DNA polymerase and use thereof

Abstract

A DNA polymerase and the use thereof. The DNA polymerase is: 1) a protein having an amino acid sequence as shown in SEQ ID NO: 1 or 2; or 2) a protein having an amino acid sequence that has 80% or more, more preferably 90% or more, and further preferably 95% or more homology to the amino acid sequence as shown in SEQ ID NO: 1 or 2, and having a DNA polymerase activity. The DNA polymerase has a relatively high amplification rate, a relatively good thermal stability, and 5'-3' polymerization activity and 3'-5' exonuclease activity. During DNA amplification, the DNA polymerase can be used to perform DNA amplification at a relatively high PCR extension rate, thus being able to better meet market demand, and having a great application potential.

Description

DNA polymerase and its application Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a DNA polymerase and an application thereof. Background Art

[0002] DNA polymerases use a single DNA strand as a template and four deoxynucleotides as substrates, replicating and synthesizing a new DNA strand complementary to the template strand starting from the 5' end. DNA polymerases can add free nucleotides to the 3' end of the newly formed strand, leading to extension of the new strand in the 5'-3' direction. Some enzymes possess 3'-to-5' exonuclease activity, which allows them to correct errors in newly synthesized DNA. If mismatched bases are generated during PCR amplification, they can be excised. After excision, the polymerase can reinsert the correct base and continue replication, thus ensuring amplification accuracy. Generally speaking, B-family DNA polymerases all possess proofreading activity, resulting in lower error rates than conventional DNA polymerases (such as Taq DNA polymerase), making them more suitable for experiments requiring high PCR fidelity, such as gene screening, sequencing, and mutation detection.

[0003] DNA polymerases are divided into six families: A, B, C, D, X, and Y. Most of the heat-resistant DNA polymerases discovered so far belong to family A or family B. Family A DNA polymerases are all derived from true bacteria, such as the genera Thermus or Bacillus. Family B DNA polymerases are all derived from archaea, such as the genera Thermococcus or Pyrococcus. Family A DNA polymerases mainly have 5'-3' polymerization activity and 5'-3' exonucleolytic activity. The main characteristics of Family B DNA polymerases are 5'-3' polymerization activity and 3'-5' exonucleolytic activity. This unique exonucleolytic activity gives Family B DNA polymerases proofreading function.

[0004] As application requirements increase, DNA polymerases are increasingly required to meet higher performance requirements, in addition to high amplification yields. These requirements include high processivity, high amplification specificity, amplification performance with low template amounts, high elongation rates, thermal stability, salt tolerance, and high fidelity. Family A DNA polymerases, exemplified by Taq DNA polymerase, offer high amplification efficiency but lack fidelity. Furthermore, most high-fidelity B family DNA polymerases are based on Pfu DNA polymerase or KOD DNA polymerase, and therefore lack the ability to achieve both high processivity and high fidelity. Therefore, the search for novel DNA polymerases is of great significance and value.

[0005] Summary of the Invention

[0006] The main purpose of the present invention is to provide a DNA polymerase and its application to solve the problem that the PCR amplification efficiency of the DNA polymerase in the prior art is difficult to exceed 1 kb / min.

[0007] To achieve the above-mentioned object, according to a first aspect of the present invention, a DNA polymerase is provided, which is: 1) a protein having an amino acid sequence as shown in SEQ ID NO: 1 or 2; or 2) a protein having an amino acid sequence having greater than 80%, more preferably greater than 90%, and even more preferably greater than 95% homology to the amino acid sequence as shown in SEQ ID NO: 1 or 2, and having DNA polymerase activity.

[0008] Furthermore, the T of DNA polymerase m The value is 95.88°C-96.45°C; preferably, the amplification rate of the DNA polymerase is 1-4 kb / min; preferably, the amplification rate of the DNA polymerase is 3-4 kb / min; preferably, the DNA polymerase has 5'-3' polymerization activity and 3'-5' exo-cleavage activity.

[0009] According to a second aspect of the present invention, a DNA molecule is provided, which encodes the above-mentioned DNA polymerase.

[0010] Furthermore, the DNA molecule is selected from: A) a polynucleotide consisting of the nucleotide sequence as shown in SEQ ID NO: 3 or 4; B) a polynucleotide having more than 80%, more preferably more than 90%, and even more preferably more than 95% homology with the polynucleotide consisting of the nucleotide sequence as shown in SEQ ID NO: 3 or 4.

[0011] According to a third aspect of the present invention, a recombinant plasmid is provided, wherein the recombinant plasmid is connected to the above-mentioned DNA molecule.

[0012] According to a fourth aspect of the present invention, a host cell is provided, into which the above-mentioned recombinant plasmid is transfected.

[0013] Furthermore, the host cell includes a prokaryotic cell or a eukaryotic cell.

[0014] According to a fifth aspect of the present invention, a PCR amplification kit is provided, comprising a DNA polymerase, wherein the DNA polymerase is the above-mentioned DNA polymerase.

