Method for regulating translation in bacteria by utilizing dead-cas13d

Abstract

The present invention relates to a method for regulating translation in bacteria. It has been verified that, by constructing a CRISPR interference system using dCas13d, which is capable of specifically binding to RNA in bacteria, nucleotides in the stem, bulge, and flanking sequence regions from among nucleotides constituting a guide RNA are replaced with other nucleotides to change the binding efficiency between dCas13d and the guide RNA, and thus the system can be widely used to control the degree of inhibition of translation of mRNA to which dCas13d binds in various target genes. Therefore, the production of a target substance can be optimized without directly replacing a promoter and 5`-UTR sequences in the genome, and the present invention can be applied to a non-model strain in which direct modification of the genome is difficult.

Description

How to Modulate Translation in Bacteria Using DEAD-CAS13D

[0001] The present invention relates to a method for regulating translation in bacteria, and more particularly, to a method for regulating translation at multiple levels in bacteria based on dead-Cas13d (dCas13d, hereinafter referred to as dCas13d).

[0002] In the case of Cas13, which activates non-specific RNA degradation when bound to a DNA sequence complementary to the guide RNA, it showed the performance of specifically degrading only the target RNA in some mammalian cells, but in bacterial cells, it induces a state of cell hibernation by non-specifically degrading intracellular RNAs. Cas13 is classified into Cas13a, Cas13b, Cas13c, and Cas13d according to phylogenetic classification. In the case of dead Cas13a (dCas13a), in which the amino acid sequence related to the non-specific RNA degradation mechanism is substituted with alanine, it was recently confirmed that when it specifically binds to the translation start sequence of mRNA, the expression of the corresponding gene can be repressed at the translational level without degrading other RNAs in the cell.

[0003] dCas13a's utility in metabolic engineering, which requires precise control of gene expression, is limited because the technology to suppress gene expression at various levels in bacteria has not yet been developed. This is because, when attempting to increase the production of a specific substance by suppressing a byproduct production pathway, if the byproduct pathway is related to cell growth, deleting or excessively suppressing the gene can actually impede cell growth and thus reduce the ability to produce the substance.

[0004] Therefore, it is necessary to develop a technology that allows precise control at the translation stage while overcoming the limitations of the CAS protein used in the conventional CRISPR interference system and belonging to the Cas13 group.

[0005] We aimed to devise a new method to overcome the limitations of the CAS protein used in the conventional CRISPR interference system, and constructed a dCas13d-based CRISPR interference system that can bind to messenger RNA (mRNA) and inhibit the translation step, thereby controlling the strength of translation regulation at various levels.

[0006] The present invention provides a target gene expression kit characterized by including a gene encoding a guide RNA of RfxCas13d in which at least one of the nucleotides in the stem, bulge, and flanking sequence regions among the nucleotides constituting the guide RNA of RfxCas13d is replaced with a nucleotide other than the wild type; and a gene encoding a dCas13d protein in which non-specific RNA degradation activity is eliminated.

[0007] Meanwhile, in the target gene expression kit of the present invention, the target gene is preferably one of the genes constituting an operon.

[0008] Meanwhile, in the target gene expression kit of the present invention, it is preferable to control the expression of the target gene by controlling the translation process.

[0009] The present invention establishes a dCas13d-based CRISPR interference system capable of specifically binding to RNA in bacteria, and verifies that the nucleotides in the stem, bulge, and flanking sequence regions of the guide RNA can be replaced with different nucleotides to change the binding efficiency between dCas13d and the guide RNA, thereby widely applicable to controlling the degree of translational repression of mRNA to which dCas13d binds in various target genes. This allows for optimization of the production of target substances without directly replacing promoter and 5'-UTR sequences within the genome, and can also be applied to non-model strains in which direct genome modification is difficult.

[0010] Figure 1 is a schematic diagram showing the RNA secondary structure of the repeat sequence (Direct Repeat; DR) of the guide RNA.

[0011] Figure 2 shows the results of confirming the expression of mCherry using mutant guide RNAs.

[0012] Figure 3 shows the results of confirming the expression of GFP or nanoluciferase using mutant guide RNAs.

[0013] Figure 4 shows the results of confirming the extent to which mutant guide RNA regulates the translation level of the target protein, mCherry, in Vibrio natriegens.

[0014] Figure 5 shows the results of confirming the amount of 3-HP produced by suppressing translation and reducing the expression level of genes in the pathway for producing 3-hydroxypropionic acid (3-HP) by utilizing the dRfxCas13d-based translation control technology of the present invention.

