Pharmaceutical composition for prevention or treatment of degenerative arthritis
A pharmaceutical composition of mesenchymal stem cells overexpressing IL-10, poly-L-lactic acid particles, and a hydrogel addresses the limitations of current treatments for degenerative arthritis by enhancing cell adhesion and proliferation, achieving effective anti-inflammatory outcomes.
Patent Information
- Application Number
- PCT/KR2024/009531
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-11-29
- Filing Date
- 2024-07-05
- Publication Date
- 2025-06-05
AI Technical Summary
Current treatments for degenerative arthritis, such as non-steroidal anti-inflammatory drugs, often come with significant side effects and do not address the underlying degenerative damage to cartilage.
A pharmaceutical composition comprising mesenchymal stem cells overexpressing interleukin-10 (IL-10), poly-L-lactic acid particles, and a hydrogel, which enhances cell adhesion and proliferation, providing anti-inflammatory effects and potential therapeutic benefits for degenerative arthritis.
The composition exhibits excellent adhesion and proliferation abilities of mesenchymal stem cells, leading to significant anti-inflammatory effects and potential therapeutic efficacy in treating degenerative arthritis, as demonstrated in a rat model of osteoarthritis.
Smart Images

Figure KR2024009531_05062025_PF_FP_ABST
Abstract
Description
Pharmaceutical composition for the prevention or treatment of degenerative arthritis
[0001] The present invention relates to a pharmaceutical composition for preventing or treating degenerative arthritis.
[0002] Degenerative arthritis, also known as osteoarthritis, is the most common type of arthritis. It is primarily caused by degenerative damage to the cartilage that protects joints, leading to inflammation and pain. While aging is generally the primary cause, other factors, such as gender, genetics, obesity, and lifestyle, can also contribute to the condition.
[0003] In modern society, interest in the treatment of arthritis, a chronic disease that occurs frequently among the elderly after hypertension, is increasing due to the increase in the elderly population. Among chronic diseases in the elderly aged 65 and older, arthritis accounts for more than 33.4%, showing the second highest prevalence rate.
[0004] Nonsteroidal anti-inflammatory drugs (NSAIDs) are commonly used for arthritis. Over 100 different medications are sold in Korea under various brand names. These drugs inhibit cyclooxygenase-2 activity, thereby reducing prostaglandin E2 synthesis and thus reducing pain and inflammation. While they offer antipyretic, analgesic, and anti-inflammatory effects, they can also cause gastrointestinal, renal, cardiac, hepatic, and hematologic side effects. Because they offer no fundamental cure, the development of alternative treatments is urgently needed.
[0005] The purpose of the present invention is to provide a pharmaceutical composition for preventing or treating degenerative arthritis that exhibits excellent efficacy.
[0006]
[0007] The present invention relates to a pharmaceutical composition for preventing or treating degenerative arthritis, comprising mesenchymal stem cells overexpressing interleukin-10 (IL-10), poly-L-lactic acid particles, and a hydrogel.
[0008] In the pharmaceutical composition of the present invention, the mesenchymal stem cells may be adipose-derived mesenchymal stem cells.
[0009] In the pharmaceutical composition of the present invention, the mesenchymal stem cells may be attached to a hydrogel.
[0010] In the pharmaceutical composition of the present invention, the poly-L-lactic acid particles may be contained within a hydrogel matrix.
[0011] In the pharmaceutical composition of the present invention, the poly-L-lactic acid particles may be plasma-treated.
[0012] The pharmaceutical composition of the present invention comprises stem cells with efficacy against degenerative arthritis, and the stem cells exhibit remarkably excellent adhesion and proliferation properties. Therefore, the composition can exhibit excellent efficacy against degenerative arthritis.
[0013]
[0014] Figure 1 shows the analysis of the optimal concentration of a biodegradable hybrid hydrogel (BH-hydrogel) through stem cell adhesion analysis.