[0015] Furthermore, the PCR amplification kit further comprises: a PCR buffer, preferably the PCR buffer comprises a 10× PCR buffer, further preferably the 10× PCR buffer is selected from any one of the following: A) 150-200 mM Tris-HCl, pH 8.2-8.6, 250-750 mM KCl, 1-15 mM MgCl2, 1-4 mg / mL BSA, and 100-600 mM TMAC; B) 150-200 mM Tris-HCl, pH 8.2-8.6, 250-750 mM KCl, 1-15 mM MgCl2, 1-4 mg / mL BSA, 100-600 mM ammonium sulfate, and a volume fraction of 1-10% Tween 20 or NP40.

[0016] Furthermore, the PCR amplification kit further comprises: a PCR enhancer and dNTPs; preferably, the PCR enhancer comprises betaine.

[0017] According to a sixth aspect of the present invention, a method for performing PCR amplification using the above-mentioned DNA polymerase or the above-mentioned PCR amplification kit is provided.

[0018] Furthermore, the PCR amplification rate is 1-4 kb / min; preferably, the PCR amplification rate is 3-4 kb / min.

[0019] According to a seventh aspect of the present invention, a method for constructing a sequencing library is provided, the method comprising: preparing a nucleic acid sample into DNA fragments with sequencing adapters; performing PCR amplification on the DNA fragments with sequencing adapters to obtain a sequencing library; wherein the PCR amplification is performed using the above-mentioned DNA polymerase or the above-mentioned PCR amplification kit.

[0020] According to an eighth aspect of the present invention, a sequencing method is provided, comprising: performing sequencing on a sequencing library obtained by the above method to obtain sequencing results.

[0021] By applying the technical solutions of the present invention, the DNA polymerase of the present application exhibits a high amplification rate, good thermal stability, and possesses both 5'-3' polymerization activity and 3'-5' exo-cleavage activity. During DNA amplification, it can achieve a relatively fast PCR extension rate, effectively meeting high market demands and possessing significant application potential. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] The accompanying drawings, which constitute part of this application, are intended to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are intended to explain the present invention and do not constitute an undue limitation of the present invention. In the accompanying drawings:

[0023] 1A and 1B show the sequence alignment results of 27°N DNA polymerase and 4°S DNA polymerase with KOD DNA polymerase and Pfu DNA polymerase in Example 1 of the present invention;

[0024] FIG2 shows a diagram of the purification results of 27°N DNA polymerase in Example 2 of the present invention;

[0025] FIG3 shows a diagram of the purification results of 4°S DNA polymerase in Example 2 of the present invention;

[0026] FIG4 is a schematic diagram showing the principle of detecting the polymerization activity of a DNA polymerase in Example 4 of the present invention;

[0027] FIG5 shows the results of the exo-activation assays of 27°N DNA polymerase, 4°S DNA polymerase, and KOD DNA polymerase in Example 5 of the present invention;

[0028] FIG6 shows the DNA electrophoresis patterns of 27°N DNA polymerase, 4°S DNA polymerase, and Pfu DNA polymerase at different PCR amplification times in Example 6 of the present invention;

[0029] FIG7 shows the DNA electrophoresis diagram of PCR amplification performed by 27°N DNA polymerase and 4°S DNA polymerase at different template contents in Example 7 of the present invention;

[0030] FIG8 shows the DNA electrophoresis diagram of PCR amplification using 27°N DNA polymerase, 4°S DNA polymerase, and Pfu DNA polymerase under different template lengths in Example 8 of the present invention. DETAILED DESCRIPTION

[0031] It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present application can be combined with each other. The present invention will be described in detail below with reference to the embodiments.

[0032] As mentioned in the background, among the DNA polymerases in the prior art, A-family DNA polymerases have high amplification efficiency but lack 3'-5' exonucleolytic activity, resulting in low PCR fidelity. B-family DNA polymerases all have proofreading activity, which can ensure high fidelity. However, due to increasing application demands, the amplification efficiency and other performance characteristics of the DNA polymerases in the prior art, such as processivity, amplification performance with low template amounts, and thermal stability, cannot meet current market demands. Therefore, this application seeks to protect a DNA polymerase that combines high processivity with high amplification efficiency.

[0033] In a first exemplary embodiment of the present application, a DNA polymerase is provided, comprising: 1) a protein having an amino acid sequence as set forth in SEQ ID NO: 1 or 2; or 2) a protein having an amino acid sequence with at least 80%, more preferably at least 90%, and even more preferably at least 95% identity to the amino acid sequence as set forth in SEQ ID NO: 1 or 2, and having DNA polymerase activity. The aforementioned DNA polymerase of the present application can achieve DNA amplification with high amplification efficiency while maintaining fidelity, and the sustained stability of the high amplification efficiency can meet current application requirements for DNA polymerases.

