Strontium-emitting 3D printing scaffold for promoting bone cartilage regeneration and method for manufacturing same

A hierarchically structured 3D printed scaffold with strontium-doped bioactive nanoglass addresses the challenges of repairing large cartilage defects by promoting cell migration, immune regulation, and angiogenesis, achieving effective osteochondral regeneration.

WO2025127798A1PCT designated stage expired Publication Date: 2025-06-19DANKOOK UNIV CHEONAN CAMPUS IND ACADEMIC COOP FOUND
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2024/096675
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-12
Filing Date
2024-12-11
Publication Date
2025-06-19

AI Technical Summary

Technical Problem

Current clinical interventions for repairing large cartilage defects are inadequate due to poor graft integration and deposition of fibrotic extracellular matrix, and there is a lack of effective therapies for simultaneous regulation of cartilage and bone repair in osteochondral defects.

Method used

A hierarchically structured 3D printed scaffold reinforced with strontium-doped bioactive nanoglass is developed, which maintains the release of triple ions including strontium, silicate, and calcium to promote cell migration, immune regulation, and angiogenesis, enhancing tissue regeneration and chondrocyte behavior.

Benefits of technology

The scaffold effectively promotes the regeneration of osteochondral defects by enhancing cell engraftment, immune regulation, and angiogenesis, while also exhibiting anti-inflammatory effects and improving the expression of maturation-related genes in chondrocytes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2024096675_19062025_PF_FP_ABST
    Figure KR2024096675_19062025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a strontium-emitting 3D printing scaffold for promoting bone cartilage regeneration and a method for manufacturing same. The scaffold continuously maintains the emission of a triad of ions including strontium (Sr), silicate (Si), and calcium (Ca) to promote cell migration to a damaged site, and has a hierarchical porous structure, and thus enhances tissue regeneration by increasing cell engraftment, immune regulation, and angiogenesis, and exhibits an excellent anti-inflammatory effect. Therefore, the scaffold can be effectively used for the regeneration of damaged bone and cartilage tissue.
Need to check novelty before this filing date? Find Prior Art

Description

Strontium-releasing 3D-printed scaffold for promoting bone cartilage regeneration and its manufacturing method

[0001] The present invention relates to a strontium-releasing 3D printing scaffold for promoting bone cartilage regeneration and a method for manufacturing the same.

[0002] Articular cartilage defects are a prominent clinical challenge in orthopedic surgery and a major cause of disability. These defects arise from a variety of causes, including trauma, inflammation, and aging. The impact is far-reaching, affecting more than 350 million individuals worldwide, regardless of gender, age, or nationality.

[0003] However, the potential for regeneration of damaged cartilage is significantly limited by its avascular nature and distinctive structural characteristics, which include a low density of chondrocytes and a significant proportion of the extracellular matrix, which is composed primarily of type II collagen and proteoglycans. In particular, regeneration of large cartilage defects is very difficult due to the size of the defect exceeding the self-healing capacity of the cartilage tissue and the damage to the subchondral bone tissue.

[0004] Current clinical interventions, including bone marrow stimulation, autologous chondrocyte transplantation, and osteochondral allografts, are often inadequate for restoring large cartilage defects. This inadequacy is often associated with poor graft integration into the host tissues and the deposition of fibrotic extracellular matrix in the regenerated area.

[0005] Given the ability of 3D printing technology to precisely control factors such as size, shape, and structure, it has become a cornerstone for regenerating patient-specific tissue defects in a time- and cost-effective manner. Scaffold-based tissue repair is emerging as a powerful strategy, particularly for addressing large tissue defects. At the tissue level, scaffolds fill the void left by injury, providing physical support, mitigating further damage caused by body movement and providing mechanical reinforcement to damaged tissue. Furthermore, scaffolds can facilitate the migration of host cells to the defect site, providing a supportive environment for their proliferation, maturation, and extracellular matrix remodeling.

[0006] We demonstrated that hierarchically structured 3D-printed scaffolds, unlike unstructured scaffolds, precisely regulate various tissue regeneration processes, including immune responses, angiogenesis, and stem cell homing. The large surface area of ​​these hierarchical structures facilitates the sequestration of growth factors, particularly stromal-derived factor 1 and vascular endothelial growth factor, onto the scaffold surface, thereby promoting stem cell recruitment and new blood vessel formation. Furthermore, the hierarchically structured scaffolds promoted anti-inflammatory responses by reducing neutrophil retention and M1 macrophage polarization. The structural and topological properties of the scaffolds, when combined with soluble signaling molecules such as therapeutic ions, can further promote tissue repair.

[0007] Although strontium (Sr) has been widely used in bone regeneration therapies, research on its potential for cartilage repair has been limited. Furthermore, the therapeutic effects of Sr on simultaneous modulation of cartilage and bone repair in osteochondral defects have not been studied.

[0008] Against this backdrop, the present inventors have conducted extensive studies to develop a hierarchically structured 3D printed scaffold reinforced with strontium-doped bioactive nanoglass to enhance the repair of osteochondral defects, resulting in the development of a scaffold with hierarchical features consisting of i) macropores derived from the layer-by-layer lattice structure of 3D printing, ii) micropores introduced through the pore formation process, and iii) nanotopology imparted by the integration of bioactive nanoglass within the scaffold matrix.

[0009] The scaffold of the present invention was confirmed to promote the migration of host cells to the damaged area by maintaining the release of triple ions including strontium (Sr), silicate (Si), and calcium (Ca) as an innovative system, and the hierarchical structure of the scaffold of the present invention exhibits a synergistic effect with the above ions to promote subsequent cell engraftment, immune regulation, and angiogenesis, thereby enhancing tissue regeneration, and clearly exhibiting a binding effect with Sr ions, Si, and Ca ions that induce the behavior of chondrocytes and bone marrow-derived mesenchymal stem cells (BMSCs), thereby confirming that it is effective in the process of regenerating osteochondral defects, thereby completing the present invention.

[0010] [Prior Art Literature]

[0011] [Patent Document]

[0012] (Patent Document 1) Korean Patent Publication No. KR 10-2012-0114797 (Published: October 17, 2012)

[0013] An object of the present invention is to provide a 3D printing composite scaffold composition comprising a biocompatible polymer and a strontium-doped bioactive nanoglass.

[0014] Another object of the present invention is to provide a 3D printing composite scaffold comprising the composition.

[0015] Another object of the present invention is to provide a pharmaceutical composition for tissue regeneration comprising the 3D printed composite scaffold.

[0016] Another object of the present invention is to provide a method for tissue regeneration, comprising the step of applying the pharmaceutical composition to damaged tissue.

[0017] Another object of the present invention is to provide a method for manufacturing a 3D printing composite scaffold, comprising the steps of: i) preparing a first mixture by dissolving a biocompatible polymer and a pore-forming agent in acetone; ii) preparing a composite by mixing strontium-doped bioactive nanoglass with the first mixture; and iii) forming the composite into a three-dimensional shape by 3D printing.

[0018] The advantages and features of the present invention, and the methods for achieving them, will become clearer with reference to the embodiments described in detail below together with the accompanying drawings. However, the present invention is not limited to the embodiments disclosed below and may be implemented in various different forms. These embodiments are provided solely to ensure that the disclosure of the present invention is complete and to fully inform those skilled in the art of the scope of the present invention, and the present invention is defined solely by the scope of the claims.

[0019] The terminology used herein is for the purpose of describing embodiments only and is not intended to limit the present invention. In this specification, the singular also includes the plural unless specifically stated otherwise. As used herein, the terms "comprises" and / or "comprising" do not exclude the presence or addition of one or more other components in addition to the mentioned components. Like reference numerals refer to like components throughout the specification, and "and / or" includes each and any combination of one or more of the mentioned components. Although "first", "second", etc. are used to describe various components, these components are not limited by these terms. These terms are only used to distinguish one component from another. Therefore, it should be understood that a first component mentioned below may also be a second component within the technical spirit of the present invention.

[0020] Unless otherwise defined, all terms (including technical and scientific terms) used herein may be used in their common sense to those skilled in the art to which the present invention pertains. Furthermore, terms defined in commonly used dictionaries are not to be interpreted ideally or excessively unless explicitly and specifically defined otherwise.

[0021] The present invention provides a 3D printing composite scaffold composition comprising a biocompatible polymer and a strontium-doped bioactive nanoglass.

[0022] The composition of the present invention may additionally include a pore-forming agent.

[0023] The above pore-forming agent may be any one selected from the group consisting of camphene, camphor, naphthalene, menthol, thymol, coumarin, vanillin, salicylic acid, 2-aminopyridine, t-butanol, trichloro-t-butanol, imidazole, dimethylsulfone, urea, and 2-amidopyridine, and preferably camphene.

[0024] The biocompatible polymer of the present invention may be any one selected from the group consisting of polycaprolactone, polylactic acid, polyglycolic acid, polylactic acid-glycolic acid copolymer, polylactic acid-caprolactone copolymer, polyhydroxybutyric acid-hydroxyvaleric acid copolymer, polydioxanone, and polyphosphoester, and preferably polycaprolactone.

[0025] The bioactive nanoglass of the present invention refers to glass nanoparticles capable of inducing a specific biological action within a living tissue, and generally refers to glass nanoparticles composed of inorganic materials.

[0026] The strontium-doped bioactive nanoglass of the present invention refers to a bioactive nanoglass in which strontium ions are loaded on the surface and pores of bioactive glass nanoparticles.

[0027] The element content ratio (weight ratio) of Si: Ca: Sr of the strontium-doped bioactive nanoglass may be 8 to 9:0.5 to 1.5:0.1 to 1.

[0028] Based on the total weight of the composition, the biocompatible polymer may be in an amount of 20 to 40 parts by weight, and the strontium-doped bioactive nanoglass may be in an amount of 30 to 50 parts by weight.

[0029] Based on the total weight of the composition, the pore forming agent may be present in an amount of 20 to 40 parts by weight.

[0030] If the strontium-doped bioactive nanoglass of the present invention is less than 30 parts by weight based on the total weight of the composition, the effect of using the nanoparticles is minimal, and if it is more than 50 parts by weight, a problem of increased viscosity may occur.

[0031] In a specific embodiment of the present invention, 3D printing was performed by including 30 parts by weight of the biocompatible polymer, 40 parts by weight of the strontium-doped bioactive nanoglass, and 30 parts by weight of the pore forming agent based on the total weight of the composition.

