Carbon monoxide dehydrogenase exhibiting excellent oxygen resistance and enzyme activity under atmospheric conditions, and use thereof

By modifying amino acids at positions 559 and 610, the CO dehydrogenase gains significant oxygen tolerance and enzyme activity, enabling efficient conversion of carbon monoxide to carbon dioxide even in the presence of oxygen, addressing the limitations of existing CO dehydrogenases.

WO2025143342A1PCT designated stage expired Publication Date: 2025-07-03UNIST (ULSAN NAT INST OF SCI & TECH)
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2024/000556
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-28
Filing Date
2024-01-11
Publication Date
2025-07-03

AI Technical Summary

Technical Problem

Existing carbon monoxide dehydrogenases (CO dehydrogenases) lack sufficient oxygen tolerance and enzyme activity under atmospheric conditions, rendering them ineffective in oxidizing carbon monoxide in the presence of oxygen, which is commonly found in waste gases.

Method used

Modification of specific amino acids at positions 559 and 610 of the CO dehydrogenase, such as substitutions with Tryptophan or Histidine, enhances oxygen tolerance and enzyme activity, allowing the enzyme to maintain activity even in the presence of oxygen.

Benefits of technology

The modified CO dehydrogenase exhibits increased oxygen tolerance by 1 to 250 times and enzyme activity, effectively converting carbon monoxide into carbon dioxide even in the presence of oxygen, suitable for industrial and household applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2024000556_03072025_PF_FP_ABST
    Figure KR2024000556_03072025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a carbon monoxide dehydrogenase exhibiting excellent oxygen resistance and enzyme activity under atmospheric conditions, a preparation method therefor, and use thereof. The carbon monoxide dehydrogenase according to the present invention exhibits increased enzyme activity, oxygen resistance, or both.
Need to check novelty before this filing date? Find Prior Art

Description

Carbon monoxide dehydrogenase with excellent oxygen tolerance and enzyme activity under atmospheric conditions and its use

[0001] The present invention relates to a carbon monoxide dehydrogenase having excellent oxygen tolerance and enzyme activity under atmospheric conditions and its use.

[0002] Incomplete combustion of carbon in homes and industrial settings generates significant amounts of carbon monoxide. Carbon monoxide has a much higher affinity for the hemoglobin protein in red blood cells than oxygen, and this allows it to bind. Consequently, inhaling air containing carbon monoxide in concentrations exceeding a certain level can lead to oxygen deprivation, increased heart rate, increased blood pressure, and vascular damage. In the worst cases, this can lead to unconsciousness and even death. Therefore, it is necessary to simply oxidize toxic carbon monoxide in the air to harmless carbon dioxide at room temperature and pressure.

[0003] In particular, in the case of cigarettes, carbon dioxide accounts for 9 to 14% (45 to 65 mg / cigarette) of the gas inhaled by smokers, while carbon monoxide accounts for 2.8 to 4.6% (14 to 23 mg / cigarette), which is a very high proportion of carbon monoxide generated and inhaled, posing a fatal threat to the health of smokers and passive smokers. Although cigarette filters contain adsorbents such as activated carbon, they do not have the specificity and performance to adsorb carbon monoxide, making them ineffective in removing carbon monoxide.

[0004] Meanwhile, carbon monoxide dehydrogenase (CO dehydrogenase: CODH) is a metabolic enzyme in microorganisms that can oxidize highly toxic carbon monoxide gas into carbon dioxide at room temperature and pressure (see Reaction Scheme 1 below). Its unique characteristic is that it uses water molecules as electron acceptors instead of oxygen, and water molecules, not oxygen molecules, are required for carbon monoxide oxidation.

[0005] [Reaction Formula 1]

[0006] CO + H2O ↔ CO2+ 2H + + 2e -

[0007] While CO dehydrogenases known to date have the advantage of relatively high unit activity, they are extremely vulnerable to oxygen molecules in the air, which causes a rapid decrease in enzyme activity. Most waste gases containing carbon monoxide, even at low concentrations, contain oxygen. Attempts to oxidize CO in waste gases using CO dehydrogenase have failed to achieve the desired goal due to the rapid decrease in CO dehydrogenase activity caused by the oxygen molecules in the waste gases. Therefore, it is necessary to develop a CO dehydrogenase that has both excellent oxygen tolerance and excellent enzyme activity under these atmospheric conditions.

