Compositions and methods for modulating protein interactions

Abstract

Described herein are compositions of recombinant polynucleic acid constructs comprising at least one nucleic acid sequence encoding a peptide that can bind to a target protein and modulate binding of the target protein to a binding partner. Also described herein is use of the compositions in modulating formation of an interactome comprising a complex comprising a target protein and a binding partner.

Description

WSGR Docket No.: 57623-713.601 COMPOSITIONS AND METHODS FOR MODULATING PROTEIN INTERACTIONS CROSS REFERENCE

[0001] This application claims the benefit of U.S. Application No. 63 / 598,304, filed onNovember 13, 2023, which is incorporated herein by reference in its entirety. BACKGROUND

[0002] Protein-protein interactions provide structural and functional basis for many cellularprocesses. It is estimated that there are about 130,000 – 650,000 protein-protein interactions in human interactome. Numerous human diseases and disorders are caused by or associated with changes in protein-protein interactions or abnormal protein-protein interactions. Therefore, protein-protein interactions can be an important and attractive target and modulating protein- protein interactions can be a promising therapeutic approach. One challenge of developing therapeutics around protein-protein interactions (e.g., protein-protein interaction modulators) is that protein-protein interactions are generally regarded as “undruggable” at least in part due to large and flat interface of proteins involved in protein-protein interactions and lack of binding pockets. Therefore, small molecules, which require a well-defined binding site on a target that they can interact with are not considered good therapeutic candidates to modulate protein- protein interactions. In addition, synthetic peptides, due to their limited size (<100 amino acid) and / or lack of secondary structure, may not considered as good therapeutic candidates as protein-protein interaction modulators. Accordingly, there is a need for developing a protein- protein interaction modulator that can specifically bind to a target protein and modulate the protein-protein interaction. SUMMARY

[0003] Described herein are methods and compositions for modulating an interaction of two ormore proteins using at least one peptide that binds to a target protein. In some embodiments, a peptide can be introduced from recombinant polynucleic acid or RNA constructs comprising at least one nucleic acid sequence encoding a peptide. Also described herein are methods and compositions that are useful for treating a disease or a disorder by modulating an interaction of two or more proteins associated with the disease or the disorder.

[0004] In some aspects, provided herein is a pharmaceutical composition comprising (i) at leastone recombinant polynucleic acid construct comprising a nucleic acid sequence encoding a peptide and (ii) a pharmaceutically acceptable excipient or carrier; wherein the peptide binds to a target protein and modulates binding of the target protein to a binding partner, therebyWSGR Docket No.: 57623-713.601 modulating formation of an interactome, the interactome comprising a complex comprising the target protein and the binding partner.

[0005] In some aspects, provided herein is a composition comprising at least one recombinantpolynucleic acid construct comprising a nucleic acid sequence encoding a peptide; wherein the peptide binds to a target protein and modulates binding of the target protein to a binding partner, thereby modulating formation of an interactome, the interactome comprising a complex comprising the target protein and the binding partner.

[0006] In some aspects, provided herein is a composition comprising a recombinant polynucleicacid construct comprising a nucleic acid sequence encoding a peptide; wherein the peptide is at least about 70 amino acid residues, wherein the peptide binds to KRAS, wherein the binding of the peptide to KRAS inhibits an interaction between CRAF and KRAS.

[0007] In some aspects, provided herein is a composition comprising a recombinant polynucleicacid construct comprising a nucleic acid sequence encoding a peptide; wherein the peptide comprises at least about 10 amino acid residues, wherein the peptide binds to MDM2, wherein the binding of the peptide to MDM2 inhibits an interaction between p53 and MDM2.

[0008] In some aspects, provided herein is a composition comprising a recombinant polynucleicacid construct comprising (i) a nucleic acid sequence encoding a peptide; wherein the peptide comprises at least about 10 amino acid residues, wherein the peptide binds to MDM2, MDM4, or both, and wherein the binding of the peptide to MDM2, MDM4, or both inhibits an interaction between p53 and MDM2, MDM4, or both, and (ii) at least one nucleic acid sequence encoding a small interfering RNA (siRNA) capable of binding to a target RNA that encodes MDM2, MDM4, or a combination thereof.

[0009] In some aspects, provided herein is a composition comprising a recombinant polynucleicacid construct comprising a nucleic acid sequence encoding a peptide; wherein the peptide comprises at least about 300 amino acid residues, wherein the peptide binds to ubiquitin, an E3 ubiquitin ligase, Rad18, a recombinase, an ATPase, Rad51, or a combination thereof, and wherein the binding of the peptide to ubiquitin, an E3 ubiquitin ligase, Rad18, a recombinase, an ATPase, Rad51, or a combination thereof inhibits (i) an interaction between FANCD2 and ubiquitin, an E3 ubiquitin ligase, Rad18, a recombinase, an ATPase, Rad51, or a combination thereof, (ii) ubiquitination of FANCD2, (iii) or both (i) and (ii).

[0010] In some aspects, provided herein is a composition comprising a recombinant polynucleicacid construct comprising a nucleic acid sequence encoding a peptide; wherein the peptidecompri -Catenin, and-Catenin inhibits an interaction between BCL9L, TCF4, -Catenin.WSGR Docket No.: 57623-713.601

[0011] In some aspects, provided herein is a composition comprising a recombinant polynucleicacid construct comprising a nucleic acid sequence encoding a peptide; wherein the peptide comprises at least about 150 amino acid residues, wherein the peptide binds to BCL9L, TCF4, or both, and wherein the binding of the peptide to BCL9L, TCF4, or both inhibits an interaction -Catenin.

[0012] In some aspects, provided herein is a composition comprising a recombinant polynucleicacid construct comprising a nucleic acid sequence encoding a peptide; wherein the peptide -Catenin, and -Catenin inhibits an interaction between BCL9L, TCF4, -Catenin.

[0013] In some aspects, provided herein is a composition comprising a recombinant polynucleicacid construct comprising a nucleic acid sequence encoding a peptide; herein the peptide comprises at least about 180 amino acid residues, wherein the peptide binds to H3.3, and wherein the binding of the peptide to H3.3 inhibits an interaction between CBP and H3.3.

[0014] In some aspects, provided herein is a composition comprising a recombinant polynucleicacid construct comprising a nucleic acid sequence encoding a peptide; wherein the peptide comprises at least about 40 amino acid residues, wherein the peptide binds to CBP, and wherein the binding of the peptide to CBP inhibits an interaction between H3.3 and CBP.

[0015] In some aspects, provided herein is a composition comprising a recombinant polynucleicacid construct comprising a nucleic acid sequence encoding a peptide; wherein the peptide comprises at least about 40 amino acid residues, wherein the peptide binds to CD3, and wherein the binding of the peptide to CD3 inhibits an interaction between TCR and CD3. In someembodiments, the TCR comprises TCR- -

[0016] In some aspects, provided herein is a pharmaceutical composition comprising anycomposition described herein and a pharmaceutically acceptable excipient or carrier. In some aspects, provided herein is a peptide expressed or encoded by the recombinant polynucleic acid construct of any composition described herein or any pharmaceutical composition described herein. In some embodiments, the peptide comprises an amino acid sequence comprising any one of SEQ ID NOs: 25-48 or 179-222. In some aspects, provided herein is a cell comprising the recombinant polynucleic acid construct of any composition described herein, any pharmaceutical composition described herein, or any peptide described herein.

[0017] In some aspects, provided herein is use of any composition described herein, anypharmaceutical composition described herein, or any peptide described herein for modulating a binding activity of a target protein in a cell. In some aspects, provided herein is use of anyWSGR Docket No.: 57623-713.601 composition described herein, any pharmaceutical composition described herein, any peptide described herein, or any cell described herein in treating a disease or a condition in a subject in need thereof. In some aspects, provided herein, is use of any composition described herein, any pharmaceutical composition described herein, any peptide described herein, or any cell described herein in manufacturing a medicament for treating a disease or a condition in a subject in need thereof.

[0018] In some aspects, provided herein is a method of treating a disease or a condition in asubject in need thereof, the method comprising: administering a therapeutically effective amount of any composition described herein, any pharmaceutical composition described herein, anypeptide described herein, or any cell described herein to the subject. In some aspects, providedherein, is a method of modulating a binding activity of a target protein in a cell comprising: introducing into the cell a recombinant polynucleic acid construct of any composition described herein, or any pharmaceutical composition described herein.

[0019] In some aspects, provided herein is a composition comprising a recombinant polynucleicacid construct comprising at least one nucleic acid sequence encoding a fragment of a protein encoded by a gene of interest, wherein the protein encoded by the gene of interest binds to a binding partner, wherein the fragment of the protein encoded by the gene of interest modulates binding of the binding partner to the protein encoded by a gene of interest, thereby modulating formation of an interactome comprising the protein encoded by the gene of interest and the binding partner.

[0020] In some aspects, provided herein is a messenger RNA (mRNA) comprising a nucleicacid sequence encoding (i) a protein or a fragment thereof and (ii) a target motif selected from the group consisting of a signal peptide, a nuclear localization signal (NLS), a nucleolar localization signal (NoLS), a lysosomal targeting signal, a mitochondrial targeting signal, a peroxisomal targeting signal, a microtubule tip localization signal (MtLS), an endosomal targeting signal, a chloroplast targeting signal, a Golgi targeting signal, an endoplasmic reticulum (ER) targeting signal, a proteasomal targeting signal, a membrane targeting signal, a transmembrane targeting signal, and a centrosomal localization signal (CLS), wherein the target motif is from a protein selected from the group consisting of a target motif of Polyoma Simian Vacuolating Virus 40 (SV40), a target motif of p53, a target motif of Myc proto-oncogene protein (c-Myc), and a target motif of insulin-like growth factor-binding protein 3 (IGFBP3).

[0021] In some aspects, provided herein is a composition comprising a recombinant polynucleicacid construct comprising: (i) at least one nucleic acid sequence encoding or comprising a small interfering RNA (siRNA) capable of binding to a target RNA; and (ii) at least one nucleic acid sequence encoding a gene of interest or a fragment thereof; wherein the target RNA is selectedWSGR Docket No.: 57623-713.601 from the group consisting of an RNA encoding MDM2, an RNA encoding MDM4, and a combination thereof, and wherein the gene of interest or the fragment thereof comprises p53. INCORPORATION BY REFERENCE

[0022] All publications, patents, and patent applications mentioned in this specification areherein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] The features of the present disclosure are set forth with particularity in the appendedclaims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure are utilized, and the accompanying drawings of which:

[0024] Figure 1 depicts a schematic representation of blocking protein-protein interaction (PPI)through an RNA encoding a peptide binding to a target protein (RNA encoding blocking peptide, also referred as interactome blocker).

[0025] Figures 2A-2B are plots showing the measurement of KRAS / CRAF protein-proteininteraction (PPI) in HEK 293 cells with NanoBiT complementation system upon the exposure of BI-2825, mRNA encoded CRAF blocking peptides or untagged full length CRAF mRNA control in 96-well format. KRAS-LgBiT and CRAF-SmBiT constructs were expressed through bi-cistronic plasmid vector in HEK293 cells to establish NanoBiT complementation system. Figure 2A shows normalized data of blocking KRAS / CRAF PPI of tested compounds compared to untransfected controls. Cpd.1 - 4 comprises of CRAF encoding blocking peptides around RAS binding domain (RBD) with increasing length. Exogenous untagged full length CRAF mRNA used as a negative control. BI-2825 small molecule inhibitor used as a positive control. Data represent means ± standard error of the mean of three replicates. Significance (**, <0.01; *, <0.05) was assessed by Student’s t-test of tested compounds and untreated control. Figure 2B shows normalized data of blocking KRAS / CRAF PPI of tested compounds compared to untreated control with or without (high CRAF vs. low CRAF, respectively) the co-expression of untagged full length CRAF mRNA control to demonstrate competitive interaction. Data represent means ± standard error of the mean of three replicates.

[0026] Figures 3A-3B are plots showing the relationship between p53 blocking peptide aminoacid length and reduction in p53 / MDM2 interaction. While MCF7 cells endogenously express p53 and MDM2 proteins, the continuous MDM2-mediated p53 ubiquitination leads toWSGR Docket No.: 57623-713.601 proteasomal degradation in a constant manner and leads to reduced proteins levels. The successful blocking of p53 / MDM2 interaction shows an increase in the expression of both proteins. Figure 3A is a plot for the measurement of p53 protein expression in MCF7 cells by western blot upon the exposure of MI-773, mRNA encoded p53 blocking peptides or negative mRNA control in 6-well format. The band intensities of p53 were normalized against GAPDH using ImageJ analysis and fold change was calculated in reference to Negative mRNA control. Cpd.5 - 10 comprises of p53 mRNA-encoding blocking peptides around MDM2 interaction site with increasing length. MI-773 small molecule inhibitor used as a positive control. Figure 3B is a plot for the measurement of p53 / MDM2 interaction in HEK 293 cells with NanoBiT complementation system upon the exposure of MI-773, mRNA encoded p53 blocking peptides or Negative mRNA control in 96-well format. p53-LgBiT and MDM2-SmBiT were expressed through two plasmid vectors in HEK293 cells to establish NanoBiT complementation system. Data of tested compounds were normalized to negative mRNA controls. Cpd.5 - 10 comprises of p53 encoding blocking peptides around MDM2 interaction site with increasing length. Nutlin- 3 small molecule inhibitor used as a positive control. Data represent means ± standard error of the mean of three to four replicates. Significance (*, p<0.05; **, p<0.01; ***, <0.001) was assessed by Student’s t-test of an individual Cpd. compared to Negative mRNA control.

[0027] Figures 4A-4B are plots showing the time course expression of p53 and p21 uponblocking p53 / MDM2 interaction. Figure 4A is a plot for the measurement of p53 protein expression in MCF7 cells by western blot upon the exposure of MI-773, Cpd.8 (mRNA encoded p53 blocking peptide) or negative mRNA control in 6-well format. The band intensities of p53 were normalized against GAPDH using ImageJ analysis and fold change was calculated in reference to Negative mRNA control. Figure 4B is a plot for the measurement of p21 protein expression (a downstream apoptotic marker of p53 activation) in MCF7 cells by western blot upon the exposure of MI-773, Cpd.8 (mRNA encoded p53 blocking peptide) or negative mRNA control in 6-well format. The band intensities of p21 were normalized against GAPDH using ImageJ analysis and fold change was calculated in reference to Negative mRNA control. Data represent means ± standard error of the mean of three to four replicates. Significance (***, <0.001) was assessed by two-way ANOVA followed by Geisser-Greenhouse correction test.

[0028] Figures 5A-5G. Figure 5A shows a representative western blot gel image with thebands for MDM2, p53, p21, GAPDH and p53 blocking peptides expression. The protein expression of MDM2, p53, p21, GAPDH and p53 blocking peptides were performed in MCF7 cells upon the exposure of MI-773, Cpd.11-24 (mRNA encoded p53 blocking peptides) or negative mRNA control (mentioned as control in the blot) in 6-well format. Figure 5B is a plot for the mean measurement of MDM2 protein expression, Figure 5C is a plot for the meanWSGR Docket No.: 57623-713.601 measurement of p53 protein expression, Figure 5D is a plot for the mean measurement of p21 protein expression and Figure 5E is a plot for the mean measurement of p53 blocking peptide expression in MCF7 cells with three independent western blot experiments upon the exposure of MI-773 Cpd.11-24 (mRNA encoded p53 blocking peptides) or negative mRNA control. The band intensities of p53 were normalized against GAPDH using ImageJ analysis and fold change was calculated in reference to Negative mRNA control. Figure 5F shows the impact of linking NLS domain to p53 blocking peptides derived from SV40, p53, c-Myc and IGFBP-3 with p53 protein expression. The data were extracted from Figure 4A and Figure 5C. Figure 5G shows the impact of linking NLS domain to p53 blocking peptides derived from SV40, p53, c-Myc and IGFBP-3 with MDM2 protein expression. The data were extracted from Figure 5B.

[0029] Figure 6A depicts a schematic representation of in vitro siRNA screening assay usingturbo-GFP reporter system. The 5’ sequence of turbo-GFP mRNA comprises of siRNA binding sites from MDM2 and MDM4 target RNA. The siRNAs from Cpd.22 specifically bind to these sites, leading to a reduction in GFP protein expression through siRNA-mediated RNA degradation. In parallel, Cpd.22 expresses p53 blocking peptide which blocks p53 / MDM2 interaction.

[0030] Figure 6B (left panel) presents representative microscopic images of HEK293 cellsexpressing Turbo GFP, comparing untreated controls with cells treated with compounds Cpd.18 and Cpd.22. Turbo GFP-positive cells are shown as white dots, following grayscale conversion through ImageJ analysis (representative image from one well). Figure 6B (right panel) shows the effects of RNA interference in Cpd.22-treated cells measured by GFP intensity, where siRNAs targeting MDM2 and MDM4 are applied. Results are normalized to Cpd.18-treated cells. Statistical significance (*p < 0.05) is determined via Student's t-test for Cpd.22 compared to Cpd.18. Data represent means ± standard error of the mean of 4 replicates.

[0031] Figure 6C (left panel) displays a western blot image showing MDM2 and GAPDHbands in MCF7 (p53 WT) cells treated with Cpd.18, Cpd.22 (mRNA-encoded p53-blocking peptides), MI-773, Nutlin-3, or a negative mRNA control (labeled as 'control' on the blot) in a 6- well format. MDM2 band intensities are normalized to GAPDH using ImageJ, and fold change is calculated relative to the negative mRNA control. Figure 6C (right panel) presents a western blot image with p53 and GAPDH bands for the same treatments in MCF7 cells, with p53 band intensities normalized to GAPDH and fold change calculated relative to the negative mRNA control.

[0032] Figure 6D (left panel) presents a western blot image showing MDM2 and GAPDHbands in A549 (p53 WT) cells treated with Cpd.18, Cpd.22 (mRNA-encoded p53-blocking peptides), MI-773, Nutlin-3, or a negative mRNA control (labeled as 'control' on the blot) in a 6-WSGR Docket No.: 57623-713.601 well format. MDM2 band intensities are normalized to GAPDH using ImageJ, with fold change calculated relative to the negative mRNA control. Figure 6D (right panel) displays a western blot image of p53 and GAPDH bands in A549 cells under the same treatment conditions, with p53 band intensities normalized to GAPDH and fold change calculated relative to the negative mRNA control.

[0033] Figure 6E (left panel) displays a western blot image showing MDM2 and GAPDHbands in FaDu (p53 mutant) cells treated with Cpd.18, Cpd.22 (mRNA-encoded p53-blocking peptides), MI-773, Nutlin-3, or a negative mRNA control (labeled as 'control' on the blot) in a 6- well format. MDM2 band intensities are normalized to GAPDH using ImageJ, with fold change calculated relative to the negative mRNA control. Figure 6E (right panel) presents a western blot image showing p53 and GAPDH bands in FaDu cells under the same treatment conditions, with p53 band intensities normalized to GAPDH and fold change calculated relative to the negative mRNA control.

[0034] Figure 6F (left panel) presents a western blot image showing MDM2 and GAPDHbands in LN-229 (p53 mutant) cells treated with Cpd.18, Cpd.22 (mRNA-encoded p53-blocking peptides), MI-773, Nutlin-3, or a negative mRNA control (labeled as 'control' on the blot) in a 6- well format. MDM2 band intensities are normalized to GAPDH using ImageJ, with fold change calculated relative to the negative mRNA control. Figure 6F (right panel) displays a western blot image of p53 and GAPDH bands in LN-229 cells under the same treatment conditions, with p53 band intensities normalized to GAPDH and fold change calculated relative to the negative mRNA control.

[0035] Figure 7A (left panel) presents a plot of dose-dependent cell death in U-87MG (p53WT) cells treated with Cpd.18 and Cpd.22, as measured by the Cell-Titre Glo assay and normalized to control RNA. Statistical significance is determined using two-way ANOVA followed by Tukey’s multiple comparison tests, with both Cpd.18 (***p < 0.001) and Cpd.22 (***p < 0.001) displayed significant differences from control RNA. Figure 7A (right panel) shows a similar dose-dependent cell death response in SH-SY5Y (p53 WT) cells, where significance is assessed in the same manner. Here, Cpd.18 (**p < 0.01) and Cpd.22 (***p < 0.001) also differed significantly from control RNA. Data represent means ± standard error of the mean from nine replicates across three independent experiments.

[0036] Figure 7B (left panel) presents a plot of dose-dependent cell death in FaDu (p53 mut)cells treated with Cpd.18 and Cpd.22, as measured by the Cell-Titre Glo assay and normalized to control RNA. Statistical significance is determined using two-way ANOVA followed by Tukey’s multiple comparison tests and only Cpd.22 (***p < 0.001) showed significant differences from control RNA. Figure 7B (right panel) shows a similar dose-dependent cellWSGR Docket No.: 57623-713.601 death response in LN-229 (p53 mut) cells, where significance is assessed in the same manner. Only Cpd.22 (***p < 0.001) differed significantly from control RNA. Data represent means ± standard error of the mean from nine replicates across three independent experiments.

[0037] Figure 7C (left panel) shows a heatmap of RT-qPCR analysis for p21, BCL2, and c-Myc mRNA levels in SJSA-1 (p53 WT) cells treated with control RNA, Nutlin-3, Cpd.18, and Cpd.22. Expression is normalized to 18s, with untreated control samples set to 1. Mean values from three replicates are shown as Log2 fold changes, where grey indicates up-regulation and white indicates down-regulation. Figure 7C (right panel) shows a similar heatmap for LN-229 (p53 mutant) cells under the same treatment and normalization conditions.

[0038] Figure 8A provides a schematic representation of the design of FANCD2-blockingpeptides encoded by mRNA constructs (Cpd.25-Cpd.29), aimed at inhibiting the interaction between FANCD2 and ubiquitin.

[0039] Figure 8B shows cell death plot in SCC-4 cells treated with varying doses ofDoxorubicin (left panel: 0.1, 0.3, 1, and 3 µM) and Cisplatin (right panel: 0.3, 1, 3, 10, 30, and 100 µM), each co-treated with control RNA or Cpd.25-Cpd.29 and measured by the CTG assay. Data are presented as means ± SEM (n = 3), normalized to untreated controls. The area under the curve (AUC) is calculated for each treatment group, with the control RNA group’s AUC set to 100%, and changes for treated groups calculated relative to this baseline.

[0040] Figure 8C shows cell death plot in A549 cells treated with varying doses of Doxorubicin(left panel: 0.1, 0.3, 1, and 3 µM) and Cisplatin (right panel: 0.3, 1, 3, 10, 30, and 100 µM), each co-treated with control RNA or Cpd.25-Cpd.29 and measured by the CTG assay. Data are presented as means ± SEM (n = 3), normalized to untreated controls. The area under the curve (AUC) is calculated for each treatment group, with the control RNA group’s AUC set to 100%, and changes for treated groups calculated relative to this baseline.

[0041] Figure 8D shows cell death plot in SCC-9 cells treated with varying doses ofDoxorubicin (left panel: 0.1, 0.3, 1, and 3 µM) and Cisplatin (right panel: 0.3, 1, 3, 10, 30, and 100 µM), each co-treated with control RNA or Cpd.25-Cpd.29 and measured by the CTG assay. Data are presented as means ± SEM (n = 3), normalized to untreated controls. The area under the curve (AUC) is calculated for each treatment group, with the control RNA group’s AUC set to 100%, and changes for treated groups calculated relative to this baseline.

[0042] Figure 8E shows a western blot of FANCD2, ubiquitinated FANCD2, and GAPDH inA549 cells treated with Cpd.27, Cpd.28 (mRNA-encoded FANCD2-blocking peptides), or a negative mRNA control (labeled 'control') in a 6-well format. FANCD2 and ubiquitinated FANCD2 band intensities are normalized to GAPDH using ImageJ, with changes calculated relative to the untransfected control, set to 100%.WSGR Docket No.: 57623-713.601

[0043] Figure 9A illustrates a schematic of the mRNA-encoded peptide constructs designed toinhibit interactions among -Catenin, and TCF4. Constructs Cpd.30-Cpd.37 areBCL9L- -Catenin interactions, Cpd.38- -Catenin-blocking peptides that disrupt interactions with both BCL9L and TCF4, and Cpd.47-Cpd.52 areTCF4- -Catenin interactions. Each mRNA construct is engineered todisrupt specific protein- -Catenin / TCF4 complex.

[0044] Figure 9B shows a plot showing Vascular endothelial growth factor A (VEGFA) proteinlevels measured by ELISA in SCC-4 cells following the inhibition of B -Catenin / TCF4interactions. Cells are transfected with Cpd.30–Cpd.52 at 0.6 µg per well, and VEGFA levels are measured 24 hours post-transfection. Data presented as mean ± SEM across 6-9 replicates from two to three independent experiments. Statistical significance (*p < 0.05, p** < 0.01) is determined using Student’s t-test for each compound compared to the untransfected control.

[0045] Figure 9C shows a plot of RT-qPCR analysis of VEGFA mRNA expression levels inSCC- -Catenin / TCF4 interactions. Cells are transfectedwith compounds Cpd.30 to Cpd.52 at a concentration of 0.6 µg per well. VEGFA mRNA levels are assessed 24 hours post-transfection, with cDNA synthesized from the isolated RNA of transfected cells. Data are shown as mean ± SEM across 6-9 replicates from two to three independent experiments, normalized to 18s expression, and set relative to untransfected control levels (defined as 1). Relative reductions in VEGFA mRNA levels are displayed, with treatments showing a reduction of less than 0.5 considered for statistical analysis. Statistical significance (p*** < 0.001) is determined using Student’s t-test for each compound compared to the untransfected control.

[0046] Figure 9D shows a plot of RT-qPCR analysis of cluster of differentiation 44 (CD44)mRNA expression levels in SCC- -Catenin / TCF4interactions. Cells are transfected with compounds Cpd.30 to Cpd.52 at a concentration of 0.6 µg per well. CD44 mRNA levels are assessed 24 hours post-transfection, with cDNA synthesized from the isolated RNA of transfected cells. Data are shown as mean ± SEM across 6-9 replicates from two to three independent experiments, normalized to 18s expression, and set relative to untransfected control levels (defined as 1). Relative reductions in CD44 mRNA levels are displayed, with treatments showing a reduction of less than 0.5 considered for statistical analysis. Statistical significance (p*** < 0.001) is determined using Student’s t-test for each compound compared to the untransfected control.

[0047] Figure 9E shows a plot of RT-qPCR analysis of c-Myc mRNA expression levels inSCC- -Catenin / TCF4 interactions. Cells are transfectedwith compounds Cpd.30 to Cpd.52 at a concentration of 0.6 µg per well. C-Myc mRNA levelsWSGR Docket No.: 57623-713.601 are assessed 24 hours post-transfection, with cDNA synthesized from the isolated RNA of transfected cells. Data are shown as mean ± SEM across 6-9 replicates from two to three independent experiments, normalized to 18s expression, and set relative to untransfected control levels (defined as 1). Relative reductions in CD44 mRNA levels are displayed, with treatments showing a reduction of less than 0.5 considered for statistical analysis. Statistical significance (p*** < 0.001) is determined using Student’s t-test for each compound compared to the untransfected control.

[0048] Figure 10A provides a schematic representation of the design of CBP-blocking peptidesencoded by mRNA constructs (Cpd.53-Cpd.62) and H3.3-blocking peptides encoded by mRNA constructs (Cpd.63-Cpd.66). All the mRNA constructs aimed at inhibiting the interaction amongCBP / H3.3 protein-protein interactions. Constructs with asterisks (*) comprise a c-Myc NLS.

[0049] Figure 10B shows a cell death plot in SCC-4, A549 and LN-229 cells treated withvarying doses of Doxorubicin (left panel: 0.1, 0.3, 1, 3, 10 and 30 µM) and Cisplatin (right panel: 0.3, 1, 3, 10, 30, 100 and 300 µM) measured by the CTG assay. Data are presented asmeans ± SEM (n = 3), normalized to untreated controls. IC50 values are calculated by [Inhibitor]vs. Response with four Parameter Variable Slope Model by GraphPad prism.

[0050] Figure 10C shows a cell death plot in MCF7 cells as a screening assay to analyze thecell killing activity of Cpd.53-Cpd.66 as a monotreatment which block CBP / H3.3 interaction using Cell-Titre Glo (CTG) assay. The values are normalized to control RNA, and GFP mRNA and CBP-112 (30 µM) treatment also assessed. Statistical significance (p* < 0.05) is determined using Student’s t-test for each compound compared to the control.

[0051] Figure 10D are plots showing the measurement of CBP / H3.3 protein-protein interaction(PPI) in HEK 293 cells with NanoBRET system upon the exposure of CBP-112 (30 µM),mRNA encoded CBP blocking peptides (CPd.53-Cpd.62), mRNA encoded H3.3 blockingpeptides (CPd.63-Cpd.66) or control mRNA control in 96-well format. CBP Bromodomain with NanoLuc® and H3.3 with HaloTag® constructs are expressed through plasmid vectors in HEK293 cells to establish NanoBRET system. CBP-112 small molecule inhibitor used as a positive control. Data represent means ± standard error of the mean of three replicates.Significance (p* < 0.05) is assessed by Student’s t-test of tested compounds and control mRNA.

[0052] Figure 10E shows cell death plot in A549 cells treated with varying doses ofDoxorubicin (left panel: 0.1, 0.3, 1, and 3 µM) and Cisplatin (right panel: 0.3, 1, 3, 10, 30, and 100 µM), each co-treated with control RNA or Cpd.54, Cpd.57-59 and Cpd.66 and measured by the CTG assay. Data are presented as means ± SEM (n = 3), normalized to untreated controls. The area under the curve (AUC) is calculated for each treatment group, with the control RNA group’s AUC set to 100%, and changes for treated groups calculated relative to this baseline.WSGR Docket No.: 57623-713.601

[0053] Figure 10F shows cell death plot in SCC-4 cells treated with varying doses ofDoxorubicin (left panel: 0.1, 0.3, 1, and 3 µM) and Cisplatin (right panel: 0.3, 1, 3, 10, 30, and100 µM), each co-treated with control RNA or Cpd.54, Cpd.57-59 and Cpd.66 and measured bythe CTG assay. Data are presented as means ± SEM (n = 3), normalized to untreated controls. The area under the curve (AUC) is calculated for each treatment group, with the control RNA group’s AUC set to 100%, and changes for treated groups calculated relative to this baseline.

[0054] Figure 10G shows cell death plot in LN-229 cells treated with varying doses ofDoxorubicin (left panel: 0.1, 0.3, 1, and 3 µM) and Cisplatin (right panel: 0.3, 1, 3, 10, 30, and 100 µM), each co-treated with control RNA or Cpd.54, Cpd.57-59 and Cpd.66 and measured by the CTG assay. Data are presented as means ± SEM (n = 3), normalized to untreated controls. The area under the curve (AUC) is calculated for each treatment group, with the control RNA group’s AUC set to 100%, and changes for treated groups calculated relative to this baseline.

[0055] Figure 11 (top panel) presents a schematic overview of the design for mRNA constructsencoding TCR- -(Cpd.68). The bottom panel displays a plot illustrating Transact-induced activation, which stimulates CD69-positive Jurkat T-cells, along with the effects of Cpd.67 and Cpd.68 treatmentsin reducing CD69-positive cell populations. Data represented as CD69-negative cells where noTransact treated cells normalized to 100%. Data are represented as the percentage of CD69- negative cells, with untreated (no Transact) cells normalized to 100%. Results are shown as mean ± SEM (n = 3). Statistical significance (p* < 0.05, ** <0.01) was assessed using Student’s t-test for each compound compared to the Transact-treated control. DETAILED DESCRIPTION

[0056] Certain specific details of this description are set forth in order to provide a thoroughunderstanding of various embodiments. However, one skilled in the art will understand that the present disclosure may be practiced without these details. In other instances, well–known structures have not been shown or described in detail to avoid unnecessarily obscuring descriptions of the embodiments. Unless the context requires otherwise, throughout the specification and claims which follow, the word “comprise” and variations thereof, such as, “comprises” and “comprising” are to be construed in an open, inclusive sense, that is, as “including, but not limited to.” Further, headings provided herein are for convenience only and do not interpret the scope or meaning of the claimed disclosure.

[0057] Unless otherwise defined, all technical and scientific terms used herein have the samemeaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can beWSGR Docket No.: 57623-713.601 used in the practice or testing of the present disclosure, suitable methods, and materials are described below. Definitions

[0058] As used in this specification and the appended claims, the singular forms “a,” “an,” and“the” include plural referents unless the content clearly dictates otherwise. It should also be noted that the term “or” is generally employed in its sense including “and / or” unless the content clearly dictates otherwise. The terms “and / or” and “any combination thereof” and their grammatical equivalents as used herein, can be used interchangeably. These terms can convey that any combination is specifically contemplated. Solely for illustrative purposes, the following phrases “A, B, and / or C” or “A, B, C, or any combination thereof” can mean “A individually; B individually; C individually; A and B; B and C; A and C; and A, B, and C.” The term “or” can be used conjunctively or disjunctively, unless the context specifically refers to a disjunctive use.

[0059] The term “about” or “approximately” can mean within an acceptable error range for theparticular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, “about” can mean within 1 or more than 1 standard deviation, per the practice in the art. Alternatively, “about” can mean a range of up to 20%, up to 10%, up to 5%, or up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, within 5-fold, and more preferably within 2-fold, of a value. Where particular values are described in the application and claims, unless otherwise stated the term “about” meaning within an acceptable error range for the particular value should be assumed.

[0060] As used in this specification and claim(s), the words “comprising” (and any form ofcomprising, such as “comprise” and “comprises”), “having” (and any form of having, such as “have” and “has”), “including” (and any form of including, such as “includes” and “include”) or “containing” (and any form of containing, such as “contains” and “contain”) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps. It is contemplated that any embodiment discussed in this specification can be implemented with respect to any method or composition of the present disclosure, and vice versa. Furthermore, compositions of the present disclosure can be used to achieve methods of the present disclosure.

[0061] Reference in the specification to “embodiments,” “certain embodiments,” “preferredembodiments,” “specific embodiments,” “some embodiments,” “an embodiment,” “one embodiment” or “other embodiments” mean that a particular feature, structure, or characteristic described in connection with the embodiments is included in at least some embodiments, but notWSGR Docket No.: 57623-713.601 necessarily all embodiments, of the present disclosures. To facilitate an understanding of the present disclosure, a number of terms and phrases are defined below.

[0062] The term “RNA” as used herein includes RNA which encodes an amino acid sequence(e.g., mRNA, etc.) as well as RNA which does not encode an amino acid sequence (e.g., siRNA, shRNA etc.). The RNA as used herein may be a coding RNA, i.e., an RNA which encodes an amino acid sequence. Such RNA molecules are also referred to as mRNA (messenger RNA) and are single-stranded RNA molecules. The RNA as used herein may be a non-coding RNA, i.e., an RNA which does not encode an amino acid sequence or is not translated into a protein. A non- coding RNA can include, but are not limited to, small interfering RNA (siRNA), short or small harpin RNA (shRNA), microRNA (miRNA), piwi-interacting RNA (piRNA), and long non- coding RNA (IncRNA). siRNAs as used herein may comprise a double-stranded RNA (dsRNA) region, a hairpin structure, a loop structure, or a combination thereof. In some embodiments, siRNAs as used herein may comprise at least one shRNA, at least one dsRNA region, or at least one loop structure. In some embodiments, siRNAs as used herein may be processed from a dsRNA or an shRNA. RNAs may be made by synthetic chemical and / or enzymatic methodology known to one of ordinary skill in the art, or by the use of recombinant technology, or may be isolated from natural sources, or by a combination thereof. RNAs may optionally comprise unnatural and naturally occurring nucleoside modifications known in the art such as e.g., N1- Methylpseudouridine also referred herein as methylpseudouridine.