[0015] Figure 6 is a schematic diagram of the dRfxCas13d-based translation control technology of the present invention.

[0016] The present invention provides a target gene expression kit characterized by including a gene encoding a guide RNA of RfxCas13d in which at least one of the nucleotides in the stem, bulge, and flanking sequence regions among the nucleotides constituting the guide RNA of RfxCas13d is replaced with a nucleotide other than the wild type; and a gene encoding a dCas13d protein in which non-specific RNA degradation activity is eliminated.

[0017] In the present invention, various mutant guide RNAs were obtained by replacing at least one nucleotide in the stem, bulge, and flanking sequence regions of the guide RNA of RfxCas13d with a nucleotide other than the wild type. This allows for controlling the binding efficiency between dCas13d and the guide RNA, thereby controlling the degree of translational inhibition of mRNA to which dCas13d binds in various target genes, thereby modulating the expression of target genes.

[0018] Meanwhile, in the present invention, the stem belonging to the structure of the nucleotides constituting the guide RNA refers to a portion forming base pairing, a portion outside the base pairing is referred to as a bulge, and a portion forming a single strand outside the stem can be viewed as a flanking sequence. The above terms are general concepts in the art and can be confirmed in related papers (Mitchell R. O'Connell, "Molecular Mechanisms of RNA Targeting by Cas13-containing Type VI CRISPR-Cas Systems", 2019, Journal of Molecular Biology, Vol. 431, pages 66-87).

[0019] In the target gene expression kit of the present invention, a gene encoding a guide RNA of RfxCas13d in which at least one of the nucleotides in the stem, bulge, and flanking sequence regions among the nucleotides constituting the guide RNA of RfxCas13d is replaced with a nucleotide other than the wild type; and a gene encoding a dCas13d protein in which non-specific RNA degradation activity is eliminated, are preferably each inserted into separate vectors.

[0020] In the present invention, Cas13, which activates non-specific RNA degradation when bound to a target RNA having a sequence complementary to the guide RNA, was selected. It is classified into Cas13a, Cas13b, Cas13c, and Cas13d, but 'Cas13d' was used among them. In the case of the previously known dead Cas13a (dCas13a, in which the amino acid sequence related to the non-specific RNA degradation mechanism is substituted with alanine), there was no technology developed to suppress gene expression at various levels in bacteria, so there was a limitation in its use in the field of metabolic engineering that requires precise control of gene expression, but this was overcome. In other words, when the existing technology aims to increase the production of a specific substance by suppressing the by-product production pathway, if the by-product pathway is related to cell growth, deleting or excessively suppressing the gene actually hinders cell growth and thus inhibits material production ability. However, this limitation was overcome.

[0021] Accordingly, in the present invention, dead RfxCas13d (dRfxCas13d) was used as a dCas13d protein that has eliminated non-specific RNA degradation activity, and the non-specific RNA degradation activity of RfxCas13d (CasRx), a type of Cas13d, has been eliminated. Based on this, a CRISPR interference system can be constructed, thereby enabling Cas13-based gene expression suppression to be implemented at various levels.

[0022] In the present invention, the target gene is a gene to be transcribed or expressed, and is not limited to any gene that needs to be expressed in the host strain from a metabolic engineering perspective.

[0023] Meanwhile, in the method of the present invention, the bacteria is not limited to any type known in the art, but may be, for example, E. coli, a representative Gram-negative bacterium, or Vibrio natriegens, a marine microorganism belonging to the Gram-negative bacterium. In the present invention, it was confirmed that the translation control system described above can precisely control the mRNA translation level not only in E. coli, a representative Gram-negative bacterium, but also in Vibrio natriegens, and thus can be applied to various strains.

[0024] Meanwhile, according to the following experiment, the dRfxCas13d-based CRISPRi system of the present invention was able to control the intensity of expression regulation of various target genes by utilizing various mutant guide RNAs, and this could be implemented not only in E. coli but also in Vibrio natriegens. Furthermore, it could be used to optimize the material flow so as to increase the production of target materials by utilizing it to control the expression level of genes corresponding to intracellular metabolism.