[0015] Figure 2 shows the confirmation of IL-10 overexpression and verification of stem cell properties in IL-10 hATMSCs (IL-10 overexpressing adipose-derived mesenchymal stem cells). A: Confirmation of IL-10 mRNA expression through RT-PCR, B: Confirmation of IL-10 protein through ELISA, C: Confirmation of stem cell marker through immunophenotyping.
[0016] Figure 3 shows the evaluation of the adhesion ability of hATMSCs and IL-10 hATMSCs to BH-hydrogel.
[0017] Figure 4 shows the evaluation of the proliferation capacity of hATMSCs and IL-10 hATMSCs by BH-hydrogel.
[0018] Figure 5 shows the analysis of the expression of TNF-α, IL-1β, and IL-6 mRNA in the joint tissue of a rat model induced by osteoarthritis after administration of BH-hydrogel and IL-10 hATMSCs.
[0019] The present invention is described in detail below.
[0020]
[0021] The present invention relates to a pharmaceutical composition for preventing or treating degenerative arthritis.
[0022] The pharmaceutical composition of the present invention comprises mesenchymal stem cells overexpressing interleukin-10 (IL-10), poly-L-lactic acid particles, and a hydrogel.
[0023] “Overexpression” means that the level of expression of a specific gene is excessively increased compared to the normal or general state. Mesenchymal stem cells that overexpress IL-10 are specifically mesenchymal stem cells in which the level of expression of the IL-10 gene (mRNA) or protein is increased.
[0024] Mesenchymal stem cells overexpressing IL-10 exhibit excellent anti-inflammatory effects and may exhibit excellent therapeutic efficacy against degenerative arthritis.
[0025] Mesenchymal stem cells can be derived from various sources. For example, they can be derived from umbilical cord, cord blood, placenta, bone marrow, fat, muscle, amniotic fluid, or amniotic membrane. For ease of supply / production, they can be derived from adipose tissue.
[0026] Mesenchymal stem cells may be obtained by a known method. For example, mesenchymal stem cells may be isolated from a derived sample, cultured in a suitable medium, floating cells removed during the culture process, and cells attached to the culture plate may be subcultured to ultimately obtain established mesenchymal stem cells. Isolation of mesenchymal stem cells from a derived sample may be performed by, but is not limited to, density gradient fractionation, immunoselection, and differential adhesion separation.
[0027] Mesenchymal stem cells can overexpress IL-10 by introducing the IL-10 gene. The introduced IL-10 gene can be of mammalian origin, including human origin, and specifically, human origin. The introduced IL-10 gene can include, for example, the base sequence known as BC104252.1 in the NCBI GenBank database.
[0028] Poly-L-lactic acid particles can allow the hydrogel to degrade more slowly and allow mesenchymal stem cells to better adhere to the hydrogel.
[0029] The number average molecular weight (Mn) of the poly-L-lactic acid contained in the particles may be, for example, 50,000 to 500,000 Dalton, 50,000 to 300,000 Dalton, or 50,000 to 200,000 Dalton. If the number average molecular weight is less than 50,000 Dalton, the degradation rate of the biodegradable polymer microparticles increases, and if the number average molecular weight exceeds 500,000 Dalton, processing may be difficult due to high viscoelasticity, making it difficult to manufacture particles having uniform size and quality.
[0030] The poly-L-lactic acid particles may have, for example, an average particle diameter (D50) of 20 μm to 100 μm, 20 μm to 90 μm, 20 μm to 80 μm, 20 μm to 70 μm, 20 μm to 60 μm, or 20 μm to 50 μm. If the average particle diameter is less than 20 μm, the particles may be phagocytosed by macrophages, and if it is greater than 100 μm, the particles may be unsuitable for use as injections.
[0031] Among the poly-L-lactic acid particles, the proportion of particles having a particle size ranging from 30 µm to 90 µm may be 50 vol% or more, 55 vol% or more, 60 vol% or more, 65 vol% or more, 70 vol% or more, 75 vol% or more, or 80 vol% or more of the total particles.