[0063] The terms “nucleic acid sequence,” “polynucleic acid sequence,” “nucleotide sequence,”and / or “nucleotide acid sequence” are used herein interchangeably and can have the identical meaning herein and cam refer to preferably DNA or RNA. The terms “nucleic acid sequence,” “nucleotide sequence,” and / or “nucleotide acid sequence” can be used synonymously with the term "polynucleotide sequence." In some embodiments, a nucleic acid sequence can be a polymer comprising or consisting of nucleotide monomers, which are covalently linked to each other by phosphodiester-bonds of a sugar / phosphate-backbone. The term “nucleic acid sequence” can also encompass modified nucleic acid sequences, such as base-modified, sugar-modified or backbone- modified etc., DNA or RNA.

[0064] The recombinant polynucleic acid, DNA, or RNA construct described herein mayinclude one or more nucleotide variants, including nonstandard nucleotide(s), non–natural nucleotide(s), nucleotide analog(s), and / or modified nucleotides. Examples of modified nucleotides include, but are not limited to diaminopurine, 5–fluorouracil, 5–bromouracil, 5– chlorouracil, 5–iodouracil, hypoxanthine, xantine, 4–acetylcytosine, 5– (carboxyhydroxylmethyl)uracil, 5–carboxymethylaminomethyl–2–thiouridine, 5– carboxymethylaminomethyluracil, dihydrouracil, beta–D–galactosylqueosine, inosine, N6–WSGR Docket No.: 57623-713.601 isopentenyladenine, 1–methylguanine, 1–methylinosine, 2,2–dimethylguanine, 2– methyladenine, 2–methylguanine, 3–methylcytosine, 5–methylcytosine, N6–adenine, 7– methylguanine, 5–methylaminomethyluracil, 5–methoxyaminomethyl–2–thiouracil, beta–D– mannosylqueosine, 5’–methoxycarboxymethyluracil, 5–methoxyuracil, 2–methylthio–N6– isopentenyladenine, uracil–5–oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2– thiocytosine, 5–methyl–2–thiouracil, 2–thiouracil, 4–thiouracil, 5–methyluracil, uracil–5– oxyacetic acid methylester, 5–methyl–2–thiouracil, 3–(3–amino– 3– N–2–carboxypropyl) uracil, (acp3)w, 2,6–diaminopurine and the like. In some cases, nucleotides may include modifications in their phosphate moieties, including modifications to a triphosphate moiety. Non–limiting examples of such modifications include phosphate chains of greater length (e.g., a phosphate chain having, 4, 5, 6, 7, 8, 9, 10 or more phosphate moieties) and modifications with thiol moieties (e.g., alpha–thiotriphosphate and beta–thiotriphosphates).

[0065] In some embodiments, modified nucleosides can include m5C (5-methylcytidine). Inanother embodiment, the modified nucleoside is m5U (5-methyluridine). In another embodiment, the modified nucleoside is m6A (N6-methyladenosine). In another embodiment, the modified nucleoside is s2U (2- (pseudouridine). In some embodiment, modified nucleosides can include -O- methyluridine). In some embodiments, modified nucleoside can include m1A (1-methyladenosine); m2A (2- -O-methyladenosine); ms2m6A (2-methylthio-N6-methyladenosine); i6A (N6-isopentenyladenosine); ms2m6A (2-methylthio- N6isopentenyladenosine); io6A (N6-(cis-hydroxyisopentenyl)adenosine); ms2io6A (2-methylthio- N6-(cis-hydroxyisopentenyl) adenosine); g6A (N6-glycinylcarbamoyladenosine); t6A (N6- threonylcarbamoyladenosine); ms2t6A (2-methylthio-N6-threonylcarbamoyladenosine); m6t6A (N6-methyl-N6-threonylcarbamoyladenosine); hn6A(N6-hydroxynorvalylcarbamoyladenosine);ms2hn6A (2-methylthio-N6- -O-ribosyladenosine(phosphate)); I (inosine); m1I (1-methylinosine); m1-O-dimethylinosine); m3C (3-meth -O-methylcytidine); s2C (2-thiocytidine); ac4C (N4-acetylcytidine); f5C(5-formylcytidine); m5 -O-dimethylcytidine); ac4Cm (N4-acetyl- -O-methylcytidine);k2C (lysidine); m1G (1-methylguanosine); m2G (N2-methylguanosine); m7G (7- -O-methylguanosine); m22G (N2,N2-dimethylguanosine); m2Gm(N2 -O-dimethylguanosine); m2 2Gm (N2,N2 -O- -O-ribosylguanosine (phosphate)); yW (wybutosine); o2yW (peroxywybutosine); OHyW (hydroxywybutosine); OHyW* (undermodified hydroxywybutosine); imG (wyosine); mimG (methylwyosine); Q (queuosine); oQ (epoxyqueuosine); galQ (galactosyl-queuosine); manQ (mannosyl-queuosine); preQ0(7-cyano-7-deazaguanosine); preQ1(7-aminomethyl-7-WSGR Docket No.: 57623-713.601deazaguanosine); G (archaeosine); D (dihydrouridine); m5 -O-dimethyluridine); s4U (4-thiouridine); m5s2U (5-methyl-2-thiouridine); s2Um (2-thio- -O-methyluridine); acp3U (3-(3-amino-3-carboxypropyl)uridine); ho5U (5-hydroxyuridine); mo5U (5-methoxyuridine); cmo5U (uridine 5-oxyacetic acid); mcmo5U (uridine 5-oxyacetic acid methyl ester); chm5U (5- (carboxyhydroxymethyl)uridine)); mchm5U (5-(carboxyhydroxymethyl)uridine methyl ester);mcm5U (5-methoxycarbonylmethyluridine); mcm5Um (5-methoxycarbonylmethyl- -O-methyluridine); mcm5s2U (5-methoxycarbonylmethyl-2-thiouridine); nm5s2U (5-aminomethyl- 2-thiouridine); mnm5U (5-methylaminomethyluridine); mnm5s2U (5-methylaminomethyl-2- thiouridine); mnm5se2U (5-methylaminomethyl-2-selenouridine); ncm5U (5-carbamoylmethyluridine); ncm5Um (5-carbamoylmethyl- -O-methyluridine); cmnm5U (5-carboxymethylaminomethyluridine); cmnm5Um (5-carboxymethylaminomethyl- -O-methyluridine); cmnm5s2U (5-carboxymethylaminomethyl-2-thiouridine); m62A (N6,N6- -O-methylinosine); m4C (N4-methylcytidine); m4Cm (N4-O- dimethylcytidine); hm5C (5-hydroxymethylcytidine); m3U (3-methyluridine); cm5U (5-carboxymethyluridine); m6Am (N6 -O-dimethyladenosine); m6 2Am (N6,N6,O- -trimethyladenosine); m2,7G (N2,7-dimethylguanosine); m2,2,7G (N2,N2,7-trimethylguanosine);m3 -O-dimethyluridine); m5D (5-methyldihydrouridine); f5Cm (5-formyl- -O-methylcytidine); m1 -O-dimethylguanosine); m1 -O- 5U(5-taurinomethyluridine);5s2U (5-taurinomethyl-2-thiouridine)); imG-14 (4- demethylwyosine); imG2 (isowyosine); or ac6A (N6-acetyladenosine).

[0066] The recombinant polynucleic acid, DNA, or RNA construct described herein may bemodified at the base moiety (e.g., at one or more atoms that typically are available to form a hydrogen bond with a complementary nucleotide and / or at one or more atoms that are not typically capable of forming a hydrogen bond with a complementary nucleotide), sugar moiety, or phosphate backbone. In some embodiments, backbone modifications include, but are not limited to, a phosphorothioate, a phosphorodithioate, a phosphoroselenoate, a phosphorodiselenoate, a phosphoroanilothioate, a phosphoraniladate, a phosphoramidate, and a phosphorodiamidate linkage. A phosphorothioate linkage substitutes a sulfur atom for a non- bridging oxygen in the phosphate backbone and delay nuclease degradation of oligonucleotides. degradation. In some embodiments, backbone modifications include having peptide bonds instead of phosphorous in the backbone structure (e.g., N-(2-aminoethyl)-glycine units linked by peptide bonds in a peptide nucleic acid), or linking groups including carbamate, amides, and linear and cyclic hydrocarbon groups. Oligonucleotides with modified backbones are reviewed in Micklefield, Backbone modification of nucleic acids: synthesis, structure and therapeuticWSGR Docket No.: 57623-713.601 applications, Curr. Med. Chem., 8 (10): 1157-79, 2001 and Lyer et al., Modified oligonucleotides-synthesis, properties and applications, Curr. Opin. Mol. Ther., 1 (3): 344-358, 1999.

[0067] The terms “peptide” can refer to a series of amino acid residues connected one to the-amino and carboxyl groups of adjacent amino acid residues. The term “protein” as used herein can refer to molecules typically comprising one or more peptides or polypeptides. A peptide or polypeptide can comprise a chain of amino acid residues, linked by peptide bonds. A peptide can comprise between 2 and 50 amino acid residues, between 10 and 100 amino acid residues, between 20 and 200 amino acid residues, between 30 and 300 amino acid residues, between 40 and 400 amino acid residues, or between 50 and 500 amino acid residues. In some embodiments, a peptide can comprise more than 500 amino acid residues. A polypeptide can comprise more than 150, more than 200, more than 250, more than 300, more than 350, more than 400, more than 450, more than 500, or more than 550 amino acid residues. A protein is typically folded into 3-dimensional form, which may be required for the protein to exert its biological function. The term “protein” as used herein can include a fragment of a protein and / or fusion proteins. In some embodiments, the protein can be mammalian, e.g., of human origin, i.e., can be a human protein. In some embodiments, the protein can be a protein which is normally secreted from a cell, i.e., a protein which is secreted from a cell in nature, or a protein produced by a virus.

[0068] The term “target motif” or “targeting motif” as used herein can refer to any short peptidepresent in the newly synthesized polypeptides or proteins that are destined to any parts of cell membranes, extracellular compartments, or intracellular compartments. Intracellular compartments include, but are not limited to, intracellular organelles such as nucleus, nucleolus, endosome, proteasome, ribosome, chromatin, nuclear envelope, nuclear pore, exosome, melanosome, Golgi apparatus, peroxisome, endoplasmic reticulum (ER), lysosome, centrosome, microtubule, mitochondria, chloroplast, microfilament, intermediate filament, or plasma membrane. Other terms include, but are not limited to, signal sequence, targeting signal, localization signal, localization sequence, transit peptide, leader sequence, or leader peptide. The target motif may comprise a signal peptide, a nuclear localization signal (NLS), a nucleolar localization signal (NoLS), a lysosomal targeting signal, a mitochondrial targeting signal, a peroxisomal targeting signal, a microtubule tip localization signal (MtLS), an endosomal targeting signal, a chloroplast targeting signal, a Golgi targeting signal, an endoplasmic reticulum (ER) targeting signal, a proteasomal targeting signal, a membrane targeting signal, a transmembrane targeting signal, a centrosomal localization signal (CLS), or any other signal thatWSGR Docket No.: 57623-713.601 targets a protein to a certain part of cell membrane, extracellular compartments, or intracellular compartments.

[0069] The term “signal peptide” also referred herein to as signaling peptide or pre-domain canbe a short peptide (usually 16-40 amino acids long) present at the N-terminus of newly synthesized proteins that are destined towards the secretory pathway. Signal peptides described herein can be preferably 10-50, more preferably 11-45, even more preferably 12-45, most preferably 13-45, in particular 14-45, more particular 15-45, even more particular 16-40 amino acids long. A signal peptide can be situated at the N-terminal end of the protein of interest or at the N-terminal end of the pro-protein form of the protein of interest. A signal peptide can be usually of eukaryotic origin e.g., the signal peptide of a eukaryotic protein, preferably of mammalian origin e.g., the signal peptide of a mammalian protein, more preferably of human origin e.g., the signal peptide of a mammalian protein. In some embodiments the heterologous signal peptide and / or the homologous signal peptide to be modified is the naturally occurring signal peptide of a eukaryotic protein, preferably the naturally occurring signal peptide of a mammalian protein, more preferably the naturally occurring signal peptide of a human protein.

[0070] The terms “fragment,” or “fragment of a sequence” as used herein can be a shorterportion of a full-length sequence of e.g., a nucleic acid molecule such as DNA or RNA, or a protein. Accordingly, a fragment can comprise a sequence that is identical to the corresponding stretch within the full-length sequence. In some embodiments, a fragment can represent at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the total molecule (i.e., full-length sequence), from which the fragment is derived.

[0071] The term “vector” or “expression vector” as used herein can refer to naturally occurringor synthetically generated constructs for uptake, proliferation, expression or transmission of nucleic acids in a cell, e.g., plasmids, minicircles, phagemids, cosmids, artificial chromosomes / mini-chromosomes, bacteriophages, viruses such as baculovirus, retrovirus, adenovirus, adeno-associated virus, herpes simplex virus, bacteriophages. Vectors can either integrate into the genome of the host cell or remain as autonomously replicating construct within the host cell. Methods used to construct vectors are well known to a person skilled in the art and described in various publications. In particular, techniques for constructing suitable vectors, including a description of the functional and regulatory components such as promoters, enhancers, termination and polyadenylation signals, selection markers, origins of replication, and splicing signals, are known to the person skilled in the art. The eukaryotic expression vectors can also comprise prokaryotic sequences that facilitate the propagation of the vector in bacteria suchWSGR Docket No.: 57623-713.601as an origin of replication and antibiotic resistance genes for selection in bacteria which mightbe removed before transfection of eukaryotic cells. A variety of eukaryotic expression vectors, containing a cloning site into which a polynucleotide can be operably linked, are well known in the art and some are commercially available from companies such as Agilent Technologies, Santa Clara, Calif.; Invitrogen, Carlsbad, Calif.; Promega, Madison, Wis. or Invivogen, San Diego, Calif.

[0072] The term “transcription unit,” “expression unit,” or “expression cassette” as used hereincan refer to a region within a vector, construct, or polynucleotide sequence that comprises one or more genes to be transcribed, wherein the genes contained within the segment are operably linked to each other. They are transcribed from a single promoter and transcription is terminated by at least one polyadenylation signal. As a result, the different genes are at least transcriptionally linked. More than one protein or product can be transcribed and expressed from each transcription unit (multicistronic transcription unit). Each transcription unit can comprise the regulatory elements necessary for the transcription and translation of any of the selected sequence that are contained within the unit. Each transcription unit may contain the same or different regulatory elements. For example, each transcription unit may contain the same terminator. IRES element or introns may be used for the functional linking of the genes within a transcription unit. A vector or polynucleotide sequence may contain more than one transcription unit.

[0073] The term “recombinant polynucleic acid” or “recombinant RNA” can refer to apolynucleic acid, DNA, or RNA that are not naturally occurring and are synthesized or manipulated in vitro. A recombinant polynucleic acid, DNA, or RNA can be synthesized in a laboratory and can be prepared by using recombinant DNA or RNA technology by using enzymatic modification of DNA or RNA, such as enzymatic restriction digestion, ligation, and cloning. A recombinant polynucleic acid or DNA can be transcribed in vitro to produce a messenger RNA (mRNA) and the recombinant mRNA can be isolated, purified, and used for transfection. A recombinant polynucleic acid, DNA, or RNA used herein can encode a protein, polypeptide, a target motif, a signal peptide, and / or a non-coding RNA such as small interfering RNA (siRNA). Under suitable conditions, a recombinant polynucleic acid, DNA, or RNA can be incorporated into a cell and expressed within the cell.

[0074] The term “expression” of a polynucleic acid, gene, DNA, or RNA, as used herein, canrefer to transcription and / or translation of the polynucleic acid, gene, DNA, or RNA. The term “modulating,” “increasing,” “upregulating,” “decreasing,” or “downregulating” the expression of a polynucleic acid, gene, such as a gene of interest, DNA, or RNA, such as a target RNA or a target mRNA, as used herein, can refer to modulating, increasing, upregulating, decreasing, orWSGR Docket No.: 57623-713.601 downregulating the level of protein encoded by a polynucleic acid, gene, such as a gene of interest, DNA, or RNA, such as a target RNA or a target mRNA by affecting transcription and / or translation of the polynucleic acid, gene, such as a gene of interest, DNA, or RNA, such as a target RNA or a target mRNA. The term “inhibiting” the expression of a polynucleic acid, gene, such as a gene of interest, DNA, or RNA, such as a target RNA or a target mRNA can refer to affect transcription and / or translation of the polynucleic acid, gene, such as a gene of interest, DNA, or RNA, such as a target RNA or a target mRNA such that the level of protein encoded by the polynucleic acid, gene, such as a gene of interest, DNA, or RNA, such as a target RNA or a target mRNA is reduced or abolished.

[0075] The term “expression” of a polynucleic acid, gene, DNA, or RNA, as used herein, canrefer to transcription and / or translation of the polynucleic acid, gene, DNA, or RNA. The term “modulating,” “increasing,” “upregulating,” “decreasing,” or “downregulating” the expression of a polynucleic acid, gene, such as a gene of interest, DNA, or RNA, such as a target RNA or a target mRNA, as used herein, can refer to modulating, increasing, upregulating, decreasing, or downregulating the level of protein encoded by a polynucleic acid, gene, such as a gene of interest, DNA, or RNA, such as a target RNA or a target mRNA by affecting transcription and / or translation of the polynucleic acid, gene, such as a gene of interest, DNA, or RNA, such as a target RNA or a target mRNA. The term “inhibiting” the expression of a polynucleic acid, gene, such as a gene of interest, DNA, or RNA, such as a target RNA or a target mRNA can refer to affect transcription and / or translation of the polynucleic acid, gene, such as a gene of interest, DNA, or RNA, such as a target RNA or a target mRNA such that the level of protein encoded by the polynucleic acid, gene, such as a gene of interest, DNA, or RNA, such as a target RNA or a target mRNA is reduced or abolished.

[0076] The term “operably linked” or “linked” can refer to a functional relationship betweentwo or more nucleic acid sequences, e.g., a functional relationship of a transcriptional regulatory or signal sequence to a transcribed sequence. For example, a target motif or a nucleic acid sequence encoding a target motif is operably linked to a coding sequence if it is expressed as a preprotein that participates in targeting the polypeptide encoded by the coding sequence to a cell membrane, intracellular, or an extracellular compartment. For example, a signal peptide or a nucleic acid sequence encoding a signal peptide is operably linked to a coding sequence if it is expressed as a preprotein that participates in the secretion of the polypeptide encoded by the coding sequence. For example, a NLS or a nucleic acid sequence encoding a NLS is operably linked to a coding sequence if it is expressed as a preprotein that participates in the translocation of the polypeptide encoded by the coding sequence into the nucleus. For example, a promoter is operably linked if it stimulates or modulates the transcription of the coding sequence.WSGR Docket No.: 57623-713.601

[0077] The term “Kozak sequence,” “Kozak consensus sequence,” or “Kozak consensus” canrefer to a nucleic acid sequence motif that functions as the protein translation initiation site. Kozak sequences are described at length in the literature, e.g., by Kozak, M., Gene 299(1-2):1- 34, incorporated herein by reference herein in its entirety. Recombinant polynucleic acid or RNA construct

[0078] Provided herein are compositions comprising recombinant polynucleic acid constructscomprising at least one nucleic acid sequence encoding a peptide. In some embodiments, peptides described herein can bind to a target protein. In some embodiments, peptides described herein can bind to a target protein and modulate binding of the target protein to a binding partner. In some embodiments, modulating binding of the target partner protein to the binding partner can modulate formation of an interactome that comprises a complex comprising thetarget protein and the binding partner. In some embodiments, recombinant polynucleic acidconstructs can be recombinant DNA constructs. In some embodiments, recombinant polynucleic acid constructs can be recombinant RNA constructs. Figure 1 shows an exemplary schematic of using a recombinant polynucleic acid construct comprising at least one nucleic acid sequence encoding a peptide to modulate an interaction between two proteins. In this example, a recombinant RNA construct comprising, in a 5’ to 3’ direction, a 5’ cap, a sequence encoding a peptide, and poly(A) tail (e.g., RNA encoding blocking peptide) can be introduced into a cell. The peptide (e.g., Interactome Blocker) expressed from the recombinant RNA construct can bind to a target protein (e.g., Protein-B). The peptide can modulate (e.g., block or prevent) a protein-protein interaction (e.g., interaction between Protein-A and Protein-B) by binding to the target protein (e.g., Protein-B). In this example, modulating the protein-protein interaction can further modulate a downstream signaling pathway. For example, the peptide can bind to the target protein to block or prevent a protein-protein interaction and further block or prevent a downstream signaling pathway that may lead to cell death.

[0079] In some aspects, compositions described herein can comprise recombinant polynucleicacid or RNA constructs comprising at least one nucleic acid sequence encoding a peptide. In some embodiments, recombinant polynucleic acid or RNA constructs can comprise two or more nucleic acid sequences each encoding a peptide. For example, recombinant polynucleic acid or RNA constructs can comprise at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten nucleic acid sequences each encoding a peptide. For example, recombinant polynucleic acid or RNA constructs can comprise at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20 nucleic acid sequences each encoding a peptide. In some embodiments,WSGR Docket No.: 57623-713.601 recombinant polynucleic acid or RNA constructs can comprise more than 20 nucleic acid sequences each encoding a peptide.

[0080] In some embodiments, each of the two or more nucleic acid sequences can encode adifferent peptide, a same peptide, or a combination thereof. In one embodiment, each of the two or more nucleic acid sequences can encode the same peptide. In another embodiment, each of the two or more nucleic acid sequences can encode a different peptide. In yet another embodiment, two or more nucleic acid sequences can encode a combination of the same peptide and different peptide. For example, recombinant polynucleic acid or RNA constructs can comprise three nucleic acid sequences each encoding a peptide, wherein two of the three nucleic acid sequences each encoding a peptide can encode the same peptide and one of the three nucleic acid sequences each encoding a peptide can encode a different peptide.

[0081] In some embodiments, each of the two or more nucleic acid sequences can encode adifferent peptide. In this embodiment, different peptides encoded by the two or more nucleic acid sequences can bind to a same target protein, a different target protein, or a combination thereof. In one example, recombinant polynucleic acid or RNA constructs can comprise three nucleic acid sequences each encoding a different peptide, wherein each of the three different peptides can bind to the same target protein. In another example, recombinant polynucleic acid or RNA constructs can comprise three nucleic acid sequences each encoding a different peptide, wherein each of the three different peptides can bind to a different target protein. In yet another example, recombinant polynucleic acid or RNA constructs can comprise three nucleic acid sequences each encoding a different peptide, wherein two of the three different peptides can bind to the same target protein (e.g., target protein A) and the other one of the three different peptides can bind to a different target protein (e.g., target protein B).

[0082] In some embodiments, recombinant polynucleic acid or RNA constructs can comprise atleast one nucleic acid sequence encoding a peptide comprising a first nucleic acid sequence encoding a first peptide and a second nucleic acid sequence encoding a second peptide. In this embodiment, the first peptide can bind to a first target protein and the second peptide can bind to a second target protein. In one embodiment, the first target protein and the second target protein may be the same. In another embodiment, the first target protein and the second target protein may be different.

[0083] In some embodiments, recombinant polynucleic acid or RNA constructs can comprise afirst nucleic acid sequence encoding a first peptide and a second nucleic acid sequence encoding a second peptide, optionally a third nucleic acid sequence encoding a third peptide. In some embodiments, the first peptide can bind to a first target protein and the second peptide can bind to a second target protein, optionally the third peptide can bind to the third target protein. InWSGR Docket No.: 57623-713.601 some embodiments, the first target protein and the second target protein, optionally the third target protein, may be the same. In some embodiments, the first target protein and the second target protein, optionally the third target protein, may be different from each other.

[0084] In some embodiments, the first peptide can bind to the first target protein, the secondpeptide can bind to the second target protein, and the third peptide can bind to the third target protein. In some embodiments, the first target protein, the second target protein, and the third target protein may be the same. In some embodiments, the first target protein, the second target protein, and the third target protein may be different from each other. In some embodiments, the first target protein and the second target protein may be different from the third target protein. In some embodiments, the first target protein and the third target protein may be different from the second target protein. In some embodiments, the second target protein and the third target protein may be different from the first target protein. In some embodiments, the first target protein and the second target protein may be the same and the first target protein and the second target protein may be different from the third target protein. In some embodiments, the first target protein and the third target protein may be the same and the first target protein and the third target protein may be different from the second target protein. In some embodiments, the second target protein and the third target protein may be the same and the second target protein and the third target protein may be different from the first target protein.

[0085] In some embodiments, recombinant polynucleic acid or RNA constructs that comprisestwo or more nucleic acid sequences each encoding a peptide can comprise a linker. In this embodiment, each of the two or more nucleic acid sequences encoding a peptide may be connected by a linker. In some embodiments, recombinant polynucleic acid or RNA constructs that comprises a first nucleic acid sequence encoding a first peptide and a second nucleic acid sequence encoding a second peptide, optionally a third nucleic acid sequence encoding a third peptide can comprise a linker. In this embodiment, the first nucleic acid sequence encoding the first peptide and the second nucleic acid sequence encoding the second peptide, optionally the third nucleic acid sequence encoding the third peptide may be connected by a linker. Details of linkers that can be used are described in the “Linker” section. In some embodiments, a linker described herein can comprise a peptide linker. For example, a linker can comprise a sequence comprising GGS (Peptide Linker A, SEQ ID NO: 131). In some embodiments, a linker can comprise a flexible linker. For example, a linker can comprise a sequence comprising GGGGSGGGGSGGGGS (Peptide Linker B, SEQ ID NO: 133). In some embodiments, a linker described herein can connect two or more petide sequences. In some embodiments, In some embodiments, a linker described herein can comprise a nucleic acid sequence comprising a sequence comprising SEQ ID NO: 132 or SEQ ID NO: 134.WSGR Docket No.: 57623-713.601

[0086] In some embodiments, recombinant polynucleic acid constructs described herein can becircular. In some embodiments, recombinant polynucleic acid constructs described herein can be linear. In some embodiments, recombinant polynucleic acid constructs described herein can be recombinant DNA constructs. In some embodiments, recombinant polynucleic acid constructs described herein can be recombinant RNA constructs.

[0087] In some embodiments, recombinant polynucleic acid constructs comprising at least onenucleic acid sequence encoding a peptide described herein can further comprise a promoter. In some embodiments, the promoter may be upstream of the at least one nucleic acid sequence encoding the peptide. Non-limiting examples of promoters can include T3, T7, SP6, P60, Syn5, and KP34, etc. In some embodiments, recombinant polynucleic acid constructs can comprise a T3 promoter. In some embodiments, recombinant polynucleic acid constructs can comprise a SP6 promoter. In some embodiments, recombinant polynucleic acid constructs can comprise a P60 promoter. In some embodiments, recombinant polynucleic acid construct can comprise a Syn5 promoter. In some embodiments, recombinant polynucleic acid construct can comprise a KP34 promoter. In a preferred embodiment, recombinant polynucleic acid construct can comprise a T7 promoter. In some embodiments, the T7 promoter can comprise a sequence comprising TAATACGACTCACTATA (SEQ ID NO: 76).

[0088] In some embodiments, recombinant polynucleic acid constructs described herein can berecombinant RNA constructs. In some embodiments, recombinant polynucleic acid constructs described herein can be recombinant RNA constructs lacking a promoter. In some embodiments, the recombinant RNA construct can be a naked RNA.

[0089] In some embodiments, recombinant RNA constructs described herein can comprise a 5’cap (e.g., an anti-reverse CAP analog (ARCA), Clean Cap, Cap 0, Cap 1, Cap 2, or Locked Nucleic Acid cap (LNA-cap), etc.), an internal ribosome entry site (IRES), and / or a poly(A) tail In some embodiments, recombinant RNA constructs can have further regions promoting translation known to any skilled artisan. In some embodiments, 5’ cap can comprise an ARCA, Clean Cap, Cap 0, Cap 1, Cap 2, or Locked Nucleic Acid cap (LNA-cap). In some embodiments, 5’ cap can comprise m27,3'-OG(5')ppp(5')G, m7G, m7G(5’)G, m7GpppG, or m7GpppGm. In some embodiments, recombinant RNA constructs described herein can comprise an IRES upstream or 5’ of a nucleic acid sequence encoding a peptide. In some embodiments, recombinant RNA constructs describe herein can comprise an IRES immediately upstream or 5’ of a nucleic acid sequence encoding a peptide.

[0090] In some embodiments, recombinant RNA constructs described herein may not comprisea nucleotide variant. In some embodiments, recombinant RNA constructs described herein may comprise one or more uridines. In some embodiments, recombinant RNA constructs describedWSGR Docket No.: 57623-713.601 herein may comprise a modified uridine. In some embodiments, recombinant RNA constructs described herein may not comprise a modified uridine. In some embodiments, recombinant RNA constructs described herein may comprise one or more N1-methylpseudouridines. In some embodiments, recombinant RNA constructs described herein may not comprise one or more N1- methylpseudouridines. In some embodiments, between 99% and 1%, between 98% and 2%, between 97% and 3%, between 96% and 4%, between 95% and 2%, between 94% and 6%, between 93% and 7%, between 92% and 8%, between 91% and 9%, between 90% and 10%, between 97% and 3%, of the one or more uridines comprised in the recombinant RNA constructs may be unmodified. In some embodiments, between 99% and 1%, between 98% and 2%, between 97% and 3%, between 96% and 4%, between 95% and 2%, between 94% and 6%, between 93% and 7%, between 92% and 8%, between 91% and 9%, between 90% and 10%, between 97% and 3%, of the one or more uridines comprised in the recombinant RNA constructs may be modified. In some embodiments, at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% of one or more uridines comprised in the recombinant RNA constructs may be unmodified. In some embodiments, at most 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% of one or more uridines comprised in the recombinant RNA constructs may be modified. In one embodiment, recombinant RNA constructs described herein can comprise solely unmodified nucleotides. For example, recombinant RNA constructs described herein can comprise only natural nucleotides. For example, recombinant RNA constructs described herein can comprise only canonical nucleotides. In some embodiments, recombinant RNA constructs described herein can comprise one or more uridines, wherein all of one or more uridines are unmodified. In another embodiment, recombinant RNA constructs described herein can comprise solely modified nucleotides. In some embodiments, recombinant RNA constructs described herein can comprise one or more uridines, wherein all of one or more uridines are modified.

[0091] In some embodiments, modified nucleosides can include m5C (5-methylcytidine). Inanother embodiment, the modified nucleoside is m5U (5-methyluridine). In another embodiment, the modified nucleoside is m6A (N6-methyladenosine). In another embodiment, the modified nucleoside is s2U (2-thiouridine). In another embod (pseudouridine). In some embodiment, modified nucleosides can include -O- methyluridine). In some embodiments, modified nucleoside can include m1A (1-methyladenosine); m2A (2- -O-methyladenosine); ms2m6A (2-methylthio-N6-methyladenosine); i6A (N6-isopentenyladenosine); ms2m6A (2-methylthio-WSGR Docket No.: 57623-713.601 N6isopentenyladenosine); io6A (N6-(cis-hydroxyisopentenyl)adenosine); ms2io6A (2-methylthio- N6-(cis-hydroxyisopentenyl) adenosine); g6A (N6-glycinylcarbamoyladenosine); t6A (N6- threonylcarbamoyladenosine); ms2t6A (2-methylthio-N6-threonylcarbamoyladenosine); m6t6A (N6-methyl-N6-threonylcarbamoyladenosine); hn6A(N6-hydroxynorvalylcarbamoyladenosine); ms2hn6A (2-methylthio-N6-hydroxynorvalylcarbamoyladenosine); -O-ribosyladenosine (phosphate)); I (inosine); m1I (1-methylinosine); m1-O-dimethylinosine); m3C (3- -O-methylcytidine); s2C (2-thiocytidine); ac4C (N4-acetylcytidine); f5C(5-formylcytidine); m5 -O-dimethylcytidine); ac4Cm (N4-acetyl- -O-methylcytidine);k2C (lysidine); m1G (1-methylguanosine); m2G (N2-methylguanosine); m7G (7- -O-methylguanosine); m22G (N2,N2-dimethylguanosine); m2Gm(N2 -O-dimethylguanosine); m2 2Gm (N2,N2 -O-trim -O-ribosylguanosine (phosphate)); yW (wybutosine); o2yW (peroxywybutosine); OHyW (hydroxywybutosine); OHyW* (undermodified hydroxywybutosine); imG (wyosine); mimG (methylwyosine); Q (queuosine); oQ (epoxyqueuosine); galQ (galactosyl-queuosine); manQ (mannosyl-queuosine); preQ0(7-cyano-7-deazaguanosine); preQ1(7-aminomethyl-7-deazaguanosine); G (archaeosine); D (dihydrouridine); m5 -O-dimethyluridine); s4U (4-thiouridine); m5s2U (5-methyl-2-thiouridine); s2Um (2-thio- -O-methyluridine); acp3U (3-(3-amino-3-carboxypropyl)uridine); ho5U (5-hydroxyuridine); mo5U (5-methoxyuridine); cmo5U (uridine 5-oxyacetic acid); mcmo5U (uridine 5-oxyacetic acid methyl ester); chm5U (5- (carboxyhydroxymethyl)uridine)); mchm5U (5-(carboxyhydroxymethyl)uridine methyl ester);mcm5U (5-methoxycarbonylmethyluridine); mcm5Um (5-methoxycarbonylmethyl- -O-methyluridine); mcm5s2U (5-methoxycarbonylmethyl-2-thiouridine); nm5s2U (5-aminomethyl- 2-thiouridine); mnm5U (5-methylaminomethyluridine); mnm5s2U (5-methylaminomethyl-2- thiouridine); mnm5se2U (5-methylaminomethyl-2-selenouridine); ncm5U (5-carbamoylmethyluridine); ncm5Um (5-carbamoylmethyl- -O-methyluridine); cmnm5U (5-carboxymethylaminomethyluridine); cmnm5Um (5-carboxymethylaminomethyl- -O-methyluridine); cmnm5s2U (5-carboxymethylaminomethyl-2-thiouridine); m62A (N6,N6- -O-methylinosine); m4C (N4-methylcytidine); m4Cm (N4-O- dimethylcytidine); hm5C (5-hydroxymethylcytidine); m3U (3-methyluridine); cm5U (5-carboxymethyluridine); m6Am (N6 -O-dimethyladenosine); m6 2Am (N6,N6,O- -trimethyladenosine); m2,7G (N2,7-dimethylguanosine); m2,2,7G (N2,N2,7-trimethylguanosine);m3 -O-dimethyluridine); m5D (5-methyldihydrouridine); f5Cm (5-formyl- -O-methylcytidine); m1 -O-dimethylguanosine); m1 -O- 5U(5- 5s2U (5-taurinomethyl-2-thiouridine)); imG-14 (4-demethylwyosine); imG2 (isowyosine); or ac6A (N6-acetyladenosine).WSGR Docket No.: 57623-713.601

[0092] In some embodiments, recombinant RNA constructs described herein can include one ormore nucleotide variants, including nonstandard nucleotide(s), non–natural nucleotide(s), nucleotide analog(s), and / or modified nucleotides. Examples of modified nucleotides include, but are not limited to diaminopurine, 5–fluorouracil, 5–bromouracil, 5–chlorouracil, 5– iodouracil, hypoxanthine, xantine, 4–acetylcytosine, 5–(carboxyhydroxylmethyl)uracil, 5– carboxymethylaminomethyl–2–thiouridine, 5–carboxymethylaminomethyluracil, dihydrouracil, beta–D–galactosylqueosine, inosine, N6–isopentenyladenine, 1–methylguanine, 1– methylinosine, 2,2–dimethylguanine, 2–methyladenine, 2–methylguanine, 3–methylcytosine, 5– methylcytosine, N6–methyladenosine, 7–methylguanine, 5–methylaminomethyluracil, 5– methoxyaminomethyl–2–thiouracil, beta–D–mannosylqueosine, 5’– methoxycarboxymethyluracil, 5–methoxyuracil, 2–methylthio–N6–isopentenyladenine, uracil– 5–oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2–thiocytosine, 5–methyl–2– thiouracil, 2–thiouracil, 4–thiouracil, 5–methyluracil, uracil–5–oxyacetic acid methylester, 5– methyl–2–thiouracil, 3–(3–amino–3–N–2–carboxypropyl) uracil, (acp3)w, 2,6–diaminopurine,N1-methylpseudouridine, and the like. In some cases, nucleotides can include modifications in their phosphate moieties, including modifications to a triphosphate moiety. Non–limiting examples of such modifications can include phosphate chains of greater length and modifications with thiol moieties. In some embodiments, phosphate chains can comprise 4, 5, 6, 7, 8, 9, 10 or more phosphate moieties. In some embodiments, thiol moieties can include but are not limited to alpha–thiotriphosphate and beta–thiotriphosphates. In some embodiments, recombinant RNA constructs described herein may not comprise 5–methylcytosine and / or N6– methyladenosine.