[0008] The background technology described above is something that the inventor possessed or acquired in the process of deriving the disclosure of the present application, and cannot necessarily be said to be a publicly known technology disclosed to the general public prior to the present application.

[0009] The present invention aims to solve the above-described problems by providing a carbon monoxide dehydrogenase having excellent oxygen tolerance and enzyme activity under atmospheric conditions, a method for producing the same, and a use thereof.

[0010] However, the problems to be solved by the present invention are not limited to the problems mentioned above, and other problems not mentioned can be clearly understood by a person having ordinary skill in the relevant technical field from the description below.

[0011] The carbon monoxide dehydrogenase according to the present invention has increased enzyme activity, oxygen resistance, or both.

[0012] In one embodiment, the carbon monoxide dehydrogenase may have a modification at position 559, position 610, or both amino acids.

[0013] In one embodiment, the modification may be at least one form selected from the group consisting of deletion, addition and substitution.

[0014] In one embodiment, the 559th amino acid of the carbon monoxide dehydrogenase may be alanine, and the 610th amino acid of the carbon monoxide dehydrogenase may be valine.

[0015] In one embodiment, when the modification is the substitution, the 559th amino acid, Alanine, of the carbon monoxide dehydrogenase may be substituted with Tryptophan or Histidine, and the 610th amino acid, Valine, of the carbon monoxide dehydrogenase may be substituted with Alanine, Serine, Tryptophan, or Histidine.

[0016] According to one embodiment, the carbon monoxide dehydrogenase may comprise a protein encoded by a polynucleotide comprising at least one base sequence selected from the group consisting of base sequences of SEQ ID NOs: 18 to 21.

[0017] In one embodiment, the oxygen tolerance may be increased by 1 to 250 times compared to the wild type.

[0018] In one embodiment, the enzyme activity may be increased by 1 to 250 times compared to the wild type.

[0019] In one embodiment, the carbon monoxide dehydrogenase may have increased enzyme activity, oxygen tolerance, or both, at a temperature of 10° C. to 70° C. and a pressure of 1000 hPa to 5000 hPa.

[0020] According to one embodiment, the carbon monoxide dehydrogenase comprises a protein having an amino acid sequence of carbon monoxide dehydrogenase and a sequence homology of 70% or more, and the carbon monoxide dehydrogenase may be at least one carbon monoxide dehydrogenase selected from the group consisting of carbon monoxide dehydrogenase-1 (CODH-1), carbon monoxide dehydrogenase-2 (CODH-2), carbon monoxide dehydrogenase-3 (CODH-3), and carbon monoxide dehydrogenase-4 (CODH-4).

[0021] The polynucleotide of the present invention encodes a carbon monoxide dehydrogenase according to the present invention.

[0022] The vector of the present invention expresses carbon monoxide dehydrogenase according to the present invention, including a polynucleotide according to the present invention.

[0023] The microorganism of the present invention clones or expresses the vector according to the present invention.

[0024] The method for producing carbon monoxide dehydrogenase of the present invention comprises the steps of culturing a microorganism according to the present invention; treating the microorganism with a substance capable of promoting the expression of carbon monoxide dehydrogenase; and isolating and purifying a protein from the microorganism.

[0025] The carbon monoxide removal device of the present invention includes a carbon monoxide dehydrogenase according to the present invention.

[0026] The filter of the present invention comprises a carbon monoxide dehydrogenase according to the present invention.

[0027] The present invention can provide a carbon monoxide dehydrogenase having excellent oxygen tolerance and enzyme activity under atmospheric conditions, a method for producing the same, and a use thereof.

[0028] Specifically, the carbon monoxide dehydrogenase according to the present invention has increased oxygen tolerance and / or enzyme activity under atmospheric conditions, and the carbon monoxide dehydrogenase can easily oxidize toxic carbon monoxide at room temperature and pressure to convert it into carbon dioxide, thereby detoxifying it, and can effectively oxidize carbon monoxide even in a gas containing oxygen, etc. Furthermore, the carbon monoxide dehydrogenase can be used in various ways, such as removing carbon monoxide emitted in large quantities from industries such as petrochemicals and steel industries, cigarette combustion, household cooking appliances, and various boiler combustion through cigarette filters, air purifiers, household cooking appliance suction filters, gas boilers, etc.

[0029] Figure 1 is a three-dimensional stereoscopic structure showing a gas tunnel through which a substrate passes inside the protein in a carbon monoxide dehydrogenase according to the present invention.

