Method for detecting mirna from biological sample without nucleic acid purification

Abstract

The present invention addresses the problem of providing a method that makes it possible to detect miRNA from a biological sample without nucleic acid purification. The abovementioned problem is solved by a method for detecting miRNA from a biological sample without nucleic acid purification, said method including a step in which a liquid mixture of the biological sample and a solvent is subjected to a heat treatment.

Description

Method for detecting miRNA from biological samples without nucleic acid purification

[0001] The present invention relates to a method for detecting miRNA from a biological sample without purifying nucleic acid, and a miRNA detection kit.

[0002] Research on microRNAs (miRNAs) is increasing as scientists begin to recognize the broad role these molecules play in regulating eukaryotic gene expression. Two of the most studied miRNAs, lin-4 and let-7, regulate developmental timing in Caenorhabditis elegans (C. elegans) by regulating the translation of key mRNA families (reviewed in [Illegible Text]). Hundreds of miRNAs have been identified in C. elegans, Drosophila, mice, and humans. MiRNA levels have been shown to vary between tissues and developmental states. Many miRNAs have been characterized and shown to influence a variety of processes, including early development ([Illegible Text]), cell proliferation and cell death ([Illegible Text]), and apoptosis and fat metabolism ([Illegible Text]). Furthermore, Non-Patent Document 5 describes a strong correlation between decreased expression of two miRNAs and chronic lymphocytic leukemia, suggesting the possibility of a correlation between miRNAs and cancer. Although this is still a new field, there is speculation that miRNAs may play as important a role as transcription factors in regulating gene expression in higher eukaryotes.

[0003] miRNAs are relatively stable in the body and may be involved in mRNA expression, function as oncogenes or tumor suppressors, or be involved in the control of metastatic cancer, making them useful for diagnostic or therapeutic applications and an attractive model for targeted therapeutics.

[0004] MiRNAs are known to be abundant in extracellular vesicles (EVs). Cancer cells release large amounts of extracellular vesicles (EVs), including exosomes. EVs derived from cancer cells contain tumor RNA (including miRNAs) and are present at high concentrations in the body fluids of cancer patients (Non-Patent Document 6). EVs released from tumor cells may provide information about the tumor cells from which they originate and are a source of nucleic acids distinct from cells that may serve as potential cancer-related biomarkers. Therefore, detecting miRNAs in EVs is important for diagnostic applications.

[0005] Advances in the field of genetic engineering have made it possible to perform genetic analysis without purifying nucleic acids such as DNA and RNA from biological samples such as cells and tissues (Patent Documents 1 and 2).

[0006] Patent Document 1 describes a method for performing RT-PCR without extracting and purifying nucleic acids by using a biological sample treatment solution containing a chaotropic agent.

[0007] Patent Document 2 describes a method for amplifying a target nucleic acid by using a biological sample treatment solution consisting of an aqueous solution containing dimethyl sulfoxide and a surfactant and having a pH of 2.5 to 5.0, thereby reducing the influence of inhibitory substances.

[0008] JP-T-2011-528914 A JP-A-2006-158283 A

[0009] Pasquinelli and Ruvkun, Ann. Rev. Cell Dev. Biol., 18:495-513, 2002Reinhart et al., Nature, 403:901-906, 2000Brennecke et al., Cell, 113:25-36, 2003Xu et al., Curr. Biol., 13:790-795, 2003Calin et al., Proc. Natl. Acad. Sci., USA, 99:15524-15529, 2002Brock et al. (2015) Translational Cancer Res. 4:280

[0010] Conventionally, nucleic acid detection from EVs requires purifying EVs from blood, urine, etc., and then purifying nucleic acids from the purified EVs using nucleic acid adsorption particles, nucleic acid adsorption columns, etc. This is thought to be because substances such as proteins derived from biological samples inhibit nucleic acid amplification during nucleic acid amplification. However, the process of extracting and purifying nucleic acids from biological samples is cumbersome and time-consuming, and there is a risk of sample loss.

[0011] Furthermore, through further investigations, the present inventors have found that the methods described in Patent Documents 1 and 2 do not sufficiently reduce the effects of nucleic acid amplification inhibitors when used in detecting miRNA.

