Methods of making targeting oligonucleotides and uses thereof

Abstract

Disclosed are methods for adding a sequence to an oligonucleotide to create a custom targeting oligonucleotide. The custom targeting oligonucleotides can be used in methods to enhance single cell sequencing platforms to allow highly targeted capture of nucleotide sequences.

Description

[0001] Attorney Docket No.: 36406.0036P1 METHODS OF MAKING TARGETING OLIGONUCLEOTIDES AND USES THEREOF BACKGROUND CROSS REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No.63 / 519,972, filed on August 16, 2023, and U.S. Provisional Application No.63 / 612,808, filed on December 20, 2023. The content of these earlier filed applications is hereby incorporated by reference herein in its entirety. STATEMENT REGARDING FEDERALLY FUNDED RESEARCH This invention was made with government support under award no. AG066507, awarded by the National Institutes of Health. The government has certain rights in the invention. REFERENCE TO A SEQUENCE LISTING The present application contains a Sequence Listing that is submitted concurrent with the filing of this application in XML format, containing the file name “36406_0036P1_SL.xml,” created on August 15, 2024, and having a size of 24,576 bytes. The Sequence Listing is hereby incorporated by reference pursuant into the present application in its entirety. BACKGROUND Single-cell RNA-sequencing (scRNA seq) is an emerging technology for investigating cellular transcriptomes used across basic science fields. The beads commonly used for droplet- based scRNA-seq are fixed with polyA or a few specific options for capture sequences and are not easily modified for custom approaches. Thus, a need exists for cheap and efficient options to modify droplet-based sequencing methods and add custom probes against targets of interest that are not simply the polyA or 3’ end of an mRNA sequence. SUMMARY Disclosed herein are methods that leverage short cycles of DNA oligomer hybridization and polymerase-based extension to modify droplet-based beads to target custom sequences. Disclosed herein are methods of adding a sequence to an oligonucleotide, the methods comprising: a) contacting a first oligonucleotide with a second oligonucleotide, wherein the second oligonucleotide comprises from 5’ to 3’: i) a capture sequence; ii) a first spacer sequence; iii) a sequence that is complementary to the 3’ end of the first oligonucleotide; iv) a Attorney Docket No.: 36406.0036P1 second spacer sequence; and v) a 3’ sequence, wherein the 3’ sequence is not complementary to the first oligonucleotide, under conditions suitable for hybridization of the sequence of the second oligonucleotide that is complementary to the 3’ end of the first oligonucleotide to the 3’ end of the first oligonucleotide to form a partially double stranded complex; b) contacting the partially double stranded complex with a polymerase under conditions suitable for elongation of the first oligonucleotide, thereby generating a partially double stranded extension product, wherein the first oligonucleotide of the partially double stranded extension product comprises a sequence complementary to the first spacer sequence and capture sequence of the second oligonucleotide; c) contacting the partially double stranded extension product with a primer complementary to the 3’ sequence of the second oligonucleotide under conditions suitable for hybridization of the primer to the 3’ sequence of the second oligonucleotide; and d) extending the primer hybridized to the 3’ sequence of the second oligonucleotide, whereby the second oligonucleotide is displaced from the first oligonucleotide of the partially double stranded extension product, thereby generating a single stranded, extended first oligonucleotide, wherein the single stranded, extended first oligonucleotide comprises sequence complementary to the capture sequence and first spacer sequence of the second oligonucleotide. Disclosed herein are methods of adding a sequence to an oligonucleotide, the methods comprising: a) contacting a first oligonucleotide with a second oligonucleotide, wherein the second oligonucleotide comprises from 5’ to 3’: i) a first spacer sequence; ii) a sequence that is complementary to the 3’ end of the first oligonucleotide; iii) a second spacer sequence; and iv) a 3’ sequence, wherein the 3’ sequence is not complementary to the first oligonucleotide, under conditions suitable for hybridization of the sequence of the second oligonucleotide that is complementary to the 3’ end of the first oligonucleotide to the 3’ end of the first oligonucleotide to form a partially double stranded complex, wherein the partially double stranded complex comprises overhangs; b) contacting the first spacer sequence of the partially double stranded complex with an adapter complex comprising a capture sequence complementary to the first spacer sequence in the presence of a ligase under conditions suitable for ligating the first spacer sequence of the partially double stranded complex with an adapter complex, thereby generating a partially double stranded ligation product,; c) contacting the partially double stranded ligation product with a primer complementary to the 3’ sequence of the second oligonucleotide under conditions suitable for hybridization of the primer to the 3’ sequence of the second oligonucleotide; and d) extending the primer hybridized to the 3’ sequence of the second oligonucleotide, whereby the second oligonucleotide is displaced from Attorney Docket No.: 36406.0036P1 the first oligonucleotide of the partially double stranded extension product, thereby generating a single stranded, extended first oligonucleotide, wherein the single stranded, extended first oligonucleotide comprises sequence complementary to the capture sequence and first spacer sequence of the second oligonucleotide. BRIEF DESCRIPTION OF THE DRAWINGS FIGS.1A-B show diagrams of target capture. FIG.1A shows the 10x v3 bead structure. The sequences shown in FIG.1A are: CTACACGACGCTCTTCCGATCT (SEQ ID NO: 1); TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT (SEQ ID NO: 2); GTCAGATGTGTATAAGAGACAG (SEQ ID NO: 3); TTGCTAGGACCGGCCTTAAAGC (SEQ ID NO: 4); and CCTTAGCCGCTAATAGGTGAGC (SEQ ID NO: 5). FIG.1B shows the steps of replacing polyT oligos on a bead with custom sequences. In particular, FIG.1B shows exemplary targeting custom oligonucleotides (TaCO) methodology for changing the final capture sequence of oligonucleotides on beads used for droplet-based single cell sequencing. For example, FIG.1B shows an example of using targeting custom oligonucleotides (TaCO) methodology for replacing polyT oligonucleotides on beads with custom sequences using polymerase extension The sequences shown in FIG.1B are: CTACACGACGCTCTTCCGATCT (SEQ ID NO: 1); TTTTTTTTTTTTTTTTTTTTTTTTTTTT (SEQ ID NO: 6); NNNNNNNNNNNNNNNN (SEQ ID NO: 7); NNNNNNNNNNNN (SEQ ID NO: 8); GACTCCAAGGCCGATTCGGA (SEQ ID NO: 9); ATAT (SEQ ID NO; 10); AAAAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO; 11); CTCT (SEQ ID NO: 12); GGAGAGCAACTGCATAAGG (SEQ ID NO: 13); TCCGAATCGGCCT (SEQ ID NO: 14); CTACACGACGCTCTTCCGATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTT TTTTTTTTTTTTTTTTTTTTTTTATATTCCGAATCGGCCT (SEQ ID NO: 15); GACTCCAAGGCCGATTCGGAATATAAAAAAAAAAAAAAAAAAAAAAAAAAAACT CTGGAGAGCAACTGCATAAGG (SEQ ID NO; 16); CTACACGACGCTCTTCCGATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTT TTTTTTTTTTTTTTTTTTTTTTTATATTCCGAATCGGCCTTGGAGTC (SEQ ID NO: 17); CCTTATGCAGTTGCTCTCC (SEQ ID NO: 18); CCTTATGCAGTTGCTCTCCTCTCTTTTTTTTTTTTTTTT (SEQ ID NO: 19); CCTTATGCAGTTGCTCTCCTCTCTTTTTTTTTTTTTTTTTTTTTTTTTTTTATATTCCG AATCGGCCTTGGAGTC (SEQ ID NO: 20); and Attorney Docket No.: 36406.0036P1 GACTCCAAGGCCGATTCGGAATATAAAAAAAAAAAAAAAAAAAAAAAAAAAACT CTGGAGAGCAACTGCATAAGG (SEQ ID NO: 21). FIGS.2A-C demonstrate that the TaCO methodology can be used to capture of cryptic exons from human brain tissue with TDP-43 pathology. TaCO beads successfully captured TDP-43 cryptic exon junctions for three genes, UNC13A (FIG.2A), ATG4B (FIG.2B), and PFKP (FIG.2C).10x reads that contain split-reads across a cryptic exon are highlighted in red. Each 10x read represents a unique mRNA sequence (UMI) that can be mapped onto gene expression UMAP projections derived from the poly(dT) capture probes. These reads are aligned to a UCSC genome browser view that shows bulk RNA sequencing data from control and TDP-43 knockdown (red) human iPSC neurons and human brain cortex from GTEx. TDP- 43 cryptic exons identified in bulk RNA-Seq data are indicated by arrows. These cryptic exons are not detectable using standard 10x single cell sequencing, as the cryptic splicing events are located internally on the mRNA. Standard 10x single cell sequencing primarily captures reads ~250bp proximal to the 3’ end of the mRNA, i.e., the polyA tail. FIG.3 shows an example of using targeting custom oligonucleotides (TaCO) methodology for replacing polyT oligonucleotides on beads with custom sequences using ligation. The sequences shown are: CTACACGACGCTCTTCCGATCT (SEQ ID NO: 1); TTTTTTTTTTTTTTTTTTTTTTTTTTTT (SEQ ID NO: 6); NNNNNNNNNNNNNNNN (SEQ ID NO: 7); NNNNNNNNNNNN (SEQ ID NO: 8); ATAT (SEQ ID NO: 10); AAAAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO: 11); CTCT (SEQ ID NO: 12); GGAGAGCAACTGCATAAGG (SEQ ID NO: 13); TCCGAATCGGCCT (SEQ ID NO: 14); CTACACGACGCTCTTCCGATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTT TTTTTTTTTTTTTTTTTTTTTTT (SEQ ID NO: 22) ATATTCCGAATCGGCCTTGGAGTC (SEQ ID NO: 23); GACTCCAAGGCCGATTCGGA (SEQ ID NO: 24); ATATAAAAAAAAAAAAAAAAAAAAAAAAAAAACTCTGGAGAGCAACTGCATAAG G (SEQ ID NO: 25); CTACACGACGCTCTTCCGATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTT TTTTTTTTTTTTTTTTTTTTTTTATATTCCGAATCGGCCTTGGAGTC (SEQ ID NO: 17); GACTCCAAGGCCGATTCGGAATATAAAAAAAAAAAAAAAAAAAAAAAAAAAACT CTGGAGAGCAACTGCATAAGG (SEQ ID NO: 16); CCTTATGCAGTTGCTCTCC (SEQ ID NO: 18); CCTTATGCAGTTGCTCTCCTCTCTTTTTTTTTTTTTTTT (SEQ ID NO: 19); Attorney Docket No.: 36406.0036P1 CCTTATGCAGTTGCTCTCCTCTCTTTTTTTTTTTTTTTTTTTTTTTTTTTTATATTCCG AATCGGCCTTGGAGTC (SEQ ID NO; 20); and GACTCCAAGGCCGATTCGGAATATAAAAAAAAAAAAAAAAAAAAAAAAAAAACT CTGGAGAGCAACTGCATAAGG (SEQ ID NO: 21). DETAILED DESCRIPTION OF THE INVENTION The present disclosure can be understood more readily by reference to the following detailed description of the invention, the figures and the examples included herein. Before the present methods and compositions are disclosed and described, it is to be understood that they are not limited to specific synthetic methods unless otherwise specified, or to particular reagents unless otherwise specified, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular aspects only and is not intended to be limiting. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, example methods and materials are now described. Moreover, it is to be understood that unless otherwise expressly stated, it is in no way intended that any method set forth herein be construed as requiring that its steps be performed in a specific order. Accordingly, where a method claim does not actually recite an order to be followed by its steps or it is not otherwise specifically stated in the claims or descriptions that the steps are to be limited to a specific order, it is in no way intended that an order be inferred, in any respect. This holds for any possible non-express basis for interpretation, including matters of logic with respect to arrangement of steps or operational flow, plain meaning derived from grammatical organization or punctuation, and the number or type of aspects described in the specification. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided herein can be different from the actual publication dates, which can require independent confirmation. Attorney Docket No.: 36406.0036P1 DEFINITIONS As used in the specification and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise. The word “or” as used herein means any one member of a particular list and also includes any combination of members of that list. Ranges can be expressed herein as from “about” or “approximately” one particular value, and / or to “about” or “approximately” another particular value. When such a range is expressed, a further aspect includes from the one particular value and / or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” or “approximately,” it will be understood that the particular value forms a further aspect. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint and independently of the other endpoint. It is also understood that there are a number of values disclosed herein and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. It is also understood that each unit between two particular units is also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed. As used herein, the terms “optional” or “optionally” mean that the subsequently described event or circumstance may or may not occur and that the description includes instances where said event or circumstance occurs and instances where it does not. As used herein, the term “sample” is meant a tissue or organ from a subject; a cell (either within a subject, taken directly from a subject, or a cell maintained in culture or from a cultured cell line); a cell lysate (or lysate fraction) or cell extract; or a solution containing one or more molecules derived from a cell or cellular material (e.g. a polypeptide or nucleic acid), which is assayed as described herein. A sample may also be any body fluid or excretion (for example, but not limited to, blood, urine, stool, saliva, tears, bile) that contains cells or cell components. The term sample can also refer to a “cancer sample” or “sample of the cancer” or the like. The sample can be obtained via biopsy such as needle biopsy, surgical biopsy, etc. A cancer sample includes, for example, a specimen of cancers, parts of a cancer, cancer cells derived from a cancer (including cancer cell lines derived from a cancer and are grown in cell culture) and also the cancer mass as a whole, cell lines, cells and / or tissue derived from a subject that are suspected of being cancerous or suspected of comprising cancerous cells. Thus, it is possible that the cancer sample may also comprise non-cancerous cells. Attorney Docket No.: 36406.0036P1 As used herein, the term “comprising” can include the aspects “consisting of” and “consisting essentially of.” “Comprising” can also mean “including but not limited to.” The phrase “at least” preceding a series of elements is to be understood to refer to every element in the series. For example, “at least one” includes one, two, three, four or more. As used herein, the term “target nucleic acid molecule,” “target sequence,” “target nucleic acid,” or “target polynucleotide” and the like are nucleic acids. A target nucleic acid molecule can be a portion of a gene, a regulatory sequence, genomic DNA, cDNA, RNA including mRNA and rRNA, or others. As described herein, the target nucleic acid molecule can be a target nucleic acid molecule from a sample, or a secondary target such as a product of an amplification reaction, etc. It may be any length. The term “nucleic acids” or “oligonucleotide” or grammatical equivalents herein refers to at least two nucleotides covalently linked together. Nucleic acids containing one or more carbocyclic sugars are also included within the definition of nucleic acids. A “nucleic acid” will generally contain phosphodiester bonds, although in some cases (for example, in the construction of primers and probes, such as label probes), nucleic acid analogs are included that may have alternate backbones, comprising, for example, phosphoramide (Beaucage et al., Tetrahedron 49(10): 1925 (1993) and references therein; Letsinger, J. Org. Chem.35:3800 (1970); Sprinzl et al., Eur. J. Biochem.81:579 (1977); Letsinger et al., Nucl. Acids Res. 14:3487 (1986); Sawai et al, Chem. Lett.805 (1984), Letsinger et al., J. Am. Chem. Soc. 110:4470 (1988); and Pauwels et al., Chemica Scripta 26:14191986)), phosphorothioate (Mag et al., Nucleic Acids Res.19:1437 (1991); and U.S. Pat. No.5,644,048), phosphorodithioate (Briu et al., J. Am. Chem. Soc.111:2321 (1989), O-methylphosphoroamidite linkages (see Eckstein, Oligonucleotides and Analogues: A Practical Approach, Oxford University Press), and peptide nucleic acid backbones and linkages (see Egholm, J. Am. Chem. Soc.114:1895 (1992); Meier et al., Chem. Int. Ed. Engl.31:1008 (1992); Nielsen, Nature, 365:566 (1993); Carlsson et al., Nature 380:207 (1996), all of which are incorporated by reference). Other analog nucleic acids include those with bicyclic structures including locked nucleic acids, Koshkin et al., J. Am. Chem. Soc.120:132523 (1998); positive backbones (Denpcy et al., Proc. Natl. Acad. Sci. USA 92:6097 (1995); non-ionic backbones (U.S. Pat. Nos.5,386,023, 5,637,684, 5,602,240, 5,216,141 and 4,469,863; Kiedrowshi et al., Angew. Chem. Intl. Ed. English 30:423 (1991); Letsinger et al., J. Am. Chem. Soc.110:4470 (1988); Letsinger et al., Nucleoside & Nucleotide 13:1597 (1994); Chapters 2 and 3, ASC Symposium Series 580, "Carbohydrate Modifications in Antisense Research", Ed. Y. S. Sanghui and P. Dan Cook; Attorney Docket No.: 36406.0036P1 Mesmaeker et al., Bioorganic & Medicinal Chem. Lett.4:395 (1994); Jeffs et al., J. Biomolecular NMR 34:17 (1994); Tetrahedron Lett.37:743 (1996)) and non-ribose backbones, including those described in U.S. Pat. Nos.5,235,033 and 5,034,506, and Chapters 6 and 7, ASC Symposium Series 580, "Carbohydrate Modifications in Antisense Research", Ed. Y. S. Sanghui and P. Dan Cook. Nucleic acids containing one or more carbocyclic sugars are also included within the definition of nucleic acids (see Jenkins et al., Chem. Soc. Rev. (1995) pp 169176). Several nucleic acid analogs are described in Rawls, C & E News Jun.2, 1997 page 35. All of these references are hereby expressly incorporated by reference. These modifications of the ribose-phosphate backbone may be done to increase the stability and half-life of such molecules in physiological environments. For example, PNA:DNA hybrids can exhibit higher stability and thus may be used in some embodiments. Nucleic acids may be single-stranded or double-stranded, as specified, or contain portions of both double-stranded and single-stranded sequences. The nucleic acids may be DNA, both genomic and cDNA, RNA or a hybrid, where the nucleic acid contains any combination of deoxyribo- and ribo-nucleotides, and any combination of bases, including uracil, adenine, thymine, cytosine, guanine, inosine, xathanine hypoxathanine, isocytosine, isoguanine, etc. As used herein, the term “sequence of interest” is the object of amplification or sequencing and can be any nucleic acid. As used herein, the term “sequence of interest” can