Sirna and modified substance thereof for inhibiting DGAT2, and use thereof

Abstract

An siRNA and a modified substance thereof for inhibiting DGAT2, and the use thereof, which belong to the field of biotechnology. Provided is an siRNA for inhibiting DGAT2. Experiments prove that the siRNA has a high inhibitory activity against DGAT2. Further provided is a modified siRNA for inhibiting DGAT2. The modified siRNA can effectively inhibit the expression of the DGAT2 gene in vivo.

Description

siRNA for inhibiting DGAT2 and its modified products and applications

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to Chinese patent application number 2023118034181 filed with the Chinese Patent Office on December 26, 2023, entitled “siRNA for inhibiting DGAT2 and its modifications and applications,” the entire contents of which are incorporated herein by reference. Technical Field

[0003] The present disclosure relates to siRNA for inhibiting DGAT2 and its modified products and applications, and belongs to the field of biotechnology. Background Art

[0004] Nonalcoholic steatohepatitis (NASH) is a severe liver disease characterized by triglyceride accumulation, severe inflammation, and fibrosis. While the exact molecular mechanisms underlying NASH progression remain unclear, a widely held hypothesis suggests that fat accumulation is a primary driver of the disease. Consequently, diacylglycerol O-acyltransferase 2 (DGAT2), a key enzyme in triglyceride synthesis, has been explored as a NASH target.

[0005] Targeting molecular pathways involved in the early pathogenesis and abnormal accumulation of hepatic steatosis could prevent inflammation, cellular damage, and fibrosis, thereby providing potential therapeutic approaches for patients with NASH and liver fibrosis. Acetyl-CoA carboxylase (ACC) and diacylglycerol acyltransferase 2 (DGAT2) both play a role in hepatic steatosis. De novo lipogenesis (DNL) is more active in patients with NAFLD than in healthy individuals and may lead to hepatic triglyceride excess, and ACC is the first directed enzyme in the hepatic DNL pathway. DGAT2 is highly expressed in the liver and adipose tissue and catalyzes the final step of DNL, ​​specifically the esterification of fatty acids with diacylglycerol to form triglycerides. Independent inhibition of each of these steps has been shown to reduce hepatic steatosis.

[0006] Small interfering RNA (siRNA), typically a double-stranded RNA of 20 to 25 nucleotides in length, specifically regulates gene expression through the RNA interference (RNAi) mechanism to treat disease. Therefore, developing an siRNA to inhibit DGAT2 production would be an effective approach for tumor treatment.

[0007] Summary of the Invention

[0008] To solve the above problems, the present disclosure provides an siRNA for inhibiting DGAT2, wherein the siRNA comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand are at least partially reverse-complementary to form a double-stranded region.

[0009] wherein the sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO.1 or the entire nucleotide sequence of SEQ ID NO.1, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO.2 or the entire nucleotide sequence of SEQ ID NO.2; or,

[0010] The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 3 or the entire nucleotide sequence of SEQ ID NO. 3, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 4 or the entire nucleotide sequence of SEQ ID NO. 4; or

[0011] The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 5 or the entire nucleotide sequence of SEQ ID NO. 5, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 6 or the entire nucleotide sequence of SEQ ID NO. 6; or

[0012] The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 7 or the entire nucleotide sequence of SEQ ID NO. 7, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 8 or the entire nucleotide sequence of SEQ ID NO. 8; or

[0013] The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 9 or the entire nucleotide sequence of SEQ ID NO. 9, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 10 or the entire nucleotide sequence of SEQ ID NO. 10; or

[0014] The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 11 or the entire nucleotide sequence of SEQ ID NO. 11, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 12 or the entire nucleotide sequence of SEQ ID NO. 12; or

[0015] The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 13 or the entire nucleotide sequence of SEQ ID NO. 13, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 14 or the entire nucleotide sequence of SEQ ID NO. 14; or

[0016] The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 15 or the entire nucleotide sequence of SEQ ID NO. 15, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 16 or the entire nucleotide sequence of SEQ ID NO. 16; or

[0017] The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 17 or the entire nucleotide sequence of SEQ ID NO. 17, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 18 or the entire nucleotide sequence of SEQ ID NO. 18; or

[0018] The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 19 or the entire nucleotide sequence of SEQ ID NO. 19, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 20 or the entire nucleotide sequence of SEQ ID NO. 20; or

[0019] The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 21 or the entire nucleotide sequence of SEQ ID NO. 21, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 22 or the entire nucleotide sequence of SEQ ID NO. 22; or

[0020] The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 23 or the entire nucleotide sequence of SEQ ID NO. 23, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 24 or the entire nucleotide sequence of SEQ ID NO. 24; or

[0021] The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 25 or the entire nucleotide sequence of SEQ ID NO. 25, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 26 or the entire nucleotide sequence of SEQ ID NO. 26; or

[0022] The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 27 or the entire nucleotide sequence of SEQ ID NO. 27, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 28 or the entire nucleotide sequence of SEQ ID NO. 28; or

[0023] The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 29 or the entire nucleotide sequence of SEQ ID NO. 29, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 30 or the entire nucleotide sequence of SEQ ID NO. 30; or,

[0024] The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 31 or the entire nucleotide sequence of SEQ ID NO. 31, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 32 or the entire nucleotide sequence of SEQ ID NO. 32; or,

[0025] The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 33 or the entire nucleotide sequence of SEQ ID NO. 33, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 34 or the entire nucleotide sequence of SEQ ID NO. 34; or

[0026] The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 35 or the complete nucleotide sequence of SEQ ID NO. 35, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 36 or the complete nucleotide sequence of SEQ ID NO. 36.

[0027] In one embodiment of the present disclosure, the sense strand comprises: a nucleotide sequence as shown in SEQ ID NO.1, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.1 and retains the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO.2, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.2 and retains the biological function of the sequence from which it is derived; or,

[0028] The sense strand comprises: a nucleotide sequence as shown in SEQ ID NO.3, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.3 and retains the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO.4, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.4 and retains the biological function of the sequence from which it is derived; or

[0029] The sense strand comprises: a nucleotide sequence as shown in SEQ ID NO.5, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.5 and retains the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO.6, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.6 and retains the biological function of the sequence from which it is derived; or

[0030] The sense strand comprises: a nucleotide sequence as shown in SEQ ID NO.7, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.7 and retains the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO.8, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.8 and retains the biological function of the sequence from which it is derived; or

[0031] The sense strand comprises: a nucleotide sequence as shown in SEQ ID NO.9 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.9 and retains the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO.10 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.10 and retains the biological function of the sequence from which it is derived; or

[0032] The sense strand comprises: a nucleotide sequence as shown in SEQ ID NO.11, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.11 and retains the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO.12, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.12 and retains the biological function of the sequence from which it is derived; or

[0033] The sense strand comprises: a nucleotide sequence as shown in SEQ ID NO.13, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.13 and retains the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO.14, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.14 and retains the biological function of the sequence from which it is derived; or

[0034] The sense strand comprises: a nucleotide sequence as shown in SEQ ID NO.15, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.15 and retains the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO.16, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.16 and retains the biological function of the sequence from which it is derived; or

[0035] The sense strand comprises: a nucleotide sequence as shown in SEQ ID NO.17, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.17 and retains the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO.18, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.18 and retains the biological function of the sequence from which it is derived; or

[0036] The sense strand comprises: a nucleotide sequence as shown in SEQ ID NO.19, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.19 and retains the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO.20, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.20 and retains the biological function of the sequence from which it is derived; or

[0037] The sense strand comprises: a nucleotide sequence as shown in SEQ ID NO.21, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.21 and retains the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO.22, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.22 and retains the biological function of the sequence from which it is derived; or

[0038] The sense strand comprises: a nucleotide sequence as shown in SEQ ID NO. 23, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO. 23 and retains the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO. 24, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO. 24 and retains the biological function of the sequence from which it is derived; or

[0039] The sense strand comprises: a nucleotide sequence as shown in SEQ ID NO.25, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.25 and retains the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO.26, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.26 and retains the biological function of the sequence from which it is derived; or,

[0040] The sense strand comprises: a nucleotide sequence as shown in SEQ ID NO.27, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.27 and retains the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO.28, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.28 and retains the biological function of the sequence from which it is derived; or

[0041] The sense strand comprises: a nucleotide sequence as shown in SEQ ID NO.29, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.29 and retains the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO.30, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.30 and retains the biological function of the sequence from which it is derived; or

[0042] The sense strand comprises: a nucleotide sequence as shown in SEQ ID NO.31, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.31 and retains the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO.32, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.32 and retains the biological function of the sequence from which it is derived; or

[0043] The sense strand comprises: a nucleotide sequence as shown in SEQ ID NO.33, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.33 and retains the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO.34, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.34 and retains the biological function of the sequence from which it is derived; or

[0044] The sense strand comprises: a nucleotide sequence as shown in SEQ ID NO.35, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.35 and retains the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO.36, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.36 and retains the biological function of the sequence from which it is derived.

[0045] In one embodiment of the present disclosure, the sense strand consists of the nucleotide sequence shown in SEQ ID NO.1, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.2; or,

[0046] The sense strand consists of the nucleotide sequence shown in SEQ ID NO.3, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.4; or

[0047] The sense strand consists of the nucleotide sequence shown in SEQ ID NO.5, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.6; or

[0048] The sense strand consists of the nucleotide sequence shown in SEQ ID NO.7, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.8; or,

[0049] The sense strand consists of the nucleotide sequence shown in SEQ ID NO.9, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.10; or

[0050] The sense strand consists of the nucleotide sequence shown in SEQ ID NO.11, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.12; or

[0051] The sense strand consists of the nucleotide sequence shown in SEQ ID NO.13, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.14; or

[0052] The sense strand consists of the nucleotide sequence shown in SEQ ID NO.15, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.16; or

[0053] The sense strand consists of the nucleotide sequence shown in SEQ ID NO.17, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.18; or

[0054] The sense strand consists of the nucleotide sequence shown in SEQ ID NO.19, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.20; or

[0055] The sense strand consists of the nucleotide sequence shown in SEQ ID NO.21, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.22; or

[0056] The sense strand consists of the nucleotide sequence shown in SEQ ID NO.23, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.24; or

[0057] The sense strand consists of the nucleotide sequence shown in SEQ ID NO.25, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.26; or

[0058] The sense strand consists of the nucleotide sequence shown in SEQ ID NO.27, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.28; or,

[0059] The sense strand consists of the nucleotide sequence shown in SEQ ID NO.29, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.30; or

[0060] The sense strand consists of the nucleotide sequence shown in SEQ ID NO.31, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.32; or

[0061] The sense strand consists of the nucleotide sequence shown in SEQ ID NO.33, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.34; or,

[0062] The sense strand consists of the nucleotide sequence shown in SEQ ID NO.35, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.36.

[0063] In one embodiment of the present disclosure, the siRNA is prepared by solid phase synthesis or liquid phase synthesis.

[0064] In one embodiment of the present disclosure, the nucleotides in the siRNA are each independently a modified or unmodified nucleotide.

[0065] In one embodiment of the present disclosure, each nucleotide in the siRNA is an unmodified nucleotide.

[0066] In one embodiment of the present disclosure, some or all of the nucleotides in the siRNA are modified nucleotides, and these modifications on the nucleotide groups do not significantly weaken or lose the function of the siRNA of the present disclosure in inhibiting DGAT2 gene expression.

[0067] In one embodiment of the present disclosure, at least one nucleotide in the sense strand or the antisense strand of the siRNA is a modified nucleotide.

[0068] In one embodiment of the present disclosure, at least one phosphate group in the sense strand or the antisense strand of the siRNA is a phosphate group having a modified group.

[0069] In one embodiment of the present disclosure, at least a portion of the phosphate group and / or ribose group in the phosphate-sugar backbone of at least one single strand in the sense strand and the antisense strand of the siRNA is a phosphate group having a modified group and / or a ribose group having a modified group.

[0070] In one embodiment of the present disclosure, all nucleotides in the sense strand and / or antisense strand of the siRNA are modified nucleotides, and these modifications on the nucleotide groups do not significantly weaken or lose the function of the siRNA of the present disclosure in inhibiting DGAT2 gene expression.

[0071] In one embodiment of the present disclosure, each nucleotide in the sense strand and the antisense strand of the siRNA is independently a fluorine-modified nucleotide or a non-fluorine-modified nucleotide.

[0072] In one embodiment of the present disclosure, the modification is a chemical modification, and the chemical modification is selected from one or more of methoxy modification, fluorination modification or thiophosphate linkage.

[0073] In one embodiment of the present disclosure, a "fluorinated nucleotide" refers to a nucleotide in which the hydroxyl group at the 2' position of the ribose group of the nucleotide is replaced by fluorine, and has a structure shown in the following formula (1). The non-fluorinated nucleotide is independently selected from a nucleotide or a nucleotide analog in which the hydroxyl group at the 2' position of the ribose group of the nucleotide is replaced by a non-fluorinated group.