[0093] In some embodiments, recombinant RNA constructs described herein may be modifiedat the base moiety, sugar moiety, or phosphate backbone. For example, modifications can be at one or more atoms that typically are available to form a hydrogen bond with a complementary nucleotide and / or at one or more atoms that are not typically capable of forming a hydrogen bond with a complementary nucleotide. In some embodiments, backbone modifications can include, but are not limited to, a phosphorothioate, a phosphorodithioate, a phosphoroselenoate, a phosphorodiselenoate, a phosphoroanilothioate, a phosphoraniladate, a phosphoramidate, and a phosphorodiamidate linkage. A phosphorothioate linkage can substitute a sulfur atom for a non- bridging oxygen in the phosphate backbone and delay nuclease degradation of oligonucleotides. can prevent nuclease recognition and degradation. In some embodiments, backbone modifications can include having peptide bonds instead of phosphorous in the backbone structure, or linking groups including carbamate, amides, and linear and cyclic hydrocarbon groups. For example, N-(2-aminoethyl)-glycine units may beWSGR Docket No.: 57623-713.601linked by peptide bonds in a peptide nucleic acid. Oligonucleotides with modified backbones arereviewed in Micklefield, Backbone modification of nucleic acids: synthesis, structure and therapeutic applications, Curr. Med. Chem., 8 (10): 1157-79, 2001 and Lyer et al., Modified oligonucleotides-synthesis, properties and applications, Curr. Opin. Mol. Ther., 1 (3): 344-358, 1999.

[0094] In some embodiments, recombinant RNA constructs described herein can contain acombination of modified and unmodified nucleotides. In some embodiments, the modified NTPs can comprise N1-methylpseudouridine, pseudouridine, N1-Ethylpseudouridine, N1- Methoxymethylpseudouridine, N1-Propylpseudouridine, 2-thiouridine, 4-thiouridine, 5- methoxyuridine, 5-methylurdine, 5-carboxymethylesteruridine, 5-formyluridine, 5- carboxyuridine, 5-hydroxyuridine, 5-Bromouridine, 5-Iodouridine, 5,6-dihydrouridine, 6- Azauridine, Thienouridine, 3-methyluridine, 1-carboxymethyl-pseudouridine, 4-thio-1-methyl- pseudouridine, 2-thio-1-methyl-pseudouridine, dihydrouridine, dihydropseudouridine, 2- methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio- pseudouridine, 5-methylcytidine, 5-methoxycytidine, 5-hydroxymethylcytidine, 5- formylcytidine, 5-carboxycytidine, 5-hydroxycytidine, 5-Iodocytidine, 5-Bromocytidine, 2- thiocytidine, 5-azacytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetylcytidine, 5- formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl-pseudoisocytidine, 4- methoxy-pseudoisocytidine, and 4-methoxy-1-methyl-pseudoisocytidine, N1-methyladenosine, N6-methyladenosine, N6-methyl-2-Aminoadenosine, N6-isopentenyladenosine, N6,N6- dimethyladenosine, 7-methyladenine, 2-methylthio-adenine, or 2-methoxy-adenine.

[0095] In some embodiments, in such a modified recombinant RNA construct, 1 to 100%,preferably 10 to 100%, more preferably 50 to 100%, even more preferably 90 to 100%, most preferably 100% of the uridine nucleotides may be modified. In some embodiments, recombinant RNA constructs transcribed from any recombinant polynucleic acid or DNA constructs described herein may comprise modified uridines. In a preferred embodiment, 100% of uridine nucleotides in recombinant RNA constructs transcribed from any recombinant polynucleic acid or DNA constructs described herein may be modified. In some embodiments, the adenosine-, guanosine-, and cytidine-containing nucleotides may be unmodified or partiallymodified, and they may be preferably present in unmodified form. Preferably, the content of themodified uridine nucleotides in the recombinant RNA construct may lie in a range from 5 to 25%. Non-limiting examples of the modified uridine nucleotides may comprise pseudouridines, N1-Methylpseudouridines, or N1-methylpseudo-UTP. In some embodiments, any modified uridine nucleotides known in the art may be utilized. In some embodiments, recombinant RNA constructs may contain a combination of modified and unmodified nucleotides, wherein in suchWSGR Docket No.: 57623-713.601 a modified recombinant RNA construct, 1 to 100%, preferably 10 to 100%, more preferably 50 to 100%, even more preferably 90 to 100%, most preferably 100% of the uridine nucleotides may comprise pseudouridines, N1-Methylpseudouridines, N1-methylpseudo-UTP, or any other modified uridine nucleotide known in the art. In some embodiments, recombinant RNA constructs may contain a combination of modified and unmodified nucleotides, wherein in such a modified recombinant RNA construct, 1 to 100%, preferably 10 to 100%, more preferably 50 to 100%, even more preferably 90 to 100%, most preferably 100% of the uridine nucleotides may comprise N1-Methylpseudouridines. In some embodiments, recombinant RNA constructs described herein may comprise N1-Methylpseudouridines. In a preferred embodiment, 100% of uridine nucleotides in recombinant RNA constructs described herein may be modified to N1- Methylpseudouridines.

[0096] In some embodiments, recombinant polynucleic acid, DNA, or RNA constructs canfurther comprise a nucleic acid sequence encoding a poly(A) tail. In some embodiments, poly(A) tail can comprise about 1, 3, 5, 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, or about 220 base pairs of poly(A). In some embodiments, poly(A) tail can comprise about 1 to about 220 base pairs of poly(A). In some embodiments, poly(A) tail can comprise 1 to 20, 1 to 40, 1 to 60, 1 to 80, 1 to 100, 1 to 120, 1 to 140, 1 to 160, 1 to 180, 1 to 200, 1 to 220, 20 to 40, 20 to 60, 20 to 80, 20 to 100, 20 to 120, 20 to 140, 20 to 160, 20 to 180, 20 to 200, 20 to 220, 40 to 60, 40 to 80, 40 to 100, 40 to 120, 40 to 140, 40 to 160, 40 to 180, 40 to 200, 40 to 220, 60 to 80, 60 to 100, 60 to 120, 60 to 140, 60 to 160, 60 to 180, 60 to 200, 60 to 220, 80 to 100, 80 to 120, 80 to 140, 80 to 160, 80 to 180, 80 to 200, 80 to 220, 100 to 120, 100 to 140, 100 to 160, 100 to 180, 100 to 200, 100 to 220, 120 to 140, 120 to 160, 120 to 180, 120 to 200, 120 to 220, 140 to 160, 140 to 180, 140 to 200, 140 to 220, 160 to 180, 160 to 200, 160 to 220, 180 to 200, 180 to 220, or 200 to 220 base pairs of poly(A). In some embodiments, poly(A) tail can comprise about 1, 3, 10, 20, 40, 60, 80, 100, 120, 140, 160, 180, 200, or 220 base pairs of poly(A). In some embodiments, poly(A) tail can comprise at least about 1, 3, 10, 20, 40, 60, 80, 100, 120, 140, 160, 180, or at least about 200 base pairs of poly(A). In some embodiments, poly(A) tail can comprise at most about 20, 40, 60, 80, 100, 120, 140, 160, 180, 200, or at most about 220 base pairs of poly(A). In a preferred embodiment, the poly(A) tail can comprise about 120 base pairs of poly(A).

[0097] In some embodiments, recombinant polynucleic acid, DNA, or RNA constructs canfurther comprise a Kozak sequence. In some embodiments, a Kozak sequence can comprise a sequence comprising GCCACC (SEQ ID NO: 75).WSGR Docket No.: 57623-713.601

[0098] In some embodiments, recombinant polynucleic acid, DNA, or RNA constructs describedherein may be codon-optimized. In general, codon optimization refers to a process of modifying a nucleic acid sequence for expression in a host cell of interest by replacing at least one codon (e.g., more than 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more codons) of a native sequence with codons that are more frequently or most frequently used in the genes of that host cell while maintaining the native amino acid sequence. Codon usage tables are readily available, for example, at the “Codon Usage Database,” and these tables can be adapted in a number of ways. Computer algorithms for codon optimizing a particular sequence for expression in a particular host cell are also available, such as Gene Forge®(Aptagen, PA) and GeneOptimizer®(ThermoFischer, MA) which is preferred. In some embodiments, recombinant polynucleic acid, DNA, or RNA constructs may not be codon-optimized. Peptide, target protein, and binding partner

[0099] Provided herein are recombinant polynucleic acid or RNA constructs comprising at leastone nucleic acid sequence encoding a peptide that can bind to a target protein. In some embodiments, the peptide can bind to a target protein to form an interactome. In some embodiments, an interactome can comprise a complex comprising the target protein and the binding partner. In some embodiments, a peptide described herein can bind to a target protein and modulate binding of the target protein to a binding partner, thereby modulating formation of an interactome, wherein the interactome can comprise a complex comprising the target protein and the binding partner. In some embodiments, a peptide described herein can comprise a fragment of a binding partner of the target protein. In some embodiments, a peptide expressed or encoded by any recombinant polynucleic acid or RNA constructs described herein can comprise a fragment of a binding partner of the target protein.

[0100] In some embodiments, a target protein described herein can comprise a human protein.In some embodiments, a target protein can comprise rapidly accelerated fibrosarcoma (RAF), rat sarcoma virus (RAS), mitogen-activated protein kinase kinase (MEK), extracellular signal- regulated kinase 1 / 2 (ERK), p53, mouse double minute 2 homolog (MDM2), MDM4, B-cellCLL / lymphoma 9- -Catenin, transcription factor 4 (TCF4), CREB bindingprotein (CBP), Histone 3.3 (H3.3), Fanconi anemia group D2 (FANCD2), optionally whereinthe FANCD2 is wild-type FANCD2, ubiquitin, T-cell receptor alpha (TCR- - or clusterof differentiation 3 gamma (CD3 ), , , or .

[0101] In some embodiments, a binding partner described herein can comprise RAF, RAS,MEK, ERK, p53, MDM2, MDM4, -Catenin, TCF4, CBP, H3.3, wild-type FANCD2,ubiquitin, TCR- - , , , , or a combination thereof.WSGR Docket No.: 57623-713.601

[0102] In some embodiments, RAF can comprise ARAF, BRAF, CRAF, or a combinationthereof. In some embodiments, RAS can comprise HRAS, NRAS, KRAS, or a combination thereof. In some embodiments, MEK can comprise MEK1, MEK2, or a combination thereof. In some embodiments, ERK can comprise ERK1, ERK2, or a combination thereof.

[0103] In one specific embodiment, a target protein can comprise MDM2, MDM4, or both and abinding partner can comprise p53. In some embodiments, p53 can comprise an amino acid sequence comprising SEQ ID NO: 84. In some embodiments, p53 can be encoded by a nucleic acid sequence comprising SEQ ID NO: 83. In some embodiments, MDM2 can comprise an amino acid sequence comprising SEQ ID NO: 86. In some embodiments, MDM2 can be encoded by a nucleic acid sequence comprising SEQ ID NO: 85. In some embodiments, MDM4 can comprise an amino acid sequence comprising SEQ ID NO: 88. In some embodiments, MDM4 can be encoded by a nucleic acid sequence comprising SEQ ID NO: 87.

[0104] In another specific embodiment, a target protein can comprise KRAS and a bindingpartner can comprise CRAF. In some embodiments, CRAF can comprise an amino acid sequence comprising SEQ ID NO: 80. In some embodiments, CRAF can be encoded by a nucleic acid sequence comprising SEQ ID NO: 79. In some embodiments, KRAS can comprise an amino acid sequence comprising SEQ ID NO: 82. In some embodiments, KRAS can be encoded by a nucleic acid sequence comprising SEQ ID NO: 81.

[0105] In another specific embodiment, a target protein can comprise ubiquitin and a bindingpartner can comprise FANCD2. In some embodiments, FANCD2 can comprise an amino acid sequence comprising SEQ ID NO: 224.

[0106] In another specific embodiment -Catenin and a bindingpartner can comprise BCL9L. In another specific embodiment, a target protein can comprise TCF4, BCL9L, or a combination thereof and a binding partner can comprise -Catenin. Inanother specific embodiment -Catenin and a binding partner cancomprise TCF4. In some embodiments, BCL9L can comprise an amino acid sequence comprising SEQ ID NO: 225. In some embodiments, -Catenin can comprise an amino acid sequence comprising SEQ ID NO: 226. In some embodiments, TCF4 can comprise an amino acid sequence comprising SEQ ID NO: 227.

[0107] In another specific embodiment, a target protein can comprise H3.3 and a binding partnercan comprise CBP. In another specific embodiment, a target protein can comprise CBP and a binding partner can comprise H3.3. In some embodiments, CBP can comprise an amino acid sequence comprising SEQ ID NO: 228. In some embodiments, H3.3 can comprise an amino acid sequence comprising SEQ ID NO: 229.WSGR Docket No.: 57623-713.601

[0108] In another specific embodiments, a target protein can comprise CD3, for example, CD3 ,, , , or a combination thereof, and a binding partner can comprise TCR, forexample, TCR- , TCR- , or a combination thereof. In some embodiments, TCR- can comprisean amino acid sequence comprising SEQ ID NO: 230. In some embodiments, TCR- cancomprise an amino acid sequence comprising SEQ ID NO: 231.

[0109] In some embodiments, a target protein can have an activity. In some embodiments, atarget protein can have an enzymatic activity. Non-limiting examples of an enzymatic activity can include a ubiquitination activity, a GTPase activity, a kinase activity, a histone acetyltransferase activity, or a combination thereof. In some embodiments, the binding of any peptide described herein to the target protein may not affect the enzymatic activity of the target protein. For example, the target protein can have an enzymatic activity and the binding of any peptide described herein to the target protein may not inhibit or promote the enzymatic activity of the target protein. In some embodiments, any peptide described herein may not bind to an active site of the target protein. In some embodiments, the active site of the target protein may not be a binding site of the peptide.

[0110] In some embodiments, a binding partner can have an activity. Non-limiting examples ofan activity can include a transcription activation, a transcription repression, an apoptosis induction, a signal transduction, a protein binding, a DNA binding, a ubiquitination, a GTPase activity, a kinase activity, a histone acetyltransferase activity, or a combination thereof.

[0111] In some embodiments, a peptide expressed or encoded by any recombinant polynucleicacid or RNA constructs described herein can comprise from about 1 to about 2000 amino acid residues. For example, a peptide expressed or encoded by any recombinant polynucleic acid or RNA constructs described herein can comprise from about 10 to about 1100 amino acid residues. For example, a peptide expressed or encoded by any recombinant polynucleic acid or RNA constructs described herein can comprise at least about 1, about 5, about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 110, about 120, about 130, about 140, about 150, about 160, about 170, about 180, about 190, about 200, about 210, about 220, about 230, about 240, about 250, about 260, about 270, about 280, about 290, about 300, about 310, about 320, about 330, about 340, about 350, about 360, about 370, about 380, about 390, about 400, about 410, about 420, about 430, about 440, about 450, about 460, about 470, about 480, about 490, about 500, about 510, about 520, about 530, about 540, about 550, about 560, about 570, about 580, about 590, about 600, about 610, about 620, about 630, about 640, about 650, about 660, about 670, about 680, about 690, about 700, about 710, about 720, about 730, about 740, about 750, about 760, about 770, about 780, about 790, about 800, about 810, about 820, about 830, about 840, about 850, about 860, about 870, aboutWSGR Docket No.: 57623-713.601 880, about 890, about 900, about 910, about 920, about 930, about 940, about 950, about 960, about 970, about 980, about 990, about 1000, about 1100, about 1200, about 1300, about 1400,or at least about 1500 amino acid residues. In some embodiments, the peptide can comprise atleast about 10 amino acid residues. In some embodiments, the peptide can comprise at least 75, at least 128, at least 150, or at least 355 amino acid residues. In some embodiments, the peptide can comprise at least 14, at least 28, at least 40, at least 83, at least 125, or at least 166 amino acid residues. In some embodiments, the peptide can comprise at least 349, at least 400, at least 450, or at least 1018 amino acid residues. In some embodiments, the peptide can comprise comprises at least 29, at least 300, at least 500, or at least 510 amino acid residues. In some embodiments, the peptide can comprise at least 200, at least 306, or at least 484 amino acid residues. In some embodiments, the peptide can comprise at least 219 or at least 300 amino acid residues. In some embodiments, the peptide can comprise at least 189 or at least 200 amino acid residues. In some embodiments, the peptide can comprise at least 44, at least 66, or at least 77 amino acid residues.

[0112] For example, a peptide expressed or encoded by any recombinant polynucleic acid orRNA constructs described herein can comprise at most about 5, about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 110, about 120, about 130, about 140, about 150, about 160, about 170, about 180, about 190, about 200, about 210, about 220, about 230, about 240, about 250, about 260, about 270, about 280, about 290, about 300, about 310, about 320, about 330, about 340, about 350, about 360, about 370, about 380, about 390, about 400, about 410, about 420, about 430, about 440, about 450, about 460, about 470, about 480, about 490, about 500, about 510, about 520, about 530, about 540, about 550, about 560, about 570, about 580, about 590, about 600, about 610, about 620, about 630, about 640, about 650, about 660, about 670, about 680, about 690, about 700, about 710, about 720, about 730, about 740, about 750, about 760, about 770, about 780, about 790, about 800, about 810, about 820, about 830, about 840, about 850, about 860, about 870, about 880, about 890, about 900, about 910, about 920, about 930, about 940, about 950, about 960, about 970, about 980, about 990, about 1000, about 1100, about 1200, about 1300, about 1400, about 1500, about 1600, about 1700, about 1800, about 1900, or at most about 2000 amino acid residues. In some embodiments, the peptide can comprise at most about 1500 amino acid residues. In some embodiments, the peptide can comprise at most 75, at most 128, at most 150, or at most 355 amino acid residues. In some embodiments, the peptide can comprise at most 14, at most 28, at most 40, at most 83, at most 125, or at most 166 amino acid residues. In some embodiments, the peptide can comprise at most 349, at most 400, at most 450, or at most 1018 amino acid residues. In some embodiments, the peptide can comprise comprises at most 29, at most 300, atWSGR Docket No.: 57623-713.601 most 500, or at most 510 amino acid residues. In some embodiments, the peptide can comprise at most 200, at most 306, or at most 484 amino acid residues. In some embodiments, the peptide can comprise at most 219 or at most 300 amino acid residues. In some embodiments, the peptide can comprise at most 189 or at most 200 amino acid residues. In some embodiments, the peptide can comprise at most 44, at most 66, or at most 77 amino acid residues.

[0113] In some embodiments, a peptide described herein can bind to a target protein with a Kdof less than 500 nM, 450 nM, 400 nM, 350 nM, 300 nM, 250 nM, 200 nM, 150 nM, 100 nM, 90 nM, 80 nM, 70 nM, 60 nM, 50 nM, 40 nM, 30 nM, 20 nM, 10 nM, 9 nM, 8 nM, 7 nM, 6 nM, 5 nM, 4 nM, 3 nM, 2 nM, 1 nM, 0.95 nM, 0.9 nM, 0.85 nM, 0.8 nM, 0.75 nM, 0.7 nM, 0.65 nM, 0.6 nM, 0.55 nM, 0.5 nM, 0.45 nM, 0.4 nM, 0.35 nM, 0.3 nM, 0.25 nM, 0.2 nM, 0.15 nM, 0.1 nM, 0.095 nM, 0.09 nM, 0.085 nM, 0.08 nM, 0.075 nM, 0.07 nM, 0.065 nM, 0.06 nM, 0.055 nM, 0.05 nM, 0.045 nM, 0.04 nM, 0.035 nM, 0.03 nM, 0.025 nM, 0.02 nM, 0.015 nM, 0.01 nM, 0.009 nM, 0.008 nM, 0.007 nM, 0.006 nM, 0.005 nM, 0.004 nM, 0.003 nM, 0.002 nM, or less than 0.001 nM.

[0114] In some embodiments, a peptide described herein can bind to a target protein with a Kdof from about 0.001 nM to about 0.01 nM, from about 0.001 nM to about 0.1 nM, from about 0.001 nM to about 1 nM, from about 0.001 nM to about 10 nM, from about 0.001 nM to about 50 nM, from about 0.001 nM to about 100 nM, from about 0.001 nM to about 150 nM, from about 0.001 nM to about 200 nM, from about 0.001 nM to about 300 nM, from about 0.001 nM to about 400 nM, from about 0.001 nM to about 500 nM, from about 0.01 nM to about 0.1 nM, from about 0.01 nM to about 1 nM, from about 0.01 nM to about 10 nM, from about 0.01 nM to about 50 nM, from about 0.01 nM to about 100 nM, from about 0.01 nM to about 150 nM, from about 0.01 nM to about 200 nM, from about 0.01 nM to about 300 nM, from about 0.01 nM to about 400 nM, from about 0.01 nM to about 500 nM, from about 0.1 nM to about 1 nM, from about 0.1 nM to about 10 nM, from about 0.1 nM to about 50 nM, from about 0.1 nM to about 100 nM, from about 0.1 nM to about 150 nM, from about 0.1 nM to about 200 nM, from about 0.1 nM to about 300 nM, from about 0.1 nM to about 400 nM, from about 0.1 nM to about 500 nM, from about 1 nM to about 10 nM, from about 1 nM to about 50 nM, from about 1 nM to about 100 nM, from about 1 nM to about 150 nM, from about 1 nM to about 200 nM, fromabout 1 nM to about 300 nM, from about 1 nM to about 400 nM, from about 1 nM to about 500nM, from about 10 nM to about 50 nM, from about 10 nM to about 100 nM, from about 10 nM to about 150 nM, from about 10 nM to about 200 nM, from about 10 nM to about 300 nM, from about 10 nM to about 400 nM, from about 10 nM to about 500 nM, from about 50 nM to about 100 nM, from about 50 nM to about 150 nM, from about 50 nM to about 200 nM, from about 50 nM to about 300 nM, from about 50 nM to about 400 nM, from about 50 nM to about 500 nM,WSGR Docket No.: 57623-713.601 from about 100 nM to about 150 nM, from about 100 nM to about 200 nM, from about 100 nM to about 300 nM, from about 100 nM to about 400 nM, from about 100 nM to about 500 nM, from about 150 nM to about 200 nM, from about 150 nM to about 300 nM, from about 150 nM to about 400 nM, from about 150 nM to about 500 nM, from about 200 nM to about 300 nM, from about 200 nM to about 400 nM, from about 200 nM to about 500 nM, from about 300 nM to about 400 nM, from about 300 nM to about 500 nM, or from about 400 nM to about 500 nM.

[0115] Protein binding affinity or Kd can be measured using any suitable methods known in theart. In some embodiments, protein binding affinity or Kd can be measured by any known protein binding assays including, but not limited to, radioligand binding assays, affinity chromatography, surface plasmon resonance, isothermal titration calorimetry, fluorescence energy resonance transfer method (FRET), or light-based techniques using absorbance, fluorescence, or luminescence readouts.

[0116] In some aspects, provided herein are peptides expressed or encoded by any recombinantpolynucleic acid or RNA constructs described herein. In some embodiments, peptides described herein can comprise an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% sequence identity any one of SEQ ID NOs: 25-48 or 179-222. In some embodiments, peptides described herein can comprise an amino acid sequence comprising any one of SEQ ID NOs: 25-48 or 179- 222. In some embodiments, peptides described herein can comprise an amino acid encoded by a nucleic acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1-24, 49-72, or 135-178. In some embodiments, peptides described herein can comprise an amino acid sequence encoded by a nucleic acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 93-116 or 242-285. Target motif

[0117] In some aspects, recombinant polynucleic acid or RNA constructs comprising at leastone nucleic acid sequence encoding a peptide described herein can further comprise at least one nucleic acid sequence encoding a target motif. The term “target motif” as used herein can refer to any short peptide present in the newly synthesized peptides or proteins that are destined to any parts of cell membranes, extracellular compartments, or intracellular compartments. Intracellular compartments include, but are not limited to, intracellular organelles such as nucleus, nucleolus, endosome, proteasome, ribosome, chromatin, nuclear envelope, nuclear pore, exosome, melanosome, Golgi apparatus, peroxisome, endoplasmic reticulum (ER),WSGR Docket No.: 57623-713.601 lysosome, centrosome, microtubule, mitochondria, chloroplast, microfilament, intermediate filament, or plasma membrane. Non-limiting examples of a target motif can include a signal peptide, a nuclear localization signal (NLS), a nucleolar localization signal (NoLS), a lysosomal targeting signal, a mitochondrial targeting signal, a peroxisomal targeting signal, a microtubule tip localization signal (MtLS), an endosomal targeting signal, a chloroplast targeting signal, a Golgi targeting signal, an endoplasmic reticulum (ER) targeting signal, a proteasomal targeting signal, a membrane targeting signal, a transmembrane targeting signal, or a centrosomal localization signal (CLS).

[0118] In some embodiments, the target motif can be selected from the group consisting of: (a) atarget motif heterologous to the binding partner, wherein the peptide is a fragment of the binding partner; (b) a target motif heterologous to the binding partner, wherein the peptide is a fragment of the binding partner, wherein the target motif heterologous to the binding partner is modified by insertion, deletion, and / or substitution of at least one amino acid; (c) a target motif homologous to the binding partner, wherein the peptide is a fragment of the binding partner, wherein the target motif homologous to the binding partner is modified by insertion, deletion, and / or substitution of at least one amino acid; and (d) a naturally occurring amino acid sequence which does not have the function of a target motif in nature, wherein the naturally occurring amino acid sequence is optionally modified by insertion, deletion, and / or substitution of at least one amino acid.

[0119] In some embodiments, the at least one nucleic acid sequence encoding a target motif maybe operably linked to the at least one nucleic acid sequence encoding the peptide. For example, a target motif or a nucleic acid sequence encoding a target motif can be operably linked to a nucleic acid sequence encoding a peptide, if it is expressed as preprotein or as a part of the peptide and participates in targeting the peptide to a cell membrane, intracellular, or an extracellular compartment.

[0120] In some embodiments, the target motif can comprise an NLS. In some embodiments, theNLS can be selected from the group consisting of: (a) an NLS heterologous to the binding partner, wherein the peptide is a fragment of the binding partner; (b) an NLS heterologous to the binding partner, wherein the peptide is a fragment of the binding partner, wherein the NLS heterologous to the binding partner is modified by insertion, deletion, and / or substitution of at least one amino acid; (c) an NLS homologous to the binding partner, wherein the peptide is a fragment of the binding partner, wherein the NLS homologous to the binding partner is modified by insertion, deletion, and / or substitution of at least one amino acid; and (d) a naturally occurring amino acid sequence which does not have the function of an NLS in nature, whereinWSGR Docket No.: 57623-713.601 the naturally occurring amino acid sequence is optionally modified by insertion, deletion, and / or substitution of at least one amino acid.

[0121] In some embodiments, an NLS or a nucleic acid sequence encoding an NLS may beoperably linked to a peptide coding sequence if it is expressed as a part of the peptide and participates in localizing the peptide encoded by the coding sequence to the nucleus.

[0122] In some embodiments, the peptide expressed from recombinant polynucleic acid or RNAconstructs further comprising at least one nucleic acid sequence encoding an NLS can localize to the nucleus of a cell expressing the recombinant polynucleic acid or RNA constructs. In some embodiments, the NLS can comprise an NLS of SV40, an NLS of p53, an NLS of c-Myc, an NLS of IGFBP3, or an NLS of TCF4. In some embodiments, an NLS of SV40 can comprise a sequence comprising SEQ ID NO: 123. In some embodiments, an NLS of p53 can comprise a sequence comprising SEQ ID NO: 124. In some embodiments, an NLS of c-Myc can comprise a sequence comprising SEQ ID NO: 125. In some embodiments, an NLS of IGFBP3 can comprise a sequence comprising SEQ ID NO: 126. In some embodiments, an NLS of TCF4 can comprise a sequence comprising SEQ ID NO: 288.

[0123] In some embodiments, the at least one nucleic acid sequence encoding the NLS may belocated at the 5’ end (or upstream) of the at least one nucleic acid sequence encoding the peptide or 3’ end (or downstream) of the at least one nucleic acid sequence encoding the peptide. In some embodiments, the at least one nucleic acid sequence encoding the NLS may be located at both the 5’ end (or upstream) of the at least one nucleic acid sequence encoding the peptide and 3’ end (or downstream) of the at least one nucleic acid sequence encoding the peptide.

[0124] In some embodiments, recombinant polynucleic acid or RNA constructs can comprisetwo or more nucleic acid sequences each encoding an NLS. In some embodiments, each of the two or more nucleic acid sequences may encode a different NLS, a same NLS, or a combination thereof. In one embodiment, each of the two or more nucleic acid sequences may encode the same NLS. In another embodiment, each of the two or more nucleic acid sequences may encode a different NLS. In yet another embodiment, two or more nucleic acid sequences may encode a combination of the same NLS and different NLS. For example, recombinant polynucleic acid or RNA constructs can comprise three nucleic acid sequences each encoding an NLS, wherein two of the three nucleic acid sequences each encoding an NLS can encode the same NLS and one of the three nucleic acid sequences each encoding an NLS can encode a different NLS.

[0125] In some embodiments, recombinant polynucleic acid or RNA constructs comprising twoor more nucleic acid sequences each encoding an NLS can further comprise one or more nucleic acid sequences each encoding a linker. In some embodiments, recombinant polynucleic acid or RNA constructs comprising two or more nucleic acid sequences each encoding an NLS canWSGR Docket No.: 57623-713.601 comprise a nucleic acid sequence encoding a linker between each of the two or more nucleic acid sequences encoding an NLS. In some embodiments, each of the two or more nucleic acid sequences encoding an NLS may be connected by a nucleic acid sequence encoding a linker. In some embodiments, a nucleic acid sequence encoding an NLS can comprise a sequence comprising SEQ ID NO: 132 or SEQ ID NO: 134.

[0126] In some embodiments, recombinant polynucleic acid or RNA constructs can comprise afirst nucleic acid sequence encoding a first NLS and a second nucleic acid sequence encoding a second NLS. In one embodiment, the first nucleic acid sequence encoding the first NLS may be located at the 5’ end of the at least one nucleic acid sequence encoding the peptide. In another embodiment, the second nucleic acid sequence encoding the second NLS may be located at the 3’ end of the at least one nucleic acid sequence encoding the peptide. In some embodiments, the first nucleic acid sequence encoding the first NLS may be located at the 5’ end of the at least one nucleic acid sequence encoding the peptide and the second nucleic acid sequence encoding the second NLS may be located at the 3’ end of the at least one nucleic acid sequence encoding the peptide.

[0127] In some embodiments, recombinant polynucleic acid or RNA constructs can comprise afirst nucleic acid sequence encoding a first NLS, a second nucleic acid sequence encoding a second NLS, a third nucleic acid sequence encoding a third NLS, and a fourth nucleic acid sequence encoding a fourth NLS. In this embodiment, the first nucleic acid sequence encoding the first NLS and the second nucleic acid sequence encoding the second NLS may be located at the 5’ end of the at least one nucleic acid sequence encoding the peptide. In this embodiment, the third nucleic acid sequence encoding the third NLS and the fourth nucleic acid sequence encoding the fourth NLS may be located at the 3’ end of the at least one nucleic acid sequence encoding the peptide.

[0128] In some embodiments, each of the first nucleic acid sequence encoding the first NLS, thesecond nucleic acid sequence encoding the second NLS, the third nucleic acid sequence encoding the third NLS, and the fourth nucleic acid sequence encoding the fourth NLS may be different. In some embodiments, each of the first nucleic acid sequence encoding the first NLS, the second nucleic acid sequence encoding the second NLS, the third nucleic acid sequence encoding the third NLS, and the fourth nucleic acid sequence encoding the fourth NLS may be the same.

[0129] In some embodiments, the first nucleic acid sequence encoding the first NLS and thesecond nucleic acid encoding the second NLS may be connected by a linker. In some embodiments, the third nucleic acid sequence encoding the third NLS and the fourth nucleic acid encoding the fourth NLS may be connected by a linker. For example, a recombinant polynucleicWSGR Docket No.: 57623-713.601 acid or RNA constructs described herein can comprise, from 5’ end to 3’ end, a first nucleic acid sequence encoding a first NLS, a nucleic acid sequence encoding a linker, a second nucleic acid sequence encoding a second NLS, a nucleic acid sequence encoding a peptide, a third nucleic acid sequence encoding a third NLS, a nucleic acid sequence encoding a linker, and a fourth nucleic acid sequence encoding a fourth NLS. In some embodiments, a nucleic acid sequence encoding a linker can comprise a sequence comprising SEQ ID NO:132 or SEQ ID NO: 134. Details of linkers that can be used are described in the “Linker” section. RNA interference and small interfering RNA (siRNA)

[0130] In some aspects, recombinant polynucleic acid or RNA constructs comprising at leastone nucleic acid sequence encoding a peptide described herein can further comprise at least one nucleic acid sequence encoding or comprising a small interfering RNA (siRNA) capable of binding to a target RNA. RNA interference (RNAi) or RNA silencing is a process in which RNA molecules inhibit gene expression or translation, by neutralizing target mRNA molecules. RNAi process is described in Mello & Conte (2004) Nature 431, 338-342, Meister & Tuschl (2004) Nature 431, 343-349, Hannon & Rossi (2004) Nature 431, 371-378, and Fire (2007) Angew. Chem. Int. Ed.46, 6966-6984. Briefly, in a natural process, the reaction initiates with a cleavage of long double-stranded RNA (dsRNA) into small dsRNA fragments or siRNAs with a hairpin structure (i.e., shRNAs) by a dsRNA-specific endonuclease Dicer. These small dsRNA fragments or siRNAs are then integrated into RNA-induced silencing complex (RISC) and guide the RISC to the target mRNA sequence. During interference, the siRNA duplex unwinds, and the anti-sense strand remains in complex with RISC to lead RISC to the target mRNA sequence to induce degradation and subsequent suppression of protein translation. Unlike commercially available synthetic siRNAs, siRNAs described herein can utilize endogenous Dicer and RISC pathway in the cytoplasm of a cell to get cleaved from recombinant RNA constructs (e.g., recombinant RNA constructs comprising at least nucleic acid sequence encoding a peptide and at least one nucleic acid comprising an siRNA) after cellular uptake and follow the natural process detailed above, as siRNAs in recombinant RNA constructs described herein can comprise a hairpin loop structure. In addition, as the rest of recombinant RNA constructs (i.e., at least one nucleic acid sequence encoding a peptide) is left intact after cleavage of siRNAs by Dicer, the desired peptide expression from the at least one nucleic acid sequence encoding a peptide in recombinant RNA constructs described herein is attained.