refer to a portion of a “target nucleic acid molecule,” “target sequence,” “target nucleic acid,” or “target polynucleotide” and the like. The sequence of interest can include multiple nucleic acid molecules, such as in the case of whole genome amplification, multiple sites in a nucleic acid molecule, or a single region of a nucleic acid molecule. A sequence of interest can be in any nucleic acid sample of interest and of any length. The term “sequence of interest” can also mean a nucleic acid sequence (e.g., a therapeutic gene), that is partly or entirely heterologous, i.e., foreign, to a cell into which it is introduced. The term “sequence of interest” can also mean a nucleic acid sequence that is partly or entirely homologous to an endogenous gene of the cell into which it is introduced. For example, a sequence of interest can be cDNA, DNA, or RNA including mRNA and rRNA or others. The term “sequence of interest” can also mean a nucleic acid sequence that is partly or entirely complementary to an endogenous gene of the cell into which it is introduced. The nucleotide bases are abbreviated as follows: adenine (A), cytosine (C), guanine (G), thymine (T), and uracil. Attorney Docket No.: 36406.0036P1 A nucleotide analogue or modified nucleotide refers to a chemical compound that is structurally and functionally similar to the nucleotide, i.e. the nucleotide analogue can be recognized by polymerase as a substrate. That is, for example, a nucleotide analogue comprising adenine or an analogue of adenine should form hydrogen bonds with thymine, a nucleotide analogue comprising C or an analogue of C should form hydrogen bonds with G, a nucleotide analogue comprising G or an analogue of G should form hydrogen bonds with C, and a nucleotide analogue comprising T or an analogue of T should form hydrogen bonds with A, in a double helix format. All publications and patent applications mentioned in the specification are indicative of the level of those skilled in the art to which this invention pertains. All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference. Although the foregoing disclosure has been described in some detail by way of illustration and example for purposes of clarity of understanding, certain changes and modifications may be practiced within the scope of the appended claims. Current methods for single cell sequencing (e.g., 10x Genomics) is limited to solely capturing the 5' or 3' end of transcripts. Targeted enrichment of genes is possible, but because of the current limitations in the bead design, no internal mRNA sequences can be captured except through random priming. Disclosed herein are methods that are cost-effective and straightforward that can be used to modify 10x Genomics and other droplet-based sequencing beads. The methods described herein can be used to improve cancer diagnostics, immune cell profiling, personal medicine, enhance science research and identification and development of clinical biomarkers. METHODS Disclosed herein are compositions and methods for adding a nucleotide sequence to an oligonucleotide. The methods described herein can also be used in connection with sequencing, SNP detection, improving cancer diagnostics, and immune cell profiling as well as any other applications for detecting or determining a sequence of interest. In some aspects, the methods described herein can be used to improve cancer diagnostics, for example, fine needle aspiration alternative to slide staining cytology, and be applied to personal medicine (e.g., to guide decisions made regarding preventing, diagnosing, and treating a disease). Attorney Docket No.: 36406.0036P1 In some aspects, the methods can comprise: contacting a first oligonucleotide with a second oligonucleotide. In some aspects, the second oligonucleotide can comprise from 5’ to 3’: a capture sequence; a first spacer sequence; a sequence that is complementary to the 3’ end of the first oligonucleotide; a second spacer sequence; and a 3’ sequence wherein the 3’ sequence is not complementary to the first oligonucleotide, under conditions suitable for hybridization of the sequence of the second oligonucleotide that is complementary to the 3’ end of the first oligonucleotide to the 3’ end of the first oligonucleotide to form a partially double stranded complex. In some aspects, the methods can comprise contacting the partially double stranded complex with a polymerase under conditions suitable for elongation of the first oligonucleotide, thereby generating a partially double stranded extension product. In some aspects, the first oligonucleotide of the partially double stranded extension product can comprise a sequence complementary to the first spacer sequence and capture sequence of the second oligonucleotide. In some aspects, the methods can comprise contacting the partially double stranded extension product with a primer complementary to the 3’ sequence of the second oligonucleotide under conditions suitable for hybridization of the primer to the 3’ sequence of the second oligonucleotide. In some aspects, the methods can comprise extending the primer hybridized to the 3’ sequence of the second oligonucleotide, whereby the second oligonucleotide is displaced from the first oligonucleotide of the partially double stranded extension product, thereby generating a single stranded, extended first oligonucleotide, wherein the single stranded, extended first oligonucleotide comprises sequence complementary to the capture sequence and first spacer sequence of the second oligonucleotide. In some aspects, the methods can comprise: contacting a first oligonucleotide with a second oligonucleotide. In some aspects, the second oligonucleotide can comprise from 5’ to 3’: a capture sequence; a first spacer sequence; a sequence that is complementary to the 3’ end of the first oligonucleotide; a second spacer sequence; and a 3’ sequence, wherein the 3’ sequence is not complementary to the first oligonucleotide, under conditions suitable for hybridization of the sequence of the second oligonucleotide that is complementary to the 3’ end of the first oligonucleotide to the 3’ end of the first oligonucleotide to form a double stranded complex. In some aspects, a capture sequence can be ligated to the first spacer sequence or the capture sequence. In some aspects, the capture sequence can further comprises an adapter sequence on the 3’ end of the capture sequence. In some aspects, the methods can comprise contacting the double stranded complex with a polymerase under conditions suitable for elongation of the first oligonucleotide, thereby generating a double stranded extension Attorney Docket No.: 36406.0036P1 product. In some aspects, the first oligonucleotide of the double stranded extension product can comprise a sequence complementary to the first spacer sequence and capture sequence of the second oligonucleotide. In some aspects, the methods can comprise contacting the double stranded extension product with a primer complementary to the 3’ sequence of the second oligonucleotide under conditions suitable for hybridization of the primer to the 3’ sequence of the second oligonucleotide. In some aspects, the methods can comprise extending the primer hybridized to the 3’ sequence of the second oligonucleotide, whereby the second oligonucleotide is displaced from the first oligonucleotide of the partially double stranded extension product, thereby generating a single stranded, extended first oligonucleotide, wherein the single stranded, extended first oligonucleotide comprises sequence complementary to the capture sequence and first spacer sequence of the second oligonucleotide. In some aspects, the methods can comprise: contacting a first oligonucleotide with a second oligonucleotide. In some aspects, the second oligonucleotide can comprise from 5’ to 3’: a capture sequence; a sequence that is complementary to the 3’ end of the first oligonucleotide; and a 3’ sequence wherein the 3’ sequence is not complementary to the first oligonucleotide, under conditions suitable for hybridization of the sequence of the second oligonucleotide that is complementary to the 3’ end of the first oligonucleotide to the 3’ end of the first oligonucleotide to form a partially double stranded complex. In some aspects, the methods can comprise contacting the partially double stranded complex with a polymerase under conditions suitable for elongation of the first oligonucleotide, thereby generating a partially double stranded extension product. In some aspects, the first oligonucleotide of the partially double stranded extension product can comprise a sequence complementary to the capture sequence of the second oligonucleotide. In some aspects, the methods can comprise contacting the partially double stranded extension product with a primer complementary to the 3’ sequence of the second oligonucleotide under conditions suitable for hybridization of the primer to the 3’ sequence of the second oligonucleotide. In some aspects, the methods can comprise extending the primer hybridized to the 3’ sequence of the second oligonucleotide, whereby the second oligonucleotide is displaced from the first oligonucleotide of the partially double stranded extension product, thereby generating a single stranded, extended first oligonucleotide, wherein the single stranded, extended first oligonucleotide comprises sequence