Composition for detecting staphylococcus epidermidis cicaria strain, and use thereof

Abstract

A composition and a primer set for detecting a Staphylococcus epidermidis CICARIA strain, and a detection method using same are provided. The composition can quickly and accurately detect or discriminate a Staphylococcus epidermidis CICARIA strain with high detection specificity at the strain or species level.

Description

Composition for detecting Staphylococcus epidermidis CICARIA strain and use thereof

[0001] The present invention relates to a composition for identifying microorganisms at a specific strain level and to a use thereof.

[0002] The skin is the largest organ in the human body, directly exposed to the external environment. Its key function is to protect the body from external irritants and prevent moisture loss. Along with other bodily organs such as the intestines, the skin is home to a diverse array of microorganisms, including bacteria, fungi, small larvae, and viruses, all of which maintain specialized functions. These microorganisms and their entire genetic information (genome) are collectively referred to as the skin microbiome.

[0003] Skin microbiome research has become possible with the development of next-generation sequencing (NGS) analysis methods. Specifically, utilizing 16S rRNA gene primers allows for cataloging and processing the bacterial composition of the microbiome.

[0004] While these 16S rRNA gene-based NGS assays offer the advantage of detecting all microorganisms in a given environment, they currently require at least a week of analysis and have limitations in that the 16S rRNA gene alone cannot detect specific strains. Furthermore, using NGS to detect specific strains is expensive.

[0005] (Patent Document 1) KR 10-2305609 B1

[0006] The present disclosure relates to a molecular marker based on Whole Genome Sequence (WGS) data that can identify Staphylococcus epidermidis CICARIA strains at the strain or species level. Using the molecular marker, the Staphylococcus epidermidis CICARIA strain can be identified relatively quickly and accurately through a nucleic acid amplification reaction such as polymerase chain reaction (PCR).

[0007] One aspect is to provide a composition for detecting a Staphylococcus epidermidis CICARIA strain deposited under accession number KCCM12559P, which comprises an agent capable of specifically detecting a polynucleotide consisting of a sequence from position 3487 to position 3608 of SEQ ID NO: 1 or a complementary polynucleotide thereof.

[0008] Another aspect is to provide a primer set for the detection of Staphylococcus epidermidis CICARIA strain deposited under accession number KCCM12559P, comprising a forward primer represented by sequence number 2 and a reverse primer represented by sequence number 3.

[0009] Another aspect is to provide a kit for detecting Staphylococcus epidermidis CICARIA strain deposited under accession number KCCM12559P, comprising a composition according to one aspect.

[0010] Another aspect provides a method for detecting a Staphylococcus epidermidis CICARIA strain deposited under accession number KCCM12559P using a composition, primer set, or kit according to one aspect.

[0011] One aspect provides a composition for detecting a Staphylococcus epidermidis CICARIA strain deposited under accession number KCCM12559P, comprising an agent capable of specifically detecting a polynucleotide consisting of a sequence from position 3487 to position 3608 of SEQ ID NO: 1 or a complementary polynucleotide thereof.

[0012] The Staphylococcus epidermidis CICARIA strain deposited under the above accession number KCCM12559P is known in Korean Patent Registration No. 10-2305609.

[0013] The above sequence number 1 may be the complete sequence of the plasmid DNA of the Staphylococcus epidermidis CICARIA strain deposited under accession number KCCM12559P.

[0014] The polynucleotide comprising the sequence from position 3487 to position 3608 of the above sequence number 1 or a complementary polynucleotide thereof may be a partial sequence of plasmid DNA of the Staphylococcus epidermidis CICARIA strain.

[0015] The polynucleotide consisting of the sequence from positions 3487 to 3608 of the above sequence number 1 or a complementary polynucleotide thereof may be a whole genome sequencing (WGS)-based molecular marker capable of identifying the Staphylococcus epidermidis CICARIA strain at the strain or species level. The "molecular marker" refers to a molecule having a characteristic that can confirm the presence or state of a certain living organism or substance. For example, a specific DNA base sequence can be used as a molecular marker capable of determining the presence or absence of a specific strain. When the sequence from positions 3487 to 3608 of the above sequence number 1 or a complementary sequence thereof is present in the nucleic acid sequence of the microorganism to be analyzed, the microorganism can be identified as the Staphylococcus epidermidis CICARIA strain.