[0034] SEQ ID NO: 1: (27°N DNA polymerase)

[0035] SEQ ID NO: 2: (4°S DNA polymerase)

[0036] As used herein, amino acid residues are abbreviated as follows: alanine (Ala; A), asparagine (Asn; N), aspartic acid (Asp; D), arginine (Arg; R), cysteine ​​(Cys; C), glutamic acid (Glu; E), glutamine (Gln; Q), glycine (Gly; G), histidine (His; H), isoleucine (Ile; I), leucine (Leu; L), lysine (Lys; K), methionine (Met; M), phenylalanine (Phe; F), proline (Pro; P), serine (Ser; S), threonine (Thr; T), tryptophan (Trp; W), tyrosine (Tyr; Y), and valine (Val; V).

[0037] Substitution and replacement rules generally state that amino acids with similar properties will have similar effects after substitution. For example, conservative amino acid substitutions may occur in the homologous proteins mentioned above. "Conservative amino acid substitutions" include but are not limited to:

[0038] Hydrophobic amino acids (Ala, Cys, Gly, Pro, Met, Val, Ile, Leu) are replaced by other hydrophobic amino acids;

[0039] Substitution of bulky hydrophobic amino acids (Phe, Tyr, Trp) with other bulky hydrophobic amino acids;

[0040] Amino acids with positively charged side chains (Arg, His, Lys) are replaced by other amino acids with positively charged side chains;

[0041] Amino acids with polar and uncharged side chains (Ser, Thr, Asn, Gln) are replaced by other amino acids with polar and uncharged side chains.

[0042] Those skilled in the art may also perform conservative substitutions on amino acids according to amino acid substitution rules well known to those skilled in the art, such as the "blosum62 scoring matrix" in the prior art.

[0043] The above-mentioned DNA polymerase has good application performance, such as amplification rate, amplification sensitivity, amplification extension, and thermal stability. In a preferred embodiment, the DNA polymerase has a Tm value of 95.88°C-96.45°C, which has high thermal stability; preferably, the DNA polymerase has an amplification rate of 1-4 kb / min; preferably, the DNA polymerase has an amplification rate of 3-4 kb / min, which has high amplification efficiency; preferably, the DNA polymerase has 5'-3' polymerization activity and 3'-5' exo-cleavage activity, which can ensure the fidelity of its PCR amplification process.

[0044] In a second typical embodiment of the present application, a DNA molecule is provided, which encodes the above-mentioned DNA polymerase.

[0045] In a preferred embodiment, the above-mentioned DNA molecule is selected from: A) a polynucleotide consisting of the nucleotide sequence as shown in SEQ ID NO: 3 or 4; B) a polynucleotide having more than 80%, more preferably more than 90%, and even more preferably more than 95% homology with the polynucleotide consisting of the nucleotide sequence as shown in SEQ ID NO: 3 or 4.

[0046] SEQ ID NO: 3: (27°N DNA polymerase) (5'-3')

[0047] SEQ ID NO: 4: (4°S DNA polymerase) (5'-3')

[0048] Due to the principle of codon degeneracy, the nucleotide sequence for translating the amino acid sequence is not limited to the nucleotide sequence shown in SEQ ID NO: 3 or 4 above. Any nucleotide sequence that can encode the above amino acid sequence falls within the protection scope of the DNA molecule of this application.

[0049] In a third typical embodiment of the present application, a recombinant plasmid is provided, wherein the recombinant plasmid is connected to the above-mentioned DNA molecule.

[0050] The DNA can encode the DNA polymerase and can be linked to a recombinant plasmid to form circular DNA. Both the DNA and the recombinant plasmid can undergo transcription and translation under the action of RNA polymerase, ribosomes, tRNA, etc., to produce the DNA polymerase with high amplification efficiency and a certain degree of fidelity.

[0051] In a fourth exemplary embodiment of the present application, a host cell is provided, into which the above-mentioned recombinant plasmid is transfected. In a preferred embodiment, the host cell comprises a prokaryotic cell or a eukaryotic cell. Specifically, the prokaryotic cell can be Escherichia coli, and the eukaryotic cell can be yeast.

[0052] The host cells described above can replicate recombinant plasmids within the host cells, and can also transcribe and translate DNA molecules carried on the recombinant plasmids, thereby obtaining a large amount of DNA polymerase. Using existing technologies, the host cells can be fragmented and purified for protein, or subjected to crude enzyme catalysis after fragmentation, or other methods, to obtain DNA polymerase and subsequently amplify DNA. The host cells are non-plant-derived.

[0053] In a fifth typical embodiment of the present application, a PCR amplification kit is provided, comprising a DNA polymerase, wherein the DNA polymerase is the aforementioned DNA polymerase. The kit can be used to conveniently and quickly perform a DNA amplification reaction with high efficiency and high fidelity, and has good application prospects.