complementary to the capture sequence of the second oligonucleotide. In some aspects, the methods can comprise: contacting a first oligonucleotide with a second oligonucleotide. In some aspects, the second oligonucleotide can comprise from 5’ to Attorney Docket No.: 36406.0036P1 3’: a capture sequence; a sequence that is complementary to the 3’ end of the first oligonucleotide; and a 3’ sequence, wherein the 3’ sequence is not complementary to the first oligonucleotide, under conditions suitable for hybridization of the sequence of the second oligonucleotide that is complementary to the 3’ end of the first oligonucleotide to the 3’ end of the first oligonucleotide to form a double stranded complex. In some aspects, a capture sequence can be ligated to the capture sequence. In some aspects, the capture sequence can further comprises an adapter sequence on the 3’ end of the capture sequence. In some aspects, the methods can comprise contacting the double stranded complex with a polymerase under conditions suitable for elongation of the first oligonucleotide, thereby generating a double stranded extension product. In some aspects, the first oligonucleotide of the double stranded extension product can comprise a sequence complementary to the capture sequence of the second oligonucleotide. In some aspects, the methods can comprise contacting the double stranded extension product with a primer complementary to the 3’ sequence of the second oligonucleotide under conditions suitable for hybridization of the primer to the 3’ sequence of the second oligonucleotide. In some aspects, the methods can comprise extending the primer hybridized to the 3’ sequence of the second oligonucleotide, whereby the second oligonucleotide is displaced from the first oligonucleotide of the partially double stranded extension product, thereby generating a single stranded, extended first oligonucleotide, wherein the single stranded, extended first oligonucleotide comprises sequence complementary to the capture sequence of the second oligonucleotide. In some aspects, the methods can comprise: contacting a first oligonucleotide with a second oligonucleotide. In some aspects, the second oligonucleotide can comprise from 5’ to 3’: a first spacer sequence; a sequence that is complementary to the 3’ end of the first oligonucleotide; a second spacer sequence; and a 3’ sequence, wherein the 3’ sequence is not complementary to the first oligonucleotide, under conditions suitable for hybridization of the sequence of the second oligonucleotide that is complementary to the 3’ end of the first oligonucleotide to the 3’ end of the first oligonucleotide to form a partially double stranded complex, wherein the partially double stranded complex comprises overhangs. In some aspects, the first spacer sequence can serve as an overhang for adapter ligation. In some aspects, the methods can comprise contacting the first spacer sequence of the partially double stranded complex with an adapter complex comprising a capture sequence complementary to the first spacer sequence in the presence of a ligase under conditions suitable for ligating the first spacer sequence of the partially double stranded complex with an adapter complex, Attorney Docket No.: 36406.0036P1 thereby generating a partially double stranded ligation product. In some aspects, the methods can comprise contacting the partially double stranded ligation product with a primer complementary to the 3’ sequence of the second oligonucleotide under conditions suitable for hybridization of the primer to the 3’ sequence of the second oligonucleotide. In some aspects, the method can comprise extending the primer hybridized to the 3’ sequence of the second oligonucleotide, whereby the second oligonucleotide is displaced from the first oligonucleotide of the partially double stranded extension product, thereby generating a single stranded, extended first oligonucleotide, wherein the single stranded, extended first oligonucleotide comprises sequence complementary to the capture sequence and first spacer sequence of the second oligonucleotide. Any DNA ligase is suitable for use in the disclosed amplification method. Preferred ligases are those that preferentially form phosphodiester bonds at nicks in double stranded DNA. That is, ligases that fail to ligate the free ends of single-stranded DNA at a significant rate are preferred. Thermostable ligases are especially preferred. Many suitable ligases are known, such as T4 DNA ligase (Davis et al., Advanced Bacterial Genetics Manual for Genetic Engineering (Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1980)), E. coli DNA ligase (Panansko et al., J. Biol. Chem.253:4590-4592 (1978)), AMPLIGASE® (Kalin et al., Mutat. Res., 283(2):119-123 (1992); Winn-Deen et al. Mol Cell Probes (England) 7(3):179- 186 (1993)), Taq DNA ligase (Barany, Proc. Natl. Acad. Sci. USA 88:189-193 (1991), Thermus thermophilus DNA ligase (Abbott Laboratories), Thermus scotoductus DNA ligase and Rhodothermus marinus DNA ligase (Thorbjarnardottir et al., Gene 151:177-180 (1995)). T4 DNA ligase is preferred for ligations involving RNA target sequences due to its ability to ligate DNA ends involved in DNA:RNA hybrids (Hsuih et al., Quantitative detection of HCV RNA using novel ligation-dependent polymerase chain reaction, American Association for the Study of Liver Diseases (Chicago, Ill., Nov.3-7, 1995)). In some aspects, the ligase is a blunt- end ligase. In some aspects, the ligase can be T4 DNA ligase. In some aspects, the ligase can be a T3 DNA ligase. In some aspects, the ligase can be a T7 DNA ligase. In some aspects, the ligase can be a 9° N™ DNA ligase. In some aspects, the methods described herein can follow the method steps depicted in FIG.2 or FIG.3. As shown, the method steps depicted in FIG.2 and FIG. 3 differ in that STEP 1 of FIG.3 anneals a single-stranded oligonucleotide to the bead sequence that has a first spacer sequence that can serve as an overhang for double-stranded oligonucleotide to be Attorney Docket No.: 36406.0036P1 annealed in STEP 2. Additionally, a capture sequence can be ligated to the capture sequence of the first oligonucleotide and / or the second oligonucleotide. In some aspects, the methods can comprising ligating a capture sequence. For example, the methods can comprise contacting a first oligonucleotide with a capture sequence. In some aspects the capture sequence comprises from 5’ to 3’: a sequence that is complementary to the 3’ end of the first oligonucleotide; and a 3’ sequence wherein the 3’ sequence is not complementary to the first oligonucleotide, under conditions suitable for hybridization of the capture sequence that is complementary to the 3’ end of the first oligonucleotide to the 3’ end of the first oligonucleotide to form a partially double stranded complex; contacting the partially double stranded complex with a polymerase under conditions suitable for elongation of the first oligonucleotide, thereby generating a partially double stranded extension product, wherein the first oligonucleotide of the partially double stranded extension product comprises a sequence complementary to the first spacer sequence and capture sequence; contacting the partially double stranded extension product with a primer complementary to the 3’ sequence of the capture sequence under conditions suitable for hybridization of the primer to the 3’ sequence of the capture sequence; and extending the primer hybridized to the 3’ sequence of the capture sequence, whereby the capture sequence is displaced from the first oligonucleotide of the partially double stranded extension product, thereby generating a single stranded, extended first oligonucleotide, wherein the single stranded, extended first oligonucleotide comprises sequence complementary to the capture sequence. In some aspects, the methods can further comprise immobilizing the single stranded, extended first oligonucleotide. In other words, the methods further comprise adding the extended first oligonucleotide to a bead, after the reaction steps described above. In some aspects, the first oligonucleotide can be immobilized. For example, the first oligonucleotide can be on a bead. In some aspects, the step of extending the primer hybridized to the 3’ sequence of the second oligonucleotide can comprise extending the primer sequence using a strand displacing polymerase enzyme. In some aspects, the strand displacing polymerase enzyme can comprise a thermostable stand displacing polymerase enzyme. In some aspects, the single stranded, extended first oligonucleotide or first oligonucleotide can be immobilized on a bead or a slide. In some aspects, the bead can be porous. In some aspects, the bead can be non-porous. In some aspects, the bead can be a gel bead. Attorney Docket No.: 36406.0036P1 Suitable solid support materials include materials such as glass, polyacrylamide-coated glass, ceramics, silica, silicon, quartz, various plastics, and the like. In an aspect, the solid support can be glass or quartz, such as a microscope slide, having a surface that can be uniformly silanized. Solid-state substrates for use in solid supports can include any solid material to which oligonucleotides can be coupled. This includes materials such as acrylamide, agarose, cellulose, nitrocellulose, glass, polystyrene, polyethylene vinyl acetate, polypropylene, polymethacrylate, polyethylene, polyethylene