[0131] Provided herein are compositions comprising recombinant polynucleic acid or RNAconstructs comprising at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding or comprising a siRNA capable of binding to a target RNA. InWSGR Docket No.: 57623-713.601 some embodiments, the target RNA can comprise a noncoding RNA. In some embodiments, the target RNA can comprise a messenger RNA (mRNA). In some embodiments, an siRNA may be capable of binding to a target mRNA in the 5’ untranslated region. In some embodiments, an siRNA may be capable of binding to a target mRNA in the 3’ untranslated region. In some embodiments, an siRNA may be capable of binding to a target mRNA in an exon. In some embodiments, recombinant polynucleic acid or RNA constructs can comprise a nucleic acid sequence encoding or comprising a sense siRNA strand. In some embodiments, recombinant polynucleic acid or RNA constructs can comprise a nucleic acid sequence encoding or comprising an anti-sense siRNA strand. In some embodiments, recombinant polynucleic acid or RNA constructs can comprise a nucleic acid sequence encoding or comprising a sense siRNA strand and a nucleic acid sequence encoding or comprising an anti-sense siRNA strand. Details of siRNA comprised in the present invention are described in Cheng, et al. (2018) J. Mater. Chem. B., 6, 4638-4644, which is incorporated by reference herein.

[0132] In some embodiments, the target RNA can comprise a messenger RNA (mRNA). Insome embodiments, the target RNA can comprise an RNA encoding MDM2, an RNA encoding MDM4, or a combination thereof. In some embodiments, the target RNA can comprise an RNA encoding MDM2 and an RNA encoding MDM4. In some embodiments, the siRNA can comprise a sense strand sequence comprising SEQ ID NO: 89 or SEQ ID NO: 90. In some embodiments, the siRNA can comprise an anti-sense strand sequence comprising SEQ ID NO: 91 or SEQ ID NO: 92.

[0133] In some embodiments, recombinant polynucleic acid or RNA constructs can comprise atleast 1 species or copy of siRNA, i.e., a nucleic acid sequence encoding or comprising a sense strand of siRNA and a nucleic acid sequence encoding or comprising an anti-strand of siRNA.1 species or 1 copy of siRNA, as described herein, can refer to 1 species or 1 copy of sense strand siRNA and 1 species or 1 copy of anti-sense strand siRNA. In some embodiments, recombinant polynucleic acid or RNA constructs can comprise more than 1 species or 1 copy of siRNA, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more species or copies of siRNA encoding or comprising a sense strand of siRNA and an anti-strand of siRNA. In some embodiments, recombinant polynucleic acid or RNA constructs can comprise 1 to 20 species or copies of siRNA. In some embodiments, recombinant polynucleic acid or RNA constructs can comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or at least 10 species or copies of siRNA. In some embodiments, recombinant polynucleic acid or RNA constructs can comprise at most 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or at most 20 species or copies of siRNA. In some embodiments, recombinant polynucleic acid or RNA constructs can comprise from 1 to 2, from 1 to 3, from 1 to 4, from 1 to 5, from 1 to 6, from 1 to 7, from 1 to 8, from 1 to 9, from 1 to 10, from 2 to 3, from 2 to 4, from 2 to 5, from 2WSGR Docket No.: 57623-713.601 to 6, from 2 to 7, from 2 to 8, from 2 to 9, from 2 to 10, from 3 to 4, from 3 to 5, from 3 to 6, from 3 to 7, from 3 to 8, from 3 to 9, from 3 to 10, from 4 to 5, from 4 to 6, from 4 to 7, from 4 to 8, from 4 to 9, from 4 to 10, from 5 to 6, from 5 to 7, from 5 to 8, from 5 to 9, from 5 to 10, from 6 to 7, from 6 to 8, from 6 to 9, from 6 to 10, from 7 to 8, from 7 to 9, from 7 to 10, from 8 to 9, from 8 to 10, or from 9 to 10 species or copies of siRNA. In some embodiments, recombinant polynucleic acid or RNA constructs can comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 species or copies of siRNA. In some embodiments, recombinant polynucleic acid or RNA constructs can comprise at least 1, 2, 3, 4, 5, 6, 7, 8, or 9 species or copies of siRNA. In some embodiments, recombinant polynucleic acid or RNA constructs can comprise at most 2, 3, 4, 5, 6, 7, 8, 9, or 10 species or copies of siRNA. In some embodiments, recombinant polynucleic acid or RNA constructs can comprise between 2 siRNAs and 10 siRNAs, between 3 siRNAs and 10 siRNAs, between 4 siRNAs and 10 siRNAs, between 5 siRNAs and 10 siRNAs, between 6 siRNAs and 10 siRNAs, between 7 siRNAs and 10 siRNAs, between 9 siRNAs and 10 siRNAs, preferably between 2 siRNAs and 6 siRNAs, between 3 siRNAs and 6 siRNAs, or between 4 siRNAs and 6 siRNAs.

[0134] Provided herein are compositions of recombinant polynucleic acid or RNA constructscomprising at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding or comprising 1-20 or more siRNA species or copies, wherein each of the 1- 20 or more siRNA species or copies is capable of binding to a target RNA. In some embodiments, a target RNA is an mRNA or a non-coding RNA. In some embodiments, each of the siRNA species or copies binds to the same target RNA. In one embodiment, each of the siRNA species or copies can comprise the same sequence and bind to the same region or sequence of the same target RNA. For example, recombinant polynucleic acid or RNA constructs can comprise 1, 2, 3, 4, 5, or more siRNA species or copies and each of the 1, 2, 3, 4, 5, or more siRNA species or copies comprise the same sequence targeting the same region of a target RNA, i.e., recombinant polynucleic acid or RNA constructs can comprise 1, 2, 3, 4, 5, or more redundant species or copies of siRNA. In another embodiment, each of the siRNA species or copies can comprise a different sequence and bind to a different region or sequence of the same target RNA. For example, recombinant polynucleic acid or RNA constructs can comprise 1, 2, 3, 4, 5, or more siRNA species or copies and each of the 1, 2, 3, 4, 5, or more siRNA species or copies can comprise a different sequence targeting a different region of the same target RNA. In this example, one siRNA of the 1, 2, 3, 4, 5, or more siRNA species or copies may target exon 1 and another siRNA of the 1, 2, 3, 4, 5, or more siRNA species or copies may target exon 2 of the same mRNA, etc. In some embodiments, recombinant polynucleic acid or RNA constructs can comprise 1, 2, 3, 4, 5, or more siRNA species or copies capable of bindingWSGR Docket No.: 57623-713.601 to the same and different regions of the same target RNA. For example, recombinant polynucleic acid or RNA constructs can comprise 1, 2, 3, 4, 5, or more siRNA species or copies and 2 of the 1, 2, 3, 4, 5, or more siRNA species or copies can comprise the same sequence and bind to the same regions of the target RNA and 3 or more of the 1, 2, 3, 4, 5, or more siRNA species or copies can comprise a different sequence and bind to different regions of the same target RNA. In some embodiments, each of the siRNA species or copies binds to a different target RNA. In some embodiments, recombinant polynucleic acid or RNA constructs can comprise 1, 2, 3, 4, 5, or more siRNA species or copies capable of binding to the same and different target RNAs. For example, recombinant polynucleic acid or RNA constructs can comprise 1, 2, 3, 4, 5, or more siRNA species or copies and 2 of the 1, 2, 3, 4, 5, or more siRNA species or copies can comprise a sequence capable of binding to the same or different regions of the same target RNA and 3 or more of the 1, 2, 3, 4, 5, or more siRNA species or copies can comprise a sequence capable of binding to a different target RNA. In some embodiments, a target RNA may be an mRNA and / or a non-coding RNA. In some embodiments, each of the siRNA species or copies can comprise the same sequence that can bind to different target RNAs. For example, each of the siRNA species or copies may bind to a sequence common to, or shared by, two or more target RNAs. In some embodiments, each of the siRNA species or copies may be connected by a linker. Details of linkers that can be used are described in the “Linker” section.

[0135] In some aspects, recombinant polynucleic acid or RNA constructs described herein cancomprise at least one nucleic acid sequence encoding a peptide and at least one nucleic acidsequence encoding or comprising an siRNA capable of binding to a target RNA. In one embodiment, the target RNA can encode the target protein. In another embodiment, the target RNA can encode a protein that may not be the target protein. In some embodiments, the expression of the target protein encoded by the target RNA may be modulated by the siRNA. In some embodiments, the expression of the target protein encoded by the target RNA may be downregulated by the siRNA. For example, the expression of the target protein encoded by the target RNA may be downregulated by at least about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%,WSGR Docket No.: 57623-713.601 about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or at least about 99% in a cell comprising or expressing a recombinant polynucleic acid or RNA constructs comprising at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding or comprising an siRNA capable of binding to a target RNA compared to in a cell comprising or expressing a corresponding recombinant polynucleic acid or RNA constructs without at least one nucleic acid sequence encoding or comprising an siRNA capable of binding to a target RNA.

[0136] For example, the expression of the target protein encoded by the target RNA may bedownregulated by at most about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or at most about 99% in a cell comprising or expressing a recombinant polynucleic acid or RNA constructs comprising at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding or comprising an siRNA capable of binding to a target RNA compared to in a cell comprising or expressing a corresponding recombinant polynucleic acid or RNA constructs without at least one nucleic acid sequence encoding or comprising an siRNA capable of binding to a target RNA.

[0137] In some embodiments, the expression of the target protein encoded by the target RNAmay be downregulated by at least about 1.1-fold, about 1.2-fold, about 1.3-fold, about 1.4-fold, about 1.5-fold, about 1.6-fold, about 1.7-fold, about 1.8-fold, about 1.9-fold, about 2.0-fold, about 2.1-fold, about 2.2-fold, about 2.3-fold, about 2.4-fold, about 2.5-fold, about 2.6-fold, about 2.7-fold, about 2.8-fold, about 2.9-fold, about 3.0-fold, about 3.1-fold, about 3.2-fold, about 3.3-fold, about 3.4-fold, about 3.5-fold, about 3.6-fold, about 3.7-fold, about 3.8-fold, about 3.9-fold, about 4.0-fold, about 4.1-fold, about 4.2-fold, about 4.3-fold, about 4.4-fold, about 4.5-fold, about 4.6-fold, about 4.7-fold, about 4.8-fold, about 4.9-fold, about 5.0-fold, about 5.1-fold, about 5.2-fold, about 5.3-fold, about 5.4-fold, about 5.5-fold, about 5.6-fold, about 5.7-fold, about 5.8-fold, about 5.9-fold, about 6.0-fold, about 6.1-fold, about 6.2-fold,WSGR Docket No.: 57623-713.601 about 6.3-fold, about 6.4-fold, about 6.5-fold, about 6.6-fold, about 6.7-fold, about 6.8-fold, about 6.9-fold, about 7.0-fold, about 7.1-fold, about 7.2-fold, about 7.3-fold, about 7.4-fold, about 7.5-fold, about 7.6-fold, about 7.7-fold, about 7.8-fold, about 7.9-fold, about 8.0-fold, about 8.1-fold, about 8.2-fold, about 8.3-fold, about 8.4-fold, about 8.5-fold, about 8.6-fold, about 8.7-fold, about 8.8-fold, about 8.9-fold, about 9.0-fold, about 9.1-fold, about 9.2-fold, about 9.3-fold, about 9.4-fold, about 9.5-fold, about 9.6-fold, about 9.7-fold, about 9.8-fold, about 9.9-fold, or by at least about 10.0-fold in a cell comprising or expressing a recombinant polynucleic acid or RNA constructs comprising at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding or comprising an siRNA capable of binding to a target RNA compared to in a cell comprising or expressing a corresponding recombinant polynucleic acid or RNA constructs without at least one nucleic acid sequence encoding or comprising an siRNA capable of binding to a target RNA.

[0138] In some embodiments, the expression of the target protein encoded by the target RNAmay be downregulated by at most about 1.1-fold, about 1.2-fold, about 1.3-fold, about 1.4-fold, about 1.5-fold, about 1.6-fold, about 1.7-fold, about 1.8-fold, about 1.9-fold, about 2.0-fold, about 2.1-fold, about 2.2-fold, about 2.3-fold, about 2.4-fold, about 2.5-fold, about 2.6-fold, about 2.7-fold, about 2.8-fold, about 2.9-fold, about 3.0-fold, about 3.1-fold, about 3.2-fold, about 3.3-fold, about 3.4-fold, about 3.5-fold, about 3.6-fold, about 3.7-fold, about 3.8-fold, about 3.9-fold, about 4.0-fold, about 4.1-fold, about 4.2-fold, about 4.3-fold, about 4.4-fold, about 4.5-fold, about 4.6-fold, about 4.7-fold, about 4.8-fold, about 4.9-fold, about 5.0-fold, about 5.1-fold, about 5.2-fold, about 5.3-fold, about 5.4-fold, about 5.5-fold, about 5.6-fold, about 5.7-fold, about 5.8-fold, about 5.9-fold, about 6.0-fold, about 6.1-fold, about 6.2-fold, about 6.3-fold, about 6.4-fold, about 6.5-fold, about 6.6-fold, about 6.7-fold, about 6.8-fold, about 6.9-fold, about 7.0-fold, about 7.1-fold, about 7.2-fold, about 7.3-fold, about 7.4-fold, about 7.5-fold, about 7.6-fold, about 7.7-fold, about 7.8-fold, about 7.9-fold, about 8.0-fold, about 8.1-fold, about 8.2-fold, about 8.3-fold, about 8.4-fold, about 8.5-fold, about 8.6-fold, about 8.7-fold, about 8.8-fold, about 8.9-fold, about 9.0-fold, about 9.1-fold, about 9.2-fold, about 9.3-fold, about 9.4-fold, about 9.5-fold, about 9.6-fold, about 9.7-fold, about 9.8-fold, about 9.9-fold, or by at most about 10.0-fold in a cell comprising or expressing a recombinant polynucleic acid or RNA constructs comprising at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding or comprising an siRNA capable of binding to a target RNA compared to in a cell comprising or expressing a corresponding recombinant polynucleic acid or RNA constructs without at least one nucleic acid sequence encoding or comprising an siRNA capable of binding to a target RNA.WSGR Docket No.: 57623-713.601

[0139] In some embodiments, recombinant polynucleic acid or RNA constructs comprising atleast one nucleic acid sequence encoding the peptide and at least one nucleic acid sequence encoding or comprising the siRNA can further comprise a sequence encoding or comprising a linker. In some embodiments, the at least one nucleic acid sequence encoding the peptide and the at least one nucleic acid sequence encoding or comprising the siRNA may be separated by a linker (e.g., a first linker). Details of linkers that can be used are described in the “Linker” section.

[0140] In some embodiment, the at least one nucleic acid sequence encoding or comprising thesiRNA may be downstream or 3’ of the nucleic acid sequence encoding the peptide. In some embodiments, the at least one nucleic acid sequence encoding or comprising the siRNA may be upstream or 5’ of the nucleic acid sequence encoding the peptide.

[0141] In some embodiments, recombinant polynucleic acid or RNA constructs can comprisetwo or more nucleic acid sequences encoding or comprising an siRNA capable of binding to a target RNA. In this embodiment, each of the two or more nucleic acid sequences can encode or comprise an siRNA capable of binding to a same target RNA. In this embodiment, each of the two or more nucleic acid sequences can encode or comprise an siRNA capable of binding to a different target RNA.

[0142] In some embodiments, a linker (e.g., a second linker) can connect each of the two ormore nucleic acid sequences encoding or comprising the siRNA capable of binding to the target RNA. In some embodiments, a linker can be about 6 to about 80 nucleic acid residues in length. In some embodiments, the target RNA can encode the target protein. Details of linkers that can be used are described in the “Linker” section. Linker

[0143] In some embodiments, a linker described herein may have a structure of Formula (I)XmCAACAAXn, wherein X is any nucleotide, m is an integer from 1 to 12, and n is an integer from 0 to 4 (SEQ ID NO: 118). In some instances, a linker described herein may have a structure of Formula (II): XpTCCCXr, wherein X is any nucleotide, p is an integer from 0 to 17,and r is an integer from 0 to 13 (SEQ ID NO: 119). In some embodiments, a linker can comprisea sequence comprising ATAGTGAGTCGTATTAACAACAATCCC (SEQ ID NO: 77). In some embodiments, a linker can comprise a sequence comprising ACAACAATCCC (SEQ ID NO: 78). In some embodiments, a linker described herein can connect two or more nucleic acid sequences each encoding or comprising an siRNA.

[0144] In some embodiments, a linker described herein can comprise a peptide linker. Forexample, a linker can comprise a sequence comprising GGS (PeptideWSGR Docket No.: 57623-713.601 Linker A, SEQ ID NO: 131). In some embodiments, a linker can comprise a flexible linker. For example, a linker can comprise a sequence comprising GGGGSGGGGSGGGGS (Peptide Linker B, SEQ ID NO: 133). In some embodiments, a linker described herein can connect two or more target motifs (e.g., NLS).

[0145] In some embodiments, a linker can comprise a tRNA linker. The tRNA system isevolutionarily conserved across living organism and utilizes endogenous RNases P and Z to process multicistronic constructs (Dong et al., 2016). In some embodiments, tRNA linkers can comprise a nucleic acid sequence comprising AACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGG GTTCGATTCCCGGCTGGTGCA (SEQ ID NO: 120). In some embodiments, a linker can comprise a sequence comprising ATAGTGAGTCGTATTAACGTACCAACAA (SEQ ID NO: 121). In some embodiments, a linker can comprise a sequence comprising TTTATCTTAGAGGCATATCCCTACGTACCAACAA (SEQ ID NO: 122).

[0146] In some embodiments, linkers described herein may not form a secondary structure. Forexample, linkers described herein may not bind to or base-pairs with a nucleic acid sequence of recombinant polynucleic acid or RNA constructs provided herein. In some embodiments, linkers described herein may not form a secondary structure within linker sequences. For example, linkers described herein may not have base-pairing within linker sequences. In some embodiments, an RNA sequence of linkers described herein may not form a secondary structure according to RNAfold WebServer. In some embodiments, an siRNA sequence described herein may form a secondary structure according to RNAfold WebServer.

[0147] In some embodiments, the length of a linker may be from about 4 to about 50, fromabout 4 to about 45, from about 4 to about 40, from about 4 to about 35, or from about 4 to about 30 nucleotides. In some embodiments, the length of a linker may be from about 4 to about 27 nucleotides. In some embodiments, the length of a linker may be from about 4 to about 18 nucleotides. For example, the length of a linker may be about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, about 40, about 41, about 42, about 43, about 44, about 45, about 46, about 47, about 48, about 49, or about 50 nucleotides. In some embodiments, the length of a linker can be at most about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, aboutWSGR Docket No.: 57623-713.601 40, about 41, about 42, about 43, about 44, about 45, about 46, about 47, about 48, about 49, or at most about 50 nucleotides. In some embodiments, the length of a linker may be 4 nucleotides. In some embodiments, the length of a linker may be 7 nucleotides. In some embodiments, the length of a linker may be 11 nucleotides. In some embodiments, the length of a linker may be 12 nucleotides. In some embodiments, the length of a linker may be 18 nucleotides. In some embodiments, the length of a linker may be 16 nucleotides. In some embodiments, the length of a linker may be 17 nucleotides. In some embodiments, the length of a linker may be 20 nucleotides. In some embodiments, the length of a linker may be 23 nucleotides. In some embodiments, the length of a linker may be 27 nucleotides.

[0148] In some embodiments, recombinant RNA constructs described herein may be cleaved.For example, recombinant RNA constructs described herein may be cleaved endogenously after cellular uptake. In some embodiments, recombinant RNA constructs may be cleaved by an intracellular protein or an endogenous protein. In some embodiments, recombinant RNA constructs may be cleaved by DICER, e.g., an endogenous DICER.

[0149] In some embodiments, recombinant RNA constructs can comprise two or more nucleicacid sequences each encoding a peptide, wherein each of the two or more nucleic acid sequences encoding a peptide may be connected by a linker. In this embodiment, recombinant RNA constructs may be cleaved between each of the two or more nucleic acid sequences each encoding a peptide. In some embodiments, recombinant RNA constructs can comprise a first nucleic acid sequence encoding a first peptide, a second nucleic acid sequence encoding a second peptide, wherein the first nucleic acid sequence encoding the first peptide and the second nucleic acid sequence encoding the second peptide may be connected by a linker. In this embodiment, recombinant RNA constructs may be cleaved between the first nucleic acid sequence encoding the first peptide and the second nucleic acid sequence encoding the second peptide. In some embodiments, the cleavage of recombinant RNA constructs may be enhanced compared to the cleavage of a corresponding RNA construct that does not comprise a linker described herein. For example, the cleavage of recombinant RNA constructs comprising a first nucleic acid sequence encoding a first peptide, a second nucleic acid sequence encoding a second peptide, a linker that connects the first nucleic acid sequence and the second nucleic acid sequence may be enhanced compared to the cleavage of an RNA construct that does not comprise a linker described herein.

[0150] In some embodiments, recombinant RNA constructs comprising at least one nucleic acidsequence comprising an siRNA capable of binding to a target RNA described herein may be cleaved. In some embodiments, recombinant RNA constructs can comprise two or more nucleic acid sequences each comprising an siRNA capable of binding to a target RNA, wherein each ofWSGR Docket No.: 57623-713.601 the two or more nucleic acid sequences comprising an siRNA capable of binding to a target RNA may be connected by a linker. In this embodiment, recombinant RNA constructs may be cleaved between each of the two or more nucleic acid sequences comprising an siRNA. In some embodiments, recombinant RNA constructs can comprise a first nucleic acid sequencecomprising a first siRNA, a second nucleic acid sequence comprising a second siRNA, whereinthe first nucleic acid sequence comprising the first siRNA and the second nucleic acid sequencecomprising the second siRNA may be connected by a linker. In this embodiment, recombinantRNA constructs may be cleaved between the first nucleic acid sequence comprising the firstsiRNA and the second nucleic acid sequence comprising the second siRNA. In someembodiments, the cleavage of recombinant RNA constructs may be enhanced compared to the cleavage of a corresponding RNA construct that does not comprise a linker described herein. For example, the cleavage of recombinant RNA constructs comprising a first nucleic acid sequence comprising a first siRNA, a second nucleic acid sequence comprising a second siRNA, a linker that connects the first nucleic acid sequence and the second nucleic acid sequence may be enhanced compared to the cleavage of an RNA construct that does not comprise a linker described herein.

[0151] In some embodiments, recombinant RNA constructs comprising at least one nucleic acidsequence encoding a peptide and at least one nucleic acid sequence comprising an siRNA capable of binding to a target RNA described herein may be cleaved. For example, recombinant RNA constructs can comprise at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence comprising an siRNA capable of binding to a target RNA may be connected by a linker and cleaved between the at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence comprising an siRNA. In some embodiments, the cleavage of recombinant RNA constructs may be enhanced compared to the cleavage of a corresponding RNA construct that does not comprise a linker described herein. For example, the cleavage of recombinant RNA constructs comprising at least one nucleic acid sequence encoding a peptide, at least one nucleic acid sequence comprising an siRNA capable of binding to a target RNA, and a linker that connects the at least one nucleic acid sequence encoding a peptide and the at least one nucleic acid sequence comprising an siRNA may be enhanced compared to the cleavage of an RNA construct that does not comprise one or more linkers described herein.

[0152] In some embodiments, recombinant RNA constructs can comprise a first nucleic acidsequence encoding a first peptide, a second nucleic acid sequence encoding a second peptide, a first nucleic acid sequence comprising a first siRNA, and a second nucleic acid sequence comprising a second siRNA, wherein the first nucleic acid sequence encoding the first peptide,WSGR Docket No.: 57623-713.601 the second nucleic acid sequence encoding the second peptide, the first nucleic acid sequence comprising the first siRNA, and the second nucleic acid sequence comprising the second siRNA are connected by one or more linkers. In this embodiment, recombinant RNA constructs may be cleaved between each of the first nucleic acid sequence encoding the first peptide, the second nucleic acid sequence encoding the second peptide, the first nucleic acid sequence comprising the first siRNA, and the second nucleic acid sequence comprising the second siRNA. In some embodiments, the cleavage of recombinant RNA constructs may be enhanced compared to the cleavage of a corresponding RNA construct that does not comprise a linker described herein. For example, the cleavage of recombinant RNA constructs comprising a first nucleic acid sequence encoding a first peptide, a second nucleic acid sequence encoding a second peptide, a first nucleic acid sequence comprising a first siRNA, a second nucleic acid sequence comprising a second siRNA, and one or more linkers that connect the first nucleic acid sequence encoding the first peptide, the second nucleic acid sequence encoding the second peptide, the first nucleic acid sequence comprising the first siRNA, and the second nucleic acid sequence comprising the second siRNA may be enhanced compared to the cleavage of an RNA construct that does not comprise one or more linkers described herein. Recombinant polynucleic acid, DNA, or RNA construct sequences

[0153] In some embodiments, recombinant DNA constructs described herein can comprise anucleic acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1-24, 49-72, or 135-178. In some embodiments, recombinant DNA constructs described herein can comprise a nucleic acid sequence comprising any one of SEQ ID NOs: 1-24, 49-72, or 135-178.

[0154] In some embodiments, recombinant RNA constructs described herein can comprise anucleic acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 93-116 or 242-285. In some embodiments, recombinant RNA constructs described herein can comprise a nucleic acid sequence comprising any one of SEQ ID NOs: 93-116 or 242-285. In some embodiments, recombinant RNA constructs described herein can comprise an RNA sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% sequence identity to an RNA sequence encoded by the nucleic acid sequence comprising any one of SEQ ID NOs: 1-24, 49-72, or 135-178. In some embodiments, recombinant RNA constructs described herein can comprise an RNA sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%,WSGR Docket No.: 57623-713.601 96%, 97%, 98%, or at least 99% sequence identity to an RNA sequence encoded by the nucleic acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1-24, 49-72, or 135-178. In some embodiments, recombinant RNA constructs described herein can comprise an RNA sequence encoded by the nucleic acid sequence comprising any one of SEQ ID NOs: 1-24, 49-72, or 135-178. In some embodiments, recombinant RNA constructs described herein can comprise a nucleic acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1-24, 49-72, or 135-178, wherein all thymidines (Ts) are replaced with uridines (Us). In some embodiments, recombinant RNA constructs described herein can comprise a modified uridine. In some embodiments, a modified uridine can comprise N1-Methylpseudouridine.

[0155] In some aspects, recombinant polynucleic acid or RNA constructs described herein cancomprise at least one nucleic acid sequence encoding a peptide; wherein the peptide can be at least about 70 amino acid residues, wherein the peptide can bind to KRAS, and wherein the binding of the peptide to KRAS can modulate an interaction between CRAF and KRAS. In some aspects, recombinant polynucleic acid or RNA constructs described herein can comprise at least one nucleic acid sequence encoding a peptide; wherein the peptide can be at least about 70 amino acid residues, wherein the peptide can bind to KRAS, and wherein the binding of the peptide to KRAS can inhibit an interaction between CRAF and KRAS. In some embodiments, recombinant polynucleic acid constructs can comprise a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 1-4 or SEQ ID NOs: 49-52. In some embodiments, recombinant RNA constructs can comprise a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 93-96. In some embodiments, peptides expressed or encoded by recombinant polynucleic acid or RNA constructs can comprise an amino acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 25-28.WSGR Docket No.: 57623-713.601

[0156] In some aspects, recombinant polynucleic acid or RNA constructs described herein cancomprise at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding an NLS; wherein the peptide can be at least about 70 amino acid residues, wherein the peptide can bind to KRAS, and wherein the binding of the peptide to KRAS can modulate an interaction between CRAF and KRAS. In some aspects, recombinant polynucleic acid or RNA constructs described herein can comprise at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding an NLS; wherein the peptide can be at least about 70 amino acid residues, wherein the peptide can bind to KRAS, and wherein the binding of the peptide to KRAS can inhibit an interaction between CRAF and KRAS.

[0157] In some aspects, recombinant polynucleic acid or RNA constructs described herein cancomprise at least one nucleic acid sequence encoding a peptide; wherein the peptide cancomprise at least about 10 amino acid residues, wherein the peptide can bind to MDM2, andwherein the binding of the peptide to MDM2 can modulate an interaction between p53 and MDM2. In some aspects, recombinant polynucleic acid or RNA constructs described herein can comprise at least one nucleic acid sequence encoding a peptide; wherein the peptide can comprise at least about 10 amino acid residues, wherein the peptide can bind to MDM2, and wherein the binding of the peptide to MDM2 can inhibit an interaction between p53 and MDM2. In some embodiments, recombinant polynucleic acid constructs can comprise a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 5-10 or SEQ ID NOs: 53-58. In some embodiments, recombinant RNA constructs can comprise a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 97-102. In some embodiments, peptides expressed or encoded by recombinant polynucleic acid or RNA constructs can comprise an amino acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 29-34.

[0158] In some aspects, recombinant polynucleic acid or RNA constructs described herein cancomprise at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding an NLS; wherein the peptide can comprise at least about 10 amino acidWSGR Docket No.: 57623-713.601 residues, wherein the peptide can bind to MDM2, and wherein the binding of the peptide to MDM2 can modulate an interaction between p53 and MDM2. In some aspects, recombinant polynucleic acid or RNA constructs described herein can comprise at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding an NLS; wherein the peptide can comprise at least about 10 amino acid residues, wherein the peptide can bind to MDM2, and wherein the binding of the peptide to MDM2 can inhibit an interaction between p53 and MDM2. In some embodiments, the NLS can comprise an NLS of Polyoma Simian Vacuolating Virus 40 (SV40), an NLS of p53, an NLS of Myc proto-oncogene protein (c-Myc), or an NLS of insulin-like growth factor-binding protein 3 (IGFBP3). In some embodiments, recombinant polynucleic acid constructs can comprise a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 11- 21 or SEQ ID NOs: 59-69. In some embodiments, recombinant RNA constructs can comprise a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 103-113. In some embodiments, peptides expressed or encoded by recombinant polynucleic acid or RNA constructs can comprise an amino acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 35-45.

[0159] In some aspects, recombinant polynucleic acid or RNA constructs described herein cancomprise (i) at least one nucleic acid sequence encoding a peptide; wherein the peptide can comprise at least about 10 amino acid residues, wherein the peptide can bind to MDM2, MDM4, or both, and wherein the binding of the peptide to MDM2, MDM4, or both can modulate an interaction between p53 and MDM2, MDM4, or both, and (ii) at least one nucleic acid sequence encoding a small interfering RNA (siRNA) capable of binding to a target RNA that encodes MDM2, MDM4, or a combination thereof. In some aspects, recombinant polynucleic acid or RNA constructs described herein can comprise (i) at least one nucleic acid sequence encoding a peptide; wherein the peptide can comprise at least about 10 amino acid residues, wherein the peptide can bind to MDM2, MDM4, or both, and wherein the binding of the peptide to MDM2, MDM4, or both can inhibit an interaction between p53 and MDM2, MDM4, or both, and (ii) atWSGR Docket No.: 57623-713.601 least one nucleic acid sequence encoding a small interfering RNA (siRNA) capable of binding toa target RNA that encodes MDM2, MDM4, or a combination thereof.

[0160] In some aspects, recombinant polynucleic acid or RNA constructs described herein cancomprise (i) at least one nucleic acid sequence encoding a peptide; wherein the peptide can comprise at least about 10 amino acid residues, wherein the peptide can bind to MDM2, MDM4, or both, and wherein the binding of the peptide to MDM2, MDM4, or both can modulate an interaction between p53 and MDM2, MDM4, or both, (ii) at least one nucleic acid sequence encoding a small interfering RNA (siRNA) capable of binding to a target RNA that encodes MDM2, MDM4, or a combination thereof, and (iii) at least one nucleic acid sequence encoding an NLS. In some aspects, recombinant polynucleic acid or RNA constructs described herein can comprise (i) at least one nucleic acid sequence encoding a peptide; wherein the peptide can comprise at least about 10 amino acid residues, wherein the peptide can bind to MDM2, MDM4, or both, and wherein the binding of the peptide to MDM2, MDM4, or both can inhibit an interaction between p53 and MDM2, MDM4, or both, (ii) at least one nucleic acid sequence encoding a small interfering RNA (siRNA) capable of binding to a target RNA that encodes MDM2, MDM4, or a combination thereof, and (iii) at least one nucleic acid sequence encoding an NLS. In some embodiments, the NLS can comprise an NLS of Polyoma Simian Vacuolating Virus 40 (SV40), an NLS of p53, an NLS of Myc proto-oncogene protein (c-Myc), or an NLS of insulin-like growth factor-binding protein 3 (IGFBP3). In some embodiments, recombinant polynucleic acid constructs can comprise a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 22-24 or SEQ ID NOs: 70-72. In some embodiments, recombinant RNA constructs can comprise a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 114-116. In some embodiments, peptides expressed or encoded by recombinant polynucleic acid or RNA constructs can comprise an amino acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 46-48.

[0161] In some aspects, recombinant polynucleic acid or RNA constructs described herein cancomprise at least one nucleic acid sequence encoding a peptide; wherein the peptide can be atWSGR Docket No.: 57623-713.601 least about 300 amino acid residues, wherein the peptide can bind to ubiquitin, and wherein the binding of the peptide to ubiquitin can modulate (i) an interaction between FANCD2 and ubiquitin, an E3 ubiquitin ligase, Rad18, a recombinase, an ATPase, Rad51, or a combination thereof, (ii) ubiquitination of FANCD2, or (iii) both (i) and (ii). In some aspects, recombinant polynucleic acid or RNA constructs described herein can comprise at least one nucleic acid sequence encoding a peptide; wherein the peptide can be at least about 300 amino acid residues, wherein the peptide can bind to ubiquitin, and wherein the binding of the peptide to ubiquitin can inhibit (i) an interaction between FANCD2 and ubiquitin, an E3 ubiquitin ligase, Rad18, a recombinase, an ATPase, Rad51, or a combination thereof, (ii) ubiquitination of FANCD2, or (iii) both (i) and (ii). In some embodiments, recombinant polynucleic acid constructs can comprise a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 135-139. In some embodiments, recombinant RNA constructs can comprise an RNA sequence encoded by a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 135-139. In some embodiments, recombinant RNA constructs can comprise an RNA sequence encoded by a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 242-246. In some embodiments, peptides expressed or encoded by recombinant polynucleic acid or RNA constructs can comprise an amino acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 179-183.