[0030] Figure 2 is a three-dimensional stereoscopic structure showing an oxygen-passing tunnel residue at the tunnel entrance in a carbon monoxide dehydrogenase according to the present invention.

[0031] Figure 3 is a graph showing the oxygen stability of carbon monoxide dehydrogenase according to an embodiment of the present invention.

[0032] Figure 4 is a three-dimensional stereoscopic structure showing a three-dimensional protein crystal structure and a gas tunnel of carbon monoxide dehydrogenase according to an embodiment of the present invention.

[0033] Hereinafter, embodiments are described in detail with reference to the attached drawings. However, the embodiments may be modified in various ways, and the scope of the patent application is not limited or restricted by these embodiments. It should be understood that all modifications, equivalents, or alternatives to the embodiments are included within the scope of the patent application.

[0034] The terms used in the examples are for illustrative purposes only and should not be construed as limiting. Singular expressions include plural expressions unless the context clearly dictates otherwise. In this specification, terms such as "comprise" or "have" are intended to specify the presence of a feature, number, step, operation, component, part, or combination thereof described in the specification, but should be understood to not preclude the presence or addition of one or more other features, numbers, steps, operations, components, parts, or combinations thereof.

[0035] Unless otherwise defined, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by a person of ordinary skill in the art to which the embodiments pertain. Terms defined in commonly used dictionaries should be interpreted as having a meaning consistent with their meaning in the context of the relevant technology, and shall not be interpreted in an idealized or overly formal sense unless explicitly defined herein.

[0036] In addition, when describing with reference to the attached drawings, identical components will be assigned the same reference numerals regardless of the drawing numbers, and redundant descriptions thereof will be omitted. When describing embodiments, if a detailed description of a related known technology is judged to unnecessarily obscure the gist of the embodiment, the detailed description will be omitted.

[0037] Additionally, terms such as first, second, A, B, (a), (b), etc. may be used to describe components of the embodiments. These terms are only intended to distinguish the components from other components, and the nature, order, or sequence of the components are not limited by the terms. When a component is described as being "connected," "coupled," or "connected" to another component, it should be understood that the component may be directly connected or connected to the other component, but another component may also be "connected," "coupled," or "connected" between each component.

[0038] Components included in one embodiment and components with common functions will be described using the same names in other embodiments. Unless otherwise stated, the descriptions given in one embodiment can be applied to other embodiments, and detailed descriptions will be omitted to the extent of overlap.

[0039]

[0040] The carbon monoxide dehydrogenase according to the present invention has increased enzyme activity, oxygen resistance, or both.

[0041] In one embodiment, the enzyme activity may mean the activity of the carbon monoxide dehydrogenase to catalyze the reaction of the following reaction scheme 1.

[0042] [Reaction Formula 1]

[0043] CO + H2O ↔ CO2+ 2H + + 2e -

[0044] In one embodiment, the activity of the carbon monoxide dehydrogenase can be determined by contacting carbon monoxide and water with the carbon monoxide dehydrogenase and measuring the carbon dioxide, hydrogen ions, or electrons generated.

[0045] In one embodiment, the oxygen tolerance refers to the ability of the carbon monoxide dehydrogenase to maintain activity even in the presence of oxygen under atmospheric conditions, and can be specifically confirmed by first contacting the enzyme with a specific concentration of oxygen and then measuring the activity of the carbon monoxide dehydrogenase.

[0046] In one embodiment, the oxygen tolerance can be determined by measuring the maximum oxygen concentration at which the activity of the enzyme is maintained at 20% to 80%, 20% to 70%, 20% to 60%, 30% to 80%, 30% to 70%, 30% to 60%, 40% to 80%, 40% to 70%, or 40% to 60% of the initial activity.

[0047] In one embodiment, carbon monoxide can be removed by contacting carbon monoxide with a carbon monoxide dehydrogenase having increased oxygen tolerance and / or enzyme activity under atmospheric conditions.

[0048] According to one embodiment, through the above contact, carbon monoxide reacts with water and is transformed into carbon dioxide, hydrogen ions, and electrons, so that carbon monoxide can be removed, and carbon dioxide can be removed with excellent efficiency even in the presence of oxygen under atmospheric conditions.

[0049] In one embodiment, carbon dioxide can be produced by contacting carbon monoxide with a carbon monoxide dehydrogenase (CO dehydrogenase) having increased oxygen tolerance and / or enzyme activity under atmospheric conditions.