[0016] In addition, since the polynucleotide comprising the sequence at positions 3487 to 3608 of the above sequence number 1 or its complementary polynucleotide is a whole-genome (WGS)-based molecular marker, its detection specificity is significantly superior to that of the existing 16S rRNA gene-based NGS analysis method that cannot detect a specific strain. Therefore, by utilizing the above molecular marker, it is possible to distinguish the Staphylococcus epidermidis CICARIA strain from microorganisms belonging to closely related strains or closely related species that cannot be distinguished by general physiological or chemical differences.

[0017] In addition, by using an agent capable of specifically detecting a polynucleotide consisting of a sequence at positions 3487 to 3608 of the above sequence number 1 or a complementary polynucleotide thereof, a specific strain can be identified only by detecting a molecular marker of a relatively short length (e.g., 122 bp), and thus time and cost can be significantly reduced compared to the existing NGS analysis method that identifies a 16S rRNA gene of several hundred to several thousand bp in length.

[0018] Accordingly, a formulation capable of specifically detecting a polynucleotide consisting of a sequence from positions 3487 to 3608 of SEQ ID NO: 1 or a complementary polynucleotide thereof may be a formulation capable of detecting or identifying a Staphylococcus epidermidis CICARIA strain. The formulation may specifically detect only the Staphylococcus epidermidis CICARIA strain, distinguishing it from microorganisms with different detailed lineages. Therefore, a composition according to the above aspect may be a composition for identifying the Staphylococcus epidermidis CICARIA strain deposited under accession number KCCM12559P.

[0019] The above formulation is not limited in type as long as it is a substance capable of specifically binding to the polynucleotide or its complementary polynucleotide. The formulation may be, but is not limited to, a primer or probe that specifically binds to the polynucleotide or its complementary polynucleotide.

[0020] The above "primer" is a short single-stranded oligonucleotide that serves as a starting point for the production of another polymer strand complementary to the template during DNA synthesis. The primer used in the nucleic acid amplification reaction may include a primer set consisting of a forward primer and a reverse primer. The length of the primer may be, but is not limited to, 15 to 40 nt, 15 to 30 nt, 15 to 25 nt, 18 to 40 nt, 18 to 30 nt, or 18 to 25 nt.

[0021] When a nucleic acid amplification reaction is performed using a primer that specifically binds to a polynucleotide consisting of a sequence from positions 3487 to 3608 of sequence number 1 or a complementary polynucleotide thereof, a Staphylococcus epidermidis CICARIA strain can be specifically identified based on whether or not an amplification product is detected.

[0022] In one specific example, the primer may be a primer set consisting of a forward primer represented by SEQ ID NO: 2 and a reverse primer represented by SEQ ID NO: 3.

[0023] The above "probe" refers to a DNA or RNA fragment complementary to a specific base sequence of DNA or RNA, and is labeled with a radioactive element, dye, fluorescent substance, etc., so that the presence or absence of a specific base sequence can be confirmed. The length of the probe may be 10 to 1000 bp, 10 to 200 bp, or 10 to 100 bp, but is not limited thereto.

[0024] When hybridization is performed using a probe that specifically binds to a polynucleotide consisting of a sequence from position 3487 to position 3608 of sequence number 1 or a complementary polynucleotide thereof, the Staphylococcus epidermidis CICARIA strain can be specifically identified through hybridization.

[0025] In one specific example, the probe may be an oligonucleotide consisting of a sequence of at least 10, at least 20, at least 30, at least 40, at least 50, or at least 100 consecutive nucleotides complementary to a part or all of a polynucleotide consisting of a sequence from position 3487 to position 3608 of SEQ ID NO: 1 or a complementary polynucleotide thereof.

[0026] In one specific example, the probe may be an oligonucleotide consisting of a nucleotide sequence of 122 nt in length complementary to a polynucleotide consisting of a sequence from position 3487 to position 3608 of SEQ ID NO: 1 or a complementary polynucleotide thereof.

[0027] The above primer or probe can be chemically synthesized using a known method. The primer or probe may additionally include one or more labels selected from a radioactive element, a chromophore, a chemiluminescent phosphor, a fluorophore, and a magnetic particle linked to the 5'-end or 3'-end.