[0025] Thus, the present invention constructs a dCas13d-based CRISPR interference system, and by using this, it is a technology that can control the degree of translation inhibition of mRNA to which dCas13d binds in various target genes by varying the binding efficiency between dCas13d, which can inhibit translation by binding to the translation initiation sequence of mRNA transcribed from a gene, and guide RNA (Fig. 6). Unlike the existing CRISPRi system, this system does not require promoter parts with various transcription intensities to control the intensity of translation inhibition, and thus has the advantage of being easily utilized for diversifying gene expression levels even in non-model strains where the discovery and identification of genetic parts are limited. In addition, since the guide RNA spacer sequence that determines the target RNA sequences is not changed, it has the advantage of being able to change only the intensity of inhibition while maintaining specificity for the mRNA to be inhibited.

[0026] By utilizing this technology, we can contribute to conducting research on quantitatively controlling the translation step in various industrially useful Gram-negative bacteria as well as Gram-negative bacteria, and optimizing the production of high value-added substances.

[0027]

[0028] Hereinafter, the present invention will be described in more detail through the following examples and experimental examples. However, the scope of the present invention is not limited to the following examples and experimental examples, but includes modifications of technical concepts equivalent thereto.

[0029] Tables 1 to 3 below show strains, plasmids, primers, and genetic information used in the examples and experimental examples of the present invention.

[0030] Strain and plasmid used, strain name, related characteristics, source: Mach-T1 RE. coliF- 80(lacZ)ΔM15 ΔlacX74 hsdR(rK-mK+)ΔrecA1398 endA1 tonAInvitrogenEscherichia coliK-12 MG1655 P OXB20 -mCherryE. coliF-lambda-ilvG-rfb-50rph-1P OXB20 -mCherry invention Escherichia coli K-12 MG1655 P J23119 -GFPE. coliF-lambda-ilvG-rfb-50rph-1P J23119 -GFPThis invention Escherichia coli K-12 MG1655 P J23100 -nanoluciferaseE. coliF-lambda-ilvG-rfb-50rph-1P J23100 -nanoluciferaseInventionVibrio natriegensATCC 14048Gram-negative marine bacteriumATCCCEscherichia coliWATCC 9637Acid tolerantE. colistrainATCCplasmidNameRelated featuresSourcepACYCDuetCm R , p15A originNovagenpACYC_TetRtetR,Cm R , p15A origin of the present invention pACYC_TetR-dRfxCas13dtetR, dRfxCas13d, Cm R , p15A origin of the present invention pCDF-J23119-sgRNA-BsaI sgRNA (BsaI site (x2)), Sm R , CloDF13 origin prior research pCDF_J23119-WTDR-BsaI(non-target)RfxcrRNA(WTDR-BsaI site(x2)), Sm R , CloDF13 origin of the present invention pCDF_J23119-WTDR-mCherry spRfxcrRNA (WTDR-mCherry sp), Sm R, CloDF13 origin of the present invention pCDF_J23119-WTDR-GFP spRfxcrRNA (WTDR-GFP sp), Sm R , CloDF13 origin of the present invention pCDF_J23119-WTDR-nluc spRfxcrRNA (WTDR-nluc sp), Sm R , CloDF13 origin of the present invention pCDF_J23119-WTDR-fabI spRfxcrRNA(WTDR-fabI sp), Sm R , CloDF13 origin present invention pSIM5lambda-red recombinase expression vector, Cm R Previous studies pACYC_TetR-dRfxCas13d_TJmT100tetR, dRfxCas13d, P J23100 -mCherry, Cm R , p15A origin Invention pACYC_TetR-dRfxCas13d_TJmT100_DRXYY (XYY=S12, S15, S19, S22, S25, F01)-mCherry sptetR, dRfxCas13d, P J23100 -mCherry, RfxcrRNA(DRXYY-mCherry sp), Cm R , p15A origin of the present invention pCDF_J23119-DRXYY(XYY=S01~S29, F01~F09, B01~B06)-mCherry spRfxcrRNA(DRXYY-mCherry sp), Sm R , CloDF13 origin of the present invention pCDF_J23119-DRXYY (XYY=S12, S14, S15, S16, S17, S19, S25, F01)-GFP spRfxcrRNA (DRXYY-GFP sp), Sm R , CloDF13 origin of the present invention pCDF_J23119-DRXYY(XYY=S12, S14, S15, S16, S17, S19, S25, F01)-nluc spRfxcrRNA(DRXYY-nluc sp), Sm R, CloDF13 origin of the present invention pCDF_J23119-DRXYY (XYY=S10, S12, S15, S19, S22)-fabI spRfxcrRNA (DRXYY-fabI sp), Sm R , CloDF13 origin of the present invention pET_Ptac-mcrmalonyl-CoA reductase, Amp R , pBR322 origin of the present invention