[0012] In view of the above circumstances, the present inventors have conducted extensive research and found that a method including a step of heat-treating a mixture of a biological sample and a lysis solution enables the detection of miRNA from a biological sample without purifying nucleic acids. Based on this finding, the present inventors have conducted further extensive research and have arrived at the present invention.

[0013] The present invention encompasses the following aspects. [Item 1] A method for detecting miRNA from a biological sample without nucleic acid purification, comprising Step A of heat-treating a mixture of the biological sample and a lysis solution. [Item 1A] A method for detecting miRNA from a biological sample, comprising Step A of heat-treating a mixture of the biological sample and a lysis solution, wherein the method detects miRNA without nucleic acid purification. [Item 2] The method of Item 1 or 1A, further comprising Step b of incubating the mixture at room temperature before Step A. [Item 3] The method of Item 2, further comprising Step a of mixing the biological sample with the lysis solution to obtain the mixture before Step b. [Item 4] The method of any of Items 1 to 3 and 1A, wherein the biological sample is at least one selected from animal cells, extracellular vesicles, plasma, serum, whole blood, and urine. [Item 5] The method of Item 4, wherein the extracellular vesicles are at least one selected from exosomes, microvesicles, and apoptotic bodies. [Item 6] The method according to any one of Items 1 to 5 and 1A, wherein Step A is carried out at a temperature of 60°C or higher and 99°C or lower. [Item 7] The method according to any one of Items 1 to 6 and 1A, wherein Step A is carried out for 30 seconds or higher and 10 minutes or lower. [Item 8] The method according to any one of Items 2 to 7, wherein Step b is carried out for 2 minutes or higher and 10 minutes or lower. [Item 9] The method according to any one of Items 2 to 8, wherein Step b is carried out at a temperature of 20°C or higher and 30°C or lower. [Item 10] The method according to any one of Items 1 to 9 and 1A, wherein the lysis solution contains at least one selected from a protease, a chaotropic salt, a surfactant, a reducing agent, an RNase inhibitor, and a DNase. [Item 11] The method according to Item 10, wherein the protease is at least one selected from proteinase K and pronase. [Item 12] The method according to Item 10 or 11, wherein the RNase inhibitor is a proteinaceous RNase inhibitor. [Item 13] The method according to any one of Items 10 to 12, wherein the surfactant is a nonionic surfactant.[Item 14] The method of any one of Items 10 to 13, wherein the reducing agent is at least one selected from dithiothreitol (DTT), tris(carboxyethyl)phosphine (TCEP), N-acetylcysteine, tris(hydroxypropyl)phosphine (THPP), 1-thioglycerol, and β-mercaptoethanol. [Item 15] The method of any one of Items 1 to 14 and 1A, further comprising, after Step A, Step B of synthesizing DNA derived from miRNA by reverse transcription. [Item 16] The method of Item 15, further comprising Step C of amplifying the miRNA-derived DNA obtained by Step B by a nucleic acid amplification reaction and detecting it. [Item 17] The method of Item 16, wherein the nucleic acid amplification reaction is qPCR. [Item 18] A miRNA detection kit for use in the method of any one of Items 1 to 17 and 1A. [Item 18A] Use of a miRNA detection kit for use in the method of any one of Items 1 to 17 and 1A.

[0014] According to the present invention, miRNA can be detected from a biological sample (e.g., animal cells and / or extracellular vesicles) without purifying nucleic acids. By eliminating the nucleic acid purification step, the time required for nucleic acid purification can be reduced and the sample yield can be improved.

[0015] The present invention will be described in more detail below by showing embodiments of the present invention, but the present invention is not limited to these.

[0016] All non-patent documents and patent documents described in this specification are incorporated herein by reference in their entirety. In addition, the term "to" in this specification means "at least or equal to, at most or equal to," and for example, "X to Y" in this specification means "at least X and at most Y." In this specification, "and / or" means any one or any possible combination of two or more of the listed elements. In this specification, "comprising" encompasses the concepts of "consisting essentially of" and "consisting only of."