[0028] The above "label" or "detectable label" may refer to any chemical moiety bound to a nucleotide or a nucleotide polymer, wherein the binding may be a covalent bond or a non-covalent bond. The detectable labels are known in the art. Non-limiting examples of the detectable labels include, 32 P or 35 Radioactive elements such as S; linker molecules such as biotin, avidin, streptavidin, horseradish peroxidase (HRP), protein A, protein G, antibodies or fragments thereof, FLAG tags, and myc tags; enzymes such as peroxidase and luciferase; electron donors and acceptors; dyes such as Cy5 and Cy3; and magnetic particles (MPs) such as iron oxide nanoparticles and gold nanoparticles.

[0029] Another aspect provides a primer set for the detection of Staphylococcus epidermidis CICARIA strain deposited under accession number KCCM12559P, comprising a forward primer represented by sequence number 2 and a reverse primer represented by sequence number 3.

[0030] The forward primer represented by the above sequence number 2 has a length of 23 bp, a Tm (melting temperature) of about 60°C, and a GC% of about 43%.

[0031] The reverse primer represented by the above sequence number 3 is 22 bp in length, has a Tm of about 60°C, and a GC% of about 50%.

[0032] When a nucleic acid amplification reaction is performed using the above primer set, an amplification product of 122 bp in size can be detected only when the Staphylococcus epidermidis CICARIA strain is present.

[0033] In one embodiment, when PCR was performed using the primer sets of SEQ ID NO: 2 and SEQ ID NO: 3, it was confirmed that, under one condition having the same annealing temperature and time, no PCR products were synthesized for 74 strains of Staphylococcus caprae, 24 strains of Staphylococcus capitissubsp.Capitis, and Staphylococcus capitissubsp.Urealyticus SH2 strains belonging to the same genus, and that a PCR product was synthesized only for the Staphylococcus epidermidis CICARIA strain. Through this, it was confirmed that only the Staphylococcus epidermidis CICARIA strain could be specifically and clearly detected and distinguished at the species level even if strains of the same genus were present in the sample.

[0034] In one embodiment, when PCR was performed using the primer sets of SEQ ID NO: 2 and SEQ ID NO: 3, it was confirmed that under one condition with the same annealing temperature and time, no PCR products were synthesized for Staphylococcus epidermidis KACC13234 strain and Staphylococcus epidermidis KCTC1917 strain belonging to the same species, and that a PCR product was synthesized only for the Staphylococcus epidermidis CICARIA strain. Through this, it was found that even if strains of the same species are present in a sample, only the Staphylococcus epidermidis CICARIA strain can be specifically and clearly detected and identified at the strain level.

[0035] Another aspect provides a kit for detecting Staphylococcus epidermidis CICARIA strain deposited under accession number KCCM12559P, comprising a composition according to one aspect.

[0036] The above kit may additionally include reagents required for nucleic acid amplification reaction.

[0037] The nucleic acid amplification reaction described above may be performed using any nucleic acid amplification technology known in the art without limitation. The nucleic acid amplification reaction may be, for example, PCR (polymerase chain reaction). The PCR may include, but is not limited to, real-time PCR, RT-PCR (Reverse Transcriptase Polymerase Chain Reaction), qRT-PCR (quantitative Real-Time Polymerase Chain Reaction), etc. Accordingly, the kit described above may be a PCR kit.

[0038] Reagents required for the above nucleic acid amplification reaction may include DNA polymerase, dNTP, buffer solution, etc.

[0039] The above kit may additionally include a user guide describing optimal reaction performance conditions.

[0040] Another aspect provides a method for detecting a Staphylococcus epidermidis CICARIA strain deposited under accession number KCCM12559P using a composition, primer set, or kit according to one aspect.

[0041] The above detection may be performed by one or more methods selected from, but not limited to, PCR analysis, DNA sequencing, hybridization by microarray, DAF (DNA Amplification Fingerprinting), Northern blot, and Southern blot.

[0042] In one embodiment, the method comprises the steps of isolating nucleic acids from a sample;

[0043] A step of performing a nucleic acid amplification reaction using the above nucleic acid as a template and a primer set according to one aspect; and

[0044] It may include a step of detecting an amplification product generated by the above nucleic acid amplification reaction.

[0045] The above sample may be a strain to be analyzed or a material expected to contain the strain.