[0074] In one embodiment of the present disclosure, the nucleotides formed by replacing the hydroxyl group at the 2' position of the ribose group with a non-fluorinated group are well known to those skilled in the art, and these nucleotides can be selected from 2'-alkoxy-modified nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-amino-modified nucleotides, 2'-substituted amino-modified nucleotides, and 2'-deoxynucleotides.

[0075] In one embodiment of the present disclosure, the 2'-alkoxy modified nucleotide is a 2'-methoxy (2'-OMe) modified nucleotide, as shown in formula (2); the 2'-substituted alkoxy modified nucleotide may be, for example, a 2'-O-methoxyethyl (2'-MOE) modified nucleotide, as shown in formula (3); the 2'-amino (2'-NH2) modified nucleotide is as shown in formula (4); and the 2'-deoxynucleotide (DNA) is as shown in formula (5):

[0076] In one embodiment of the present disclosure, the fluorinated modified nucleotides are located in the antisense strand and the sense strand of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the 9th, 10th, and 11th nucleotides of the sense strand are fluorinated modified nucleotides, and at least the 2nd, 6th, 14th, and 16th nucleotides of the antisense strand are fluorinated modified nucleotides.

[0077] In one embodiment of the present disclosure, the fluorinated modified nucleotides are located in the antisense strand and the sense strand of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the 7th, 8th, and 9th nucleotides of the sense strand are fluorinated modified nucleotides, and at least the 2nd, 6th, 14th, and 16th nucleotides of the antisense strand are fluorinated modified nucleotides.

[0078] In one embodiment of the present disclosure, the fluorinated-modified nucleotides are located in the sense strand and the antisense strand, the number of fluorinated-modified nucleotides in the sense strand is no more than 5, and, in the direction from the 5' end to the 3' end, at least the 7th, 8th, and 9th nucleotides of the sense strand are fluorinated-modified nucleotides, the number of fluorinated-modified nucleotides in the antisense strand is no more than 7, and, at least the 2nd, 6th, 14th, and 16th nucleotides of the antisense strand are fluorinated-modified nucleotides.

[0079] In one embodiment of the present disclosure, in the direction from the 5' end to the 3' end, in the sense chain, the nucleotides at positions 7, 8, 9 or positions 5, 7, 8, 9 of the sense chain are fluorinated modified nucleotides, and the nucleotides at the remaining positions in the sense chain are non-fluorinated modified nucleotides; in the antisense chain, the nucleotides at positions 2, 6, 14, 16 or positions 2, 6, 8, 9, 14, 16 of the antisense chain are fluorinated modified nucleotides, and the nucleotides at the remaining positions in the antisense chain are non-fluorinated modified nucleotides.

[0080] In one embodiment of the present disclosure, the methoxy-modified nucleotides are located in the antisense strand and the sense strand of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, 20th, and 21st nucleotides of the sense strand are methoxy-modified nucleotides, and at least the 1st, 3rd, 4th, 5th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 17th, 18th, 19th, 20th, and 23rd nucleotides of the antisense strand are methoxy-modified nucleotides.

[0081] In one embodiment of the present disclosure, the methoxy-modified nucleotides are located in the antisense strand and the sense strand of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, 20th, and 21st nucleotides of the sense strand are methoxy-modified nucleotides, and at least the 1st, 3rd, 4th, 5th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 17th, 18th, 19th, 20th, and 23rd nucleotides of the antisense strand are methoxy-modified nucleotides.

[0082] In one embodiment of the present disclosure, the methoxy-modified nucleotides are located in the antisense strand and the sense strand of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the 1st, 2nd, 3rd, 4th, 5th, 6th, 10th, 11th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, and 19th nucleotides of the sense strand are methoxy-modified nucleotides, and at least the 1st, 3rd, 4th, 5th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 17th, 18th, 19th nucleotides of the antisense strand are methoxy-modified nucleotides.

[0083] In one embodiment of the present disclosure, the methoxyethyl-modified nucleotide is located in the sense strand of the nucleotide sequence, and, from the 5' end to the 3' end, at least the first nucleotide of the sense strand is a methoxyethyl-modified nucleotide.

[0084] In one embodiment of the present disclosure, the nucleotide analog refers to a group that can replace a nucleotide in a nucleic acid but has a structure different from adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide or thymine deoxyribonucleotide.

[0085] In one embodiment of the present disclosure, the nucleotide analogue may be an isonucleotide, a bridged nucleotide or an acyclic nucleotide.

[0086] In one embodiment of the present disclosure, the bridged nucleic acid (BNA) refers to a constrained or inaccessible nucleotide. The BNA may contain a five-membered ring, a six-membered ring, or a seven-membered ring with a "fixed" C3'-endosugar condensed bridge structure. The bridge is usually incorporated into the 2'- and 4'-positions of the ribose to provide a 2',4'-BNA nucleotide.

[0087] In one embodiment of the present disclosure, the BNA may be an LNA, an ENA, a cET BNA, etc., wherein the LNA is as shown in formula (6), the ENA is as shown in formula (7), and the cET BNA is as shown in formula (8):

[0088] In one embodiment of the present disclosure, the LNA-modified nucleotide is located in the sense strand of the nucleotide sequence, and, from the 5' end to the 3' end, at least the first nucleotide of the sense strand is an LNA-modified nucleotide.

[0089] In one embodiment of the present disclosure, at least a portion of the phosphate groups in the phosphate-sugar backbone of at least one single strand of the sense strand and the antisense strand of the siRNA is a phosphate group having a modified group.

[0090] In one embodiment of the present disclosure, the phosphate group having a modified group is a phosphorothioate group formed by replacing at least one oxygen atom in the phosphodiester bond in the phosphate group with a sulfur atom.

[0091] In one embodiment of the present disclosure, the phosphate group having a modified group is a thiophosphate group having a structure as shown in formula (9):

[0092] In one embodiment of the present disclosure, the phosphorothioate linkage is present at at least one of the following positions: between the first and second nucleotides at either end of the sense strand or the antisense strand; between the second and third nucleotides at either end of the sense strand or the antisense strand; or any combination thereof.

[0093] In one embodiment of the present disclosure, phosphorothioate linkages are present at all of the aforementioned positions except the 5' end of the sense strand.

[0094] In one embodiment of the present disclosure, phosphorothioate linkages are present at all of the aforementioned positions except the 3' end of the sense strand.

[0095] In one embodiment of the present disclosure, the phosphorothioate linkage is present in at least one of the following positions:

[0096] between the first and second nucleotides at the 5' end of the sense strand;

[0097] between the second and third nucleotides at the 5' end of the sense strand;

[0098] between the first and second nucleotides at the 3' end of the sense strand;

[0099] between the second and third nucleotides at the 3' end of the sense strand;

[0100] between the first and second nucleotides at the 5' end of the antisense strand;

[0101] between the second and third nucleotides at the 5' end of the antisense strand;

[0102] between the first and second nucleotides at the 3' end of the antisense strand; and

[0103] between the second and third nucleotides at the 3' end of the antisense strand.

[0104] In one embodiment of the present disclosure, the nucleotides linked by the thiophosphate groups are located in the antisense strand and the sense strand of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the 1st and 2nd positions, and the 2nd and 3rd positions of the sense strand are nucleotides linked by the thiophosphate groups; and in the direction from the 5' end to the 3' end, at least the 1st and 2nd positions, the 2nd and 3rd positions, the 21st and 22nd positions, and the 22nd and 23rd positions of the antisense strand are nucleotides linked by the thiophosphate groups.

[0105] In one embodiment of the present disclosure, the nucleotides linked by the thiophosphate groups are located in the antisense strand and the sense strand of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the 1st and 2nd positions, and the 2nd and 3rd positions of the sense strand are nucleotides linked by the thiophosphate groups; and in the direction from the 5' end to the 3' end, at least the 1st and 2nd positions, the 2nd and 3rd positions, the 19th and 20th positions, and the 20th and 21st positions of the antisense strand are nucleotides linked by the thiophosphate groups.

[0106] In one embodiment of the present disclosure, the siRNA introduces modified nucleotides by using nucleomonomers having corresponding modifications.

[0107] The present disclosure also provides a product for inhibiting DGAT2, comprising an active ingredient and a pharmaceutically acceptable carrier, wherein the active ingredient is the above-mentioned siRNA or the above-mentioned modified siRNA.

[0108] In one embodiment of the present disclosure, the product is a pharmaceutical composition or a kit.

[0109] In one embodiment of the present disclosure, the product is a pharmaceutical composition, and the pharmaceutically acceptable carrier can be a carrier conventionally used in the field of siRNA administration, such as, but not limited to, magnetic nanoparticles (such as nanoparticles based on Fe3O4 or Fe2O3), carbon nanotubes, mesoporous silicon, calcium phosphate nanoparticles, polyethylenimine (PEI), polyamidoamine (PAMAM) dendrimer, poly(L-lysine, PLL), chitosan, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), poly (D&L-lactic / glycolic acid) copolymer (PLGA), poly (2-aminoethyl ethylene phosphate), and the like. phosphate), PPEEA) and poly (methacrylate-N, N-dimethylaminoethyl ester) (poly (2-dimethylaminoethylmethacrylate), PDMAEMA) and one or more of their derivatives.

[0110] In one embodiment of the present disclosure, there is no particular requirement for the content of siRNA and pharmaceutically acceptable carriers, and the conventional content of each component can be used.

[0111] In one embodiment of the present disclosure, in the pharmaceutical composition, the weight ratio of the active ingredient to the pharmaceutically acceptable carrier is 1:(1-500).

[0112] In one embodiment of the present disclosure, in the pharmaceutical composition, the weight ratio of the active ingredient to the pharmaceutically acceptable carrier is 1:(1-50).

[0113] In one embodiment of the present disclosure, the pharmaceutical composition may further comprise other pharmaceutically acceptable excipients, which may be one or more of various preparations or compounds conventionally used in the art.

[0114] In one embodiment of the present disclosure, the other pharmaceutically acceptable excipients may include at least one of a pH buffer, a protective agent, and an osmotic pressure regulator.

[0115] In one embodiment of the present disclosure, the pH buffer may be a tris hydrochloride buffer with a pH value of 7.5 to 8.5 and / or a phosphate buffer with a pH value of 5.5 to 8.5.

[0116] In one embodiment of the present disclosure, the protective agent may be at least one of inositol, sorbitol, sucrose, trehalose, mannose, maltose, lactose and glucose.

[0117] In one embodiment of the present disclosure, the content of the protective agent may be 0.01 to 30 weight % based on the total weight of the pharmaceutical composition.

[0118] In one embodiment of the present disclosure, the osmotic pressure regulator may be sodium chloride and / or potassium chloride.

[0119] In one embodiment of the present disclosure, the content of the osmotic pressure regulator makes the osmotic pressure of the pharmaceutical composition 200-700 milliosm / liter (mOSM / L). According to the required osmotic pressure, those skilled in the art can easily determine the content of the osmotic pressure regulator.

[0120] In one embodiment of the present disclosure, the pharmaceutical composition may be a liquid preparation, such as an injection; or it may be a lyophilized powder injection, which is mixed with a liquid excipient to be formulated into a liquid preparation during administration.

[0121] In one embodiment of the present disclosure, the liquid preparation can be, but is not limited to, administered by subcutaneous, intramuscular or intravenous injection, and can also be, but is not limited to, administered to the lungs by spray, or administered to other organ tissues (such as the liver) through the lungs by spray.

[0122] In one embodiment of the present disclosure, the pharmaceutical composition is for intravenous administration.

[0123] In one embodiment of the present disclosure, the pharmaceutical composition may be in the form of a liposome formulation.

[0124] In one embodiment of the present disclosure, the pharmaceutically acceptable carrier used in the liposome preparation comprises an amine-containing transfection compound (hereinafter also referred to as an organic amine), a helper lipid and / or a PEGylated lipid.

[0125] In one embodiment of the present disclosure, the organic amine, helper lipid and PEGylated lipid can be selected from one or more of the amine-containing transfection compounds or pharmaceutically acceptable salts or derivatives thereof, helper lipids and PEGylated lipids described in CN108220295B (incorporated herein by reference in its entirety).

[0126] In one embodiment of the present disclosure, the pharmaceutically acceptable targeting group in the siRNA conjugate can be galactose or N-acetylgalgactosamine (GalNAc). N-acetylgalactosamine is a ligand that binds to the asialoglycoprotein receptor (ASGPR) on the liver surface. The asialoglycoprotein receptor is an endocytic receptor specifically expressed by hepatocytes. N-acetylgalactosamine serves as a targeting molecule to deliver small RNA to the liver.

[0127] In one embodiment of the present disclosure, the galactose or N-acetylgalactosamine molecule can be monovalent, divalent, trivalent, or tetravalent; the monovalent, divalent, trivalent, and tetravalent respectively refer to that after the siRNA molecule forms an siRNA conjugate with a coupling group containing a galactose or N-acetylgalactosamine molecule as a targeting group, the molar ratio of the siRNA molecule to the galactose or N-acetylgalactosamine molecule in the siRNA conjugate is 1:1, 1:2, 1:3, or 1:4.