[0050] According to one embodiment, through the above contact, carbon monoxide reacts with water and is transformed into carbon dioxide, hydrogen ions, and electrons, so that carbon dioxide can be produced, and carbon dioxide can be produced with excellent efficiency even in the presence of oxygen.

[0051] In one embodiment, the carbon monoxide dehydrogenase has increased enzyme activity under atmospheric conditions, oxygen tolerance, or both, and can easily oxidize toxic carbon monoxide at room temperature and pressure to detoxify it by converting it into carbon dioxide, and can effectively oxidize carbon monoxide even in a gas containing oxygen or the like.

[0052]

[0053] In one embodiment, the carbon monoxide dehydrogenase may have a modification at position 559, position 610, or both amino acids.

[0054] In one embodiment, the carbon monoxide dehydrogenase may be derived from natural sources or obtained by various protein synthesis methods well known in the art. For example, it may be produced using polynucleotide recombination and protein expression systems, in vitro synthesis through chemical synthesis such as protein synthesis, and cell-free protein synthesis methods. Furthermore, as another example, the carbon monoxide dehydrogenase may be a peptide, an extract of plant-derived tissue or cells, or a product obtained by culturing microorganisms (e.g., bacteria or fungi, and particularly yeast).

[0055] According to one embodiment, the protein may mean a polymer composed of two or more amino acids linked by amide bonds (or peptide bonds).

[0056] In one embodiment, a protecting group may be bonded to the N- or C-terminus of the carbon monoxide dehydrogenase to obtain better chemical stability, enhanced pharmacological properties (half-life, absorbability, potency, efficacy, etc.), altered specificity (e.g., broad biological activity spectrum), and reduced antigenicity. The protecting group may be an acetyl group, a fluorenyl methoxy carbonyl group, a formyl group, a palmitoyl group, a myristyl group, a stearyl group, or polyethylene glycol (PEG), but any component that can enhance the modification of the carbon monoxide dehydrogenase, particularly the stability of the carbon monoxide dehydrogenase, may be included without limitation.

[0057] In one embodiment, the stability may mean not only in vivo stability, which protects the carbon monoxide dehydrogenase from attack by in vivo protein cleavage enzymes, but also storage stability (e.g., room temperature storage stability).

[0058] In addition, the above carbon monoxide dehydrogenase may additionally include an amino acid sequence manufactured for a specific purpose for a targeting sequence, a tag, or a labeled residue, and may be specifically in a form linked to a protein at the end of a His-tag expressed from a pET-28 (SEQ ID NO: 3) plasmid.

[0059]

[0060] In one embodiment, the modification may be at least one form selected from the group consisting of deletion, addition and substitution.

[0061] In one embodiment, the modification may be a modification of one amino acid or a modification of two or more amino acids.

[0062] In one embodiment, the deletion is a deletion mutation, which refers to a mutation in which one or more nucleotides are missing from DNA. The deletion of several nucleotides can cause various problems, the most notable of which is a frameshift. A frameshift causes the ribosome to shift out of its reading frame during protein translation. If the missing nucleotides are not a multiple of three, a protein with an entirely different amino acid is produced, and deletion mutations can have serious implications for cellular function.

[0063] In one embodiment, the insertion is an insertional mutation, which refers to a mutation in which one or more nucleotides are inserted into DNA. The insertion of new nucleotides can cause various problems, the most notable of which is a frameshift. A frameshift causes the ribosome to shift out of the reading frame when reading mRNA during protein translation. If the inserted nucleotide is not a multiple of 3, a protein with an entirely different amino acid is produced, and insertional mutations can have serious consequences for cellular function.

[0064]

[0065] In one embodiment, the 559th amino acid of the carbon monoxide dehydrogenase may be alanine, and the 610th amino acid of the carbon monoxide dehydrogenase may be valine.

[0066] According to one embodiment, the tunnel through which the gaseous substrate of the carbon monoxide dehydrogenase passes can be divided into a selective CO tunnel through which only carbon monoxide passes and a non-selective CO tunnel through which oxygen passes.

[0067] In one embodiment, the 559th amino acid and the 610th amino acid of the carbon monoxide dehydrogenase may be key amino acids that constitute a tunnel of a non-selective CO tunnel through which oxygen passes.

[0068]

[0069] In one embodiment, when the modification is the substitution, the 559th amino acid, Alanine, of the carbon monoxide dehydrogenase may be substituted with Tryptophan or Histidine, and the 610th amino acid, Valine, of the carbon monoxide dehydrogenase may be substituted with Alanine, Serine, Tryptophan, or Histidine.

