Method of producing immortalized progenitor megakaryocytes from adult human hematopoietic stem and progenitor cells for in vitro large-scale functional platelet generation

Abstract

The present invention provides a method of producing human immortalized megakaryocytes and / or human immortalized megakaryocyte progenitors and / or a human megakaryocytic cell line (102) from adult CD34+ HSPCs (100) capable of maturing towards functional megakaryocytes (103) that produce functional platelets (104), the method at least comprising a step of enforcing expression of at least one gene by introducing an expression cassette comprising at least one gene into the CD34+ HSPCs (100) by transduction, in particular lentiviral (LV) transduction, wherein the transduced CD34+ HSPCs (100) are configured to express at least one gene from the HOXL subclass of ANTP homeobox class family and / or the TALE homeobox class family upon induction of expression by an activator, and constitutively express at least one antiapoptotic gene from the BCL2 family, wherein the transduced CD34+ HSPCs (100) are immortalized through expression of the at least one gene from the HOXL subclass of the ANTP homeobox class family and / or the TALE homeobox class family, preferably wherein the at least one gene from the HOXL subclass includes one among HOXB8, HOXA7, HOXA10, or HOXB4 gene in combination with at least one among MEIS1, MEIS2, MEIS3, PBX1, PBX2, PBX3, and / or PBX4 gene, while the at least one antiapoptotic gene from the BCL2 family includes BCL2L1 or BCL2L2. The invention further provides a method of producing a functional platelet by using immortalized megakaryocytes and / or immortalized megakaryocyte progenitors and / or an immortalized megakaryocytic cell line obtained through the above-described method. Still further, the invention provides a pharmaceutical composition comprising functional platelets obtained through the above-described method, and therapeutic uses thereof.

Description

[0001] Method of producing immortalized progenitor megakaryocytes from adult human hematopoietic stem and progenitor cells for in vitro large-scale functional platelet generation

[0002] The present invention belongs to the field of methods and techniques for obtaining functional platelets, in particular functional clinical-grade platelets, from human immortalized megakaryocytes and / or human immortalized megakaryocyte progenitors and / or human megakaryocytic cell lines.

[0003] In particular, the invention relates to a method of producing human immortalized megakaryocytes and / or human immortalized megakaryocyte progenitors and / or a human megakaryocytic cell line from adult CD34+ hematopoietic stem and progenitor cells (HSPCs) capable of maturing towards functional megakaryocytes that produce functional platelets.

[0004] The invention further relates to a method of producing a functional platelet, in particular a functional clinical-grade platelet, using immortalized megakaryocytes and / or immortalized megakaryocyte progenitors and / or an immortalized megakaryocytic cell line, obtained through the above method.

[0005] Still further, the invention relates to a functional platelet obtained though the above method.

[0006] Eventually, the invention relates to a pharmaceutical composition comprising functional platelets obtained through the method above, and therapeutic uses thereof.

[0007] Diseases such as thrombocytopenia lead to a low level of platelets in affected patients.

[0008] In such cases, platelet transfusion represents the only therapeutic option to avoid lifethreatening bleedings.

[0009] Platelet infusion in patients can also be used for treatment of other clinically-relevant conditions, such as leukemia, bone marrow transplantation, anticancer treatment, or the like.

[0010] Platelets can be isolated during voluntary blood donation.

[0011] Nonetheless, their short shelf life (in the range of about 5 to 7 days) negatively impacts on their availability.

[0012] This is even more problematic in health crisis situations, such as epidemics.

[0013] Moreover, platelets from donors always contain human plasma, red blood cells, and residual leukocytes, potentially leading to adverse events after transfusion, unless the concentrate is treated with devices such as filters or pathogen-reduction techniques. In vivo, platelets are formed and released into the bloodstream by precursor cells called megakaryocytes (MKs), derived from pluripotent hematopoietic and progenitor stem cells (HSPCs) that reside within the bone marrow (BM) (Wang and Zheng, 2016).

[0014] Megakaryocytopoiesis, also referred to as megakaryopoiesis orthrombopoiesis, is the process by which megakaryocytes (and, ultimately, platelets) develop from HSPCs.

[0015] The differentiation of platelets from hematopoietic stem cells (HSCs) proceeds by multiple cell differentiation steps, orchestrated by many transcriptional programs regulated by a network of transcription factors.

[0016] In principle, the hierarchical megakaryocytopoiesis model is: HSCs differentiate into Multipotential Progenitors, which differentiate into Common Myeloid Progenitor, which differentiate into Megakaryocyte-erythroid progenitors, which differentiate into megakaryoblasts.

[0017] Megakaryoblasts mature into megakaryocytes within the bone marrow.

[0018] Mature megakaryocytes migrate toward the sinusoidal blood vessel and form pseudopodial elongation (proplatelets) through the vascular endothelial cells to produce platelets.

[0019] Over the years, significant efforts have been invested in developing techniques for in vitro production of platelets from different sources, to sustain the continuous need for fresh platelet concentrate, in particular: (1) HSPCs, (2) reprogrammed cells, (3) non-hematopoietic sources, and (4) artificial platelets.

[0020] Large scale production of platelets from HSPCs for therapeutic use is a challenge, mainly for the following reasons.

[0021] First, in v / fro-derived-MKs do not produce as many platelets as in vivo.

[0022] Also, in vitro expansion of megakaryocytes or their progenitors has a limited self-renewal capacity.

[0023] Eventually, the source of megakaryocytes or their progenitors is limited since they are either isolated from peripheral blood (PB) or BM aspiration from volunteer donors.

[0024] In particular, even though large-scale donation of megakaryocytes progenitors and / or platelets would be potentially achievable, nevertheless correct isolation, maturation, and platelet production protocols would be too expensive and would lead to unsolvable variation in platelet production and quality, having a potential negative impact as to safety and efficacy for the patient.

[0025] Therefore, blood donation at a large scale is not suitable for industrialization for therapeutic use. Identification of new techniques to generate functional platelets ex vivo (in vitro) would allow to meet clinical demands, assist in reducing the cost of safety testing, and support patient treatment.

[0026] Development of a megakaryocytic cell line as single source for platelet production would allow for production of an indefinite number of platelets of equivalent quality, thus improving patient safety and transfusion efficacy.

[0027] To overcome the limited self-renewal capacity of HSPCs, scientists have developed human induced pluripotent stem cells (iPSCs) with the potential to differentiate towards megakaryocytes given the adequate growth conditions (including but not limited to a growth factor cocktail), able to produce platelet-like particles (Chen, Sugimoto and Eto, 2023).

[0028] This solution allows providing an inexhaustible self-renewable source of megakaryocytes that can be genetically modified to become universal donor platelets (Figueiredo et al., 2010) and can be grown under serum-free conditions (Pick et al., 2013).

[0029] However, clinical benefit of this technique has not been proven yet.

[0030] One limitation is that iPSCs are more prone to form tumor following transplantation, and current methods of producing iPSCs do not ensure reproducibility and maintenance, as the raw material comes from differentiated tissues (Prochazkova etal., 2015). As seen in experimental work, iPSCs maturation towards megakaryocytes is suboptimal (Mookerjee et al., 2020). Furthermore, due to their embryonic-like biology, iPSCs may lead to primitive megakaryopoiesis, resulting in megakaryocytes and platelets expressing low levels of key receptors, such as CD9 or GPIV, thereby reducing their functionality (Mattia et al., 2002; Bluteau et al., 2013).

[0031] EP2708597B1 discloses a method of producing polyploidized megakaryocytes. In particular, this known method comprises the step of obtaining polyploid megakaryocytes by forcing expression of an oncogene selected from the MYC family of genes, and from a polycomb group gene, such as BMI1 , in cells at any differentiation stage from hematopoietic progenitor cells to MKs before polyploidization, forcing expression of BCL-XL in MKs before polyploidization, and culturing and proliferating the resulting cells. Further disclosed therein is a method of producing a platelet from the obtained polyploidized MKs.

[0032] Other types of cells have also been exploited to produce megakaryocytes and platelets ex vivo.

[0033] Endothelial cells as well as fibroblasts can transdifferentiate towards megakaryocytes under specific conditions (Ono et al., 2012; Lis et al., 2017). However, the most promising cell types are adipose tissue-derived stromal cells, in particular because of their availability, although with the limitation of producing less than 1 platelet per cell (Tozawa et al., 2019).

[0034] Also, although described as functional, these megakaryocytes and obtained platelets are not originated from their natural progenitors, i.e., the HSPCs. Thus, they may be lacking of important features, such as haemostatic potency.

[0035] To overcome the limitations of platelet progenitors, scientists also tried to develop artificial platelets utilizing biosynthetic particle constructs that functionally emulate various haemostatic mechanisms of platelets.

[0036] There are several ways to develop these artificial platelets, e.g., protein-decorated artificial platelet systems, peptide-decorated artificial platelet systems, and hetero-multivalent decorations (Luc et al., 2022).

[0037] Despite artificial platelets seem to represent an excellent alternative solution, particularly for their universal aspect, accurate studies still need to be performed to assess thrombotic risks, scalability, possible immune responses in case of multiple infusions, and overall costs.

[0038] In the light of the above, it is an object of the present invention to provide an improved method of producing human immortalized megakaryocytes and / or human immortalized megakaryocyte progenitors and / or a human megakaryocytic cell line allowing obtaining high- quality functional platelets from adult CD34+ HSPCs which are as similar as possible to natural platelets circulating in vivo, in a clinically-relevant amount.

[0039] It is also an object of the invention to provide a method of producing a functional platelet using human immortalized megakaryocytes and / or human immortalized megakaryocyte progenitors and / or a human megakaryocytic cell line obtained through the above method.

[0040] A still further object of the present invention is to provide a pharmaceutical composition comprising functional platelets obtained through the above method, and therapeutic uses thereof.

[0041] The above-mentioned objects are obtained by the provision of a method as defined in claim 1.

