and the intensity of the band, and the EP300 mutation (EP300 having a deleted region) was detected.

[0060] Example 4: To confirm that the use of the primer set used in Example 3 in Step 2 of Example 1 can remove even low levels of mutant cells, quantitative PCR was performed on iPS cells lacking EP300 spiked into iPS cells lacking EP300 at various concentrations (0%, 0.01%, 0.1%, 1%, 10%, and 100%). RNA was extracted from each sample using a QIAGEN RNeasy mini kit (#74106), and cDNA was synthesized using a TOYOBO ReverTra-plus (#PCR501) kit. Primers: Random primers. Reaction scale: 20 μL. Reaction conditions: 42°C for 20 minutes x 1, 99°C for 5 minutes x 1. Quantitative PCR was performed on the generated cDNA using an ABI Step OnePlus kit with TOYOBO THUNDERBIRD SYBR qPCR Mix (#QPS201). Reaction scale: 20 μL Reaction conditions: (95°C for 3 seconds, 62°C for 30 seconds) x 40 The results are shown in Figure 7. Figure 7 shows comparative values ​​when the value of the group containing 100% EP300-deficient iPS cells is set to 100%. The sequences of the primers used for qPCR are shown in the table below.

[0061]

[0062] It was found that mutant cells can be detected even with a spike rate (contamination rate) of at least about 0.1%.

[0063] Example 5 A master cell bank of iPS cells different from that used in Example 1 was passaged to estimate the contamination rate of EP300 mutant cells. Quantitative PCR was performed in the same manner as in Example 4. The results are shown in Table 5 below.

[0064]

[0065] The division rate of EP300 mutant cells is faster than that of normal cells, and the proportion of mutant cells increases with expansion. However, by following the method of Example 1, mutant cells can be removed early and contamination can be prevented. Note that the method of Example 1 is not limited to removing EP300 mutant cells, but can also be applied to removing cells mutated by other genes.

[0066] Because a certain number of cells are cultured, a certain cell population can be obtained compared to limiting dilution, thereby shortening the culture time and enabling detection of mutant cells even with a low contamination rate, thereby enabling efficient removal of mutant cells. By implementing this method before expansion of iPS cells, mutant cells that are difficult to detect before expansion can be discovered and removed early, preventing contamination with mutant cells after expansion. This application is based on Japanese Patent Application No. 2023-121145 (filing date: July 25, 2023), the contents of which are incorporated in their entirety herein.

Claims

1. A method for purifying normal cells from a cell population containing mutant cells at a contamination rate of 1% or less, comprising the following steps: step 1: fractionating and culturing the cell population; step 2: detecting mutant cells in each cultured fraction; and step 3: culturing cells in the fraction in which mutant cells are not detected.

2. The method according to claim 1, further comprising one or more expansion steps between steps 1 and 2.

3. The method according to claim 1, wherein the contamination rate is 0.1 to 1%.

4. The method according to claim 1, wherein in step 1, the number of fractions is 20 to 30.

5. In step 1, 0.05 to 2 x 10 per fraction ３ cells / cm ２ 5. The method of claim 4, wherein the seeds are seeded at a density of 6. The method according to claim 1, wherein in step 1, the number of fractions is 90 to 100.

7. In step 1, 0.03 to 3 x 10 per fraction ３ cells / cm ２ 7. The method of claim 6, wherein the seeds are seeded at a density of 8. The method of claim 1, wherein the cell is a pluripotent stem cell.

9. The method according to claim 8, wherein the pluripotent stem cells are iPS cells.

10. The method of any one of claims 1 to 9, wherein the mutation is a mutation in the EP300 gene.

11. The method according to claim 10, wherein the mutation in the EP300 gene is a partial deletion in the PHD (plant homeodomain) region of the EP300 gene.

12. A primer set for specifically detecting a mutation in the PHD region of the EP300 gene, the primer set comprising a combination of a forward primer having the base sequence of SEQ ID NO:7 and a reverse primer having the base sequence of SEQ ID NO:

8.

13. A probe for specifically detecting a mutation in the PHD region of the EP300 gene, the probe having the base sequence of SEQ ID NO:

9.

14. A primer set for detecting a PHD region of the EP300 gene, the primer set comprising a combination of a forward primer having the base sequence of SEQ ID NO:1 and a reverse primer having the base sequence of SEQ ID NO:

2.

15. A probe for detecting the PHD region of the EP300 gene, having the base sequence of SEQ ID NO:

3.

16. A primer set for detecting the EP300 gene, the primer set comprising a combination of a forward primer having the base sequence of SEQ ID NO:4 and a reverse primer having the base sequence of SEQ ID NO:

5.

17. A probe for detecting the EP300 gene, having the base sequence of SEQ ID NO:

6.

18. A primer set for amplifying a target nucleic acid sequence, comprising a combination of a forward primer having the base sequence of SEQ ID NO: 10 and a reverse primer having the base sequence of SEQ ID NO: 11, characterized in that the target nucleic acid sequence is within a PHD region having a mutation in the EP300 gene.

19. The primer set according to claim 18, wherein the mutation in the EP300 gene is a partial deletion in the PHD region of the EP300 gene.

20. The method according to claim 1, characterized in that in step 2, the primer set according to claim 12 and the probe according to claim 13 are used.

21. The method according to claim 1, characterized in that in step 2, the primer set according to claim 18 is used.

Images