[0070] In one embodiment, the substitution may be a substitution of one amino acid or a substitution of two or more amino acids.

[0071] In one embodiment, the substitution refers to synthesizing a mutation by replacing an amino acid at a specific position in the amino acid sequence with another amino acid. Any method used in the technical field of the present invention may be used as long as it does not deviate from the purpose of the present invention. For example, it may be a saturated mutagenesis method, a random mutagenesis method, a site-directed mutagenesis method, etc. Preferably, it may be a site-directed mutagenesis method.

[0072] In one embodiment, oxygen can move into carbon monoxide dehydrogenase through a non-selective tunnel. However, if oxygen passes through this non-selective tunnel, the enzyme loses its oxygen tolerance and can rapidly lose its enzymatic activity in the presence of oxygen. Therefore, by substituting some of the amino acids that make up the non-selective tunnel through which oxygen passes, the non-selective tunnel through which oxygen passes is narrowed, thereby blocking or disappearing the tunnel, thereby preventing oxygen from passing through. This can produce carbon monoxide dehydrogenase with excellent oxygen tolerance and high enzymatic activity.

[0073]

[0074] According to one embodiment, the carbon monoxide dehydrogenase may comprise a protein encoded by a polynucleotide comprising at least one base sequence selected from the group consisting of base sequences of SEQ ID NOs: 18 to 21.

[0075] In one embodiment, the polynucleotide means a plurality of nucleotides sequentially linked, and the polynucleotide can express the carbon monoxide dehydrogenase. A polynucleotide encoding a protein refers to a polynucleotide encoding an enzyme, or a polynucleotide further comprising additional coding and / or non-coding sequences.

[0076]

[0077] In one embodiment, the oxygen tolerance may be increased by 1 to 250 times compared to the wild type.

[0078] In one embodiment, the carbon monoxide dehydrogenase may have an oxygen tolerance increased by 1 to 250 times, 1 to 150 times, 1 to 125 times, 50 to 250 times, 50 to 150 times, 50 to 125 times, 75 to 250 times, 75 to 150 times, or 75 to 125 times compared to the wild type.

[0079] In one embodiment, the oxygen tolerance refers to the ability of the carbon monoxide dehydrogenase to maintain activity even in the presence of oxygen under atmospheric conditions, and can be specifically confirmed by first contacting the enzyme with a specific concentration of oxygen and then measuring the activity of the carbon monoxide dehydrogenase.

[0080]

[0081] In one embodiment, the enzyme activity may be increased by 1 to 250 times compared to the wild type.

[0082] In one embodiment, the carbon monoxide dehydrogenase may have an enzyme activity increased by 1 to 250 times, 1 to 150 times, 1 to 125 times, 50 to 250 times, 50 to 150 times, 50 to 125 times, 75 to 200 times, 75 to 150 times, or 75 to 125 times compared to the wild type.

[0083] In one embodiment, the enzyme activity means the activity of the carbon monoxide dehydrogenase to catalyze the reaction of the following reaction scheme 1:

[0084] [Reaction Formula 1]

[0085] CO + H2O ↔ CO2+ 2H + + 2e -

[0086] In one embodiment, the activity of the carbon monoxide dehydrogenase can be determined by contacting carbon monoxide and water with the carbon monoxide dehydrogenase and measuring the carbon dioxide, hydrogen ions, or electrons generated.

[0087]

[0088] In one embodiment, the carbon monoxide dehydrogenase may have increased enzyme activity, oxygen tolerance, or both, at a temperature of 10° C. to 70° C. and a pressure of 1000 hPa to 5000 hPa.

[0089] In one embodiment, the carbon monoxide dehydrogenase is at a temperature of 10° C. to 70° C.; 15° C. to 70° C.; 20° C. to 70° C.; 25° C. to 70° C.; 30° C. to 70° C.; 35° C. to 70° C.; 40° C. to 70° C.; 45° C. to 70° C.; 50° C. to 70° C.; 55° C. to 70° C.; 60° C. to 70° C.; 65° C. to 70° C.; 10° C. to 65° C.; 10° C. to 60° C.; 10° C. to 50° C.; 10° C. to 40° C.; 10° C. to 30° C. At temperatures of 10°C to 20°C, enzyme activity, oxygen tolerance, or both may be increased.

