Strain capable of producing γ-cyclodextrin glycosyltransferase with high yield and use thereof

Abstract

Provided are a strain capable of producing γ-cyclodextrin glycosyltransferase with a high yield and the use thereof. Specifically, the present invention relates to a γ-cyclodextrin production method, comprising the steps: (a) in the presence of a γ-cyclodextrin glycosyltransferase mutant, subjecting the substrate starch to an enzymatic reaction to form γ-cyclodextrin. Also provided is a strain capable of producing γ-cyclodextrin glycosyltransferase with a high yield, the genome of the strain integrating the gene of the γ-cyclodextrin glycosyltransferase mutant. The mutant enzyme and the strain can be used to produce γ-cyclodextrin with a high yield.

Description

A strain with high yield of γ-cyclodextrin glucosyltransferase and its application Technical Field

[0001] The present invention relates to the fields of biotechnology, synthetic biology, bioengineering, genetic engineering and enzyme engineering, and in particular to a strain with high yield of γ-cyclodextrin glucosyltransferase and application thereof. Background Art

[0002] Cyclodextrin glycosyltransferase (CGTase, EC2.4.1.19), a member of the α-amylase family (G13), can convert starch into cyclodextrins. Cyclodextrin is a general term for a series of cyclic oligosaccharides produced by the action of CGTase, typically containing 6 to 12 D-pyranose glucopyranose units. Cyclodextrins have a slightly tapered hollow cylindrical ring structure, combining a hydrophilic surface with a hydrophobic cavity. They are promising encapsulation materials and have been used in medicine, food, daily chemicals, agriculture, environmental protection, and materials. Depending on the number of glucose units in a cyclodextrin, the common cyclodextrins composed of 6, 7, and 8 glucose units are designated α-cyclodextrin, β-cyclodextrin, and γ-cyclodextrin, respectively. Based on their product specificity, cyclodextrin glucosyltransferases are classified as α-CGTases, β-CGTases, and γ-CGTases.

[0003] Compared to α-cyclodextrin and β-cyclodextrin, γ-cyclodextrin has the best solubility and the largest cavity. It can be almost completely broken down by α-amylase in the body and is rapidly degraded, absorbed, and metabolized in the gastrointestinal tract. Therefore, γ-cyclodextrin has the lowest toxicity and currently has no minimum daily intake limit. It has broad application prospects in the fields of food and medicine. The global cyclodextrin industry market has reached 1.5 billion yuan, mainly dominated by β-cyclodextrin. γ-cyclodextrin production accounts for only about 4% of global cyclodextrin production and is extremely expensive.

[0004] At present, the bacterial species commonly used in industrial production of cyclodextrin glucosyltransferase (CGTase) include only a few species such as Bacillus stearothermophilus, Bacillus stearalkaliphilus, and Bacillus softening. The products generated by the CGTase produced by them when converting starch are mainly β-cyclodextrin, so they are generally used in the production of β-cyclodextrin. The γ-CGTase for γ-cyclodextrin either has weak product specificity and poor production performance, or the production bacteria have weak enzyme production ability during fermentation and low yield, which cannot meet the requirements of industrial production, greatly affecting the commercial production and promotion and application of γ-cyclodextrin.

[0005] Researchers at home and abroad have been trying to find gamma-cyclodextrin glucosyltransferase (γ-CGTase) with good product specificity and high catalytic efficiency, and to express it heterologously (i.e., using a heterologous host with strong production performance to construct a genetically engineered strain that can efficiently express γ-CGTase) in order to significantly increase its yield and realize industrial production.

[0006] Currently, the existing technology has the following shortcomings:

[0007] ① Existing sources of CGTases catalyze starch conversion, producing a very low proportion of γ-cyclodextrin in the product, generally less than 30%, indicating insufficient product specificity. γ-CGTases produced by wild-type strains also have very low starch conversion rates, generally reported to be 8-10%, with the highest reported being only around 30%.

[0008] ② The proportion of γ-cyclodextrin produced by γ-CGTase produced by genetically engineered enzyme-producing bacteria in the cyclodextrin mixture can be as high as 50%-80%, but existing literature reports show that its starch conversion rate is still relatively low (about 10%).

[0009] ③ All genetically engineered bacteria reported in existing literature use prokaryotes as hosts, with E. coli being the most common. The main disadvantages of prokaryotic hosts are: the exogenous genes reside in plasmids, resulting in unstable genetic traits and susceptible strain degeneration, making them unsuitable for large-scale industrial applications; they are prone to forming inclusion bodies when expressing exogenous proteins, resulting in low levels of active enzyme protein; their poor protein excretion capacity necessitates cell wall disruption and homogenization during collection, leading to high levels of contaminants in the fermentation broth and low purity of the resulting CGTase, impacting product quality; and they are easily degraded by the host's own proteases, resulting in a short enzyme activity lifespan and hindering production operations. A greater problem is that E. coli, a common host in genetic engineering operations, presents potential safety risks in the food and pharmaceutical sectors.

[0010] Therefore, there is an urgent need to establish a safe, efficient, and high-yield γ-CGTase microbial secretion expression system in this field to promote the development and application of γ-cyclodextrin.

[0011] Summary of the Invention

[0012] The present invention provides a safe, efficient and high-yield microbial secretion expression system for gamma-CGTase and its application.