[0054] To further ensure the amplification efficiency of the DNA polymerase involved in the amplification reaction, in a preferred embodiment, the PCR amplification kit further includes: a PCR buffer, preferably a 10× PCR buffer. Any PCR buffer concentration suitable for DNA amplification reactions is suitable for this application. In a preferred embodiment, the PCR buffer includes a 1× PCR buffer, a 10× PCR buffer, or a 20× PCR buffer. Furthermore, the 10× PCR buffer is preferably selected from any of the following: A) 150-200 mM Tris-HCl, pH 8.2-8.6, 250-750 mM KCl, 1-15 mM MgCl2, 1-4 mg / mL BSA, and 100-600 mM TMAC. TMAC can increase the efficiency and specificity of the PCR reaction. B) 150-200 mM Tris-HCl (pH 8.2-8.6), 250-750 mM KCl, 1-15 mM MgCl2, 1-4 mg / mL BSA, 100-600 mM ammonium sulfate, and 1-10% by volume of Tween 20 or NP40. Ammonium sulfate can release nonspecific binding between primers and template, improving reaction specificity, while Tween 20 or NP40 has a protective effect on the enzymes involved in the PCR reaction.

[0055] To further ensure the amplification efficiency, sensitivity, and fidelity of the DNA polymerase-mediated amplification reaction, in a preferred embodiment, the PCR amplification kit also includes a PCR enhancer and dNTPs. The PCR enhancer can improve the sensitivity, specificity, and fidelity of the DNA amplification process, and mitigate amplification errors such as false positives and false negatives. Any type of PCR enhancer is suitable for this application, including but not limited to small molecule compounds, proteins, or nanomaterials. In a preferred embodiment, the PCR enhancer includes betaine.

[0056] In a sixth typical embodiment of the present application, a method for performing PCR amplification using the above-mentioned DNA polymerase or the above-mentioned PCR amplification kit is provided.

[0057] The DNA polymerase of the present application has a high amplification efficiency. In a preferred embodiment, the PCR amplification rate is 1-4 kb / min; preferably, the PCR amplification rate is 3-4 kb / min.

[0058] In a seventh typical embodiment of the present application, a method for constructing a sequencing library is provided, comprising: preparing a nucleic acid sample into DNA fragments with sequencing adapters; performing PCR amplification on the DNA fragments with sequencing adapters to obtain a sequencing library; wherein, performing PCR amplification using the above-mentioned DNA polymerase or the above-mentioned PCR amplification kit can obtain a sequencing library of higher quality in a shorter time.

[0059] The DNA polymerase of this application can be used to construct sequencing libraries for samples including DNA and RNA. If the sample is RNA, it is necessary to reverse transcribe the sample to obtain cDNA for subsequent library construction before making a sequencing adapter. In addition, the DNA fragmentation process can be selected based on the size of the sample fragments, including physical and chemical shearing methods. The DNA fragments can also be end-repaired before the sequencing adapters are connected, depending on the type of adapter used to construct the library.

[0060] In an eighth typical embodiment of the present application, a sequencing method is provided, comprising: performing sequencing on a sequencing library obtained by the above method to obtain sequencing results.

[0061] The application of the DNA polymerase of the present application is not limited to high-throughput sequencing methods. So-called "high-throughput sequencing methods" include "second generation" and / or "third generation" sequencing methods. These high-throughput sequencing methods can provide single-molecule sequencing and adopt technologies such as pyrophosphate sequencing, reversible terminator sequencing, sequencing by ligated cleavable probes, sequencing by ligated non-cleavable probes, DNA nanospheres, and real-time single-molecule sequencing.

[0062] The present application is further described in detail below with reference to specific embodiments. These embodiments should not be construed as limiting the scope of protection claimed in this application.

[0063] Example 1 Sequence Alignment

[0064] Using the Clustal Omega online sequence alignment website, a multiple sequence alignment was performed between the two novel DNA polymerases disclosed herein (27°N DNA polymerase and 4°S DNA polymerase), KOD DNA polymerase (shown in SEQ ID NO: 14), and Pfu DNA polymerase (shown in SEQ ID NO: 15). The alignment results showed that the sequence identities of 27°N DNA polymerase, KOD DNA polymerase, and Pfu DNA polymerase were 43.41% and 44.95%, respectively. The sequence identities of 4°S DNA polymerase, KOD DNA polymerase, and Pfu DNA polymerase were 42.61% and 43.62%, respectively. The specific alignment results are shown in Figures 1A and 1B.

[0065] SEQ ID NO: 14: KOD DNA polymerase

[0066] SEQ ID NO: 15: Pfu DNA polymerase

[0067] Example 2 Construction of recombinant plasmid, expression and purification

[0068] Changzhou Xinyisheng Life Science Technology Co., Ltd. was commissioned to synthesize the 27°N DNA polymerase and 4°S DNA polymerase gene sequences and clone the genes into the pET28a expression vector with the cloning sites Nde I and Xho I. The recombinant plasmids were transformed into competent Escherichia coli BL21 (DE3) cells and incubated at 37°C overnight for subsequent expression and purification.

[0069] 1. The affinity chromatography column and cation exchange column used for 27°N DNA polymerase protein purification were HisTrap FF 5mL and HiTrap SP HP 5mL, respectively. The specific purification steps were as follows:

[0070] 1. Pick 3-6 single colonies that grow well on the plate, inoculate them into a 50 / 250ml LB liquid conical flask, and culture at 37℃ for 5-7h. 600 Then, the above bacterial solution was inoculated into 2L / 5L LB medium at a 1% inoculation volume and cultured at 37℃ for 2-4h. 600 Reach 0.8-1.0. Pre-cool the original shaker to 16°C. Add IPTG to each culture medium to a final concentration of 0.5 mM. Induce expression for 12-16 hours in a shaker at 16°C, 220 rpm.