[0090] In one embodiment, the carbon monoxide dehydrogenase has a pressure of 1000 hPa to 5000 hPa; 1500 hPa to 5000 hPa; 2000 hPa to 5000 hPa; 2500 hPa to 5000 hPa; 3000 hPa to 5000 hPa; 3500 hPa to 5000 hPa; 4000 hPa to 5000 hPa; 4500 hPa to 5000 hPa; 4800 hPa to 5000 hPa; 1000 hPa to 4500 hPa; 1000 hPa to 4000 hPa; 1000 hPa to 3500 hPa; 1000 hPa to 3000 hPa; 1000 hPa to 2500 hPa; At pressures of 1000 hPa to 2000 hPa; 1000 hPa to 1500 hPa; enzyme activity, oxygen tolerance, or both may be increased.

[0091] According to one embodiment, the carbon monoxide dehydrogenase may exhibit reduced reaction activity due to low temperature when the temperature is lower than 10°C, and may have problems with long-term operation due to thermal stability issues of the enzyme when the temperature is higher than 70°C.

[0092] According to one embodiment, the carbon monoxide dehydrogenase may have a problem in that the reaction rate of the enzyme is reduced when the pressure is less than 1000 hPa, and may have a problem in the long-term stability of the enzyme due to pressure when the pressure is more than 5000 hPa.

[0093]

[0094] According to one embodiment, the carbon monoxide dehydrogenase comprises a protein having an amino acid sequence of carbon monoxide dehydrogenase and a sequence homology of 70% or more, and the carbon monoxide dehydrogenase may be at least one carbon monoxide dehydrogenase selected from the group consisting of carbon monoxide dehydrogenase-1 (CODH-1), carbon monoxide dehydrogenase-2 (CODH-2), carbon monoxide dehydrogenase-3 (CODH-3), and carbon monoxide dehydrogenase-4 (CODH-4).

[0095] In one embodiment, the carbon monoxide dehydrogenase may include a protein having a sequence identity of at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 95%, at least about 97%, at least about 98%, or at least about 99% to an amino acid sequence of carbon monoxide dehydrogenase.

[0096] According to one embodiment, the homology is intended to indicate the degree of similarity with a wild-type amino acid sequence, and a comparison of such homology can be performed using a comparison program widely known in the art, and the homology between two or more sequences can be calculated as a percentage (%).

[0097] In one embodiment, the carbon monoxide dehydrogenase may be an isozyme of carbon monoxide dehydrogenase. Specifically, the carbon monoxide dehydrogenase is Moorella thermoacetica, Rhodospirillum rubrum, Carboxydothermus hydrogenoformans, Methanococcus vannielii, Methanosarcina barkeri, Methanothermobacter thermautotrophicus, Clostridium pasteurianum, Oligotropha carboxidovorans, Aeropyrum pernix, Ferroglobus placidus, Clostridium autoethanogenum, It may be a carbon monoxide dehydrogenase derived from Clostridium ragsdalei, Clostridium ljungdahlii, Clostridium scatologenes, Clostridium acetobutylicum, Clostridium beijerinckii, C. perfringens, C. thermocellum, C. kluyveri or C. botulinum, and specifically, it may be a carbon monoxide dehydrogenase derived from Carboxydothermus hydrogenoformans.

[0098] According to one embodiment, the carbon monoxide dehydrogenase may be at least one carbon monoxide dehydrogenase selected from the group consisting of carbon monoxide dehydrogenase-1 (CODH-1), carbon monoxide dehydrogenase-2 (CODH-2), carbon monoxide dehydrogenase-3 (CODH-3), and carbon monoxide dehydrogenase-4 (CODH-4), specifically carbon monoxide dehydrogenase-2 (CODH-2) or carbon monoxide dehydrogenase-4 (CODH-4), and more specifically, may be a protein encoded by a polynucleotide consisting of a base sequence of SEQ ID NO: 1 or 2.

[0099]

[0100] The polynucleotide of the present invention encodes a carbon monoxide dehydrogenase according to the present invention.

[0101] According to one embodiment, the polynucleotide means a plurality of nucleotides connected in series, and the polynucleotide encodes a carbon monoxide dehydrogenase according to the present invention, and can express the carbon monoxide dehydrogenase.

[0102] In one embodiment, the expression refers to the process by which a polypeptide is produced from a structural gene. The process includes the transcription of the gene (polynucleotide) into mRNA, and the translation of such mRNA into polypeptide (protein)(s).