[0128] In one embodiment of the present disclosure, when siRNA is coupled to a coupling group containing N-acetylgalactosamine, the N-acetylgalactosamine molecule is trivalent or tetravalent.

[0129] In one embodiment of the present disclosure, when siRNA is conjugated to a coupling group containing N-acetylgalactosamine, the N-acetylgalactosamine molecule is trivalent.

[0130] In one embodiment of the present disclosure, the targeting group can be connected to the siRNA molecule via a suitable linker. Those skilled in the art can select a suitable linker according to the specific type of the targeting group.

[0131] In one embodiment of the present disclosure, the types of linkers and targeting groups and the connection methods with siRNA can be found in WO2015006740A2, the entire contents of which are incorporated herein by reference.

[0132] In one embodiment of the present disclosure, the siRNA conjugate formed by GalNAc and siRNA molecules has a structure as shown in the following formula (10):

[0133] In one embodiment of the present disclosure, the kit further comprises a pharmaceutically acceptable carrier and / or excipient.

[0134] In one embodiment of the present disclosure, the siRNA, pharmaceutically acceptable carrier and / or excipient in the kit may exist alone, in the form of a mixture of two or more thereof, or in the form of a final pharmaceutical composition.

[0135] In one embodiment of the present disclosure, in the kit, the pharmaceutically acceptable carrier is an amine-containing compound, a helper lipid and a PEGylated lipid.

[0136] In one embodiment of the present disclosure, in the kit, the pharmaceutically acceptable carrier is a mixture or exists independently.

[0137] In one embodiment of the present disclosure, the siRNA, pharmaceutically acceptable carrier and / or excipients in the kit are provided in liquid form, dry form or lyophilized form.

[0138] In one embodiment of the present disclosure, the siRNA, pharmaceutically acceptable carriers and / or excipients in the kit are substantially pure and / or sterile.

[0139] In one embodiment of the present disclosure, the kit comprises a container for providing siRNA, one or more containers for providing an amine-containing compound, a helper lipid, and a PEGylated lipid, and optionally, a container for providing an excipient.

[0140] In one embodiment of the present disclosure, the kit further comprises one or more components necessary or beneficial for a specific application, the components being selected from:

[0141] one or more components for achieving the desired cell transfection;

[0142] One or more components used to achieve the diagnosis, treatment, or prevention of a specific disease or disorder;

[0143] one or more buffers;

[0144] Positive or negative control samples;

[0145] excipients, stabilizers or preservatives.

[0146] In one embodiment of the present disclosure, the one or more components for achieving diagnosis, treatment or prevention of a specific disease or disorder are one or more additional therapeutic compounds or compositions, one or more diagnostic agents.

[0147] In one embodiment of the present disclosure, the kit further comprises one or more of sterile water, physiological saline and PBS.

[0148] The present disclosure also provides the use of the above siRNA or the above product in the preparation of a product for preventing, diagnosing and / or treating a pathological condition or disease caused by DGAT2.

[0149] In one embodiment of the present disclosure, the disease caused by DGAT2 is cancer.

[0150] In one embodiment of the present disclosure, the cancer is non-small cell lung cancer.

[0151] The present disclosure provides the use of the above siRNA or the above product in preventing, diagnosing and / or treating pathological conditions or diseases caused by DGAT2.

[0152] The present disclosure provides a method for preventing and / or treating a pathological condition or disease caused by DGAT2, wherein the above-mentioned siRNA or the above-mentioned product is administered to a subject.

[0153] The disclosed technical solution has the following advantages:

[0154] The present disclosure provides siRNA for inhibiting DGAT2, wherein the sense strand of the siRNA is as shown in SEQ ID NO. 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33 or 35, and the antisense strand is as shown in SEQ ID NO. 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34 or 36, and the siRNA is used for inhibiting DGAT2. TM -2 plasmid was constructed to detect the plasmid and determine the targeting relationship between siRNA and target gene fragment, and 18 siRNAs were obtained, all of which had high inhibitory activity.

[0155] The present disclosure provides modified siRNA for inhibiting DGAT2, wherein the modifications include methoxy modification, fluorine modification, phosphorothioate linkage, LNA modification and methoxyethyl modification, and the siRNA is modified by psiCHECK. TM-2 plasmid construction and test plasmids were constructed and the targeting relationship between the modified siRNA obtained by chemically modifying the sense chain of SEQ ID NO. 7, 9, 15, 17, 21 or 23 and the antisense chain of SEQ ID NO. 8, 10, 16, 18, 22 or 23 and the target gene fragment was determined, and a good DGAT2 inhibitory effect was still achieved at a concentration of 1 nM; after GalNAc coupling, in vivo verification was performed in mice after a single dose, and at a dose of 3 mg / kg, the modified siRNA obtained by chemically modifying the sense chain of SEQ ID NO. 7 and the antisense chain of SEQ ID NO. 8 and the modified siRNA obtained by chemically modifying the sense chain of SEQ ID NO. 21 and the antisense chain of SEQ ID NO. 22 had a very prominent inhibitory effect (inhibition rate greater than 80%); at a dose of 3 mg / kg, the modified siRNA obtained by chemically modifying the sense chain of SEQ ID NO. 7 or 21 and the antisense chain of SEQ ID NO. The modified siRNA obtained after the antisense strand shown in NO. 8 or 22 was newly chemically modified still had a very prominent inhibitory effect (RD34DG011 still had a very prominent inhibitory effect (the inhibition rate was greater than 90% after 10 days, and the inhibition rate was still greater than 60% after 17 days). BRIEF DESCRIPTION OF THE DRAWINGS

[0156] Figure 1: qPCR results of a single-dose study (3 mg / kg) of modified siRNA conjugates (RD34DG004G, RD34DG008G, RD34DG009G, RD34DG011G, and RD34DG012G) for DGAT2 inhibition in mice.

[0157] Figure 2: qPCR results of a single-dose study (3 mg / kg) of modified siRNA conjugates (RD34DG004G, RD34DG004LNA1G, and RD34DG004MOE1G) for DGAT2 inhibition in mice.

[0158] FIG3 : qPCR detection results of a single-dose study (3 mg / kg) of modified siRNA conjugates (RD34DG011G, RD34DG011LNA1G, and RD34DG011MOE1G) for inhibiting DGAT2 in mice. DETAILED DESCRIPTION

[0159] The following examples are provided to further better understand the present disclosure, but are not limited to the best mode of implementation and do not limit the content and protection scope of the present disclosure. Any product identical or similar to the present disclosure obtained by anyone under the guidance of the present disclosure or by combining the features of the present disclosure with other prior arts shall fall within the protection scope of the present disclosure.

[0160] In the following examples, DGAT2 mRNA refers to mRNA having the sequence shown in GeneBank Accession No. NM_032564.5, NM_026384.3, or XM_005579118.3. Furthermore, unless otherwise specified, the term "target gene" as used in this disclosure refers to the gene that transcribes the above-mentioned DGAT2 mRNA, and the term "target mRNA" refers to the above-mentioned DGAT2 mRNA.

[0161] If no specific experimental steps or conditions are specified in the following examples, the experiments were carried out according to the conventional experimental steps or conditions described in the literature in the field. If no manufacturer is specified for the reagents or instruments used, they are all commercially available conventional reagents.

[0162] In the following examples, capital letters C, G, U, and A represent ribonucleotides; lowercase letter m indicates that the nucleotide adjacent to the left of letter m is a methoxy-modified nucleotide; lowercase letter f indicates that the nucleotide adjacent to the left of letter f is a fluorinated-modified nucleotide; lowercase letter s indicates that the nucleotides adjacent to the left and right of letter s are modified with a phosphorothioate group.

[0163] In the following examples, a "modified nucleotide" refers to a nucleotide or nucleotide analog in which the hydroxyl group at the 2' position of the ribose group of a nucleotide is replaced by another group, or a nucleotide in which the base on the nucleotide is a modified base. A "fluorinated nucleotide" refers to a nucleotide in which the hydroxyl group at the 2' position of the ribose group of a nucleotide is replaced by fluorine, and a "non-fluorinated nucleotide" refers to a nucleotide or nucleotide analog in which the hydroxyl group at the 2' position of the ribose group of a nucleotide is replaced by a non-fluorinated group. A "nucleotide analog" refers to a group that can replace a nucleotide in a nucleic acid but has a structure different from adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide. Examples include isonucleotides, bridged nucleic acids (BNAs), or acyclic nucleotides. A "methoxy-modified nucleotide" refers to a nucleotide in which the 2'-hydroxyl group of the ribose group is replaced by a methoxy group.

[0164] In the following examples, the terms "complementary" and "reverse complementary" are used interchangeably and have the meanings known to those skilled in the art, i.e., in a double-stranded nucleic acid molecule, the bases of one strand pair with bases on the other strand in a complementary manner. In DNA, the purine base adenine (A) always pairs with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (C) always pairs with the pyrimidine base cytosine (G). Each base pair consists of a purine and a pyrimidine. When adenine on one strand always pairs with thymine (or uracil) on the other strand, and guanine always pairs with cytosine, the two strands are considered to be complementary to each other, and the sequence of a strand can be inferred from the sequence of its complementary strand.

[0165] In the following embodiments, particularly when describing the preparation method of siRNA of the present disclosure, pharmaceutical composition or siRNA conjugate, unless otherwise stated, nucleoside monomer (nucleoside monomer) refers to, according to the kind and order of nucleotide in the siRNA for preparation or the siRNA conjugate, the modification used in the phosphoramidite solid phase synthesis or unmodified nucleoside phosphoramidite monomer (unmodified or modified RNA phosphoramidites, RNA phosphoramidites is also referred to as Nucleoside phosphoramidites sometimes).Phosphoramidite solid phase synthesis is the method used in RNA synthesis known to those skilled in the art.The nucleoside monomer used in the disclosure all can be commercially available.

[0166] In the following embodiments, "coupling" refers to the covalent attachment of two or more chemical moieties, each with a specific function, to one another; accordingly, "conjugate" refers to a compound formed by covalent attachment of these chemical moieties. Furthermore, "siRNA conjugate" refers to a compound formed by covalent attachment of one or more chemical moieties with a specific function to an siRNA. The term "siRNA conjugate" should be understood, depending on the context, as a general term for multiple siRNA conjugates or as a siRNA conjugate represented by a certain chemical formula. In the context of the present disclosure, a "conjugated molecule" should be understood as a specific compound that can be coupled to an siRNA through a reaction to ultimately form the siRNA conjugate of the present disclosure.

[0167] In the following embodiments, "optional" or "optionally" means that the event or situation described thereafter may or may not occur, and the description includes both instances where the event or situation occurs and instances where it does not occur. For example, "optionally substituted" "alkyl" includes "alkyl" and "substituted alkyl" as defined below. It will be understood by those skilled in the art that for any group containing one or more substituents, these groups are not intended to introduce any substitution or substitution pattern that is sterically impractical, synthetically unfeasible, and / or inherently unstable.

[0168] In the following examples, "treating," "alleviating," or "improving" are used interchangeably herein. These terms refer to an approach for obtaining beneficial or desired results, including but not limited to a therapeutic benefit. "Therapeutic benefit" means eradication or amelioration of the underlying disorder being treated. Furthermore, a therapeutic benefit is achieved by eradication or amelioration of one or more physiological symptoms associated with the underlying disorder, such that an improvement is observed in the subject, even though the subject may still be afflicted with the underlying disorder.

[0169] In the following examples, "prevent" and "prevent" are used interchangeably. These terms refer to an approach to obtaining a beneficial or desired result, including but not limited to a prophylactic benefit. To obtain a "prophylactic benefit," a composition can be administered to a subject at risk for a particular disease, or to a subject reporting one or more pathological symptoms of a disease, even though a diagnosis of the disease may not have yet been made.

[0170] To solve the above problems, the present disclosure provides an siRNA for inhibiting DGAT2, wherein the siRNA comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand are at least partially reverse-complementary to form a double-stranded region.