[0032] In addition, the present invention provides a 3D printing composite scaffold comprising the above 3D printing composite scaffold composition.

[0033] The scaffold may have a porous structure including macropores between struts and layers, micropores on the surface of the struts, and microchannels inside the struts.

[0034] The strut width may be 150 to 250 μm, and the distance between the struts may be 200 to 300 μm, preferably the strut width may be 181.6 ± 7.0 μm, and the distance between the struts may be 236.9 ± 9.7 μm.

[0035] Scaffolds with pores in the range of 100 to 300 μm efficiently retain chondrocytes, whereas pores smaller than 100 μm do not promote chondrocyte infiltration.

[0036] The scaffold may have a roughness value of 150 to 250 nm Ra, preferably a roughness value of 199.63 ± 21.71 nm Ra.

[0037] The above scaffold has increased surface hydrophilicity, which can enhance cell adhesion. In the present invention, sodium hydroxide (NaOH) can be additionally treated to enhance cell adhesion.

[0038] The above scaffold is Sr 2+ , Si 4+ and Ca 2+ It can continuously release triple ions including , for more than 14 days. The continuous and simultaneous delivery of the triple ions can have a synergistic effect on the regeneration of tissues such as cartilage.

[0039] The above cartilage repair requires a lower Sr dose compared to bone repair, and it was confirmed that the concentration of Sr released from the scaffold of the present invention is within 2.5 to 45.6 μM, which is effective for cartilage repair.

[0040] The above scaffold can increase the expression of maturation-related genes in chondrocytes, and the maturation-related genes in chondrocytes can be, but are not limited to, Sox9, Col2a1 or Acan.

[0041] The scaffolds described above can reduce cellular oxygen consumption, meaning less mitochondrial ATP is produced, suggesting that maturation of chondrocytes requires lower energy requirements.

[0042] The above scaffold can increase the expression of genes involved in regulating the composition and stability of the extracellular matrix (ECM), and the genes involved in regulating the composition and stability of the extracellular matrix (ECM) can be, but are not limited to, Col2a1, Matn3, Col9a1, or Col11a1.

[0043] The above scaffold may have increased anti-inflammatory effects by promoting M2 polarization of macrophages.

[0044] In a specific embodiment of the present invention, after the scaffold is transplanted into the rat subcutaneous tissue, iNOS is expressed at the transplant site. + We observed a significantly smaller M1 macrophage population and a higher number of Arg1 + The presence of M2 macrophages was confirmed.

[0045] The above scaffold can increase angiogenic response.

[0046] In one specific embodiment of the present invention, it was confirmed that the scaffold promoted bone regeneration through enhanced angiogenic response in rat subcutaneous tissue.

[0047] The scaffold can increase tissue regeneration, and the tissue can be one or more selected from tissues including cartilage, bone, skin, skeletal muscle, muscle tissue, cardiac tissue, cardiac muscle, and neovascularization, preferably, but not limited to, cartilage tissue.

[0048] In addition, the present invention provides a pharmaceutical composition for tissue regeneration comprising the 3D printing composite scaffold.

[0049] The regeneration of the present invention generally refers to the process of regenerating a damaged or lost tissue or organ in a living organism to restore it to its original state or restore its function. Given the nature of the present invention, the regeneration may encompass all processes for restoring damaged or lost cartilage tissue to its original state or restoring its function.

[0050] The pharmaceutical composition of the present invention can be used as a single preparation, or can be manufactured and used as a combination preparation by additionally including a drug known to have a recognized tissue regeneration effect.

[0051] The pharmaceutical composition of the present invention can be administered as an individual therapeutic agent or in combination with other therapeutic agents, and can be administered sequentially or simultaneously with conventional therapeutic agents. It can be administered singly or in multiple doses. Taking all of the above factors into account, it is important to administer the amount that achieves maximum effect with the minimum amount possible without causing side effects, a determination readily made by those skilled in the art.

[0052] The above administration means introducing the pharmaceutical composition of the present invention into a patient by any appropriate method, and the route of administration of the composition of the present invention may be administered through various routes, such as oral or parenteral, as long as it can reach the target tissue, and is not limited thereto, but may be administered through a parenteral route due to the nature of the present invention, and specifically, may be administered directly to or near a site of bone tissue that is damaged or has lost function.

[0053] The dosage of the composition of the present invention may vary depending on the number of cells, the size of the scaffold, and the degree of tissue damage, and may be appropriately selected by a person skilled in the art.

[0054] The frequency of administration of the composition of the present invention is not particularly limited, but may be administered once or additionally over time, or may be administered in divided doses several times.

[0055] The present invention also provides a method for tissue regeneration, comprising the step of applying the pharmaceutical composition to damaged tissue of an individual.

[0056] The subject of the present invention refers to a subject requiring treatment of damaged tissue, and more specifically, may be a mammal such as a human or non-human primate, mouse, rat, dog, cat, horse, or cow, but is not limited thereto.

[0057] Application of the present invention means providing a given composition of the present invention to a subject by any suitable method.

[0058] In addition, the present invention provides a method for manufacturing the 3D printing composite scaffold.

[0059] The above manufacturing method may include the following steps: i) preparing a first mixture by dissolving a biocompatible polymer and a pore-forming agent in acetone; ii) preparing a composite by mixing strontium-doped bioactive nanoglass with the first mixture; and iii) forming the composite into a three-dimensional shape by 3D printing.

[0060] The above iii) molding step may be to insert the complex into a 3D printer, melt it at 40 to 60°C, pressurize it, extrude it through a nozzle into an ethanol bath, and mold it while laminating it.

[0061] The above ethanol concentration may be 40 to 70 v / v%, and preferably 60 v / v%. If the ethanol concentration is less than 40 v / v%, a problem of significantly lowered mechanical stability may occur, and if it exceeds 70 v / v%, pore formation may be difficult.

[0062] In a specific embodiment of the present invention, it was confirmed that the porosity and pore size of the scaffold can be effectively controlled when the ethanol is 60 v / v%.

[0063] In a specific embodiment of the present invention, it was confirmed that scaffolds with clear macro- and microporous structures were generated by 3D printing with a composite solution comprising 40% (w / w) bioactive nanoglass, 30% (w / v) PCL and 30% (w / v) camphene in a 60% (v / v) ethanol bath.

[0064] The present invention provides a strontium-releasing 3D printing scaffold for promoting bone cartilage regeneration and a method for manufacturing the same, wherein the scaffold continuously maintains the release of triple ions including strontium (Sr), silicate (Si) and calcium (Ca) to promote cell migration to a damaged area, has a hierarchical porous structure to increase cell engraftment, immune regulation and angiogenesis, thereby enhancing tissue regeneration, and has an excellent anti-inflammatory effect, so that it can be usefully used for the regeneration of damaged bone cartilage tissue.

[0065] Figure 1 is a diagram showing the fabrication and characterization of a hierarchically structured 3D printed scaffold composed of strontium-doped bioactive nanoglass, Figure 1a is a schematic diagram of a composite scaffold referred to as SrBGn-μCh, Figure 1b is a diagram showing representative FE-SEM images of SrBGn and BGn (scale bar = 300 nm), Figure 1c is a diagram showing the physical properties of SrBGn and BGn, Figure 1d is a diagram showing EDS analysis measuring the elemental ratio of SrBGn and BGn, Figure 1e is a diagram showing FE-SEM images showing the hierarchical structure of scaffolds of various sizes with cross-sections showing interconnected microchannels, Figure 1f is a diagram showing the topology (top) and 3D projection image (bottom) of SrBGn-μCh measured by AFM, and Figure 1g is a diagram showing the surface roughness of SrBGn-μCh and BGn-μCh. Figure 1h shows the quantification (n = 4 scaffolds), and Figure 1h shows the measurement of the water contact angle of the scaffolds before and after sodium hydroxide (NaOH) treatment (n = 4 scaffolds / condition) (Data represent mean ± sd of n and are representative of at least three independent experiments, **p< 0.01 and ***p< 0.001; one-way ANOVA followed by Tukey's post-hoc test).

[0066] Figure 2 is a diagram showing Sr substitution of bioactive nanoglass enabling triple ion release including Sr, Si and Ca ions and accelerating cell-free biomineralization of the surface, Figure 2a is a diagram showing core-level XPS spectra of Si 2p, Ca 2p and Sr 3d for composite or non-composite scaffolds, Figure 2b is a diagram showing the release profiles of Si, Ca and Sr ions from scaffolds for 14 days under physiological conditions (n ​​= 3 scaffolds / group), Figure 2c is a diagram showing FE-SEM images (scale bar = 40 μm for main, 4 μm for insert) showing hydroxyapatite formation on the scaffold surface at 1 and 14 days after biomineralization, Figure 2d is a diagram showing EDX spectra showing an increase in the intensity of calcium and phosphorus peaks over time due to biomineralization, Figure 2e is a diagram showing calcium and phosphorus peaks based on Figure 2d. This diagram shows the sum of the peak intensities.

[0067] Figure 3 is a diagram showing the triple ion release of SrBGn-μCh that enhances chondrocyte activity in vitro, Figure 3a is a schematic diagram showing indirect chondrocyte culture using a scaffold using insert wells, Figure 3b is a diagram showing representative images visualizing cell viability and proliferation using Live / Dead (L / D, green / red) assay and F-actin (green) staining (scale bar = 200 μm, nuclei are stained with DAPI (blue)), Figure 3c is a diagram showing the cell spread area measured on day 1 after culture with the extract (n = 25 cells / group), Figure 3d is a diagram showing the cell viability evaluated using the CCK-8 assay (n = 3 replicates / condition), Figure 3e is a diagram showing the expression levels of mature chondrocyte-specific genes including Sox9, Acan, and Col2a1 after 7 days of culture with the extract (n = 3 replicates / condition), Figure 3f shows Alcian blue staining (left) (scale bar = 5 mm) and quantification of staining density (n = 3 scaffolds / group) on day 7 of culture, Figure 3g shows scratch-based migration assay (scale bar = 500 μm) (left) of chondrocytes treated with various concentrations of SrCl2 or SrBGn-μCh extracts for 18 h and the closure rate at 18 h was calculated (right) compared to the initial open area at 0 h (n = 3 fields / condition), Figure 3h shows oxygen consumption rate (OCR) analysis of chondrocytes treated with μCh, SrBG-μCh or SrCl2 extract, and Figure 3i shows statistical analysis (n = 18 replicates / condition) of basal respiration, ATP-coupled production levels, maximal OCR and reserve respiratory capacity levels (not significant, *p<0.05, **p<0.01, ***p< 0.001, ****p< 0.0001; one-way ANOVA followed by Tukey's post hoc test).