[0013] In a first aspect of the present invention, a method for producing γ-cyclodextrin is provided, comprising the steps of:

[0014] (a) in the presence of a mutant of γ-cyclodextrin glucosyltransferase, enzymatically hydrolyzing a substrate starch to form γ-cyclodextrin;

[0015] The mutant has the following mutation: S561A, wherein the site is based on the wild-type alkaliphilic Bacillus (Bacillus clarkii 7364) γ-cyclodextrin glucosyltransferase sequence shown in SEQ ID NO: 3.

[0016] In another preferred embodiment, in the presence of the γ-cyclodextrin glucosyltransferase mutant, the conversion rate of starch into cyclodextrin is 50-70 wt %, preferably 60-70 wt %, more preferably 65-70 wt %, based on the total weight of cyclodextrin.

[0017] In another preferred embodiment, the cyclodextrin includes: γ-cyclodextrin and β-cyclodextrin.

[0018] In another preferred embodiment, the content of γ-cyclodextrin in all cyclodextrins is ≥95%, preferably ≥97%, and more preferably ≥98%.

[0019] In a second aspect of the present invention, an isolated or purified γ-cyclodextrin glucosyltransferase mutant is provided, wherein the mutant is: a γ-cyclodextrin glucosyltransferase mutant having S561A;

[0020] The amino acid numbering is based on the amino acid sequence of wild-type Bacillus clarkii 7364 shown in SEQ ID NO: 3.

[0021] In the third aspect of the present invention, an isolated polynucleotide is provided, wherein the polynucleotide encodes the γ-cyclodextrin glucosyltransferase mutant according to the second aspect of the present invention.

[0022] In another preferred embodiment, the polynucleotide sequence is SEQ ID NO: 2.

[0023] In the fourth aspect of the present invention, a vector is provided, wherein the vector contains the polynucleotide described in the third aspect of the present invention.

[0024] In the fifth aspect of the present invention, a genetically engineered host cell is provided. The host cell contains the vector described in the fourth aspect of the present invention, or the polynucleotide described in the third aspect of the present invention is integrated into its genome.

[0025] In another preferred embodiment, the host cell is selected from the following group: prokaryotes, eukaryotes, or a combination thereof.

[0026] In another preferred embodiment, the host cell is a unicellular organism.

[0027] In another preferred embodiment, the host cell is a eukaryotic organism.

[0028] In another preferred embodiment, the host cell is a fungus.

[0029] In another preferred embodiment, the host cell comprises a fungus selected from the group consisting of yeast, mold, or a combination thereof.

[0030] In another preferred embodiment, the host cell is yeast.

[0031] In another preferred embodiment, the host cell is Pichia pastoris.

[0032] In another preferred embodiment, the host cell is genetically engineered Pichia sp., with a deposit number of CGMCC NO.27287.

[0033] In the sixth aspect of the present invention, there is provided a use of the γ-cyclodextrin glucosyltransferase mutant according to the second aspect of the present invention, which is used in an enzymatic hydrolysis reaction.

[0034] In the seventh aspect of the present invention, there is provided a use of the genetically engineered host cell according to the fifth aspect of the present invention for producing γ-cyclodextrin glucosyltransferase.

[0035] In an eighth aspect of the present invention, a reaction system for performing an enzymatic hydrolysis reaction is provided, the reaction system comprising:

[0036] (Z1) an enzyme, wherein the enzyme is: the γ-cyclodextrin glucosyltransferase mutant according to the second aspect of the present invention; and

[0037] (Z2) Starch substrate.

[0038] In another preferred embodiment, the enzyme is an enzyme that is isolated or not isolated from cells.

[0039] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features described in detail below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be listed here one by one. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] FIG1 shows the respectively amplified pPICZαA plasmid backbone fragment and γ-CGTase gene fragment.

[0041] FIG2 shows the results of colony PCR on E. coli JM109 containing the recombinant plasmid pPICZαA-γCGT.

[0042] FIG3 shows the SDS-PAGE electrophoresis of 10 single colonies selected for shake flask induction.

[0043] Figure 4 shows the electrophoresis of the fermentation broth from a 10 L fermenter.

[0044] FIG5 shows the growth curve of enzyme activity produced by fermentation in a 10 L tank.

[0045] FIG6 shows the distribution of various cyclodextrin components in the product of starch conversion produced by the γ-CGTase produced by the recombinant engineered bacteria constructed in the present invention. DETAILED DESCRIPTION

[0046] After extensive and intensive research and extensive screening, the inventors unexpectedly developed a method for high-yield γ-cyclodextrin production. Specifically, the inventors discovered that by mutating the original gene sequence for γ-cyclodextrin glucosyltransferase and then introducing it into Pichia pastoris, a high-yield γ-cyclodextrin glucosyltransferase mutant can be produced. This mutant γ-cyclodextrin glucosyltransferase can then be used in the enzymatic hydrolysis of starch to obtain high-yield γ-cyclodextrin. This led to the completion of the present invention.

[0047] the term

[0048] As used herein, "CGTase," "CGTase," or "cyclodextrin glucosyltransferase" are used interchangeably to refer to cyclodextrin glucosyltransferase.