[0017] An miRNA detection method according to one embodiment of the present invention includes a step A of heat-treating a mixture of a biological sample and a lysis solution.

[0018] "MicroRNA" (also called "miRNA") is a type of non-coding RNA (ncRNA) that is not thought to code for proteins. MicroRNAs are matured by processing their precursors. MicroRNAs are known to usually have a length of about 20 to 25 bases. MicroRNAs can be double-stranded.

[0019] The miRNA detection method preferably does not involve purification of nucleic acids, i.e., step A is preferably a step of heat-treating a mixture of a biological sample containing unpurified nucleic acids and a lysis solution.

[0020] The biological sample is not particularly limited as long as it is a sample derived from an organism. Biological samples usually contain impurities other than miRNA. Impurities may include nucleic acid amplification inhibitors, etc., but miRNA can also be detected from biological samples containing impurities.

[0021] Examples of biological samples include animal cells derived from animals, including humans, and cultures thereof, extracellular vesicles, and body fluids such as plasma, serum, whole blood, and urine. Biological samples also include samples derived from plants and microorganisms. In a preferred embodiment, the biological sample is at least one selected from animal cells and extracellular vesicles.

[0022] The biological sample may be purified cells, extracellular vesicles, etc., prior to mixing with the lysis solution, or may be suspended in a buffer solution such as PBS.

[0023] "Extracellular vesicles" (also referred to as "EVs") are vesicles released from cells, including those released from cells during apoptosis and those released from healthy cells. Extracellular vesicles are broadly classified into exosomes, microvesicles (MVs), and apoptosis bodies based on their size and surface markers. Therefore, at least one selected from exosomes, microvesicles, and apoptosis bodies may be used as extracellular vesicles. Extracellular vesicles may be purified from, for example, plasma, serum, whole blood, urine, etc. In a preferred embodiment, purified exosomes can be used as extracellular vesicles. Exosome purification can be performed using methods known to those skilled in the art, including, but not limited to, ultracentrifugation, PEG precipitation, immunoprecipitation, affinity precipitation using magnetic beads, and density gradient centrifugation. Commercially available exosome purification kits may also be used.

[0024] The biological sample may be collected from a living organism and used as is, or may be a sample collected from a living organism and suspended in a solvent known to those skilled in the art, such as water, an organic solvent (e.g., a lower alcohol such as ethanol), a mixture thereof, or a buffer solution such as PBS.

[0025] The lysis solution (also referred to as "lysis solution") is not particularly limited as long as it can lyse a biological sample and liberate miRNA. In one embodiment, the lysis solution preferably contains at least one component (one, two, three, four, five, or six) selected from a protease, a chaotropic salt, a surfactant, a reducing agent, an RNase inhibitor, and a DNase, and preferably contains the component in a solvent known to those skilled in the art, such as water or an organic solvent (e.g., a lower alcohol such as ethanol, glycerol, etc.), a mixture thereof, or a buffer solution such as Tris-HCl.

[0026] The protease is not particularly limited as long as it can degrade RNase, and examples include proteinase K, pronase, trypsin, and the like. In one embodiment, at least one selected from protease, proteinase K, and pronase is preferred. Proteinase K can be, for example, Proteinase K (PK) Solution manufactured by Promega. Pronase can be, for example, Pronase From Streptomyces Griseus manufactured by Roche. One type of protease may be used alone, or two or more types may be used in combination. The protease is preferably contained in the lysis solution at a concentration of 0.0 mg / mL to 10.0 mg / mL, more preferably 0.001 mg / mL to 1.0 mg / mL, even more preferably 0.003 mg / mL to 0.1 mg / mL, and particularly preferably 0.005 mg / mL to 0.05 mg / mL. Since the method of the present invention includes step A, miRNA can be detected from a biological sample without purifying nucleic acids, and therefore the protease may be used at a low concentration. The protease of the present invention is contained in the dissolution solution at a concentration of 0.05 mg / mL or less, preferably 0.01 mg / mL or less (for example, 0.005 mg / mL or less).

[0027] The chaotropic salt is not particularly limited as long as it denatures RNase, and examples thereof include guanidinium hydrochloride, guanidinium thiocyanate, sodium iodide, sodium perchlorate, sodium trichloroacetate, etc. The chaotropic salt may be used alone or in combination of two or more kinds.