[0068] Figure 4 is a diagram showing strontium ions released from SrBG-μCh that contribute to cartilage repair by changing the transcriptome level of chondrocytes, Figure 4a is a diagram showing a heatmap showing the expression level of total differentially expressed genes (DEGs; fold change ≥ 1.5), Figure 4b is a diagram showing a DEG Venn diagram showing the number of up-regulated (red), down-regulated (blue), and counter-regulated (green) genes in each comparison group, Figure 4c is a diagram showing gene ontology (GO) analysis (BP; biological process, CC; cellular component, MF; molecular function) of up-regulated DEGs in the SrBGn-μCh group compared to the BGn-μCh group, and Figure 4d is a diagram showing the expression of DEGs related to cartilage development (top, GO: 0051216), ECM organization (middle, GO: 0030198), and mitochondrial matrix (bottom, GO: 0005759). Figure 4e is a diagram showing relative gene expression levels, Figure 4e is a diagram showing gene set enrichment analysis (GSEA) showing enrichment of genes in the Notch signaling pathway within the SrBGn-μCh group compared to the other groups (BGn-μCh and μCh), Figure 4f is a diagram showing relative gene expression levels of annotated gene sets within the Notch signaling pathway, Figure 4g is a diagram showing GSEA showing enrichment of genes related to cell adhesion molecules (CAMs) in the SrBGn-μCh group compared to the BGn-μCh group, and Figure 4h is a diagram showing the corresponding protein-protein interaction network of CAMs along with gene expression levels.

[0069] Figure 5 is a diagram showing the nanotopology signal of SrBGn in addition to the combined effect of trivalent ions that further enhances chondrocyte adhesion and subsequent proliferation and maturation, Figure 5a is a diagram showing a schematic of direct chondrocyte culture on scaffolds, Figure 5b is a diagram showing a representative CLSM image (scale bar = 200 μm) showing chondrocyte proliferation stained with F-actin (green) and nuclei (blue), Figure 5c is a diagram showing a reverse fluorescence image (scale bar = 25 μm) showing the morphology of chondrocytes (black) on the scaffold on day 1 of culture, Figure 5d is a diagram showing the initial cell attachment number (left) and cell spreading area (right) (n = 4 struts) on day 1 of culture, and Figure 5e is a representative image of F-actin staining (red) showing cell attachment and distribution on the scaffold surface on day 7 of culture (scale bar = 100 μm), Fig. 5f is a diagram showing the chondrocyte proliferation profile (n = 4 scaffolds / condition) for 7 days, and Fig. 5g is a diagram showing Alcian blue staining (left) (scale bar = 2.5 mm) and quantified staining density (right) (n = 9 struts) on day 7 after maturation (**p< 0.01, ***p< 0.001, ****p< 0.0001; one-way ANOVA followed by Tukey's post-hoc test).

[0070] Figure 6 is a diagram showing a composite scaffold that increases proliferation, migration, and osteogenic differentiation of BMSCs. Figure 6a is a representative image (scale bar = 200 μm) visualizing cell viability and proliferation using Live / Dead (L / D, green / red) assay and F-actin (green) staining, respectively (nuclei are stained with DAPI (blue)). Figure 6b is a diagram showing quantification of cell viability based on Live / Dead assay (n = 3 replicates / condition). Figure 6c is a diagram showing cell spread area measured 1 day after culture with extracts (n = 25 cells / group). Figure 6d is a scratch-based migration assay (n = 3 fields / condition, scale bar = 500 μm) of BMSCs treated with μCh, BGn-μCh, and SrBGn-μCh extracts for 18 h (top) and the calculated closure rate compared to the initial open area at 0 h. (bottom), Fig. 6e is a diagram showing the relative expression levels (n = 3 replicates / condition) of osteogenic markers including Runx2, Alp, Col1a1, and Opn in BMSCs after 7 days of osteogenic differentiation by treating scaffold extracts, Fig. 6f is a diagram showing ALP (blue) and ARS (red) staining (scale bar = 8 mm) on days 7 and 21 after osteogenic differentiation by scaffold extracts, Fig. 6g is a diagram showing representative CLSM images (scale bar = 200 μm) showing BMSC proliferation on scaffolds stained for F-actin (green) and nuclei (blue), Fig. 6h is a diagram showing the relative cell expansion profile (n = 3 fields / condition) based on the fluorescence intensity of F-actin shown in Fig. 6g, and Fig. 6i is a diagram showing the initial cell proliferation on day 1 of direct culture on scaffolds. The figure shows the number of adhesions and the area of ​​diffusion (n = 4 fields / group) (*p< 0.05, **p< 0.01, ***p< 0.001, ****p< 0.0001; one-way ANOVA followed by Tukey's post-hoc test).

[0071] Figure 7 is a diagram showing SrBG-μCh accelerating cartilage and bone regeneration in an osteochondral defect model, Figure 7a is a diagram showing the gross appearance for cartilage repair evaluation, Figure 7b is a diagram showing H&E, Masson's trichrome (MT), Safranin O, and type II collagen staining images (scale bar = 1 mm for 4X, 40 μm for 40X) showing the quality of regenerated cartilage at 20 weeks after transplantation, Figure 7c is a diagram showing the positive staining area of ​​total collagen by MT staining and quantitative analysis of type II collagen by immunostaining, Figure 7d is a diagram showing cell morphology analysis evaluating cell circularity (n = 11 cells from 4 animals) and cell clustering (n = 6 fields from 4 animals), and Figure 7e is a diagram showing cell morphology analysis evaluating cell circularity (n = 11 cells from 4 animals) and cell clustering (n = 6 fields from 4 animals) in a defect at 10 weeks after transplantation. Micro-CT image (left) showing regenerated subchondral bone (areas of newly formed bone tissue are highlighted in red) and bone volume / tissue volume (BV / TV) analysis (right) quantifying the extent of regeneration (n = 5 animals) (**p< 0.01, ***p< 0.001, ****p< 0.0001; one-way ANOVA followed by Tukey's post hoc test).

[0072] Figure 8 is a schematic diagram showing how SrBGn-μCh improves osteochondral defect repair.

[0073] FIG. 9 is a diagram showing the effect of Sr substitution for Ca in SrBGn, FIG. 9a is a diagram showing EDS spectra of SrBGn and BGn, FIG. 9b is a diagram showing the contents of Si, Ca, and Sr elements measured in bioactive nanoglass (ND; not detected), and FIG. 9c is a diagram showing XRD patterns of SrBGn and BGn.

[0074] Figure 10 is a diagram showing the optimization for manufacturing 3D printing scaffolds, Figure 10a is a diagram showing FE-SEM images of scaffolds manufactured with various concentrations of camphene in the printing solution and ethanol concentration in the bath (scale bar = 40 μm), Figure 10b is a diagram showing FT-IR spectra of camphene, PCL and μCh, Figure 10c is a diagram showing FE-SEM images showing scaffolds manufactured with concentrations of bioactive nanoglass ranging from 10% to 60% (w / w) in the printing solution (scale bar = 400 μm for low magnification, 40 μm for high magnification), Figure 10d is a diagram showing composite scaffolds containing 40% (w / w) bioactive nanoglass, 30% (w / v) PCL and 30% (w / v) camphene in a 60% (v / v) ethanol bath. Figure 10e shows the porosity of 3D printed scaffolds (n = 3 scaffolds) using solutions (nonporous PCL scaffold; PCL, porous PCL scaffold; μCh and SrBGn composite porous PCL scaffold; Sr-BGn-μCh), and Figure 10e shows FE-SEM images (scale bar = 40 μm) showing scaffolds treated with various concentrations of NaOH for 1 h at 37 °C (**p < 0.01 and ****p < 0.0001; one-way ANOVA followed by Tukey's post-hoc test).

[0075] Figure 11 is a diagram showing the surface morphology and topology of a hierarchically structured 3D printed scaffold, Figure 11a is a top view and cross-section of an FE-SEM image showing micropores on the surface of the scaffold and interconnected microchannels within the struts, and Figure 11b is a diagram showing the topology (top) and 3D projection image (bottom) of the scaffold measured by AFM.

[0076] Figure 12 is a diagram showing the chemical surface properties of 3D printed scaffolds, Figure 12a is a diagram showing XPS survey spectra of μCh, BGn-μCh and SrBGn-μCh, and Figure 12b is a diagram showing FE-SEM images showing hydroxyapatite formation in scaffolds (nonporous PCL scaffold (PCL), porous / noncomposite PCL scaffold (μCh) and composite scaffolds (BGn-μCh and SrBGn-μCh)) after acellular biomineralization in simulated body fluid (SBF) for 14 days.

[0077] Figure 13 shows that Sr ions alone accelerate chondrocyte migration without affecting chondrocyte proliferation and maturation, Figure 13a shows a Live / Dead assay (scale bar = 500 μm) visualizing cell viability and proliferation, Figure 13b shows a quantification of chondrocyte proliferation using the CCK-8 assay (n = 6 replicates / condition), Figure 13c shows a scratch-based migration assay (n = 3 replicates / condition, scale bar = 500 μm) of chondrocytes treated with various concentrations of SrCl2 or SrBGn-μCh extract for 18 h, Figure 13d shows the measured closure rate compared to the initial open area at 0 h, and Figure 13e shows the expression levels of mature chondrocyte-specific genes including Sox9, Col2a1, and Acan after culturing with SrCl2 for 7 days (n = 6 replicates / condition). (GM; growth medium, MM; maturation medium. ns; not significant, *p<0.05 and **p<0.01; one-way ANOVA followed by Tukey's post-hoc test).

[0078] Figure 14 is a diagram showing the cellular respiration capacity of chondrocytes treated with scaffold extracts, Figure 14a is a diagram showing the oxygen consumption rate analysis of chondrocytes treated with μCh or BGn-μCh extracts, Figure 14b is a diagram showing the statistical analysis (n = 12 replicates / condition) for basal respiration, ATP-coupled production level, maximal OCR, and spare respiratory capacity level, and Figure 14c is a diagram showing the relative gene expression level (GO: 0034599) of DEGs related to cellular response to oxidative stress (BGn; BGn-μCh and SrBGn; SrBGn-μCh).