[0049] As used herein, the terms "Pichia pastoris genetically engineered bacteria", "Pichia pastoris X33", and "Pichia sp." are used interchangeably and all refer to Pichia pastoris genetically engineered bacteria into which the γ-cyclodextrin glucosyltransferase mutant gene of the present invention is integrated.

[0050] As used herein, the terms "Alkalophilic Bacillus clarkii 7364," "wild-type Bacillus clarkii 7364," and "wild-type Alkalophilic Bacillus clarkii 7364" are used interchangeably to refer to wild-type Alkalophilic Bacillus clarkii 7364.

[0051] As used herein, the terms "γ-cyclodextrin glucosyltransferase mutant," "γ-cyclodextrin glucosyltransferase mutant protein," and "mutant γ-cyclodextrin glucosyltransferase" are used interchangeably to refer to a mutant protein having one or more amino acid substitutions, deletions, or insertions compared to the amino acid sequence of the wild-type γ-cyclodextrin glucosyltransferase.

[0052] As used herein, "cyclodextrin" or "CD" refers to cyclodextrins produced by the conversion of starch into a substrate using CGTase as a biocatalyst. There are three common types: α-cyclodextrin (α-CD), β-cyclodextrin (β-CD), and γ-cyclodextrin (γ-CD). These cyclodextrins are composed of 6, 7, and 8 glucose residues linked by glycosidic bonds, respectively, forming a closed ring structure.

[0053] The purpose of the present invention is to use starch as raw material (substrate) and CGTase secreted by the constructed recombinant genetic engineering bacteria as catalyst to convert starch into gamma-cyclodextrin.

[0054] As used herein, "prokaryotes" refer to organisms such as bacteria and actinomycetes that do not have a typical nuclear structure (lack of a nuclear membrane).

[0055] As used herein, "eukaryote" refers to organisms with a typical nuclear structure, such as yeast, mold (filamentous fungi), animal and plant cells, and an intact nuclear membrane.

[0056] As used herein, "host bacteria" refers to a strain that has incorporated a foreign gene into its own genome, enabling autonomous growth and reproduction. The foreign gene replicates synchronously with the host genome and is expressed (synthesizing the protein encoded by the target gene). The resulting recombinant strain is referred to as a "recombinant genetically engineered bacterium."

[0057] Host bacteria are generally genetically engineered and are not completely equivalent to wild-type strains, but some basic physiological characteristics are still retained. This is also the underlying logic for selecting suitable host bacteria for different exogenous genes in order to exhibit different culture characteristics.

[0058] Generally, the technical difficulty of transferring genes from prokaryotes (such as the CGTase encoding gene used in the present invention) into prokaryotic hosts is lower than that into eukaryotic hosts. However, prokaryotic hosts have many disadvantages that are not conducive to subsequent production, which have been described in detail above.

[0059] The host bacteria selected in the present invention is Pichia pastoris, a eukaryotic host with excellent production performance. It was successfully constructed after overcoming great technical obstacles, which is one of the biggest highlights of the present invention.

[0060] As used herein, "recombinant plasmid" refers to a plasmid tool that can recombinate foreign genes into the host nuclear genome.

[0061] As used herein, "starch conversion rate" refers to the ratio of (γ-cyclodextrin production / starch feed), specifically, the conversion rate of γ-cyclodextrin alone to starch. This is contrasted with the ratio of the total amount of a mixture of all three cyclodextrins (α-, β-, and γ-) to the starch feed. Therefore, the starch conversion rate described herein better reflects the product specificity of the CGTase of the present invention than this indicator commonly found in the literature.

[0062] Protein of the present invention

[0063] As used herein, the term "protein of the present invention" refers to γ-cyclodextrin glucosyltransferase or a mutant thereof.

[0064] In the present invention, a particularly preferred class of proteins is

[0065] (i) γ-cyclodextrin glucosyltransferase mutant with S561A.

[0066] As used herein, an "isolated polypeptide" means a polypeptide that is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify such polypeptides using standard protein purification techniques. A substantially pure polypeptide will produce a single major band on a non-reducing polyacrylamide gel. The purity of the polypeptide can also be further analyzed by amino acid sequence analysis.

[0067] The active polypeptides of the present invention may be recombinant polypeptides, natural polypeptides, or synthetic polypeptides. The polypeptides of the present invention may be naturally purified products, chemically synthesized products, or produced using recombinant technology from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, plants). Depending on the host used in the recombinant production protocol, the polypeptides of the present invention may be dehydration-condensed or non-dehydration-condensed. The polypeptides of the present invention may or may not include an initial methionine residue.

[0068] The present invention also includes fragments, derivatives and analogs of the polypeptide. As used herein, the terms "fragment", "derivative" and "analog" refer to polypeptides that substantially retain the same biological function or activity of the polypeptide.

[0069] The polypeptide fragments, derivatives or analogs of the present invention may be (i) polypeptides having one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues) substituted, and such substituted amino acid residues may or may not be encoded by the genetic code, or (ii) polypeptides having a substituent group in one or more amino acid residues, or (iii) polypeptides formed by fusion of a mature polypeptide with another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol), or (iv) polypeptides formed by fusion of an additional amino acid sequence to the polypeptide sequence (such as a leader sequence or secretory sequence or a sequence used to purify the polypeptide or a proprotein sequence, or a fusion protein formed with an antigen IgG fragment). Based on the teachings herein, these fragments, derivatives and analogs are well known to those skilled in the art.