[0162] In some aspects, recombinant polynucleic acid or RNA constructs described herein cancomprise at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding an NLS; wherein the peptide can be at least about 300 amino acid residues, wherein the peptide can bind to ubiquitin, and wherein the binding of the peptide to ubiquitin can modulate (i) an interaction between FANCD2 and ubiquitin, an E3 ubiquitin ligase, Rad18, a recombinase, an ATPase, Rad51, or a combination thereof, (ii) ubiquitination of FANCD2, or (iii) both (i) and (ii). In some aspects, recombinant polynucleic acid or RNA constructsWSGR Docket No.: 57623-713.601 described herein can comprise at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding an NLS; wherein the peptide can comprise at least about 300 amino acid residues, wherein the peptide can bind to ubiquitin, and wherein the binding of the peptide to ubiquitin can inhibit (i) an interaction between FANCD2 and ubiquitin, an E3 ubiquitin ligase, Rad18, a recombinase, an ATPase, Rad51, or a combination thereof, (ii) ubiquitination of FANCD2, or (iii) both (i) and (ii). In some embodiments, the NLS can comprise an NLS of Polyoma Simian Vacuolating Virus 40 (SV40), an NLS of p53, an NLS of Myc proto-oncogene protein (c-Myc), an NLS of insulin-like growth factor-binding protein 3 (IGFBP3), or T-cell transcription factor 4 (TCF4). In some embodiments, recombinant polynucleic acid constructs can comprise a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 135- 139. In some embodiments, recombinant RNA constructs can comprise an RNA sequence encoded by a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 135-139. In some embodiments, recombinant RNA constructs can comprise an RNA sequence encoded by a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 242-246. In some embodiments, peptides expressed or encoded by recombinant polynucleic acid or RNA constructs can comprise an amino acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 179-183.

[0163] In some aspects, recombinant polynucleic acid or RNA constructs described herein cancomprise at least one nucleic acid sequence encoding a peptide; wherein the peptide can be at least about 20 amino acid residues, wherein the peptide can bind to -Catenin, and wherein the binding of the peptide to -Catenin can modulate an interaction between BCL9L and -Catenin. In some aspects, recombinant polynucleic acid or RNA constructs described herein can comprise at least one nucleic acid sequence encoding a peptide; wherein the peptide can be at least about 20 amino acid residues, wherein the peptide can bind to -Catenin, and wherein the binding ofWSGR Docket No.: 57623-713.601 the peptide to -Catenin can inhibit an interaction between BCL9L and -Catenin. In some embodiments, recombinant polynucleic acid constructs can comprise a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 140-147. In some embodiments, recombinant RNA constructs can comprise an RNA sequence encoded by a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 140-147. In some embodiments, recombinant RNA constructs can comprise an RNA sequence encoded by a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 247-254. In some embodiments, peptides expressed or encoded by recombinant polynucleic acid or RNA constructs can comprise an amino acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 184-191.

[0164] In some aspects, recombinant polynucleic acid or RNA constructs described herein cancomprise at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding an NLS; wherein the peptide can be at least about 20 amino acid residues, wherein the peptide can bind to -Catenin, and wherein the binding of the peptide to -Catenincan modulate an interaction between BCL9L and -Catenin. In some aspects, recombinantpolynucleic acid or RNA constructs described herein can comprise at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding an NLS; wherein the peptide can comprise at least about 20 amino acid residues, wherein the peptide can bind to -Catenin, and wherein the binding of the peptide to -Catenin can inhibit an interaction between BCL9L and -Catenin. In some embodiments, the NLS can comprise an NLS of Polyoma Simian Vacuolating Virus 40 (SV40), an NLS of p53, an NLS of Myc proto-oncogene protein (c-Myc), an NLS of insulin-like growth factor-binding protein 3 (IGFBP3), or T-cell transcription factor 4 (TCF4). In some embodiments, recombinant polynucleic acid constructs can comprise a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, atWSGR Docket No.: 57623-713.601 least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 146 or SEQ ID NO: 147. In some embodiments, recombinant RNA constructs can comprise an RNA sequence encoded by a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 146 or SEQ ID NO: 147. In some embodiments, recombinant RNA constructs can comprise an RNA sequence encoded by a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 253 or SEQ ID NO: 254. In some embodiments, peptides expressed or encoded by recombinant polynucleic acid or RNA constructs can comprise an amino acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 190 or SEQ ID NO: 191.

[0165] In some aspects, recombinant polynucleic acid or RNA constructs described herein cancomprise at least one nucleic acid sequence encoding a peptide; wherein the peptide can be at least about 150 amino acid residues, wherein the peptide can bind to TCF4 and / or BCL9L, and wherein the binding of the peptide to TCF4 and / or BCL9L can modulate an interaction among TCF4, BCL9L -Catenin. In some aspects, recombinant polynucleic acid or RNA constructs described herein can comprise at least one nucleic acid sequence encoding a peptide; wherein the peptide can be at least about 150 amino acid residues, wherein the peptide can bind to TCF4 and / or BCL9L, and wherein the binding of the peptide to TCF4 and / or BCL9L can inhibit an interaction among TCF4, BCL9L, and -Catenin. In some embodiments, recombinant polynucleic acid constructs can comprise a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 148- 156. In some embodiments, recombinant RNA constructs can comprise an RNA sequence encoded by a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 148-156. In some embodiments, recombinant RNA constructs can comprise an RNA sequence encoded by a nucleic acidWSGR Docket No.: 57623-713.601 sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 255-263. In some embodiments, peptides expressed or encoded by recombinant polynucleic acid or RNA constructs can comprise an amino acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 192-200.

[0166] In some aspects, recombinant polynucleic acid or RNA constructs described herein cancomprise at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding an NLS; wherein the peptide can be at least about 150 amino acid residues, wherein the peptide can bind to TCF4 and / or BCL9L, and wherein the binding of the peptide to TCF4 and / or BCL9L can modulate an interaction between TCF4, BCL9L, and -Catenin. In some aspects, recombinant polynucleic acid or RNA constructs described herein can comprise at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding an NLS; wherein the peptide can comprise at least about 150 amino acid residues,wherein the peptide can bind to TCF4 and / or BCL9L, and wherein the binding of the peptide toTCF4 and / or BCL9L can inhibit an interaction between TCF4, BCL9L, and -Catenin. In some embodiments, the NLS can comprise an NLS of Polyoma Simian Vacuolating Virus 40 (SV40), an NLS of p53, an NLS of Myc proto-oncogene protein (c-Myc), an NLS of insulin-like growth factor-binding protein 3 (IGFBP3), or T-cell transcription factor 4 (TCF4). In some embodiments, recombinant polynucleic acid constructs can comprise a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 149, 150, 152, 153, 155, or 156. In some embodiments, recombinant RNA constructs can comprise an RNA sequence encoded by a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 149, 150, 152, 153, 155, or 156. In some embodiments, recombinant RNA constructs can comprise an RNA sequence encoded by a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, atWSGR Docket No.: 57623-713.601 least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 256, 257, 259, 260, 262, or 263. In some embodiments, peptides expressed or encoded by recombinant polynucleic acid or RNA constructs can comprise an amino acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 193, 194, 196, 197, 199, or 200.

[0167] In some aspects, recombinant polynucleic acid or RNA constructs described herein cancomprise at least one nucleic acid sequence encoding a peptide; wherein the peptide can be at least about 200 amino acid residues, wherein the peptide can bind to -Catenin, and wherein the binding of the peptide to -Catenin can modulate an interaction between TCF4 and -Catenin. In some aspects, recombinant polynucleic acid or RNA constructs described herein can comprise at least one nucleic acid sequence encoding a peptide; wherein the peptide can be at least about 200 amino acid residues, wherein the peptide can bind to -Catenin, and wherein the binding of the peptide to -Catenin can inhibit an interaction between TCF4 and -Catenin. In some embodiments, recombinant polynucleic acid constructs can comprise a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 157-162. In some embodiments, recombinant RNA constructs can comprise an RNA sequence encoded by a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 157-162. In some embodiments, recombinant RNA constructs can comprise an RNA sequence encoded by a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 264-269. In some embodiments, peptides expressed or encoded by recombinant polynucleic acid or RNA constructs can comprise an amino acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 201-206.WSGR Docket No.: 57623-713.601

[0168] In some aspects, recombinant polynucleic acid or RNA constructs described herein cancomprise at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding an NLS; wherein the peptide can be at least about 200 amino acid residues, wherein the peptide can bind to -Catenin, and wherein the binding of the peptide to -Catenin can modulate an interaction between TCF4 and -Catenin. In some aspects, recombinant polynucleic acid or RNA constructs described herein can comprise at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding an NLS; wherein the peptide can comprise at least about 200 amino acid residues, wherein the peptide can bind to -Catenin, and wherein the binding of the peptide to -Catenin can inhibit an interaction between TCF4 and -Catenin. In some embodiments, the NLS can comprise an NLS of Polyoma Simian Vacuolating Virus 40 (SV40), an NLS of p53, an NLS of Myc proto-oncogene protein (c-Myc), an NLS of insulin-like growth factor-binding protein 3 (IGFBP3), or T-cell transcription factor 4 (TCF4). In some embodiments, recombinant polynucleic acid constructs can comprise a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 158-160. In some embodiments, recombinant RNA constructs can comprise an RNA sequence encoded by a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 158-160. In some embodiments, recombinant RNA constructs can comprise an RNA sequence encoded by a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 265-267. In some embodiments, peptides expressed or encoded by recombinant polynucleic acid or RNA constructs can comprise an amino acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 202-204.

[0169] In some aspects, recombinant polynucleic acid or RNA constructs described herein cancomprise at least one nucleic acid sequence encoding a peptide; wherein the peptide can be at least about 180 amino acid residues, wherein the peptide can bind to H3.3, and wherein the binding of the peptide to H3.3 can modulate an interaction between CBP and H3.3. In someWSGR Docket No.: 57623-713.601 aspects, recombinant polynucleic acid or RNA constructs described herein can comprise at least one nucleic acid sequence encoding a peptide; wherein the peptide can be at least about 180 amino acid residues, wherein the peptide can bind to H3.3, and wherein the binding of the peptide to H3.3 can inhibit an interaction between CBP and H3.3. In some embodiments, recombinant polynucleic acid constructs can comprise a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 163-172. In some embodiments, recombinant RNA constructs can comprise an RNA sequence encoded by a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 163-172. In some embodiments, recombinant RNA constructs can comprise an RNA sequence encoded by a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 270-279. In some embodiments, peptides expressed or encoded by recombinant polynucleic acid or RNA constructs can comprise an amino acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 207-216.

[0170] In some aspects, recombinant polynucleic acid or RNA constructs described herein cancomprise at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding an NLS; wherein the peptide can be at least about 180 amino acid residues, wherein the peptide can bind to H3.3, and wherein the binding of the peptide to H3.3 can modulate an interaction between CBP and H3.3. In some aspects, recombinant polynucleic acid or RNA constructs described herein can comprise at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding an NLS; wherein the peptide can comprise at least about 180 amino acid residues, wherein the peptide can bind to H3.3, and wherein the binding of the peptide to H3.3 can inhibit an interaction between CBP and H3.3. In some embodiments, the NLS can comprise an NLS of Polyoma Simian Vacuolating Virus 40 (SV40), an NLS of p53, an NLS of Myc proto-oncogene protein (c-Myc), an NLS of insulin-like growth factor-binding protein 3 (IGFBP3), or T-cell transcription factor 4 (TCF4). In someWSGR Docket No.: 57623-713.601 embodiments, recombinant polynucleic acid constructs can comprise a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 164, 166, 168, 170, or 172. In some embodiments, recombinant RNA constructs can comprise an RNA sequence encoded by a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 164, 166, 168, 170, or 172. In some embodiments, recombinant RNA constructs can comprise an RNA sequence encoded by a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 271, 273, 275, 277, or 279. In some embodiments, peptides expressed or encoded by recombinant polynucleic acid or RNA constructs can comprise an amino acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 208, 210, 212, 214, or 216.

[0171] In some aspects, recombinant polynucleic acid or RNA constructs described herein cancomprise at least one nucleic acid sequence encoding a peptide; wherein the peptide can be at least about 40 amino acid residues, wherein the peptide can bind to CBP, and wherein the binding of the peptide to CBP can modulate an interaction between H3.3 and CBP. In some aspects, recombinant polynucleic acid or RNA constructs described herein can comprise at least one nucleic acid sequence encoding a peptide; wherein the peptide can be at least about 40 amino acid residues, wherein the peptide can bind to CBP, and wherein the binding of the peptide to CBP can inhibit an interaction between H3.3 and CBP. In some embodiments, recombinant polynucleic acid constructs can comprise a nucleic acid sequence comprising any one of SEQ ID NOs: 173-176. In some embodiments, recombinant RNA constructs can comprise an RNA sequence encoded by a nucleic acid sequence comprising any one of SEQ ID NOs: 173-176. In some embodiments, recombinant RNA constructs can comprise an RNA sequence encoded by a nucleic acid sequence comprising any one of SEQ ID NOs: 280-283. In some embodiments, peptides expressed or encoded by recombinant polynucleic acid or RNA constructs can comprise an amino acid sequence comprising any one of SEQ ID NOs: 217-220.WSGR Docket No.: 57623-713.601

[0172] In some aspects, recombinant polynucleic acid or RNA constructs described herein cancomprise at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding an NLS; wherein the peptide can be at least about 40 amino acid residues, wherein the peptide can bind to CBP, and wherein the binding of the peptide to CBP can modulate an interaction between H3.3 and CBP. In some aspects, recombinant polynucleic acid or RNA constructs described herein can comprise at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding an NLS; wherein the peptide can comprise at least about 40 amino acid residues, wherein the peptide can bind to CBP, and wherein the binding of the peptide to CBP can inhibit an interaction between H3.3 and CBP. In some embodiments, the NLS can comprise an NLS of Polyoma Simian Vacuolating Virus 40 (SV40), an NLS of p53, an NLS of Myc proto-oncogene protein (c-Myc), an NLS of insulin-like growth factor-binding protein 3 (IGFBP3), or T-cell transcription factor 4 (TCF4). In some embodiments, recombinant polynucleic acid constructs can comprise a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 174 or SEQ ID NO: 176. In some embodiments, recombinant RNA constructs can comprise an RNA sequence encoded by a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 174 or SEQ ID NO: 176. In some embodiments, recombinant RNA constructs can comprise an RNA sequence encoded by a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 281 or SEQ ID NO: 283. In some embodiments, peptides expressed or encoded by recombinant polynucleic acid or RNA constructs can comprise an amino acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 218 or SEQ ID NO: 220.

[0173] In some aspects, recombinant polynucleic acid or RNA constructs described herein cancomprise at least one nucleic acid sequence encoding a peptide; wherein the peptide can be at least about 40 amino acid residues, wherein the peptide can bind to CD3, and wherein the binding of the peptide to CD3 can modulate an interaction between TCR and CD3. In someWSGR Docket No.: 57623-713.601 aspects, recombinant polynucleic acid or RNA constructs described herein can comprise at least one nucleic acid sequence encoding a peptide; wherein the peptide can be at least about 40 amino acid residues, wherein the peptide can bind to CD3, and wherein the binding of the peptide to CD3 can inhibit an interaction between TCR and CD3. In some embodiments, TCRcan comprise TCR- - In some embodiments, CD3 cancomprise CD3 , , , , or a combination thereof. In some embodiments,recombinant polynucleic acid constructs can comprise a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 177 or SEQ ID NO: 178. In some embodiments, recombinant RNA constructs can comprise an RNA sequence encoded by a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 177 or SEQ ID NO: 178. In some embodiments, recombinant RNA constructs can comprise an RNA sequence encoded by a nucleic acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 284 or SEQ ID NO: 285. In some embodiments, peptides expressed or encoded by recombinant polynucleic acid or RNA constructs can comprise an amino acid sequence with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 221 or SEQ ID NO: 222.

[0174] In some aspects, recombinant polynucleic acid or RNA constructs described herein cancomprise at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding an NLS; wherein the peptide can be at least about 40 amino acid residues, wherein the peptide can bind to CD3, and wherein the binding of the peptide to CD3 can modulate an interaction between TCR and CD3. In some aspects, recombinant polynucleic acid or RNA constructs described herein can comprise at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding an NLS; wherein the peptide can comprise at least about 40 amino acid residues, wherein the peptide can bind to CD3, and wherein the binding of the peptide to CD3 can inhibit an interaction between TCR and CD3. InWSGR Docket No.: 57623-713.601some embodiments, TCR can comprise TCR- - In someembodiments, CD3 can comprise CD3 , , , , or a combination thereof.

[0175] In some aspects, a composition provided herein can comprise a recombinant polynucleicacid or RNA construct comprising at least one nucleic acid sequence encoding a fragment of a protein encoded by a gene of interest. In some embodiments, the protein encoded by the gene of interest can bind to a binding partner. In some embodiments, the fragment of the protein encoded by the gene of interest can modulate binding of the binding partner to the protein encoded by a gene of interest, thereby modulating formation of an interactome comprising the protein encoded by the gene of interest and the binding partner.

[0176] In some embodiments, a gene of interest can comprise RAF, RAS, MEK, ERK, p53,-Catenin, TCF4, CBP, H3.3, wild-type FANCD2, ubiquitin, an E3ubiquitin ligase, Rad18, a recombinase, an ATPase, Rad51, TCR- - , ,, , or a combination thereof. In some embodiments, a binding partner can comprise -Catenin, TCF4, CBP, H3.3, wild-type FANCD2, ubiquitin, an E3 ubiquitin ligase, Rad18, a recombinase, an ATPase, Rad51, TCR-TCR- , , , , or a combination thereof. In some embodiments, RAF cancomprise ARAF, BRAF, CRAF, or a combination thereof. In some embodiments, RAS can comprise HRAS, NRAS, KRAS, or a combination thereof. In some embodiments, MEK can comprise MEK1, MEK2, or a combination thereof. In some embodiments, ERK can comprise ERK1, ERK2, or a combination thereof. In some embodiments, an E3 ubiquitin ligase can comprise Rad18. In some embodiments, a recombinase can comprise Rad51. In some embodiments, an ATPase can comprise Rad51.

[0177] In one specific embodiment, a gene of interest can comprise p53 and a binding partnercan comprise MDM2, MDM4, or both. In some embodiments, p53 can comprise an amino acid sequence comprising SEQ ID NO: 84. In some embodiments, p53 can be encoded by a nucleic acid sequence comprising SEQ ID NO: 83. In some embodiments, MDM2 can comprise an amino acid sequence comprising SEQ ID NO: 86. In some embodiments, MDM2 can be encoded by a nucleic acid sequence comprising SEQ ID NO: 85. In some embodiments, MDM4 can comprise an amino acid sequence comprising SEQ ID NO: 88. In some embodiments, MDM4 can be encoded by a nucleic acid sequence comprising SEQ ID NO: 87.

[0178] In another specific embodiment, a gene of interest can comprise CRAF and a bindingpartner can comprise KRAS. In some embodiments, CRAF can comprise an amino acid sequence comprising SEQ ID NO: 80. In some embodiments, CRAF can be encoded by a nucleic acid sequence comprising SEQ ID NO: 79. In some embodiments, KRAS can compriseWSGR Docket No.: 57623-713.601 an amino acid sequence comprising SEQ ID NO: 82. In some embodiments, KRAS can be encoded by a nucleic acid sequence comprising SEQ ID NO: 81.

[0179] In another specific embodiment, a gene of interest can comprise FANCD2 and a bindingpartner can comprise ubiquitin, an E3 ubiquitin ligase, Rad18, a recombinase, an ATPase, Rad51, or a combination thereof. In some embodiments, FANCD2 can comprise an amino acid sequence comprising SEQ ID NO: 224.

[0180] In another specific embodiment, a gene of interest can comprise BCL9L and a bindingpartner can comprise -Catenin. In another specific embodiment, a gene of interest can comprise -Catenin and a binding partner can comprise TCF4, BCL9L, or a combination thereof. In another specific embodiment, a gene of interest can comprise TCF4 and a binding partner can comprise -Catenin. In some embodiments, BCL9L can comprise an amino acid sequence comprising SEQ ID NO: 225. In some embodiments, -Catenin can comprise an amino acid sequence comprising SEQ ID NO: 226. In some embodiments, TCF4 can comprise an amino acid sequence comprising SEQ ID NO: 227.

[0181] In another specific embodiment, a gene of interest can comprise CBP and a bindingpartner can comprise H3.3. In another specific embodiment, a gene of interest can comprise H3.3 and a binding partner can comprise CBP. In some embodiments, CBP can comprise an amino acid sequence comprising SEQ ID NO: 228. In some embodiments, H3.3 can comprise an amino acid sequence comprising SEQ ID NO: 229.

[0182] In another specific embodiments, a gene of interest can comprise TCR (e.g., TCR- ,TCR- , or a combination thereof) and a binding partner can comprise CD3 (e.g., CD3 , ,, , or a combination thereof). In some embodiments, TCR- can comprise an aminoacid sequence comprising SEQ ID NO: 230. In some embodiments, TCR- can comprise anamino acid sequence comprising SEQ ID NO: 231.

[0183] In some aspects, provided herein is a messenger RNA (mRNA) comprising a nucleicacid sequence encoding (i) a protein or a fragment thereof and (ii) a target motif. In some embodiments, a target motif may be selected from the group consisting of a signal peptide, a nuclear localization signal (NLS), a nucleolar localization signal (NoLS), a lysosomal targeting signal, a mitochondrial targeting signal, a peroxisomal targeting signal, a microtubule tip localization signal (MtLS), an endosomal targeting signal, a chloroplast targeting signal, a Golgi targeting signal, an endoplasmic reticulum (ER) targeting signal, a proteasomal targeting signal, a membrane targeting signal, a transmembrane targeting signal, and a centrosomal localization signal (CLS). In some embodiments, a target motif may be from a protein selected from the group consisting of a target motif of Polyoma Simian Vacuolating Virus 40 (SV40), a targetWSGR Docket No.: 57623-713.601 motif of p53, a target motif of Myc proto-oncogene protein (c-Myc), and a target motif of insulin-like growth factor-binding protein 3 (IGFBP3).

[0184] In some aspects, a composition provided herein can comprise a recombinant polynucleicacid or RNA construct comprising: (i) at least one nucleic acid sequence encoding or comprising a small interfering RNA (siRNA) capable of binding to a target RNA; and (ii) at least one nucleic acid sequence encoding a gene of interest or a fragment thereof. In some embodiments, the target RNA may be selected from the group consisting of an RNA encoding MDM2, an RNA encoding MDM4, and a combination thereof. In some embodiments, the gene of interest or the fragment thereof can comprise p53. In some embodiments, the target RNA may be selected from the group consisting of an RNA encoding MDM2, an RNA encoding MDM4, and a combination thereof and the gene of interest or the fragment thereof can comprise p53.

[0185] In some aspects, a composition provided herein can comprise a recombinant polynucleicacid or RNA construct comprising: (i) at least one nucleic acid sequence encoding or comprising a small interfering RNA (siRNA) capable of binding to a target RNA; and (ii) at least one nucleic acid sequence encoding a gene of interest or a fragment thereof. In some embodiments, the target RNA can comprise an RNA encoding KRAS. In some embodiments, the gene of interest or the fragment thereof can comprise CRAF. In some embodiments, the target RNA can comprise an RNA encoding KRAS and the gene of interest or the fragment thereof can comprise CRAF.

[0186] In some aspects, a composition provided herein can comprise a recombinant polynucleicacid or RNA construct comprising: (i) at least one nucleic acid sequence encoding or comprising a small interfering RNA (siRNA) capable of binding to a target RNA; and (ii) at least one nucleic acid sequence encoding a gene of interest or a fragment thereof. In some embodiments, the target RNA can comprise an RNA encoding ubiquitin, an RNA encoding an E3 ubiquitin ligase, an RNA encoding Rad18, a recombinase, an ATPase, Rad51, or a combination thereof. In some embodiments, the gene of interest or the fragment thereof can comprise FANCD2. In some embodiments, the target RNA can comprise an RNA encoding ubiquitin, an RNA encoding an E3 ubiquitin ligase, an RNA encoding Rad18, a recombinase, an ATPase, Rad51, or a combination thereof and the gene of interest or the fragment thereof can comprise FANCD2.

[0187] In some aspects, a composition provided herein can comprise a recombinant polynucleicacid or RNA construct comprising: (i) at least one nucleic acid sequence encoding or comprising a small interfering RNA (siRNA) capable of binding to a target RNA; and (ii) at least one nucleic acid sequence encoding a gene of interest or a fragment thereof. In some embodiments, the target RNA can comprise an RNA encoding -Catenin. In some embodiments, the gene of interest or the fragment thereof can comprise BCL9L, TCF4, or a combination thereof. In someWSGR Docket No.: 57623-713.601 embodiments, the target RNA can comprise an RNA encoding -Catenin and the gene of interest or the fragment thereof can comprise BCL9L, TCF4, or a combination thereof. In some embodiments, the target RNA can comprise an RNA encoding TCF4, an RNA encoding BCL9L, or a combination thereof. In some embodiments, the gene of interest or the fragment thereof can comprise -Catenin. In some embodiments, the target RNA can comprise an RNA encoding TCF4, an RNA encoding BCL9L, or a combination thereof and the gene of interest or the fragment thereof can comprise -Catenin.

[0188] In some aspects, a composition provided herein can comprise a recombinant polynucleicacid or RNA construct comprising: (i) at least one nucleic acid sequence encoding or comprising a small interfering RNA (siRNA) capable of binding to a target RNA; and (ii) at least one nucleic acid sequence encoding a gene of interest or a fragment thereof. In some embodiments, the target RNA can comprise an RNA encoding H3.3. In some embodiments, the gene of interest or the fragment thereof can comprise CBP. In some embodiments, the target RNA can comprise an RNA encoding H3.3 and the gene of interest or the fragment thereof can comprise CBP. In some embodiments, the target RNA can comprise an RNA encoding CBP. In some embodiments, the gene of interest or the fragment thereof can comprise H3.3. In some embodiments, the target RNA can comprise an RNA encoding CBP and the gene of interest or the fragment thereof can comprise H3.3.

[0189] In some aspects, a composition provided herein can comprise a recombinant polynucleicacid or RNA construct comprising: (i) at least one nucleic acid sequence encoding or comprising a small interfering RNA (siRNA) capable of binding to a target RNA; and (ii) at least one nucleic acid sequence encoding a gene of interest or a fragment thereof. In some embodiments, the target RNA can comprise an RNA encoding CD3. In some embodiments, CD3 can compriseCD3 , , , , or a combination thereof. In some embodiments, the gene of interestor the fragment thereof can comprise TCR- - . In someembodiments, the target RNA can comprise an RNA encoding CD3 , , , or , ora combination thereof and the gene of interest or the fragment thereof can comprise TCR- TCR-

[0190] In some embodiments, the at least one nucleic acid sequence encoding the gene of theinterest or the fragment thereof and the at least one nucleic acid sequence encoding or comprising the siRNA may be comprised in a sequential manner. In some embodiments, a protein or a fragment thereof expressed by the gene of interest or the fragment thereof can bind to a target protein. In some embodiments, the target RNA can encode the target protein. In some embodiments, the expression of the target protein encoded by the target RNA may be modulated by the siRNA capable of binding to the target RNA. In some embodiments, the expression of theWSGR Docket No.: 57623-713.601 target protein encoded by the target RNA maybe downregulated by the siRNA capable of binding to the target RNA. Method of producing recombinant polynucleic acid or RNA constructs

[0191] In some aspects, provided herein, is a method of producing recombinant polynucleic acidor RNA constructs comprising at least one nucleic acid sequence encoding a peptide. In some embodiments, recombinant polynucleic acid or RNA constructs described herein can further comprise at least one nucleic acid sequence encoding or comprising an siRNA, at least one nucleic acid sequence encoding a target motif (e.g., an NLS), or both. In some embodiments, recombinant RNA constructs can be produced by in vitro transcription. In this embodiment, (i) a polynucleic acid construct comprising a promoter, at least one nucleic acid sequence encoding a peptide and a nucleic acid sequence encoding poly(A) tail; (ii) an RNA polymerase; and (iii) a mixture of nucleotide triphosphates (NTPs) can be provided for the in vitro (“cell free”) transcription (IVT). In another embodiment, (i) a polynucleic acid construct comprising a promoter, at least one nucleic acid sequence encoding a peptide and a nucleic acid sequence encoding poly(A) tail, optionally at least one nucleic acid sequence encoding or comprising an siRNA, at least one nucleic acid sequence encoding a target motif (e.g., an NLS), or both; (ii) an RNA polymerase; and (iii) a mixture of nucleotide triphosphates (NTPs) can be provided for the in vitro (“cell free”) transcription. Details of producing RNA using IVT as well as isolating and purifying transcribed RNAs is well known in the art and can be found, for example, in Beckert & Masquida ((2011) Synthesis of RNA by In vitro Transcription. RNA. Methods in Molecular Biology (Methods and Protocols), vol 703. Humana Press). A non-limiting list of in vitro transcript kits can include MEGAscript™ T3 Transcription Kit, MEGAscript T7 kit, MEGAscript™ SP6 Transcription Kit, MAXIscript™ T3 Transcription Kit, MAXIscript™ T7 Transcription Kit, MAXIscript™ SP6 Transcription Kit, MAXIscript™ T7 / T3 Transcription Kit, MAXIscript™ SP6 / T7 Transcription Kit, mMESSAGE mMACHINE™ T3 Transcription Kit, mMESSAGE mMACHINE™ T7 Transcription Kit, mMESSAGE mMACHINE™ SP6 Transcription Kit, MEGAshortscript™ T7 Transcription Kit, HiScribe™ T7 High Yield RNA Synthesis Kit, HiScribe™ T7 In Vitro Transcription Kit, AmpliScribe™ T7-Flash™ Transcription Kit, AmpliScribe™ T7 High Yield Transcription Kit, AmpliScribe™ T7-Flash™ Biotin-RNA Transcription Kit, T7 Transcription Kit, HighYield T7 RNA Synthesis Kit, DuraScribe® T7 Transcription Kit, etc.

[0192] The in vitro transcription reaction can further comprise a transcription buffer system,nucleotide triphosphates (NTPs), and an RNase inhibitor. In some embodiments, the transcription buffer system may comprise dithiothreitol (DTT) and magnesium ions. The NTPsWSGR Docket No.: 57623-713.601 can be naturally occurring or non-naturally occurring (modified) NTPs. Non-limiting examples of non-naturally occurring (modified) NTPs include N1-methylpseudouridine, Pseudouridine, N1-Ethylpseudouridine, N1-Methoxymethylpseudouridine, N1-Propylpseudouridine, 2- thiouridine, 4-thiouridine, 5-methoxyuridine, 5-methylurdine, 5-carboxymethylesteruridine, 5- formyluridine, 5-carboxyuridine, 5-hydroxyuridine, 5-Bromouridine, 5-Iodouridine, 5,6- dihydrouridine, 6-Azauridine, Thienouridine, 3-methyluridine, 1-carboxymethyl-pseudouridine, 4-thio-1-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, dihydrouridine, dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, 5-methylcytidine, 5-methoxycytidine, 5- hydroxymethylcytidine, 5-formylcytidine, 5-carboxycytidine, 5-hydroxycytidine, 5- Iodocytidine, 5-Bromocytidine, 2-thiocytidine, 5-azacytidine, pseudoisocytidine, 3-methyl- cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1- methyl-pseudoisocytidine, 4-methoxy-pseudoisocytidine, and 4-methoxy-1-methyl- pseudoisocytidine, N1-methyladenosine, N6-methyladenosine, N6-methyl-2-Aminoadenosine,N6-isopentenyladenosine, N6,N6-dimethyladenosine, 7-methyladenine, 2-methylthio-adenine, or 2-methoxy-adenine. Non-limiting examples of DNA-dependent RNA polymerase can include T3, T7, SP6, P60, Syn5, or KP34 RNA polymerases. In some embodiments, the RNA polymerase can comprise T3 RNA polymerase, T7 RNA polymerase, SP6 RNA polymerase, P60 RNA polymerase, Syn5 RNA polymerase, or KP34 RNA polymerase.

[0193] In further embodiments, transcribed RNAs may be isolated and / or purified from the invitro transcription reaction mixture. In this embodiments, transcribed RNAs may be isolated and purified using column purification. Details of isolating and purifying transcribed RNAs from in vitro transcription reaction mixture is well known in the art and any commercially available kits may be used. A non-limiting list of RNA purification kits includes MEGAclear kit, Monarch® RNA Cleanup Kit, EasyPure® RNA Purification Kit, NucleoSpin® RNA Clean-up, etc. Modulation of protein interactions or interactome

[0194] Provided herein are compositions comprising any recombinant polynucleic acid or RNAconstructs described herein for modulating a binding activity of a target protein in a cell. In some aspects, provided herein is a peptide or peptides expressed or encoded by any recombinant polynucleic acid or RNA constructs described herein. In some aspects, provided herein is a pharmaceutical composition comprising the composition of any recombinant polynucleic acid or RNA constructs described herein and a pharmaceutically acceptable excipient. In some embodiments, compositions, peptides, or pharmaceutical compositions described herein can be used for modulating a binding activity of a target protein in a cell. In some embodiments,WSGR Docket No.: 57623-713.601 compositions, peptides, or pharmaceutical compositions described herein can be used for modulating formation of an interactome. For example, compositions, peptides, or pharmaceutical compositions described herein can be used for modulating formation of an interactome that comprises a target protein and a binding partner of the target protein. In some aspects, provided herein is use of compositions, peptides, or pharmaceutical compositions described herein in modulating a binding activity of a target protein in a cell.

[0195] In some embodiments, modulating formation of an interactome can comprise preventingor inhibiting binding of the target protein to the binding partner. In some embodiments,modulating a binding activity can comprise preventing or inhibiting a binding activity. In someembodiments, a peptide expressed or encoded by any recombinant polynucleic acid or RNA constructs described herein can bind to a target protein. In some embodiments, a peptide expressed or encoded by any recombinant polynucleic acid or RNA constructs described herein can bind to a target protein and prevents or inhibits binding of the target protein to the binding partner, thereby preventing or inhibiting formation of the interactome.

[0196] In some embodiments, the amount, expression, or formation of the interactome may belower in a cell comprising or expressing a peptide expressed or encoded by any recombinant polynucleic acid or RNA constructs described herein than the amount, expression, or formation of the interactome in a cell without the peptide or in a cell not expressing the peptide. In one embodiment, the amount, expression, or formation of the interactome may be at least about 10%, 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or at least about 99% lower in a cell comprising or expressing the peptide expressed or encoded by any recombinant polynucleic acid or RNA constructs described herein than the amount, expression, or formation of the interactome in a cell without the peptide or in a cell not expressing the peptide.

[0197] In another embodiment, the amount, expression, or formation of the interactome may beat most about 10%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%,WSGR Docket No.: 57623-713.601 about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or at most about 99% lower in a cell comprising or expressing the peptide expressed or encoded by any recombinant polynucleic acid or RNA constructs described herein than the amount, expression, or formation of the interactome in a cell without the peptide or in a cell not expressing the peptide.