[0079] Figure 15 is a heatmap showing the relative gene expression levels of DEGs, Figure 15a is a diagram showing cell response to TGF-β stimulation (GO:0071560), and Figure 15b is a diagram showing cell adhesion (GO: GO:0007155).

[0080] Figure 16 is a diagram showing that in vivo subcutaneous implantation of composite scaffolds modulates macrophage polarization and angiogenesis, Figure 16a is a diagram showing staining images of histological analysis of H&E staining and immunohistochemical staining for iNOS and Arg1 at 2 and 4 weeks after implantation (scale bar = 100 μm), Figure 16b is a diagram showing the quantification of staining density for iNOS (n = 86 fields from 4 animals) and Arg1 (n = 316 fields from 4 animals), Figure 16c is a diagram showing the M1 to M2 ratio calculated based on the ratio of iNOS and Arg1 positive cells, Figure 16d is a diagram showing representative images of immunohistochemical staining for CD31 (scale bar = 100 μm), Figure 13e is a diagram showing the quantification of staining density based on Figure 13d (n = 86 fields from 4 animals). 20 fields) (*p< 0.05, **p< 0.01, ***p< 0.001, ****p< 0.0001; one-way ANOVA followed by Tukey's post-hoc test).

[0081] Figure 17 shows representative micro-CT images of subchondral bone regenerated from the defect 10 and 20 weeks after transplantation.

[0082] Hereinafter, the present invention will be described in more detail through the following examples and experimental examples. However, the scope of the present invention is not limited to the following examples and experimental examples, but includes modifications of technical concepts equivalent thereto.

[0083] Example 1. Preparation of bioactive nanoglass

[0084] Hexadecyltrimethylammonium bromide (H5882, Sigma-Aldrich, USA) (1 g) was dissolved in a mixture of distilled water (DW) (140 mL), ammonium hydroxide solution (221228, Sigma-Aldrich, USA) (2 mL), 2-methoxyethanol (E0398, Samchun, South Korea) (40 mL), and ethyl alcohol (4023-4100, Daejung, South Korea) (20 mL). Then, calcium nitrate tetrahydrate (237124, Sigma-Aldrich, USA) and strontium nitrate (31633, Sigma-Aldrich, USA) were added and stirred at room temperature for 30 minutes.

[0085] Subsequently, tetraethyl orthosilicate (131903, Sigma-Aldrich, USA) was added dropwise to the mixture. After 4 h of reaction, the white precipitated powder was collected, washed with deionized water and ethanol, dried at 60 °C for 24 h, and then calcined at 550 °C for 8 h. The phase of the sample was identified by X-ray diffraction (XRD, Rigaku, Ultima IV, Japan) analysis performed using Cu-Ka radiation at 40 mA and 40 kV using a step size of 0.02 ° and a scanning speed of 2.0 ° / min.

[0086] Example 2. Fabrication of 3D-printed scaffolds

[0087] Polycaprolactone (PCL, MW 80 kDa, 440744, Sigma-Aldrich, USA) and camphene (456055, Sigma-Aldrich, USA) were dissolved in acetone (Daejung, South Korea). The PCL concentration was 30% (w / v), and the PCL / camphene ratio was 1:1 (w / w). Bioactive nanoglasses at various concentrations (3%, 6%, 9%, 12%, 18%, and 27% (w / v)) were mixed with the PCL / camphene solutions.

[0088] Before 3D printing, the mixture was ball-milled at 50°C for 24 h. Scaffolds were 3D printed using a robotic casting machine (Ez-ROBO3, Iwashita, Japan). The mixture was loaded into a syringe equipped with a heating jacket (50°C) and extruded into an ethanol / DW bath at a rate of 5 mm / sec through a 330 mm nozzle using pneumatic pressure. The resulting lattice structure had dimensions of 8 mm in width and 2 mm in height and consisted of 12 vertical layers. After printing, the scaffolds were freeze-dried overnight to remove camphene. Before cell culture, the scaffolds were treated with 1 M sodium hydroxide (221465, Sigma-Aldrich, USA) at 37°C for 1 h.

[0089] Example 3. Characterization of 3D-printed scaffolds

[0090] The surface morphology and elemental composition of the scaffolds were observed using a field emission scanning electron microscope (FE-SEM, Sigma 300, Carl Zeiss, Germany) equipped with energy-dispersive spectroscopy (EDS, XFlash Detector 6, BRUKER, Germany). The chemical composition of the scaffolds was analyzed by Fourier transform infrared spectroscopy (FT-IR; 640-IR, Varian, Australia) and X-ray photoelectron spectroscopy (XPS, K-alpha, Thermo Fisher Scientific, USA).

[0091] The porosity of the scaffolds was measured using a mercury intrusion porosimetry system (Autoore IV 9500, Micromeritics, USA). To evaluate the ion release profiles of the scaffolds, they were immersed in Dulbecco's modified eagle's medium (DMEM, LM 001-05, Welgene, South Korea) and cultured at 37°C for 14 days.

[0092] The amounts of ions, including Sr, Si, and Ca, were quantified using an ICP-atomic emission spectrometer (OPTIMA 8300, Perkin-Elmer, USA). The surface roughness of the scaffolds was analyzed using atomic force microscopy (AFM, SPM-9700, Shimadzu, Japan).

[0093] Example 4. Acellular biomineralization of scaffolds using simulated body fluids

[0094] The apatite-forming capacity of the scaffolds was evaluated in simulated body fluid (SBF, Sigma-Aldrich, USA). For acellular mineralization, the scaffolds were immersed in SBF and cultured at 37°C for 14 days. The SBF solution was replaced every 3 days.

[0095] After the scaffolds were thoroughly washed with DW and dried, the apatite formation on the scaffolds was analyzed using FE-SEM equipped with EDS.

[0096] Example 5. Isolation and culture of rat bone BMSCs and chondrocytes

[0097] BMSCs and chondrocytes were obtained from rats and used for up to passage 10. Rat BMSCs were isolated from the femur. After euthanasia, the rat femurs were harvested, disinfected with 70% (v / v) ethanol, and thoroughly rinsed with Hanks' balanced salt solution (HBSS, LB 003-02, Welgene, South Korea).

[0098] After removing the femoral end, the bone marrow was washed with MEM Alpha (α-MEM, SH30265.01, Cytiva, USA) medium and filtered through a 70 μm cell strainer (93070, SPL, South Korea). Cells obtained from the bone marrow were cultured in 10% (v / v) fetal bovine serum (FBS, 35-015-CV, Corning, USA) and 1% (v / v) penicillin / streptomycin (P / S, Thermo Fisher Scientific, USA).

[0099] Rat chondrocytes were isolated from ribs. The intercostal space between the ribs on each side of the sternum was incised to obtain the ribs. The excised ribs were placed in HBSS containing 10% (v / v) phosphate-buffered saline (P / S), and the cartilage tissue was excised and separated as completely as possible from muscle and bone tissue. The cartilage tissue was incubated with trypsin-EDTA (25200-056, Thermo Fisher Scientific, USA) at room temperature for 1 hour and then centrifuged to remove excess connective tissue.

[0100] Afterwards, the cartilage tissue was cultured with 0.2% (w / v) collagenase type 2 (LS004176, Worthington Biochemical Corporation, USA) at room temperature for 12 h. After enzymatic digestion, the lysate was filtered through a 70 μm cell strainer and centrifuged to obtain chondrocytes. The isolated chondrocytes were cultured in DMEM containing 10% (v / v) FBS and 1% (v / v) P / S. The cells were cultured in a humidified atmosphere of 37°C with 5% CO2, and the medium was changed every 2 days.

[0101] Example 6. Preparation of scaffold extract

[0102] 3D-printed scaffolds were sterilized by ethylene oxide (EO) gas treatment and cultured in DMEM (1 mL per scaffold) containing 1% (v / v) P / S at 37°C with gentle shaking at 60 rpm. After 24 h of incubation, the supernatant was collected, centrifuged at 10,000 rpm for 2 min, and filtered using a 0.22 μm pore syringe filter.

[0103] For further in vitro studies, FBS was added to the extract at a concentration of 10% (v / v). For long-term differentiation studies lasting 14 days, scaffolds were inserted into the same wells seeded with cells using transwells with pores of 8 μm in diameter and cultured with the cells throughout the differentiation period.

[0104] Example 7. Evaluation of cell proliferation and migration after scaffold extract treatment

[0105] For proliferation assays, BMSCs and chondrocytes were seeded at 5 x 10 in 96-well plates, respectively. 3 and 1 x 10 4 Cells were seeded at a density of 10 cells / well. After seeding the cells for 24 h, the extracts were treated and cultured for 1, 3, and 7 days. Afterwards, the cells were washed with phosphate buffer solution (PBS, BPB-9121-004LR, Tech and Innovation, South Korea) and treated with medium containing the Cell Counting Kit-8 reagent (CCK-8, CK04-20, Dojindo, Japan).

[0106] After incubation at 37°C for 2 h, the absorbance was measured at 450 nm using a microplate reader (Varioskan LUX, Thermo Fisher Scientific, USA). The total DNA amount was determined using Quant-iT TMQuantification was performed using the PicoGreen dsDNA assay kit (Invitrogen, USA). Cells were stained for 20 min using the Ethidium Homodimer-1 kit (E1169, Thermo Fisher Scientific, USA), and then imaged using a confocal laser scanning microscope (Zeiss LSM 700, Carl Zeiss, Germany) to perform a live / dead assay.

[0107] For cell adhesion analysis, the number of attached cells was counted using DAPI staining, and spreading was calculated based on the area stained with F-actin using Image J software. To evaluate the migratory ability, a scratch-based migration assay was performed. Briefly, BMSCs and chondrocytes were seeded at 5 x 10 in a 96-well plate. 4 Cells were seeded at a density of 10 cells / well. After seeding the cells for 24 hours, they were scraped to form a straight line, and then the extract or strontium chloride was added. Cell migration was performed using JuLI TM Images were taken at 0, 4, 12, and 18 h using Stage (NanoEnTeK, South Korea).