[0070] The polypeptide preferably has the sequence set forth in SEQ ID NO: 3. This term also includes variants and derivatives of SEQ ID NO: 3 that have the same function as the polypeptide. These variants include (but are not limited to): deletion, insertion, and / or substitution of one or more (usually 1-50, preferably 1-30, more preferably 1-20, and most preferably 1-10) amino acids, and addition of one or more (usually within 20, preferably within 10, and more preferably within 5) amino acids to the C-terminus and / or N-terminus.

[0071] For example, in the art, substitution with amino acids of similar or similar properties generally does not alter protein function. For another example, adding one or more amino acids to the C-terminus and / or N-terminus generally does not alter protein function. The term also includes active fragments and active derivatives of the γ-cyclodextrin glucosyltransferase (γ-CGTase) of the present invention. The present invention also provides analogs of the polypeptides described.

[0072] These polypeptides include natural or induced genetic variants. Induced variants can be obtained by various techniques, such as random mutagenesis by radiation or exposure to mutagens, site-directed mutagenesis or other known molecular biology techniques. Analogs also include analogs with residues other than natural L-amino acids (such as D-amino acids), as well as analogs with non-naturally occurring or synthetic amino acids (such as β, γ-amino acids). It should be understood that the polypeptides of the present invention are not limited to the representative polypeptides exemplified above.

[0073] Modifications (generally without altering the primary structure) include in vivo or in vitro chemical derivatization of the polypeptide, such as acetylation or carboxylation. Modifications also include sequences containing phosphorylated amino acid residues (e.g., phosphotyrosine, phosphoserine, and phosphothreonine). Modifications also include polypeptides modified to enhance resistance to proteolysis or optimize solubility.

[0074] The amino or carboxyl termini of the proteins of the present invention may also contain one or more polypeptide fragments as protein tags. Any suitable tag may be used in the present invention. For example, the tag may be FLAG, HA, HA1, c-Myc, Poly-His, Poly-Arg, Strep-TagII, AU1, EE, T7, 4A6, ε, B, gE, and Ty1. These tags can be used to purify the protein.

[0075] To ensure secretory expression of the translated protein (e.g., extracellularly), a signal peptide sequence, such as the pelB signal peptide, may be added to the amino terminus of the γ-cyclodextrin glucosyltransferase (γ-CGTase). The signal peptide may be cleaved during the process of secretion of the polypeptide from the cell.

[0076] The polynucleotides of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA may be single-stranded or double-stranded. DNA may be a coding strand or a non-coding strand.

[0077] For example, the coding region encoding the S561A mutant γ-CGT can be identical to the coding region sequence set forth in SEQ ID NO:3 or a degenerate variant. As used herein, "degenerate variant" refers to a nucleic acid sequence encoding the protein of SEQ ID NO:3 but differing from the coding region sequence set forth in SEQ ID NO:2.

[0078] The polynucleotide encoding the mature polypeptide of SEQ ID NO: 3 includes: a coding sequence encoding only the mature polypeptide; a coding sequence for the mature polypeptide and various additional coding sequences; a coding sequence for the mature polypeptide (and optional additional coding sequences) and non-coding sequences.

[0079] The term "polynucleotide encoding a polypeptide" may include a polynucleotide encoding the polypeptide, or may also include additional coding and / or non-coding sequences.

[0080] The present invention also relates to variants of the aforementioned polynucleotides, which encode polypeptides or fragments, analogs, and derivatives thereof having the same amino acid sequence as the present invention. These polynucleotide variants may be naturally occurring isovariants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As is known in the art, an allelic variant is an alternative form of a polynucleotide, which may contain one or more nucleotide substitutions, deletions, or insertions that do not substantially alter the function of the encoded polypeptide.

[0081] The present invention also relates to polynucleotides that hybridize to the above-mentioned sequences and have at least 50%, preferably at least 70%, and more preferably at least 80% identity between the two sequences. The present invention particularly relates to polynucleotides that hybridize to the polynucleotides of the present invention under stringent conditions (or stringent conditions). In the present invention, "stringent conditions" refer to: (1) hybridization and elution at relatively low ionic strength and relatively high temperature, such as 0.2×SSC, 0.1% SDS, 60°C; or (2) the addition of a denaturing agent during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42°C; or (3) hybridization occurs only when the identity between the two sequences is at least 90%, more preferably at least 95%. Furthermore, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 1.

[0082] The present invention also relates to nucleic acid fragments that hybridize to the aforementioned sequences. As used herein, a "nucleic acid fragment" is at least 15 nucleotides in length, preferably at least 30 nucleotides, more preferably at least 50 nucleotides, and most preferably at least 100 nucleotides in length. Nucleic acid fragments can be used in nucleic acid amplification techniques (e.g., PCR) to identify and / or isolate polynucleotides encoding γ-cyclodextrin glucosyltransferase (γ-CGTase) proteins.