[0042] According to the invention, a method of producing human immortalized megakaryocytes and / or human immortalized megakaryocyte progenitors and / or a human megakaryocytic cell line from adult CD34+ hematopoietic stem and progenitor cells (HSPCs) capable of maturing towards functional megakaryocytes that produce functional platelets at least comprises: S1 : enforcing expression of at least one gene by introducing an expression cassette comprising at least one gene into the CD34+ HSPCs (100) by transduction, in particular lentiviral (LV) transduction, wherein the transduced CD34+ HSPCs are configured to express at least one gene from the HOXL subclass of the antennapedia homeoprotein (ANTP) homeobox class family and / or the three-amino-acid loop extension (TALE) homeobox class family upon induction of expression by an activator, and constitutively express at least one antiapoptotic gene from the BCL2 family; wherein the transduced CD34+ HSPCs are immortalized through expression of the at least one gene from the HOXL subclass of the ANTP homeobox class family and / or the TALE homeobox class family, preferably wherein the at least one gene from the HOXL subclass includes one among HOXB8, HOXA7, HOXA10, or HOXB4 gene in combination with at least one among MEIS1 , MEIS2, MEIS3, PBX1 , PBX2, PBX3, and / or PBX4 gene, while the at least one antiapoptotic gene from the BCL2 family includes BCL2L1 or BCL2L2.

[0043] The present invention provides a method of producing human immortalized megakaryocytes and / or human immortalized megakaryocyte progenitors and / or a human megakaryocytic cell line.

[0044] In particular, according to the invention, human immortalized megakaryocytes and / or human immortalized megakaryocyte progenitors and / or a human megakaryocytic cell line are obtained from adult CD34+ hematopoietic stem and progenitor cells (HSPCs) capable of maturing towards functional megakaryocytes.

[0045] In particular, these functional megakaryocytes are capable of producing functional platelets.

[0046] The method at least comprises a step of enforcing expression of at least one gene by introducing an expression cassette comprising at least one gene into the CD34+ HSPCs by transduction, in particular lentiviral (LV) transduction.

[0047] Transduction using lentivirus enables integration of the expression cassette within the genome of the cells, thus avoiding expression loss of the gene.

[0048] Preferably, second or third generation lentiviruses are used for transduction.

[0049] In particular, the cassette contains a constitutive (e.g., Elongation Factor (EF)1a) and / or an inducible, for instance, tetracycline-dependent (e.g., Tetracycline Responding Element (TRE)) promoter. The transduced CD34+ HSPCs are configured to express at least one gene from the HOXL subclass of the antennapedia homeoprotein (ANTP) homeobox class family and / or the three- amino-acid loop extension (TALE) homeobox class family upon induction of expression by an activator, and constitutively express at least one antiapoptotic gene from the BCL2 family.

[0050] The transduced CD34+ HSPCs are immortalized through expression of the at least one gene from the HOXL subclass of the ANTP homeobox class family and / or the TALE homeobox class family.

[0051] Preferably, the at least one gene from the HOXL subclass includes one among HOXB8, HOXA7, HOXA10, or HOXB4 gene in combination with at least one among MEIS1 , MEIS2, MEIS3, PBX1 , PBX2, PBX3, and / or PBX4 gene.

[0052] Preferably, the at least one antiapoptotic gene from the BCL2 family includes BCL2L1 or BCL2L2.

[0053] The invention is based on the basic idea that human adult CD34+ HSPCs, i.e., the natural source of stem and progenitor cells from which megakaryocytes and platelets originate, are immortalized by blocking differentiation process, while ensuring continuous proliferation by transduction of at least one gene, the expression of which is controlled by an activator and at least one gene which is constitutively expressed. The transduced CD34+ HSPCs are immortalized and capable of differentiating into mature megakaryocytes by reducing at least one transduced gene expression, this resulting in an immortalized megakaryocytic cell line with an almost infinite proliferative capacity, at the same time preserving megakaryocytes differentiation potential.

[0054] An essentially unlimited cell source for in vitro production of clinically-relevant platelets is thus provided.

[0055] In particular, this almost infinite proliferating capacity allows obtaining a potentially unlimited stock of immortalized megakaryocytes and / or immortalized megakaryocyte progenitors and / or human megakaryocytic cell line, without the need of continuously finding new sources of megakaryocyte progenitors.

[0056] This inter alia permits increasing homogeneity among the batches of produced platelets.

[0057] The method allows obtaining standardized platelets that are functionally similar to natural ones circulating in vivo.

[0058] Still further, the method allows reducing the overall production costs.

[0059] An immortalized cell line can be defined as a population from a multicellular organism which would normally not proliferate indefinitely but, due to genetic modifications, becomes capable of evading cellular senescence and keep undergoing division. The cells can therefore be grown for prolonged periods in vitro. The genetic modifications required for immortality can occur naturally or be intentionally introduced or induced.

[0060] CD34 is a transmembrane phosphoglycoprotein protein encoded by the CD34 gene in humans, mice, rats and other species.

[0061] The CD34 protein is a member of a family of single-pass transmembrane sialomucin proteins that show expression on early haematopoietic and vascular-associated progenitor cells.

[0062] Immortalized megakaryocytes and / or immortalized megakaryocyte progenitors and / or megakaryocytic cell lines obtained through the method of the invention are capable of providing functional platelets, in particular functional clinical-grade platelets, upon maturation towards megakaryocytes.

[0063] As described previously, an unlimited cell source for in vitro platelet production is provided, which allows to produce enough platelets for an infusion, obtain platelets that are functionally similar to natural ones circulating in vivo, obtain universality, and reduce overall production costs.

[0064] As described below, mature megakaryocytes can be mechanically manipulated to generate platelets on demand.

[0065] The method of the invention allows overcoming the above-discussed drawbacks and limitations of the solutions of the state of the art.

[0066] An immortalized megakaryocyte cell line derived from human HSPCs, in particular adult CD34+ HSPCs, has the advantage of being capable to grow for a longer period compared to megakaryocyte progenitor cells derived from human HSPCs, in particular adult CD34+ HSPCs, and in a minimal growth media.

[0067] Immortalized CD34+ HSPC and / or mature megakaryocytes derived from immortalized CD34+ HSPC, provide the possibility to freeze and thaw immortalized CD34+ HSPC and / or mature megakaryocytes derived from the immortalized CD34+ HSPC as needed, representing an infinite source of megakaryocytes to produce improved functional platelets at minimal cost.

[0068] B cell lymphoma 2 (BCL2) family members are well known for their apoptotic regulator role.

[0069] Anti-apoptotic proteins from the BCL2 family, particularly MCL1 , BCL2L1 and BCL2L2, are known to increase pro-platelet formation by mature megakaryocytes (Kodama et al., 2012; Bhatlekar et al., 2019), and the expression of BCL2L1 has a beneficial effect on platelet life span (Mason et al., 2007; Zhang et al., 2007; Debrincat et al., 2012). In line, leukemia patient treated with Venetoclax, an inhibitor of the anti-apoptotic members of the BCL2 family, are prone to develop thrombocytopenia (10.6004 / jadpro.2022.13.4.4).

[0070] Key transcription factors which orchestrate hematopoiesis are the members of the homeobox family.

[0071] The HOXL subclass of the ANTP homeobox class family genes (HOX genes) are known to be highly involved in the regulation of hematopoiesis and are linked to aberrant proliferation and inhibition of differentiation when aberrantly expressed in acute myeloid leukemia.

[0072] HOXB4, H0XA9, HOXA10 and HOXB8 are able to immortalize hematopoietic progenitors in a growth-dependent manner, but with reduced megakaryopoiesis and erythropoiesis potential when used alone (Ferrell et al., 2005; Redecke et al., 2013; Stahlhut et al., 2021).

[0073] Several HOX genes, such as HOXB8, HOXA10 or HOXA7, are expressed in CD34+ sub population allowing for CFU-GEMM proliferation and in K562 cell line with megakaryocyte differentiation potential, and are important for cell fate decision (Sauvageau et al., 1994; So et al., 2004; Ferrell et al., 2005)

[0074] As mentioned in the foregoing, in the method of the invention, preferred HOXL subclasses are HOXB8, HOXA7, HOXA10, or HOXB4.

[0075] Transcription factors members of the TALE family are atypical homeodomain proteins, whose members are characterised by a three-residue insertion between helix 1 and 2, and play essential roles during embryonic development by participating in interactive transcription factor networks together with the HOX genes.

[0076] Myeloid ecotropic viral integration site (MEIS) homeobox family members, together with Pre- B cell leukaemia transcription factors (Pbx), act as a HOX gene co-factor to facilitate DNA binding and maintain proliferation of hematopoietic cells, while inhibiting myeloid differentiation in presence of growth factors (Calvo et al., 2001 ; Fujino et al., 2001 ; Wong et al., 2007; Bessa et al., 2008; Jolma et al., 2015).

[0077] In particular, MEIS1 was described as an important regulator in early haematopoiesis and megakaryocytic differentiation, and the constant MEIS1 expression is needed for progenitor fate choice towards MK lineage (Cai et al., 2012).

[0078] Preferably, produced immortalized megakaryocytes and / or immortalized megakaryocyte progenitors and / or human megakaryocytic cell line are / is capable of providing mature functional platelets, in particular functional clinical-grade platelets, upon differentiation and maturation in absence of the activator.

[0079] Preferably, the activator is a tetracycline or estrogen-receptor modulator. As a non-limiting example, the activator can be Tetracycline or a derivate thereof.

[0080] For instance, the activator can be one of Chlortetracycline, Oxytetracycline, Demectocycline, Lymecycline, Meclocycline, Methacycline, Minocycline, Rolitetetracycline, Doxycycline, Tiigecyline, Ervacycline, Sarecycline, or Omadacycline.

[0081] The estrogen-receptor modulator can be a Selective estrogen receptor modulator.

[0082] In particular, the estrogen-receptor modulator can be Tamoxifene, Toremifene, Reloxifene, Ospemifene, Anordrin, Bazedoxifene, Broparestrol, Clomifene, Cyclofenil, Lasofoxifene or Ormeloxifene.

[0083] Additionally or alternatively, the activator can be Isopropyl p-D-1 -thiogalactopyranoside (IPTG) and / or lactose (e.g.: through Lac operon based system).

[0084] Additionally or alternatively, the activator can be cumate (e.g.: through a Cumate-controlled operator system).

[0085] The expression of the gene can be activated (alternative wording: induced) by the addition of the activator (e.g., through tetracycline-controlled transcriptional activation).

[0086] This has the advantage that the gene can be expressed only during the expansion phase, and reduced during the maturation phase.

[0087] Advantageously, the method further comprises a step of culturing the transduced adult CD34+ HSPCs.

[0088] In particular, said step of culturing the transduced adult CD34+ HSPCs comprises expanding the transduced adult CD34+ HSPC in presence of the activator and at last one growth factor cocktail.