[0031]

[0032] Primer sequences used 1 (listed as partial FR sets) Primer name Sequence Sequence information TetR_BciVI_FTCGTCGTATCCCACTACggaTCCttcattatggtgaaagttggaac Sequence number 1 Ptet_RBS_GA_RgataaagacctcctaattttgaattcttgtcGACttctctatcactgatagggag Sequence number 2 rrnBT1_RBS_Faagaattcaaaattaggaggtctttatcgagctctaaggatctccaggcatc Sequence number 3 rrnBT1_pACYC_GA_RTGCTTCTCAAATGCCTGAGGgagagcgttcaccgacaaac Sequence number 4mCherrysp_BsaI_F / mCherrysp_BsaI_RaaacCCATATAAACCCTCCCTTTTCCGACACTCCT / cttgAGGAGTGTCGGAAAAGGGAGGGTTTATATGGSEQ ID NO: 5 / SEQ ID NO: 6GFPsp_BsaI_F / GFPsp_BsaI_RaaacATGCCATAAATTACCTCCTTAAGATTCCTGA / cttgTCAGGAATCTTAAGGAGGTAATTTATGGCATSEQ ID NO: 7 / SEQ ID NO: 8nlucsp_BsaI_F / nlucsp_BsaI_RaaacCCATTAATACCTCCTCTATCCACTCGCGAAG / cttgCTTCGCGAGTGGATAGAGGAGGTATTAATGGSEQ ID NO: 9 / SEQ ID NO: 10fabIsp_BsaI_F / fabIsp_BsaI_RaaacGAAAACCCATAGCTTTAATCCTT / cttgAAGGATTAAAGCTATGGGTTTTCSEQ ID NO: 11 / SEQ ID NO: 12RfxCas13d_matureRNA_BsaI_F / RfxCas13d_matureRNA_BsaI_RGGAGACCGAGATTGGTCTCGcaagTTTTCCTCAGGCATTTGAGAAGC / gtttcaaaccccgaccagttggtaggggttgctagcattatacctaggactgagcSEQ ID NO: 13 / SEQ ID NO: 14L3S2P21_Bsu36I_FTTTTCCTCAGGCTCGGGACCAAATTCCAGSEQ ID NO:15L3S2P21_AgeI_RGTTTACCGGTggaccaaaacgaaaaaaggcSEQ ID NO: 16mCherrysp_blunt_FCATATAAACCCTCCCTTTTCCGSEQ ID NO: 17GFPsp_blunt_FATGCCATAAATTACCTCCTTAAGATTCSEQ ID NO: 18nlucsp_blunt_FCCATTAATACCTCCTCTATCCACTCSEQ ID NO: 19fabIsp_blunt_FGAAAACCCATAGCTTTAATCCTTSEQ ID NO: 20PJ23119_DRS01_RgtttcaaaTcccgaccagttggtagggAttGCTAGCATTATACCTAGGACTGAGCSEQ ID NO: 21PJ23119_DRS02_RgtttcaaaTTccgaccagttggtaggAAttGCTAGCATTATACCTAGGACTGAGCSEQ ID NO: 22PJ23119_DRS03_RgtttcaaaTTTcgaccagttggtagAAAttGCTAGCATTATACCTAGGACTGAGCSEQ ID NO 23PJ23119_DRS04_RgtttcaaaTTTTgaccagttggtaAAAAttGCTAGCATTATACCTAGGACTGAGCSEQ ID NO 24PJ23119_DRS05_RgtttcaaaccgaccagttggtaggttGCTAGCATTATACCTAGGACTGAGCSEQ ID NO 25PJ23119_DRS06_RgtttcaaacccgaccagttggtagggttGCTAGCATTATACCTAGGACTGAGCSEQ ID NO 26PJ23119_DRS07_RgtttcaaaccccggaccagttggtacggggttGCTAGCATTATACCTAGGACTGAGCSEQ ID NO. 27PJ23119_DRS08_RgtttcaaaccccgggaccagttggtaccggggttGCTAGCATTATACCTAGGACTGAGCSEQ ID NO. 28PJ23119_DRS09_RgtttcaaaccccggggaccagttggtacccggggttGCTAGCATTATACCTAGGACTGAGCSEQ ID NO.29PJ23119_DRS10_RgtttcaaacccTgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC서열번호 30PJ23119_DRS11_RgtttcaaaccTcgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC서열번호 31PJ23119_DRS12_RgtttcaaacTccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC서열번호 32PJ23119_DRS13_RgtttcaaaTcccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC서열번호 33PJ23119_DRS14_RgtttcaaaccTTgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC서열번호 34PJ23119_DRS15_RgtttcaaacTTcgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC서열번호 35PJ23119_DRS16_RgtttcaaaTTccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC서열번호 36PJ23119_DRS17_RgtttcaaacTTTgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC서열번호 37PJ23119_DRS18_RgtttcaaaTTTcgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC서열번호 38PJ23119_DRS19_RgtttcaaaTTccgaccagttggtaggggAtGCTAGCATTATACCTAGGACTGAGC서열번호 39PJ23119_DRS20_RgtttcaaGTTccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC서열번호 40PJ23119_DRS21_RgtttcaaaTcccgaccagttggtaggggAAGCTAGCATTATACCTAGGACTGAGC서열번호 41PJ23119_DRS22_RgtttcaGGTcccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC서열번호42