[0198] In some embodiments, the amount, expression, or formation of the interactome may be atleast about 1.1-fold, about 1.2-fold, about 1.3-fold, about 1.4-fold, about 1.5-fold, about 1.6- fold, about 1.7-fold, about 1.8-fold, about 1.9-fold, about 2.0-fold, about 2.1-fold, about 2.2- fold, about 2.3-fold, about 2.4-fold, about 2.5-fold, about 2.6-fold, about 2.7-fold, about 2.8- fold, about 2.9-fold, about 3.0-fold, about 3.1-fold, about 3.2-fold, about 3.3-fold, about 3.4- fold, about 3.5-fold, about 3.6-fold, about 3.7-fold, about 3.8-fold, about 3.9-fold, about 4.0- fold, about 4.1-fold, about 4.2-fold, about 4.3-fold, about 4.4-fold, about 4.5-fold, about 4.6- fold, about 4.7-fold, about 4.8-fold, about 4.9-fold, about 5.0-fold, about 5.1-fold, about 5.2- fold, about 5.3-fold, about 5.4-fold, about 5.5-fold, about 5.6-fold, about 5.7-fold, about 5.8-fold, about 5.9-fold, about 6.0-fold, about 6.1-fold, about 6.2-fold, about 6.3-fold, about 6.4-fold, about 6.5-fold, about 6.6-fold, about 6.7-fold, about 6.8-fold, about 6.9-fold, about 7.0- fold, about 7.1-fold, about 7.2-fold, about 7.3-fold, about 7.4-fold, about 7.5-fold, about 7.6- fold, about 7.7-fold, about 7.8-fold, about 7.9-fold, about 8.0-fold, about 8.1-fold, about 8.2- fold, about 8.3-fold, about 8.4-fold, about 8.5-fold, about 8.6-fold, about 8.7-fold, about 8.8- fold, about 8.9-fold, about 9.0-fold, about 9.1-fold, about 9.2-fold, about 9.3-fold, about 9.4- fold, about 9.5-fold, about 9.6-fold, about 9.7-fold, about 9.8-fold, about 9.9-fold, or at least about 10.0-fold, or more than about 10.0-fold lower in a cell comprising or expressing the peptide expressed or encoded by any recombinant polynucleic acid or RNA constructs described herein than the amount, expression, or formation of the interactome in a cell without the peptide or in a cell not expressing the peptide.

[0199] In some embodiments, the amount, expression, or formation of the interactome may be atmost about 1.1-fold, about 1.2-fold, about 1.3-fold, about 1.4-fold, about 1.5-fold, about 1.6-WSGR Docket No.: 57623-713.601 fold, about 1.7-fold, about 1.8-fold, about 1.9-fold, about 2.0-fold, about 2.1-fold, about 2.2- fold, about 2.3-fold, about 2.4-fold, about 2.5-fold, about 2.6-fold, about 2.7-fold, about 2.8- fold, about 2.9-fold, about 3.0-fold, about 3.1-fold, about 3.2-fold, about 3.3-fold, about 3.4- fold, about 3.5-fold, about 3.6-fold, about 3.7-fold, about 3.8-fold, about 3.9-fold, about 4.0- fold, about 4.1-fold, about 4.2-fold, about 4.3-fold, about 4.4-fold, about 4.5-fold, about 4.6- fold, about 4.7-fold, about 4.8-fold, about 4.9-fold, about 5.0-fold, about 5.1-fold, about 5.2- fold, about 5.3-fold, about 5.4-fold, about 5.5-fold, about 5.6-fold, about 5.7-fold, about 5.8- fold, about 5.9-fold, about 6.0-fold, about 6.1-fold, about 6.2-fold, about 6.3-fold, about 6.4- fold, about 6.5-fold, about 6.6-fold, about 6.7-fold, about 6.8-fold, about 6.9-fold, about 7.0- fold, about 7.1-fold, about 7.2-fold, about 7.3-fold, about 7.4-fold, about 7.5-fold, about 7.6- fold, about 7.7-fold, about 7.8-fold, about 7.9-fold, about 8.0-fold, about 8.1-fold, about 8.2- fold, about 8.3-fold, about 8.4-fold, about 8.5-fold, about 8.6-fold, about 8.7-fold, about 8.8- fold, about 8.9-fold, about 9.0-fold, about 9.1-fold, about 9.2-fold, about 9.3-fold, about 9.4- fold, about 9.5-fold, about 9.6-fold, about 9.7-fold, about 9.8-fold, about 9.9-fold, or at most about 10.0-fold or more than about 10.0-fold lower in a cell comprising or expressing the peptide expressed or encoded by any recombinant polynucleic acid or RNA constructs described herein than the amount, expression, or formation of the interactome in a cell without the peptide or in a cell not expressing the peptide. In some embodiments, the amount, expression, or formation of the interactome may be more than about 10.0-fold lower in a cell comprising or expressing the peptide expressed or encoded by any recombinant polynucleic acid or RNA constructs described herein than the amount, expression, or formation of the interactome in a cell without the peptide or in a cell not expressing the peptide.

[0200] In some embodiments, the amount, expression, or formation of the interactome may belower in a cell comprising or expressing a peptide expressed or encoded by any recombinant polynucleic acid or RNA constructs described herein than the amount, expression, or formation of the interactome in a cell comprising or expressing a corresponding peptide that is shorter in length than the peptide. In one embodiment, the amount, expression, or formation of the interactome may be at least about 10%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, aboutWSGR Docket No.: 57623-713.601 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or at least about 99% lower in a cell comprising or expressing the peptide expressed or encoded by any recombinant polynucleic acid or RNA constructs described herein than the amount, expression, or formation of the interactome in a cell comprising or expressing a corresponding peptide that is shorter in length than the peptide.

[0201] In another embodiment, the amount, expression, or formation of the interactome may beat most about 10%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or at most about 99% lower in a cell comprising or expressing the peptide expressed or encoded by any recombinant polynucleic acid or RNA constructs described herein than the amount, expression, or formation of the interactome in a cell comprising or expressing a corresponding peptide that is shorter in length than the peptide.

[0202] In some embodiments, the amount, expression, or formation of the interactome may be atleast about 1.1-fold, about 1.2-fold, about 1.3-fold, about 1.4-fold, about 1.5-fold, about 1.6- fold, about 1.7-fold, about 1.8-fold, about 1.9-fold, about 2.0-fold, about 2.1-fold, about 2.2- fold, about 2.3-fold, about 2.4-fold, about 2.5-fold, about 2.6-fold, about 2.7-fold, about 2.8- fold, about 2.9-fold, about 3.0-fold, about 3.1-fold, about 3.2-fold, about 3.3-fold, about 3.4- fold, about 3.5-fold, about 3.6-fold, about 3.7-fold, about 3.8-fold, about 3.9-fold, about 4.0- fold, about 4.1-fold, about 4.2-fold, about 4.3-fold, about 4.4-fold, about 4.5-fold, about 4.6- fold, about 4.7-fold, about 4.8-fold, about 4.9-fold, about 5.0-fold, about 5.1-fold, about 5.2- fold, about 5.3-fold, about 5.4-fold, about 5.5-fold, about 5.6-fold, about 5.7-fold, about 5.8- fold, about 5.9-fold, about 6.0-fold, about 6.1-fold, about 6.2-fold, about 6.3-fold, about 6.4- fold, about 6.5-fold, about 6.6-fold, about 6.7-fold, about 6.8-fold, about 6.9-fold, about 7.0- fold, about 7.1-fold, about 7.2-fold, about 7.3-fold, about 7.4-fold, about 7.5-fold, about 7.6- fold, about 7.7-fold, about 7.8-fold, about 7.9-fold, about 8.0-fold, about 8.1-fold, about 8.2- fold, about 8.3-fold, about 8.4-fold, about 8.5-fold, about 8.6-fold, about 8.7-fold, about 8.8-WSGR Docket No.: 57623-713.601 fold, about 8.9-fold, about 9.0-fold, about 9.1-fold, about 9.2-fold, about 9.3-fold, about 9.4- fold, about 9.5-fold, about 9.6-fold, about 9.7-fold, about 9.8-fold, about 9.9-fold, or at least about 10.0-fold, or more than about 10.0-fold lower in a cell comprising or expressing the peptide expressed or encoded by any recombinant polynucleic acid or RNA constructs described herein than the amount, expression, or formation of the interactome in a cell comprising or expressing a corresponding peptide that is shorter in length than the peptide.

[0203] In some embodiments, the amount, expression, or formation of the interactome may be atmost about 1.1-fold, about 1.2-fold, about 1.3-fold, about 1.4-fold, about 1.5-fold, about 1.6- fold, about 1.7-fold, about 1.8-fold, about 1.9-fold, about 2.0-fold, about 2.1-fold, about 2.2- fold, about 2.3-fold, about 2.4-fold, about 2.5-fold, about 2.6-fold, about 2.7-fold, about 2.8- fold, about 2.9-fold, about 3.0-fold, about 3.1-fold, about 3.2-fold, about 3.3-fold, about 3.4- fold, about 3.5-fold, about 3.6-fold, about 3.7-fold, about 3.8-fold, about 3.9-fold, about 4.0- fold, about 4.1-fold, about 4.2-fold, about 4.3-fold, about 4.4-fold, about 4.5-fold, about 4.6- fold, about 4.7-fold, about 4.8-fold, about 4.9-fold, about 5.0-fold, about 5.1-fold, about 5.2- fold, about 5.3-fold, about 5.4-fold, about 5.5-fold, about 5.6-fold, about 5.7-fold, about 5.8- fold, about 5.9-fold, about 6.0-fold, about 6.1-fold, about 6.2-fold, about 6.3-fold, about 6.4- fold, about 6.5-fold, about 6.6-fold, about 6.7-fold, about 6.8-fold, about 6.9-fold, about 7.0- fold, about 7.1-fold, about 7.2-fold, about 7.3-fold, about 7.4-fold, about 7.5-fold, about 7.6- fold, about 7.7-fold, about 7.8-fold, about 7.9-fold, about 8.0-fold, about 8.1-fold, about 8.2- fold, about 8.3-fold, about 8.4-fold, about 8.5-fold, about 8.6-fold, about 8.7-fold, about 8.8- fold, about 8.9-fold, about 9.0-fold, about 9.1-fold, about 9.2-fold, about 9.3-fold, about 9.4- fold, about 9.5-fold, about 9.6-fold, about 9.7-fold, about 9.8-fold, about 9.9-fold, or at most about 10.0-fold or more than about 10.0-fold lower in a cell comprising or expressing the peptide expressed or encoded by any recombinant polynucleic acid or RNA constructs described herein than the amount, expression, or formation of the interactome in a cell comprising or expressing a corresponding peptide that is shorter in length than the peptide. In some embodiments, the amount, expression, or formation of the interactome may be more than about 10.0-fold lower in a cell comprising or expressing the peptide expressed or encoded by any recombinant polynucleic acid or RNA constructs described herein than the amount, expression, or formation of the interactome in a cell comprising or expressing a corresponding peptide that is shorter in length than the peptide.

[0204] In some embodiments, the amount, expression, or formation of the interactome orinteraction may be lower in a cell comprising or expressing the peptide comprising at least 130, at least 150, or at least 357 amino acid residues than the amount, expression, or formation of the interactome or interaction in a cell comprising or expressing the peptide comprising at most 77WSGR Docket No.: 57623-713.601 amino acid residues. In some embodiments, the amount, expression, or formation of the interactome or interaction may be lower in a cell comprising or expressing the peptide comprising at least 150, or at least 357 amino acid residues than the amount, expression, or formation of the interactome or interaction in a cell comprising or expressing the peptide comprising at most 77 or at most 130 amino acid residues. In some embodiments, the amount, expression, or formation of the interactome or interaction may be lower in a cell comprising or expressing the peptide comprising at least 357 amino acid residues than the amount, expression, or formation of the interactome or interaction in a cell comprising or expressing the peptide comprising at most 77, at most 130, or at most 150 amino acid residues.

[0205] In some embodiments, the amount, expression, or formation of the interactome orinteraction may be lower in a cell comprising or expressing the peptide comprising at least 83, at least 125, or at least 166 amino acid residues than the amount, expression, or formation of the interactome or interaction in a cell comprising or expressing the peptide comprising at most 14, at most 28, or at most 40 amino acid residues. In some embodiments, amount, expression, or formation of the interactome or interaction may be lower in a cell comprising or expressing the peptide comprising at least 125 or at least 166 amino acid residues than the amount, expression, or formation of the interactome or interaction in a cell comprising or expressing the peptide comprising at most 14, at most 28, at most 40, or at most 83 amino acid residues. In some embodiments, the amount, expression, or formation of the interactome or interaction may be lower in a cell comprising or expressing the peptide comprising at least 166 amino acid residues than the amount, expression, or formation of the interactome or interaction in a cell comprising or expressing the peptide comprising at most 14, at most 28, at most 40, at most 83, or at most 125 amino acid residues.

[0206] In some embodiments, a peptide expressed or encoded by any recombinant polynucleicacid or RNA constructs described herein can comprise a fragment of a binding partner of the target protein.

[0207] In some embodiments, the amount of degradation of a binding partner of a target proteinof a peptide encoded by any recombinant polynucleic acid or RNA construct described herein may be lower in a cell comprising or expressing the peptide than the amount of degradation of the binding partner in a cell without the peptide or in a cell not expressing the peptide. In one embodiment, the amount of degradation of a binding partner of a target protein of a peptide encoded by any recombinant polynucleic acid or RNA construct described herein may be at least about 10%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%,WSGR Docket No.: 57623-713.601 about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or at least about 99% lower in a cell comprising or expressing the peptide than the amount ofdegradation of the binding partner in a cell without the peptide or in a cell not expressing thepeptide. In some embodiments, a binding partner can comprise p53. In some embodiments, a target protein can comprise MDM2, MDM4, or a combination thereof.

[0208] In another embodiment, the amount of degradation of a binding partner of a targetprotein of a peptide encoded by any recombinant polynucleic acid or RNA construct described herein may be at most about 10%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or at most about 99% lower in a cell comprising or expressing the peptide than the amount of degradation of the binding partner in a cell without the peptide or in a cell not expressing the peptide. In some embodiments, a binding partner can comprise p53. In some embodiments, a target protein can comprise MDM2, MDM4, or a combination thereof.

[0209] In some embodiments, the amount of degradation of a binding partner of a target proteinof a peptide encoded by any recombinant polynucleic acid or RNA construct described herein may be at least about 1.1-fold, about 1.2-fold, about 1.3-fold, about 1.4-fold, about 1.5-fold, about 1.6-fold, about 1.7-fold, about 1.8-fold, about 1.9-fold, about 2.0-fold, about 2.1-fold, about 2.2-fold, about 2.3-fold, about 2.4-fold, about 2.5-fold, about 2.6-fold, about 2.7-fold, about 2.8-fold, about 2.9-fold, about 3.0-fold, about 3.1-fold, about 3.2-fold, about 3.3-fold, about 3.4-fold, about 3.5-fold, about 3.6-fold, about 3.7-fold, about 3.8-fold, about 3.9-fold, about 4.0-fold, about 4.1-fold, about 4.2-fold, about 4.3-fold, about 4.4-fold, about 4.5-fold,WSGR Docket No.: 57623-713.601 about 4.6-fold, about 4.7-fold, about 4.8-fold, about 4.9-fold, about 5.0-fold, about 5.1-fold, about 5.2-fold, about 5.3-fold, about 5.4-fold, about 5.5-fold, about 5.6-fold, about 5.7-fold, about 5.8-fold, about 5.9-fold, about 6.0-fold, about 6.1-fold, about 6.2-fold, about 6.3-fold, about 6.4-fold, about 6.5-fold, about 6.6-fold, about 6.7-fold, about 6.8-fold, about 6.9-fold, about 7.0-fold, about 7.1-fold, about 7.2-fold, about 7.3-fold, about 7.4-fold, about 7.5-fold, about 7.6-fold, about 7.7-fold, about 7.8-fold, about 7.9-fold, about 8.0-fold, about 8.1-fold, about 8.2-fold, about 8.3-fold, about 8.4-fold, about 8.5-fold, about 8.6-fold, about 8.7-fold, about 8.8-fold, about 8.9-fold, about 9.0-fold, about 9.1-fold, about 9.2-fold, about 9.3-fold, about 9.4-fold, about 9.5-fold, about 9.6-fold, about 9.7-fold, about 9.8-fold, about 9.9-fold, or at least about 10.0-fold, or more than about 10.0-fold lower in a cell comprising or expressing the peptide than the amount of degradation of the binding partner in a cell without the peptide or in a cell not expressing the peptide. In some embodiments, a binding partner can comprise p53. In some embodiments, a target protein can comprise MDM2, MDM4, or a combination thereof.

[0210] In some embodiments, the amount of degradation of a binding partner of a target proteinof a peptide encoded by any recombinant polynucleic acid or RNA construct described herein may be at most about 1.1-fold, about 1.2-fold, about 1.3-fold, about 1.4-fold, about 1.5-fold, about 1.6-fold, about 1.7-fold, about 1.8-fold, about 1.9-fold, about 2.0-fold, about 2.1-fold, about 2.2-fold, about 2.3-fold, about 2.4-fold, about 2.5-fold, about 2.6-fold, about 2.7-fold, about 2.8-fold, about 2.9-fold, about 3.0-fold, about 3.1-fold, about 3.2-fold, about 3.3-fold, about 3.4-fold, about 3.5-fold, about 3.6-fold, about 3.7-fold, about 3.8-fold, about 3.9-fold, about 4.0-fold, about 4.1-fold, about 4.2-fold, about 4.3-fold, about 4.4-fold, about 4.5-fold, about 4.6-fold, about 4.7-fold, about 4.8-fold, about 4.9-fold, about 5.0-fold, about 5.1-fold, about 5.2-fold, about 5.3-fold, about 5.4-fold, about 5.5-fold, about 5.6-fold, about 5.7-fold, about 5.8-fold, about 5.9-fold, about 6.0-fold, about 6.1-fold, about 6.2-fold, about 6.3-fold, about 6.4-fold, about 6.5-fold, about 6.6-fold, about 6.7-fold, about 6.8-fold, about 6.9-fold, about 7.0-fold, about 7.1-fold, about 7.2-fold, about 7.3-fold, about 7.4-fold, about 7.5-fold, about 7.6-fold, about 7.7-fold, about 7.8-fold, about 7.9-fold, about 8.0-fold, about 8.1-fold, about 8.2-fold, about 8.3-fold, about 8.4-fold, about 8.5-fold, about 8.6-fold, about 8.7-fold, about 8.8-fold, about 8.9-fold, about 9.0-fold, about 9.1-fold, about 9.2-fold, about 9.3-fold, about 9.4-fold, about 9.5-fold, about 9.6-fold, about 9.7-fold, about 9.8-fold, about 9.9-fold, or at most about 10.0-fold or more than about 10.0-fold lower in a cell comprising or expressing the peptide than the amount of degradation of the binding partner in a cell without the peptide or in a cell not expressing the peptide. In some embodiments, the amount of degradation of a binding partner of a target protein of a peptide encoded by any recombinant polynucleic acid or RNA construct described herein may be more than about 10.0-fold lower in a cell comprising orWSGR Docket No.: 57623-713.601 expressing the peptide than the amount of degradation of the binding partner in a cell without the peptide or in a cell not expressing the peptide. In some embodiments, a binding partner can comprise p53. In some embodiments, a target protein can comprise MDM2, MDM4, or a combination thereof.

[0211] In some embodiments, the amount of a binding partner of a target protein of a peptideencoded by any recombinant polynucleic acid or RNA construct described herein may be higher in a cell comprising or expressing the peptide than the amount of the binding partner in a cell without the peptide or in a cell not expressing the peptide. In one embodiment, the amount of a binding partner of a target protein of a peptide encoded by any recombinant polynucleic acid or RNA construct described herein may be at least about 10%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or at least about 99% higher in a cell comprising or expressing the peptide than the amount of the binding partner in a cell without the peptide or in a cell not expressing the peptide.

[0212] In another embodiment, the amount of a binding partner of a target protein of a peptideencoded by any recombinant polynucleic acid or RNA construct described herein may be at most about 10%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, aboutWSGR Docket No.: 57623-713.601 98%, or at most about 99% higher in a cell comprising or expressing the peptide than the amount of the binding partner in a cell without the peptide or in a cell not expressing the peptide.

[0213] In some embodiments, the amount of a binding partner of a target protein of a peptideencoded by any recombinant polynucleic acid or RNA construct described herein may be at least about 1.1-fold, about 1.2-fold, about 1.3-fold, about 1.4-fold, about 1.5-fold, about 1.6-fold, about 1.7-fold, about 1.8-fold, about 1.9-fold, about 2.0-fold, about 2.1-fold, about 2.2-fold, about 2.3-fold, about 2.4-fold, about 2.5-fold, about 2.6-fold, about 2.7-fold, about 2.8-fold, about 2.9-fold, about 3.0-fold, about 3.1-fold, about 3.2-fold, about 3.3-fold, about 3.4-fold, about 3.5-fold, about 3.6-fold, about 3.7-fold, about 3.8-fold, about 3.9-fold, about 4.0-fold, about 4.1-fold, about 4.2-fold, about 4.3-fold, about 4.4-fold, about 4.5-fold, about 4.6-fold, about 4.7-fold, about 4.8-fold, about 4.9-fold, about 5.0-fold, about 5.1-fold, about 5.2-fold, about 5.3-fold, about 5.4-fold, about 5.5-fold, about 5.6-fold, about 5.7-fold, about 5.8-fold, about 5.9-fold, about 6.0-fold, about 6.1-fold, about 6.2-fold, about 6.3-fold, about 6.4-fold, about 6.5-fold, about 6.6-fold, about 6.7-fold, about 6.8-fold, about 6.9-fold, about 7.0-fold, about 7.1-fold, about 7.2-fold, about 7.3-fold, about 7.4-fold, about 7.5-fold, about 7.6-fold, about 7.7-fold, about 7.8-fold, about 7.9-fold, about 8.0-fold, about 8.1-fold, about 8.2-fold, about 8.3-fold, about 8.4-fold, about 8.5-fold, about 8.6-fold, about 8.7-fold, about 8.8-fold, about 8.9-fold, about 9.0-fold, about 9.1-fold, about 9.2-fold, about 9.3-fold, about 9.4-fold, about 9.5-fold, about 9.6-fold, about 9.7-fold, about 9.8-fold, about 9.9-fold, about 10-fold, about 20-fold, about 30-fold, about 40-fold, about 50-fold, about 60-fold, about 70-fold, about 80-fold, about 90-fold, or at least about 100-fold higher in a cell comprising or expressing the peptide than the amount of the binding partner in a cell without the peptide or in a cell not expressing the peptide.

[0214] In some embodiments, the amount of a binding partner of a target protein of a peptideencoded by any recombinant polynucleic acid or RNA construct described herein may be at most about 1.1-fold, about 1.2-fold, about 1.3-fold, about 1.4-fold, about 1.5-fold, about 1.6- fold, about 1.7-fold, about 1.8-fold, about 1.9-fold, about 2.0-fold, about 2.1-fold, about 2.2- fold, about 2.3-fold, about 2.4-fold, about 2.5-fold, about 2.6-fold, about 2.7-fold, about 2.8- fold, about 2.9-fold, about 3.0-fold, about 3.1-fold, about 3.2-fold, about 3.3-fold, about 3.4-fold, about 3.5-fold, about 3.6-fold, about 3.7-fold, about 3.8-fold, about 3.9-fold, about 4.0-fold, about 4.1-fold, about 4.2-fold, about 4.3-fold, about 4.4-fold, about 4.5-fold, about 4.6- fold, about 4.7-fold, about 4.8-fold, about 4.9-fold, about 5.0-fold, about 5.1-fold, about 5.2- fold, about 5.3-fold, about 5.4-fold, about 5.5-fold, about 5.6-fold, about 5.7-fold, about 5.8- fold, about 5.9-fold, about 6.0-fold, about 6.1-fold, about 6.2-fold, about 6.3-fold, about 6.4-fold, about 6.5-fold, about 6.6-fold, about 6.7-fold, about 6.8-fold, about 6.9-fold, about 7.0-WSGR Docket No.: 57623-713.601 fold, about 7.1-fold, about 7.2-fold, about 7.3-fold, about 7.4-fold, about 7.5-fold, about 7.6- fold, about 7.7-fold, about 7.8-fold, about 7.9-fold, about 8.0-fold, about 8.1-fold, about 8.2- fold, about 8.3-fold, about 8.4-fold, about 8.5-fold, about 8.6-fold, about 8.7-fold, about 8.8- fold, about 8.9-fold, about 9.0-fold, about 9.1-fold, about 9.2-fold, about 9.3-fold, about 9.4- fold, about 9.5-fold, about 9.6-fold, about 9.7-fold, about 9.8-fold, about 9.9-fold, about 10-fold, about 20-fold, about 30-fold, about 40-fold, about 50-fold, about 60-fold, about 70-fold, about 80-fold, about 90-fold, or at most about 100-fold higher in a cell comprising or expressing the peptide than the amount of the binding partner in a cell without the peptide or in a cell not expressing the peptide.

[0215] In some embodiments, a binding partner can have an activity. In some embodiments, abinding partner can have an activity comprising a transcription activation, a transcription repression, an apoptosis induction, a signal transduction, a protein binding, a DNA binding, a ubiquitination, a GTPase activity, a kinase activity, a histone acetyltransferase activity, or a combination thereof.

[0216] In some embodiments, the level of an activity of a binding partner of a target protein of apeptide encoded by any recombinant polynucleic acid or RNA construct described herein may be higher in a cell comprising or expressing the peptide than the level of an activity of the binding partner in a cell without the peptide or in a cell not expressing the peptide. In one embodiment, the level of an activity of a binding partner of a target protein of a peptide encoded by any recombinant polynucleic acid or RNA construct described herein may be at least about 10%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or at least about 99% higher in a cell comprising or expressing the peptide than the level of an activity of the binding partner in a cell without the peptide or in a cell not expressing the peptide. In some embodiments, a binding partner can comprise p53. In some embodiments, a target protein can comprise MDM2, MDM4, or a combination thereof.WSGR Docket No.: 57623-713.601

[0217] In another embodiment, the level of an activity of a binding partner of a target protein ofa peptide encoded by any recombinant polynucleic acid or RNA construct described herein may be at most about 10%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or at most about 99% higher in a cell comprising or expressing the peptide than the level of an activity of the binding partner in a cell without the peptide or in a cell not expressing the peptide. In some embodiments, a binding partner can comprise p53. In some embodiments, a target protein can comprise MDM2, MDM4, or a combination thereof.

[0218] In some embodiments, the level of an activity of a binding partner of a target protein of apeptide encoded by any recombinant polynucleic acid or RNA construct described herein may be at least about 1.1-fold, about 1.2-fold, about 1.3-fold, about 1.4-fold, about 1.5-fold, about 1.6-fold, about 1.7-fold, about 1.8-fold, about 1.9-fold, about 2.0-fold, about 2.1-fold, about 2.2- fold, about 2.3-fold, about 2.4-fold, about 2.5-fold, about 2.6-fold, about 2.7-fold, about 2.8-fold, about 2.9-fold, about 3.0-fold, about 3.1-fold, about 3.2-fold, about 3.3-fold, about 3.4-fold, about 3.5-fold, about 3.6-fold, about 3.7-fold, about 3.8-fold, about 3.9-fold, about 4.0- fold, about 4.1-fold, about 4.2-fold, about 4.3-fold, about 4.4-fold, about 4.5-fold, about 4.6- fold, about 4.7-fold, about 4.8-fold, about 4.9-fold, about 5.0-fold, about 5.1-fold, about 5.2- fold, about 5.3-fold, about 5.4-fold, about 5.5-fold, about 5.6-fold, about 5.7-fold, about 5.8- fold, about 5.9-fold, about 6.0-fold, about 6.1-fold, about 6.2-fold, about 6.3-fold, about 6.4- fold, about 6.5-fold, about 6.6-fold, about 6.7-fold, about 6.8-fold, about 6.9-fold, about 7.0- fold, about 7.1-fold, about 7.2-fold, about 7.3-fold, about 7.4-fold, about 7.5-fold, about 7.6- fold, about 7.7-fold, about 7.8-fold, about 7.9-fold, about 8.0-fold, about 8.1-fold, about 8.2- fold, about 8.3-fold, about 8.4-fold, about 8.5-fold, about 8.6-fold, about 8.7-fold, about 8.8- fold, about 8.9-fold, about 9.0-fold, about 9.1-fold, about 9.2-fold, about 9.3-fold, about 9.4- fold, about 9.5-fold, about 9.6-fold, about 9.7-fold, about 9.8-fold, about 9.9-fold, about 10-fold, about 20-fold, about 30-fold, about 40-fold, about 50-fold, about 60-fold, about 70-fold, about 80-fold, about 90-fold, or at least about 100-fold higher in a cell comprising or expressing theWSGR Docket No.: 57623-713.601 peptide than the level of an activity of the binding partner in a cell without the peptide or in a cell not expressing the peptide. In some embodiments, a binding partner can comprise p53. In some embodiments, a target protein can comprise MDM2, MDM4, or a combination thereof.

[0219] In some embodiments, the level of an activity of a binding partner of a target protein of apeptide encoded by any recombinant polynucleic acid or RNA construct described herein may be at most about 1.1-fold, about 1.2-fold, about 1.3-fold, about 1.4-fold, about 1.5-fold, about 1.6-fold, about 1.7-fold, about 1.8-fold, about 1.9-fold, about 2.0-fold, about 2.1-fold, about 2.2- fold, about 2.3-fold, about 2.4-fold, about 2.5-fold, about 2.6-fold, about 2.7-fold, about 2.8-fold, about 2.9-fold, about 3.0-fold, about 3.1-fold, about 3.2-fold, about 3.3-fold, about 3.4-fold, about 3.5-fold, about 3.6-fold, about 3.7-fold, about 3.8-fold, about 3.9-fold, about 4.0- fold, about 4.1-fold, about 4.2-fold, about 4.3-fold, about 4.4-fold, about 4.5-fold, about 4.6- fold, about 4.7-fold, about 4.8-fold, about 4.9-fold, about 5.0-fold, about 5.1-fold, about 5.2- fold, about 5.3-fold, about 5.4-fold, about 5.5-fold, about 5.6-fold, about 5.7-fold, about 5.8-fold, about 5.9-fold, about 6.0-fold, about 6.1-fold, about 6.2-fold, about 6.3-fold, about 6.4-fold, about 6.5-fold, about 6.6-fold, about 6.7-fold, about 6.8-fold, about 6.9-fold, about 7.0- fold, about 7.1-fold, about 7.2-fold, about 7.3-fold, about 7.4-fold, about 7.5-fold, about 7.6- fold, about 7.7-fold, about 7.8-fold, about 7.9-fold, about 8.0-fold, about 8.1-fold, about 8.2- fold, about 8.3-fold, about 8.4-fold, about 8.5-fold, about 8.6-fold, about 8.7-fold, about 8.8-fold, about 8.9-fold, about 9.0-fold, about 9.1-fold, about 9.2-fold, about 9.3-fold, about 9.4-fold, about 9.5-fold, about 9.6-fold, about 9.7-fold, about 9.8-fold, about 9.9-fold, about 10-fold, about 20-fold, about 30-fold, about 40-fold, about 50-fold, about 60-fold, about 70-fold, about 80-fold, about 90-fold, or at most about 100-fold higher in a cell comprising or expressing the peptide than the level of an activity of the binding partner in a cell without the peptide or in a cell not expressing the peptide. In some embodiments, a binding partner can comprise p53. In some embodiments, a target protein can comprise MDM2, MDM4, or a combination thereof.

[0220] In some embodiments, the binding partner, the target protein, or the interactome canmodulate transcription of a downstream protein involved in the same pathway as the binding partner. In some embodiments, the binding partner, the target protein, or the interactome can activate transcription of a downstream protein involved in the same pathway as the binding partner. In some embodiments, the expression of the downstream protein may be higher in a cell comprising or expressing the peptide than in a cell without the peptide or in a cell not expressing the peptide.

[0221] In one embodiment, the expression of the downstream protein may be at least about10%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, aboutWSGR Docket No.: 57623-713.601 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or at least about 99% higher in a cell comprising or expressing the peptide than in a cell without the peptide or in a cell not expressing the peptide.

[0222] In another embodiment, the expression of the downstream protein may be at most about10%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or at most about 99% higher in a cell comprising or expressing the peptide than in a cell without the peptide or in a cell not expressing the peptide.

[0223] In some embodiments, the expression of the downstream protein may be at least about1.1-fold, about 1.2-fold, about 1.3-fold, about 1.4-fold, about 1.5-fold, about 1.6-fold, about 1.7- fold, about 1.8-fold, about 1.9-fold, about 2.0-fold, about 2.1-fold, about 2.2-fold, about 2.3- fold, about 2.4-fold, about 2.5-fold, about 2.6-fold, about 2.7-fold, about 2.8-fold, about 2.9- fold, about 3.0-fold, about 3.1-fold, about 3.2-fold, about 3.3-fold, about 3.4-fold, about 3.5- fold, about 3.6-fold, about 3.7-fold, about 3.8-fold, about 3.9-fold, about 4.0-fold, about 4.1- fold, about 4.2-fold, about 4.3-fold, about 4.4-fold, about 4.5-fold, about 4.6-fold, about 4.7- fold, about 4.8-fold, about 4.9-fold, about 5.0-fold, about 5.1-fold, about 5.2-fold, about 5.3- fold, about 5.4-fold, about 5.5-fold, about 5.6-fold, about 5.7-fold, about 5.8-fold, about 5.9- fold, about 6.0-fold, about 6.1-fold, about 6.2-fold, about 6.3-fold, about 6.4-fold, about 6.5- fold, about 6.6-fold, about 6.7-fold, about 6.8-fold, about 6.9-fold, about 7.0-fold, about 7.1- fold, about 7.2-fold, about 7.3-fold, about 7.4-fold, about 7.5-fold, about 7.6-fold, about 7.7-WSGR Docket No.: 57623-713.601 fold, about 7.8-fold, about 7.9-fold, about 8.0-fold, about 8.1-fold, about 8.2-fold, about 8.3- fold, about 8.4-fold, about 8.5-fold, about 8.6-fold, about 8.7-fold, about 8.8-fold, about 8.9- fold, about 9.0-fold, about 9.1-fold, about 9.2-fold, about 9.3-fold, about 9.4-fold, about 9.5- fold, about 9.6-fold, about 9.7-fold, about 9.8-fold, about 9.9-fold, about 10-fold, about 20-fold, about 30-fold, about 40-fold, about 50-fold, about 60-fold, about 70-fold, about 80-fold, about 90-fold, or at least about 100-fold higher in a cell comprising or expressing the peptide than in a cell without the peptide or in a cell not expressing the peptide.

[0224] In some embodiments, the expression of the downstream protein may be at most about1.1-fold, about 1.2-fold, about 1.3-fold, about 1.4-fold, about 1.5-fold, about 1.6-fold, about 1.7- fold, about 1.8-fold, about 1.9-fold, about 2.0-fold, about 2.1-fold, about 2.2-fold, about 2.3- fold, about 2.4-fold, about 2.5-fold, about 2.6-fold, about 2.7-fold, about 2.8-fold, about 2.9- fold, about 3.0-fold, about 3.1-fold, about 3.2-fold, about 3.3-fold, about 3.4-fold, about 3.5- fold, about 3.6-fold, about 3.7-fold, about 3.8-fold, about 3.9-fold, about 4.0-fold, about 4.1- fold, about 4.2-fold, about 4.3-fold, about 4.4-fold, about 4.5-fold, about 4.6-fold, about 4.7- fold, about 4.8-fold, about 4.9-fold, about 5.0-fold, about 5.1-fold, about 5.2-fold, about 5.3- fold, about 5.4-fold, about 5.5-fold, about 5.6-fold, about 5.7-fold, about 5.8-fold, about 5.9- fold, about 6.0-fold, about 6.1-fold, about 6.2-fold, about 6.3-fold, about 6.4-fold, about 6.5- fold, about 6.6-fold, about 6.7-fold, about 6.8-fold, about 6.9-fold, about 7.0-fold, about 7.1- fold, about 7.2-fold, about 7.3-fold, about 7.4-fold, about 7.5-fold, about 7.6-fold, about 7.7- fold, about 7.8-fold, about 7.9-fold, about 8.0-fold, about 8.1-fold, about 8.2-fold, about 8.3- fold, about 8.4-fold, about 8.5-fold, about 8.6-fold, about 8.7-fold, about 8.8-fold, about 8.9- fold, about 9.0-fold, about 9.1-fold, about 9.2-fold, about 9.3-fold, about 9.4-fold, about 9.5- fold, about 9.6-fold, about 9.7-fold, about 9.8-fold, about 9.9-fold, about 10-fold, about 20-fold, about 30-fold, about 40-fold, about 50-fold, about 60-fold, about 70-fold, about 80-fold, about 90-fold, or at most about 100-fold higher in a cell comprising or expressing the peptide than in a cell without the peptide or in a cell not expressing the peptide.