[0103] In one embodiment, the polynucleotide encoding the enzyme refers to a polynucleotide encoding the enzyme, or a polynucleotide further comprising additional coding and / or non-coding sequences.

[0104] According to one embodiment, when the carbon monoxide dehydrogenase is a wild-type carbon monoxide dehydrogenase-2 (CODH-2) derived from Carboxydothermus hydrogenoformans, it may be a polynucleotide consisting of a base sequence of SEQ ID NO: 1, and when the carbon monoxide dehydrogenase is a wild-type carbon monoxide dehydrogenase-4 (CODH-4) derived from Carboxydothermus hydrogenoformans, it may be a polynucleotide consisting of a base sequence of SEQ ID NO: 2.

[0105] Additionally, the polynucleotide encoding carbon monoxide dehydrogenase with increased oxygen tolerance and / or enzyme activity under the above atmospheric conditions may be a polynucleotide consisting of one base sequence selected from the group consisting of base sequences of SEQ ID NOs: 18 to 21.

[0106]

[0107] The vector of the present invention expresses carbon monoxide dehydrogenase according to the present invention, including a polynucleotide according to the present invention.

[0108] In one embodiment, the vector refers to a means for expressing a target gene in a host cell. The vector replicates DNA and can be independently reproduced in the host cell. For example, it may include a plasmid vector, a cosmid vector, a bacteriophage vector, an adenovirus vector, a retrovirus vector, and a viral vector such as an adeno-associated virus vector.

[0109] According to one embodiment, the vector expressing the carbon monoxide dehydrogenase may be a recombinant vector, and a vector that can be used as a recombinant vector may be produced by manipulating a plasmid often used in the art (e.g., pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8 / 9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14, pGEX series, pET series (including pET-28) and pUC19, etc.), phage or virus (e.g., SV40, etc.), and specifically, may be pET-28 (SEQ ID NO: 3).

[0110] In one embodiment, the recombinant vector comprises any cloning or expression vector containing the desired cloned gene(s).

[0111] In one embodiment, the recombinant cell refers to a cell that replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, a heterologous peptide, or a heterologous nucleic acid. The recombinant cell may express a gene or gene fragment not found in the cell's native form, either in sense or antisense form. The recombinant cell may also express a gene found in the cell in its native state, but in a modified form that has been reintroduced into the cell by artificial means.

[0112] In one embodiment, the polynucleotide encoding the enzyme in the recombinant vector may be operably linked to a promoter.

[0113] In one embodiment, operatively linked means a functional linkage between a nucleotide expression regulatory sequence (e.g., a promoter sequence) and another nucleotide sequence. The regulatory sequence is capable of regulating the transcription and / or translation of the other nucleotide sequence by being operatively linked.

[0114] In one embodiment, the recombinant vector may be constructed as a vector typically for cloning or expression. The expression vector may be any conventional vector used in the art to express foreign proteins in plants, animals, or microorganisms. The recombinant vector may be constructed using various methods known in the art.

[0115] In one embodiment, the recombinant vector can be constructed using a prokaryotic cell or a eukaryotic cell as a host. For example, when the vector used is an expression vector and a prokaryotic cell is used as a host, it generally includes a strong promoter capable of initiating transcription (e.g., a CMV promoter, a trp promoter, a lac promoter, a tac promoter, a T7 promoter, etc.), a ribosome binding site for initiating translation, and a transcription / translation termination sequence. When a eukaryotic cell is used as a host, the replication origin that operates in a eukaryotic cell included in the vector includes, but is not limited to, the f1 replication origin, the SV40 replication origin, the pMB1 replication origin, the adeno-replication origin, the AAV replication origin, and the BBV replication origin. Additionally, promoters derived from the genome of mammalian cells (e.g., metallothionine promoter) or promoters derived from mammalian viruses (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter and tk promoter of HSV) can be used, and generally have a polyadenylation sequence as a transcription termination sequence.

[0116] According to one embodiment, when the gene encoding carbon monoxide dehydrogenase introduced into the recombinant vector is carbon monoxide dehydrogenase-2 (CODH-2) derived from wild-type Carboxydothermus hydrogenoformans, the recombinant vector may be a polynucleotide consisting of the base sequence of SEQ ID NO: 4, and when the gene encoding carbon monoxide dehydrogenase introduced into the recombinant vector is carbon monoxide dehydrogenase-4 (CODH-4) derived from wild-type Carboxydothermus hydrogenoformans, the recombinant vector may be a polynucleotide consisting of the base sequence of SEQ ID NO: 5.