[0089] In particular, the step of culturing transduced CD34+ HSPCs is carried out in an expansion medium composition.

[0090] The presence of the activator allows and / or favours the expansion of the transduced adult CD34+ HSPC and / or immortalized megakaryocytes and / or immortalized megakaryocyte progenitors and / or human megakaryocytic cell line by enforcing gene expression regulated by an inducible promoter.

[0091] For instance, said inducible promoter may include Tetracyclin response element (TRE) or Cumate operator (CuO).

[0092] A specific effect can be determined by selecting a combination of single growth factors and tuning their concentration in the cocktail. Preferably, the at least one growth factor cocktail comprises at least one of Thrombopoietin (TPO), TPO receptor agonist, stem cell factor (SCF), interleukin 3 (IL-3), interleukin 6 (IL-6), interleukin 9 (IL-9,) and interleukin 11 (IL-11).

[0093] In particular, these growth factors, either alone or in combination, are advantageous for transduced CD34+ HSPC expansion.

[0094] Advantageously, the method may further comprise a step of differentiating and maturing the transduced CD34+ HSPCs and / or immortalized megakaryocytes and / or immortalized megakaryocyte progenitors and / or immortalized cell line into mature functional megakaryocytes.

[0095] In particular, this step is carried out in absence of the activator but in presence of the at least one growth factor cocktail.

[0096] Hence, gene expression regulated by the inducible promoter is reduced.

[0097] Also, growth factors allow and / or enable and / or induce differentiation into mature megakaryocytes.

[0098] Preferably, this step is carried out in a differentiation and maturation medium composition.

[0099] The differentiation and maturation medium composition is different from the expansion medium composition.

[0100] Advantageously, the method may further comprise a step of culturing the immortalized megakaryocytes and / or immortalized megakaryocyte progenitors and / or the immortalized megakaryocytic cell line.

[0101] In particular, this step is carried out in absence of the activator.

[0102] In principle, culturing allows keeping a cell line for a period of time.

[0103] Preferably, the step of culturing the transduced CD34+ HSPCs and / or transduced adult CD34+ HSPCs and / or the immortalized megakaryocytes and / or the immortalized megakaryocyte progenitors and / or the immortalized megakaryocytic cell line is conducted in absence of a serum and / or in absence of a feeder cell.

[0104] Serum is quite expensive and variable from lot to lot.

[0105] Thus, implementing culturing in serum-free conditions allows saving production costs and reducing undesired variability.

[0106] Feeder cells support the growth of cells in culture by contributing an undefined and complex mixture of extracellular matrix (ECM) components and growth factors.

[0107] The use feeder cells in cells culturing is overall expensive and complex. Thus, by implementing culturing without using feeder cells allows saving production costs and reducing undesired contamination of platelets by non-hematopoietic cells.

[0108] Preferably, adult CD34+ HSPCs are derived from peripheral blood (PB) or bone marrow (BM) of healthy adult donors, in particular a single human donor.

[0109] A single donor is advantageous, because production time and costs can be minimized as no pool of donors is required (e.g., only one health test, only one blood collection, etc. is required).

[0110] Procedures to differentiate HSPCs into megakaryocytes are nowadays well-known and several sources of CD34+ HSPCs are available (e.g., cord-blood (CB), bone marrow (BM) and mobilized or non-mobilized peripheral blood (PB)).

[0111] In principle, the CD34+ HSPCs used for the production of megakaryocytes according to the invention can be derived from adult BM and / or PB.

[0112] CD34+ HSPCs from CB, BM or PB may be not equally available and not giving the same quality of mature megakaryocytes and / or platelets, derived from megakaryocytes.

[0113] CB represents an abundant source of immature HSPCs and has been extensively used to produce megakaryocytes because of the high proliferative rate of CB CD34+ HSPC.

[0114] Experimental evidence showed that megakaryocytes derived from CD34+ HSPC isolated from CB differ from the one derived from CD34+HSPC isolated from BM or PB because of the reduced megakaryocyte size when matured (Ignatz et al., 2007), in turn resulting in a reduced platelet yield, which can negatively affect functionality of the resulting platelets (Miyazaki et al., 2000; Gaur et al., 2006).

[0115] Adult BM may represent an interesting source of HSPCs because CD34+ HSPCs are more frequent in BM than in PB.

[0116] However, the invasive procedure to obtain BM limits it access.

[0117] Finally, PB may be an adequate solution.

[0118] Blood donations are a well-accessible means and, although quantity of adult CD34+ HSPCs is lower in PB, they can be mobilized in the blood donor using mobilizing agents, such as G- CSF and / or Plerixafor.

[0119] CD34+ HSPCs derived from PB allow obtaining functional mature megakaryocytes and, in turn, functional platelets upon differentiation in vitro.

[0120] In all cases, regardless of the source, CD34+ HSPCs (i.e., not immortalized HSPCs) have limited proliferation and self-renewal properties, and are therefore not suitable for providing platelets on demand on the long term. Culture conditions of the cells have two main purposes: expansion / survival of the CD34+ HSPC and / or the transduced CD34+ HSPC and / or the immortalized megakaryocytes and / or the immortalized megakaryocyte progenitor and / or the immortalized megakaryocyte cell line, and differentiation and maturation towards mature megakaryocytes.

[0121] A chemically defined culture condition allows preventing compromising the final product and reducing variation.

[0122] The step of culturing the transduced CD34+ HSPCs, immortalized megakaryocytes and / or immortalized megakaryocyte progenitors and / or immortalized megakaryocytic cell line is preferably conducted for a duration of about one day to at least 3 months.

[0123] Also, the step of culturing the transduced CD34+ HSPCs, immortalized megakaryocytes and / or immortalized megakaryocyte progenitors and / or immortalized megakaryocytic cell line is preferably conducted at 37°C, 5% CO2 in a humid incubator.

[0124] Another important aspect when producing platelets is universality of the product.

[0125] Indeed, allogenic platelet refractoriness may often be caused by incompatibility of human leukocyte antigens (HLA) and antibodies in the recipient binding donor epitopes.

[0126] Universal platelets can be generated mainly through gene modification techniques targeting Beta-2-Microglobulin (B2M), which encodes the |32m-light chain component of HLA class I antigens.

[0127] B2M-knockdown through RNA interference technology reduces HLA class I expression, whereas B2M-knockout via endonucleases (ex: CRISPR / Cas9) creates HLA class l-null cells.

[0128] Experimental evidence revealed that cultured H LA-null or ablated megakaryocytes and platelets are functional while evading immune detection (Suzuki et al., 2020). In the proposed experimental procedure, while transducing the adult human CD34+ HSPCs to induce expression of the gene described below, addition of a lentiviral vector encoding for a miRNA B2M (SEQ ID1) can be considered.

[0129] SEQ ID1 :

[0130] 5’-

[0131] GAATCTTTGGAGTACGCTGGATGTTTTGGCCACTGACTGACATCCAGCGCTCCAAAGAT T-3’

[0132] This allows to generate a source of universally compatible human platelets able to escape their destruction through natural killer cells, thus avoiding an immune response that could be detrimental in patients in need of platelets transfusion. A further important aspect is the capacity to freeze transduced CD34+ HSPCs and / or immortalized megakaryocytes and / or immortalized megakaryocyte progenitors and / or immortalized megakaryocytic cell line and / or mature megakaryocytes derived from the immortalized cells.

[0133] In particular, the set of genes and choice of promoters described above may increase megakaryocyte survival after freezing and thawing, allowing to generate a bank of transduced CD34+ HSPCs and / or immortalized megakaryocytes and / or immortalized megakaryocyte progenitors and / or immortalized megakaryocytic cell line and / or mature megakaryocytes.

[0134] In particular, transduced genes members of the BCL2 family (such as BCL2L1), having an antiapoptotic function, are constitutively expressed by the cells toward the process.

[0135] The present invention further provides a method of producing a functional platelet.

[0136] Here, a functional platelet is produced by using immortalized megakaryocytes and / or immortalized megakaryocyte progenitors and / or an immortalized megakaryocytic cell line obtained through the method described in the foregoing.

[0137] In particular, the method comprises a step of obtaining immortalized megakaryocytes and / or immortalized megakaryocyte progenitors and / or an immortalized megakaryocytic cell line by implementing the above-described method.

[0138] The method further comprises a step of culturing the obtained immortalized megakaryocytes and / or immortalized megakaryocyte progenitors and or immortalized megakaryocytic cell line.

[0139] Still further, the comprises a step of differentiating the immortalized megakaryocytes and / or immortalized megakaryocyte progenitors and / or immortalized megakaryocytic cell line into mature functional megakaryocytes.

[0140] Eventually, the method comprises a step of obtaining functional platelets by mechanically manipulating the mature functional megakaryocytes.

[0141] Preferably, the latter step is conducted in a bioreactor.

[0142] Alternatively, the latter step may be conducted in a microfluidic device.

[0143] The functional platelets so obtained have similar functionalities to natural ones circulating in vivo.

[0144] In particular, the method allows obtaining high-quality functional platelets in a clinically-relevant quantity.

[0145] Also, the method allows obtaining high-quality functional platelets with reduced production costs. The invention further provides a functional platelet, in particular produced by implementing the method described in the foregoing.

[0146] Also, the invention provides a pharmaceutical composition comprising functional platelets obtained though the method described in the foregoing.

[0147] The pharmaceutical composition can be used in the treatment of a disease.

[0148] In particular, the pharmaceutical composition can be used in target specific treatment of a disease.

[0149] In particular, the disease can be thrombocytopenia.

[0150] Alternatively, the disease can be a bleeding disorder.

[0151] Also, the pharmaceutical composition can be used in regenerative medicine.

[0152] It can be seen as an advantage of the invention that adult human CD34+ HSPCs are the original (natural) source of megakaryocytes and, in turn, of platelets. Compared to other techniques using different cell sources, the megakaryocytes and / or platelets produced by the method(s) according to the invention are physiologically closer to the ones found in vivo. During the immortalization process, adult human CD34+ HSPCs and / or immortalized megakaryocytes and / or immortalized megakaryocyte progenitors and / or mature megakaryocytes can be modified to generate universal platelets. Altogether, the approach of the present invention can practically and economically become a solution to support the clinical needs in transfusion units, therapeutic and / or preventive applications and / or regenerative medicine.