[0032] Poly-L-lactic acid particles, for example, 0.2 to 0.9 g / cm 3 , 0.2 to 0.8 g / cm 3 , 0.2 to 0.7 g / cm 3 , 0.2 to 0.6 g / cm 3 , or 0.2 to 0.5 g / cm 3 It can have a density of . Since poly-L-lactic acid particles have a density in this range, they can be easily and quickly hydrated in water, etc.
[0033]
[0034] The compound of chemical formula 1 may be included in an amount of, for example, 1 to 50%, 5 to 50%, 6 to 50%, 7 to 50%, 8 to 50%, 9 to 50%, 6 to 50%, 7 to 50%, 8 to 50%, 9 to 50%, 10 to 50%, 15 to 50%, 20 to 50%, etc., of the total weight of the poly-L-lactic acid particles. When the content of the compound of chemical formula 1 is within the above range, a decrease in pH due to decomposition of poly-L-lactic acid can be more effectively prevented.
[0035] Poly-L-lactic acid particles may be plasma-treated. This can significantly reduce the water contact angle and significantly improve cell adhesion to hydrogels containing them.
[0036] The hydrogel may be a hydrogel scaffold commonly used in cell culture applications, for example, one containing hyaluronic acid chains or collagen fibrils.
[0037] If desired, hyaluronic acid may be thiol-modified.
[0038] If desired, the collagen fibrils may be thiol modified denatured collagen.
[0039] If desired, the hydrogel may further comprise a thiol-reactive crosslinker.
[0040] If necessary, the hydrogel may further contain heparin sulfate, growth factors, etc.
[0041] Hydrogels may be liquid, in which case they may gel after administration.
[0042] A mixture of hydrogel and poly-L-lactic acid particles, wherein the poly-L-lactic acid particles can be incorporated (e.g., dispersed) into the hydrogel matrix, is referred to as a biodegradable hybrid hydrogel.
[0043] The mixing ratio of the hydrogel and poly-L-lactic acid particles is not limited, and for example, the volume ratio between the solutions may be 1: 0.5 to 2, 1: 0.5 to 1.5, 1: 0.8 to 1.2, etc. If the content of the poly-L-lactic acid particles is added in excess of the above range, it may be difficult for the hydrogel to function as a gel.
[0044] The concentration of the poly-L-lactic acid particle solution may be, for example, 0.1 to 5 mg / ml, 0.5 to 4 mg / ml, 1 to 3 mg / ml, etc., but is not limited thereto, and higher concentrations can also be adjusted.
[0045] Mesenchymal stem cells can be included with a hydrogel (or composite hydrogel) and attached to the hydrogel. This can significantly improve adhesion and proliferation abilities. The mesenchymal stem cells can be included with the biodegradable composite hydrogel at a concentration of, for example, 10 μg / ml, 30 μg / ml, 50 μg / ml, 100 μg / ml, 150 μg / ml, 200 μg / ml or more. The upper limit of the concentration is not limited, and can be, for example, 1000 μg / ml, 900 μg / ml, 800 μg / ml, 700 μg / ml, 600 μg / ml, 500 μg / ml, etc.
[0046] The pharmaceutical composition of the present invention can exhibit excellent efficacy (prevention or treatment) for degenerative arthritis.
[0047] The pharmaceutical composition of the present invention may be formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., as well as external preparations, suppositories, injections, etc., according to conventional methods. Specifically, it may be used in the form of an injection, and for example, it may be a dosage form for intra-articular injection.
[0048] Carriers, excipients and diluents that may be contained in the pharmaceutical composition of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
[0049] When formulating, it is usually prepared using diluents or excipients such as fillers, bulking agents, binders, wetting agents, disintegrants, and surfactants.
[0050] Solid preparations for oral administration include tablets, pills, powders, granules, and capsules, and these solid preparations are prepared by mixing at least one excipient, such as starch, calcium carbonate, sucrose or lactose, or gelatin. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral administration include suspensions, oral solutions, emulsions, and syrups, and in addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, flavoring agents, and preservatives may be included. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Suppository bases include witepsol, macrogol, Tween 61, cocoa butter, laurin, and glycerogelatin.