[0225] In some embodiments, the downstream protein can comprise p21, B-cellleukemia / lymphoma 2 (BCL2), or c-Myc. For example, a peptide can bind its target protein, e.g., p53 and inhibit p53-MDM2 / MDM4 interaction, which can, in turn, activate transcription of a downstream marker, e.g., p21.

[0226] In some embodiments, the binding partner, the target protein, or the interactome caninhibit or repress transcription of a downstream protein involved in the same pathway as the binding partner. In some embodiments, the expression of the downstream protein may be lower in a cell comprising or expressing the peptide than in a cell without the peptide or in a cell not expressing the peptide.WSGR Docket No.: 57623-713.601

[0227] In one embodiment, the expression of the downstream protein may be at least about10%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or at least about 99% lower in a cell comprising or expressing the peptide than in a cell without the peptide or in a cell not expressing the peptide.

[0228] In another embodiment, the expression of the downstream protein may be at most about10%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or at most about 99% lower in a cell comprising or expressing the peptide than in a cell without the peptide or in a cell not expressing the peptide.

[0229] In some embodiments, the expression of the downstream protein may be at least about1.1-fold, about 1.2-fold, about 1.3-fold, about 1.4-fold, about 1.5-fold, about 1.6-fold, about 1.7- fold, about 1.8-fold, about 1.9-fold, about 2.0-fold, about 2.1-fold, about 2.2-fold, about 2.3- fold, about 2.4-fold, about 2.5-fold, about 2.6-fold, about 2.7-fold, about 2.8-fold, about 2.9- fold, about 3.0-fold, about 3.1-fold, about 3.2-fold, about 3.3-fold, about 3.4-fold, about 3.5- fold, about 3.6-fold, about 3.7-fold, about 3.8-fold, about 3.9-fold, about 4.0-fold, about 4.1- fold, about 4.2-fold, about 4.3-fold, about 4.4-fold, about 4.5-fold, about 4.6-fold, about 4.7- fold, about 4.8-fold, about 4.9-fold, about 5.0-fold, about 5.1-fold, about 5.2-fold, about 5.3- fold, about 5.4-fold, about 5.5-fold, about 5.6-fold, about 5.7-fold, about 5.8-fold, about 5.9-WSGR Docket No.: 57623-713.601 fold, about 6.0-fold, about 6.1-fold, about 6.2-fold, about 6.3-fold, about 6.4-fold, about 6.5- fold, about 6.6-fold, about 6.7-fold, about 6.8-fold, about 6.9-fold, about 7.0-fold, about 7.1- fold, about 7.2-fold, about 7.3-fold, about 7.4-fold, about 7.5-fold, about 7.6-fold, about 7.7- fold, about 7.8-fold, about 7.9-fold, about 8.0-fold, about 8.1-fold, about 8.2-fold, about 8.3- fold, about 8.4-fold, about 8.5-fold, about 8.6-fold, about 8.7-fold, about 8.8-fold, about 8.9- fold, about 9.0-fold, about 9.1-fold, about 9.2-fold, about 9.3-fold, about 9.4-fold, about 9.5- fold, about 9.6-fold, about 9.7-fold, about 9.8-fold, about 9.9-fold, or at least about 10.0-fold or more than about 10.0-fold lower in a cell comprising or expressing the peptide than in a cell without the peptide or in a cell not expressing the peptide.

[0230] In some embodiments, the expression of the downstream protein may be at most about1.1-fold, about 1.2-fold, about 1.3-fold, about 1.4-fold, about 1.5-fold, about 1.6-fold, about 1.7- fold, about 1.8-fold, about 1.9-fold, about 2.0-fold, about 2.1-fold, about 2.2-fold, about 2.3- fold, about 2.4-fold, about 2.5-fold, about 2.6-fold, about 2.7-fold, about 2.8-fold, about 2.9- fold, about 3.0-fold, about 3.1-fold, about 3.2-fold, about 3.3-fold, about 3.4-fold, about 3.5- fold, about 3.6-fold, about 3.7-fold, about 3.8-fold, about 3.9-fold, about 4.0-fold, about 4.1- fold, about 4.2-fold, about 4.3-fold, about 4.4-fold, about 4.5-fold, about 4.6-fold, about 4.7- fold, about 4.8-fold, about 4.9-fold, about 5.0-fold, about 5.1-fold, about 5.2-fold, about 5.3- fold, about 5.4-fold, about 5.5-fold, about 5.6-fold, about 5.7-fold, about 5.8-fold, about 5.9- fold, about 6.0-fold, about 6.1-fold, about 6.2-fold, about 6.3-fold, about 6.4-fold, about 6.5- fold, about 6.6-fold, about 6.7-fold, about 6.8-fold, about 6.9-fold, about 7.0-fold, about 7.1- fold, about 7.2-fold, about 7.3-fold, about 7.4-fold, about 7.5-fold, about 7.6-fold, about 7.7- fold, about 7.8-fold, about 7.9-fold, about 8.0-fold, about 8.1-fold, about 8.2-fold, about 8.3- fold, about 8.4-fold, about 8.5-fold, about 8.6-fold, about 8.7-fold, about 8.8-fold, about 8.9- fold, about 9.0-fold, about 9.1-fold, about 9.2-fold, about 9.3-fold, about 9.4-fold, about 9.5- fold, about 9.6-fold, about 9.7-fold, about 9.8-fold, about 9.9-fold, or at most about 10.0-fold or more than about 10.0-fold lower in a cell comprising or expressing the peptide than in a cell without the peptide or in a cell not expressing the peptide.

[0231] In some embodiments, the downstream protein can comprise CD69, B-cellleukemia / lymphoma 2 (BCL2), or c-Myc. For example, a peptide can bind its target protein, e.g., TCR and inhibit TCR-CD3 interaction, which in turn can repress transcription of adownstream marker, e.g., CD69. In some embodiments, TCR can comprise TCR- -combination thereof. In some embodiments, CD3 can comprise CD3 , , , , or acombination thereof.

[0232] In some embodiments, the amount, expression, or formation of the interactome may belower in a cell expressing recombinant polynucleic acid or RNA constructs comprising at leastWSGR Docket No.: 57623-713.601 one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding or comprising an siRNA capable of binding a target RNA than the amount, expression, or formation of the interactome in a cell comprising or expressing a recombinant polynucleic acid or RNA construct comprising at least one nucleic acid sequence encoding a peptide without the at least one nucleic acid sequence encoding or comprising the siRNA. In one embodiment, the amount, expression, or formation of the interactome may be at least about 10%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or at least about 99% lower in a cell expressing recombinant polynucleic acid or RNA constructs comprising at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding or comprising an siRNA capable of binding a target RNA than the amount, expression, or formation of the interactome in a cell comprising or expressing a recombinant polynucleic acid or RNA construct comprising at least one nucleic acid sequence encoding a peptide without the at least one nucleic acid sequence encoding or comprising the siRNA.

[0233] In another embodiment, the amount, expression, or formation of the interactome may beat most about 10%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or at most about 99% lower in a cell expressing recombinant polynucleic acid or RNA constructs comprising at least one nucleic acid sequence encoding a peptide and at leastWSGR Docket No.: 57623-713.601 one nucleic acid sequence encoding or comprising an siRNA capable of binding a target RNA than the amount, expression, or formation of the interactome in a cell comprising or expressing a recombinant polynucleic acid or RNA construct comprising at least one nucleic acid sequenceencoding a peptide without the at least one nucleic acid sequence encoding or comprising thesiRNA.

[0234] In some embodiments, the amount, expression, or formation of the interactome may be atleast about 1.1-fold, about 1.2-fold, about 1.3-fold, about 1.4-fold, about 1.5-fold, about 1.6- fold, about 1.7-fold, about 1.8-fold, about 1.9-fold, about 2.0-fold, about 2.1-fold, about 2.2- fold, about 2.3-fold, about 2.4-fold, about 2.5-fold, about 2.6-fold, about 2.7-fold, about 2.8- fold, about 2.9-fold, about 3.0-fold, about 3.1-fold, about 3.2-fold, about 3.3-fold, about 3.4- fold, about 3.5-fold, about 3.6-fold, about 3.7-fold, about 3.8-fold, about 3.9-fold, about 4.0- fold, about 4.1-fold, about 4.2-fold, about 4.3-fold, about 4.4-fold, about 4.5-fold, about 4.6- fold, about 4.7-fold, about 4.8-fold, about 4.9-fold, about 5.0-fold, about 5.1-fold, about 5.2- fold, about 5.3-fold, about 5.4-fold, about 5.5-fold, about 5.6-fold, about 5.7-fold, about 5.8-fold, about 5.9-fold, about 6.0-fold, about 6.1-fold, about 6.2-fold, about 6.3-fold, about 6.4-fold, about 6.5-fold, about 6.6-fold, about 6.7-fold, about 6.8-fold, about 6.9-fold, about 7.0- fold, about 7.1-fold, about 7.2-fold, about 7.3-fold, about 7.4-fold, about 7.5-fold, about 7.6- fold, about 7.7-fold, about 7.8-fold, about 7.9-fold, about 8.0-fold, about 8.1-fold, about 8.2- fold, about 8.3-fold, about 8.4-fold, about 8.5-fold, about 8.6-fold, about 8.7-fold, about 8.8- fold, about 8.9-fold, about 9.0-fold, about 9.1-fold, about 9.2-fold, about 9.3-fold, about 9.4- fold, about 9.5-fold, about 9.6-fold, about 9.7-fold, about 9.8-fold, about 9.9-fold, or at least about 10.0-fold lower in a cell expressing recombinant polynucleic acid or RNA constructs comprising at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding or comprising an siRNA capable of binding a target RNA than the amount, expression, or formation of the interactome in a cell comprising or expressing a recombinant polynucleic acid or RNA construct comprising at least one nucleic acid sequence encoding a peptide without the at least one nucleic acid sequence encoding or comprising the siRNA.

[0235] In some embodiments, the amount, expression, or formation of the interactome may be atmost about 1.1-fold, about 1.2-fold, about 1.3-fold, about 1.4-fold, about 1.5-fold, about 1.6- fold, about 1.7-fold, about 1.8-fold, about 1.9-fold, about 2.0-fold, about 2.1-fold, about 2.2- fold, about 2.3-fold, about 2.4-fold, about 2.5-fold, about 2.6-fold, about 2.7-fold, about 2.8- fold, about 2.9-fold, about 3.0-fold, about 3.1-fold, about 3.2-fold, about 3.3-fold, about 3.4- fold, about 3.5-fold, about 3.6-fold, about 3.7-fold, about 3.8-fold, about 3.9-fold, about 4.0- fold, about 4.1-fold, about 4.2-fold, about 4.3-fold, about 4.4-fold, about 4.5-fold, about 4.6- fold, about 4.7-fold, about 4.8-fold, about 4.9-fold, about 5.0-fold, about 5.1-fold, about 5.2-WSGR Docket No.: 57623-713.601 fold, about 5.3-fold, about 5.4-fold, about 5.5-fold, about 5.6-fold, about 5.7-fold, about 5.8- fold, about 5.9-fold, about 6.0-fold, about 6.1-fold, about 6.2-fold, about 6.3-fold, about 6.4- fold, about 6.5-fold, about 6.6-fold, about 6.7-fold, about 6.8-fold, about 6.9-fold, about 7.0- fold, about 7.1-fold, about 7.2-fold, about 7.3-fold, about 7.4-fold, about 7.5-fold, about 7.6- fold, about 7.7-fold, about 7.8-fold, about 7.9-fold, about 8.0-fold, about 8.1-fold, about 8.2- fold, about 8.3-fold, about 8.4-fold, about 8.5-fold, about 8.6-fold, about 8.7-fold, about 8.8- fold, about 8.9-fold, about 9.0-fold, about 9.1-fold, about 9.2-fold, about 9.3-fold, about 9.4- fold, about 9.5-fold, about 9.6-fold, about 9.7-fold, about 9.8-fold, about 9.9-fold, or at most about 10.0-fold lower in a cell expressing recombinant polynucleic acid or RNA constructs comprising at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding or comprising an siRNA capable of binding a target RNA than the amount, expression, or formation of the interactome in a cell comprising or expressing a recombinant polynucleic acid or RNA construct comprising at least one nucleic acid sequence encoding a peptide without the at least one nucleic acid sequence encoding or comprising the siRNA.

[0236] In some embodiments, the amount of the peptide localized to the nucleus of a cellexpressing recombinant polynucleic acid or RNA constructs comprising at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding an NLS may be higher than the amount of the peptide localized to the nucleus of a cell expressing a recombinant polynucleic acid or RNA constructs comprising at least one nucleic acid sequence encoding a peptide without the at least one nucleic acid sequence encoding an NLS. In one embodiment, the amount of the peptide localized to the nucleus of a cell expressing recombinant polynucleic acid with NLS or RNA constructs comprising at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding an NLS are at least about 10%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or at least about 99% higher than the amount of the peptide localized to the nucleus of a cell expressing a recombinantWSGR Docket No.: 57623-713.601 polynucleic acid or RNA constructs comprising at least one nucleic acid sequence encoding a peptide without the at least one nucleic acid sequence encoding an NLS.

[0237] In another embodiment, the amount of the peptide localized to the nucleus of a cellexpressing recombinant polynucleic acid or RNA constructs comprising at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding an NLS may be at most about 10%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about98%, or at most about 99% higher than the amount of the peptide localized to the nucleus of acell expressing a recombinant polynucleic acid or RNA constructs comprising at least onenucleic acid sequence encoding a peptide without the at least one nucleic acid sequence encoding an NLS.

[0238] In some embodiments, the amount of the peptide localized to the nucleus of a cellexpressing recombinant polynucleic acid or RNA constructs comprising at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding an NLS may be at least one nucleic acid sequence encoding an NLS may be at least about 1.1-fold, about 1.2-fold, about 1.3-fold, about 1.4-fold, about 1.5-fold, about 1.6-fold, about 1.7-fold, about 1.8-fold, about 1.9-fold, about 2.0-fold, about 2.1-fold, about 2.2-fold, about 2.3-fold, about 2.4-fold, about 2.5-fold, about 2.6-fold, about 2.7-fold, about 2.8-fold, about 2.9-fold, about 3.0-fold, about 3.1-fold, about 3.2-fold, about 3.3-fold, about 3.4-fold, about 3.5-fold, about 3.6-fold, about 3.7-fold, about 3.8-fold, about 3.9-fold, about 4.0-fold, about 4.1-fold, about 4.2-fold, about 4.3-fold, about 4.4-fold, about 4.5-fold, about 4.6-fold, about 4.7-fold, about 4.8-fold, about 4.9-fold, about 5.0-fold, about 5.1-fold, about 5.2-fold, about 5.3-fold, about 5.4-fold, about 5.5-fold, about 5.6-fold, about 5.7-fold, about 5.8-fold, about 5.9-fold, about 6.0-fold, about 6.1-fold, about 6.2-fold, about 6.3-fold, about 6.4-fold, about 6.5-fold, about 6.6-fold, about 6.7-fold, about 6.8-fold, about 6.9-fold, about 7.0-fold, about 7.1-fold, about 7.2-fold, about 7.3-fold, about 7.4-fold, about 7.5-fold, about 7.6-fold, about 7.7-fold, about 7.8-fold, about 7.9-fold, about 8.0-fold, about 8.1-fold, about 8.2-fold, about 8.3-fold, about 8.4-fold,WSGR Docket No.: 57623-713.601 about 8.5-fold, about 8.6-fold, about 8.7-fold, about 8.8-fold, about 8.9-fold, about 9.0-fold, about 9.1-fold, about 9.2-fold, about 9.3-fold, about 9.4-fold, about 9.5-fold, about 9.6-fold, about 9.7-fold, about 9.8-fold, about 9.9-fold, about 10-fold, about 20-fold, about 30-fold, about 40-fold, about 50-fold, about 60-fold, about 70-fold, about 80-fold, about 90-fold, or at least about 100-fold higher than the amount of the peptide localized to the nucleus of a cell expressing a recombinant polynucleic acid or RNA constructs comprising at least one nucleic acid sequence encoding a peptide without the at least one nucleic acid sequence encoding an NLS.

[0239] In some embodiments, the amount of the peptide localized to the nucleus of a cellexpressing recombinant polynucleic acid or RNA constructs comprising at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding an NLS may be at most about 1.1-fold, about 1.2-fold, about 1.3-fold, about 1.4-fold, about 1.5-fold, about 1.6- fold, about 1.7-fold, about 1.8-fold, about 1.9-fold, about 2.0-fold, about 2.1-fold, about 2.2- fold, about 2.3-fold, about 2.4-fold, about 2.5-fold, about 2.6-fold, about 2.7-fold, about 2.8- fold, about 2.9-fold, about 3.0-fold, about 3.1-fold, about 3.2-fold, about 3.3-fold, about 3.4- fold, about 3.5-fold, about 3.6-fold, about 3.7-fold, about 3.8-fold, about 3.9-fold, about 4.0- fold, about 4.1-fold, about 4.2-fold, about 4.3-fold, about 4.4-fold, about 4.5-fold, about 4.6- fold, about 4.7-fold, about 4.8-fold, about 4.9-fold, about 5.0-fold, about 5.1-fold, about 5.2- fold, about 5.3-fold, about 5.4-fold, about 5.5-fold, about 5.6-fold, about 5.7-fold, about 5.8- fold, about 5.9-fold, about 6.0-fold, about 6.1-fold, about 6.2-fold, about 6.3-fold, about 6.4- fold, about 6.5-fold, about 6.6-fold, about 6.7-fold, about 6.8-fold, about 6.9-fold, about 7.0- fold, about 7.1-fold, about 7.2-fold, about 7.3-fold, about 7.4-fold, about 7.5-fold, about 7.6- fold, about 7.7-fold, about 7.8-fold, about 7.9-fold, about 8.0-fold, about 8.1-fold, about 8.2- fold, about 8.3-fold, about 8.4-fold, about 8.5-fold, about 8.6-fold, about 8.7-fold, about 8.8- fold, about 8.9-fold, about 9.0-fold, about 9.1-fold, about 9.2-fold, about 9.3-fold, about 9.4- fold, about 9.5-fold, about 9.6-fold, about 9.7-fold, about 9.8-fold, about 9.9-fold, about 10-fold, about 20-fold, about 30-fold, about 40-fold, about 50-fold, about 60-fold, about 70-fold, about 80-fold, about 90-fold, or at most about 100-fold higher than the amount of the peptide localized to the nucleus of a cell expressing a recombinant polynucleic acid or RNA constructs comprising at least one nucleic acid sequence encoding a peptide without the at least one nucleic acid sequence encoding an NLS.

[0240] In some embodiments, the expression of a binding partner of a target protein of a peptidemay be higher in a cell expressing recombinant polynucleic acid or RNA constructs comprising at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding an NLS than in a cell expressing a recombinant polynucleic acid or RNA constructWSGR Docket No.: 57623-713.601 comprising at least one nucleic acid sequence encoding a peptide without the at least one nucleic acid sequence encoding the NLS. In one embodiment, the expression of a binding partner of a target protein of a peptide may be at least about 10%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or at least about 99% higher in a cell expressing recombinant polynucleic acid or RNA constructs comprising at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding an NLS than in a cell expressing a recombinant polynucleic acid or RNA construct comprising at least one nucleic acid sequence encoding a peptide without the at least one nucleic acid sequence encoding the NLS. In some embodiments, a binding partner can comprise p53. In some embodiments, a target protein can comprise MDM2, MDM4, or a combination thereof.

[0241] In one embodiment, the expression of a binding partner of a target protein of a peptidemay be at most about 10%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or at most about 99% higher in a cell expressing recombinant polynucleic acid or RNA constructs comprising at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding an NLS than in a cell expressing a recombinant polynucleic acid or RNA construct comprising at least one nucleic acid sequence encoding a peptide without the at least one nucleic acid sequence encoding the NLS. In some embodiments, a bindingWSGR Docket No.: 57623-713.601 partner can comprise p53. In some embodiments, a target protein can comprise MDM2, MDM4, or a combination thereof.

[0242] In some embodiments, the expression of a binding partner of a target protein of a peptidemay be at least about 1.1-fold, about 1.2-fold, about 1.3-fold, about 1.4-fold, about 1.5-fold,about 1.6-fold, about 1.7-fold, about 1.8-fold, about 1.9-fold, about 2.0-fold, about 2.1-fold,about 2.2-fold, about 2.3-fold, about 2.4-fold, about 2.5-fold, about 2.6-fold, about 2.7-fold, about 2.8-fold, about 2.9-fold, about 3.0-fold, about 3.1-fold, about 3.2-fold, about 3.3-fold, about 3.4-fold, about 3.5-fold, about 3.6-fold, about 3.7-fold, about 3.8-fold, about 3.9-fold, about 4.0-fold, about 4.1-fold, about 4.2-fold, about 4.3-fold, about 4.4-fold, about 4.5-fold,about 4.6-fold, about 4.7-fold, about 4.8-fold, about 4.9-fold, about 5.0-fold, about 5.1-fold,about 5.2-fold, about 5.3-fold, about 5.4-fold, about 5.5-fold, about 5.6-fold, about 5.7-fold, about 5.8-fold, about 5.9-fold, about 6.0-fold, about 6.1-fold, about 6.2-fold, about 6.3-fold, about 6.4-fold, about 6.5-fold, about 6.6-fold, about 6.7-fold, about 6.8-fold, about 6.9-fold, about 7.0-fold, about 7.1-fold, about 7.2-fold, about 7.3-fold, about 7.4-fold, about 7.5-fold, about 7.6-fold, about 7.7-fold, about 7.8-fold, about 7.9-fold, about 8.0-fold, about 8.1-fold, about 8.2-fold, about 8.3-fold, about 8.4-fold, about 8.5-fold, about 8.6-fold, about 8.7-fold, about 8.8-fold, about 8.9-fold, about 9.0-fold, about 9.1-fold, about 9.2-fold, about 9.3-fold, about 9.4-fold, about 9.5-fold, about 9.6-fold, about 9.7-fold, about 9.8-fold, about 9.9-fold, about 10-fold, about 20-fold, about 30-fold, about 40-fold, about 50-fold, about 60-fold, about 70-fold, about 80-fold, about 90-fold, or at least about 100-fold higher in a cell expressing recombinant polynucleic acid or RNA constructs comprising at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding an NLS than in a cell expressing a recombinant polynucleic acid or RNA construct comprising at least one nucleic acid sequence encoding a peptide without the at least one nucleic acid sequence encoding the NLS. In some embodiments, a binding partner can comprise p53. In some embodiments, a target protein can comprise MDM2, MDM4, or a combination thereof.

[0243] In some embodiments, the expression of a binding partner of a target protein of a peptidemay be at most about 1.1-fold, about 1.2-fold, about 1.3-fold, about 1.4-fold, about 1.5-fold, about 1.6-fold, about 1.7-fold, about 1.8-fold, about 1.9-fold, about 2.0-fold, about 2.1-fold, about 2.2-fold, about 2.3-fold, about 2.4-fold, about 2.5-fold, about 2.6-fold, about 2.7-fold, about 2.8-fold, about 2.9-fold, about 3.0-fold, about 3.1-fold, about 3.2-fold, about 3.3-fold, about 3.4-fold, about 3.5-fold, about 3.6-fold, about 3.7-fold, about 3.8-fold, about 3.9-fold, about 4.0-fold, about 4.1-fold, about 4.2-fold, about 4.3-fold, about 4.4-fold, about 4.5-fold, about 4.6-fold, about 4.7-fold, about 4.8-fold, about 4.9-fold, about 5.0-fold, about 5.1-fold, about 5.2-fold, about 5.3-fold, about 5.4-fold, about 5.5-fold, about 5.6-fold, about 5.7-fold,WSGR Docket No.: 57623-713.601 about 5.8-fold, about 5.9-fold, about 6.0-fold, about 6.1-fold, about 6.2-fold, about 6.3-fold, about 6.4-fold, about 6.5-fold, about 6.6-fold, about 6.7-fold, about 6.8-fold, about 6.9-fold, about 7.0-fold, about 7.1-fold, about 7.2-fold, about 7.3-fold, about 7.4-fold, about 7.5-fold, about 7.6-fold, about 7.7-fold, about 7.8-fold, about 7.9-fold, about 8.0-fold, about 8.1-fold, about 8.2-fold, about 8.3-fold, about 8.4-fold, about 8.5-fold, about 8.6-fold, about 8.7-fold, about 8.8-fold, about 8.9-fold, about 9.0-fold, about 9.1-fold, about 9.2-fold, about 9.3-fold, about 9.4-fold, about 9.5-fold, about 9.6-fold, about 9.7-fold, about 9.8-fold, about 9.9-fold, about 10-fold, about 20-fold, about 30-fold, about 40-fold, about 50-fold, about 60-fold, about 70-fold, about 80-fold, about 90-fold, or at most about 100-fold higher in a cell expressing recombinant polynucleic acid or RNA constructs comprising at least one nucleic acid sequence encoding a peptide and at least one nucleic acid sequence encoding an NLS than in a cell expressing a recombinant polynucleic acid or RNA construct comprising at least one nucleic acid sequence encoding a peptide without the at least one nucleic acid sequence encoding the NLS. In some embodiments, a binding partner can comprise p53. In some embodiments, a target protein can comprise MDM2, MDM4, or a combination thereof.

[0244] In some embodiments, the level of the interaction between the target protein and thebinding partner may be lower in a cell comprising or expressing the peptide than the level of the interaction between the target protein and the binding partner in a cell without the peptide or in a cell not expressing the peptide. For example, the level of the interaction between the target protein and the binding partner may be at least about 10%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or at least about 99% lower in the cell comprising or expressing the peptide than the level of the interaction between the target protein and the binding partner in the cell without the peptide or in the cell not expressing the peptide. For example, the level of the interaction between the target protein and the binding partner may be at least about 1.1-fold, about 1.2-fold, about 1.3-fold, about 1.4-fold, about 1.5-fold, about 1.6-fold, about 1.7-fold, about 1.8-fold, about 1.9-fold, about 2.0-fold, about 2.1-fold, about 2.2-WSGR Docket No.: 57623-713.601 fold, about 2.3-fold, about 2.4-fold, about 2.5-fold, about 2.6-fold, about 2.7-fold, about 2.8- fold, about 2.9-fold, about 3.0-fold, about 3.1-fold, about 3.2-fold, about 3.3-fold, about 3.4- fold, about 3.5-fold, about 3.6-fold, about 3.7-fold, about 3.8-fold, about 3.9-fold, about 4.0- fold, about 4.1-fold, about 4.2-fold, about 4.3-fold, about 4.4-fold, about 4.5-fold, about 4.6- fold, about 4.7-fold, about 4.8-fold, about 4.9-fold, about 5.0-fold, about 5.1-fold, about 5.2- fold, about 5.3-fold, about 5.4-fold, about 5.5-fold, about 5.6-fold, about 5.7-fold, about 5.8-fold, about 5.9-fold, about 6.0-fold, about 6.1-fold, about 6.2-fold, about 6.3-fold, about 6.4-fold, about 6.5-fold, about 6.6-fold, about 6.7-fold, about 6.8-fold, about 6.9-fold, about 7.0- fold, about 7.1-fold, about 7.2-fold, about 7.3-fold, about 7.4-fold, about 7.5-fold, about 7.6- fold, about 7.7-fold, about 7.8-fold, about 7.9-fold, about 8.0-fold, about 8.1-fold, about 8.2- fold, about 8.3-fold, about 8.4-fold, about 8.5-fold, about 8.6-fold, about 8.7-fold, about 8.8- fold, about 8.9-fold, about 9.0-fold, about 9.1-fold, about 9.2-fold, about 9.3-fold, about 9.4- fold, about 9.5-fold, about 9.6-fold, about 9.7-fold, about 9.8-fold, about 9.9-fold, or at least about 10.0-fold lower in a cell comprising or expressing the peptide than the level of the interaction between the target protein and the binding partner in a cell without the peptide or in a cell not expressing the peptide. In some embodiments, the target protein can comprise BCL9L, -Catenin. In some embodiments, the target -Catenin and the binding partner can comprise BCL9L, TCF4, or both.

[0245] In some embodiments, the level of interaction between the target protein and the bindingpartner can be determined by measuring the expression level of a protein or an mRNA encoded by a target gene of Wingless-type MMTV integration site (WNT) signaling. In some embodiments, the expression level of the protein or the mRNA encoded by the target gene of WNT signaling may be lower in a cell comprising or expressing the peptide than the expression level of the protein or the mRNA encoded by the target gene of WNT signaling in a cell without the peptide or in a cell not expressing the peptide. For example, the expression level of the protein or the mRNA encoded by the target gene of WNT signaling may be at least about 10%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%,WSGR Docket No.: 57623-713.601 about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or at least about 99% lower in a cell comprising or expressing the peptide than the expression level of the protein or the mRNA encoded by the target gene of WNT signaling in a cell without the peptide or in a cell not expressing the peptide. For example, the expression level of the protein or the mRNA encoded by the target gene of WNT signaling may be at least about 1.1-fold, about 1.2- fold, about 1.3-fold, about 1.4-fold, about 1.5-fold, about 1.6-fold, about 1.7-fold, about 1.8- fold, about 1.9-fold, about 2.0-fold, about 2.1-fold, about 2.2-fold, about 2.3-fold, about 2.4- fold, about 2.5-fold, about 2.6-fold, about 2.7-fold, about 2.8-fold, about 2.9-fold, about 3.0- fold, about 3.1-fold, about 3.2-fold, about 3.3-fold, about 3.4-fold, about 3.5-fold, about 3.6- fold, about 3.7-fold, about 3.8-fold, about 3.9-fold, about 4.0-fold, about 4.1-fold, about 4.2- fold, about 4.3-fold, about 4.4-fold, about 4.5-fold, about 4.6-fold, about 4.7-fold, about 4.8- fold, about 4.9-fold, about 5.0-fold, about 5.1-fold, about 5.2-fold, about 5.3-fold, about 5.4- fold, about 5.5-fold, about 5.6-fold, about 5.7-fold, about 5.8-fold, about 5.9-fold, about 6.0- fold, about 6.1-fold, about 6.2-fold, about 6.3-fold, about 6.4-fold, about 6.5-fold, about 6.6- fold, about 6.7-fold, about 6.8-fold, about 6.9-fold, about 7.0-fold, about 7.1-fold, about 7.2- fold, about 7.3-fold, about 7.4-fold, about 7.5-fold, about 7.6-fold, about 7.7-fold, about 7.8- fold, about 7.9-fold, about 8.0-fold, about 8.1-fold, about 8.2-fold, about 8.3-fold, about 8.4- fold, about 8.5-fold, about 8.6-fold, about 8.7-fold, about 8.8-fold, about 8.9-fold, about 9.0- fold, about 9.1-fold, about 9.2-fold, about 9.3-fold, about 9.4-fold, about 9.5-fold, about 9.6- fold, about 9.7-fold, about 9.8-fold, about 9.9-fold, or at least about 10.0-fold lower in a cell comprising or expressing the peptide than the expression level of the protein or the mRNA encoded by the target gene of WNT signaling in a cell without the peptide or in a cell not expressing the peptide. In some embodiments, the target gene of WNT signaling can comprise Vascular endothelial growth factor A (VEGFA), cluster of differentiation 44 (CD44), c-Myc, or a combination thereof.

[0246] In some embodiments, methods described herein can comprise introducing or deliveringinto a cell compositions, peptides, or pharmaceutical compositions described herein. Any known methods for introducing or delivering compositions, peptides, or pharmaceutical compositions into a cell can be used. In some embodiments, methods of introducing or delivering compositions, peptides, or pharmaceutical compositions into a cell can comprise transfection, transduction, transformation, electroporation, or administering to a subject.

[0247] In some embodiments, compositions comprising recombinant polynucleic acid or RNAconstructs described herein can be delivered to a cell via direct DNA transfer (Wolff et al. (1990) Science 247, 1465-1468). Recombinant polynucleic acid or RNA constructs described herein can be delivered to cells following mild mechanical disruption of the cell membrane,WSGR Docket No.: 57623-713.601 temporarily permeabilizing the cells. Such a mild mechanical disruption of the membrane can be accomplished by gently forcing cells through a small aperture (Sharei et al. PLOS ONE (2015) 10(4), e0118803). In some embodiments, compositions comprising recombinant polynucleic acid or RNA constructs described herein can be delivered to a cell via liposome-mediated DNA transfer (e.g., Gao & Huang (1991) Biochem. Biophys. Res. Comm.179, 280-285, Crystal (1995) Nature Med.1, 15-17, Caplen et al. (1995) Nature Med.3, 39-46). The term “liposome” can encompass a variety of single and multilamellar lipid vehicles formed by the generation of enclosed lipid bilayers or aggregates. Recombinant polynucleic acid or RNA constructs can be encapsulated in the aqueous interior of a liposome, interspersed within the lipid bilayer of a liposome, attached to a liposome via a linking molecule that is associated with both the liposome and the oligonucleotide, entrapped in a liposome, or complexed with a liposome. In some embodiments, compositions comprising recombinant polynucleic acid or RNA constructs described herein can be delivered to a cell using lipid nano particles (LNPs). In some embodiments, LNPs can be formulated by a microfluidic assembly process. In some embodiments, LNPs can be prepared by mixing an ethanolic lipid mixture with an acidic aqueous solution containing recombinant polynucleic acid, DNA, or RNA constructs described herein. For example, lipids can be dissolved in ethanol and mixed with an aqueous stream containing recombinant polynucleic acid constructs (e.g., recombinant DNA or RNA constructs described herein), or vectors or nanoplasmids comprising recombinant polynucleic acid constructs dissolved in an acidic buffer. After further processing, including ethanol removal, concentration by ultrafiltration, and sterilization, LNPs can be diluted to a de...

Claims

WSGR Docket No.: 57623-713.601 CLAIMS WHAT IS CLAIMED IS:

1. A pharmaceutical composition comprising (i) a recombinant polynucleic acid constructcomprising at least one nucleic acid sequence encoding a peptide and (ii) a pharmaceutically acceptable excipient or carrier; wherein the peptide binds to a target protein and modulates binding of the target protein to a binding partner, thereby modulating formation of an interactome, the interactome comprising a complex comprising the target protein and the binding partner.

2. A composition comprising a recombinant polynucleic acid construct comprising at least onenucleic acid sequence encoding a peptide; wherein the peptide binds to a target protein and modulates binding of the target protein to a binding partner, thereby modulating formation of an interactome, the interactome comprising a complex comprising the target protein and the binding partner.

3. The composition of claim 2, wherein modulating comprises preventing or inhibiting bindingof the target protein to the binding partner.

4. The composition of claim 2, wherein the peptide binds to a target protein and prevents orinhibits binding of the target protein to the binding partner, thereby preventing or inhibiting formation of the interactome.

5. The composition of claim 2, wherein the target protein has an enzymatic activity and thepeptide does not inhibit the enzymatic activity of the target protein.