[0153] Further details and advantages of the present invention shall now be disclosed in the connection with the drawings, in particular where:

[0154] Fig. 1 is a block diagram illustrating a method of producing human immortalized megakaryocytes and / or human immortalized megakaryocyte progenitors and / or an immortalized megakaryocytic cell line from CD34+ HSPCs capable of maturing towards functional megakaryocytes, according to an embodiment the invention;

[0155] Fig. 2 is a block diagram illustrating a method of producing a functional platelet according to an embodiment of the invention;

[0156] Fig. 3 is a diagram illustrating the methods of Fig. 1 (see area bounded by dashed lines) and Fig. 2 (complete figure);

[0157] Fig. 4 is a diagram illustrating plasmid maps of TRE-HOXB8, TRE-MEIS1 , EF1a-rtTA and EF1a-BCL2L1 , as used in the described experiments; Fig. 5 is a list of cloning primers suitable for use in the described experiment. In particular, the figures provide a lists of primers and restriction enzymes that are suitable for use to clone constructions;

[0158] Figs. 6A-I are diagrams illustrating experimental results of the described experiment, in particular demonstrating the advantages of transducing adult human CD34+ HSPCs with H0XB8, MEIS1 , BCL2L1 , and rtTA to obtain long-term proliferative cells capable of maintaining potential to differentiate towards mature megakaryocytes;

[0159] Fig. 7 is table that summarizes the different transduction conditions tested in the experiment of Figs. 6H-I;

[0160] Figs. 8A-H are diagrams illustrating experimental evidence that demonstrates clinical quality of platelets produced by using mature megakaryocytes derived from transduced adult human CD34+ HSPC with H0XB8, MEIS1 , BCL2L1 , and rtTA;

[0161] Fig. 9 is a diagram showing reduction of B2M in transduced adult human CD34+ HSPCs, and the impact on HLA-I surface expression.

[0162] Fig. 1 provides a block diagram showing steps S1 to S4 of a method of producing human immortalized megakaryocytes and / or human immortalized megakaryocyte progenitors and / or an immortalized megakaryocytic cell line from adult human CD34+ hematopoietic stem and progenitor cells (HSPCs) 100, according to an embodiment of the invention.

[0163] In particular, CD34+ HSPCs are capable of maturing towards functional megakaryocytes 103 that produce functional platelets 104.

[0164] The method comprises a step S1 of enforcing expression of at least one gene by introducing an expression cassette comprising at least one gene into the CD34+ HSPCs 100 by transduction, in particular lentiviral (LV) transduction.

[0165] The transduced CD34+ HSPCs 100 are configured to express the at least one gene from the HOXL subclass of the antennapedia homeoprotein (ANTP) homeobox class family and / or the three-amino-acid loop extension (TALE) homeobox class family, upon induction of expression by an activator.

[0166] In the present embodiment, the activator can be a tetracycline or estrogen-receptor modulator and / or Isopropyl p-D-1 -thiogalactopyranoside (IPTG) and / or a Cumate-controlled operator system.

[0167] Different kinds of activators may also be used, provided that they are suitable for the purpose.

[0168] The transduced CD34+ HSPCs 100 constitutively express at least one antiapoptotic gene from the BCL2 family. The transduced CD34+ HSPCs 100 are immortalized through expression of the at least one gene from the HOXL subclass of the ANTP homeobox class family and / or the TALE homeobox class family.

[0169] In the present embodiment, the at least one gene from the HOXL subclass includes one among HOXB8, HOXA7, HOXA10, or HOXB4 gene in combination with at least one among MEIS1 , MEIS2, MEIS3, PBX1 , PBX2, PBX3, and / or PBX4 gene.

[0170] Also, in the present embodiment, the at least one antiapoptotic gene from the BCL2 family includes BCL2L1 or BCL2L2.

[0171] The produced immortalized megakaryocytes and / or immortalized megakaryocyte progenitors and / or human megakaryocytic cell line 102 are / is capable providing functional platelets 104, in particular functional clinical-grade platelets 104, upon differentiation and maturation in absence of the activator.

[0172] In the present embodiment, the method further comprises a step S2 of culturing the transduced CD34+ HSPCs 100.

[0173] In particular culturing of the transduced CD34+ HSPCs 100 is carried out by expanding the transduced adult CD34+ HSPCs 100 in presence of the activator and at least one growth factor cocktail.

[0174] Here, step S2 is carried out in an expansion medium composition.

[0175] In the present embodiment, the at least one growth factor cocktail comprises at least one of thrombopoietin (TPO), a TPO receptor agonist, a stem cell factor (SCF), interleukin 3 (IL-3), interleukin 6 (IL-6), interleukin 9 (IL-9), and interleukin 11 (IL-11).

[0176] In the present embodiment, the method further comprise a step S3 of differentiating and maturing the transduced and / or expanded CD34+ HSPCs 100 and / or the immortalized megakaryocytes and / or immortalized megakaryocyte progenitors 102 and / or immortalized cell line into mature functional megakaryocytes 103.

[0177] Here, step S3 is carried out in absence of the activator and in presence of the at least one growth factor cocktail.

[0178] In the present embodiment, differentiation and maturation are carried out in a differentiation and maturation medium composition.

[0179] In particular, said differentiation and maturation medium composition is different from the expansion medium composition. In the present embodiment, the method further comprises a step S4 of culturing the immortalized megakaryocytes and / or immortalized megakaryocyte progenitors and / or the immortalized megakaryocytic cell line.

[0180] Here, step S4 is carried out in absence of the activator.

[0181] In the present embodiment, the step(s) of culturing the transduced CD34+ HSPCs 100 (step S2), the immortalized megakaryocytes 102 and / or the immortalized megakaryocyte progenitors and / or the immortalized megakaryocytic cell line 102 (step S4) is conducted in absence of a serum and / or in absence of a feeder cell.

[0182] Not explicitly shown is that, in this embodiment, the CD34+ HSPCs 100 are derived from adult peripheral blood or adult bone marrow of a single adult donor.

[0183] Also not explicitly shown is that, in the present embodiment, the single adult donor is a single human adult donor.

[0184] Fig. 2 provides is a block diagram showing steps S11 to S14 of a method of producing a functional platelet 104, according to an embodiment of the invention.

[0185] In particular, the method includes a step S11 of obtaining immortalized megakaryocytes and / or immortalized megakaryocyte progenitors and / or an immortalized megakaryocytic cell line 102 by implementing the method described in the foregoing (Fig. 1).

[0186] The method further includes a step S12 of culturing the obtained immortalized megakaryocytes and / or immortalized megakaryocyte progenitors and / or immortalized megakaryocytic cell line 102.

[0187] Still further, the method comprises a step S13 of differentiating the immortalized megakaryocytes and / or the immortalized megakaryocyte progenitors and / or the immortalized megakaryocytic cell line 102 into mature functional megakaryocytes 103.

[0188] Eventually, the method comprises a step S14 of obtaining functional platelets 104 by mechanically manipulating the mature functional megakaryocytes 103.

[0189] The method allows obtaining high-quality functional platelets 104 similar to natural ones circulating in vivo, in a clinically-relevant quantity.

[0190] Fig. 3 provides an exemplary illustration of the method Fig. 1 (area bounded by dashed lines) and the method of Fig. 2 (complete figure).

[0191] In the present embodiment, as shown in Fig. 3, step S14 is conveniently conducted in a bioreactor (or microfluidic device). Starting material are human adult CD34+ HPSCs 100 from peripheral blood or bone marrow of a single donor.

[0192] All blood cell lineages are produced via functional maturation of a rare population of multipotent HPSCs that can proliferate by self-renewal and differentiation.

[0193] HSPCs can be found in several organs, such as peripheral blood, bone marrow, and umbilical cord blood.

[0194] A first lentivirus LV is used to transduce cells with a first expression cassette.

[0195] A second lentivirus LV is used to transduce cells with a second expression cassette.

[0196] The first expression cassette comprises a constitutive promoter (EF1a). the second expression cassette comprises a tetracycline-dependent promoter (TRE).

[0197] In principle, a lentivirus LV may comprise more than one expression cassette or an expression cassette with a constitutive and an inducible promoter.

[0198] Transduction using lentivirus LV allows the integration of the expression cassette within the genome of the transduced cells, avoiding expression loss of the gene.

[0199] Culture conditions of the cells have two purposes, namely expansion / survival of the transduced adult CD34+ HSPCs and / or immortalized megakaryocytes and / or immortalized megakaryocytic progenitors and / or megakaryocytic cell line 102, but also their differentiation into mature megakaryocytes 103.

[0200] This needs to be done in chemically defined conditions to improve standardization of the process and prevent compromising the final product.

[0201] Not explicitly shown is that, in this embodiment, a specific combination of genes to immortalize CD34+ HSPCs 100 is used, i.e., HOXB8 together with MEIS1 , BCL2L1 and rtTA.

[0202] HOXB8 protein together with MEIS1 protein are sequence-specific transcription factors, with ability to arrest myeloid differentiation and allow the progenitors to divide indefinitely, while BCL2L1 protein is a critical anti-apoptotic protein and improve platelet quality.

[0203] In this experimental setting, rtTA and BCL2L1 are under the control of the EF1a promoter and is constitutively expressed, while HOXB8 and MEIS1 are under the control of the TER promoter, which depends on the co-transduction of reverse tetracycline-controlled transactivator (rtTA) (LV-EF1a-rtTA) and the presence of the activator doxycycline to be expressed.

[0204] The present invention further provides a functional platelet 104, in particular produced by implementing the above-described method(s) (Fig. 3). The present invention further provides a pharmacological composition, in particular comprising functional platelets 104 obtained through the above-described method(s) (Fig. 3).

[0205] The pharmacological composition is suitable for use for the treatment of a disease, preferably target specific treatment of a disease.

[0206] As a non-limiting example, the disease can be thrombocytopenia.

[0207] As a further example, the disease can be a bleeding disorder.

[0208] Alternatively, the pharmacological composition can be used in regenerative medicine.

[0209] Experimental data

[0210] Laboratory activities have been conducted by the inventors involving implementation of the above-described methods of the invention (Figs. 1 to 3).

[0211] The resulting experimental evidence will now be discussed with reference to Figs. 4 to 9.

[0212] Fig. 4 provides maps of plasmids used in the described experiment.

[0213] Here, MEIS1 and HOXB8 coding sequences were placed next to a Tetracycline Responded Element (TRE) promoter. rtTA and BCL2L1 coding sequences were placed next to an EF1A promoter.