[0051] The dosage of the pharmaceutical composition of the present invention may vary depending on the patient's age, sex, and weight, but may be administered once or several times daily at a dosage of 0.001 to 100 mg / kg, preferably 0.011 to 10 mg / kg. Furthermore, the dosage may be increased or decreased depending on the route of administration, severity of the disease, sex, body weight, age, and the like. Therefore, the dosage does not limit the scope of the present invention in any way.
[0052]
[0053] Example
[0054] cell culture
[0055] Human adipose tissue-derived mesenchymal stem cells (hATMSCs) purchased from Cell Bio Co., Ltd. were cultured at 37°C with 5% CO2 supply in CEFOgrowTM Human MSC Growth Medium [Cell Bio Co., Ltd.] containing antibiotics.
[0056]
[0057] Production of Biodegradable Hybrid Hydrogel (BH-hydrogel)
[0058] Poly-L lactic acid (PLLA, provided by UltraV) with a concentration of 2 mg / mL and cell culture hydrogel (Sigma-Aldrich, HYSC020) were mixed in a 1:1 ratio to produce BH-hydrogel containing PLLA with a concentration of 1 mg / mL.
[0059]
[0060] Determination of the optimal concentration of biodegradable composite hydrogels through stem cell adhesion analysis.
[0061] Add 3ml of stem cell culture medium to a 6-well plate and add 150 x 10 3 After adding canine stem cells and BH-hydrogel at various concentrations (10, 50, 100, and 200 μg / mL), they were cultured for 4 hours.
[0062] The attached cells were recovered and the number of attached cells was measured using a trypan blue exclusion assay (Fig. 1).
[0063] As a result of measuring the number of attached cells, the stem cell attachment rate was highest in the groups containing 100 and 200 μg / mL of BH-hydrogel, and 100 μg / mL of BH-hydrogel was determined to be the optimal concentration for in vitro experimental studies.
[0064]
[0065] Example 1. Production of IL-10 hATMSCs and confirmation of IL-10 overexpression.
[0066] To produce IL-10 overexpressing human adipose tissue-derived mesenchymal stem cells (IL-10 hATMSCs), a human IL-10 lentiviral expression vector [Product name: IL-10 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) Lentiviral Vector Cat. No. LV188793] was produced and purchased from ABM Inc. The IL-10 lentiviral vector was transfected and packaged into 293FT cells, and the viral particles were transduced into human adipose tissue-derived mesenchymal stem cells (hATMSCs) via liposomal transfection, thereby obtaining IL-10 gene-transduced human adipose tissue-derived mesenchymal stem cells (IL-10 hATMSCs).
[0067] To analyze the stem cell properties of transformed IL-10-hATMSCs and the markers of adipose-derived mesenchymal stem cells (hATMSCs), overexpression of IL-10 was confirmed in the produced IL-10-hATMSCs through RT-PCR and ELISA analysis, and expression analysis of stem cell markers (positive markers: CD73, CD90, CD105, negative markers: CD34, CD45, HLA-DR) was performed through flow cytometry. hATMSCs were used as a control. RT-PCR and ELISA analysis results confirmed overexpression of IL-10 mRNA and protein in adipose-derived mesenchymal stem cells introduced with the IL-10 gene (Fig. 2A and Fig. 2B). Immunophenotyping analysis using a flow cytometer confirmed that positive markers (CD73, CD90, CD105) and negative markers (CD34, CD45, HLA-DR) of adipose-derived mesenchymal stem cells (hATMSCs) did not change due to the introduction of the IL-10 gene, thereby verifying the stem cell properties of adipose-derived mesenchymal stem cells introduced with the IL-10 gene (Fig. 2C).
[0068]
[0069] Example 2. Analysis of the adhesion and proliferation capacity of IL-10 hATMSCs using a biodegradable composite hydrogel (BH-hydrogel).