[0071] 2. Collect the cells by centrifugation at 8000g for 30min, then resuspend them in affinity solution A at a ratio of 1:10, and disrupt them by ultrasound in an ice bath.

[0072] 3. Heating treatment: Preheat the water bath to 75-80℃, place the broken bacteria into the water bath, shake and mix, use a clean thermometer to check the internal temperature of the bacteria solution. When it reaches 75℃, start timing for 30 minutes. During this period, shake and mix 3 times every 10 minutes to ensure uniform heating.

[0073] 4. Centrifuge the heat-treated ultrasonic disrupted liquid at 12,000 rpm and 4°C for 60 min. Filter the supernatant with a 0.22 μM filter membrane and use it as the sample for the purification column.

[0074] 5. Load the sample onto the pretreated HisTrap FF column at a rate of 3 ml / min. After loading, rinse with Ni-column affinity buffer A for 20 column volumes. Then, perform a linear elution with Ni-column affinity buffer B from 0% to 70% over 10.5 CV. Collect the eluted protein when the UV absorbance peak reaches 50 mAu and stop collecting when the UV absorbance peak drops to 200 mAu.

[0075] 6. Dilute the collected eluate 10-fold with diluent and load it onto the pretreated SP column (HiTrap SP HP 5ml). After loading, rinse with SP column solution A for 30CV until the baseline is stable at a flow rate of 5min / min.

[0076] 7. Use SP column B solution for gradient elution (0-70% SP column B solution, 20CV) to elute the target protein at a flow rate of 5 ml / min. The collected samples are analyzed by SDS-PAGE to determine the protein purity.

[0077] 8. After the purified protein sample is dialyzed and its concentration is determined, it is stored in storage solution for subsequent functional activity analysis.

[0078] The specific components of the buffer used in the purification process are shown below, and the purification results are shown in Figure 2:

[0079] Ni column-A Buffer: 20mM Tris-HCl (2.42g / L), 500mM NaCl (29.22g / L), 20mM Imid azole (1.36g / L), 5% Glycerol (62.5g / L), pH 7.5;

[0080] Ni column-B Buffer: 20mM Tris-HCl (2.42g / L), 500mM NaCl (29.22g / L), 500mM Imid azole (34.04g / L), 5% Glycerol (62.5g / L), pH 7.5;

[0081] SP column-A Buffer: 20mM Tris-Hcl (2.42g / L), 50mM NaCl (2.92g / L), 5% Glycerol (62.5g / L), pH 7.5;

[0082] SP column-B Buffer: 20mM Tris-Hcl (2.42g / L), 1M NaCl (58.44g / L), 5% Glycerol (62.5g / L), pH 7.5;

[0083] Diluent: 20 mM Tris-HCl (2.42 g / L), 5% Glycerol (62.5 g / L), pH 7.5;

[0084] 2X dialysate: 40 mM Tris-HCl, 200 mM KCl, 2 mM DTT (0.154 g / L), 0.2 mM EDTA (0.0884 g / L), 5% Glycerol, pH 8.0 @ 25°C;

[0085] Stock solution: 10 mM Tris-HCl (1.2114 g / L), 100 mM KCl (7.455 g / L), 1 mM DTT (0.15425 g / L), 0.1 mM EDTA (0.037224 g / L), 50% Glycerol (625 g / L), pH 7.5@25°C.

[0086] 2. The affinity chromatography column and anion exchange column used for purification of 4°S DNA polymerase protein were HisTrap FF 5mL and HiTrap Q HF 5mL, respectively. The specific purification steps were as follows:

[0087] 1. Pick 3-6 single colonies that grow well on the plate, inoculate them into a 50 / 250ml LB liquid conical flask, and culture at 37℃ for 5-7h. 600 Then, the above bacterial solution was inoculated into 2L / 5L LB medium at a 1% inoculation volume and cultured at 37℃ for 2-4h. 600 Reach 0.8-1.0. Pre-cool the original shaker to 16°C. Add IPTG to each culture medium to a final concentration of 0.5 mM. Induce expression for 12-16 hours in a shaker at 220 rpm at 16°C.

[0088] 2. Collect the cells by centrifugation at 8000g for 30min, then resuspend them in affinity solution A at a ratio of 1:10, and disrupt them by ultrasound in an ice bath.

[0089] 3. Heating treatment: Preheat the water bath to 75-80℃, place the broken bacteria into the water bath, shake and mix, use a clean thermometer to check the internal temperature of the bacteria solution. When it reaches 75℃, start timing for 30 minutes. During this period, shake and mix 3 times every 10 minutes to ensure uniform heating.

[0090] 4. Centrifuge the heat-treated ultrasonic disrupted liquid at 12,000 rpm and 4°C for 60 min. Filter the supernatant with a 0.22 μM filter membrane and use it as the sample for the purification column.