[0214] In presence of the activator, TRE promoter is activated by rtTA.

[0215] In the experiment, doxycycline was used as the activator.

[0216] Upon activation of the TRE promoter, HOXB8 and MEIS expression is increased in the the transduced adult CD34+ HSPCs and / or immortalized megakaryocytes and / or immortalized megakaryocytic progenitors and / or megakaryocytic cell line.

[0217] In absence of the activator, rtTA is inactive as the TRE promoter.

[0218] Upon inactivation of the TRE promoter, HOXB8 and MEIS1 expression is reduced.

[0219] EF1a promoter allows for constitutively expression of the genes.

[0220] BCL2L1 and rtTA are continuously expressed in the the transduced adult CD34+ HSPC and / or immortalized megakaryocytes and / or immortalized megakaryocytic progenitors and / or megakaryocytic cell line and / or mature megakaryocytes.

[0221] Fig. 5 provides a list of cloning primers suitable for use in the context of the experiment (see also Fig. 6H). In particular, Fig. 5 provides a list of primers and restriction enzymes that can be used to clone constructions.

[0222] Fig. 6A shows experimental evidence regarding transducing adult CD34+ HSPCs with lentiviral (LV) vectors encoding for the proteins HOXB8, rtTA and BCL2L1 or HOXB8, MEIS1 , rtTA and BCL2L1 (see also the portion bounded by dashed lines in Fig. 3, and Fig. 4 for plasmid maps).

[0223] After transduction of CD34+ HSPCs and expansion for several weeks (here, more than 100 days) in the presence of the activator (here, doxycycline), CD41 an CD42b surface expression was measured by flow cytometry at different days during the culture.

[0224] During the time of culture, co-respective untransduced cells (control cells, cultured under the same conditions) did not survive (data not shown), suggesting an immortalization of the cells transduced with the gene only. Furthermore, the vector containing rtTA is also containing a puromycin resistant cassette allowing for selection of cells expressing rtTA with puromycin treatment (0.25 pg / mL for three days).

[0225] Fig. 6B shows evidence demonstrating that the expression of MEIS1 in transduced adult CD34+ HSPCs in presence of the activator increases the number of megakaryocyte progenitor (CD45RA-CD9+CD49f+). Transduced adult CD34+HSPCs were kept in expansion in presence of the activator for more than one month. Expression of the surface markers CD45RA, CD9 and CD49f were measured by flow cytometry.

[0226] Fig. 6C illustrates transduced CD34+ HSPCs with HOXB8, rtTA and BCL2L1 or HOXB8, MEIS1 , rtTA and BCL2L1 that were kept for more than one month in expansion in presence of doxycycline (DOX ON), and then differentiated towards megakaryocyte in absence of doxycycline (DOX OFF) for one week. CD41 and CD42b surface expression were measured by flow cytometry. It should be noted that cells with forced expression of MEIS1 during the expansion phase (DOX ON) were more CD41+CD42b+ double positive in differentiation phase (DOX OFF) compared with cells not transduced with LV vector expressing MEIS1.

[0227] Figs. 6 D-G illustrates transduced adult CD34+ HSPCs with lentiviral vectors encoding for the proteins BCL2L1 , HOXB8, MEIS1 and rtTA in expansion in presence of doxycycline (DOX ON), or cultured for one week in absence of doxycycline (DOX OFF).

[0228] Fig. 6D shows evidence confirming the reduction of the expression of doxycycline induced genes MEIS1 and HOXB8 after one week of doxycycline removal (DOX OFF) compared with transduced CD34+ HSPCs kept in expansion with doxycycline (DOX ON). MEIS1 and HOXB8 are also expressed in non-transduced cells, therefore a complete inhibition is not expected. Fig. 6E shows evidence demonstrating an increase in CD41+CD42b+ population in transduced adult CD34+ HSPCs after one week of doxycycline removal (DOX OFF), compared with transduced adult CD34+ HSPCs kept in expansion in presence of doxycycline (DOX ON). Cells were expanded for more than one month in presence of doxycycline prior differentiation by doxycycline removal was induced.

[0229] Fig. 6F shows evidence confirming surface expression of GPVI in both transduced adult CD34+ HSPCs after one week of doxycycline removal (DOX OFF) and transduced adult CD34+ HSPCs kept in expansion in presence of doxycycline (DOX ON).

[0230] Fig. 6G shows evidence demonstrating that transduced adult CD34+ HSPCs kept in expansion in presence of doxycycline (DOX ON) are smaller and mononucleated while transduced adult CD34+ HSPCs after one week of doxycycline removal (DOX OFF) can be polyploid and bigger than in DOX ON.

[0231] Together, Figs. 6 A-G confirm that co-expression of HOXB8, MEIS1 , BCL2L1 and rtTA in transduced adult CD34+ HSPCs in presence of doxycycline allows for long term culturing (Figs. 6A-B) with expansion of cells that kept megakaryocytic differentiation potential (Figs. 6C-G).

[0232] Figs. 6H-I show evidence confirming that combining HOXB8, MEIS1 , BCL2L1 and rtTA to transduced adult CD34+ HSPCs provides the best combination for producing immortalized megakaryocytes and / or immortalized megakaryocytic progenitors.

[0233] Fig. 6H shows the expansion of transduced adult CD34+ HSPCs in particular using the combination illustrated in Fig. 7, in presence of doxycycline (DOX ON). After transduction of CD34+ HSPCs, expansion was carried out over several weeks (here, more than 100 days) in presence of the activator doxycycline. CD41 an CD42b surface expressions were measured by flow cytometry at different moments during culture. During the time of culture, the co- respective untransduced cells (control cells, cultured under the same conditions) did not survive (data not shown), suggesting an immortalization of the cells transduced with the gene only. Furthermore, the vector containing rtTA is also containing a puromycin resistant cassette allowing for selection of cells expressing rtTA with puromycin treatment (0.25 pg / mL for three days).

[0234] Fig. 6I shows exemplary conditions kept up to 100 days in expansion in the presence of doxycycline and subsequent culturing in the absence of doxycycline, to allow maturation of the cells for 7 days. The different conditions had only relatively low amount of CD41 +CD42b+ cells after doxycycline removal (DOX OFF), compared with the expansion phase in presence of doxycycline (DOX ON), as observed in the flow cytometry analysis. Fig. 7 summarizes the different gene combination that were tested, as illustrated in Fig. 5H, confirming that the combination HOXB8 - MEIS1 - BCL2L1 - rtTA is the most suitable to produce mature megakaryocytes from transduced adult CD34+ HSPCs and / or immortalized megakaryocytes and / or immortalized megakaryocytic progenitors and / or an immortalized megakaryocytic cell line.

[0235] Fig. 8 shows the production of functional platelets by using transduced adult CD34+ HSPCs and / or immortalized megakaryocytes and / or immortalized megakaryocytic progenitors and / or an immortalized megakaryocytic cell line, differentiated into mature megakaryocytes after one week of doxycycline removal.

[0236] Fig 8A shows platelet (CD42b+CalceinAM+) production within a modified bioreactor at different time points (up to 120 minutes). The yield of produced platelets per megakaryocytes (Cells CD42b+CalceinAM+) was calculated as follows: (Number of platelets at T(t) - Number of Platelets at T(0)) I Megakaryocytes T(0).

[0237] Yield per time point is shown in Fig. 8B.

[0238] Evidence provided in Figs. 8C-D confirms the data illustrated in Figs. 8A-B, in particular using CD41 and CD42b as platelet surface markers.

[0239] Figs. 8E-H respectively show activation of platelets produced with the transduced adult CD34+ HSPCs with HOXB8 - MEIS1 - BCL2L1 - rtTA, by using convulxin (Fig. 8F), Thrombin (Fig. 8G), or a Thrombin and convulxin mix (Fig. 8H).

[0240] Fig. 9A: shows evidence demonstrating how universal platelets can be produced (Fig. 9A) by reducing B2M expression using lentiviral (LV) particles in transduced adult CD34+ HSPCs with HOXB8 - MEIS1 - BCL2L1 - rtTA.

[0241] Fig. 9B shows evidence demonstrating that it is possible to reduce B2M using a siRNA in 50.28% of transduced adult CD34+ HSPCs with HOXB8 - MEIS1 - BCL2L1 - rtTA, compared to transduced adult CD34+ HSPCs with HOXB8 - MEIS1 - BCL2L1 - rtTA not expressing the siRNA.

[0242] Experimental setup

[0243] Material and methods

[0244] Human embryonic kidney (HEK) 293T cell culture

[0245] HEK 293T cells were cultured and maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) (Gibco, 41966-029) supplemented with 10% Fetal Bovin Serum (FBS) and 1% penicillin streptomycin in a humidified incubator containing 5% CO2 at 37°C. For lentivirus production cells were plated at a density of 2*106cells in a 10 cm petri dish pre-treated 30 minutes room temperature with a 0.002% Poly-L-lysine solution (Sigma-Aldrich, P407).

[0246] Lentiviral Vector Cloning

[0247] Lentiviral clones expressing rtTA, HOXB8 and E6 / E7 were purchased from VectorBuilder (pLV[Exp]-EF1A>rtTA(ns):T2A:Puro (VB220725-1177cms), pLV[Exp]TRE>HPV16E6(ns):T2A:HPV16E7(ns):P2A:EGFP (VB2207271102pym), pLV[Exp]TRE>hHOXB8[NM_024016.4](ns):T2A:EGFP (VB2207271200nbb).

[0248] For subsequent construction, pLV[Exp]-EF1A>rtTA(ns):T2A:Puro and pLV[Exp]TRE>hHOXB8[NM_024016.4](ns):T2A:EGFP were modified to obtain a pLV[Exp]- EF1A>MCS (Multiple Cloning Site) and a pLV[Exp]-TRE>MCS, respectively. The open reading frame of BCL2L1 , ERG, FLI1 , MEIS1 , CDK4R24C-CCND1 , hTERT, MLL-AF9, JAK2V617F, YAPS127Awere amplified using primers from Fig. 5. The PCR products were gel purified prior digestion with the specified restriction enzymes (Fig. 5). Digested fragments were then cloned into a lentiviral backbone with elongation factor-1 a (EF1a) or with tetracycline response element (TRE) (Fig. 5). Ligation was carried out using the T3 DNA ligase (NEB). rtTA containing vector contains a puromycin, antibiotic-resistance gene for selection of transduced mammalian cells.