[0108] Example 8. Cell culture on 3D printed scaffolds

[0109] After sterilization by EO gas treatment, the scaffolds were immersed in 70% (v / v) ethanol and sonicated for 10 min to remove trapped air bubbles. After a series of washes with DW and cell culture medium, rat chondrocytes (3 × 10 4 cells) or BMSC (5 × 10 4A cell suspension (200 μL) containing cells was added drop-by-drop to each scaffold (5 mm in diameter and 1.5 mm in height) in a 96-well plate.

[0110] After seeding for 6 h, the scaffolds were transferred to 48-well plates with additional medium (500 μL) and cultured for 1, 3, and 7 days. After the specified culture periods, the scaffolds were fixed with 4% (v / v) paraformaldehyde (PFA, BPP-9004, Tech & Innovation, South Korea) and stained with Alexa Fluor™488 Phalloidin (Invitrogen, USA) and 4',6-diamidino-2'-phenylindole dihydrochloride (DAPI). Cell morphology was examined using confocal laser scanning microscopy (Zeiss LSM 700, Carl Zeiss, Germany).

[0111] Example 9. Osteogenic differentiation of BMSCs

[0112] BMSCs were seeded at 1 x 10 in a 24-well plate. 5 Cells were seeded at a density of 10 cells / well. Twenty-four hours after cell seeding, the medium was replaced with osteogenic differentiation medium containing α-MEM supplemented with 10% (v / v) FBS, 1% (v / v) P / S, 10 mM β-glycerophosphate (Sigma-Aldrich, USA), 10 nM dexamethasone (Sigma-Aldrich, USA), and 50 μg / mL L-ascorbic acid (Sigma-Aldrich, USA). Scaffolds were inserted into the same wells in which cells were seeded using transwells with 8 μm diameter pores.

[0113] After 7 days of differentiation, cells were fixed with 4% (v / v) PFA and stained with NBT / BCIP solution (Sigma-Aldrich, USA) at 37°C for 1 h. On day 21, fixed cells were stained with Lizard Red S solution (ARS, A5533, Sigma-Aldrich, USA) (40 mM, pH 4.2) for 10 min at room temperature. Images were captured using a scanner (V300, EPSON, Japan).

[0114] Osteogenesis-related gene expression was assessed using real-time polymerase chain reaction (qRT-PCR). Total RNA was extracted using Direct-zol RNA Microprep Kits (ZYMO RESEARCH, USA) and reverse transcribed using AccuPower®RT PreMix (Bioneer, South Korea).

[0115] qRT-PCR was performed using Fast SYBR green master mix (QT605-05, Meridian Bioscience, USA) and StepOne TM The assay was performed using a device (Applied Biosystem, USA). Relative gene expression levels were quantified using the ΔΔ Ct method and normalized to the endogenous housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (Gapdh). Detailed primer sequences are listed in Table 1 below.

[0116] GeneSequence ('5-3')GapdhF: GCAGAAGGAGATTACTGCCCTR: GCTGATCCACATCTGCTGGAARunx2F: GACCGACACAGCCATATAAAR: TCCCTAACCTGAAACCAAAGAlpF: CTCTGCCGTTGTTTCTCTATR: AGGTGCTTTGGGAATCTGCol1F: CTGGTACATCAGCCCAAACR: GAACCTTCGCTTCCATACTCOpnF: CGCTTCTGTTCTTTCTGTGR: TTGCTGTTCCTGTAAGTTTGSox9F: AGAGCGTTGCTCGGAACTGTR: TCCTGGACCGAAACTGGTAAACol2a1F: GGCTCCCAGAACATCACCTAR: GCCCTCATCTCCACATCATTAcanF: CCCTACCCTTGCTTCTCCAR: CTTGAGAGGCACTCATCAATGT

[0117] Example 10. Evaluation of chondrocyte maturation

[0118] To assess chondrocyte maturation, chondrocytes were treated with extracts or seeded directly onto scaffolds. They were then cultured in maturation medium (DMEM) containing 10% (v / v) FBS, 1% (v / v) P / S, 1% (v / v) insulin-transferrin-selenium (41400045, Thermo Fisher Scientific, USA), 50 μg / mL L-ascorbic acid, 10 nM dexamethasone (Sigma-Aldrich, USA), and 10 ng / mL TGF-β (100-21C, Peprotech, USA).

[0119] After 7 days of maturation, cells were stained with 0.5% (v / v) alcian blue (A3157, Sigma-Aldrich, USA) in 0.1 N hydroxychloride for 12 h. Chondrocyte-specific gene expression was quantified by qRT-PCR according to the same procedure described above. Detailed primer sequences are described in Table 1.

[0120] Example 11. Evaluation of respiration of chondrocytes

[0121] To evaluate the respiration of chondrocytes, oxygen consumption rate (OCR) was measured using an XFe96 extracellular flux analyzer (Agilent Technologies, Santa Clara, USA). Rat chondrocytes were seeded at 7 × 10 in a Seahorse XF96 cell culture microplate (Agilent, USA). 3 Inoculated at a density of 10 cells / well.

[0122] Six hours after cell seeding, the medium was replaced with scaffold extract containing 10% (v / v) FBS, 1% (v / v) PS, 1% (v / v) insulin-transferrin-selenium, 50 μg / mL L-ascorbic acid, 10 nM dexamethasone, and 10 ng / mL TGF-β. The next day, cells were replaced with fresh extract medium and cultured for an additional 72 hours.

[0123] The medium was replaced with Seahorse XF medium (180 μL / well, 103575-100, Agilent, USA), and the cells were cultured in a CO2-free incubator at 37 °C for 1 h and then placed into a Seahorse XFe96 analyzer. For OCR measurement, the cells were treated with 2.5 μM oligomycin (O4876, Sigma-Aldrich, USA), 1 μM CCCP (C2759, Sigma-Aldrich, USA), 0.5 μM rotenone (R8875, Sigma-Aldrich, USA), and antimycin A (A8674, Sigma-Aldrich, USA) for 20, 40, and 60 min, respectively, and measured. All OCR and ECAR data were normalized to cell number per well using Pierce™BCA Protein Assay (23225, Thermo Fisher Scientific, USA).

[0124] Example 12. Bulk RNA sequence analysis

[0125] To evaluate the ionic effects of the scaffold on transcriptome modification, chondrocytes were treated with extracts and cultured in maturation medium. After 7 days of maturation, total RNA was extracted using Direct-zol RNA Microprep Kits (ZYMO RESEARCH, USA). Subsequently, quantitative sequencing was performed at E-biogen Inc. (South Korea). Briefly, libraries were constructed for both control and test sample RNA using the QuantSeq 3' mRNA-Seq Library Prep Kit (Lexogen, Inc., Austria) according to the manufacturer's protocol.

[0126] An oligo-dT primer containing an Illumina-compatible sequence at the 5' end was used for RNA hybridization (500 ng of total RNA per condition). Reverse transcription was then performed. After digestion of the RNA template, double-strand synthesis was initiated using a random primer containing an Illumina-compatible linker sequence at the 5' end. The resulting double-stranded library was purified using magnetic beads to effectively remove all reaction components.

[0127] The library was then amplified and clustered to generate complete adapter sequences. The final library was purified from the PCR components. For high-throughput sequencing, a single-end 75-base sequencing approach was used, utilizing the NextSeq 500 platform (Illumina, Inc., USA).

[0128] The resulting reads were aligned using Bowtie2. Coverage analysis using Bedtools was used to identify unique and differentially expressed genes in multiple pairs. Read count data were processed in R using the TMM+CPM normalization method as implemented by EdgeR via Bioconductor. Gene classification was performed based on searches of DAVID (http: / / david.abcc.ncifcrf.gov / ) and Medline databases (http: / / www.ncbi.nlm.nih.gov / ).

[0129] Example 13. In vivo subcutaneous implantation of scaffolds

[0130] The animal protocol was approved by the Institutional Animal Care and Use Committee (IACUC) of Dankook University. Scaffolds (μCh, BGn-μCh, and SrBGn-μCh) were implanted subcutaneously into male Sprague-Dawley rats (8-week-old). Briefly, the surgical procedure was performed under general anesthesia via intramuscular injection of ketamine (80 mg / kg) and xylazine (10 mg / kg).

[0131] The dorsal skin was shaved and cleaned with povidone and 70% (v / v) ethanol. A subcutaneous pocket was created, a long linear incision was made, and a scaffold was inserted into the pocket. The incision was closed with 4-0 non-absorbable suture material (Prolene, Braun, Germany).

[0132] The animals were sacrificed 2 and 4 weeks after surgery, and the implanted scaffolds were recovered. After fixation in 10% (v / v) neutral buffered formalin, they were dehydrated through a graded series of ethanol, and embedded in paraffin. The paraffin blocks were sectioned into 5-μm-thick slices using a microtome (Leica RM2245, Leica Biosystems, Germany).

[0133] These tissue sections were stained with hematoxylin and eosin (H&E) or immunohistochemically stained using anti-iNOS (1:200, PA1-036, Thermo Fisher, USA), anti-Arg1 (1:200, PA5-29645, Thermo Fisher, USA), and anti-CD31 (1:200, ab281583, Abcam, UK) antibodies. Nuclei were counterstained with hematoxylin. The M1 / M2 ratio was quantified based on the mean optical density of the images using Image J.

[0134] Example 14. In vivo scaffold-mediated osteochondral regeneration

[0135] Sprague-Dawley rats (male, 5 weeks old) were anesthetized with an intramuscular injection of ketamine (80 mg / kg) and xylazine (10 mg / kg). The knee area was then shaved and cleaned with povidone-iodine and 70% (v / v) ethanol. The skin was incised longitudinally with a surgical blade, and the skin and subcutaneous tissue were separated from the periosteum.

[0136] A circular articular cartilage defect measuring 1.6 mm in diameter and 2 mm in depth was created in the knee using a trephine drill, and this defect was filled with a single scaffold. After implantation, the subcutaneous tissue, periosteum, and skin were sutured with absorbable sutures (4-0 Vicryl®, Ethicon, Germany) and non-absorbable sutures (4-0 Prolene, Ethicon, Germany), respectively. After 20 weeks of surgery, the animals were sacrificed, and tissues were collected. These tissues were fixed in 10% (v / v) neutral-buffered formalin and analyzed using micro-CT (Skyscan 1176, Skyscan, Belgium). The micro-CT device was set to operate at 65 kV and 385 μA, with an exposure time of 279 ms for each cross-sectional slice.