6. The composition of claim 5, wherein the target protein has an enzymatic activity and thepeptide does not directly inhibit enzymatic activity of the target protein.

7. The composition of claim 2, wherein the peptide does not bind to an active site of the targetprotein.

8. The composition of claim 7, wherein the active site of the target protein is not a binding siteof the peptide.

9. The composition of claim 5, wherein the enzymatic activity comprises a ubiquitinationactivity, a GTPase activity, a kinase activity, a histone acetyltransferase activity, or a combination thereof.WSGR Docket No.: 57623-713.60110. The composition of claim 2, wherein the amount, expression, or formation of theinteractome is lower in a cell comprising or expressing the peptide than the amount, expression, or formation of the interactome in a cell without the peptide or in a cell not expressing the peptide.

11. The composition of claim 2, wherein the amount, expression, or formation of theinteractome is at least 10% lower or at least 1.1-fold lower in a cell comprising or expressing the peptide than the amount, expression, or formation of the interactome in a cell without the peptide or in a cell not expressing the peptide.

12. The composition of claim 2, wherein the peptide comprises from about 10 to about 1100amino acid residues.

13. The composition of claim 2, wherein the peptide comprises at least about 10 amino acidresidues.

14. The composition of claim 2, wherein the peptide comprises at most about 1100 amino acidresidues.

15. The composition of claim 2, wherein the amount, expression, or formation of theinteractome is lower in a cell comprising or expressing the peptide than the amount, expression, or formation of the interactome in a cell comprising or expressing a corresponding peptide that is shorter in length than the peptide.

16. The composition of claim 2, wherein the peptide comprises at least 75, at least 128, at least150, or at least 355 amino acid residues.

17. The composition of claim 2, wherein the peptide comprises at most 75, at most 128, at most150, or at most 355 amino acid residues.

18. The composition of claim 2, wherein the peptide comprises at least 14, at least 28, at least40, at least 83, at least 125, or at least 166 amino acid residues.

19. The composition of claim 2, wherein the peptide comprises at most 14, at most 28, at most40, at most 83, at most 125, or at most 166 amino acid residues.

20. The composition of claim 2, wherein the peptide comprises at least 349, at least 400, at least450, or at least 1018 amino acid residues.WSGR Docket No.: 57623-713.60121. The composition of claim 2, wherein the peptide comprises at most 349, at most 400, at most450, or at most 1018 amino acid residues.

22. The composition of claim 2, wherein the peptide comprises at least 29, at least 300, at least500, or at least 510 amino acid residues.

23. The composition of claim 2, wherein the peptide comprises at most 29, at most 300, at most500, or at most 510 amino acid residues.

24. The composition of claim 2, wherein the peptide comprises at least 200, at least 306, or atleast 484 amino acid residues.

25. The composition of claim 2, wherein the peptide comprises at most 200, at most 306, or atmost 484 amino acid residues.

26. The composition of claim 2, wherein the peptide comprises at least 219 or at least 300 aminoacid residues.

27. The composition of claim 2, wherein the peptide comprises at most 219 or at most 300amino acid residues.

28. The composition of claim 2, wherein the peptide comprises at least 189 or at least 200 aminoacid residues.

29. The composition of claim 2, wherein the peptide comprises at most 189 or at most 200amino acid residues.

30. The composition of claim 2, wherein the peptide comprises at least 44, at least 66, or at least77 amino acid residues.

31. The composition of claim 2, wherein the peptide comprises at most 44, at most 66, or atmost 77 amino acid residues.

32. The composition of claim 2, wherein the peptide comprises a fragment of the bindingpartner.

33. The composition of claim 2, wherein the target protein comprises a human protein selectedfrom the group consisting of rapidly accelerated fibrosarcoma (RAF), rat sarcoma virus (RAS), mitogen-activated protein kinase kinase (MEK), extracellular signal-regulated kinase 1 / 2 (ERK), p53, mouse double minute 2 homolog (MDM2), MDM4, B-cell CLL / lymphomaWSGR Docket No.: 57623-713.601 9- -Catenin, transcription factor 4 (TCF4), CREB binding protein (CBP),Histone 3.3 (H3.3), Fanconi anemia group D2 (FANCD2), optionally wherein the FANCD2 is wild-type FANCD2, ubiquitin, an E3 ubiquitin ligase, Rad18, a recombinase, an ATPase, Rad51, T-cell receptor alpha (TCR- - gamma (CD3 ),, , and .

34. The composition of claim 2, wherein the binding partner comprises RAF, RAS, MEK, ERK,p53, MDM2, MDM4, -Catenin, TCF4, CBP, H3.3, wild-type FANCD2, ubiquitin, an E3 ubiquitin ligase, Rad18, a recombinase, an ATPase, Rad51, TCR- - ,, , , or a combination thereof.

35. The composition of claim 33 or 34, wherein RAF comprises ARAF, BRAF, CRAF, or acombination thereof.

36. The composition of claim 33 or 34, wherein RAS comprises HRAS, NRAS, KRAS, or acombination thereof.

37. The composition of claim 33 or 34, wherein MEK comprises MEK1, MEK2, or acombination thereof.

38. The composition of claim 33 or 34, wherein ERK comprises ERK1, ERK2, or a combinationthereof.

39. The composition of claim 2, wherein the target protein is MDM2, MDM4, or both and thebinding partner comprises p53.

40. The composition of claim 39, wherein the amount of degradation of the binding partner islower in a cell comprising or expressing the peptide than the amount of degradation of the binding partner in a cell without the peptide or in a cell not expressing the peptide.

41. The composition of claim 39 or 40, wherein the amount of the binding partner is higher in acell comprising or expressing the peptide than the amount of the binding partner in a cell without the peptide or in a cell not expressing the peptide.

42. The composition of claim 39, wherein the cell viability of a cell comprising or expressingthe peptide is lower than the cell viability of a cell without the peptide or in a cell not expressing the peptide.WSGR Docket No.: 57623-713.60143. The composition of claim 42, wherein the cell viability of the cell comprising or expressingthe peptide is at least about 10% or at least about 1.1-fold lower than the cell viability of the cell without the peptide or in the cell not expressing the peptide.

44. The composition of claim 2, wherein the target protein is FANCD2 and the binding partnercomprises ubiquitin, an E3 ubiquitin ligase, Rad18, a recombinase, an ATPase, Rad51, or a combination thereof.

45. The composition of claim 44, wherein the amount of ubiquitinated FANCD2 is lower in acell comprising or expressing the peptide than the amount of an ubiquitinated FANCD2 in a cell without the peptide or in a cell not expressing the peptide.

46. The composition of claim 45, wherein the amount of ubiquitinated FANCD2 is at least about10% or at least 1.1-fold lower in the cell comprising or expressing the peptide than the amount of an ubiquitinated FANCD2 in the cell without the peptide or in the cell not expressing the peptide.

47. The composition of claim 2, wherein the target protein is CBP and the binding partnercomprises H3.3.

48. The composition of claim 2, wherein the target protein is H3.3 and the binding partnercomprises CBP.

49. The composition of any one of claims 44, 47, or 48, wherein the sensitivity to achemotherapy agent of a cell comprising or expressing the peptide is higher than the sensitivity to a chemotherapy agent of a cell without the peptide or of a cell not expressing the peptide.

50. The composition of claim 49, wherein the sensitivity to the chemotherapy agent of the cellcomprising or expressing the peptide is at least about 10% or at least about 1.1-fold higher than the sensitivity to the chemotherapy agent of the cell without the peptide or of the cell not expressing the peptide.

51. The composition of claim 49 or 50, wherein the chemotherapy agent comprises Doxorubicin,Cisplatin, or a combination thereof.WSGR Docket No.: 57623-713.60152. The composition of claim 47 or 48, wherein the cell viability of a cell comprising orexpressing the peptide is lower than the cell viability of a cell without the peptide or in a cell not expressing the peptide.

53. The composition of claim 52, wherein the cell viability of the cell comprising or expressingthe peptide is at least about 10% or at least about 1.1-fold lower than the cell viability of the cell without the peptide or in the cell not expressing the peptide.

54. The composition of claim 2, wherein the target protein is BCL9L, TCF4, or both and thebinding partner comprises -Catenin.

55. The composition of claim 2, wherein the target protein is -Catenin and the binding partnercomprises BCL9L, TCF4, or both.

56. The composition of claim 54 or 55, wherein the level of the interaction between the targetprotein and the binding partner is lower in a cell comprising or expressing the peptide than the level of the interaction between the target protein and the binding partner in a cell without the peptide or in a cell not expressing the peptide.

57. The composition of claim 56, wherein the level of the interaction between the target proteinand the binding partner is at least about 10% or at least 1.1-fold lower in the cell comprising or expressing the peptide than the level of the interaction between the target protein and the binding partner in the cell without the peptide or in the cell not expressing the peptide.

58. The composition of claim 56 or 57, wherein the level of interaction between the targetprotein and the binding partner is determined by measuring the expression level of a protein or an mRNA encoded by a target gene of Wingless-type MMTV integration site (WNT) signaling.

59. The composition of claim 58, wherein the expression level of the protein or the mRNAencoded by the target gene of WNT signaling is lower in a cell comprising or expressing thepeptide than the expression level of the protein or the mRNA encoded by the target gene of WNT signaling in a cell without the peptide or in a cell not expressing the peptide.

60. The composition of claim 59, wherein the expression level of the protein or the mRNAencoded by the target gene of WNT signaling is at least about 10% or at least about 1.1-fold lower in the cell comprising or expressing the peptide than the expression level of the proteinWSGR Docket No.: 57623-713.601 or the mRNA encoded by the target gene of WNT signaling in the cell without the peptide or in the cell not expressing the peptide.

61. The composition of claim 58, wherein the target gene of WNT signaling comprises Vascularendothelial growth factor A (VEGFA), cluster of differentiation 44 (CD44), c-Myc, or a combination thereof.

62. The composition of claim 2, wherein the target protein is TCR- - and thebinding partner comprises CD3 , or a combination thereof.

63. The composition of claim 62, wherein the activation level of a T-cell comprising orexpressing the peptide is lower than the activation level of a T-cell without the peptide or not expressing the peptide.

64. The composition of claim 63, wherein the activation level of the T-cell comprising orexpressing the peptide is at least about 10% or at least about 1.1-fold lower than the activation level of the T-cell without the peptide or not expressing the peptide.

65. The composition of claim 63 or 64, wherein the activation level of the T-cell is determinedby measuring the expression level of cluster of differentiation 69 (CD69) in the T-cell.

66. The composition of claim 65, wherein the expression level of CD69 in the T-cell comprisingor expressing the peptide is lower than the expression level of CD69 in a T-cell without the peptide or not expressing the peptide.

67. The composition of claim 66, wherein the expression level of CD69 in the T-cell comprisingor expressing the peptide is at least about 10% or at least about 1.1-fold lower than the expression level of CD69 in the T-cell without the peptide or not expressing the peptide.

68. The composition of claim 2, wherein the target protein is KRAS and the binding partnercomprises CRAF.

69. The composition of claim 2, wherein the level of an activity of the binding partner ismodulated in a cell comprising or expressing the peptide.

70. The composition of claim 2, wherein the level of an activity of the binding partner is higherin a cell comprising or expressing the peptide than the level of an activity of the binding partner in a cell without the peptide or in a cell not expressing the peptide.WSGR Docket No.: 57623-713.60171. The composition of claim 70, wherein the activity comprises a transcription activation, atranscription repression, an apoptosis induction, a signal transduction, a protein binding, a DNA binding, a ubiquitination, a GTPase activity, a kinase activity, a histone acetyltransferase activity, or a combination thereof.

72. The composition of claim 2, wherein the binding partner, the target protein, or theinteractome modulates transcription of a downstream protein involved in the same pathway as the binding partner.

73. The composition of claim 72, wherein modulating comprises activating transcription.

74. The composition of claim 73, wherein the expression of the downstream protein is higher ina cell comprising or expressing the peptide than in a cell without the peptide or in a cell not expressing the peptide.

75. The composition of claim 73 or 74, wherein the expression of the downstream protein is atleast 1.1-fold higher in a cell comprising or expressing the peptide than in a cell without the peptide or in a cell not expressing the peptide.

76. The composition of claim 74, wherein the downstream protein comprises p21.

77. The composition of claim 72, wherein modulating comprises inhibiting or repressingtranscription.

78. The composition of claim 77, wherein the expression of the downstream protein is lower in acell comprising or expressing the peptide than in a cell without the peptide or in a cell not expressing the peptide.

79. The composition of claim 77 or 78, wherein the expression of the downstream protein is atleast 10% or at least 1.1-fold lower in a cell comprising or expressing the peptide than in a cell without the peptide or in a cell not expressing the peptide.

80. The composition of claim 77, wherein the downstream protein comprises CD69 or B-cellleukemia / lymphoma 2 (BCL2).

81. The composition of claim 2, wherein the at least one nucleic acid sequence encoding thepeptide comprises a first nucleic acid sequence encoding a first peptide and a second nucleic acid sequence encoding a second peptide, optionally a third nucleic acid sequence encoding a third peptide.WSGR Docket No.: 57623-713.60182. The composition of claim 81, wherein the first peptide binds to a first target and the secondpeptide binds to a second target, optionally the third peptide binds to the third target.

83. The composition of claim 82, wherein the first target and the second target are the same.

84. The composition of claim 83, wherein the first peptide binds to the first target, the secondpeptide binds to the second target, and the third peptide binds to the third target, wherein the first target, the second target, and the third target are the same.

85. The composition of claim 83, wherein the first peptide binds to the first target, the secondpeptide binds to the second target, and the third peptide binds to the third target, wherein the first target and the second target are different from the third target.

86. The composition of claim 82, wherein the first target and the second target are different.

87. The composition of claim 81, wherein the first nucleic acid sequence encoding the firstpeptide and the second nucleic acid sequence encoding the second peptide, optionally the third nucleic acid sequence encoding the third peptide are connected by a linker.

88. The composition of claim 87, wherein the linker comprises a nucleic acid sequencecomprising a sequence comprising SEQ ID NO: 132 or SEQ ID NO: 134.

89. The composition of claim 87, wherein the linker comprises a peptide sequence comprising asequence comprising SEQ ID NO: 131 or SEQ ID NO: 133.

90. The composition of claim 2, wherein the recombinant polynucleic acid construct furthercomprises at least one nucleic acid sequence encoding or comprising a small interfering RNA (siRNA) capable of binding to a target RNA, wherein the target RNA encodes the target protein or a protein that is not the target protein.

91. The composition of claim 90, wherein the expression of the target protein encoded by thetarget RNA is downregulated by the siRNA.

92. The composition of claim 90 or 91, wherein the target RNA comprises an RNA encodingMDM2, an RNA encoding MDM4, or a combination thereof.

93. The composition of claim 90, wherein the amount, expression, or formation of theinteractome is lower in a cell expressing the recombinant polynucleic acid construct than the amount, expression, or formation of the interactome in a cell comprising or expressing aWSGR Docket No.: 57623-713.601 recombinant polynucleic acid construct without the at least one nucleic acid sequence encoding or comprising the siRNA.

94. The composition of claim 93, wherein the amount, expression, or formation of theinteractome is at least about 10% or at least 1.1-fold lower in a cell expressing the recombinant polynucleic acid construct than the amount, expression, or formation of the interactome in a cell comprising or expressing a recombinant polynucleic acid construct without the at least one nucleic acid sequence encoding or comprising the siRNA.

95. The composition of claim 2, wherein the recombinant polynucleic acid construct furthercomprises at least one nucleic acid sequence encoding a target motif, wherein the at least one nucleic acid sequence encoding a target motif is operably linked to the at least one nucleic acid sequence encoding the peptide.

96. The composition of claim 95, wherein the target motif comprises a signal peptide, a nuclearlocalization signal (NLS), a nucleolar localization signal (NoLS), a lysosomal targeting signal, a mitochondrial targeting signal, a peroxisomal targeting signal, a microtubule tip localization signal (MtLS), an endosomal targeting signal, a chloroplast targeting signal, a Golgi targeting signal, an endoplasmic reticulum (ER) targeting signal, a proteasomal targeting signal, a membrane targeting signal, a transmembrane targeting signal, or a centrosomal localization signal (CLS).

97. The composition of claim 95 or 96, wherein the target motif is selected from the groupconsisting of: (a) a target motif heterologous to the binding partner, wherein the peptide is a fragment of the binding partner; (b) a target motif heterologous to the binding partner, wherein the peptide is a fragment of the binding partner, wherein the target motif heterologous to the binding partner is modified by insertion, deletion, and / or substitution of at least one amino acid; (c) a target motif homologous to the binding partner, wherein the peptide is a fragment of the binding partner, wherein the target motif homologous to the binding partner is modified by insertion, deletion, and / or substitution of at least one amino acid; and (d) a naturally occurring amino acid sequence which does not have the function of a target motif in nature, wherein the naturally occurring amino acid sequence is optionally modified by insertion, deletion, and / or substitution of at least one amino acid.WSGR Docket No.: 57623-713.60198. The composition of claim 95, wherein the target motif comprises an NLS.

99. The composition of claim 98, wherein the NLS comprises an NLS of SV40, p53, c-Myc,IGFBP3, or TCF4.

100. The composition of claim 98 or 99, wherein the at least one nucleic acid sequenceencoding the NLS is located at the 5’ end of the at least one nucleic acid sequence encoding the peptide, 3’ end of the at least one nucleic acid sequence encoding the peptide, or both.

101. The composition of claim 98, wherein the recombinant polynucleic acid constructcomprises a first nucleic acid sequence encoding a first NLS and a second nucleic acid sequence encoding a second NLS.

102. The composition of claim 101, wherein the first nucleic acid sequence encoding the firstNLS is located at the 5’ end of the at least one nucleic acid sequence encoding the peptide and the second nucleic acid sequence encoding the second NLS is located at the 3’ end of the at least one nucleic acid sequence encoding the peptide.

103. The composition of claim 98, wherein the recombinant polynucleic acid constructcomprises a first nucleic acid sequence encoding a first NLS, a second nucleic acid sequence encoding a second NLS, a third nucleic acid sequence encoding a third NLS, and a fourth nucleic acid sequence encoding a fourth NLS.

104. The composition of claim 103, wherein the first nucleic acid sequence encoding the firstNLS and the second nucleic acid sequence encoding the second NLS are located at the 5’ end of the at least one nucleic acid sequence encoding the peptide.

105. The composition of claim 103 or 104, wherein the third nucleic acid sequence encodingthe third NLS and the fourth nucleic acid sequence encoding the fourth NLS are located at the 3’ end of the at least one nucleic acid sequence encoding the peptide.

106. The composition of claim 101, wherein each of the first nucleic acid sequence encodingthe first NLS, the second nucleic acid sequence encoding the second NLS, the third nucleic acid sequence encoding the third NLS, and the fourth nucleic acid sequence encoding the fourth NLS are different.

107. The composition of claim 101, wherein each of the first nucleic acid sequence encodingthe first NLS, the second nucleic acid sequence encoding the second NLS, the third nucleicWSGR Docket No.: 57623-713.601 acid sequence encoding the third NLS, and the fourth nucleic acid sequence encoding the fourth NLS are the same.

108. The composition of claim 103, wherein the first nucleic acid sequence encoding the firstNLS and the second nucleic acid sequence encoding the second NLS are connected by a linker.

109. The composition of claim 103, wherein the third nucleic acid sequence encoding thethird NLS and the fourth nucleic acid sequence encoding the fourth NLS are connected by a linker.

110. The composition of claim 108 or 109, wherein the linker comprises a nucleic acidsequence comprising a sequence comprising SEQ ID NO: 132 or SEQ ID NO: 134.

111. The composition of claim 108 or 109, wherein the linker comprises a peptide sequencecomprising a sequence comprising SEQ ID NO: 131 or SEQ ID NO: 133.

112. The composition of claim 2, wherein the peptide localizes to the nucleus of a cellexpressing the recombinant polynucleic acid construct.

113. The composition of claim 98, wherein the amount of the peptide localized to the nucleusof a cell expressing the recombinant polynucleic acid construct is higher than the amount of the peptide localized to the nucleus of a cell expressing a recombinant polynucleic acid construct without the at least one nucleic acid sequence encoding the NLS.

114. The composition of claim 2, wherein the amount of the binding partner is higher in a cellcomprising or expressing the peptide than in a cell without the peptide or in a cell not expressing the peptide.

115. The composition of claim 2, wherein the amount of the binding partner is at least 1.1-fold higher in a cell comprising or expressing the peptide than in a cell without the peptide or in a cell not expressing the peptide.

116. The composition of claim 2, wherein the expression of the binding partner is higher in acell expressing the recombinant polynucleic acid construct with the at least one nucleic acid sequence encoding the NLS than in a cell expressing a recombinant polynucleic acid construct without the at least one nucleic acid sequence encoding the NLS.WSGR Docket No.: 57623-713.601117. The composition of claim 2, wherein the expression of the binding partner is at least 1.1-fold higher in a cell expressing the recombinant polynucleic acid construct with the at least one nucleic acid sequence encoding the NLS than in a cell expressing the recombinant polynucleic acid construct without the at least one nucleic acid sequence encoding the NLS.

118. The composition of claim 2, wherein the recombinant polynucleic acid construct furthercomprises a nucleic acid sequence encoding or comprising a poly(A) tail, a 5’ cap, a DNA sequence comprising a promoter or an RNA sequence lacking a promoter, or a nucleic acid sequence comprising a Kozak sequence.

119. The composition of claim 118, wherein the promoter comprises a T7 promoter, a SP6promoter, a T3 promoter, a P60 promoter, a Syn5 promoter, or a KP34 promoter.

120. The composition of claim 118, wherein the poly(A) tail is at least about 3 bp in length, atmost about 220 bp in length, or about 120 bp in length.

121. The composition of claim 2, wherein the peptide comprises an amino acid sequencecomprising any one of SEQ ID NOs: 25-48 or 179-222.

122. The composition of claim 121, wherein the peptide comprises an amino acid sequenceencoded by a nucleic acid sequence with at least 80% sequence identity to any one of SEQ ID NOs: 1-24, 49-72, or 135-178.

123. The composition of claim 121, wherein the peptide comprises an amino acid sequenceencoded by a nucleic acid sequence with at least 80% sequence identity to any one of SEQ ID NOs: 93-116 or 242-285.

124. The composition of claim 2, wherein the recombinant polynucleic acid construct is aDNA construct.

125. The composition of claim 124, wherein the DNA construct comprises a nucleic acidsequence comprising any one of SEQ ID NOs: 1-24, 49-72, or 135-178.

126. The composition of claim 2, wherein the recombinant polynucleic acid construct is anRNA construct.

127. The composition of claim 126, wherein the RNA construct comprises a nucleic acidsequence comprising any one of SEQ ID NOs: 93-116 or 242-285.WSGR Docket No.: 57623-713.601128. The composition of claim 126, wherein the RNA construct comprises an RNA sequenceencoded by the nucleic acid sequence comprising any one of SEQ ID NOs: 1-24, 49-72, or 135-178.

129. The composition of claim 126, wherein the RNA construct comprises a modified uridine.

130. The composition of claim 129, wherein the modified uridine comprises N1-Methylpseudouridine.

131. A composition comprising a recombinant polynucleic acid construct comprising anucleic acid sequence encoding a peptide; wherein the peptide is at least about 70 amino acid residues, wherein the peptide binds to KRAS, and wherein the binding of the peptide to KRAS inhibits an interaction between CRAF and KRAS.

132. The composition of claim 131, wherein the peptide comprises at least 75, at least 128, atleast 150, or at least 355 amino acid residues.

133. The composition of claim 131, wherein the peptide comprises at most 75, at most 128, atmost 150, or at most 355 amino acid residues.

134. The composition of claim 132 or 133, wherein the amount, expression, or formation ofthe interactome is lower in a cell comprising or expressing the peptide comprising at least 128, at least 150, or at least 355 amino acid residues than the amount, expression, or formation of the interactome in a cell comprising or expressing the peptide comprising at most 75 amino acid residues.

135. The composition of claim 132 or 133, wherein the amount, expression, or formation ofthe interactome is lower in a cell comprising or expressing the peptide comprising at least 150, or at least 355 amino acid residues than the amount, expression, or formation of the interactome in a cell comprising or expressing the peptide comprising at most 75 or at most 128 amino acid residues.

136. The composition of claim 132 or 133, wherein the amount, expression, or formation ofthe interactome is lower in a cell comprising or expressing the peptide comprising at least 355 amino acid residues than the amount, expression, or formation of the interactome in aWSGR Docket No.: 57623-713.601 cell comprising or expressing the peptide comprising at most 75, at most 128, or at most 150 amino acid residues.

137. A composition comprising a recombinant polynucleic acid construct comprising anucleic acid sequence encoding a peptide; wherein the peptide comprises at least about 10 amino acid residues, wherein the peptide binds to MDM2, and wherein the binding of the peptide to MDM2 inhibits an interaction between p53 and MDM2.

138. A composition comprising a recombinant polynucleic acid construct comprising:(i) a nucleic acid sequence encoding a peptide; wherein the peptide comprises at least about 10 amino acid residues, wherein the peptide binds to MDM2, MDM4, or both, and wherein the binding of the peptide to MDM2, MDM4, or both inhibits an interaction between p53 and MDM2, MDM4, or both, and (ii) at least one nucleic acid sequence encoding a small interfering RNA (siRNA) capable of binding to a target RNA that encodes MDM2, MDM4, or a combination thereof.

139. The composition of claim 137 or 138, wherein the peptide comprises at least 14, at least28, at least 40, at least 83, at least 125, or at least 166 amino acid residues.

140. The composition of claim 137 or 138, wherein the peptide comprises at most 14, at most28, at most 40, at most 83, at most 125, or at most 166 amino acid residues.

141. The composition of claim 139 or 140, wherein the amount, expression, or formation ofthe interactome is lower in a cell comprising or expressing the peptide comprising at least 83, at least 125, or at least 166 amino acid residues than the amount, expression, or formation of the interactome in a cell comprising or expressing the peptide comprising at most 14, at most 28, or at most 40 amino acid residues.

142. The composition of claim 139 or 140, wherein the amount, expression, or formation ofthe interactome is lower in a cell comprising or expressing the peptide comprising at least 125 or at least 166 amino acid residues than the amount, expression, or formation of the interactome in a cell comprising or expressing the peptide comprising at most 14, at most 28, at most 40, or at most 83 amino acid residues.WSGR Docket No.: 57623-713.601143. The composition of claim 139 or 140, wherein the amount, expression, or formation ofthe interactome is lower in a cell comprising or expressing the peptide comprising at least 166 amino acid residues than the amount, expression, or formation of the interactome in a cell comprising or expressing the peptide comprising at most 14, at most 28, at most 40, at most 83, or at most 125 amino acid residues.

144. A composition comprising a recombinant polynucleic acid construct comprising anucleic acid sequence encoding a peptide; wherein the peptide comprises at least about 70 amino acid residues, wherein the peptide binds to CRAF, and wherein the binding of the peptide to CRAF inhibits an interaction between KRAS and CRAF.

145. A composition comprising a recombinant polynucleic acid construct comprising anucleic acid sequence encoding a peptide; wherein the peptide comprises at least about 300 amino acid residues, wherein the peptide binds to ubiquitin, an E3 ubiquitin ligase, Rad18, a recombinase, an ATPase, Rad51, or a combination thereof, and wherein the binding of the peptide to ubiquitin, an E3 ubiquitin ligase, Rad18, a recombinase, an ATPase, Rad51, or a combination thereof inhibits (i) an interaction between FANCD2 and ubiquitin, an E3 ubiquitin ligase, Rad18, a recombinase, an ATPase, Rad51, or a combination thereof, (ii) ubiquitination of FANCD2, (iii) or both (i) and (ii).

146. A composition comprising a recombinant polynucleic acid construct comprising anucleic acid sequence encoding a peptide; wherein the peptide comprises at least about 20 amino acid residues, wherein the peptide binds to -Catenin, and wherein the binding of the peptide to -Catenin inhibits an interaction between BCL9L, TCF4, and -Catenin.

147. A composition comprising a recombinant polynucleic acid construct comprising anucleic acid sequence encoding a peptide; wherein the peptide comprises at least about 150 amino acid residues, wherein the peptide binds to BCL9L, TCF4, or both, and wherein the binding of the peptide to BCL9L, TCF4, or both inhibits an interaction between BCL9L, TCF4, and -Catenin.WSGR Docket No.: 57623-713.601148. A composition comprising a recombinant polynucleic acid construct comprising anucleic acid sequence encoding a peptide; wherein the peptide comprises at least about 200 amino acid residues, wherein the peptide binds to -Catenin, and wherein the binding of the peptide to -Catenin inhibits an interaction between BCL9L, TCF4, and -Catenin.

149. A composition comprising a recombinant polynucleic acid construct comprising anucleic acid sequence encoding a peptide; wherein the peptide comprises at least about 180 amino acid residues, wherein the peptide binds to H3.3, and wherein the binding of the peptide to H3.3 inhibits an interaction between CBP and H3.3.

150. A composition comprising a recombinant polynucleic acid construct comprising anucleic acid sequence encoding a peptide; wherein the peptide comprises at least about 40 amino acid residues, wherein the peptide binds to CBP, and wherein the binding of the peptide to CBP inhibits an interaction between H3.3 and CBP.

151. A composition comprising a recombinant polynucleic acid construct comprising anucleic acid sequence encoding a peptide; wherein the peptide comprises at least about 40 amino acid residues, wherein the peptide binds to CD3, and wherein the binding of the peptide to CD3 inhibits an interaction between TCR and CD3.

152. The composition of claim 151, wherein the TCR comprises TCR- -combination thereof.

153. The composition of claim 151, wherein the CD3 comprises ,or a combination thereof.

154. The composition of claim 137, wherein the recombinant polynucleic acid constructfurther comprises a sequence encoding a nuclear localization signal (NLS).

155. The composition of claim 154, wherein the NLS comprises an NLS of Polyoma SimianVacuolating Virus 40 (SV40), p53, Myc proto-oncogene protein (c-Myc), insulin-like growth factor-binding protein 3 (IGFBP3), or T-cell transcription factor 4 (TCF4).WSGR Docket No.: 57623-713.601156. A pharmaceutical composition comprising the composition of any one of claims 2-155and a pharmaceutically acceptable excipient or carrier.

157. A peptide expressed or encoded by the recombinant polynucleic acid construct of thecomposition of any one of claims 2-155 or the pharmaceutical composition of claim 1 or 156.

158. The peptide of claim 157, wherein the peptide comprises an amino acid sequencecomprising any one of SEQ ID NOs: 25-48 or 179-222.

159. A cell comprising the recombinant polynucleic acid construct of the composition of anyone of claims 2-155, the pharmaceutical composition of claim 1 or 156, or the peptide of claim 157 or 158.

160. The cell of claim 159, wherein the cell comprises a cancer cell or an immune cell.

161. The cell of claim 160, wherein the immune cell comprises a T-cell.

162. Use of the composition of any one of claims 2-155, the pharmaceutical composition ofclaim 1 or 156, or the peptide of claim 157 or 158 for modulating a binding activity of a target protein in a cell.

163. The use of claim 162, wherein modulating comprises inhibiting the binding activity.

164. A method of treating a disease or a condition in a subject in need thereof, the methodcomprising: administering a therapeutically effective amount of the composition of any one of claims 2-155, the pharmaceutical composition of claim 1 or 156, the peptide of claim 157 or 158, or the cell of claim 159 to the subject.

165. The method of claim 164, wherein the disease or the condition comprises a cancer or anon-cancer disease or condition.

166. The method of claim 165, wherein the non-cancer disease or condition comprises aninflammatory disease or a skin disease.

167. The method of claim 164, wherein the subject is a human.

168. Use of the composition of any one of claims 2-155, the pharmaceutical composition ofclaim 1 or 156, the peptide of claim 157 or 158, or the cell of claim 159 in treating a disease or a condition in a subject in need thereof.WSGR Docket No.: 57623-713.601169. Use of the composition of any one of claims 2-155, the pharmaceutical composition ofclaim 1 or 156, the peptide of claim 157 or 158, or the cell of claim 159 in manufacturing a medicament for treating a disease or a condition in a subject in need thereof.

170. The use of claim 168 or 169, wherein the disease or the condition comprises a cancer.

171. The use of claim 168, wherein the subject is a human.

172. A method of modulating a binding activity of a target protein in a cell comprising:introducing into the cell a recombinant polynucleic acid construct of the composition of any one of claims 2-155, or the pharmaceutical composition of claim 1 or 156.

173. The method of claim 172, wherein modulating comprises inhibiting the binding activity.

174. The method of claim 172 or 173, wherein introducing comprises transfection,transduction, transformation, electroporation, or administering to a subject.

175. The method of claim 174, wherein the subject has a disease or a condition.

176. The method of claim 174 or 175, the disease or the condition comprises a cancer or anon-cancer disease or condition.

177. The method of claim 176, wherein the non-cancer disease or condition comprises aninflammatory disease or a skin disease.

178. The method of claim 174, wherein the subject is a human.

179. A composition comprising a recombinant polynucleic acid construct comprising at leastone nucleic acid sequence encoding a fragment of a protein encoded by a gene of interest, wherein the protein encoded by the gene of interest binds to a binding partner, wherein the fragment of the protein encoded by the gene of interest modulates binding of the binding partner to the protein encoded by a gene of interest, thereby modulating formation of an interactome comprising the protein encoded by the gene of interest and the binding partner.

180. A messenger RNA (mRNA) comprising a nucleic acid sequence encoding (i) a protein ora fragment thereof and (ii) a target motif selected from the group consisting of a signal peptide, a nuclear localization signal (NLS), a nucleolar localization signal (NoLS), a lysosomal targeting signal, a mitochondrial targeting signal, a peroxisomal targeting signal, aWSGR Docket No.: 57623-713.601 microtubule tip localization signal (MtLS), an endosomal targeting signal, a chloroplast targeting signal, a Golgi targeting signal, an endoplasmic reticulum (ER) targeting signal, a proteasomal targeting signal, a membrane targeting signal, a transmembrane targeting signal, and a centrosomal localization signal (CLS), wherein the target motif is from a protein selected from the group consisting of a target motif of Polyoma Simian Vacuolating Virus 40 (SV40), a target motif of p53, a target motif of Myc proto-oncogene protein (c-Myc), and a target motif of insulin-like growth factor- binding protein 3 (IGFBP3).

181. A composition comprising a recombinant polynucleic acid construct comprising:(i) at least one nucleic acid sequence encoding or comprising a small interfering RNA (siRNA) capable of binding to a target RNA; and (ii) at least one nucleic acid sequence encoding a gene of interest or a fragment thereof; wherein the target RNA is selected from the group consisting of an RNA encoding MDM2, an RNA encoding MDM4, and a combination thereof, and wherein the gene of interest or the fragment thereof comprises p53.

182. The composition of claim 181, wherein the at least one nucleic acid sequence encodingthe gene of the interest or the fragment thereof and the at least one nucleic acid sequence encoding or comprising the siRNA are comprised in a sequential manner.

183. The composition of claim 181 or 182, wherein a protein or a fragment thereof expressedby the gene of interest or the fragment thereof binds to a target protein.

184. The composition of claim 183, wherein the target RNA encodes the target protein.

185. The composition of claim 183, wherein the expression of the target protein encoded bythe target RNA is modulated by the siRNA capable of binding to the target RNA.

186. The composition of claim 185, wherein the expression of the target protein encoded bythe target RNA is downregulated by the siRNA capable of binding to the target RNA.

Images