[0028] The RNase inhibitor is not particularly limited as long as it inhibits RNase activity, and examples thereof include proteinaceous RNase inhibitors. For example, RNase inhibitor Recombinant manufactured by Toyobo Co., Ltd. can be used as the RNase inhibitor. RNase inhibitors may be used alone or in combination of two or more. The RNase inhibitor is preferably contained in the lysis solution at a concentration of 0.1 U / mL to 1 U / mL, more preferably 0.2 U / mL to 0.8 U / mL.

[0029] The surfactant is not particularly limited, but is preferably a nonionic surfactant, and more preferably, polyoxyethylene-based nonionic surfactants such as polyoxyethylene sorbitan monolaurate, poly(oxyethylene) diphenyl ether, poly(oxyethylene) octylphenyl ether, polyoxyethylene oleyl ether, and polyoxyethylene lauryl ether, and sucrose fatty acid esters are included. The chain length of the polyoxyethylene chain (or the number of repeating units) of the polyoxyethylene-based nonionic surfactant is not particularly limited, but is preferably 5 to 30, more preferably 10 to 25. The surfactant may be used alone or in combination of two or more. The surfactant is preferably contained in the solution at a concentration of 0.01 v / v % to 1 v / v %, more preferably 0.05 v / v % to 0.5 v / v %.

[0030] The reducing agent is not particularly limited, but is preferably at least one selected from dithiothreitol (DTT), tris(carboxyethyl)phosphine (TCEP), N-acetylcysteine, tris(hydroxypropyl)phosphine (THPP), 1-thioglycerol, and β-mercaptoethanol. The reducing agent may be a single agent or a combination of two or more agents. The reducing agent is preferably contained in the solution at a concentration of 0.01 mM to 1 mM, more preferably 0.05 mM to 0.5 mM.

[0031] The DNase is not particularly limited as long as it cleaves genomic DNA derived from cells, and examples thereof include DNase 1 (manufactured by Takara Bio Inc.). DNase may be used alone or in combination of two or more types. DNase is preferably contained in the lysis solution at a concentration of 0.01 U / μL to 0.1 U / μL, more preferably 0.02 U / μL to 0.05 U / μL.

[0032] The lysis solution may optionally contain divalent cations such as magnesium ions to enhance DNase activity. The divalent cations may be one type alone or a combination of two or more types. The divalent cations are preferably contained in the lysis solution at a concentration of, for example, 1 mM to 5 mM, preferably 1.5 mM to 2.5 mM.

[0033] The mixture obtained by mixing the biological sample with the lysis solution may contain nucleic acids other than miRNA. The biological sample and the lysis solution are preferably mixed at room temperature, for example, at a temperature of 4°C to 30°C, preferably 15°C to 25°C. The mixture may be stirred, and stirring conditions are not particularly limited and can be appropriately determined by those skilled in the art.

[0034] The biological sample, particularly cultured cells, are present in the above-mentioned mixed solution at a concentration of preferably 0.01 to 1000 cells / μL, more preferably 0.05 to 900 cells / μL, even more preferably 0.1 to 800 cells / μL, particularly preferably 0.15 to 700 cells / μL, and most preferably 0.2 to 600 cells / μL, from the viewpoint of further enhancing the effect of reducing the influence of contaminants derived from the biological sample by the heat treatment described below.

[0035] The heat treatment in step A is preferably carried out at a temperature of 60°C to 99°C, more preferably 65°C to 97°C, for a period of preferably 30 seconds to 10 minutes, more preferably 1 minute to 6 minutes. By carrying out heat treatment, miRNA can be detected from a biological sample without purifying the nucleic acid. While not intending to be bound by any particular theory, this is thought to be because heat treatment reduces contaminants derived from the biological sample. "Nucleic acid purification" refers to a procedure in which nucleic acids are separated or isolated from the mixture of the biological sample and lysis solution obtained as described above using nucleic acid adsorption particles, a nucleic acid adsorption column, or the like.