[0137] As a result, the micro-CT scan images were reconstructed to assess both the quantity and quality of bone within the region of interest. These quantitative and qualitative analyses were performed using dedicated CTAn software. In addition, 3D representations of the analyzed tissue structures were generated and visualized using CTvol software. For histological analysis, fixed tissues were processed using RapidCal. TM The tissues were decalcified for 14 days in a solution (BBC Biochemical, USA). After decalcification, the tissues were dehydrated in a series of graded ethanol solutions and embedded in paraffin.

[0138] Tissue sections 5 μm thick were prepared using a microtome and stained with hematoxylin and eosin (H&E), Safranin O, Masson's trichrome (Polyscience, USA), and anti-collagen II (1:200, ab34712, Abcam, UK). For image analysis, tissue sections stained with MT and immunostained for type II collagen were used to quantify the positive area (%) for total collagen and type II collagen in the defect, respectively, using Image J software. To evaluate cell morphology within the tissue, circularity was calculated using the following formula.

[0139] Circularity = 4πx Area / Perimeter 2

[0140] The inventors defined a cell cluster as a group of two or more cells attached together to form a structure similar to a niche (empty space; lacunae).

[0141] Example 15. Statistical Analysis

[0142] Data are expressed as mean ± standard deviation. Statistical evaluation of data was performed using a two-tailed t-test or one-way ANOVA followed by Tukey's post hoc tests (GraphPad Prism).

[0143] In all cases, p<0.05 was considered statistically significant.

[0144] Experimental Example 1. Fabrication of 3D-printed composite scaffolds

[0145] To enhance cartilage repair through the combination of Sr delivery and 3D scaffolding, we developed a scaffold-based Sr delivery system using 3D printing technology. This system involved the fabrication of scaffolds using PCL and bioactive nanoglasses (BGn) (Fig. 1a). Sr-doped BGn (SrBGn), which serves as a source of trivalent ions including Sr, Si, and Ca, was embedded within the PCL scaffolds. The scaffolds were fabricated by 3D printing layer-by-layer a mixture of PCL, SrBGn, and camphene (a pore-forming agent) to create a lattice-like structure.

[0146] As a result, the 3D-printed composite scaffold features hierarchical porosity, with macropores located between the struts and layers, micropores on the strut surface, and interconnected microchannels within the struts due to camphene leaching. This unique porous structure not only facilitates ion release and diffusion, but also enhances host cell migration, adhesion, and proliferation. Furthermore, the exposure of SrBGn on the scaffold surface can provide nanoscale cues that promote cell anchorage and proliferation.

[0147] SrBGn was synthesized using a sol-gel method. In this method, Sr, Si, and Ca precursors formed micelles with CTAB through electrostatic interactions in a mixture of water and ammonium hydroxide. Ethoxyethanol stabilized the micelle formation, promoting condensation and mesopore formation. It is noteworthy that Sr can replace Ca in glass formation.

[0148] Substituting Sr into the bioactive nanoglass slightly decreased the particle size from 101.1 ± 3.6 nm to 92.4 ± 3.5 nm and the pore size from 4.9 nm to 3.8 nm (Figs. 1b and 1c). FE-SEM / EDS analysis confirmed that the Si:Ca:Sr ratios of BGn and SrBGn were 8.3:1.7:0 and 8.4:1.2:0.4, respectively (Figs. 1d and 9a, b).

[0149] The XRD pattern of SrBGn showed a broad hump, typical of amorphous silicate-based glasses, with diffraction peaks at 23° / 26° for CaSiO3 and 38.8° for Sr2SiO4 (Fig. 9c). This indicates that Ca was successfully substituted with Sr in the bioactive nanoglass.

[0150] A composite solution composed of PCL, SrBGn, and camphene was prepared in acetone and then 3D printed in an ethanol bath (Figure 10). The composite filament rapidly solidified due to phase separation between acetone, a good solvent used in PCL, and ethanol, a non-solvent. The composite scaffold was then freeze-dried to remove camphene through sublimation, creating a highly porous structure within the scaffold.

[0151] The inventors fine-tuned the porosity and pore size of the scaffolds by adjusting various 3D printing parameters, including the concentrations of camphene and bioactive nanoglass in the composite solution and the ethanol concentration in the bath. The yield of pore formation induced by nonsolvent phase separation was significantly affected by the ethanol concentration in the bath (Fig. 10a). Specifically, no pores were formed in a 100% (v / v) ethanol bath, regardless of the concentration of camphene in the composite solution. Pores were formed at a low ethanol concentration of 10% (v / v). However, the filaments exhibited poor mechanical stability due to inefficient solvent exchange.

[0152] Moreover, the scaffolds became more susceptible to deformation as the camphene concentration increased. When using a 60% (v / v) ethanol bath, the porosity and pore size of the scaffolds could be controlled by varying the camphene concentration. A composite solution containing 30% (w / v) camphene was 3D printed in a 60% (v / v) ethanol bath, achieving uniform micropores in the struts (Fig. 10a). Importantly, no residual camphene was detected in the scaffolds, as confirmed by FT-IR (Fig. 10b).

[0153] The yield and resolution of 3D printing were also affected by the concentration of bioactive nanoglass in the composite solution (Fig. 10c). Increasing the concentration of bioactive nanoglass resulted in scaffold solidification failure due to a decrease in the proportion of PCL. However, the present inventors successfully 3D printed a composite solution containing 40% (w / w) bioactive nanoglass, 30% (w / v) PCL, and 30% (w / v) camphene in a 60% (v / v) ethanol bath. As a result, porous scaffolds with well-defined macro- and microporous structures were generated (Fig. 10d).

[0154] The strut width was measured to be 181.6 ± 7.0 μm, and the distance between struts was 236.9 ± 9.7 μm (Fig. 1e). The average size of the micropores in the scaffold was 6.4 ± 0.9 μm, and vertical cross-sectional images confirmed the presence of highly interconnected and open microchannels throughout the scaffold (Fig. 11a). We referred to these hierarchical microchannel scaffolds as 'μCh'. When combined with BGn or SrBGn, they were referred to as BGn-μCh and SrBGn-μCh, respectively. The embedded bioactive nanoglass was partially exposed on the scaffold surface, providing additional nanotopological cues for cell adhesion.

[0155] Experimental Example 2. Physical and Chemical Surface Properties and Ion Release Profiles of 3D-Printed Composite Scaffolds

[0156] Incorporating bioactive nanoglass into the scaffold physically altered the surface properties (Figures 1f and 11b). In particular, the surface roughness of the scaffold significantly increased when nanoglass was embedded (Figure 1g). Specifically, the roughness of the scaffold composed solely of PCL (μCh) was measured to be 14.1 ± 2.23 nm Ra, whereas the scaffolds with BGn embedded (BGn-μCh) or SrBGn embedded (SrBGn-μCh) exhibited roughness values ​​of 238.01 ± 88.46 nm Ra and 199.63 ± 21.71 nm Ra, respectively. Furthermore, the water contact angle of the composite scaffolds significantly decreased compared to that of the non-composite scaffold. Meanwhile, there was no significant difference in the water contact angles between BGn-μCh and SrBGn-μCh (Figure 1h).

[0157] This suggests that the nanotopology provided by the bioactive nanoglass enhances (increases) the surface hydrophilicity of the scaffolds. To enhance cell adhesion, sodium hydroxide (NaOH) treatment was performed to further increase surface hydrophilicity (Fig. 10e). In particular, NaOH treatment significantly increased the hydrophilicity of all scaffolds, primarily through partial hydrolysis of PCL (Fig. 1h).

[0158] To further evaluate the chemical properties and properties of the scaffolds, the surface elemental composition was analyzed using XPS (Figs. 2a and 12a). Both composite scaffolds were found to contain Si 2p and Ca 2p elements. The Si 2p spectrum was resolved into three peaks attributed to Si(-O)1, Si(-O)2, and Si(-O)3 species. The Ca 2p core level spectrum showed Ca 2p peaks at 347.2 and 350.8 eV, respectively. 3 / 2 and 2p 1 / 2 The curve was fitted to two peak components corresponding to the energy states, which correspond to oxygen-bonded calcium of the O-Ca-O bond series.

[0159] Sr 3d was detected only in SrBGn-μCh with binding energies of 134.1 and 135.8 eV corresponding to Sr-O bonds, indicating the presence of strontium in the SrBGn-μCh scaffold. The release profiles of trivalent ions, including Sr, Si, and Ca, from the scaffolds were measured by ICP-AES analysis (Fig. 2b). Both composite scaffolds showed sustained release of Si and Ca ions for 14 days. In particular, Sr release was observed only in SrBGn-μCh due to the Sr substitution of bioactive nanoglass. The released contents of Si, Ca, and Sr ions in SrBGn-μCh over 14 days were confirmed to be 30–40 mg / L, 80–120 mg / L, and 2–4 mg / L, respectively. This suggests that the simultaneous delivery of trivalent ions through composite scaffolds may have a synergistic effect on cartilage repair.

[0160] The osteogenic potential of the scaffolds was assessed by measuring apatite formation in simulated body fluid (SBF) (Figs. 2c and 12b). After immersion in SBF for 14 days, the composite scaffolds were completely covered with apatite-like nanocrystals, whereas only apatite was slightly deposited on the surfaces of the nonporous PCL scaffolds or the non-composite scaffolds. EDS analysis revealed higher calcium and phosphate peaks in SrBGn-mCh than in BGn-mCh (Figs. 2d and 2e).

[0161] This indicates that scaffolds embedded with SrBGn have superior apatite formation capacity compared to scaffolds embedded with BGn, and thus have higher bioactivity for bone repair. The inventors hypothesized that SrBGn may induce greater apatite formation due to the reduced silica network connectivity resulting from Sr substitution.

[0162] Experimental Example 3. Trivalent ions released from a composite scaffold that enhances chondrocyte activity in vitro.