oxide, polysilicates, polycarbonates, teflon, fluorocarbons, nylon, silicon rubber, polyanhydrides, polyglycolic acid, polylactic acid, polyorthoesters, polypropylfumerate, collagen, glycosaminoglycans, and polyamino acids. Solid-state substrates can have any useful form including thin film, membrane, bottles, dishes, fibers, woven fibers, shaped polymers, particles, beads, microparticles, or a combination. Solid-state substrates can also comprise at least two thin films, membranes, bottles, dishes, fibers, woven fibers, shaped polymers, particles, beads, microparticles, or a combination thereof. Solid-state substrates and solid supports can be porous or non-porous. Additional arrangements are described in U.S. Pat. No.5,854,033, which is hereby incorporated by reference for its teaching of said additional arrangements. In an aspect, a glass slide can be used. This feature allows for greater control of assay reproducibility, increased throughput and sample handling, and ease of automation. As used herein, the term “bead” refers to a particle. In some aspects, the bead can be a solid or semi-solid particle. In some aspects, the bead can be a gel. In some aspects, the bead can be formed of a polymeric material. In some aspects, the bead can be magnetic or non- magnetic. A bead may comprise natural and / or synthetic materials. For example, a polymer can be a natural polymer or a synthetic polymer. In some cases, a bead may comprise both natural and synthetic polymers. Examples of natural polymers include proteins and sugars such as deoxyribonucleic acid, rubber, cellulose, starch (e.g., amylose, amylopectin), proteins, enzymes, polysaccharides, silks, polyhydroxyalkanoates, chitosan, dextran, collagen, carrageenan, ispaghula, acacia, agar, gelatin, shellac, sterculia gum, xanthan gum, Corn sugar gum, guar gum, gum karaya, agarose, alginic acid, alginate, or natural polymers thereof. Examples of synthetic polymers include acrylics, nylons, silicones, spandex, viscose rayon, polycarboxylic acids, polyvinyl acetate, polyacrylamide, polyacrylate, polyethylene glycol, polyurethanes, polylactic acid, silica, polystyrene, polyacrylonitrile, polybutadiene, Attorney Docket No.: 36406.0036P1 polycarbonate, polyethylene, polyethylene terephthalate, poly(chlorotrifluoroethylene), poly(ethylene oxide), poly(ethylene terephthalate), polyethylene, polyisobutylene, poly(methyl methacrylate), poly(oxymethylene), polyformaldehyde, polypropylene, polystyrene, poly(tetrafluoroethylene), poly(vinyl acetate), poly(vinyl alcohol), poly(vinyl chloride), poly(vinylidene dichloride), poly(vinylidene difluoride), poly(vinyl fluoride) and combinations (e.g., co-polymers) thereof. Beads may also be formed from materials other than polymers, including lipids, micelles, ceramics, glass-ceramics, material composites, metals, other inorganic materials, and others. In some aspects, the first spacer sequence and the second spacer sequence can be optional. In some aspects, the first spacer sequence or the second spacer sequence can be 1-20 basepairs in length. In some aspects, the first spacer sequence or the second spacer sequence can be 1-10 base pairs in length. In some aspects, the first spacer sequence or the second spacer sequence can be 2-6 base pairs in length. In some aspects, the first spacer sequence or the second spacer sequence can be 4 base pairs in length. Sequence of interest. In some aspects, the sequence of interest can be a human sequence of interest. In some aspects, the sequence of interest can be from genomic DNA. In some aspects, the target nucleic acid molecule can be double-stranded DNA. In some aspects, the disclosed methods can involve utilizing DNA fragments comprising one or more sequences of interest from samples. A sample solution can comprise any number of components, including, but not limited to, bodily fluids (including, but not limited to, blood, urine, serum, lymph, saliva, anal and vaginal secretions, perspiration and semen) and cells of any organism; environmental samples (including, but not limited to, air, agricultural, water and soil samples); biological warfare agent samples; research samples (i.e. in the case of nucleic acids, the sample can be the products of an amplification reaction, including both target and signal amplification, such as PCR amplification reactions; purified samples, such as purified genomic DNA, RNA preparations, raw samples (bacteria, virus, genomic DNA)); and as will be appreciated by those skilled in the art, almost any experimental manipulation can be done on the samples. In some aspects, the samples can be mammalian samples. In some aspects, the samples can be human samples. In general, cells from the target organism (e.g., animal, avian, mammalian) can be used. When genomic DNA is used, the amount of genomic DNA required for constructing arrays of the invention can vary. In some aspects, for mammalian-sized genomes, fragments can be generated from at least about 10 genome-equivalents of DNA. In another aspect, fragments Attorney Docket No.: 36406.0036P1 can be generated from at least about 30 genome-equivalents of DNA. In another aspect, fragments can be generated from at least about 60 genome-equivalents of DNA. The sequence of interest can be any nucleic acid sequence. In some aspects, the sequence of interest can be double-stranded. The hybridization region and the amplification region within the target nucleic acid molecule can be defined in terms of the relationship of the target nucleic acid molecule to the primers in a set of primers. The primers can be designed to match the chosen sequence of interest. In some aspects, the sequence to be amplified and the sites of hybridization of the primers can be separate since sequences in and around the sites where the primers hybridize can be amplified. Polymerases. In some aspects, the strand displacing polymerase enzyme can be a DNA polymerase. As used in the methods disclosed herein, the strand displacing polymerase enzyme can displace the strand complementary to the template strand, termed strand displacement, and lacks a 5' to 3' exonuclease activity. Strand displacement results in synthesis of multiple tandem copies of an amplification target circle. A 5' to 3' exonuclease activity, if present, might result in the destruction of the synthesized strand. In some aspects, DNA polymerases for use in the disclosed method can be processive. In some aspects, the DNA polymerases can be bacteriophage ^29 DNA polymerase (U.S. Patent Nos.5,198,543 and 5,001,050 to Blanco et al.), phage M2 DNA polymerase (Matsumoto et al., Gene 84:247 (1989)), phage ^PRD1 DNA polymerase (Jung et al., Proc. Natl. Acad. Sci. USA 84:8287 (1987)), VENT® DNA polymerase (Kong et al., J. Biol. Chem.268:1965-1975 (1993)), Klenow fragment of DNA polymerase I (Jacobsen et al., Eur. J. Biochem.45:623-627 (1974)), T5 DNA polymerase (Chatterjee et al., Gene 97:13-19 (1991)), PRD1 DNA polymerase (Zhu and Ito, Biochim. Biophys. Acta.1219:267-276 (1994)), modified T7 DNA polymerase (Tabor and Richardson, J. Biol. Chem.262:15330-15333 (1987); Tabor and Richardson, J. Biol. Chem.264:6447-6458 (1989); SequenaseTM(U.S. Biochemicals)), T7 native polymerase, Bst polymerase, and T4 DNA polymerase holoenzyme (Kaboord and Benkovic, Curr. Biol.5:149-157 (1995)). Strand displacement can be facilitated through the use of a strand displacement factor, such as helicase. Strand displacement factors useful in the methods disclosed herein include BMRF1 polymerase accessory subunit (Tsurumi et al., J. Virology 67(12):7648-7653 (1993)), adenovirus DNA-binding protein (Zijderveld and van der Vliet, J. Virology 68(2):1158-1164 (1994)), herpes simplex viral protein ICP8 (Boehmer and Lehman, J. Virology 67(2):711-715 (1993); Skaliter and Lehman, Proc. Natl. Acad. Sci. USA 91(22):10665-10669 (1994)), single- Attorney Docket No.: 36406.0036P1 stranded DNA binding proteins (SSB; Rigler and Romano, J. Biol. Chem.270:8910-8919 (1995)), and calf thymus helicase (Siegel et al., J. Biol. Chem.267:13629-13635 (1992)). Detected labels. To aid in detection and quantitation of nucleic acids amplified using the disclosed methods, detection labels can be directly incorporated into amplified nucleic acids or can be coupled to detection molecules. As used herein, a detection label is any molecule that can be associated with amplified nucleic acid, directly or indirectly, and which results in a measurable, detectable signal, either directly or indirectly. Many such labels for incorporation into nucleic acids or coupling to nucleic acid or antibody probes are known to those of skill in the art. Examples of detection labels suitable for use in the methods disclosed herein include but are not limited to radioactive isotopes, fluorescent molecules, phosphorescent molecules, enzymes, antibodies, and ligands. Examples of suitable fluorescent labels include but are not limited to fluorescein (FITC), 5,6-carboxymethyl fluorescein, Texas red, nitrobenz-2-oxa-1,3-diazol-4-yl (NBD), coumarin, dansyl chloride, rhodamine, 4'-6-diamidino-2-phenylinodole (DAPI), and the cyanine dyes Cy3, Cy3.5, Cy5, Cy5.5 and Cy7. Preferred fluorescent labels are fluorescein (5- carboxyfluorescein-N-hydroxysuccinimide ester) and rhodamine (5,6-tetramethyl rhodamine). Preferred fluorescent labels for combinatorial multicolor coding are FITC and