[0171] wherein the sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO.1 or the entire nucleotide sequence of SEQ ID NO.1, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO.2 or the entire nucleotide sequence of SEQ ID NO.2; or,

[0172] The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 3 or the entire nucleotide sequence of SEQ ID NO. 3, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 4 or the entire nucleotide sequence of SEQ ID NO. 4; or

[0173] The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 5 or the entire nucleotide sequence of SEQ ID NO. 5, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 6 or the entire nucleotide sequence of SEQ ID NO. 6; or

[0174] The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 7 or the entire nucleotide sequence of SEQ ID NO. 7, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 8 or the entire nucleotide sequence of SEQ ID NO. 8; or

[0175] The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 9 or the entire nucleotide sequence of SEQ ID NO. 9, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 10 or the entire nucleotide sequence of SEQ ID NO. 10; or

[0176] The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 11 or the entire nucleotide sequence of SEQ ID NO. 11, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 12 or the entire nucleotide sequence of SEQ ID NO. 12; or

[0177] The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 13 or the entire nucleotide sequence of SEQ ID NO. 13, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 14 or the entire nucleotide sequence of SEQ ID NO. 14; or

[0178] The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 15 or the entire nucleotide sequence of SEQ ID NO. 15, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 16 or the entire nucleotide sequence of SEQ ID NO. 16; or

[0179] The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 17 or the entire nucleotide sequence of SEQ ID NO. 17, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 18 or the entire nucleotide sequence of SEQ ID NO. 18; or

[0180] The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 19 or the entire nucleotide sequence of SEQ ID NO. 19, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 20 or the entire nucleotide sequence of SEQ ID NO. 20; or

[0181] The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 21 or the entire nucleotide sequence of SEQ ID NO. 21, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 22 or the entire nucleotide sequence of SEQ ID NO. 22; or

[0182] The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 23 or the entire nucleotide sequence of SEQ ID NO. 23, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 24 or the entire nucleotide sequence of SEQ ID NO. 24; or

[0183] The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 25 or the entire nucleotide sequence of SEQ ID NO. 25, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 26 or the entire nucleotide sequence of SEQ ID NO. 26; or

[0184] The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 27 or the entire nucleotide sequence of SEQ ID NO. 27, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 28 or the entire nucleotide sequence of SEQ ID NO. 28; or

[0185] The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 29 or the entire nucleotide sequence of SEQ ID NO. 29, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 30 or the entire nucleotide sequence of SEQ ID NO. 30; or,

[0186] The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 31 or the entire nucleotide sequence of SEQ ID NO. 31, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 32 or the entire nucleotide sequence of SEQ ID NO. 32; or,

[0187] The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 33 or the entire nucleotide sequence of SEQ ID NO. 33, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 34 or the entire nucleotide sequence of SEQ ID NO. 34; or

[0188] The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 35 or the complete nucleotide sequence of SEQ ID NO. 35, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 36 or the complete nucleotide sequence of SEQ ID NO. 36.

[0189] In one embodiment of the present disclosure, the sense strand comprises: a nucleotide sequence as shown in SEQ ID NO.1, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.1 and retains the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO.2, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.2 and retains the biological function of the sequence from which it is derived; or,

[0190] The sense strand comprises: a nucleotide sequence as shown in SEQ ID NO.3, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.3 and retains the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO.4, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.4 and retains the biological function of the sequence from which it is derived; or

[0191] The sense strand comprises: a nucleotide sequence as shown in SEQ ID NO.5, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.5 and retains the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO.6, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.6 and retains the biological function of the sequence from which it is derived; or

[0192] The sense strand comprises: a nucleotide sequence as shown in SEQ ID NO.7, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.7 and retains the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO.8, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.8 and retains the biological function of the sequence from which it is derived; or

[0193] The sense strand comprises: a nucleotide sequence as shown in SEQ ID NO.9 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.9 and retains the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO.10 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.10 and retains the biological function of the sequence from which it is derived; or

[0194] The sense strand comprises: a nucleotide sequence as shown in SEQ ID NO.11, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.11 and retains the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO.12, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.12 and retains the biological function of the sequence from which it is derived; or

[0195] The sense strand comprises: a nucleotide sequence as shown in SEQ ID NO.13, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.13 and retains the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO.14, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.14 and retains the biological function of the sequence from which it is derived; or

[0196] The sense strand comprises: a nucleotide sequence as shown in SEQ ID NO.15, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.15 and retains the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO.16, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.16 and retains the biological function of the sequence from which it is derived; or

[0197] The sense strand comprises: a nucleotide sequence as shown in SEQ ID NO.17, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.17 and retains the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO.18, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.18 and retains the biological function of the sequence from which it is derived; or

[0198] The sense strand comprises: a nucleotide sequence as shown in SEQ ID NO.19, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.19 and retains the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO.20, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.20 and retains the biological function of the sequence from which it is derived; or

[0199] The sense strand comprises: a nucleotide sequence as shown in SEQ ID NO.21, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.21 and retains the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO.22, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.22 and retains the biological function of the sequence from which it is derived; or

[0200] The sense strand comprises: a nucleotide sequence as shown in SEQ ID NO. 23, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO. 23 and retains the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO. 24, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO. 24 and retains the biological function of the sequence from which it is derived; or

[0201] The sense strand comprises: a nucleotide sequence as shown in SEQ ID NO.25, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.25 and retains the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO.26, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.26 and retains the biological function of the sequence from which it is derived; or,

[0202] The sense strand comprises: a nucleotide sequence as shown in SEQ ID NO.27, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.27 and retains the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO.28, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.28 and retains the biological function of the sequence from which it is derived; or

[0203] The sense strand comprises: a nucleotide sequence as shown in SEQ ID NO.29, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.29 and retains the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO.30, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.30 and retains the biological function of the sequence from which it is derived; or

[0204] The sense strand comprises: a nucleotide sequence as shown in SEQ ID NO.31, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.31 and retains the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO.32, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.32 and retains the biological function of the sequence from which it is derived; or

[0205] The sense strand comprises: a nucleotide sequence as shown in SEQ ID NO.33, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.33 and retains the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO.34, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.34 and retains the biological function of the sequence from which it is derived; or

[0206] The sense strand comprises: a nucleotide sequence as shown in SEQ ID NO.35, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.35 and retains the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO.36, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as shown in SEQ ID NO.36 and retains the biological function of the sequence from which it is derived.

[0207] In one embodiment of the present disclosure, the sense strand consists of the nucleotide sequence shown in SEQ ID NO.1, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.2; or,

[0208] The sense strand consists of the nucleotide sequence shown in SEQ ID NO.3, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.4; or

[0209] The sense strand consists of the nucleotide sequence shown in SEQ ID NO.5, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.6; or

[0210] The sense strand consists of the nucleotide sequence shown in SEQ ID NO.7, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.8; or,

[0211] The sense strand consists of the nucleotide sequence shown in SEQ ID NO.9, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.10; or

[0212] The sense strand consists of the nucleotide sequence shown in SEQ ID NO.11, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.12; or

[0213] The sense strand consists of the nucleotide sequence shown in SEQ ID NO.13, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.14; or

[0214] The sense strand consists of the nucleotide sequence shown in SEQ ID NO.15, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.16; or

[0215] The sense strand consists of the nucleotide sequence shown in SEQ ID NO.17, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.18; or

[0216] The sense strand consists of the nucleotide sequence shown in SEQ ID NO.19, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.20; or

[0217] The sense strand consists of the nucleotide sequence shown in SEQ ID NO.21, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.22; or

[0218] The sense strand consists of the nucleotide sequence shown in SEQ ID NO.23, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.24; or

[0219] The sense strand consists of the nucleotide sequence shown in SEQ ID NO.25, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.26; or

[0220] The sense strand consists of the nucleotide sequence shown in SEQ ID NO.27, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.28; or,

[0221] The sense strand consists of the nucleotide sequence shown in SEQ ID NO.29, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.30; or

[0222] The sense strand consists of the nucleotide sequence shown in SEQ ID NO.31, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.32; or

[0223] The sense strand consists of the nucleotide sequence shown in SEQ ID NO.33, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.34; or,

[0224] The sense strand consists of the nucleotide sequence shown in SEQ ID NO.35, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.36.

[0225] In one embodiment of the present disclosure, the siRNA is prepared by solid phase synthesis or liquid phase synthesis.

[0226] In one embodiment of the present disclosure, the nucleotides in the siRNA are each independently a modified or unmodified nucleotide.

[0227] In one embodiment of the present disclosure, each nucleotide in the siRNA is an unmodified nucleotide.

[0228] In one embodiment of the present disclosure, some or all of the nucleotides in the siRNA are modified nucleotides, and these modifications on the nucleotide groups do not significantly weaken or lose the function of the siRNA of the present disclosure in inhibiting DGAT2 gene expression.

[0229] In one embodiment of the present disclosure, at least one nucleotide in the sense strand or the antisense strand of the siRNA is a modified nucleotide.

[0230] In one embodiment of the present disclosure, at least one phosphate group in the sense strand or the antisense strand of the siRNA is a phosphate group having a modified group.

[0231] In one embodiment of the present disclosure, at least a portion of the phosphate group and / or ribose group in the phosphate-sugar backbone of at least one single strand in the sense strand and the antisense strand of the siRNA is a phosphate group having a modified group and / or a ribose group having a modified group.

[0232] In one embodiment of the present disclosure, all nucleotides in the sense strand and / or antisense strand of the siRNA are modified nucleotides, and these modifications on the nucleotide groups do not significantly weaken or lose the function of the siRNA of the present disclosure in inhibiting DGAT2 gene expression.

[0233] In one embodiment of the present disclosure, each nucleotide in the sense strand and the antisense strand of the siRNA is independently a fluorine-modified nucleotide or a non-fluorine-modified nucleotide.

[0234] In one embodiment of the present disclosure, the modification is a chemical modification, and the chemical modification is selected from one or more of methoxy modification, fluorination modification or thiophosphate linkage.

[0235] In one embodiment of the present disclosure, a "fluorinated nucleotide" refers to a nucleotide in which the hydroxyl group at the 2' position of the ribose group of the nucleotide is replaced by fluorine, and has a structure shown in the following formula (1). The non-fluorinated nucleotide is independently selected from a nucleotide or a nucleotide analog in which the hydroxyl group at the 2' position of the ribose group of the nucleotide is replaced by a non-fluorinated group.

[0236] In one embodiment of the present disclosure, the nucleotides formed by replacing the hydroxyl group at the 2' position of the ribose group with a non-fluorinated group are well known to those skilled in the art, and these nucleotides can be selected from 2'-alkoxy-modified nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-amino-modified nucleotides, 2'-substituted amino-modified nucleotides, and 2'-deoxynucleotides.

[0237] In one embodiment of the present disclosure, the 2'-alkoxy modified nucleotide is a 2'-methoxy (2'-OMe) modified nucleotide, as shown in formula (2); the 2'-substituted alkoxy modified nucleotide may be, for example, a 2'-O-methoxyethyl (2'-MOE) modified nucleotide, as shown in formula (3); the 2'-amino (2'-NH2) modified nucleotide is as shown in formula (4); and the 2'-deoxynucleotide (DNA) is as shown in formula (5):

[0238] In one embodiment of the present disclosure, the fluorinated modified nucleotides are located in the antisense strand and the sense strand of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the 9th, 10th, and 11th nucleotides of the sense strand are fluorinated modified nucleotides, and at least the 2nd, 6th, 14th, and 16th nucleotides of the antisense strand are fluorinated modified nucleotides.

[0239] In one embodiment of the present disclosure, the fluorinated modified nucleotides are located in the antisense strand and the sense strand of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the 7th, 8th, and 9th nucleotides of the sense strand are fluorinated modified nucleotides, and at least the 2nd, 6th, 14th, and 16th nucleotides of the antisense strand are fluorinated modified nucleotides.

[0240] In one embodiment of the present disclosure, the fluorinated-modified nucleotides are located in the sense strand and the antisense strand, the number of fluorinated-modified nucleotides in the sense strand is no more than 5, and, in the direction from the 5' end to the 3' end, at least the 7th, 8th, and 9th nucleotides of the sense strand are fluorinated-modified nucleotides, the number of fluorinated-modified nucleotides in the antisense strand is no more than 7, and, at least the 2nd, 6th, 14th, and 16th nucleotides of the antisense strand are fluorinated-modified nucleotides.

[0241] In one embodiment of the present disclosure, in the direction from the 5' end to the 3' end, in the sense chain, the nucleotides at positions 7, 8, 9 or positions 5, 7, 8, 9 of the sense chain are fluorinated modified nucleotides, and the nucleotides at the remaining positions in the sense chain are non-fluorinated modified nucleotides; in the antisense chain, the nucleotides at positions 2, 6, 14, 16 or positions 2, 6, 8, 9, 14, 16 of the antisense chain are fluorinated modified nucleotides, and the nucleotides at the remaining positions in the antisense chain are non-fluorinated modified nucleotides.

[0242] In one embodiment of the present disclosure, the methoxy-modified nucleotides are located in the antisense strand and the sense strand of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, 20th, and 21st nucleotides of the sense strand are methoxy-modified nucleotides, and at least the 1st, 3rd, 4th, 5th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 17th, 18th, 19th, 20th, and 23rd nucleotides of the antisense strand are methoxy-modified nucleotides.

[0243] In one embodiment of the present disclosure, the methoxy-modified nucleotides are located in the antisense strand and the sense strand of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, 20th, and 21st nucleotides of the sense strand are methoxy-modified nucleotides, and at least the 1st, 3rd, 4th, 5th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 17th, 18th, 19th, 20th, and 23rd nucleotides of the antisense strand are methoxy-modified nucleotides.