[0036] The miRNA detection method may further include, before step A, step b of incubating the above-mentioned mixture, preferably at room temperature, more specifically at a temperature of 20°C or higher and 30°C or lower, preferably for 2 minutes or longer and 10 minutes or shorter.

[0037] The miRNA detection method may further comprise, after step A, step B of synthesizing DNA derived from the miRNA by reverse transcription. The miRNA reverse transcription reaction is preferably carried out using a stem-loop primer. A method for reverse transcribing miRNA using a stem-loop primer is described in detail, for example, in U.S. Patent No. 7,575,863. In one preferred embodiment, a reverse transcriptase, deoxyribonucleotides, a stem-loop primer, and magnesium chloride (MgCl ２ It is desirable to add the above mixture to a reaction solution containing the above-mentioned ATP, and incubate at 10°C to 20°C for 15 minutes to 1 hour, then at 35°C to 55°C for 10 minutes to 1 hour, and then at 80°C to 99°C for 2 minutes to 10 minutes.

[0038] The miRNA detection method may further include step C, in which the miRNA-derived DNA obtained in step B is amplified by a nucleic acid amplification reaction and detected. The nucleic acid amplification reaction is not particularly limited and can be performed using methods known to those skilled in the art. Specific examples include PCR, quantitative PCR (qPCR), isothermal amplification, etc., with qPCR being preferred. The nucleic acid amplification conditions are not particularly limited and can be appropriately determined by those skilled in the art. Generally, the nucleic acid amplification reaction solution preferably contains a template nucleic acid, primers, deoxyribonucleotides, and DNA polymerase. The nucleic acid amplification reaction solution may also optionally contain other components such as reverse transcriptase. In one preferred embodiment, the nucleic acid amplification reaction is performed by adding the nucleic acid amplification reaction solution described above to a mixture containing miRNA-derived DNA (template nucleic acid), denaturing the DNA at 90-99°C for 20-60 seconds, and then performing 35-45 thermal cycles of 90-99°C for 2-10 seconds and 55-65°C for 20-60 seconds, and then detecting the fluorescence derived from the template nucleic acid.

[0039] According to another embodiment of the present invention, there is provided a miRNA detection kit for use in the above method.

[0040] The configuration of the miRNA detection kit is not particularly limited, but it is preferable that it includes, for example, the above-mentioned lysis solution, reverse transcription reaction reagent, and nucleic acid amplification reaction reagent (particularly qPCR reaction reagent). The lysis solution, reverse transcription reaction reagent, and nucleic acid amplification reaction reagent (particularly qPCR reaction reagent) may be contained in a single bottle, or may be contained in separate bottles. Alternatively, the miRNA detection kit may be configured to include a bottle containing the lysis solution and bottles containing the reverse transcription reaction reagent and nucleic acid amplification reaction reagent (particularly qPCR reaction reagent). The miRNA detection kit may optionally include a biological sample collection tool (or specimen collection tool) such as a swab and an instruction manual.

[0041] The present invention will be specifically described below with reference to examples, although the present invention is not limited to the following examples.

[0042] Test Example 1. Increase in cell lysis ability by heat treatment (1) Preparation of reverse transcription reaction solution RT primers 1 and 2 were added to 5x RT buffer (ReverTra Ace (registered trademark) qPCR RT Kit (Toyobo)) and enzyme mix (ReverTra Ace (registered trademark) qPCR RT Kit (Toyobo)) as follows. Both RT primers 1 and 2 are stem-loop primers.

[0043]

[0044] RT primer 1 (for let-7a) CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAACTATAC (SEQ ID NO: 1) RT primer 2 (for let-7d) CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAACTATGC (SEQ ID NO: 2)