the cyanine dyes Cy3, Cy3.5, Cy5, Cy5.5 and Cy7. The absorption and emission maxima, respectively, for these fluors are: FITC (490 nm; 520 nm), Cy3 (554 nm; 568 nm), Cy3.5 (581 nm; 588 nm), Cy5 (652 nm: 672 nm), Cy5.5 (682 nm; 703 nm) and Cy7 (755 nm; 778 nm), thus allowing their simultaneous detection. The fluorescent labels can be obtained from a variety of commercial sources, including Molecular Probes, Eugene, OR and Research Organics, Cleveland, Ohio. Labeled nucleotides are preferred form of detection label since they can be directly incorporated into the products of the methods disclosed herein during synthesis. Examples of detection labels that can be incorporated into amplified DNA or RNA include nucleotide analogs such as BrdUrd (Hoy and Schimke, Mutation Research 290:217-230 (1993)), BrUTP (Wansick et al., J. Cell Biology 122:283-293 (1993)) and nucleotides modified with biotin (Langer et al., Proc. Natl. Acad. Sci. USA 78:6633 (1981)) or with suitable haptens such as digoxygenin (Kerkhof, Anal. Biochem.205:359-364 (1992)). Suitable fluorescence-labeled nucleotides are Fluorescein-isothiocyanate-dUTP, Cyanine-3-dUTP and Cyanine-5-dUTP (Yu et al., Nucleic Acids Res., 22:3226-3232 (1994)). A preferred nucleotide analog detection label for DNA is BrdUrd (BUDR triphosphate, Sigma), and a preferred nucleotide analog detection Attorney Docket No.: 36406.0036P1 label for RNA is Biotin-16-uridine-5'-triphosphate (Biotin-16-dUTP, Boehringher Mannheim). Fluorescein, Cy3, and Cy5 can be linked to dUTP for direct labeling. Cy3.5 and Cy7 are available as avidin or anti-digoxygenin conjugates for secondary detection of biotin- or digoxygenin-labeled probes. Detection labels that are incorporated into amplified nucleic acid, such as biotin, can be subsequently detected using sensitive methods well-known in the art. For example, biotin can be detected using streptavidin-alkaline phosphatase conjugate (Tropix, Inc.), which is bound to the biotin and subsequently detected by chemiluminescence of suitable substrates (for example, chemiluminescent substrate CSPD: disodium, 3-(4-methoxyspiro-[1,2,-dioxetane-3-2'-(5'- chloro)tricyclo [3.3.1.13,7]decane]-4-yl) phenyl phosphate; CDP-Star.RTM. (disodium 2- chloro-5-(4-methoxyspiro{1,2-dioxetane-3-2'-(5'-chloro)tricyclo[3.3.1.13,7 ]decan}-4-yl) phenyl phosphate) and AMPPD.RTM. (disodium 3-(4-methoxyspiro{1,2-dioxetane-3-2'- tricyclo[3.3.1.13,7 ]phenyl phosphate) (all available from Tropix, Inc.). A preferred detection label for use in detection of amplified RNA is acridinium-ester- labeled DNA probe (GenProbe, Inc., as described by Arnold et al., Clinical Chemistry 35:1588-1594 (1989)). An acridinium-ester-labeled detection probe permits the detection of amplified RNA without washing because unhybridized probe can be destroyed with alkali (Arnold et al. (1989)). Molecules that combine two or more of these detection labels are also considered detection labels. Any of the known detection labels can be used with the disclosed probes, tags, and method to label and detect nucleic acid amplified using the disclosed method. Methods for detecting and measuring signals generated by detection labels are also known to those of skill in the art. For example, radioactive isotopes can be detected by scintillation counting or direct visualization; fluorescent molecules can be detected with fluorescent spectrophotometers; phosphorescent molecules can be detected with a scanner or spectrophotometer, or directly visualized with a camera; enzymes can be detected by detection or visualization of the product of a reaction catalyzed by the enzyme; antibodies can be detected by detecting a secondary detection label coupled to the antibody. Such methods can be used directly in the disclosed method of amplification and detection. As used herein, detection molecules are molecules that interact with amplified nucleic acid and to which one or more detection labels are coupled. Other examples of molecules for use in detecting any of the products formed according to the methods described herein, include, but are not limited to, decorators, or decorating Attorney Docket No.: 36406.0036P1 agents, including hybridization probes, any of the fluorescent agents disclosed herein, ligand binding molecules (such as avidin), antibodies, FKBP fold binding molecules (such as rapamycin), enzymes, receptors, nucleic acid binding proteins (such as transcription factors), ribosomal or other RNA binding proteins, affinity agents (such as aptamers, which are nucleic acids with affinity for small molecule ligands [See: Marshall et al, Current Biology, 5, 729-734 (1997) for a review], and other agents known to those skilled in the art and suitable for conjugation with an CA primer or detection tag. Kits Described herein are kits that can be used for adding a sequence to an oligonucleotide to create a custom targeting oligonucleotide as described herein and for using the same for various applications. In some aspects, the kits comprise at least one bead or slide and one or more reagents useful for adding a sequence to an oligonucleotide to create a custom targeting oligonucleotide as disclosed herein or for carrying out an application therewith. Such reagents include, without limitation, capture sequences, probes, enzymes, and the like, and can be each packaged in a container, such as, without limitation, a vial, tube or bottle, in a package suitable for commercial distribution, such as, without limitation, a box, a sealed pouch, a blister pack and a carton. In some aspects, the package can contain a label or packaging insert indicating the uses of the packaged materials. As used herein, “packaging materials” can include any article used in the packaging for distribution of reagents in a kit, including without limitation containers, vials, tubes, bottles, pouches, blister packaging, labels, tags, instruction sheets and package inserts. Examples Example 1: Targeting Custom Oligonucleotides (TaCOs) Disclosed herein are targeted custom oligonucleotide sequences (TaCOs) with three main characteristics: 1) They can hybridize to the 3’ end of bead oligo sequences, 2) They include the reverse complement of the target sequence of interest, and 3) They include a 5’ oligonucleotide sequence antisense to a separate “kickoff” oligonucleotide sequence. These custom capture sequences are added to the beads prior to the scRNA-seq run. To add TaCOs to the beads, bead diluent is removed from the beads using, for example, 0.22 µm Costar Microcentrifuge filters (spin filters). Isolated beads are collected, and the diluent is Attorney Docket No.: 36406.0036P1 saved separately. The beads are incubated at 37 ^C with TaCOs and a polymerase stable at this temperature for 45 minutes. The TaCO primers anneal to the bead oligos, and the polymerase extends the bead oligos with custom sequences complementary to the TaCOs (FIG.1). The beads are then washed, and spin filters are used to recover the beads. Next, beads are incubated at 37 ^C with “kickoff” oligonucleotides and a polymerase with helicase activity for 45 minutes. The polymerase forms a double stranded sequence with the TaCO primer that can then be unwound from the bead oligo (FIG.1). The beads are washed, and spin filters are used to recover the beads. The beads are then resuspended in the original bead diluent or a suitable equivalent, and the scRNA-seq run can turn as normal. The methods disclosed herein can be used to modify droplet-based sequencing methods to capture custom targets of interest, including identifying alternatively spliced mRNA isoforms, targeting cell-type specific or low-expressing genes, and targeting RNA that does not have a polyA tail (e.g., rRNA, tRNA, and noncoding RNA). Such applications would be of interest to many fields including but not limited to RNA biology, neurodegeneration, and immunology. Custom Bead Preparation Protocol. The materials used are shown in Table 1. Table 1. Materials Use Item Vendor Catalog # #units / Unit l er es Attorney Docket No.: 36406.0036P1 Create a large master mix (MM) of the forward primer. For example, the MM is a pre- mixed of multiple components (e.g., all of the custom TaCO primers to be added to the bead); this allows the number of pipetting steps to reduce in subsequent steps. Table 2. TACO primer master mix. TACO Primer MM Stock Final ? µL solution Each TACO primer 10 µM 5 µM 1 µL a e . s su c e o a e e o wa p e . Forward Primer MM Stock Final 100 µL solution Bl ki i 10 M 4 M 40 L This protocol uses a 4:1 ratio of the blocking primer: TACO primers. This ratio is selected to allow the appropriate capture of polyA transcripts for GEX information and appropriate demultiplexing of UMI and cell barcodes. This protocol can also be modified. For example, if using a ligation approach to modify beads, the forward primer master mix can be designed as adapter oligos that are compatible with an overhang that can be introduced by a single oligo that makes contact with the capture sequence on the bead (polyT, Capture Sequence 1, Capture Sequence 2, or otherwise) (ratio of blocking primer to overhang- containing primer can remain 4:1). Tubes are labeled so that there is no mixing between tubes of beads. Buffer recipes. *Add Kleenow immediately prior to the use of the buffer – NOT in advance. Tables 4 and 5 show the materials for preparing Buffer A and Buffer B, respectively.