[0249] Lentivirus production and concentration

[0250] A third-generation, self-inactivating glycoprotein of vesicular stomatitis virus (VSV-G)- pseudotyped virion particles were produced by transient cotransfection of the packaging plasmids pMD.G (VSV-G), pMDLg / p.RRE (gag and pol), and pRSV-Rev (Rev gene), as well as the lentiviral transfer vector. Viral supernatant was harvested 48 h later. Viral particles were concentrated using either PEG8000 or sucrose gradient protocol. Viral titters were determined by infecting HEK293T cells and quantification of Psi copy number integration by gene integration quantitative polymerisation chain reaction (PCR).

[0251] Gene integration quantitative PCR

[0252] Genomic DNA (gDNA) was isolated using QuickExtract (Biosearch technologies) following the manufacturer’s recommendations. Fluorescence detection was done with Mic Real-Time PCR system using a total reaction of 10.5 pL containing PrimeTime gene exoression master mix, Primers and Probe for Psi (236481330, IDT), Primers and Probe for Albumin (236892403, IDT) and 10 ng gDNA.

[0253] Vector copy number (VCN) was calculated as follows:

[0254] VCN (per cell) = (nb molecules Psi / quantity mean of albumin gene) x 2.

[0255] Lentiviral titer was then extracted as follows:

[0256] Titer (IP / mL) = (nb of cells the day of the transduction x VCN) / Volume of virus in mL.

[0257] CD34+human hematopoietic cell isolation and transduction

[0258] CD34+human hematopoietic stem and progenitor cells (HSPC) were isolated from Granulocyte Colony Stimulation Factor (GCSF) mobilized leukopak (Jackson) by immunomagnetic sorting (Miltenyi Biotec) following manufacturer protocol. Briefly, cells were diluted 1 :1 in D-PBS. 30 mL of the diluted cells were carefully added on 10 mL Ficoll and centrifuged at 300g (acceleration 4, Break 0) for 30 minutes at room temperature. White Blood Cells are then collected and wash twice in D-PBS. Cells were then resuspended in Buffer (PBS 0.5% BSA 2 mM EDTA) at the concentration of 30*108per mL. Cells were then incubated with Fc Block and CD34 beads for 30 minutes at 4°C and purified using LS column (Miltenyi). Purification was confirmed by flow cytometry using CD34 PerCPCy5.5 (Biolegend). Purified CD34+cells were then frozen in freezing solution (40% IMDM, 50% FBS, 10%DMSO) and kept in liquid nitrogen.

[0259] Cells were thawed 24h prior transduction and resuspended at a concentration of 0.3*106per mL in 4Cell® Nutri-T GMP Medium (Sartorius), 10 nM Thrombopoietin receptor agonist peptide (TPOR-AP, Sigma-Aldrich, IEGPTLRQWLAARA-betaAla)2-K-NH2), 5.37 U / mL SCF (Miltenyi Biotec), 4 U / mL IL-3 (Miltenyi Biotec), 1% penicillin streptomycin (Sigma-Aldrich) and cultured in 24 well plates (Sarstedt) in a humidified incubator at 37°C containing 5% CO2.

[0260] For the transduction, cells were centrifuged at 200g for 5 minutes and resuspended in complete medium complemented with 100 pg / mL Poloxamer P470, 4 pg / mL Protamine Sulfate, 10 pM Prostaglandin E2, 8 pM Cyclosporin H and Lentiviral particles at MOI 10 (see Fig. 7) at a concentration of 1*106cells per mL in 50 pL in a U shape 96 well plate or 500 pL in 24 well plate for 24 hours. Medium was changed and 48 hours later doxycycline (DOX) at a concentration of 1 pg / mL was added to activate the expression of genes regulated by the TRE promoter. Puromycin was used at a concentration of 0.25 ng / mL for 72 hours to kill nontransduced cells after 3 weeks in culture in a humidified incubator at 37°C containing 5% CO2. Cells were kept in culture for at least 60 days in a DOX supplemented expansion medium, prior to being subjected to differentiation.

[0261] Cell characterization

[0262] Flow Cytometry

[0263] The following antibodies were used for immunophenotyping: Allophycocyanin (APC) conjugated anti-human CD41 (1 / 400, cat#: 303710, Biolegend), phycoerythrin (PE) conjugated anti-human CD42b (1 / 100, cat#: 303906, Biolegend), PE conjugated anti-human CD45RA (1 :200, cat#: 304108, Biolegend) fluorescein isothiocyanate (FITC) conjugated anti- human CD49f (1 :200, cat#: 313605, Biolegend) and PE-Cyanine7 conjugated anti-human CD9 (1 :200, cat#:312115, Biolegend), APC conjugated anti-human GPVI.

[0264] Briefly, cells were harvested and 20pL of cell suspension was diluted in PBS 0.1% BSA. Cells were then incubated 100uL of antibody mix diluted in PBS 0.1 % BSA for 20 minutes at room temperature protected from light. Acquisition was performed using a flow cytometer BD Fluorescence Accuri C6 PLUS and analysis with FCSalyzer software.

[0265] May Grunwald Giemsa staining

[0266] 12 well slides were coated with 50uL PBS 5% BSA by centrifuging 5 minutes at 500 rpm. Between 1000 and 50 000 cells were harvested, centrifuged at 200 g for 5 minutes and resuspended in 50 pL PBS 5% BSA. Cell suspension was then placed in the 12 well slide and centrifuged at 500rpm for 5 minutes. Slides was let air dried. May Grunwald Giemsa staining was performed as the manufacturer’s recommendations. Briefly, cells were stained for 5 minutes with May-Grunwald Stain and washed for 1.5 minutes. Cells were then stained for 15- 20 minutes with 1 :20 diluted Giemsa Stain. Slides were then washed with deionized water prior evaluation by microscope.

[0267] Quantitative Real-Time Reverse transcriptase PCR

[0268] Total RNA was extracted and transformed into cDNA from a dry cell pellet using Cell-to-Ct kit (Thermofisher A35374), following the manufacturer recommendations. Fluorescence detection was done with Mic Real-Time PCR system using a total reaction of 10 pL containing sensiFAST noROX Mix, Primers and Probe for MEIS1 or HOXB8. Primers and Probe for Albumin as gene references and 2 pL of cDNA template. Platelet production

[0269] Small-scale Platelet production system

[0270] Small-scale platelet production device was prepared, as described in WO2022167676A1.

[0271] 200.000 Cells in 5mL complete medium complemented with 0.02 U / rnL Apyrase and 25 mM HEPES were placed into a 50 mL tube fixed on an orbital mixer (IKA MS3 basic) within an enclosed chamber containing 5% CO2. The tube was connected to the inlet and outlet of the microfluidic chip with flexible 0.51 mm ID tubing (Tygon ST R-3607, Idex Health and Science, Germany). To ensure cell circulation, a peristaltic pump (IPC8, ISMATEC, Germany) was used to flow the cell suspension through the platelet production device at a rate of 1 mL / min for 90minutes. The whole setup for small-scale platelet production was enclosed into a chamber, thermo-regulated at 37°C by an air controller (The Box, Life Imaging Services, Switzerland). Samples of the cell and platelets suspension were collected at the end for platelets and MK count and characterization.

[0272] Large-scale setup for platelet production

[0273] Before platelet production, 50mg of cellulobeads were incubated with 40 pg / mL Von Willebrand Factor (VWF) overnight at 4°C.

[0274] 40mL of cell suspension containing 20*106transduced cells were diluted in a final volume of 250mL (HEPES 25mM and 0.02U / mL Apyrase). Cells were placed in a jacketed 500 mL-glass baffled vessel (Vessel V2, SpinChem, Sweden), in which a 28 mL bed reactor (RBR S2, Spinchem, Sweden) filled with VWF-coated cellulobeads was placed and attached to the rotor shaft (rotor IKA RW20 digital). Rotating speed was set at 900rpm for 120 minutes. A gas mixer unit (CO2 Biobrick, Life Imaging Services, Switzerland) provided air with 5% CO2 at a rate of 22 L / hour in the chamber. The jacket around the vessel was connected to a temperature control unit (Colora) set at 37°C, which circulated thermo-regulated water through the jacket.

[0275] Platelet characterization

[0276] The following dyes and antibodies were used for the purpose: Calcein AM (Final Concentration: 625 nM), APC conjugated anti-human CD41 (1 / 400, cat#:303710, Biolegend), PE conjugated anti-human CD42b (1 / 100, cat#:303906, Biolegend), APC conjugated antihuman CD42b (1 / 200, cat#:303912 Biolegend)

[0277] At the beginning and final time point of platelet production, medium containing cells and platelets was sampled. 20 pL of cell suspension was diluted in PBS 0.1% BSA. Cells were then incubated 100 pL of antibody mix diluted in PBS 0.1% BSA for 20 minutes at room temperature, protected from light. Two mixes were used: Calcein AM and APC-CD42b or APC- CD41 and PE-CD42b. Acquisition was performed using a flow cytometer BD Fluorescence Accuri C6 PLUS and analysis with FCSalyzer software.

[0278] Platelet Activation

[0279] Platelets were activated in a home-made Tyrode’s buffer (137 mM NaCI, 2,68 mM KCL, 11 ,9 mM NaHCO3, 0.43 mM NaH2PO4, 1 mM MgCI2, 5.55 mM Glucose, 5 mM HEPES, 0.35% Albumin and 2 mM CaCI2, pH 7.35) and incubated with between 5 ng / mL and 5000 ng / mL Convulxin (CVX), 2 U / mL Thrombin (Flla) or a combination of 10ng / mL CVX and 0.5 U / mL Flla.

[0280] Platelets were stained with APC conjugated anti-human CD41 or APC conjugated anti-human CD42b, and activation was assessed by fluorescent fibrinogen binding (AF488-conjugated Fibrinogen). Acquisition was performed using a flow cytometer BD Fluorescence Accuri 06 PLUS and analysis with FCSalyzer software.