[0070] BH-hydrogel (100 μg / mL) and stem cells (1 x 10 5 After adding hATMSCs and IL-8 hATMSCs to a 6-well plate containing stem cell culture medium and allowing them to attach for 4 hours, the adhesion ability of hATMSCs and IL-8 hATMSCs by BH was evaluated through trypan blue exclusion assay and cell counting.
[0071] BH-hydrogel (100 μg / mL) and stem cells (5 x 10 3After adding hATMSCs (cells) to a 24-well plate containing stem cell culture medium, they were cultured for 1, 2, and 3 days, and the viability and proliferation capacity of hATMSCs and IL-10 hATMSCs by BH were evaluated using WST-1 proliferation assay and trypan blue exclusion assay.
[0072] The adhesion ability of hATMSCs and IL-10 hATMSCs to BH-hydrogel was analyzed. Compared to the control group of hATMSCs without BH-hydrogel (68.2 ± 2%), the adhesion ability of hATMSCs with BH-hydrogel added (85.5 ± 2.2%) increased. Furthermore, compared to the control group of IL-10 hATMSCs without BH-hydrogel (62.5 ± 3.5%), the adhesion ability of IL-10 hATMSCs with BH-hydrogel added (80.5 ± 3%) increased (Fig. 3). These results demonstrate that BH-hydrogel enhances the adhesion ability of stem cells.
[0073] Analysis of the proliferation capacity of hATMSCs and IL-10 hATMSCs by BH-hydrogel showed that the proliferation capacity of hATMSCs with BH-hydrogel was significantly increased compared to the control group of hATMSCs without BH-hydrogel on days 1, 2, and 3 (Fig. 4A), and the proliferation capacity of IL-10 hATMSCs with BH-hydrogel was significantly increased compared to the control group of IL-10 hATMSCs without BH-hydrogel (Fig. 4B). These results demonstrate that BH-hydrogel significantly enhanced the proliferation capacity of stem cells.
[0074]
[0075] Example 4. Analysis of the therapeutic efficacy of IL-10 hATMSCs based on a biodegradable composite hydrogel (BH-hydrogel) in a rat model induced by osteoarthritis.
[0076] (1) Method
[0077] Creation of a rat model induced by osteoarthritis
[0078] Eight-week-old male Wistar rats were anesthetized with isoflurane and injected intraarticularly with MIA (3 mg / head) into the right knee joint. Each group had 10 animals, and the normal group received a single injection of the same volume of saline into the same location of the right knee joint.
[0079]
[0080] Administration of BH-hydrogel and IL-10 hATMSCs
[0081] BH-hydrogel (100 μg) and 5 x 10 were injected into the right knee joint of a rat model with osteoarthritis induced 7 days after MIA induction through hind limb weight-bearing test. 5 IL-10 hATMSCs and hATMSCs were administered to the rats, and the control group was administered the same amount of saline.
[0082]
[0083] Measurement of hind limb weight bearing
[0084] Hindlimb weight-bearing was measured three times in total: 7 days (week 0), 14 days (week 1), and 21 days (week 2) after inducing osteoarthritis with MIA. Hindlimb weight-bearing was measured using an Incapacitance Test Meter (IITC Life Science, California, USA). After the subjects were placed obliquely (inclined 60°) in an acrylic chamber (angulated perspex container), the subjects were placed on separate weighing plates on the left and right weight-bearing platforms. Once the posture was stable, the intensity applied to each hindlimb was measured three times for 10 seconds (per measurement), and the average value was calculated. The percentage of body weight distributed to the treated right hindlimb was calculated using the following equation.
[0085] [Formula 1]
[0086] % of weight on ipsilateral limb = (weight on ipsilateral limb / weight on ipsilateral limb + weight on contralateral limb)
[0087]
[0088] Analysis of expression of inflammatory factors (TNF-α, IL-1β, and IL-6) in joint tissue
[0089] Expression analysis of inflammatory factors was performed using qRT-PCR analysis using primers for inflammatory factors (TNF-α, IL-1β, and IL-6) in joint tissue (Table 1).