[0002] Attorney Docket No.: 36406.0036P1 Table 4. Buffer A. Buffer A Stock Final 120 µL solution CutSmart 10X 1X 12 µL Table 5. Buffer B. Buffer B Stock Final 120 µL solution Full Custom Bead Prep Protocol: 1. Transfer beads from original tube to a filter tube and centrifuge at 500 rcf for 2 min; Attorney Docket No.: 36406.0036P1 2. Transfer flowthrough bead buffer to separate Eppendorf tube and keep on ice - do not toss; 3. Wash beads, Add 200 μL of elution buffer (EB; e.g., water with 10 mM Tris-Cl to reduce potential DNA degradation) to beads on filter, Centrifuge at 500 rcf for 2 min, and Ensure no liquid remains on top of the filter. If there is, spin again. 4. Recover beads Remove filter from the filter tube and tape upside-down to new Eppendorf tube without touching the filter; and Centrifuge the taped tubes at 400 rcf for 30 sec without the centrifuge lid to transfer the gel beads from the filter to the Eppendorf tube. Check the Eppendorf tube for beads. 5. Resuspend beads in 100 μL Buffer A then transfer beads in Buffer A to a PCR strip tube; 6. Tape PCR strip tube to rotator horizontally and incubate for 45 min at 37°C; 7. Add 200 μL EB to a new Eppendorf tube and 20 μL EB to the beads (to reduce viscosity); 8. Mix beads up and down and transfer the bead solution to the EB; 9. Transfer solution with EB, beads, and buffer to a filter column; 10. Centrifuge at 500 rcf for 2 min; 11. Recover beads as in step 4; 12. Repeat steps 5-10 but resuspend in Buffer B instead of Buffer A; 13. Wash beads twice (as in step 3); 14. Recover beads (as in step 4); 15. Add flowthrough bead buffer from step 2 to beads and resuspend; 16. Transfer beads in flowthrough bead buffer to new PCR tube; 17. Check <1 μL beads under microscope to see approximate bead concentration; and 18. Store recovered beads at -80° C. Example 2: A Method for Capturing TDP-43-Associated Cryptic Exons in Human Brain Samples from ALS-FTD Droplet-based RNA sequencing methods, such as the 10x Genomics platform, have revolutionized the ability to profile human tissues at single cell / nuclei resolution. However, Attorney Docket No.: 36406.0036P1 10x single nuclei RNA sequencing (snRNAseq) is currently limited to 5’ or 3’ capture and is unable to directly target the middle portions of mRNA transcripts. Internal sites of mRNAs contain many features that are relevant to disease such as alternative splicing variants. Disclosed herein are methods that can generate gel beads that are coated with both poly(dT) oligos and targeted capture oligos (TaCOs), each containing cell barcodes and unique molecular identifiers. By designing TaCOs to anneal directly adjacent to internal sequences of interest, TaCO-Seq can profile any portion of an mRNA transcript. Meanwhile, the remaining polyT probes ensure that simultaneous capture of gene expression is unaffected. TaCO beads are compatible with 10x Genomics Chromium X controllers and can integrate seamlessly with downstream sequencing and analysis pipelines. TaCO-Seq can be used to capture TDP-43-associated cryptic exons in human brain samples from ALS-FTD and identified differential cryptic exon burden in different cell types (FIG.2). Detection of splicing at single nuclei sequencing can be used clarify the genetic and environmental factors that underlie the onset and progression of TDP-43 cryptic exons in neurodegenerative diseases. Furthermore, TaCO-Seq is a highly flexible and cost-effective method that can be generalized for single cell targeting of any sequences in the genome or transcriptome. TaCO-Seq can be used to study alternative splicing in the fields of neuroscience and oncology.