[0244] In one embodiment of the present disclosure, the methoxy-modified nucleotides are located in the antisense strand and the sense strand of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the 1st, 2nd, 3rd, 4th, 5th, 6th, 10th, 11th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, and 19th nucleotides of the sense strand are methoxy-modified nucleotides, and at least the 1st, 3rd, 4th, 5th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 17th, 18th, 19th nucleotides of the antisense strand are methoxy-modified nucleotides.

[0245] In one embodiment of the present disclosure, the methoxyethyl-modified nucleotide is located in the sense strand of the nucleotide sequence, and, from the 5' end to the 3' end, at least the first nucleotide of the sense strand is a methoxyethyl-modified nucleotide.

[0246] In one embodiment of the present disclosure, the nucleotide analog refers to a group that can replace a nucleotide in a nucleic acid but has a structure different from adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide or thymine deoxyribonucleotide.

[0247] In one embodiment of the present disclosure, the nucleotide analogue may be an isonucleotide, a bridged nucleotide or an acyclic nucleotide.

[0248] In one embodiment of the present disclosure, the bridged nucleic acid (BNA) refers to a constrained or inaccessible nucleotide. The BNA may contain a five-membered ring, a six-membered ring, or a seven-membered ring with a "fixed" C3'-endosugar condensed bridge structure. The bridge is usually incorporated into the 2'- and 4'-positions of the ribose to provide a 2',4'-BNA nucleotide.

[0249] In one embodiment of the present disclosure, the BNA may be an LNA, an ENA, a cET BNA, etc., wherein the LNA is as shown in formula (6), the ENA is as shown in formula (7), and the cET BNA is as shown in formula (8):

[0250] In one embodiment of the present disclosure, the LNA-modified nucleotide is located in the sense strand of the nucleotide sequence, and, from the 5' end to the 3' end, at least the first nucleotide of the sense strand is an LNA-modified nucleotide.

[0251] In one embodiment of the present disclosure, at least a portion of the phosphate groups in the phosphate-sugar backbone of at least one single strand of the sense strand and the antisense strand of the siRNA is a phosphate group having a modified group.

[0252] In one embodiment of the present disclosure, the phosphate group having a modified group is a phosphorothioate group formed by replacing at least one oxygen atom in the phosphodiester bond in the phosphate group with a sulfur atom.

[0253] In one embodiment of the present disclosure, the phosphate group having a modified group is a thiophosphate group having a structure as shown in formula (9):

[0254] In one embodiment of the present disclosure, the phosphorothioate linkage is present at at least one of the following positions: between the first and second nucleotides at either end of the sense strand or the antisense strand; between the second and third nucleotides at either end of the sense strand or the antisense strand; or any combination thereof.

[0255] In one embodiment of the present disclosure, phosphorothioate linkages are present at all of the aforementioned positions except the 5' end of the sense strand.

[0256] In one embodiment of the present disclosure, phosphorothioate linkages are present at all of the aforementioned positions except the 3' end of the sense strand.

[0257] In one embodiment of the present disclosure, the phosphorothioate linkage is present in at least one of the following positions:

[0258] between the first and second nucleotides at the 5' end of the sense strand;

[0259] between the second and third nucleotides at the 5' end of the sense strand;

[0260] between the first and second nucleotides at the 3' end of the sense strand;

[0261] between the second and third nucleotides at the 3' end of the sense strand;

[0262] between the first and second nucleotides at the 5' end of the antisense strand;

[0263] between the second and third nucleotides at the 5' end of the antisense strand;

[0264] between the first and second nucleotides at the 3' end of the antisense strand; and

[0265] between the second and third nucleotides at the 3' end of the antisense strand.

[0266] In one embodiment of the present disclosure, the nucleotides linked by the thiophosphate groups are located in the antisense strand and the sense strand of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the 1st and 2nd positions, and the 2nd and 3rd positions of the sense strand are nucleotides linked by the thiophosphate groups; and in the direction from the 5' end to the 3' end, at least the 1st and 2nd positions, the 2nd and 3rd positions, the 21st and 22nd positions, and the 22nd and 23rd positions of the antisense strand are nucleotides linked by the thiophosphate groups.

[0267] In one embodiment of the present disclosure, the nucleotides linked by the thiophosphate groups are located in the antisense strand and the sense strand of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the 1st and 2nd positions, and the 2nd and 3rd positions of the sense strand are nucleotides linked by the thiophosphate groups; and in the direction from the 5' end to the 3' end, at least the 1st and 2nd positions, the 2nd and 3rd positions, the 19th and 20th positions, and the 20th and 21st positions of the antisense strand are nucleotides linked by the thiophosphate groups.

[0268] In one embodiment of the present disclosure, the siRNA introduces modified nucleotides by using nucleomonomers having corresponding modifications.

[0269] The present disclosure also provides a product for inhibiting DGAT2, comprising an active ingredient and a pharmaceutically acceptable carrier, wherein the active ingredient is the above-mentioned siRNA or the above-mentioned modified siRNA.

[0270] In one embodiment of the present disclosure, the product is a pharmaceutical composition or a kit.

[0271] In one embodiment of the present disclosure, the product is a pharmaceutical composition, and the pharmaceutically acceptable carrier can be a carrier conventionally used in the field of siRNA administration, such as, but not limited to, magnetic nanoparticles (such as nanoparticles based on Fe3O4 or Fe2O3), carbon nanotubes, mesoporous silicon, calcium phosphate nanoparticles, polyethylenimine (PEI), polyamidoamine (PAMAM) dendrimer, poly(L-lysine, PLL), chitosan, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), poly (D&L-lactic / glycolic acid) copolymer (PLGA), poly (2-aminoethyl ethylene phosphate), and the like. phosphate), PPEEA) and poly (methacrylate-N, N-dimethylaminoethyl ester) (poly (2-dimethylaminoethylmethacrylate), PDMAEMA) and one or more of their derivatives.

[0272] In one embodiment of the present disclosure, there is no particular requirement for the content of siRNA and pharmaceutically acceptable carriers, and the conventional content of each component can be used.

[0273] In one embodiment of the present disclosure, in the pharmaceutical composition, the weight ratio of the active ingredient to the pharmaceutically acceptable carrier is 1:(1-500).

[0274] In one embodiment of the present disclosure, in the pharmaceutical composition, the weight ratio of the active ingredient to the pharmaceutically acceptable carrier is 1:(1-50).

[0275] In one embodiment of the present disclosure, the pharmaceutical composition may further comprise other pharmaceutically acceptable excipients, which may be one or more of various preparations or compounds conventionally used in the art.

[0276] In one embodiment of the present disclosure, the other pharmaceutically acceptable excipients may include at least one of a pH buffer, a protective agent, and an osmotic pressure regulator.

[0277] In one embodiment of the present disclosure, the pH buffer may be a tris hydrochloride buffer with a pH value of 7.5 to 8.5 and / or a phosphate buffer with a pH value of 5.5 to 8.5.

[0278] In one embodiment of the present disclosure, the protective agent may be at least one of inositol, sorbitol, sucrose, trehalose, mannose, maltose, lactose and glucose.

[0279] In one embodiment of the present disclosure, the content of the protective agent may be 0.01 to 30 weight % based on the total weight of the pharmaceutical composition.

[0280] In one embodiment of the present disclosure, the osmotic pressure regulator may be sodium chloride and / or potassium chloride.

[0281] In one embodiment of the present disclosure, the content of the osmotic pressure regulator makes the osmotic pressure of the pharmaceutical composition 200-700 milliosm / liter (mOSM / L). According to the required osmotic pressure, those skilled in the art can easily determine the content of the osmotic pressure regulator.

[0282] In one embodiment of the present disclosure, the pharmaceutical composition may be a liquid preparation, such as an injection; or it may be a lyophilized powder injection, which is mixed with a liquid excipient to be formulated into a liquid preparation during administration.

[0283] In one embodiment of the present disclosure, the liquid preparation can be, but is not limited to, administered by subcutaneous, intramuscular or intravenous injection, and can also be, but is not limited to, administered to the lungs by spray, or administered to other organ tissues (such as the liver) through the lungs by spray.

[0284] In one embodiment of the present disclosure, the pharmaceutical composition is for intravenous administration.

[0285] In one embodiment of the present disclosure, the pharmaceutical composition may be in the form of a liposome formulation.

[0286] In one embodiment of the present disclosure, the pharmaceutically acceptable carrier used in the liposome preparation comprises an amine-containing transfection compound (hereinafter also referred to as an organic amine), a helper lipid and / or a PEGylated lipid.

[0287] In one embodiment of the present disclosure, the organic amine, helper lipid and PEGylated lipid can be selected from one or more of the amine-containing transfection compounds or pharmaceutically acceptable salts or derivatives thereof, helper lipids and PEGylated lipids described in CN108220295B (incorporated herein by reference in its entirety).

[0288] In one embodiment of the present disclosure, the pharmaceutically acceptable targeting group in the siRNA conjugate can be galactose or N-acetylgalgactosamine (GalNAc). N-acetylgalactosamine is a ligand that binds to the asialoglycoprotein receptor (ASGPR) on the liver surface. The asialoglycoprotein receptor is an endocytic receptor specifically expressed by hepatocytes. N-acetylgalactosamine serves as a targeting molecule to deliver small RNA to the liver.

[0289] In one embodiment of the present disclosure, the galactose or N-acetylgalactosamine molecule can be monovalent, divalent, trivalent, or tetravalent; the monovalent, divalent, trivalent, and tetravalent respectively refer to that after the siRNA molecule forms an siRNA conjugate with a coupling group containing a galactose or N-acetylgalactosamine molecule as a targeting group, the molar ratio of the siRNA molecule to the galactose or N-acetylgalactosamine molecule in the siRNA conjugate is 1:1, 1:2, 1:3, or 1:4.

[0290] In one embodiment of the present disclosure, when siRNA is coupled to a coupling group containing N-acetylgalactosamine, the N-acetylgalactosamine molecule is trivalent or tetravalent.

[0291] In one embodiment of the present disclosure, when siRNA is conjugated to a coupling group containing N-acetylgalactosamine, the N-acetylgalactosamine molecule is trivalent.

[0292] In one embodiment of the present disclosure, the targeting group can be connected to the siRNA molecule via a suitable linker. Those skilled in the art can select a suitable linker according to the specific type of the targeting group.

[0293] In one embodiment of the present disclosure, the types of linkers and targeting groups and the connection methods with siRNA can be found in WO2015006740A2, the entire contents of which are incorporated herein by reference.

[0294] In one embodiment of the present disclosure, the siRNA conjugate formed by GalNAc and siRNA molecules has a structure as shown in the following formula (10):

[0295] In one embodiment of the present disclosure, the kit further comprises a pharmaceutically acceptable carrier and / or excipient.

[0296] In one embodiment of the present disclosure, the siRNA, pharmaceutically acceptable carrier and / or excipient in the kit may exist alone, in the form of a mixture of two or more thereof, or in the form of a final pharmaceutical composition.

[0297] In one embodiment of the present disclosure, in the kit, the pharmaceutically acceptable carrier is an amine-containing compound, a helper lipid and a PEGylated lipid.

[0298] In one embodiment of the present disclosure, in the kit, the pharmaceutically acceptable carrier is a mixture or exists independently.

[0299] In one embodiment of the present disclosure, the siRNA, pharmaceutically acceptable carrier and / or excipients in the kit are provided in liquid form, dry form or lyophilized form.

[0300] In one embodiment of the present disclosure, the siRNA, pharmaceutically acceptable carriers and / or excipients in the kit are substantially pure and / or sterile.

[0301] In one embodiment of the present disclosure, the kit comprises a container for providing siRNA, one or more containers for providing an amine-containing compound, a helper lipid, and a PEGylated lipid, and optionally, a container for providing an excipient.

[0302] In one embodiment of the present disclosure, the kit further comprises one or more components necessary or beneficial for a specific application, the components being selected from:

[0303] one or more components for achieving the desired cell transfection;

[0304] One or more components used to achieve the diagnosis, treatment, or prevention of a specific disease or disorder;

[0305] one or more buffers;

[0306] Positive or negative control samples;

[0307] excipients, stabilizers or preservatives.

[0308] In one embodiment of the present disclosure, the one or more components for achieving diagnosis, treatment or prevention of a specific disease or disorder are one or more additional therapeutic compounds or compositions, one or more diagnostic agents.

[0309] In one embodiment of the present disclosure, the kit further comprises one or more of sterile water, physiological saline and PBS.

[0310] The present disclosure also provides the use of the above siRNA or the above product in the preparation of a product for preventing, diagnosing and / or treating a pathological condition or disease caused by DGAT2.

[0311] In one embodiment of the present disclosure, the disease caused by DGAT2 is cancer.

[0312] In one embodiment of the present disclosure, the cancer is non-small cell lung cancer.

[0313] The present disclosure provides the use of the above siRNA or the above product in preventing, diagnosing and / or treating pathological conditions or diseases caused by DGAT2.