[0083] The polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, preferably purified to homogeneity. The full-length nucleotide sequence of the γ-cyclodextrin glucosyltransferase (γ-CGTase) of the present invention or its fragments can usually be obtained by PCR amplification, recombinant methods or artificial synthesis methods. For PCR amplification, primers can be designed based on the relevant nucleotide sequences disclosed in the present invention, especially the open reading frame sequences, and commercially available cDNA libraries or cDNA libraries prepared by conventional methods known to those skilled in the art are used as templates to amplify the relevant sequences. When the sequence is long, it is often necessary to perform two or more PCR amplifications, and then splice the fragments amplified in the correct order.

[0084] Once the relevant sequence is obtained, it can be obtained in large quantities by recombinant methods. This is usually done by cloning it into a vector, then transferring it into cells, and then isolating the relevant sequence from the propagated host cells by conventional methods.

[0085] In addition, the sequences can also be synthesized by artificial synthesis, especially when the fragment length is shorter. Usually, a long fragment can be obtained by synthesizing multiple small fragments and then connecting them.

[0086] At present, the DNA sequence encoding the protein of the present invention (or its fragment, or its derivative) can be obtained completely by chemical synthesis. The DNA sequence can then be introduced into various existing DNA molecules (or vectors) and cells known in the art. In addition, mutations can also be introduced into the protein sequence of the present invention by chemical synthesis. The method of amplifying DNA / RNA using PCR technology is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain full-length cDNA from a library, the RACE method (RACE-cDNA end rapid amplification method) can be preferably used. The primers used for PCR can be appropriately selected based on the sequence information of the present invention disclosed herein and can be synthesized by conventional methods. The amplified DNA / RNA fragments can be separated and purified by conventional methods, such as by gel electrophoresis.

[0087] The present invention also relates to a vector comprising the polynucleotide of the present invention, a host cell produced by genetic engineering using the vector of the present invention or the γ-cyclodextrin glucosyltransferase (γ-CGTase) protein coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology.

[0088] The polynucleotide sequence of the present invention can be used to express or produce recombinant γ-cyclodextrin glucosyltransferase (γ-CGTase) polypeptides using conventional recombinant DNA techniques. Generally, the following steps are involved:

[0089] A polynucleotide (or variant) encoding a γ-cyclodextrin glucosyltransferase (γ-CGTase) polypeptide of the present invention is used to transform or transduce a suitable host cell, or a recombinant expression vector containing the polynucleotide is used to culture the host cell in a suitable culture medium; and the protein is separated and purified from the culture medium or cells.

[0090] In the present invention, the γ-cyclodextrin glucosyltransferase (γ-CGTase) polynucleotide sequence can be inserted into a recombinant expression vector. The term "recombinant expression vector" refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. As long as they can replicate and be stable in the host, any plasmid or vector can be used. An important feature of an expression vector is that it usually contains an origin of replication, a promoter, a marker gene, and translation control elements.

[0091] Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding γ-cyclodextrin glucosyltransferase (γ-CGTase) and appropriate transcriptional / translational control signals. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombination techniques, and the like. The DNA sequence can be operably linked to an appropriate promoter within the expression vector to direct mRNA synthesis. Representative examples of such promoters include the lac or trp promoters of Escherichia coli; the λ phage PL promoter; eukaryotic promoters including the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoter, retroviral LTRs, and other known promoters that control gene expression in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.

[0092] In addition, the expression vector preferably contains one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green fluorescent protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for Escherichia coli.

[0093] A vector containing the above-mentioned appropriate DNA sequence and an appropriate promoter or control sequence can be used to transform an appropriate host cell to enable it to express the protein.

[0094] Host cells can be prokaryotic cells, such as bacterial cells; lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples include Escherichia coli, Streptomyces; bacterial cells of Salmonella typhimurium; fungal cells, such as yeast; plant cells; insect cells such as Drosophila S2 or Sf9; and animal cells such as CHO, COS, 293 cells, or Bowes melanoma cells.

[0095] In another preferred embodiment, suitable host cells include Gram-positive bacteria such as Bacillus subtilis, Gram-negative bacteria such as Escherichia coli, actinomycetes such as Streptomyces, yeasts such as Saccharomyces cerevisiae, and fungi such as Aspergillus, all of which are commonly used host cells for recombinant vectors.

[0096] When the polynucleotides of the present invention are expressed in higher eukaryotic cells, transcription will be enhanced if an enhancer sequence is inserted into the vector. Enhancers are cis-acting DNA factors, typically about 10 to 300 base pairs in length, that act on promoters to increase gene transcription. Examples include the SV40 enhancer (100 to 270 base pairs on the late replication origin side), the polyoma enhancer on the late replication origin side, and adenovirus enhancers.

[0097] Those skilled in the art will appreciate how to select appropriate vectors, promoters, enhancers and host cells.

[0098] Transformation of host cells with recombinant DNA can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryotic organism such as Escherichia coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with CaCl2, using procedures well known in the art. Another method is to use MgCl2. If desired, transformation can also be performed using electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate coprecipitation, conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.

[0099] The obtained transformants can be cultured using conventional methods to express the polypeptide encoded by the gene of the present invention. Depending on the host cell used, the culture medium used can be selected from various conventional culture media. Culture is carried out under conditions suitable for the growth of the host cells. After the host cells grow to an appropriate cell density, the selected promoter is induced using a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

[0100] The recombinant polypeptide in the above method can be expressed intracellularly, on the cell membrane, or secreted extracellularly. If necessary, the recombinant protein can be isolated and purified by various separation methods utilizing its physical, chemical, and other properties. These methods are well known to those skilled in the art. Examples of these methods include, but are not limited to, conventional renaturation treatment, treatment with a protein precipitant (salting out method), centrifugation, osmotic sterilization, ultrafiltration, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations of these methods.