[0045] (2) Sample preparation / reverse transcription reaction HeLa cells 1 x 10 ６ The cells were collected and suspended in 100 μL of PBS buffer. Four 10-fold dilution series were prepared (cell dilution series A to D; cell dilution series A: 1 × 10 ４ cells / μL, cell dilution series B: 1×10 ３ cells / μL, cell dilution series C: 1×10 ２(cells / μL, cell dilution series D: 10 cells / μL) and 5 μL of each was added to 8-tube microtubes in duplicate. 60 μL of the lysis solution with the composition shown in Table 2 below was added to each tube containing the cell suspension, and the tube was vortexed to obtain a mixture of the sample and lysis solution (final concentration of each mixture using cell dilution series A to D; cell dilution series A: approximately 1.54 × 10 ２ cells / μL, cell dilution series B: approximately 1.54×10 cells / μL, cell dilution series C: approximately 1.54 cells / μL, cell dilution series D: 1.54×10 －１ The mixtures were then incubated at room temperature for 5 minutes, then heat-treated at 70°C for 2 minutes, at 95°C for 5 minutes, or stored on ice without heat treatment. The heat-treated mixtures were then transferred to ice, and 4 μL of each mixture was added to the reverse transcription reaction solution (1) and reverse transcription reaction was carried out according to Table 3.

[0046]

[0047]

[0048] (3) Real-time PCR Reaction Using 1 μL of the reaction solution after the reverse transcription reaction, real-time PCR was performed according to the instructions for THUNDERBIRD® Next SYBR® qPCR Mix (manufactured by Toyobo). The sequences of the primer sets used are shown below. The measurement system used was a StepOnePlus manufactured by ThermoFisher Scientific. The obtained Ct values ​​are shown in the table below.

[0049] [For let-7a] Forward primer: CCAGCTGGGTGAGGTAGTAGGTTGT (SEQ ID NO: 3) Reverse primer: CTGGTGCGTGGAGTCGGCAATT (SEQ ID NO: 4) [For let-7d] Forward primer: CCAGCTGGGAGAGGTAGTAGGTTGC (SEQ ID NO: 5) Reverse primer: CTGGTGCGTGGAGTCGGCAATT (SEQ ID NO: 6)

[0050]

[0051] (4) Results As shown in the results above, when the mixture was heat-treated at 95°C for 5 minutes or 70°C for 2 minutes, the Ct values ​​at higher cell counts were smaller than when the mixture was not heat-treated, and Ct values ​​were evenly spaced across cell dilution series A to D. On the other hand, when the mixture was not heat-treated, the Ct values ​​were larger, particularly at higher cell counts (cell dilution series A and B). Specifically, the number of lysed cells differed by 10-fold in cell dilution series A to C, so there should be an interval of about 3 in Ct values. However, when heat treatment was not performed, the interval was narrow, indicating insufficient lysis. Therefore, it can be seen that heat treatment enhances cell lysis ability, enabling appropriate detection of miRNA. Furthermore, for cell dilution series A to C, the difference between the Ct values ​​with and without heat treatment is large, whereas for cell dilution series D, the difference is smaller. This indicates that heat treatment of the mixed solution has a greater effect of reducing the influence of inhibitory substances for cell dilution series A to C than for cell dilution series D.

[0052] Test Example 2. Detection of miRNA from HeLa cells without nucleic acid purification (Study of surfactants) Test Example 1. An experiment similar to Test Example 1 was conducted, except that the composition of the lysis solution described in Table 2 was changed to that shown in Table 5 below. The heat treatment conditions for cell lysis were 70°C for 2 minutes. The obtained Ct values ​​are shown in Tables 6 to 10 below.

[0053]

[0054]

[0055]

[0056]

[0057]

[0058]

[0059] (1) Results As shown in the results above, when the mixture of surfactants containing the nonionic surfactants polyoxyethylene (20) sorbitan monolaurate, poly(oxyethylene) octylphenyl ether, polyoxyethylene (13) oleyl ether, polyoxyethylene lauryl ether, and sucrose fatty acid esters was heat-treated at 70°C for 2 minutes, the Ct values ​​during miRNA detection at a higher cell count were smaller than those without heat treatment, and Ct values ​​were observed at equal intervals between cell dilution series A to D. On the other hand, when heat treatment at 70°C for 2 minutes was not performed, similar Ct values ​​were observed during miRNA detection in cell dilution series A to C, indicating that cell lysis was not achieved. Therefore, it can be seen that heat treatment enhances cell lysis ability, enabling appropriate miRNA detection.