[0314] The present disclosure provides a method for preventing and / or treating a pathological condition or disease caused by DGAT2, wherein the above-mentioned siRNA or the above-mentioned product is administered to a subject.

[0315] Unless otherwise specified, the reagents and culture media used in the following examples are commercially available products, and the nucleic acid electrophoresis, real-time PCR and other operations used are performed with reference to the methods described in Molecular Biology (4th Edition) (Alexander McLennan et al., 2019).

[0316] The experimental cells involved in the following examples are 293T, which were purchased from the cell bank of the Chinese Academy of Sciences;

[0317] Experimental animals were C57BL / 6J black mice purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd. All animals were housed in an SPF-grade animal facility at Suzhou GeneGene Co., Ltd. Animals were maintained under a 12-hour light-dark cycle and had free access to food and water. Experiments began after one week of acclimatization. The use and handling of experimental animals complied with the Animal Care Committee of Suzhou GeneGene Co., Ltd. regarding experimental animals and animal welfare.

[0318] The siRNA involved in the following examples is a siRNA sequence synthesized by phosphoramidite solid phase.

[0319] The insertion sequences involved in the following examples are DNA sequences customized by Hongxun Biotechnology Co., Ltd., specifically:

[0320] 5'-TTGGCTGGTGTTTGACTGGAAGCGCTACTTTCGAGACTACTTTCCCAGGAACTATATCTTTGGATAACCTAGACTATTTGCTTTTCAAAGAATTGGAGAGAATGAAGTGTACAAGTCCAGAAGAAGTTCCAGAAATAC ACTTTTTGCTCTGTAAATTTGGTGGGTTATTTAAAAGAAATTATAAAGGAAAAAGTCAGTATTTCAAGTCAGGACCAGTTAGATGATTCACTTTTTGCGAGCAGCAGATTAGTTCCAAAGCCTTGAAAATAAATGAAAGTGA-3' (SEQ ID NO: 37).

[0321] For transfection of cells with the siRNAs and siRNA conjugates targeting the DGAT2 gene, or the negative control siRNAs and siRNA conjugates described in the following examples, Lipofectamine 2000 (purchased from Invitrogen) was used as the transfection reagent, and specific procedures were performed according to the manufacturer's instructions. For qPCR detection, HiScript III RT SuperMix for qPCR (purchased from Vazyme) was used as the reverse transcription reagent, and specific procedures were performed according to the manufacturer's instructions.

[0322] Unless otherwise stated, the reagent ratios provided below are calculated by volume (v / v).

[0323] Example 1: A siRNA for inhibiting DGAT2

[0324] This example provides an siRNA for inhibiting DGAT2. The nucleotide sequence of the siRNA is designed based on the target mRNA, as shown in Table 1.

[0325] Table 1. Nucleotide sequences of siRNAs that inhibit DGAT2

[0326] Experimental Example 1: On-target activity detection of unmodified siRNA for inhibiting DGAT2

[0327] This experimental example provides an on-target activity assay for unmodified siRNAs used to inhibit DGAT2. The assay uses the psiCHECK2 vector, a plasmid construct that can monitor changes in the expression of a target gene fused to a reporter gene. The psiCHECK2 vector utilizes Renilla luciferase as the primary reporter gene. The target fragment is cloned into the multiple cloning site downstream of the translation stop codon of Renilla luciferase. RNAi targeting the target gene, triggered by the synthesized siRNA, results in cleavage and subsequent degradation of the fusion mRNA. Changes in Renilla luciferase activity can be used to determine whether the siRNA is on-target with the target gene fragment. The experimental procedure is as follows:

[0328] Step 1: Construction of detection plasmid DGAT2-psiCHECK2

[0329] Using psiCHECK TM -2(Promega TM ) plasmid construction detection plasmid, the detection plasmid contains the insertion sequence shown in SEQ ID NO: 37, the insertion sequence is obtained by splicing the target sequence that is completely complementary to all nucleotide sequences in the antisense strand of the siRNA shown in Table 1, and a single copy of the spliced ​​sequence is cloned into psiCHECK TM -2 plasmid Xho I / Not I site, to obtain the detection plasmid DGAT2-psiCHECK2;

[0330] Step 2: Cell culture and transfection

[0331] siRNA was added to a 96-well plate at a volume of 5 μL per well, Opti-MEM containing 20 ng of FGL1-psiCHECK2 detection plasmid was added at a volume of 12.5 μL per well, Opti-MEM (Gibco) was added at a volume of 32.5 μL per well, and Lipofectamine 2000 (purchased from Invitrogen, catalog number 11668-019) was added at a volume of 0.3 μL per well, and then incubated at room temperature (23°C) for 15 minutes to obtain a mixture. To the above mixture, 1×10 4 293T cells were cultured in complete DMEM medium (purchased from Transgen Biotech, catalog number FI101-01) at 37°C for 24 hours for subsequent dual-luciferase assays. Single-dose experiments were performed at a final siRNA concentration of 10 nM or 1 nM.

[0332] Step 3: Dual luciferase assay

[0333] The 5× lysis buffer in the dual-luciferase assay kit (purchased from Promega, catalog number E2940) was diluted with water to 1× lysis buffer. Take the cells cultured in step 2, discard the supernatant, dilute and wash twice with PBS buffer (purchased from Hyclone, product number SH30256.01) per well, add 1× lysis buffer to each cell plate at a volume of 50 μL per well, and lyse at room temperature (23°C) for 20 minutes to obtain a lysed cell plate; 30 μL / well of lysate was respectively aspirated from the lysed cell plate and added to an opaque 96-well detection plate, take a dual luciferase detection kit, prepare substrate 1 and substrate 2 according to the instructions, and add substrate 1 and substrate 2 to the opaque 96-well detection plate at a volume of 30 μL per well, respectively, and detect with a multifunctional microplate reader after each addition of the substrate to obtain the numerical results of firefly luciferase and Renilla luciferase, respectively.

[0334] The luminescence ratio of each well on the ELISA plate was calculated as Renilla / Firefly. The luminescence ratio of each test or control group was the average of the luminescence ratios of three culture wells. The luminescence ratio of each test group was normalized to the luminescence ratio of the control group. The ratio R (luminescence ratio (test) / luminescence ratio (control)) was calculated to represent the expression level of the Renilla reporter gene, i.e., the relative residual activity. The inhibition rate of siRNA was calculated as (1-R) ​​× 100%.

[0335] The NC group was a negative control siRNA that was not related to DGAT2.

[0336] The on-target activity results of the 18 siRNAs are shown in Table 2 , which shows that all 18 siRNAs have high inhibitory activity.

[0337] Table 2. On-target activity of siRNA

[0338] Example 2: A modified siRNA for inhibiting DGAT2

[0339] This embodiment provides a modified siRNA for inhibiting DGAT2, wherein the modified siRNA includes RD34DG004, RD34DG005, RD34DG008, RD34DG09, RD34DG011 and RD34DG012.

[0340] The positive strands of RD34DG005, RD34DG011 and RD34DG012 are obtained by chemically modifying the sequences shown in SEQ ID NO.9, SEQ ID NO.21 and SEQ ID NO.23, respectively. From the 5' end to the 3' end, the nucleotides at positions 1 and 2, and 2 and 3 are nucleotides linked by thiophosphate groups, the nucleotides at positions 1, 2, 3, 4, 5, 6, 7, 8, 12, 13, 14, 15, 16, 17, 18, 19, 20 and 21 are methoxy-modified nucleotides, and the nucleotides at positions 9, 10 and 11 are fluorine-modified nucleotides; the antisense strands of RD34DG005, RD34DG011 and RD34DG012 are obtained by chemically modifying the sequences shown in SEQ ID NO.10, SEQ ID NO.22 and SEQ ID NO. The sequence shown in NO.24 is chemically modified, wherein, from the 5' end to the 3' end, the nucleotides at positions 1 and 2, positions 2 and 3, positions 21 and 22, and positions 22 and 23 are nucleotides linked by phosphorothioate groups, the nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, 21, 22, and 23 are methoxy-modified nucleotides, and the nucleotides at positions 2, 6, 14, and 16 are fluorine-modified nucleotides; or

[0341] The sense strands of RD34DG004, RD34DG008 and RD34DG09 are obtained by chemically modifying the sequences selected from SEQ ID NO.7, SEQ ID NO.15 and SEQ ID NO.17, respectively. From the 5' end to the 3' end, the nucleotides at positions 1 and 2, and 2 and 3 are linked by thiophosphate groups, the nucleotides at positions 1, 2, 3, 4, 5, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18 and 19 are methoxy-modified nucleotides, and the nucleotides at positions 7, 8 and 9 are fluorine-modified nucleotides; the antisense strands of RD34DG004, RD34DG008 and RD34DG09 are obtained by chemically modifying the sequences selected from SEQ ID NO.8, SEQ ID NO.16 and SEQ ID NO.17, respectively. The sequence shown in NO.18 is obtained after chemical modification, in the direction from the 5' end to the 3' end, the nucleotides at positions 1 and 2, positions 2 and 3, positions 19 and 20, and positions 20 and 21 are linked by thiophosphate groups, the nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 are methoxy-modified nucleotides, and the nucleotides at positions 2, 6, 14, and 16 are fluorine-modified nucleotides.

[0342] Experimental Example 2: Detection of on-target activity of modified siRNA for inhibiting DGAT2

[0343] This experimental example provides an on-target activity detection experiment for modified siRNAs for inhibiting DGAT2. Based on Experimental Example 1, steps 1 to 3 are retained, and the 18 siRNAs described in Example 1 in step 2 are replaced with the 6 modified siRNAs described in Example 2: the sense chain of RD34DG004 is obtained by chemically modifying the sequence shown in SEQ ID NO.7, and the antisense chain is obtained by chemically modifying the sequence shown in SEQ ID NO.8; the sense chain of RD34DG005 is obtained by chemically modifying the sequence shown in SEQ ID NO.9, and the antisense chain is obtained by chemically modifying the sequence shown in SEQ ID NO.10; the sense chain of RD34DG008 is obtained by chemically modifying the sequence shown in SEQ ID NO.15, and the antisense chain is obtained by chemically modifying the sequence shown in SEQ ID NO.16; the sense chain of RD34DG009 is obtained by chemically modifying the sequence shown in SEQ ID NO.17, and the antisense chain is obtained by chemically modifying the sequence shown in SEQ ID NO. The sense chain of RD34DG011 was obtained by chemically modifying the sequence shown in SEQ ID NO.18; the sense chain of RD34DG011 was obtained by chemically modifying the sequence shown in SEQ ID NO.21, and the antisense chain was obtained by chemically modifying the sequence shown in SEQ ID NO.22; the sense chain of RD34DG012 was obtained by chemically modifying the sequence shown in SEQ ID NO.23, and the antisense chain was obtained by chemically modifying the sequence shown in SEQ ID NO.24.

[0344] The NC group was a negative control siRNA that had nothing to do with DGAT2, with the sense strand (5'-3') being CfsAmsCfUmUfAmCfGmCfUmGfAmGfUmAfCmUfUmCfGmAf, and the antisense strand (5'-3') being UmsCfsGmAfAmGfUmAfCmUfCmAfGmCfGmUfAmAfGmUfGmsAfsUm.

[0345] The on-target activity results of the six modified siRNAs are shown in Table 3. It can be seen that the modified siRNAs all have high inhibitory activity, and RD34DG004 has a very good inhibitory effect at a concentration of 1 nM, with an inhibition rate of >90%.

[0346] Table 3. On-target activity of modified siRNAs

[0347] Experimental Example 3: Single-dose study of modified siRNA in mice (3 mg / kg)

[0348] This experimental example provides a single-dose study of modified siRNA in mice at a dose level of 3 mg / kg. The experimental procedure is as follows:

[0349] Alnylam Pharmaceuticals, Inc. first reported that siRNA based on GalNAc conjugation technology exerted interference activity in mice (Nair et al., J. Am. Chem. Soc., 2014, 136, 16958-16961). The literature reported that siRNA conjugated to three clusters of GalNAc showed good delivery activity in both in vivo and in vitro experiments. Referring to the preparation method in the above literature, RD34DG004, RD34DG008, RD34DG09, RD34DG011 and RD34DG012 shown in Example 2 were conjugated with GalNAc to obtain GalNAc-conjugated siRNAs: RD34DG004G, RD34DG008 G, RD34DG09G, RD34DG011G and RD34DG012G, 3 C57BL / 6J black mice (female, 4-6 weeks old) in each group were subcutaneously administered a single dose of 3 mg / kg of GalNAc-conjugated siRNA or normal saline or NC group control. The siRNA in the NC group was a negative control siRNA unrelated to DGAT2, and its positive chain was (5'-3'): CfsAmsCfUmUfAmCfGmCfUmGfAmGfUmAfCmUfUmCfGmAf-GalNAc, and the antisense chain was (5'-3'): UmsCfsGmAfAmGfUmAfCmUfCmAfGmCfGmUfAmAfGmUfGmsAfsUm.