[0101] application

[0102] The present invention also provides applications of the gamma-cyclodextrin glucosyltransferase (gamma-CGTase) and its mutants, especially applications in the reaction of enzymatically hydrolyzing starch to generate gamma-cyclodextrin.

[0103] Since certain mutant γ-cyclodextrin glucosyltransferases (γ-CGTases) of the present invention have a very high conversion rate for starch to γ-cyclodextrin (such as S561A), they can be used for in vitro enzymatic synthesis of γ-cyclodextrin.

[0104] Typically, the present invention provides a method for producing γ-cyclodextrin in vitro using the γ-cyclodextrin glucosyltransferase (γ-CGTase) of the present invention. In the method of the present invention, starch raw material is enzymatically hydrolyzed by the γ-cyclodextrin glucosyltransferase (γ-CGTase) to directly produce the corresponding product γ-cyclodextrin.

[0105] Culture medium formulation

[0106] The formulas of the culture media used in the present invention are as follows:

[0107] Luria-Bertani (LB) medium: Tryptone 10.0 g·L-1, Yeast extract 5.0 g·L-1, sodium chloride 10.0 g·L-1, pH 7.0, additionally add 2% agar powder to make LB solid medium, sterilize at 121°C for 20 min, and add ampicillin and kanamycin to a final concentration of 100 mg·L-1 and 50 mg·L-1 respectively when used.

[0108] Yeast peptone dextrose (YPD) medium: 20.0 g·L-1 anhydrous glucose, 20.0 g·L-1 tryptone, 10.0 g·L-1 yeast extract, and 2% agar powder are added to make YPD solid medium. Sterilize at 115°C for 20 min.

[0109] BSM inorganic salt medium: 85% H3PO4 26.7 ml·L-1, CaSO4·2H2O 0.93 g·L-1, K2SO4 18.2 g·L-1, MgSO4·2H2O 14.9 g·L-1, KOH 4.13 g·L-1, glycerol 40 g·L-1, PTM1 trace element solution 4.0 ml·L-1.

[0110] PTM1 trace element solution: CuSO4·5H2O 6.0g·L-1, KI 0.088g·L-1, MnSO4·H2O 3.0g·L-1, Na2MoO4·2H2O 0.2g·L-1, H3BO3 0.02g·L-1, CoCl2·6H2O 0.5g·L-1, ZnCl2 20.0g·L-1, FeSO4·7H2O 65.0g·L-1, Biotin 0.2g·L-1, concentrated H2SO4 5.0ml·L-1.

[0111] Growth medium: 50% glycerol containing 12 mL·L-1 PTM1 trace element solution.

[0112] Methanol induction medium: 100% methanol containing 12 mL·L-1 PTM1 trace element solution.

[0113] The main advantages of the present invention include:

[0114] 1. The present invention is based on a γ-CGTase gene derived from the wild-type strain of Bacillus clarkii 7364. This gene has been artificially modified by introducing point mutations into the original amino acid sequence of the enzyme protein. The resulting mutant γ-CGTase has a starch conversion rate of over 60% to γ-cyclodextrin. More importantly, γ-cyclodextrin accounts for over 95% of the cyclodextrin mixture produced by starch conversion. Currently, no γ-CGTase has been reported that can simultaneously achieve these two performance indicators.

[0115] 2. The present invention uses Pichia pastoris as a host to construct a recombinant engineered bacterium carrying a target gene. The exogenous target gene is recombined into the host genome, the genetic traits are stable, and the strain is not easy to degenerate.

[0116] 3. The γ-CGTase synthesized by the recombinant engineered bacteria constructed in the present invention can be autonomously secreted outside the cell, without the need for cell homogenization and cell wall disruption. The bacteria can be separated by simple means such as centrifugation, and the obtained fermentation supernatant is a crude enzyme solution rich in γ-CGTase, which greatly simplifies the operation and saves energy, making it very suitable for large-scale industrial applications.

[0117] 4. The host bacteria used in the present invention is Pichia pastoris, which has good biosafety and no special restrictions on industrial application.

[0118] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples, for which specific conditions are not specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are by weight.

[0119] Example 1. Cloning of CGTase Gene and Construction of Recombinant Vector

[0120] The present inventors artificially synthesized the γ-CGTase gene from Alkalophilic Bacillus clarkii 7364. The amino acid sequence thereof is SEQ ID NO: 1, and the nucleotide sequence thereof is SEQ ID NO: 2, as shown below.

[0121] The amino acid sequence of wild-type Bacillus clarkii 7364 γ-CGTase is shown below:

[0122] After artificially synthesizing the CGTase gene, it was connected to the pUC57 vector for ready use. When amplifying the CGTase gene, the primers were designed as follows:

[0123] Primer F1: GGTGAAGTTCATGCTTCTAACG (SEQ ID NO: 4)

[0124] Primer R1: TCTTCTAAAAGAAACTCTAACAGTATCA (SEQ ID NO: 5)

[0125] The PCR reaction conditions were: denaturation at 93°C for 3 minutes, followed by 30 cycles of denaturation at 93°C for 30 seconds, annealing at 56°C for 15 seconds, and extension at 72°C for 70 seconds, followed by incubation at 72°C for 10 minutes. The agarose gel electrophoresis results are shown in Figure 1. The CGTase gene is 2037 bp in size.