[0060] Test Example 3. Detection of miRNA from HeLa cells without nucleic acid purification (protease study) Test Example 1. The composition of the lysis solution described in Table 2 was changed to that shown in Table 11 below, and an experiment similar to Test Example 1 was carried out. The mixed solution was heat-treated at 70°C for 2 minutes. The obtained Ct values ​​are shown in Table 12 below.

[0061]

[0062]

[0063] (1) Results As shown in the above results, even when pronase was used as a protease, when the mixture was heat-treated at 70°C for 2 minutes, the Ct value during miRNA detection at a higher cell count was smaller than when no heat treatment was performed, and Ct values ​​were observed at equal intervals between cell dilution series A to D. On the other hand, when no heat treatment was performed at 70°C for 2 minutes was performed, similar Ct values ​​were observed during miRNA detection in cell dilution series A to C, indicating that cell lysis was not achieved. Therefore, it can be seen that heat treatment increases cell lysis ability and enables appropriate detection of miRNA.

[0064] Test Example 4. Detection of miRNA from Extracellular Vesicles without Purification of Nucleic Acids 20 ml of HeLa cell culture supernatant was concentrated to 1 ml using Vivaspin 20 (Sartorius), and exosomes were recovered using MagCapture Exosome Isolation Kit PS Ver. 2 (Wako Pure Chemical Industries). 5 μL of the recovered exosome fraction was dissolved using the dissolving solution listed in Table 2 of Test Example 1. The heat treatment conditions for dissolution were 70°C for 2 minutes or no heat treatment, and the same procedure as in Test Example 1 was performed. The results are shown in Table 13.

[0065]

[0066] (1) Results As shown in the above results, even for extracellular vesicles, heat treatment of the mixture (70°C, 2 minutes) resulted in a smaller Ct value and enabled the detection of nucleic acids derived from miRNA compared to the case without heat treatment. Therefore, it can be said that heat treatment of the mixture is effective even when the sample is extracellular vesicles.

Claims

1. A method for detecting miRNA from a biological sample without purifying nucleic acid, comprising step A of heat-treating a mixture of the biological sample and a lysis solution.

2. The method of claim 1, further comprising, prior to step A, step b of incubating the mixture at room temperature.

3. The method according to claim 2, further comprising a step a) of mixing the biological sample with the dissolution solution to obtain the mixture before the step b).

4. The method of claim 1, wherein the biological sample is at least one selected from animal cells, extracellular vesicles, plasma, serum, whole blood, and urine.

5. The method according to claim 4, wherein the extracellular vesicles are at least one selected from exosomes, microvesicles and apoptotic bodies.

6. The method according to claim 1, wherein step A is carried out at a temperature of 60°C or higher and 99°C or lower.

7. The method according to claim 6, wherein step A is carried out for 30 seconds or more and 10 minutes or less.

8. The method according to claim 2, wherein step b is carried out for a period of time of 2 minutes or more and 10 minutes or less.

9. The method according to claim 8, wherein step b is carried out at a temperature of 20°C or higher and 30°C or lower.

10. The method of claim 1, wherein the lysis solution comprises at least one selected from a protease, a chaotropic salt, a detergent, a reducing agent, an RNase inhibitor, and a DNase.

11. The method of claim 10, wherein the protease is at least one selected from proteinase K and pronase.

12. The method of claim 10, wherein the RNase inhibitor is a proteinaceous RNase inhibitor.

13. The method of claim 10, wherein the surfactant is a non-ionic surfactant.

14. The method of claim 10, wherein the reducing agent is at least one selected from dithiothreitol (DTT), tris(carboxyethyl)phosphine (TCEP), N-acetylcysteine, tris(hydroxypropyl)phosphine (THPP), 1-thioglycerol, and β-mercaptoethanol.

15. The method according to claim 1, further comprising, after step A, step B of synthesizing DNA derived from the miRNA by reverse transcription reaction.

16. The method according to claim 15, further comprising step C of amplifying the DNA derived from the miRNA obtained in step B by a nucleic acid amplification reaction and detecting it.

17. The method of claim 16, wherein the nucleic acid amplification reaction is qPCR.

18. A miRNA detection kit for use in the method according to claim 1.

Images