[0163] The media extracted from the composite scaffolds were used in in vitro studies to investigate the ionic effects of the composite scaffolds on cell behavior, regardless of surface properties (e.g., topology, porosity, chemistry, etc.). Sr ions generated from strontium chloride (SrCl2) were used as a control. SrCl2 concentrations ranging from 0.1 to 100 M did not induce any cytotoxicity in primary rat chondrocytes for 7 days (Figs. 13a and 13b). When the effect of Sr ions on chondrocyte migration was evaluated using a scratch-based migration assay, the chondrocyte migration rate increased dose-dependently with Sr ions (Figs. 13c and 13d).

[0164] Sr 2+ , Si 4+ and Ca 2+ To investigate the effects of trivalent ions, including BGn-μCh, on chondrocyte behavior, cells were cultured with scaffold extracts (Fig. 3a). All extracts did not exhibit any cytotoxicity in chondrocytes for 7 days (Fig. 3b). Chondrocytes treated with BGn-μCh and SrBGn-μCh extracts showed significantly improved cell spreading area and proliferation compared to chondrocytes treated with μCh extract (Figs. 3c and 3d). Notably, SrBGn-μCh extract significantly increased the expression levels of maturation-related genes (i.e., Sox9, Col2a1, and Acan) in chondrocytes, whereas BGn-μCh extract or SrCl2 did not induce any changes (Fig. 3e).

[0165] Furthermore, chondrocytes treated with the SrBGn-μCh extract produced and deposited more glycosminoglycans, which was 1.3-fold higher than those treated with μCh or BGn-μCh extracts, as confirmed by alcian blue staining (Fig. 3f). SrCl2 treatment did not affect chondrocyte maturation even at the highest concentration (100 μM) (Fig. 13e). These results indicate a synergistic effect of trivalent ions on chondrocyte maturation. Furthermore, scratch-based migration assays confirmed that chondrocytes treated with the SrBGn-μCh extract (26 μM Sr) migrated faster than chondrocytes treated with SrCl2 at similar (30 μM) or higher (60 μM) concentrations of Sr ions (Fig. 3g). This indicates that Sr ions play an important role in chondrocyte migration.

[0166] RNA sequencing analysis revealed significant changes in genes related to cellular responses to oxidative stress and mitochondrial matrix in the SrBGn-μCh group compared to the BGn-μCh or μCh groups (Figure 14). These results suggest a regulatory effect of Sr ions on cellular metabolic activity. To confirm these effects at the cellular level, a live-cell metabolic assay measuring cellular oxygen consumption rate (OCR) was additionally performed.

[0167] Chondrocytes treated with the SrBGn-μCh extract exhibited lower maximal respiration than chondrocytes treated with μCh, BGn-μCh extract, or SrCl2 (Figs. 3h, 3i, and 14). These results indicate that chondrocytes treated with SrBGn-μCh produced less mitochondrial ATP than chondrocytes treated with the other extracts. This suggests that chondrocytes treated with SrBGn-μCh required lower energy demands due to maturation. Together, these results suggest a combined effect of trivalent ions co-transported by SrBGn-μCh on the regulation of cellular activity and metabolic remodeling in chondrocytes.

[0168] Experimental Example 4. Strontium ions released from SrBGn-μCh regulate genes related to adhesion, ECM synthesis, and maturation of chondrocytes.

[0169] To further investigate the effects of ions released from SrBGn-μCh on chondrocyte activity regulation and the potential underlying mechanisms, we analyzed the transcriptome profiles of chondrocytes treated with SrBGn-μCh extract using bulk RNA sequencing (Fig. 4). The transcriptome profiles of the SrBGn-μCh group were found to be more similar to those of the BGn-μCh group than to the μCh group (Fig. 4a), indicating an ionic effect on cell activity regulation.

[0170] Furthermore, the Venn diagram displaying differentially expressed genes (DEGs, fold change ≥1.5) indicated that SrBGn-μCh completely and precisely regulated genes compared to BGn-μCh or μCh (Fig. 4b). Additional gene ontology (GO) analysis revealed that genes significantly upregulated in the SrBGn-μCh group compared to the BGn-μCh group were related to ECM organization, collagen fibril organization, cartilage development, integrin-mediated signaling pathway, cellular response to oxidative stress, mitochondrial matrix, and metal ion binding (Fig. 4c). These results indicate a unique regulatory role of Sr in chondrocyte activation and maturation.

[0171] In particular, SrBGn-μCh upregulated genes involved in transcriptional regulation and signaling cascades in cartilage development (Fig. 4d). For example, Sox9, a transcription factor essential for chondrocyte differentiation and chondrogenesis, and BMP2, a key growth factor regulating the trajectory of chondrocyte differentiation and chondrocyte-specific ECM synthesis, were significantly and significantly upregulated in the SrBGn-μCh group compared to the BGn-μCh or μCh groups.

[0172] Additionally, genes regulating ECM composition, such as Col2a1, Matn3, Col9a1, and Col11a1, or genes involved in matrix stability, such as Matn3 and Col11a1, were significantly upregulated in the SrBGn-μCh group (Fig. 4d). Because types XI and II collagen cooperate to enhance the structural integrity of the intracartilaginous ECM, these results imply a positive therapeutic effect of SrBGn-μCh on cartilage-specific ECM synthesis for repair.

[0173] In addition, the expression of anabolic genes, including Sox9, Col2a1, Comp, and Crtap, was significantly increased in the SrBGn-μCh group, whereas the expression of their negative counterpart genes related to catabolism, such as Adamts9, MMP9, and MMP13, was reduced. These results indicate the therapeutic potential of SrBGn-μCh in cartilage regeneration through cartilage-specific ECM synthesis. In addition, genes involved in cell-matrix interactions and signaling, such as Chad, Bgn, and Comp, were upregulated in the SrBGn-μCh group. Moreover, the expression of genes related to the mitochondrial matrix was significantly altered in the SrBGn-μCh group. This suggests that ions released from SrBGn-μCh regulate the physiological functions of chondrocytes by modulating the extracellular environment.

[0174] In particular, DEGs in the SrBGn-μCh group were enriched in the Notch signaling pathway, a key regulator of chondrocyte proliferation and differentiation during cartilage development (Fig. 4e and 4f). In addition, DEGs in the SrBGn-μCh group were enriched in the TGF-β signaling pathway, a key signaling pathway for cartilage development, homeostasis, and remodeling (Fig. 15a). Furthermore, SrBGn-μCh significantly downregulated genes associated with TGF-β1-mediated chondrocyte hypertrophy, such as Smad5 and Twsg1. In contrast, genes associated with TGF-β1-mediated chondrocyte proliferation, migration, and differentiation, such as Acvr1, Wnt 4, and Ankrd1, were highly upregulated in the SrBGn-μCh group.

[0175] Notably, gene set enrichment analysis (GSEA) revealed that DEGs in the SrBGn-μCh group were enriched in cell adhesion molecules compared to μCh, whereas DEGs in the BGn-μCh group were not (Fig. 4g). SrBGn-μCh specifically upregulated Itga5 and downregulated RhoA (Figs. 4h and 15b). The protein-protein network revealed Itga5 and RhoA as essential elements governing cell adhesion molecules for cell adhesion and mechanosensing (Fig. 4h).

[0176] This suggests that released Sr ions positively influence cell adhesion, suggesting that SrBGn-μCh, together with its structural and topological properties, synergistically improves cartilage repair. Furthermore, transcriptomic analysis indicates the importance of SrBGn-μCh in promoting cartilage repair.

[0177] Experimental Example 5. SrBGn-μCh enhances attachment, proliferation, and maturation of chondrocytes.

[0178] We investigated whether the surface structure and topological cues of the composite scaffolds, along with ionic effects, directly modulate cell behavior through chondrocyte culture on the composite scaffolds (Figs. 5a and 5b). Prior to cell culture, the scaffolds were treated with NaOH to enhance (increase) hydrophilicity and thereby enhance cell adhesion. The concentration of NaOH for scaffold treatment was selected to be 1 M, which ensured that pores remained intact after treatment (Fig. 10d).

[0179] Despite the hydrophilicity of the scaffold surface, more chondrocytes adhered to the composite scaffolds than to the non-composite scaffolds on day 1 after seeding (Fig. 5c), regardless of scaffold composition, upon alkaline treatment (Fig. 1h). Furthermore, cells adhered to the composite scaffolds expanded and spread more than those adhered to the non-composite scaffolds (Fig. 5d). These results suggest that chondrocyte adhesion can be enhanced by nanotopological cues derived from the bioactive nanoglasses embedded in the composite scaffolds. Notably, the cell spreading area was larger on SrBGn-μCh than on BGn-μCh, suggesting that Sr ions contribute more positively to promoting cell spreading.

[0180] This superior adhesion subsequently induced greater cell proliferation on the composite scaffolds over 7 days (Figures 5b, 5e, and 5f). On day 7 of culture, a greater number of cells covered the surface of the composite scaffold compared to the uncomposite scaffold (Figure 5e). Consequently, the amount of cartilage-specific ECM deposition by chondrocytes cultured on SrBGn-μCh was threefold greater than that of chondrocytes cultured on BGn-μCh (Figure 5g). This suggests a combined effect of tri-ion transport and the surface nanotopography of SrBGn-μCh on chondrocyte activity regulation.

[0181] Experimental Example 6. SrBGn-μCh Regulating BMSC Differentiation and Macrophage Polarization

[0182] Because bone marrow-derived mesenchymal stem cells (BMSCs) play a pivotal role in cartilage repair, the effects of scaffolds on stem cell fate regulation were evaluated. BMSCs treated with BGn-μCh or SrBGn-μCh extracts exhibited increased proliferation and migration compared to BMSCs treated with μCh extract (Figures 6A-6D).

[0183] Furthermore, BMSCs treated with BGn-μCh or SrBGn-μCh extracts significantly increased the expression levels of osteogenic markers Rux2, Alp, Col1A1, and Opn compared to BMSCs treated with μCh extract (Fig. 6e). ALP and ARS staining also showed higher ALP activity and calcium deposition on the composite scaffolds than on μCh (Fig. 6f). Direct culture of BMSCs on the scaffolds revealed that cells attached to the composite scaffolds had greater adhesion with a larger cell spreading area than cells attached to the non-composite scaffolds (Figs. 6g-i). Although there were no significant differences in proliferation, differentiation, adhesion, and proliferation between the BGn-μCh and SrBGn-μCh groups, cells treated with SrBGn-μCh showed faster migration than cells treated with BGn-μCh.