[0046] The nucleic acid may be DNA or RNA. The nucleic acid may be plasmid DNA (pDNA), genomic DNA (gDNA), or a mixture of plasmid DNA and genomic DNA. The genomic DNA is chromosomal DNA, and the plasmid DNA is extrachromosomal DNA. In one specific embodiment, the nucleic acid may be plasmid DNA. In another specific embodiment, the nucleic acid may be a mixture of plasmid DNA and genomic DNA.

[0047] In one embodiment, when PCR was performed using the total DNA (including plasmid DNA and genomic DNA) of the Staphylococcus epidermidis CICARIA strain and each of the closely related microorganisms as templates and the primer sets of SEQ ID NO: 2 and SEQ ID NO: 3, it was confirmed that a PCR product was synthesized only in the CICARIA strain. This shows that even when a mixture of plasmid DNA and genomic DNA is used as a template, only the Staphylococcus epidermidis CICARIA strain can be specifically detected and identified.

[0048] Methods for isolating nucleic acids from the sample may utilize methods known in the art. Methods for isolating nucleic acids from the sample may utilize known methods for isolating DNA. Methods for isolating nucleic acids from the sample may utilize known methods for isolating plasmid DNA. Non-limiting examples of methods for isolating plasmid DNA include alkaline lysis.

[0049] The nucleic acid amplification reaction described above can be used without limitation as long as it is a nucleic acid amplification technique known in the art. The nucleic acid amplification reaction may be, for example, PCR. The PCR may include, but is not limited to, real-time PCR, RT-PCR, qRT-PCR, etc.

[0050] The annealing temperature of the nucleic acid amplification reaction may be 63 to 70°C, 63 to 69°C, 63 to 68°C, 65 to 70°C, 65 to 69°C, 65 to 68°C, 66 to 70°C, 66 to 69°C, 66 to 68°C, or about 67°C.

[0051] Detection of the above amplification product can be performed through, but is not limited to, DNA chips, gel electrophoresis, radiometric measurement, fluorescence measurement, phosphorescence measurement, magnetic field measurement, etc.

[0052] In the above detection step, if an amplification product of 122 bp in length is detected, it may be determined that the sample is the Staphylococcus epidermidis CICARIA strain deposited under accession number KCCM12559P, or it may be determined that the strain is present in the sample.

[0053] Therefore, the above method may be a method for identifying the Staphylococcus epidermidis CICARIA strain deposited under accession number KCCM12559P.

[0054] Duplicate content is omitted in consideration of the complexity of this specification, and terms not otherwise defined herein have the meanings commonly used in the technical field to which the present invention belongs.

[0055] The composition according to the aspect utilizes whole genome sequencing (WGS)-based molecular markers, so that Staphylococcus epidermidis CICARIA strains can be rapidly and accurately detected or identified with high detection specificity at the strain or species level.

[0056] Figure 1 shows the results of confirming the selected Staphylococcus epidermidis CICARIA detection primer pair using NCBI Primer Blast.

[0057] Figure 2 is an electrophoresis result confirming that the primer pair for detecting Staphylococcus epidermidis CICARIA can specifically detect only the target microorganism.

[0058] The following examples are provided for more detailed description. However, these examples are provided solely to illustrate one or more specific examples, and the scope of the present invention is not limited to these examples.

[0059] Example 1: Preparation of primer

[0060] Primers capable of specifically detecting Staphylococcus epidermidis CICARIA strain (accession number: KCCM12559P) were developed.

[0061] First, whole-genome sequences of microorganisms belonging to closely related strains or species that cannot be distinguished by general physiological or chemical differences were collected from the National Center for Biotechnology Information (NCBI). The target strains and comparison strains are shown in Table 1.

[0062] Genus Species Strain Target strain Staphylococcus epidermidis CICARIA Comparison strain 1 Staphylococcus epidermidis KACC13234 Comparison strain 2 Staphylococcus epidermidis KCTC1917 Comparison strain 3 Staphylococcus caprae 74 Comparison strain 4 Staphylococcus capitis subsp. capitis 24 Comparison strain 5 Staphylococcus capitis subsp. urealyticus SH2

[0063] After fragmenting the whole genome information of the strains in Table 1 into 10-500 bp units, the fragmented sequences were numbered using Linux commands. Furthermore, sequence information was collected for the remaining regions after excluding regions with identical sequences using NCBI's Nucleotide Blast. Subsequently, candidate primers were designed using primer design systems such as NCBI Primer Blast among regions containing rare sequences.