[0033]

[0034] Used primer sequence 2Primer nameSequenceSequence informationPJ23119_DRS23_RgtttcaaaTTTTgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGCSEQ ID NO: 43PJ23119_DRS24_RgtttcaaacTTTgaccagttggtagggAttGCTAGCATTATACCTAGGACTGAGCSEQ ID NO: 44PJ23119_DRS25_RgtttcaaaTTTcgaccagttggtaAgggttGCTAGCATTATACCTAGGACTGAGCSEQ ID NO: 45PJ23119_DRS26_RgtttcaaaTTTcgaccagttggtaggggAtGCTAGCATTATACCTAGGACTGAGCSEQ ID NO: 46PJ23119_DRS27_RgtttcaaGTTTcgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGCSEQ ID NO 47PJ23119_DRS28_RgtttcaaaTTccgaccagttggtaggggAAGCTAGCATTATACCTAGGACTGAGCSEQ ID NO 48PJ23119_DRS29_RgtttcaGGTTccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGCSEQ ID NO 49PJ23119_DRF01_RgtttcTaaccccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGCSEQ ID NO 50PJ23119_DRF02_RgtttcCaacccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGCSEQ ID NO. 51PJ23119_DRF03_RgtttcGaaccccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGCSEQ ID NO. 52PJ23119_DRF04_RgtttTaaaccccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGCSEQ ID NO. 53PJ23119_DRF05_RgtttAaaaccccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGCSEQ ID NO.54PJ23119_DRF06_RgtttGaaaccccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC서열번호 55PJ23119_DRF07_RgttAcaaaccccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC서열번호 56PJ23119_DRF08_RgttCcaaaccccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC서열번호 57PJ23119_DRF09_RgttGcaaaccccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC서열번호 58PJ23119_DRF10_RgtAtcaaaccccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC서열번호 59PJ23119_DRF11_RgtCtcaaaccccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC서열번호 60PJ23119_DRF12_RgtGtcaaaccccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC서열번호 61PJ23119_DRF13_RgAttcaaaccccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC서열번호 62PJ23119_DRF14_RgCttcaaaccccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC서열번호 63PJ23119_DRF15_RgGttcaaaccccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC서열번호 64PJ23119_DRF16_RTtttcaaaccccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC서열번호 65PJ23119_DRF17_RAtttcaaaccccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC서열번호 66PJ23119_DRF18_RCtttcaaaccccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC서열번호67PJ23119_DRB01_RgtttcaaaccccgaccagttggtTggggttGCTAGCATTATACCTAGGACTGAGCSEQ ID NO. 68PJ23119_DRB02_RgtttcaaaccccgaccagttggtCggggttGCTAGCATTATACCTAGGACTGAGCSEQ ID NO. 69PJ23119_DRB03_RgtttcaaaccccgaccagttggtGggggttGCTAGCATTATACCTAGGACTGAGCSEQ ID NO. 70PJ23119_DRB04_RgtttcaaaccccTaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGCSEQ ID NO. 71PJ23119_DRB05_RgtttcaaaccccAaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGCSEQ ID NO 72PJ23119_DRB06_RgtttcaaaccccCaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGCSEQ ID NO 73TJmT_pACYC_GA_FGGTATCGTCGTATCCCACTACggaTCCTGCCATTGCGTGTGTCGAACSEQ ID NO 74mCherryRBS_J23100_GA_RCGTCTGCtggactatgtACTAGTttgacggctagctcagtcctaggtacagtgctagcAGAAGGAGTGTCGGAAAAGGSEQ ID NO 75TJmT_Pr_GA_FACTAGTacatagtccaGCAGACGSEQ ID NO 76L3S2P21_TJmT_GA_RgaaagtgggtcttaagacgtcAGAATCATATACCCTGGCTCGSEQ ID NO: 77L3S2P21_pACYC_GA_RGGTATCGTCGTATCCCACTACggaTCCggaccaaaacgaaaaaaggcSEQ ID NO: 78UPJ23119_TJmT_GA_FCGGTCACACTGCTTCCGGTAGTctGGTACCgcgcgcctcaaaaagagtaTTGSEQ ID NO:79Ptac_EcoNI_F / mcr_AvrII_Racgctctcccttatgcgactcctgcattaggttgacaattaatcatcggctcg / gttattgctcagcggtggcagcagcctaggTTACACGGTAATCGCCCGTCSEQ ID NO: 80 / SEQ ID NO: 81