[0090]
[0091] Primer base sequence used in qRT-PCR
[0092] GeneForward(5'-3')Reverse(5'-3')TNF-αAGCAAACCACCAAGTGGAGGA (SEQ ID NO: 1)GCTGGCACCACTAGTTGGTTGT (SEQ ID NO: 2)IL-1βAGTTGACGGACCCCAAAAG (SEQ ID NO: 3)AGCTGGATGCTCTCATCAGG (SEQ ID NO: 4)IL-6CTACCAAACTGGATATAATCAGGA (SEQ ID NO: 5)CCAGGTAGCTATGGTACTCCAGAA (SEQ ID NO: 6)GAPDHAGGTCATCCCAGAGCTGAACG (SEQ ID NO: 7)CACCCTGTTGCTGTAGCCGTAT (SEQ ID NO: 8)
[0093] Joint tissues were collected, and RNA was isolated using the Collagen type 1 and 2 RNeasy Mini Kit (Qiagen). 0.5 μg of RNA was used to synthesize cDNA using AccuPower RT PreMix (Bioneer). 2 μl of the synthesized cDNA, target primers, AccuPower GreenStar™ qPCR PreMix (Bioneer), and a Realtime-PCR machine (Exicycler96, Bioneer) were used to perform amplification. The fold change was quantified relative to the Ct value and compared.
[0094] (2) Results
[0095] Results of hind limb weight bearing measurement
[0096] The changes in body weight measured at 1 and 2 weeks in the group administered a combination of biodegradable composite hydrogel and IL-10 hATMSCs after inducing osteoarthritis did not show any significance among the normal group, control group, hATMSCs administration group, and IL-10 hATMSCs administration group (Table 1). When the hind limb weight bearing ratio of the normal group was set to 100, the change in the relative hind limb weight bearing of each group was measured. As a result, when compared to the control group (205.88±5.98 g) at 1 week after MIA induction and test substance administration, there was no significant difference in the change in hind limb weight bearing in the hATMSCs administration group (185.08±15.89 g), but a decrease in hind limb weight bearing was confirmed in the IL-10 hATMSCs administration group (175.49±11.85 g) and the group administered with biodegradable composite hydrogel and IL-10 hATMSCs (155.25±7.8 g), and in particular, a significant decrease was confirmed in the group administered with biodegradable composite hydrogel and IL-10 hATMSCs (Table 3). At 2 weeks after administration of the test substance, the weight bearing of the hind limbs tended to decrease significantly in the hATMSCs administration group (175.19±7.68 g) and the IL-10 hATMSCs administration group (165.55±6.50 g) compared to the control group (206.21±12.44 g), and in particular, the group administered the biodegradable composite hydrogel and IL-10 hATMSCs together (135.12±4.50 g) showed the most significant decrease (Table 3). These results demonstrate that the combined administration of the biodegradable composite hydrogel and IL-10 hATMSCs has a strong therapeutic effect on osteoarthritis.