[0091] 5. Load the sample onto a pretreated HisTrap FF 5 mL column at a rate of 3 mL / min. After loading, rinse with Ni-column affinity buffer A for 20 column volumes. Then, perform a linear elution with Ni-column affinity buffer B from 0% to 70% over 10.5 CV. Collect the eluted protein when the UV absorbance peak reaches 50 mAu and stop collecting when the UV absorbance peak drops to 200 mAu.

[0092] 6. Dilute the collected eluate 6-fold with diluent and load it onto a pretreated Q column (HiTrap Q HP 5ml). After loading, rinse the Q column with solution A for 30CV until the baseline is stable at a flow rate of 5min / min.

[0093] 7. Perform gradient elution (0-100% Q column B solution, 10CV) of the target protein using Q column solution B at a flow rate of 5ml / min. The collected samples were analyzed by SDS-PAGE to determine the protein purity.

[0094] 8. After the purified protein sample is dialyzed and its concentration is determined, it is stored in storage solution for subsequent functional activity analysis.

[0095] The specific components of the buffer used in the purification process are shown below, and the purification results are shown in Figure 3:

[0096] Ni column-A Buffer: 20mM Tris-HCl, 300mM NaCl, 20mM Imidazole, 5% Glycerol, pH 8.5;

[0097] Ni column-B Buffer: 20mM Tris-HCl, 300mM NaCl, 500mM Imidazole, 5% Glycerol, pH 8.5;

[0098] Q column-A Buffer: 20mM Tris-HCl, 100mM NaCl, 5% Glycerol, pH 8.5;

[0099] Q column-B Buffer: 20mM Tris-HCl, 500mM NaCl, 5% Glycerol, pH 8.5;

[0100] Diluent: 20 mM Tris-HCl, 5% Glycerol, pH 8.5;

[0101] 2X dialysate: 40 mM Tris-HCl, 200 mM KCl, 2 mM DTT (0.154 g / L), 0.2 mM EDTA (0.0884 g / L), 5% Glycerol, pH 8.0 @ 25°C;

[0102] Stock solution: 10 mM Tris-HCl (1.2114 g / L), 100 mM KCl (7.455 g / L), 1 mM DTT (0.15425 g / L), 0.1 mM EDTA (0.037224 g / L), 50% Glycerol (625 g / L), pH 8.0@25°C.

[0103] Example 3 Thermal Stability Determination

[0104] Protein stability was determined using the Protein Thermal Shift™ dye kit (ThermoFisher). KOD DNA polymerase and Pfu DNA polymerase were used as controls. The test reaction system consisted of 5 μL Protein Thermal Shift Buffer, 2 μL of the test protein (purity greater than 90%, concentration 0.2 mg / ml-2 mg / ml), 2.5 μL 8× Protein thermal shift dye, and 10.5 μL NF water. The reaction system was mixed and placed on a qPCR instrument for a 25-99°C temperature increase experiment. The changes in the ROX fluorescence signal were monitored. The results showed that the two novel DNA polymerases disclosed in this invention had good thermal stability, with their T m The values ​​are comparable to those of KOD DNA polymerase and higher than those of Pfu DNA polymerase, as shown in Table 1 below:

[0105] Table 1:

[0106] Example 4 Polymerization activity determination

[0107] Polymerization activity was determined using a primed M13 ssDNA substrate. The specific principle is shown in Figure 4. In the presence of polymerization activity, the primers on the primed M13 ssDNA will extend along the ssDNA in the 5'-3' direction to produce dsDNA, which can be quantitatively detected using the Qubit dsDNA HS Assay Kits.

[0108] The specific reaction system and components are shown in Table 2 below:

[0109] Table 2:

[0110] The reaction mixture was incubated at 72°C for 5 minutes, then terminated with 2 μl of 0.5 M EDTA. The dsDNA concentration was determined using a Qubit assay kit. A negative control (NC) was used, which was a reaction system without polymerase. The results are shown in Table 3 below (Qubit values ​​are those after subtracting the NC control):

[0111] Table 3:

[0112] The above results show that the two novel B-family DNA polymerases disclosed in the present invention have polymerization activity at 72°C.

[0113] Example 5 Exo-activity assay (3'-5' exo-activity)

[0114] The exosome activity of 27°N DNA polymerase and 4°S DNA polymerase was qualitatively confirmed using the terminal mismatch fluorescent probe method (reaction at 37°C for 1 h). The probe sequences were ATCAGCAGGCCACACGTTAAACTGT-BHQ2 (SEQ ID NO: 5) and FAM-5'-TGTCTTTAACGTGTGGCCTGCTGAT (SEQ ID NO: 6).

[0115] The reaction system used for the exo-activity assay is as follows: 2.5 μL Reaction Buffer, 0.25 μL of 10 μM fluorescent probe substrate, 2 μL of enzyme solution (the enzyme concentration used is 0.6 mg / ml), and 20.25 μL of NF water.