[0281] Results

[0282] Combination of transqene allows for long-term culture and megakaryocyte differentiation

[0283] Adult CD34+HSPCs were transduced the different gene combination including DOX inducible genes (MEIS1 and / or HOXB8) together with constitutively expressed genes (BCL2L1 and rtTA) at a MOI of 10. After gene induction by doxycycline (DOX), cells were compared on long term culture (Fig. 6A) and their potential to mature towards CD41+CD42b+cells (Fig. 6C). Both cell lines (HOXB8-BCL2L1 or HOXB8-MEIS1-BCL2L1) were able to be kept in serum-free feeder-free culture for more than 3 months (Fig. 6A). Next, cells phenotype was characterized. Megakaryocyte progenitors are CD45RA'CD41+CD49f+CD9+. The surface marker expression CD45RA, CD49f and CD9 were compared by flow cytometry and found higher expression in HOXB8-MEIS1-BCL2L1 expressing cells compared with HOXB8-BCL2L1 expressing (Fig. 6B). Next, the maturation potential towards megakaryocytes of the 2 different combinations was tested. Adult CD34+HSPCs were transduced with the different gene combination including DOX inducible genes (MEIS1 and / or HOXB8) together with constitutively expressed genes (BCL2L1 and rtTA) at a MOI of 10 and kept for at least one month in expansion in the presence of doxycycline. Doxycycline was then removed for one week, and CD41 and CD42b surface expression was evaluated by flow cytometry. The proportion of CD41+CD42b+cell population was higher in the transduced adult CD34+HSPCs with HOXB8 - MEIS1 - BCL2L1 - rtTA, compared with the transduced adult CD34+ HSPCs with HOXB8 - BCL2L1 - rtTA (Fig. 6C). Next, the reduction of DOX-induced gene after DOX removal was confirmed (Fig. 6D). Transduced adult CD34+HSPCs with HOXB8 - MEIS1 - BCL2L1 - rtTA maturation potential was confirmed towards megakaryocytes after one week in the absence of doxycycline after more than one month in expansion with doxycycline (Fig. 6E-G). It was confirmed, by May- Grunwald Giemsa staining, that cells were polyploids after 7 days of DOX removal (Fig. 6G) and, by flow cytometry, that cells had increased CD41 and CD42b surface marker expression (Fig. 6E). Furthermore, 5% of the cells expressed GPVI at their surface (Fig. 6F).

[0284] Together, it was demonstrated that the gene combination BCL2L1 , HOXB8 and MEIS1 allows for long term proliferation of cells with the potential to differentiate towards polyploid megakaryocytes.

[0285] To confirm that this approach is the most suitable to produce clinically-relevant in vitro platelets, different methods were tested to immortalize cells using known genes for immortalizing adult hematopoietic progenitors or other type of cells. Genes were firstly selected based on their expression in the megakaryocytic lineage (ERG, FLI1 , JAK2V617F, GATAIs), then based on their capacity to immortalize other hematopoietic lineage (MLL-AF9, E6 / E7). hTERT was also selected to stabilize genetically immortalized cells, and BCL2L1 as an anti-apoptotic factor. YAPS127Aand CDK4R24C-CGND1 were added as standard immortalizer. Several CD34+transductions were performed sequentially, including the combination confirmed in Figs. 6A- H, to compare the different gene combination including DOX inducible genes (CDK4R24C- CCND1 , hTERT, MLL-AF9, JAK2V617F, YAPS127Aand E6 / E7) or constitutively expressed genes (ERG, FLI1 , GATAIs) (Fig. 7). As shown in Figs. 6H-I, these approaches were not successful in either or both long term proliferation (CDK4R24C-CCND1 and YAPS127A) or in the potential to mature towards mature megakaryocytes (MLL-AF9 and E6 / E7 and hTERT) (Figs. 6H-I).

[0286] HOXB8-MEIS1-BCL2L1 derived Megakaryocytes can produce functional platelets

[0287] Next, the aim was producing functional platelets from Megakaryocytes derived from HOXB8- MEIS1-BCL2L1 expressing cells. HOXB8-MEIS1-BCL2L1 cells were seeded in a xeno-free medium containing thrombopoietin to differentiate into MK, and transferred into a specifically modified rotating bed reactor, consisting of a pod containing cellulobeads, in a 200 mL bioreactor, for 2 hours at 900 RPM. Overtime, an increase in CalceinAM+CD42b+events within the platelet like particles gate (Fig. 8A) was detected by flow cytometry. After 120 minutes it was found that each Calcein AM+CD42b+cells produced 20 Calcein AM+CD42b+platelet like particles (PLP) per Calcein AM+CD42b+MK (Fig. 8B). These data were confirmed using CD41+CD42b+staining (Figs. 8C-D).

[0288] Evaluations were conducted to ensure that CD41+CD42b+PLP were functional platelets through flow cytometry fibrinogen binding in presence of PLT agonist such as Convulxin (CVX), Thrombin or a combination of both (Fig. 8E). Between 5 and 10% of in vitro produced platelets were binding to fibrinogen without agonist (Figs. 8F-H). Titration of CVX achieved a dose response increase of fibrinogen binding in CD41+PLP (Fig. 8F). In addition, up to 37.8% CD4TPLP bond to fibrinogen in presence of 2 U / rnL Thrombin (Fig. 8G). Combination of 10 ng / mL CVX and 0.5 U / rnL thrombin leads to 56.2% of CD42b+PLP Fibrinogen* (Fig. 8H). Together, in vitro platelets produced by HOXB8-MEIS1-BCL2L1 derived Megakaryocytes were able to bind to fibrinogen upon activation, and were not preactivated.

[0289] Inhibition of beta-2-microglobulin in immortalized megakaryocytic cell line

[0290] To produce universal platelets in vitro (Fig. 9A), knock down of beta-2-microglobulin was tested in transduced adult CD34+ HSPCs with HOXB8- MEIS1 - BCL2L1 - rtTA after more than 20 days in expansion in presence of doxycycline. T ransduction was implemented by using lentiviral particles at MOI 10 transduced adult CD34+ HSPCs with HOXB8 - MEIS1 - BCL2L1 - rtTA. After two weeks, the surface expression of beta-2-microglobulin was estimated by flow cytometry. It was possible to confirm a reduced B2M expression in 50.28% of the population (Fig. 9B). This result confirmed the possibility of reducing B2M in transduced adult CD34+ HSPCs with HOXB8 - MEIS1 - BCL2L1 - rtTA.

[0291] References

[0292] 100 (CD34+) Hematopoietic stem and progenitor cell(s), HSPC(s)

[0293] 102 Immortalized megakaryocytes / immortalized megakaryocyte progenitors / human megakaryocytic cell line

[0294] 103 Mature functional megakaryocyte(s), MK(s)

[0295] 104 Platelet(s)

[0296] LV Lentivirus

[0297] 51 Method step

[0298] 52 Method step

[0299] 53 Method step

[0300] 54 Method step

[0301] 511 Method step

[0302] 512 Method step

[0303] 513 Method step

[0304] 514 Method step

[0305] Bibliography

[0306] Bessa, J. et al. (2008) ‘meisl regulates cyclin D1 and c-myc expression, and controls the proliferation of the multipotent cells in the early developing zebrafish eye’, Development (Cambridge, England), 135(5), pp. 799-803. Available at: https: / / doi.org / 10.1242 / dev.011932.

[0307] Bhatlekar, S. et al. (2019) ‘Anti-apoptotic BCL2L2 increases megakaryocyte proplatelet formation in cultures of human cord blood’, Haematologica, 104(10), pp. 2075-2083. Available at: https: / / doi.org / 10.3324 / haematol.2018.204685.

[0308] Bluteau, O. et al. (2013) ‘Developmental changes in human megakaryopoiesis’, Journal of Thrombosis and Haemostasis, 11(9), pp. 1730-1741. Available at: https: / / doi.Org / 10.1111 / jth.12326.

[0309] Cai, M. et al. (2012) ‘Dual actions of Meisl inhibit erythroid progenitor development and sustain general hematopoietic cell proliferation’, Blood, 120(2), pp. 335-346. Available at: https: / / d0i.0rg / l 0.1182 / blood-2012-01 -403139.

[0310] Calvo, K.R. et al. (2001) ‘Meisla suppresses differentiation by G-CSF and promotes proliferation by SCF: Potential mechanisms of cooperativity with Hoxa9 in myeloid leukemia’, Proceedings of the National Academy of Sciences, 98(23), pp. 13120-13125. Available at: https: / / doi.org / 10.1073 / pnas.231115398.

[0311] Chen, S.J., Sugimoto, N. and Eto, K. (2023) ‘Ex vivo manufacturing of platelets: beyond the first-in-human clinical trial using autologous iPSC-platelets’, International Journal of Hematology, 117(3), pp. 349-355. Available at: https: / / doi.org / 10.1007 / s12185-022-03512-8.

[0312] Debrincat, M.A. et al. (2012) ‘Mcl-1 and Bcl-xL coordinately regulate megakaryocyte survival’, Blood, 119(24), pp. 5850-5858. Available at: https: / / doi.org / 10.1182 / blood-2011- 12-398834.

[0313] Ferrell, C.M. et al. (2005) ‘Activation of Stem-Cell Specific Genes by HOXA9 and HOXA10 Homeodomain Proteins in CD34+ Human Cord Blood Cells’, Stem Cells, 23(5), pp. 644-655. Available at: https: / / doi.org / 10.1634 / stemcells.2004-0198.

[0314] Figueiredo, C. et al. (2010) ‘Generation of H LA-deficient platelets from hematopoietic progenitor cells: GENERATION OF HLA-DEFICIENT PLTs’, Transfusion, 50(8), pp. 1690- 1701. Available at: https: / / doi.Org / 10.1111 / j.1537-2995.2010.02644.x.

[0315] Fujino, T. et al. (2001) ‘Inhibition of myeloid differentiation by Hoxa9, Hoxb8, and Meis homeobox genes’, Experimental Hematology, 29(7), pp. 856-863. Available at: https: / / doi.Org / 10.1016 / S0301 -472X(01)00655-5.

[0316] Gaur, M. et al. (2006) ‘Megakaryocytes derived from human embryonic stem cells: a genetically tractable system to study megakaryocytopoiesis and integrin function’, Journal of thrombosis and haemostasis: JTH, 4(2), pp. 436-442. Available at: https: / / doi.Org / 10.1111 / j.1538-7836.2006.01744.x.

[0317] Ignatz, M. et al. (2007) ‘Umbilical Cord Blood Produces Small Megakaryocytes After Transplantation’, Biology of Blood and Marrow Transplantation, 13(2), pp. 145-150. Available at: https: / / doi.Org / 10.1016 / j.bbmt.2006.10.032. Jolma, A. et al. (2015) ‘DNA-dependent formation of transcription factor pairs alters their binding specificity’, Nature, 527(7578), pp. 384-388. Available at: https: / / doi.Org / 10.1038 / nature15518.