Claims

Attorney Docket No.: 36406.0036P1 CLAIMS WHAT IS CLAIMED IS:

1. A method of adding a sequence to an oligonucleotide, the method comprising: a) contacting a first oligonucleotide with a second oligonucleotide, wherein the second oligonucleotide comprises from 5’ to 3’: i) a capture sequence; ii) a first spacer sequence; iii) a sequence that is complementary to the 3’ end of the first oligonucleotide; iv) a second spacer sequence; and v) a 3’ sequence, wherein the 3’ sequence is not complementary to the first oligonucleotide, under conditions suitable for hybridization of the sequence of the second oligonucleotide that is complementary to the 3’ end of the first oligonucleotide to the 3’ end of the first oligonucleotide to form a partially double stranded complex; b) contacting the partially double stranded complex with a polymerase under conditions suitable for elongation of the first oligonucleotide, thereby generating a partially double stranded extension product, wherein the first oligonucleotide of the partially double stranded extension product comprises a sequence complementary to the first spacer sequence and capture sequence of the second oligonucleotide; c) contacting the partially double stranded extension product with a primer complementary to the 3’ sequence of the second oligonucleotide underAttorney Docket No.: 36406.0036P1 conditions suitable for hybridization of the primer to the 3’ sequence of the second oligonucleotide; and d) extending the primer hybridized to the 3’ sequence of the second oligonucleotide, whereby the second oligonucleotide is displaced from the first oligonucleotide of the partially double stranded extension product, thereby generating a single stranded, extended first oligonucleotide, wherein the single stranded, extended first oligonucleotide comprises sequence complementary to the capture sequence and first spacer sequence of the second oligonucleotide.

2. The method of claim 1, further comprising immobilizing the single stranded, extended first oligonucleotide.

3. The method of claim 1, wherein the first oligonucleotide is immobilized.

4. The method of claim 1, wherein d) comprises extending the primer sequence using a strand displacing polymerase enzyme.

5. The method of claim 4, wherein the strand displacing polymerase enzyme comprises a thermostable stand displacing polymerase enzyme.

6. The method of claims 2 or 3, wherein the single stranded, extended first oligonucleotide or first oligonucleotide is immobilized on a bead or a slide.

7. The method of claim 6, wherein the bead is porous.

8. The method of claim 6, wherein the bead is non-porous.

9. The method of claim 6, wherein the bead is a gel bead.

10. A method of adding a sequence to an oligonucleotide, the method comprising: a) contacting a first oligonucleotide with a second oligonucleotide, wherein the second oligonucleotide comprises from 5’ to 3’: i) a first spacer sequence;Attorney Docket No.: 36406.0036P1 ii) a sequence that is complementary to the 3’ end of the first oligonucleotide; iii) a second spacer sequence; and iv) a 3’ sequence, wherein the 3’ sequence is not complementary to the first oligonucleotide, under conditions suitable for hybridization of the sequence of the second oligonucleotide that is complementary to the 3’ end of the first oligonucleotide to the 3’ end of the first oligonucleotide to form a partially double stranded complex, wherein the partially double stranded complex comprises overhangs; b) contacting the first spacer sequence of the partially double stranded complex with an adapter complex comprising a capture sequence complementary to the first spacer sequence in the presence of a ligase under conditions suitable for ligating the first spacer sequence of the partially double stranded complex with an adapter complex, thereby generating a partially double stranded ligation product,; c) contacting the partially double stranded ligation product with a primer complementary to the 3’ sequence of the second oligonucleotide under conditions suitable for hybridization of the primer to the 3’ sequence of the second oligonucleotide; and d) extending the primer hybridized to the 3’ sequence of the second oligonucleotide, whereby the second oligonucleotide is displaced from the first oligonucleotide of the partially double stranded extension product, thereby generating a single stranded, extended first oligonucleotide, wherein the single stranded, extended first oligonucleotide comprises sequence complementary to the capture sequence and first spacer sequence of the second oligonucleotide.

Images