[0035]

[0036] Spacer sequences used: mCherry spccatataaaccctcccttttccgacactcctSEQ ID NO: 82 GFP spatgccataaattacctccttaagattcctgaSEQ ID NO: 83 nluc spccattaatacctcctctatccactcgcgaagSEQ ID NO: 84 fabI spgaaaacccatagctttaatccttSEQ ID NO: 85

[0037]

[0038] Gene sequences used: Genetic notes: dRfxCas13d SEQ ID NO: 86mcherry SEQ ID NO: 87GFP SEQ ID NO: 88nanoluciferase SEQ ID NO: 89mcr SEQ ID NO: 90

[0039]

[0040] [Example 1: Production of Guide RNA Variants for Establishing a dCas13d-Based Translational Precision Control CRISPRi System]

[0041] In this example, dead RfxCas13d (dRfxCas13d), which eliminates the non-specific RNA degradation activity of RfxCas13d (CasRx), a type of Cas13d, was utilized.

[0042] First, we attempted to clone the dRfxCas13d sequence downstream of the Ptet promoter to conditionally activate expression of the CRISPR protein only when anhydroustetracycline (aTc) is added. After restriction enzyme treatment of the pACYCDuet plasmid with BciVI and Bsu36I, the tetR-Ptet sequence amplified using the TetR_BciVI_F and Ptet_RBS_GA_R primers and the rrnBT1 terminator sequence amplified using the rrnBT1_RBS_F and rrnBT1_pACYC_GA_R primers were Gibson assembled to construct the pACYC_TetR plasmid. Afterwards, the dRfxCas13d sequence amplified with the RfxCas13d_NTD_GA_F and RfxCas13d_CTD_GA_R primers was cloned into the SacI enzyme site between the Ptet promoter and terminator by Gibson assembly to construct the pACYC_TetR-dRfxCas13d plasmid. In order to express the guide RNA with the J23119 promoter in the plasmid with the CloDF13 replication origin, the pCDF-J23119-sgRNA-BsaI plasmid was amplified with RfxCas13d_matureRNA_BsaI_F and RfxCas13d_matureRNA_BsaI_R, followed by self-ligation, and the L3S2P21 sequence was cloned between the Bsu36I and AgeI enzyme sites for the terminator. The pCDF-J23119-WTDR-BsaI plasmid constructed in this manner was treated with BsaI restriction enzyme, and spacer sequence fragments having identical 4-bp sticky ends at both ends were constructed by PNK treatment and oligo annealing to clone various spacer sequences.Based on the pCDF_J23119-WTDR-mCherry sp plasmid, in which a spacer that binds to the 5'-untranslated region (UTR) sequence of mCherry mRNA was cloned, a guide RNA with mutations in the direct repeat (DR) sequence of the guide RNA, which is the binding site of the guide RNA and dCas13d, was constructed. The RNA secondary structure of the DR can be divided into three structures: the stem, the bulge, and the flanking sequence, as shown in Fig. 1. In the case of the stem, mutations were applied that changed only the sequence while maintaining the structure or changed the secondary structure itself. All applicable mutation sequences were applied to both bulge sequences and the flanking sequence.