[0318] Kodama, T. et al. (2012) ‘Mcl-1 and Bcl-xL regulate Bak / Bax-dependent apoptosis of the megakaryocytic lineage at multistages’, Cell Death & Differentiation, 19(11), pp. 1856-1869. Available at: https: / / doi.org / 10.1038 / cdd.2012.88.

[0319] Lis, R. et al. (2017) ‘Conversion of adult endothelium to immunocompetent haematopoietic stem cells’, Nature, 545(7655), pp. 439-445. Available at: https: / / doi.org / 10.1038 / nature22326.

[0320] Luc, N.F. et al. (2022) ‘Bioinspired artificial platelets: past, present and future’, Platelets, 33(1), pp. 35-47. Available at: https: / / doi.org / 10.1080 / 09537104.2021.1967916.

[0321] Mason, K.D. et al. (2007) ‘Programmed Anuclear Cell Death Delimits Platelet Life Span’, Cell, 128(6), pp. 1173-1186. Available at: https: / / doi.Org / 10.1016 / j.cell.2007.01.037.

[0322] Mattia, G. et al. (2002) ‘Different ploidy levels of megakaryocytes generated from peripheral or cord blood CD34+ cells are correlated with different levels of platelet release’, Blood, 99(3), pp. 888-897. Available at: https: / / doi.Org / 10.1182 / blood.v99.3.888.

[0323] Miyazaki, R. et al. (2000) ‘Comparative analyses of megakaryocytes derived from cord blood and bone marrow’, British Journal of Haematology, 108(3), pp. 602-609. Available at: https: / / doi.Org / 10.1046 / j.1365-2141.2000.01854.x.

[0324] Mookerjee, S. et al. (2020) ‘In vitro-derived platelets: the challenges we will have to face to assess quality and safety’, Platelets, 31(6), pp. 724-730. Available at: https: / / doi.Org / 10.1080 / 09537104.2020.1769051.

[0325] Ono, Y. et al. (2012) ‘Induction of functional platelets from mouse and human fibroblasts by p45NF-E2 / Maf’, Blood, 120(18), pp. 3812-3821. Available at: https: / / doi.org / 10.1182 / blood- 2012-02-413617.

[0326] Pick, M. et al. (2013) ‘Generation of Megakaryocytic Progenitors from Human Embryonic Stem Cells in a Feeder- and Serum-Free Medium’, PLoS ONE. Edited by E.T. Zambidis, 8(2), p. e55530. Available at: https: / / doi.org / 10.1371 / journal.pone.0055530.

[0327] Prochazkova, M. et al. (2015) ‘Chapter 18 - Embryonic Versus Adult Stem Cells’, in A. Vishwakarma et al. (eds) Stem Cell Biology and Tissue Engineering in Dental Sciences. Boston: Academic Press, pp. 249-262. Available at: https: / / doi.org / 10.1016 / B978-0-12- 397157-9.00020-5.

[0328] Redecke, V. et al. (2013) ‘Hematopoietic progenitor cell lines with myeloid and lymphoid potential’, Nature Methods, 10(8), pp. 795-803. Available at: https: / / doi.org / 10.1038 / nmeth.2510.

[0329] Sauvageau, G. et al. (1994) ‘Differential Expression of Homeobox Genes in Functionally Distinct CD34+ Subpopulations of Human Bone Marrow Cells’, Proceedings of the National Academy of Sciences of the United States of America, 91(25), pp. 12223-12227.

[0330] So, C.W. et al. (2004) ‘Leukemic transformation of hematopoietic progenitors by MLL-GAS7 in the absence ofHoxa7orHoxa9’, Blood, 103(8), pp. 3192-3199. Available at: https: / / doi.org / 10.1182 / blood-2003-10-3722. Stahlhut, M. et al. (2021) ‘Conditionally immortalised leukaemia initiating cells co-expressing Hoxa9 / Meis1 demonstrate microenvironmental adaptation properties ex vivo while maintaining myelomonocytic memory’, Scientific Reports, 11(1), p. 5294. Available at: https: / / doi.Org / 10.1038 / S41598-021 -84468-3.

[0331] Suzuki, D. et al. (2020) ‘iPSC-Derived Platelets Depleted of HLA Class I Are Inert to Anti- HLA Class I and Natural Killer Cell Immunity’, Stem Cell Reports, 14(1), pp. 49-59. Available at: https: / / doi.Org / 10.1016 / j.stemcr.2O19.11.011.

[0332] Tozawa, K. et al. (2019) ‘Megakaryocytes and platelets from a novel human adipose tissue- derived mesenchymal stem cell line’, Blood, 133(7), pp. 633-643. Available at: https: / / doi.Org / 10.1182 / blood-2018-04-842641.

[0333] Wang, B. and Zheng, J. (2016) ‘Platelet generation in vivo and in vitro’, SpringerPlus, 5(1), p. 787. Available at: https: / / doi.org / 10.1186 / s40064-016-2384-1.

[0334] Wong, P. et al. (2007) ‘Meisl is an essential and rate-limiting regulator of MLL leukemia stem cell potential’, Genes & Development, 21(21), pp. 2762-2774. Available at: https: / / doi.org / 10.1101 / gad.1602107.

[0335] Zhang, H. et al. (2007) ‘Bcl-2 family proteins are essential for platelet survival’, Cell Death & Differentiation, 14(5), pp. 943-951. Available at: https: / / doi.org / 10.1038 / sj.cdd.4402081.

Claims

Claims1. A method of producing human immortalized megakaryocytes and / or human immortalized megakaryocyte progenitors and / or a human megakaryocytic cell line (102) from adult CD34+ hematopoietic stem and progenitor cells (HSPCs) (100) capable of maturing towards functional megakaryocytes (103) that produce functional platelets (104), the method at least comprising:S1 : enforcing expression of at least one gene by introducing an expression cassette comprising at least one gene into the CD34+ HSPCs (100) by transduction, in particular lentiviral (LV) transduction, wherein the transduced CD34+ HSPCs (100) are configured to express at least one gene from the HOXL subclass of the antennapedia homeoprotein (ANTP) homeobox class family and / or the three-amino-acid loop extension (TALE) homeobox class family upon induction of expression by an activator, and constitutively express at least one antiapoptotic gene from the BCL2 family; wherein the transduced CD34+ HSPCs (100) are immortalized through expression of the at least one gene from the HOXL subclass of the ANTP homeobox class family and / or the TALE homeobox class family, preferably wherein the at least one gene from the HOXL subclass includes one among HOXB8, HOXA7, HOXA10, or HOXB4 gene in combination with at least one among MEIS1 , MEIS2, MEIS3, PBX1 , PBX2, PBX3, and / or PBX4 gene, while the at least one antiapoptotic gene from the BCL2 family includes BCL2L1 or BCL2L2.

2. The method according to claim 1 , characterized in that the produced immortalized megakaryocytes and / or immortalized megakaryocyte progenitors and / or human megakaryocytic cell line (102) are / is capable of providing mature functional platelets (104), in particular functional clinical-grade platelets (104), upon differentiation and maturation in absence of the activator.

3. The method according to claim 1 , characterized in that the activator is one of a tetracycline or estrogen-receptor modulator and / or Isopropyl p-D-1 -thiogalactopyranoside (IPTG) and / or lactate, and / or a Cumate.

4. The method according to one of the preceding claims, characterized in that the method further comprises:S2: culturing the transduced CD34+ HSPCs (100), wherein culturing the transduced CD34+ HSPCs (100) comprises expanding the transduced CD34+ HSPCs (100) in presence of the activator and at least one growth factor cocktail, in an expansion medium composition.

5. The method according to claim 4, characterized in that the at least one growth factor cocktail comprises at least one of thrombopoietin (TPO), a TPO receptor agonist, a stem cell factor (SCF), interleukin 3 (IL-3), interleukin 6 (IL-6), interleukin 9 (IL-9), and interleukin 11 (IL- 11).

6. The method according to one of the preceding claims, characterized in that the method further comprises:S3: differentiating and maturing the transduced CD34+ HSPCs and / or the immortalized megakaryocytes and / or the immortalized megakaryocyte progenitors and / or the immortalized cell line (102) into mature functional megakaryocytes (103), in absence of the activator and in presence of the at least one growth factor cocktail.

7. The method according to claim 6, characterized in that differentiation and maturation are carried out in a differentiation and maturation medium composition that is different from the expansion medium composition.

8. The method according to one of the preceding claims, characterized in that the method further comprises:S4: culturing the immortalized megakaryocytes and / or the immortalized megakaryocyte progenitors and / or the immortalized megakaryocytic cell line (102) in absence of the activator.

9. The method according to one of claims 4 to 8, characterized in that the step of culturing the transduced adult CD34+ HSPCs (100) and / or the immortalized megakaryocytesand / or the immortalized megakaryocyte progenitors and / or the immortalized megakaryocytic cell line (102) is conducted in absence of a serum and / or in absence of a feeder cell.

10. The method according to one of the preceding claims, characterized in that the adult CD34+ HSPCs (100) are derived from adult human peripheral blood or bone marrow of human donors, in particular a single human donor.

11. A method of producing a functional platelet (104), comprising:S11 : obtaining immortalized megakaryocytes and / or immortalized megakaryocyte progenitors and / or an immortalized megakaryocytic cell line (102) by implementing the method according to any of claims 1 to 10;S12: culturing the obtained immortalized megakaryocytes and / or immortalized megakaryocyte progenitors and / or immortalized megakaryocytic cell line (102);S13: differentiating and maturing the immortalized megakaryocytes and / or immortalized megakaryocyte progenitors and / or immortalized megakaryocytic cell line (102) into mature functional megakaryocytes (103), andS14: obtaining functional platelets (104) by mechanically manipulating the mature functional megakaryocytes (103), preferably in a bioreactor or microfluidic device.

12. A functional platelet (104) obtained by implementing the method according to claim 11.

13. A pharmaceutical composition comprising functional platelets (104) according to claim 12.

14. Use of the pharmaceutical composition according to claim 13 for the treatment of a disease, in particular target-specific treatment of a disease, preferably wherein said disease is one of thrombocytopenia or bleeding disorder.

15. Use of the pharmaceutical composition according to claim 13 in regenerative medicine.

Images