[0064] Example 2: In-silico PCR of candidate primers

[0065] Prior to producing the primers selected as candidates in Example 1, theoretical primer validation was performed through in-silico PCR using a server. The results of confirming the final selected primer pairs using NCBI Primer Blast are shown in Figure 1.

[0066] As a result, as shown in Fig. 1, the final selected primer pair can specifically detect a 122 bp long sequence from position 3487 to position 3608 of the full-length sequence (SEQ ID NO: 1) of the plasmid DNA of the Staphylococcus epidermidis CICARIA strain.

[0067] Example 3: Primer verification PCR performed at optimal temperature

[0068] For the primers finally selected in Example 2, a primer validation experiment was conducted via PCR at the optimal temperature using total DNA, including gDNA (genomic DNA) and pDNA (plasmid DNA), of the target and comparison strains as templates. The sequences of the primer pairs are shown in Table 2 below.

[0069] Target strain direction sequence (5'->3') sequence number annealing temperature Staphylococcus epidermidis CICARIA forward AATAGCCAAGCATCAAATGCCAG267℃ reverse GGAATTATGTCCCAGGCCCTTT3

[0070] Example 4: Confirmation of specific reaction of primers

[0071] Experiments were conducted to confirm that the final selected primers specifically bind only to the target strain.

[0072] Specifically, PCR was performed using the corresponding primer pairs for total DNA of Staphylococcus epidermidis CICARIA, Staphylococcus epidermidis KACC13234, Staphylococcus epidermidis KCTC1917, Staphylococcus caprae 74, Staphylococcus capitis subsp. capitis 24, and Staphylococcus capitis subsp. urealyticus SH2; DNA of environmental samples; and a negative control. Total DNA of soil was used as the environmental sample DNA. Sterile distilled water (SDW) was used as the negative control. The electrophoresis results of the PCR products are shown in Fig. 2.

[0073] As a result, as shown in Fig. 2, a 122 bp DNA band was confirmed only in the PCR product using Staphylococcus epidermidis CICARIA as a sample.

[0074] The optimal PCR amplification conditions for detecting Staphylococcus epidermidis CICARIA strains are shown in Table 3 below.

[0075] Temperature Time Cycle Pre-denaturation 95℃ 3 minutes 1 cycle Denaturation 95℃ 30 seconds 30 cycles Annealing 67℃ 30 seconds Extension 72℃ 30 seconds Final Extension 72℃ 3 minutes 1 cycle Hold 4℃--

Claims

1. A composition for detecting a Staphylococcus epidermidis CICARIA strain deposited under accession number KCCM12559P, comprising an agent capable of specifically detecting a polynucleotide consisting of a sequence from positions 3487 to 3608 of SEQ ID NO: 1 or a complementary polynucleotide thereof.

2. A composition according to claim 1, wherein the polynucleotide or its complementary polynucleotide is a partial sequence of plasmid DNA of the Staphylococcus epidermidis CICARIA strain.

3. A composition according to claim 1, wherein the agent is a primer or probe that specifically binds to the polynucleotide or its complementary polynucleotide.

4. A composition according to claim 3, wherein the primer is a primer set comprising a forward primer represented by sequence number 2 and a reverse primer represented by sequence number 3.

5. A primer set for detecting the Staphylococcus epidermidis CICARIA strain deposited under accession number KCCM12559P, comprising a forward primer represented by sequence number 2 and a reverse primer represented by sequence number 3.

6. A kit for detecting a Staphylococcus epidermidis CICARIA strain deposited under accession number KCCM12559P, comprising the composition of claim 1.

7. A kit according to claim 6, further comprising a reagent necessary for a nucleic acid amplification reaction.

8. Step of isolating nucleic acid from the sample; A step of performing a nucleic acid amplification reaction using the above nucleic acid as a template and the primer set of claim 5; and Comprising a step of detecting an amplification product generated by the nucleic acid amplification reaction, A method for detecting a Staphylococcus epidermidis CICARIA strain deposited under accession number KCCM12559P.

9. A method according to claim 8, wherein the nucleic acid is plasmid DNA; or a mixture of plasmid DNA and genomic DNA.

10. A method according to claim 8, wherein, when an amplification product having a length of 122 bp is detected, the sample is determined to be the Staphylococcus epidermidis CICARIA strain deposited under accession number KCCM12559P, or the strain is determined to be present in the sample.

Images