[0097]
[0098] Body weight changes induced by IL-10 hATMSCs and hATMSCs administration in a rat model of osteoarthritis induced by MIA
[0099] GroupInitial body weight(g)Final body weight(g)Chage weight(g)Normal296.44±8.5362.52±6.466.08±7.5Control294.33±7.4358.38±4.464.05±5.8hATMSCs295.38±7.8360.82±7.965.44±8.2IL-10 hATMSCs298.58±8.4364.59±6.666.01±7.8BH-hydrogel + IL-10 hATMSCs297.18±2.4361.39±1.665.08±5.1
[0100] Changes in hindlimb weight bearing induced by IL-10 hATMSCs and hATMSCs administration in a rat model of osteoarthritis induced by MIA
[0101] Group0 week (g)1 week (g)2 weeks (g)Normal100±3.25100±2.33100±1.88Control213.05±33.55205.88±5.98206.21±12.44hATMSCs208.15±15.55185.08±15.89175.19±7.68IL-10 hATMSCs212.08±11.72175.49±11.85165.55±6.50BH-hydrogel + IL-10 hATMSCs213.06±15.44155.25±7.8135.12±4.50
[0102] Results of analysis of the expression of inflammatory factors (TNF-α, IL-1β, and IL-6) in joint tissue
[0103] The expression of inflammatory factors (TNF-α, IL-1β, and IL-6) was analyzed by qRT-PCR in the joint tissues of the osteoarthritis-induced rat model 1 and 2 weeks after administration of the test substance. As a result, compared to the control group, the hATMSCs administration group, the IL-10 hATMSCs, and the co-administration group of biodegradable composite hydrogel and IL-10 hATMSCs all showed a decrease in the expression of TNF-α, IL-1β, and IL-6 mRNA. In particular, the co-administration group of biodegradable composite hydrogel and IL-10 hATMSCs showed the most significant decrease in the expression of TNF-α, IL-1β, and IL-6 mRNA (Fig. 5). These results demonstrate that the co-administration of biodegradable composite hydrogel and IL-10 hATMSCs has a strong anti-inflammatory effect in the osteoarthritis-induced rat model.
[0104]
[0105] Example 4
[0106] Proteomic analysis of hATMSCs cultured on BH-hydrogel
[0107] Add 10 ml of stem cell culture medium to a 100 mm plate and add 2 x 10 5 After adding canine stem cells and BH-hydrogel (100 μg / mL), cells were harvested after culturing for 3 days, and total protein was extracted. After performing 10% SDS-PAGE on each of the two groups (control and BH-hydrogel-treated groups), six slices were gel-digested for each lane, and mass spectrometric analysis was performed. Differentially expressed proteins were analyzed using Sequest & Scaffold.
[0108] The results of proteomic analysis showed that 783 proteins were increased and 442 proteins were decreased in the BH-hydrogel-treated hATMSCs group compared to the control group (hATMSCs cultured alone) (Table 2).
[0109]
[0110] Analysis of differentially expressed proteins in BH-hydrogel-treated hATMSCs
[0111] Group UpregulationDownregulationBH-hydrogel-treated hATMSCs Group 783442
[0112] The results of functional classification analysis, as presented in Table 5, identified functionally related proteins in the following order: cell organization & biogenesis (42%), signal transduction (15%), cell cycle & proliferation (12%), cell adhesion (10%), developmental processes (6%), stress response (1.3%), and apoptosis & death (0.7%). These results demonstrate that functional proteins related to engraftment and growth are highly expressed in the BH-hydrogel-treated hATMSCs group.
[0113]
[0114] Functional classification analysis of proteins expressed in BH-hydrogel-treated hATMSCs
[0115] Functional classificationTotal protein(%)cell organization & biogenesis42signal transduction15cell cycle & proliferation12cell adhesion10developmental processes6stress response1.3apoptosis & death0.7
Claims
1. A pharmaceutical composition for preventing or treating degenerative arthritis comprising mesenchymal stem cells overexpressing interleukin-10 (IL-10), poly-L-lactic acid particles, and a hydrogel.
2. A pharmaceutical composition for preventing or treating degenerative arthritis according to claim 1, wherein the mesenchymal stem cells are adipose-derived mesenchymal stem cells.
3. A pharmaceutical composition for preventing or treating degenerative arthritis according to claim 1, wherein the mesenchymal stem cells are attached to a hydrogel.
4. A pharmaceutical composition for preventing or treating degenerative arthritis according to claim 1, wherein the poly-L-lactic acid particles are contained within a hydrogel matrix.
5. A pharmaceutical composition for preventing or treating degenerative arthritis according to claim 1, wherein the poly-L-lactic acid particles are plasma-treated.
Citation Information
Patent Citations
Multi-layered electrospun fiber incorporated hydrogel
KR1020150084519A
A hull
KR1020220031164A
Plasma carbonization system and method which including drying and pretreatment
KR102601811B1