[0043] The plasmid in which the original guide RNA was cloned was PCR amplified using a pair of primers that bind to the J23119 sequence and have a mutant DR sequence and a primer that binds to the spacer sequence of the guide RNA, and this was blunt-end ligated. All the plasmids of the present invention are Mach-T1. R The strain was cloned and cultured at 37°C with the addition of appropriate concentrations of antibiotics (Spectinomycin (Spec) 50 ug / mL, Chloramphenicol (Cm) 34 ug / mL). Plasmid extraction was performed using the GeneAll Exprep™ Plasmid SV, mini kit after culturing the colonies overnight for more than 12 hours. The mCherry protein, which is the translational repression target, was P OXB20 It was constitutively expressed downstream of the promoter, and the expression cassette was inserted into the nupG gene site of the Escherichia coli K-12 MG1655 strain using the pSIM5 plasmid-based lambda-red recombinase system.

[0044]

[0045] [Experimental Example 1: Diversification of Target Gene Expression Control Levels and Modularity Verification]

[0046] In this experimental example, the amount of mCherry fluorescent protein expression when a guide RNA having a spacer sequence that does not bind to a separate mRNA was expressed was set to 100 (%), and from this value, the relative value of the fluorescence expression amount when the translation of mCherry mRNA was controlled using the mutant guide RNAs produced in Example 1 was obtained. The strain transformed with the pACYC_TetR-dRfxCas13d plasmid and the pCDF plasmid expressing the mutant guide RNA was cultured overnight in LB medium supplemented with Spec and Cm, and then diluted at a ratio of 1 / 100 and 100 ng / mL of aTc was added to express dRfxCas13d. After 8 hours, the mCherry fluorescence value of the liquid medium was measured using a HIDEX Sense plate reader.

[0047] As a result, as shown in Table 6 and Fig. 2, when using non-mutated guide RNA, the expression level was significantly reduced to 3.5% compared to the non-suppressed control group, whereas when using the manufactured mutant guide RNAs, the expression of mCherry, a translation control target gene, was implemented at various levels, from 2.6% to 86.3% compared to the non-suppressed control group. Based on these results, we selected mutant repeat sequences with different expression suppression strengths and tried to verify whether the expression of other genes in addition to mCherry could also be controlled at various levels.

[0048]

[0049]

[0050] The fluorescent protein GFP and the luminescent protein nanoluciferase selected as targets were inserted into the chromosome of the E. coli K-12 MG1655 strain using the pSIM5 plasmid, similar to mCherry. For the luminescence assay, the Nano-Glo® Luciferase Assay System was used for nanoluciferase, and the fluorescence of GFP and the luminescence of nanoluciferase were measured using a HIDEX Sense plate reader. The expression of GFP and nanoluciferase was suppressed by using guide RNAs combined with the spacer sequence that binds to the 5'-UTR of GFP or nanoluciferase mRNA and the original and selected mutant repeat sequences. As a result, the translational levels of GFP and nanoluciferase were confirmed to vary, as shown in Fig. 3, and the results showed that the expression suppression intensity was similar to that of mCherry in the guide RNAs applied with each mutant repeat sequence.

[0051] From this, it was verified that the mutant guide RNAs obtained in the present invention can be widely used to control the expression control strength of various target genes.

[0052]

[0053] [Experimental Example 2: Precise Control of mRNA Translation Levels in Vibrio natriegens]

[0054] In this experimental example, we attempted to verify whether the translation level precision control technology based on the mutant repeat sequences selected in Experimental Example 1 above can be applied not only to Escherichia coli, a Gram-negative bacteria model strain, but also to Vibrio natriegens, a Gram-negative bacteria growing in a high-salt environment.

[0055] To this end, we attempted to additionally clone the target protein mCherry and mutant guide RNA sequences that can suppress its expression based on the pACYC_TetR-dRfxCas13d plasmid. First, P was obtained by amplifying TJmT_pACYC_GA_F and mCherryRBS_J23100_GA_R between the AatII and BamHI restriction enzyme recognition sequences below tetR in the pACYC_TetR-dRfxCas13d plasmid. J23100 - The mCherry sequence and the L3S2P21 terminator sequence amplified with TJmT_Pr_GA_F and L3S2P21_TJmT_GA_R were assembled by Gibson. The PCR products amplified with the L3S2P21_pACYC_GA_R and UPJ23119_TJmT_GA_F primers from each mutant guide RNA plasmid were assembled by Gibson to finally construct the pACYC_TetR-dRfxCas13d_TJmT100_DRXYY-mCherry sp plasmid. These plasmids were transformed into Vibrio natriegens, and the selected colonies were cultured overnight in LB medium (CLBv2) supplemented with 204 mM NaCl, 4.2 mM KCl, 23.14 mM MgCl2, and 34 µg / mL chloramphenicol. Then, the resulting colonies were diluted 1 / 100-fold and 100 ng / mL aTc was added to express dRfxCas13d. After 16 hours, fluorescence was measured, and the relative fluorescence values ​​of the strains expressing mutant guide RNAs that bind to mCherry mRNA were obtained compared to the non-suppressed control group.