[0350] The application requirements are shown in Table 4.

[0351] Table 4. 3 mg / kg single dose test administration requirements

[0352] On the 7th day after administration, the mice were sacrificed, and liver samples were collected and snap-frozen in liquid nitrogen. Liver mRNA was extracted and analyzed by RT-qPCR. The RT-qPCR detection steps were as follows:

[0353] Step 1: RNA extraction:

[0354] 1) 20 mg of mouse liver tissue was collected and lysed by adding 1 mL of Trizol Lysis Buffer (Life Technologies, Cat. No. 410701). The tissue was then ground and lysed. The completely dissolved mixture was transferred to an RNase-free 1.5 mL centrifuge tube. The mixture was shaken vigorously for approximately 15 seconds to fully lyse the tissue cells and allowed to stand at room temperature (25°C) for 5 minutes.

[0355] 2) Carefully open the tube cap and add 200 μL of chloroform (purchased from Shanghai Lingfeng Chemical Reagent Co., Ltd., catalog number 20140925); shake vigorously for 20 seconds, let stand at room temperature (25°C) for 3 minutes; and centrifuge at 4°C, 12,000 × g, for 20 minutes.

[0356] 3) After centrifugation, carefully remove the centrifuge tube to a centrifuge tube rack, aspirate the supernatant aqueous phase into a new 2.0 mL centrifuge tube, add 1.5 times the volume of anhydrous ethanol (purchased from Jiangsu Qiangsheng Functional Chemical Co., Ltd., catalog number 20210802) of the supernatant aqueous phase, and mix by inversion.

[0357] 4) Add 700 μL of the mixture from step 3) to a purification column with a collection tube (purchased from VWI, catalog number 11822AG0627). Let stand for 2 minutes. Centrifuge at 4°C, 10,000 × g, for 1 minute, and discard the filtrate. Repeat the above steps with the remaining mixture.

[0358] 5) Add 700 μL of 80% (v / v) ethanol to the purification column, centrifuge at 10,000 × g at 4°C for 1 min, and discard the filtrate;

[0359] 6) Add 700 μL of 80% (v / v) ethanol to the purification column, centrifuge at 10,000 × g at 4°C for 1 min, and discard the filtrate;

[0360] 7) Centrifuge the column at 4°C, 10,000 × g for 2 min.

[0361] 8) After centrifugation, carefully remove the purification column with the collection tube (if there is liquid in the collection tube, be careful not to splash the liquid onto the purification column), discard the collection tube, place the purification column in a new 1.5 mL centrifuge tube, add 100 μL of DEPC water to the purification column, let it stand at room temperature (25°C) for 2 minutes, and then centrifuge at 4°C, 10,000 × g, for 1 minute.

[0362] 9) Collecting the RNA solution from step 8) for subsequent experiments;

[0363] Step 2: RNA reverse transcription

[0364] HiScript III RT SuperMix for qPCR (purchased from Novozymes, catalog number R323-01) was used according to the product instructions. A 20 μL reverse transcription reaction system was prepared according to the reverse transcription protocol in the kit instructions, and total cellular RNA was reverse transcribed. The reverse transcription conditions were as follows: the reverse transcription reaction system was incubated at 37°C for 15 min, followed by incubation at 85°C for 5 s. 80 μL of DEPC water was added to each reverse transcription reaction system to obtain a solution containing cDNA.

[0365] Step 3: qPCR reaction system configuration

[0366] For each reverse transcription reaction system, 4 μL of the above-mentioned cDNA-containing solution was taken as a template, and the reagents provided by the AceQ Universal SYBR qPCR Master Mix kit (purchased from Vazyme, catalog number Q511-02) were used to prepare 20 μL of the qPCR reaction system on an ice box according to Table 5. Among them, Primer1 and Primer2 were the PCR primer sequences for amplifying the target gene DGAT2 and the internal reference gene GAPDH (as shown in Table 6), respectively. Each qPCR reaction system was placed in an ABI StepOnePlus Real-Time On the PCR instrument, a three-step method was used for amplification. The amplification program was pre-denaturation at 95°C for 10 minutes, then denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 30 seconds. After repeating the above denaturation, annealing, and extension process 40 times, a product W containing the amplified target gene DGAT2 and the internal reference gene GAPDH was obtained; the product W was then incubated at 95°C for 15 seconds, 60°C for 1 minute, and 95°C for 15 seconds. The real-time fluorescence quantitative PCR instrument collected the melting curves of the target gene DGAT2 and the internal reference gene GAPDH in the product W, respectively, and the Ct values ​​of the target gene DGAT2 and the internal reference gene GAPDH were obtained.

[0367] Table 5. RNA amplification reaction system

[0368] Table 6. Primer information

[0369] The comparative Ct (ΔΔCt) method was used to calculate the relative quantification of the target gene DGAT2 in each test group. The calculation method is as follows:

[0370] ΔCt(test group) = Ct(test group target gene) – Ct(test group reference gene)

[0371] ΔCt(control group) = Ct(control group target gene) – Ct(control group internal reference gene)

[0372] ΔΔCt(test group)=ΔCt(test group)-ΔCt(control group average)

[0373] ΔΔCt(control group) = ΔCt(control group) - ΔCt(control group average)

[0374] Wherein, ΔCt(control group average) is the arithmetic mean of the ΔCt(control group) of each of the four samples in the control group; thus, each sample in the test group and the control group corresponds to a ΔΔCt value.

[0375] The expression level of DGAT2 mRNA in the test group was normalized with the control group as the benchmark, and the expression level of DGAT2 mRNA in the control group was defined as 100%.

[0376] Relative expression level of DGAT2 mRNA in the test group = 2-ΔΔCt (test group) × 100%

[0377] DGAT2 mRNA levels were compared with the internal reference gene GAPDH, and the values ​​were normalized to the mean of the saline control group. The data were expressed as a percentage relative to the saline control group and presented as the mean plus the standard deviation.

[0378] The results are shown in FIG1 . In vivo verification in mice after a single dose showed that at a dose of 3 mg / kg, RD34DG004G showed an inhibitory effect greater than 80%, and RD34DG011G.2 showed an inhibitory effect greater than 90%.

[0379] Example 3: A modified siRNA for inhibiting DGAT2

[0380] This embodiment provides a modified siRNA for inhibiting DGAT2, wherein the modified siRNA includes RD34DG004LNA1, RD34DG004MOE1, RD34DG011LNA1, and RD34DG011MOE1.

[0381] The positive strands of the RD34DG011LNA1 are obtained by chemically modifying the sequence shown in SEQ ID NO. 21. From the 5' end to the 3' end, the nucleotides at positions 1 and 2, and 2 and 3 are nucleotides linked by phosphorothioate groups, the nucleotides at positions 2, 3, 4, 5, 6, 7, 8, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 are methoxy-modified nucleotides, the nucleotides at positions 9, 10, and 11 are fluorine-modified nucleotides, and the nucleotide at position 1 is an LNA-modified nucleotide. The antisense strands of the RD34DG011LNA1 are obtained by chemically modifying the sequence shown in SEQ ID NO. 22. From the 5' end to the 3' end, the nucleotides at positions 1 and 2, positions 2 and 3, positions 21 and 22, and positions 22 and 23 are nucleotides linked by phosphorothioate groups, the nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, 21, 22, and 23 are methoxy-modified nucleotides, and the nucleotides at positions 2, 6, 14, and 16 are fluorine-modified nucleotides.

[0382] The positive strands of the RD34DG011MOE1 are obtained by chemically modifying the sequence shown in SEQ ID NO. 21, wherein, from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and the nucleotides at positions 2 and 3 are nucleotides linked by thiophosphate groups, the nucleotides at positions 2, 3, 4, 5, 6, 7, 8, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 are methoxy-modified nucleotides, the nucleotides at positions 9, 10, and 11 are fluorine-modified nucleotides, and the nucleotide at position 1 is a 2'-O-methoxyethyl (2'-MOE)-modified nucleotide. The antisense strands of the RD34DG011MOE are obtained by chemically modifying the sequence shown in SEQ ID NO. 22. From the 5' end to the 3' end, the nucleotides at positions 1 and 2, positions 2 and 3, positions 21 and 22, and positions 22 and 23 are nucleotides linked by phosphorothioate groups, the nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, 21, 22, and 23 are methoxy-modified nucleotides, and the nucleotides at positions 2, 6, 14, and 16 are fluorine-modified nucleotides.

[0383] The positive strands of the RD34DG004LNA1 are obtained by chemically modifying a sequence selected from SEQ ID NO. 7, wherein, from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and the nucleotides at positions 2 and 3 are linked by thiophosphate groups, the nucleotides at positions 2, 3, 4, 5, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 are methoxy-modified nucleotides, the nucleotides at positions 7, 8, and 9 are fluorine-modified nucleotides, and the nucleotide at position 1 is an LNA-modified nucleotide. The antisense strands of the RD34DG004LNA1 are obtained by chemically modifying a sequence selected from SEQ ID NO. 8, wherein, from the 5' end to the 3' end, the nucleotides at positions 1 and 2, positions 2 and 3, positions 19 and 20, and positions 20 and 21 are linked by phosphorothioate groups, the nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 are methoxy-modified nucleotides, and the nucleotides at positions 2, 6, 14, and 16 are fluorine-modified nucleotides.

[0384] The positive strands of the RD34DG004MOE1 are obtained by chemically modifying a sequence selected from SEQ ID NO. 7, wherein, from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and 2 and 3 are linked by thiophosphate groups, the nucleotides at positions 2, 3, 4, 5, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 are methoxy-modified nucleotides, the nucleotides at positions 7, 8, and 9 are fluorine-modified nucleotides, and the nucleotide at position 1 is a 2'-O-methoxyethyl (2'-MOE)-modified nucleotide. The antisense strands of the RD34DG004LNA1 are obtained by chemically modifying a sequence selected from SEQ ID NO. 8, wherein, from the 5' end to the 3' end, the nucleotides at positions 1 and 2, positions 2 and 3, positions 19 and 20, and positions 20 and 21 are linked by phosphorothioate groups, the nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 are methoxy-modified nucleotides, and the nucleotides at positions 2, 6, 14, and 16 are fluorine-modified nucleotides.

[0385] Experimental Example 4: Single-dose study of modified siRNA in mice

[0386] This experimental example provides a single-dose study of modified siRNA in mice at a dose level of 3 mg / kg. The experimental procedure is as follows:

[0387] According to the results of Experimental Example 3, GalNAc was used to couple D34DG004 and RD34DG011 shown in Example 2 to obtain GalNAc-coupled siRNAs: RD34DG004G and RD34DG011G, and GalNAc was used to couple RD34DG004LNA1, RD34DG004MOE1, RD34DG011LNA1 and RD34DG011MOE1 shown in Example 3 to obtain GalNAc-coupled siRNAs: RD34DG004G and RD34DG011G. G004LNA1G, RD34DG004MOE1G, RD34DG011LNA1G, and RD34DG011MOE1G were administered subcutaneously to three C57BL / 6J mice (female, 6-8 weeks) with a single dose of 3 mg / kg of GalNAc-conjugated siRNA or a saline control. On the 10th or 17th day after administration, the mice were sacrificed, and liver samples were collected and quick-frozen in liquid nitrogen. Liver mRNA was extracted and analyzed by RT-qPCR.

[0388] The results, as shown in Figures 2 and 3, show that both RD34DG004 and RD34DG011 exhibited significant inhibitory effects in mice following a single dose. RD34DG011 achieved an inhibition rate exceeding 90% on day 10 and maintained an inhibitory effect exceeding 60% after 17 days. Furthermore, it was found that adding MOE or LNA modification to the 5' end of the sense strand significantly enhanced the inhibitory effect.

[0389] Obviously, the above embodiments are merely examples for clarity of explanation and are not intended to limit the implementation methods. Those skilled in the art will readily appreciate that other variations or modifications based on the above descriptions are possible. It is not necessary and impossible to enumerate all implementation methods here. Obvious variations or modifications arising therefrom remain within the scope of protection of the present disclosure. Industrial Applicability

[0390] The present disclosure provides siRNAs for inhibiting DGAT2. Experiments have shown that the siRNAs have high inhibitory activity against DGAT2.