[0126] When amplifying the backbone fragment, the following primers were designed using plasmid pPICZaA as a template:

[0127] Primer F2: GTTTCTTTTAGAAGAtaaGCGGCCGCGAATTAATTCG (SEQ ID NO: 6)

[0128] Primer R2: AGCATGAACTTCACCGAATTCTACGTAAGCTTCAGCC (SEQ ID NO:7)

[0129] The PCR reaction conditions were: denaturation at 93°C for 3 minutes, followed by 30 cycles of denaturation at 93°C for 30 seconds, annealing at 56°C for 15 seconds, and extension at 72°C for 170 seconds, followed by incubation at 72°C for 10 minutes. Agarose gel electrophoresis results, as shown in Figure 1, indicate that the backbone DNA fragment of the recombinant plasmid is approximately 5300 bp in size.

[0130] Refer to the above two fragments The recombinant expression plasmid pPICZaA-CGTase was constructed by seamless cloning according to the instructions of the II One Step Cloning Kit (Vazyme Biotech Co., Ltd). The recombinant plasmid was transformed into competent Escherichia coli JM109 and plated on LB + Zeocin (zeocin concentration: 30 μg / ml). After overnight incubation at 37°C, single colonies grew. Colony PCR verification of the correct transformant is shown in Figure 2. One of the positive colonies was selected and inoculated into LB (supplemented with 30 μg / mL zeocin). After overnight incubation at 37°C, the cells were harvested, the plasmid was extracted, and sent to a third party for sequencing. After correct sequencing, the recombinant vector containing the CGTase, pPICZaA-γCGTase, was obtained.

[0131] Example 2 Recombinant expression of cyclodextrin glycosyltransferase

[0132] The expression plasmid pPICZaA-γCGTase was linearized with SacI and transformed into Pichia pastoris X33 by electroporation. The transformants were plated on 100 μg / mL zeocin-resistant plates. Single colonies that emerged after 2 days of culture were identified as Pichia pastoris ZG-C6 / pPICZaA-γCGTase. Ten single colonies were selected and inoculated into YPD shake flasks. When the OD of the bacteria reached approximately 13, methanol was added at a volume ratio of 1% every 12 hours. Fermentation was stopped after 72 hours of induction. The supernatant was obtained by centrifugation, and the enzyme activity of the supernatant was measured. The target band was also detected by SDS-PAGE electrophoresis.

[0133] Enzyme activity determination method:

[0134] In this experiment, the γ-CGTase activity was determined using the bromocresol green method. The specific steps are as follows:

[0135] Prepare 1% (w / v) soluble starch in 50 mM Gly-NaOH at pH 10.0 as a substrate, take 900 μL and place it in a 5 mL centrifuge tube and preheat it in a 40°C constant temperature water bath for 15-20 minutes. Then, add 100 μL of appropriately diluted crude enzyme solution. After reacting for 10 minutes, add 100 μL of 0.5 M hydrochloric acid to terminate the reaction. Finally, add 2 mL of 200 mM citric acid buffer (pH 4.2) and 80 μL of 5 mM bromocresol green (BCG). After standing at room temperature for 15-20 minutes, measure the absorbance at a wavelength of 630 nm. The blank is the inactivated enzyme solution.

[0136] One unit of enzyme activity (U) was defined as the amount of enzyme required to generate 1 μmol of γ-CD within 1 min under the above reaction conditions.

[0137] The enzyme activities measured according to the above method are shown in Table 1.

[0138] Table 1. Enzyme activity after shake flask induction

[0139] The fermentation broths were subjected to SDS-PAGE electrophoresis, and the results are shown in Figure 3. A band at 70 kDa was detected in all fermentation broths, indicating that the selected strains were expressing the target protein. Furthermore, the S7 band was the darkest, corresponding to the highest enzyme activity detected in the fermentation broth of strain S7.

[0140] Therefore, S7 was selected for further tank fermentation verification in subsequent experiments of the present invention.

[0141] Example 3. 10L fermenter induced expression fermentation

[0142] In order to further improve the expression level of the enzyme, an induced expression experiment was carried out at the fermentation tank level. The specific operation is as follows:

[0143] The fermenter was inoculated with 10% seed solution into 4 L of BSM medium at 30°C, 1.5 vvm aeration, and pH 5.0. The dissolved oxygen concentration (DO) gradually decreased during fermentation, and the agitation speed was set at approximately 650 rpm.

[0144] When the glycerol in the initial culture medium is exhausted, the methanol induction stage begins and the culture is removed from the tank after 96 hours of induction culture.

[0145] After the tank was removed, the fermentation supernatant was obtained and subjected to SDS-PAGE electrophoresis, as shown in Figures 4 and 5 (Note: Figure 4 shows the induction time, and the horizontal axis of Figure 5 is the fermentation cycle). The target band of the fermentation liquid was the most concentrated at 96 hours of induction, and the enzyme activity was measured to reach 34.6 U / mL.