[0116] The negative control (NC) group also used the above reaction system, replacing the enzyme solution with the corresponding enzyme storage solution. The positive control (PC) group also used the above reaction system, using the known B-family DNA polymerase KOD. The reaction system was set up on ice. The entire reaction volume was 25 μL. The reaction was performed in a 384-well plate and then placed in a microplate reader for fluorescence signal detection. The excitation and emission light were set to 492 nm and 518 nm, respectively. The fluorescence signal was collected every 30 seconds, and the entire reaction lasted for 1 hour.

[0117] The results are shown in Figure 5 (the corresponding blank control values ​​have been subtracted from the fluorescence values). The lines in Figure 5 represent the changes in fluorescence signals monitored in real time during the experiment, and therefore the lines are zigzag and do not appear as straight lines. The results show that, similar to KOD DNA polymerase, both 27°N DNA polymerase and 4°S DNA polymerase possess 3'-5' exosome activity, which supports the proofreading function of DNA polymerases during PCR.

[0118] Example 6 PCR performance test (PCR amplification extension rate test)

[0119] To test the amplification rates of 27°N and 4°S DNA polymerases in PCR applications, the following reaction system was used for PCR amplification experiments. Specifically, a 2 kb target gene fragment was amplified using different extension times, and the amplification effect was detected by agarose gel electrophoresis. The template substrate used was λ DNA, and the amplification primers used were:

[0120] λF: CCTGCTCTGCCGCTTCACGC (SEQ ID NO: 7)

[0121] λ-2R (2kb): CCATGATTCAGTGTGCCCGTCTGG (SEQ ID NO: 8)

[0122] The PCR reaction system is shown in Table 4 below:

[0123] Table 4:

[0124] The 10× reaction buffer used for 27°N DNA polymerase amplification was: 200 mM Tris-HCl (pH 8.4), 250 mM KCl, 15 mM MgCl2, 3.6 mg / ml BSA, 100 mM ammonium sulfate, and 2% Tween20 / NP40.

[0125] The 10× reaction buffer used for 4°S DNA polymerase amplification was: 150 mM Tris-HCl (pH 8.4), 750 mM KCl, 1 mM MgCl2, 3.6 mg / ml BSA, and 100 mM TMAC.

[0126] The PCR reaction system is shown in Table 5 below:

[0127] Table 5:

[0128] The PCR amplification results are shown in Figure 6. It can be seen that 27°N DNA polymerase can amplify a relatively clear main target band with an extension time of 30 seconds. 27°N DNA polymerase has a higher PCR amplification rate, amplifying a relatively clear target band in 30 seconds, an amplification rate approximately three times that of pfu DNA polymerase. In contrast, 4°S DNA polymerase requires approximately 90 seconds to amplify a 2kb target band, with an amplification rate of approximately greater than 1kb / min. Both novel DNA polymerases disclosed in the present invention have relatively good PCR amplification rates.

[0129] Example 7 PCR Performance Test (Sensitivity of PCR Amplification)

[0130] In order to test the amplification sensitivity of 27°N DNA polymerase and 4°S DNA polymerase in PCR reactions, PCR amplification was performed using the reaction system in Table 6 below under conditions of different substrate addition amounts:

[0131] Table 6:

[0132] The forward primer λF used in the above reaction system is CCTGCTCTGCCGCTTCACGC (SEQ ID NO: 7), and the forward primer λ-2R (2 kb) is CCATGATTCAGTGTGCCCGTCTGG (SEQ ID NO: 8).

[0133] The PCR amplification program is shown in Table 7 below:

[0134] Table 7:

[0135] The PCR amplification results are shown in Figure 7. When the substrate template concentration is 100 pg or above, 27°N DNA polymerase can specifically amplify the target band. Meanwhile, 4°S DNA polymerase can specifically amplify the corresponding target band at a substrate template concentration of 10 pg. Both novel DNA polymerases disclosed in this invention have good amplification sensitivity and offer significant potential for improvement.

[0136] Example 8 PCR Performance Test (Amplification of Target Gene Fragments of Different Lengths)

[0137] To test the amplification capabilities of 27°N DNA polymerase and 4°S DNA polymerase, PCR amplification experiments were performed using the following reaction system to amplify target gene fragments of different lengths. The template substrate used was λDNA, and the amplification primers used were:

[0138] λF: CCTGCTCTGCCGCTTCACGC (SEQ ID NO: 7)

[0139] λ-2R (2kb): CCATGATTCAGTGTGCCCGTCTGG (SEQ ID NO: 8)

[0140] λ-4R (4kb): CCAGGACTATCCGTATGACTACG (SEQ ID NO: 9)

[0141] λ-6R (6kb): GAGATGGCATATTGCTACGCAAGA (SEQ ID NO: 10)

[0142] λ-8R (8kb): GCCCTCGTTGCGTTTTGTTTGCACG (SEQ ID NO: 11)

[0143] λ-10R (10kb): GCACAGAAGCTATTATGCGTCCCCAGG (SEQ ID NO: 12)

[0144] λ-12R (12kb):TCTTCCTCGTGCATCGAGCTATTCGG (SEQ ID NO: 13)

[0145] Using λ DNA as a template, the above primers were used to amplify target gene fragments of 2kb, 4kb, 6kb, 8kb, 10kb, and 12kb, respectively. The PCR reaction system is shown in Table 8 below:

[0146] Table 8:

[0147] The 10× reaction buffer used for 27°N DNA polymerase amplification was: 200 mM Tris-HCl (pH 8.4), 250 mM KCl, 15 mM MgCl2, 3.6 mg / mL BSA, 100 mM ammonium sulfate, and 2% Tween20 / NP40.