[0184] These results suggest that bioactive nanoglass composite scaffolds have greater potential for bone repair, which is attributed to the positive effect of Sr ions on recruiting BMSCs to the damaged area and the combined effect of trivalent ions on promoting osteogenic differentiation of BMSCs.

[0185] To evaluate the anti-inflammatory properties of the scaffold, the scaffold was implanted into the subcutaneous tissue of rats (Fig. 16a). At both 2 and 4 weeks after implantation, iNOS was significantly reduced in the SrBGn-μCh implant site compared to the BGn-μCh or μCh implant site. + A significantly smaller M1 macrophage population was observed. At week 4, a greater number of Arg1 macrophages were observed at the SrBGn-μCh transplant site. + M2 macrophages were present. Consequently, the SrBGn-μCh scaffold maintained a lower M1 to M2 ratio throughout the entire 4-week period, in contrast to BGn-μCh and μCh (Figures 16b and 16c). This indicates that SrBGn-μCh exerts an anti-inflammatory effect by promoting M2 polarization of macrophages.

[0186] Additionally, the composite scaffold exhibited enhanced angiogenic responses in the subcutaneous tissue compared to the non-composite scaffold (Figures 16d and 16e). These results suggest that the composite scaffold can promote bone regeneration by promoting angiogenesis during the osteochondral repair process. Taken together, these results suggest that SrBGn-μCh has the potential to regulate various cell types, including chondrocytes, bone marrow stem cells (BMSCs), and macrophages, all of which may positively contribute to osteochondral repair.

[0187] Experimental Example 7. SrBGn-μCh Accelerates Osteochondral Defect Repair

[0188] To evaluate the osteochondral repair capacity of the scaffold, scaffolds identical in size and shape to the defect were 3D printed and implanted into osteochondral defects in rats (Fig. 7). To mimic severe cartilage damage combined with subchondral bone defects, a critical-size defect (1.6 mm in diameter and 2 mm in depth) was created in rats.

[0189] Twenty weeks after transplantation, gross observations revealed that the defects treated with the 3D-printed scaffolds were seamlessly integrated with the surrounding healthy tissue (Fig. 7a). In contrast, the untreated defects exhibited pitting and a rough surface, indicating incomplete tissue regeneration. Further analysis using H&E and Masson's trichrome staining confirmed that the defects treated with μCh and SrBGn-μCh were filled with new tissue, whereas the untreated defects showed no regeneration of the new cartilage layer at all (Fig. 7b). Safranin O and type II collagen staining confirmed these results, with the SrBGn-μCh group showing the strongest staining intensity, followed by the μCh and untreated groups (Fig. 7b).

[0190] Furthermore, both collagen and type II collagen-positive staining areas were larger in the SrBGn-μCh group compared to the other groups (Fig. 7c). More importantly, chondrocytes within the SrBGn-μCh-treated defects exhibited highly spherical and clustered morphologies, characteristic of typical lacunar structures. These morphological features were found only in the ECM-rich areas of the regenerated tissue in the SrBGn-μCh group, whereas the μCh and untreated groups exhibited cell morphologies similar to fibroblasts (Fig. 7d). Micro-CT analysis further confirmed that regeneration of subchondral bone defects was significantly improved after SrBGn-μCh treatment (Figs. 7e and 17).

[0191] Taken together, these results demonstrate that SrBGn-μCh enhances repair of osteochondral defects through synergistic modulation of host cell recruitment, subsequent cell adhesion, proliferation, and maturation, all of which are facilitated by the simultaneous delivery of triionic and structural / topological signals (Fig. 8).

[0192] We have developed a 3D-printed SrBGn-μCh scaffold that significantly enhances osteochondral repair. This composite scaffold integrates unique chemical and physical properties that collectively modulate a spectrum of cellular behaviors associated with osteochondral defect regeneration, as summarized in Figure 8 and Table 2 below.

[0193] Cell typeCellular behaviorSoluble ionic effect*Hierarchical structural & topological effect**Main contributing factorIn vitro evaluationChondrocyteInitial adhesion & spreadingSrBGn = BGn > NC***SrBGn = BGn > NCIonic effect of Si / Ca with nano-topology of bioactive nanoglassesProliferationSrBGn = BGn > NCSrBGn > BGn > NCCombined ionic effects of Sr / Si / Ca with nano-topology of bioactive nanoglassesMaturationSrBGn > BGn = NC = SrCl2SrBGn > BGn = NCSynergistic ionic effect of Sr / Si / CaMigrationSrBGn = SrCl2-Ionic effect of SrBone marrow-derived MSCAdhesion & spreadingSrBGn = BGn = NCSrBGn > BGn > NCNano-topology with ionic effect of SrProliferationSrBGn = BGn > NCSrBGn = BGn > NCIonic effect of Si / CaMigrationSrBGn > BGn > NC-Combined ionic effect of Sr / Si / CaOsteogenic differentiationSrBGn = BGn > NC-Ionic effect of Si / CaIn vivo evaluationMacrophageM2 polarizationSrBGn > BGn = NCSr ionic effectEndothelial cellBlood vessel formationSrBGn = BGn > NCIonic effect of Si / Ca

[0194] *Extracts treated to cells

[0195] **Direct culture on the scaffolds

[0196] ***SrBGn-mCh; SrBGn, BGn-mCh; BGn, and mCh; sample labeled non-composited (NC)

[0197] The unique and distinctive structure, along with macro / micropores and nanotopological signals, enabled sustained trivalent ion delivery of Sr, Si, and Ca ions. This positively influenced gene expression related to chondrocyte function and maturation by regulating the Notch signaling pathway. Furthermore, the nanotopological signals of the scaffold generated by the integration of bioactive nanoglass synergistically promoted the adhesion, proliferation, and subsequent proliferation of chondrocytes and BMSCs. Si and Ca ions were more effective in enhancing osteogenic differentiation and vascularization of BMSCs, whereas Sr ions were more effective in promoting host cell recruitment and M2 macrophage polarization. These results indicate that the scaffold of the present invention can be usefully used in osteochondral repair applications.

[0198] While the embodiments of the present invention have been described above, the present invention is not limited to the above embodiments, but can be manufactured in various different forms. Those skilled in the art will understand that the present invention can be implemented in other specific forms without altering the technical spirit or essential characteristics of the present invention. Therefore, the embodiments described above should be understood to be illustrative in all respects and not restrictive.

Claims

1. A 3D printing composite scaffold composition comprising a biocompatible polymer and a strontium-doped bioactive nanoglass.

2. In paragraph 1, A 3D printing composite scaffold composition, characterized in that the composition further comprises a pore-forming agent.

3. In paragraph 2, A 3D printing composite scaffold composition, characterized in that the pore-forming agent is camphene.

4. In paragraph 1, A 3D printing composite scaffold composition, characterized in that the biocompatible polymer is polycaprolactone.

5. In paragraph 1, A 3D printing composite scaffold composition, characterized in that the biocompatible polymer is in an amount of 20 to 40 parts by weight and the strontium-doped bioactive nanoglass is in an amount of 30 to 50 parts by weight, based on the total weight of the composition.

6. In paragraph 2, A 3D printing composite scaffold composition, characterized in that the pore-forming agent is present in an amount of 20 to 40 parts by weight based on the total weight of the composition.

7. A 3D printed composite scaffold comprising the composition of claim 1.

8. In paragraph 7, A 3D printed composite scaffold, characterized in that the scaffold has a porous structure including macropores between struts and layers, micropores on the surface of the strut, and microchannels inside the strut.

9. In paragraph 8, A 3D printed composite scaffold, characterized in that the strut width is 150 to 250 μm and the distance between the struts is 200 to 300 μm.

10. In paragraph 7, A 3D printed composite scaffold, characterized in that the scaffold has a roughness value of 150 to 250 nm Ra.

11. In paragraph 7, The above scaffold is Sr 2+ , Si 4+ and Ca 2+ A 3D printed composite scaffold characterized by continuously releasing triple ions including for more than 14 days.

12. In paragraph 7, A 3D printed composite scaffold, wherein the scaffold is characterized by increasing the expression of a maturation-related gene in chondrocytes, wherein the maturation-related gene in chondrocytes is Sox9, Col2a1 or Acan.

13. In paragraph 7, A 3D printed composite scaffold, characterized in that the scaffold reduces cellular oxygen consumption rate.

14. In paragraph 7, A 3D printed composite scaffold, wherein the scaffold is characterized by increasing the expression of genes involved in regulating the composition of the extracellular matrix (ECM) and in stability, wherein the genes involved in regulating the composition of the extracellular matrix (ECM) and in stability are Col2a1, Matn3, Col9a1 or Col11a1.

15. In paragraph 7, A 3D printed composite scaffold characterized in that the scaffold has an increased anti-inflammatory effect by promoting M2 polarization of macrophages.

16. In paragraph 7, A 3D printed composite scaffold characterized in that the scaffold increases angiogenic response.

17. In paragraph 7, A 3D printed composite scaffold characterized in that the scaffold increases tissue regeneration.

18. In paragraph 17, A 3D printed composite scaffold, characterized in that the tissue is at least one selected from tissues including cartilage, bone, skin, skeletal muscle, muscle tissue, cardiac tissue, cardiac muscle, and neovascularization.

19. A pharmaceutical composition for tissue regeneration, comprising the 3D printing composite scaffold of clause 7.

20. A method for tissue regeneration, comprising the step of applying the composition of clause 19 to damaged tissue of a non-human organism. 21.i) A step of preparing a first mixture by dissolving a biocompatible polymer and a pore-forming agent in acetone; ii) a step of preparing a composite by mixing strontium-doped bioactive nanoglass with the first mixture; and iii) A method for manufacturing a 3D printed composite scaffold, comprising a step of forming the above complex into a three-dimensional shape by 3D printing.

22. In paragraph 21, A method for manufacturing a 3D printed composite scaffold, characterized in that the above iii) molding step comprises: inserting the composite into a 3D printer, melting it at 40 to 60°C, pressurizing it, extruding it through a nozzle into an ethanol bath, and molding it while laminating it.

Citation Information

Patent Citations

  • Implants with controlled porosity made from hybrid materials doped with osteoinductive nutrients - Patent Application 20070122999

    JP2022507372A

  • Three-dimensional scaffold with microchannels and manufacturing method thereof

    KR102510662B1

  • An anchor apparatus

    KR102667337B1