[0146] According to the literature search, the expression level of the enzyme achieved in this experiment is the highest expression level of γ-CGTase reported in the literature, laying the foundation for the subsequent efficient utilization of γ-CGTase.

[0147] Example 4. Application of recombinant γ-CGTase in the preparation of γ-cyclodextrin (γ-CD)

[0148] This example studies the starch conversion reaction under the following conditions:

[0149] Using 15% starch as the substrate, 7.5 U / g enzyme was added at 70°C for 30 minutes, the temperature was reduced to 55°C, the pH was adjusted to 10.0, and 7.5 U / g of γ-CGTase was added. At the same time, 3% (w / v) cyclododecanone was added to the reaction system. The reaction was carried out in a constant temperature water bath at 150 rpm for 6 hours. The total CD conversion rate was about 65% (w / w), of which γ-CD accounted for ≥95%, β-CD accounted for no more than 5%, and α-CD accounted for very low or undetectable proportions.

[0150] The distribution of various cyclodextrin components in the starch conversion products produced by the γ-CGTase produced by the recombinant engineered bacteria constructed in the present invention is shown in Figure 6. Among all the cyclodextrins converted from starch, γ-CD accounts for the highest proportion, reaching 98.12%, while β-CD accounts for only 1.82%, and α-CD is not detected.

[0151] This experiment shows that the recombinant γ-CGTase expressed in this patent has extremely high product specificity, laying a good foundation for the subsequent large-scale preparation of γ-cyclodextrin.

[0152] discuss

[0153] The present inventors carried out point mutation on the original amino acid sequence of CGTase derived from Bacillus clarkii 7364 strain.

[0154] The mutated CGTase exhibits improved product specificity (when starch is converted to a cyclodextrin mixture using the enzyme, γ-cyclodextrin accounts for at least 95% of all the cyclodextrins produced, and can even stabilize at over 97%; α-cyclodextrin is almost completely absent, with the remainder being β-cyclodextrin). Furthermore, the enzyme's starch conversion rate during the aforementioned conversion process is significantly higher than generally reported levels.

[0155] In addition, the tool for introducing exogenous genes used in the present invention is a recombinant plasmid. The exogenous genes it carries will be integrated into the host's nuclear genome by genetic recombination, becoming part of the host's own genome. It replicates as the host cell replicates itself. Its stability is several orders of magnitude higher than that of common free plasmid engineered bacteria, and no antibiotics need to be added during daily use.

[0156] The inventors selected Pichia pastoris as the host bacteria. After synthesis, the enzyme will be secreted outside the cell, directly eliminating the need for cell wall disruption and homogenization. More interestingly, the selected host itself has an extremely low protein excretion capacity. Therefore, in addition to the above-mentioned γ-CGTase, almost no other impurities are detected in its fermentation supernatant. Therefore, a relatively pure crude γ-CGTase enzyme solution can be obtained by simply separating the bacteria from the fermentation broth by simple centrifugation or filtration. It can be directly used for subsequent starch conversion without further purification.

[0157] All documents mentioned in this application are incorporated herein by reference, just as if each document were incorporated herein by reference individually. It should also be understood that after reading the above teachings of the present invention, those skilled in the art may make various changes or modifications to the present invention, and that such equivalents also fall within the scope of the claims appended hereto.

Claims

1. A method for producing γ-cyclodextrin, characterized in that: Includes steps: (a) in the presence of a mutant of γ-cyclodextrin glucosyltransferase, subjecting substrate starch to an enzymatic hydrolysis reaction, thereby forming γ-cyclodextrin; The mutant has the following mutation: S561A, wherein the site is based on the wild-type alkaliphilic Bacillus clarkii 7364 γ-cyclodextrin glucosyltransferase sequence shown in SEQ ID NO:

3.

2. An isolated or purified γ-cyclodextrin glucosyltransferase mutant, characterized in that: The mutants are: a γ-cyclodextrin glucosyltransferase mutant having S561A; Wherein, the amino acid numbering is based on the amino acid sequence of wild-type Bacillus clarkii 7364 shown in SEQ ID NO:

3.

3. An isolated polynucleotide, characterized in that The polynucleotide encodes the γ-cyclodextrin glucosyltransferase mutant according to claim 2.

4. A carrier, characterized in that The vector contains the polynucleotide according to claim 3.

5. A genetically engineered host cell, characterized in that The host cell contains the vector according to claim 4, or the polynucleotide according to claim 3 is integrated into its genome.

6. The host cell according to claim 5, characterized in that The host cell is Pichia pastoris.

7. The host cell according to claim 6, characterized in that The host cell is a genetically engineered Pichia sp., with a preservation number of CGMCC NO.27287.

8. Use of the γ-cyclodextrin glucosyltransferase mutant according to claim 2, characterized in that: It is used in enzymatic reactions.

9. Use of the genetically engineered host cell according to claim 5, characterized in that: Used to produce γ-cyclodextrin glucosyltransferase.

10. A reaction system for enzymatic hydrolysis, characterized in that: The reaction system comprises: (Z1) an enzyme, wherein the enzyme is: the γ-cyclodextrin glucosyltransferase mutant according to claim 2; and (Z2) Starch substrate.

Images