[0148] The 10× reaction buffer used for 4°S DNA polymerase amplification was: 150 mM Tris-HCl (pH 8.4), 750 mM KCl, 1 mM MgCl2, 3.6 mg / mL BSA, and 100 mM TMAC.

[0149] The PCR reaction system is shown in Table 9 below:

[0150] Table 9:

[0151] The PCR amplification results are shown in FIG8 . Both 27°N DNA polymerase and 4°S DNA polymerase can amplify the corresponding target bands. However, when amplifying target gene fragments larger than 8 kb, the yield of the target amplification product is low.

[0152] From the foregoing description, it can be seen that the above-described embodiments of the present invention achieve the following technical effects: the DNA polymerase of the present application has a high amplification rate, good thermal stability and amplification sensitivity, can amplify target gene fragments of varying lengths, and possesses both 5'-3' polymerization activity and 3'-5' exo-cleavage activity. During DNA amplification, it can achieve a relatively fast PCR extension rate, can better meet high market demands, and has great application potential.

[0153] The foregoing description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention shall be included within the scope of protection of the present invention.

Claims

1. A DNA polymerase, characterized in that The DNA polymerase is: 1) a protein having an amino acid sequence as shown in SEQ ID NO: 1 or 2; or 2) A protein having an amino acid sequence with 80% or more, more preferably 90% or more, and even more preferably 95% or more homology to the amino acid sequence shown in SEQ ID NO: 1 or 2, and having DNA polymerase activity.

2. The DNA polymerase according to claim 1, characterized in that The DNA polymerase T m The value is 95.88℃-96.45℃; Preferably, the amplification rate of the DNA polymerase is 1-4 kb / min; Preferably, the amplification rate of the DNA polymerase is 3-4 kb / min; Preferably, the DNA polymerase has 5'-3' polymerization activity and 3'-5' exolytic activity.

3. A DNA molecule, characterized in that The DNA molecule encodes the DNA polymerase according to claim 1 or 2.

4. The DNA molecule according to claim 3, characterized in that The DNA molecule is selected from: A) a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 3 or 4; B) A polynucleotide having 80% or more, more preferably 90% or more, and even more preferably 95% or more homology with a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 3 or 4.

5. A recombinant plasmid, characterized in that: The recombinant plasmid is connected to the DNA molecule according to claim 3 or 4.

6. A host cell, characterized in that The host cell is transfected with the recombinant plasmid according to claim 5.

7. The host cell according to claim 6, characterized in that The host cell includes a prokaryotic cell or a eukaryotic cell.

8. A PCR amplification kit, comprising a DNA polymerase, characterized in that: The DNA polymerase is the DNA polymerase according to claim 1 or 2.

9. The PCR amplification kit according to claim 8, characterized in that: The PCR amplification kit further comprises: a PCR buffer, preferably the PCR buffer comprises a 10×PCR buffer, and further preferably the 10×PCR buffer is selected from any one of the following: A) pH 8.2-8.6 150-200 mM Tris-HCl, 250-750 mM KCl, 1-15 mM MgCl2, 1-4 mg / mL BSA and 100-600 mM TMAC; B) pH 8.2-8.6: 150-200 mM Tris-HCl, 250-750 mM KCl, 1-15 mM MgCl2, 1-4 mg / mL BSA, 100-600 mM ammonium sulfate and 1-10% Tween 20 or NP40.

10. The PCR amplification kit according to claim 8, characterized in that: The PCR amplification kit also includes: a PCR enhancer and dNTPs; Preferably, the PCR enhancer comprises betaine.

11. A method for PCR amplification using the DNA polymerase according to claim 1 or 2 or the PCR amplification kit according to any one of claims 8 to 10.

12. The method according to claim 11, characterized in that The PCR amplification rate is 1-4 kb / min; Preferably, the PCR amplification rate is 3-4 kb / min.

13. A method for constructing a sequencing library, characterized in that: The method comprises: preparing nucleic acid samples into DNA fragments with sequencing adapters; Amplifying the DNA fragment with the sequencing adapter by PCR to obtain the sequencing library; Wherein, the PCR amplification is performed using the DNA polymerase described in claim 1 or 2 or the PCR amplification kit described in any one of claims 8 to 10.

14. A sequencing method, characterized in that: The method comprises: The sequencing library obtained by the method according to claim 13 is sequenced on a sequencing machine to obtain a sequencing result.

Images