[0056] As a result, similar to the expression regulation intensity observed in Escherichia coli, as shown in Figure 4, we were able to confirm that each mutant guide RNA varied in the translation level of the target protein, mCherry, in Vibrio natriegens. This suggests that the CRISPRi system for precise translation control developed through the present invention has the potential to be widely utilized in other non-model strains.

[0057]

[0058] [Experimental Example 3: Optimization of Intracellular Material Flow in Bacterial Cells for High-Efficiency 3-Hydroxypropionic Acid Production]

[0059] In this experimental example, the dRfxCas13d-based translation step control technology developed in the present invention was utilized to control the expression level of genes responsible for intracellular metabolism, thereby optimizing material flow to increase the production of target substances. As an example, the pathway for producing 3-hydroxypropionic acid (3-HP) by expressing the malonyl-CoA reductase (mcr) enzyme was utilized.

[0060] At this time, malonyl-CoA used as a precursor is also used as a precursor in the fatty acid synthesis pathway, so inhibiting fatty acid synthesis can increase the production of 3-HP, but there is a limitation that the growth of the strain is inhibited. Therefore, in this experiment, we tried to suppress the expression level of the fabI gene responsible for the fatty acid synthesis pathway to various levels using mutant guide RNA. The mcr gene used a N940V / K1106W / S1114R mutant gene with improved function, and a cassette that is expressed when Isopropyl β-D-1-thiogalactopyranoside (IPTG) is added under the Ptac promoter was amplified with the primers Ptac_EcoNI_F and mcr_AvrII_R and cloned by ligation into pETDuet treated with EcoNI and AvrII restriction enzymes. The pET_Ptac-mcr plasmid, pACYC_TetR-dRfxCas13d, and pCDF_J23119-DRXYY-fabI sp plasmid that regulates the expression of the fabI gene obtained in this way were transformed into the acid-tolerant strain Escherichia coliW ATCC 9637. All three plasmids were transformed E. The coliW strain was cultured overnight in Modified M9 medium (Glucose 8 g / L, NaCl 2.0 g / L, NH4Cl 2.0 g / L, K2HPO4 10.7 g / L, KH2PO4 5.2 g / L, MgSO4·7H2O 0.5 g / L, Yeast extract 1 g / L), diluted 1 / 100, and aTc 100 ng / ml was added to express dRfxCas13d. After 2 hours, 20 μM IPTG was additionally added to express the mcr gene. After 24 hours, 800 μL of the medium was obtained, centrifuged at 14,000 rpm for 10 minutes, and the supernatant was separated and used to measure 3-HP production.3-HP analysis was performed on an Agilent 1260 Infinity II LC system, using a Hi-Plex-H column with 5 mM sulfuric acid as the mobile phase, a flow rate of 0.6 ml / min, and a temperature of 40°C to separate and quantify the product. As a result of measuring the cell growth and 3-HP production of the strains harboring each mutant guide RNA, as shown in Fig. 5, when a guide RNA with a weaker translation inhibition strength than the existing guide RNA was used, the growth of the strain was somewhat restored as expected, and accordingly, 3-HP production also increased, ultimately showing a 14.2-fold increase compared to the non-inhibited strain.

[0061] These results suggest that the precise translation control technology devised in the present invention can be utilized to optimize the production of high value-added materials based on cell factories by regulating intracellular metabolic flow to an optimal level.

Claims

1. A gene encoding a guide RNA of RfxCas13d in which at least one nucleotide in the stem, bulge, and flanking sequence regions among the nucleotides constituting the guide RNA of RfxCas13d is replaced with a nucleotide other than the wild type; and A target gene expression kit comprising a gene encoding a dCas13d protein with non-specific RNA degradation activity eliminated.

2. In paragraph 1, The above target gene is, A target gene expression kit characterized by being one of the genes constituting an operon.

3. In paragraph 1, The above target gene expression is, A target gene expression kit characterized by regulating the expression of a target gene by controlling the translation process.

Images