Claims

1. An siRNA for inhibiting DGAT2, characterized in that, The siRNA contains a sense strand and an antisense strand, and the sense strand can at least partially reverse complement with the antisense strand to form a double-stranded region. Wherein, the sense strand comprises a nucleotide sequence of at least 15 consecutive nucleotides that is a part of the nucleotide sequence of SEQ ID NO.1 or has at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO.1, and the antisense strand comprises a nucleotide sequence of at least 15 consecutive nucleotides that is a part of the nucleotide sequence of SEQ ID NO.2 or has at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO.2; or, Wherein, the sense strand comprises a nucleotide sequence of at least 15 consecutive nucleotides that is a part of the nucleotide sequence of SEQ ID NO.3 or has at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO.3, and the antisense strand comprises a nucleotide sequence of at least 15 consecutive nucleotides that is a part of the nucleotide sequence of SEQ ID NO.4 or has at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO.4; or, Wherein, the sense strand comprises a nucleotide sequence of at least 15 consecutive nucleotides that is a part of the nucleotide sequence of SEQ ID NO.5 or has at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO.5, and the antisense strand comprises a nucleotide sequence of at least 15 consecutive nucleotides that is a part of the nucleotide sequence of SEQ ID NO.6 or has at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO.6; or, Wherein, the sense strand comprises a nucleotide sequence of at least 15 consecutive nucleotides that is a part of the nucleotide sequence of SEQ ID NO.7 or has at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO.7, and the antisense strand comprises a nucleotide sequence of at least 15 consecutive nucleotides that is a part of the nucleotide sequence of SEQ ID NO.8 or has at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO.8; or, Wherein, the sense strand comprises a nucleotide sequence of at least 15 consecutive nucleotides that is a part of the nucleotide sequence of SEQ ID NO.9 or has at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO.9, and the antisense strand comprises a nucleotide sequence of at least 15 consecutive nucleotides that is a part of the nucleotide sequence of SEQ ID NO.10 or has at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO.10; or, Wherein, the sense strand comprises a nucleotide sequence of a part of the nucleotide sequence of SEQ ID NO.11 or at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO.11, and the antisense strand comprises a nucleotide sequence of a part of the nucleotide sequence of SEQ ID NO.12 or at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO.12; or, Wherein, the sense strand comprises a nucleotide sequence of a part of the nucleotide sequence of SEQ ID NO.13 or at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO.13, and the antisense strand comprises a nucleotide sequence of a part of the nucleotide sequence of SEQ ID NO.14 or at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO.14; or, Wherein, the sense strand comprises a nucleotide sequence of a part of the nucleotide sequence of SEQ ID NO.15 or at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO.15, and the antisense strand comprises a nucleotide sequence of a part of the nucleotide sequence of SEQ ID NO.16 or at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO.16; or, Wherein, the sense strand comprises a nucleotide sequence of a part of the nucleotide sequence of SEQ ID NO.17 or at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO.17, and the antisense strand comprises a nucleotide sequence of a part of the nucleotide sequence of SEQ ID NO.18 or at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO.18; or, Wherein, the sense strand comprises a nucleotide sequence of a part of the nucleotide sequence of SEQ ID NO.19 or at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO.19, and the antisense strand comprises a nucleotide sequence of a part of the nucleotide sequence of SEQ ID NO.20 or at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO.20; or, Among them, the sense strand comprises a nucleotide sequence having at least 15 consecutive nucleotides that is part of the nucleotide sequence of SEQ ID NO.21 or has at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO.21, and the antisense strand comprises a nucleotide sequence having at least 15 consecutive nucleotides that is part of the nucleotide sequence of SEQ ID NO.22 or has at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO.22; or, Among them, the sense strand comprises a nucleotide sequence having at least 15 consecutive nucleotides that is part of the nucleotide sequence of SEQ ID NO.23 or has at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO.23, and the antisense strand comprises a nucleotide sequence having at least 15 consecutive nucleotides that is part of the nucleotide sequence of SEQ ID NO.24 or has at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO.24; or, Among them, the sense strand comprises a nucleotide sequence having at least 15 consecutive nucleotides that is part of the nucleotide sequence of SEQ ID NO.25 or has at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO.25, and the antisense strand comprises a nucleotide sequence having at least 15 consecutive nucleotides that is part of the nucleotide sequence of SEQ ID NO.26 or has at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO.26; or, Among them, the sense strand comprises a nucleotide sequence having at least 15 consecutive nucleotides that is part of the nucleotide sequence of SEQ ID NO.27 or has at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO.27, and the antisense strand comprises a nucleotide sequence having at least 15 consecutive nucleotides that is part of the nucleotide sequence of SEQ ID NO.28 or has at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO.28; or, Among them, the sense strand comprises a nucleotide sequence having at least 15 consecutive nucleotides that is part of the nucleotide sequence of SEQ ID NO.29 or has at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO.29, and the antisense strand comprises a nucleotide sequence having at least 15 consecutive nucleotides that is part of the nucleotide sequence of SEQ ID NO.30 or has at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO.30; or, Among them, the sense strand comprises a nucleotide sequence having at least 15 consecutive nucleotides that is part of the nucleotide sequence of SEQ ID NO.30 or has at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO.30, and the antisense strand comprises a nucleotide sequence having at least 15 consecutive nucleotides that is part of the nucleotide sequence of SEQ ID NO.30 or has at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO.30; or, Wherein, the sense strand comprises a nucleotide sequence of a part of the nucleotide sequence of SEQ ID NO. 31 or at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO. 31, and the antisense strand comprises a nucleotide sequence of a part of the nucleotide sequence of SEQ ID NO. 32 or at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO. 32; or, Wherein, the sense strand comprises a nucleotide sequence of a part of the nucleotide sequence of SEQ ID NO. 33 or at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO. 33, and the antisense strand comprises a nucleotide sequence of a part of the nucleotide sequence of SEQ ID NO. 34 or at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO. 34; or, Wherein, the sense strand comprises a nucleotide sequence of a part of the nucleotide sequence of SEQ ID NO. 35 or at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO. 35, and the antisense strand comprises a nucleotide sequence of a part of the nucleotide sequence of SEQ ID NO. 36 or at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with the complete nucleotide sequence of SEQ ID NO.

36.

2. The siRNA according to claim 1, wherein The sense strand consists of the nucleotide sequence as shown in SEQ ID NO. 1, and the antisense strand consists of the nucleotide sequence as shown in SEQ ID NO. 2; or, The sense strand consists of the nucleotide sequence as shown in SEQ ID NO. 3, and the antisense strand consists of the nucleotide sequence as shown in SEQ ID NO. 4; or, The sense strand consists of the nucleotide sequence as shown in SEQ ID NO. 5, and the antisense strand consists of the nucleotide sequence as shown in SEQ ID NO. 6; or, The sense strand consists of the nucleotide sequence as shown in SEQ ID NO. 7, and the antisense strand consists of the nucleotide sequence as shown in SEQ ID NO. 8; or, The sense strand consists of the nucleotide sequence as shown in SEQ ID NO. 9, and the antisense strand consists of the nucleotide sequence as shown in SEQ ID NO. 10; or, The sense strand consists of the nucleotide sequence as shown in SEQ ID NO. 11, and the antisense strand consists of the nucleotide sequence as shown in SEQ ID NO. 12; or, The sense strand consists of the nucleotide sequence as shown in SEQ ID NO. 13, and the antisense strand consists of the nucleotide sequence as shown in SEQ ID NO. 14; or, The sense strand consists of the nucleotide sequence shown in SEQ ID NO.15, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.16; or, The sense strand consists of the nucleotide sequence shown in SEQ ID NO.17, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.18; or, The sense strand consists of the nucleotide sequence shown in SEQ ID NO.19, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.20; or, The sense strand consists of the nucleotide sequence shown in SEQ ID NO.21, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.22; or, The sense strand consists of the nucleotide sequence shown in SEQ ID NO.23, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.24; or, The sense strand consists of the nucleotide sequence shown in SEQ ID NO.25, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.26; or, The sense strand consists of the nucleotide sequence shown in SEQ ID NO.27, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.28; or, The sense strand consists of the nucleotide sequence shown in SEQ ID NO.29, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.30; or, The sense strand consists of the nucleotide sequence shown in SEQ ID NO.31, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.32; or, The sense strand consists of the nucleotide sequence shown in SEQ ID NO.33, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.34; or, The sense strand consists of the nucleotide sequence shown as 1, and the antisense strand consists of the nucleotide sequence shown in SEQ ID NO.

36.

3. The siRNA according to claim 1, wherein The sense strand contains the nucleotide sequence shown in SEQ ID NO.7, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.8, or, wherein, the sense strand contains the nucleotide sequence shown in SEQ ID NO.21, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.

22.

4. The siRNA according to claim 1, wherein At least one nucleotide in the sense strand or the antisense strand of the siRNA is a modified nucleotide.

5. The siRNA according to claim 4, wherein The modification is a chemical modification, and the chemical modification is selected from one or more of methoxy modification, fluoro modification, phosphorothioate modification, LNA modification, and methoxyethyl modification.

6. The siRNA according to any one of claims 4 to 5, characterized in that, The fluorine-modified nucleotides are located in both the antisense strand and the sense strand of the nucleotide sequence. And, in the direction from the 5'-end to the 3'-end, at least the 9th, 10th, and 11th nucleotides of the sense strand are fluorine-modified nucleotides, and at least the 2nd, 6th, 14th, and 16th nucleotides of the antisense strand are fluorine-modified nucleotides; or, The fluorinated modified nucleotides are located in the antisense strand and the sense strand of the nucleotide sequence. And, in the direction from the 5'-end to the 3'-end, the nucleotides at least at the 7th, 8th, and 9th positions of the sense strand are fluorinated modified nucleotides, and the nucleotides at least at the 2nd, 6th, 14th, and 16th positions of the antisense strand are fluorinated modified nucleotides.

7. The siRNA according to any one of claims 4 to 5, characterized in that, The methoxy modified nucleotides are located in the antisense strand and the sense strand of the nucleotide sequence. And, in the direction from the 5'-end to the 3'-end, the nucleotides at least at the 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, 20th, and 21st positions of the sense strand are methoxy modified nucleotides, and the nucleotides at least at the 1st, 3rd, 4th, 5th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 17th, 18th, 19th, 20th, 21st, 22nd, and 23rd positions of the antisense strand are methoxy modified nucleotides; or, The methoxy modified nucleotides are located in the antisense strand and the sense strand of the nucleotide sequence. And, in the direction from the 5'-end to the 3'-end, the nucleotides at least at the 2nd, 3rd, 4th, 5th, 6th, 10th, 11th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, and 19th positions of the sense strand are methoxy modified nucleotides, and the nucleotides at least at the 1st, 3rd, 4th, 5th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 17th, 18th, 19th, 20th, and 21st positions of the antisense strand are methoxy modified nucleotides.

8. The siRNA according to any one of claims 4 to 5, characterized in that, The nucleotides linked by phosphorothioate groups are located in the antisense strand and the sense strand of the nucleotide sequence. And, in the direction from the 5'-end to the 3'-end, the nucleotides between at least the 1st and 2nd positions and between the 2nd and 3rd positions of the sense strand are linked by phosphorothioate groups, and the nucleotides between at least the 1st and 2nd positions, between the 2nd and 3rd positions, between the 21st and 22nd positions, and between the 22nd and 23rd positions of the antisense strand are linked by phosphorothioate groups; or, The nucleotides linked by phosphorothioate groups are located in the antisense strand and the sense strand of the nucleotide sequence. And, in the direction from the 5'-end to the 3'-end, the nucleotides between at least the 1st and 2nd positions and between the 2nd and 3rd positions of the sense strand are linked by phosphorothioate groups, and the nucleotides between at least the 1st and 2nd positions, between the 2nd and 3rd positions, between the 19th and 20th positions, and between the 20th and 21st positions of the antisense strand are linked by phosphorothioate groups.

9. The siRNA according to any one of claims 4 to 5, characterized in that, The nucleotides modified with methoxyethyl are located in the sense strand of the nucleotide sequence. And, in the direction from the 5'-end to the 3'-end, the nucleotide at least at the 1st position of the sense strand is a nucleotide modified with methoxyethyl.

10. The siRNA according to any one of claims 4 to 5, characterized in that, The nucleotides modified with LNA are located in the sense strand of the nucleotide sequence. And, in the direction from the 5'-end to the 3'-end, the nucleotide at least at the 1st position of the sense strand is a nucleotide modified with LNA.

11. The siRNA according to any one of claims 4 to 5, characterized in that, The 3'-end of the sense strand of the siRNA is conjugated with a ligand, and the ligand is GalNAc.

12. A product for inhibiting DGAT2, characterized in that, The product contains an active ingredient and a pharmaceutically acceptable carrier, and the active ingredient is the siRNA described in any one of claims 1 to 11.

13. The product according to claim 12, wherein, The product is a pharmaceutical composition or a kit.

14. Use of the siRNA according to any one of claims 1 to 11 or the product according to any one of claims 12 to 13 in the preparation of a product for preventing, diagnosing and / or treating a pathological condition or disease caused by DGAT2.

15. Use of the siRNA according to any one of claims 1 to 11 or the product according to any one of claims 12 to 13 in preventing, diagnosing and / or treating a pathological condition or disease caused by DGAT2.

16. A method for preventing and / or treating a pathological condition or disease caused by DGAT2, characterized in that, Administer the siRNA according to any one of claims 1 to 11 or the product according to any one of claims 12 to 13 to a subject.

Images