[0117]

[0118] The microorganism of the present invention clones or expresses the vector according to the present invention.

[0119] In one embodiment, the microorganism may be a recombinant microorganism, and the microorganism may be obtained by introducing the recombinant vector into a suitable host microorganism. The above microorganism can be any host cell known in the art as a cell capable of stably and continuously cloning or expressing the above recombinant vector, and as a prokaryotic cell, for example, strains of the genus Bacillus such as E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, Bacillus subtilis, Bacillus thuringiensis, and enterobacteria and strains such as Salmonella typhimurium, Serratia marcescens and various Pseudomonas species, and in the case of transformation into a eukaryotic cell, as a host cell, yeast (Saccharomyce cerevisiae), insect cells, plant cells and animal cells, for example, Sp2 / 0, CHO (Chinese hamster ovary) K1, CHO DG44, PER.C6, W138, BHK, COS-7, 293, HepG2, Huh7, 3T3, RIN, MDCK cell lines, etc. can be used, and specifically, E. coli BL21 can be used.

[0120]

[0121] The method for producing carbon monoxide dehydrogenase of the present invention comprises the steps of culturing a microorganism according to the present invention; treating the microorganism with a substance capable of promoting the expression of carbon monoxide dehydrogenase; and isolating and purifying a protein from the microorganism.

[0122] According to one embodiment, in the step of culturing a microorganism according to the present invention, the culturing may be a known conventional culturing method, and specifically, may further include a step of introducing a plasmid expressing a protein that labels carbon monoxide dehydrogenase into the microorganism.

[0123] According to one embodiment, the carbon monoxide dehydrogenase produced by the above production method can exhibit excellent enzyme activity even in the presence of oxygen under atmospheric conditions.

[0124]

[0125] The carbon monoxide removal device of the present invention includes a carbon monoxide dehydrogenase according to the present invention.

[0126] According to one embodiment, the carbon monoxide dehydrogenase included in the device reacts carbon monoxide with water to transform it into carbon dioxide, hydrogen ions, and electrons, so that carbon monoxide can be removed, and carbon dioxide can be removed with excellent efficiency even in the presence of oxygen under atmospheric conditions.

[0127] According to one embodiment, the device may be included in industrial sites requiring hazardous gas treatment technology, air sterilization / removal purification technology and systems, treatment facilities and related technologies for indoor air quality management in vehicles, trains, and other means of transportation, technologies and devices for ventilation efficiency and economic ventilation, and indoor air purification devices such as air purifiers, air conditioners, and ventilators.

[0128]

[0129] The filter of the present invention comprises a carbon monoxide dehydrogenase according to the present invention.

[0130] According to one embodiment, the carbon monoxide dehydrogenase included in the filter reacts carbon monoxide with water to transform it into carbon dioxide, hydrogen ions, and electrons, so that carbon monoxide can be removed, and carbon monoxide can be removed with excellent efficiency even in the presence of oxygen.

[0131] According to one embodiment, the filter can be applied to various filters in places where carbon monoxide is generated, such as cigarette filters and air purifier filters, and further, it can be included in industrial sites requiring harmful gas treatment technology, purification technology and systems for sterilizing / removing harmful substances in the air, treatment facilities and related technologies for managing indoor air quality in vehicles, trains, and other means of transportation, technologies and devices for ventilation efficiency and economic ventilation, and indoor air purification devices such as air purifiers, air conditioners, and ventilators.

[0132]

[0133] Hereinafter, the present invention will be described in more detail by way of examples.

[0134] However, the following examples are only intended to illustrate the present invention, and the content of the present invention is not limited to the following examples.

[0135]

[0136] Example 1: Substrate tunnel of carbon monoxide dehydrogenase (CODH)

[0137] Based on the currently known protein structure information of carbon monoxide dehydrogenase, a substrate tunnel as shown in Figure 1 was predicted.

[0138] Figure 1 is a three-dimensional stereoscopic structure showing a gas tunnel through which a substrate passes inside the protein in a carbon monoxide dehydrogenase according to the present invention.

[0139] Referring to Figure 1, the tunnels through which gaseous substances pass are divided into a selective CO tunnel through which only carbon monoxide passes and a non-selective CO tunnel through which oxygen passes. Among these, by blocking the oxygen-passing tunnel consisting of tunnel residues 559 and 610, we developed a carbon monoxide dehydrogenase with high activity and increased oxygen stability. ChCODH-II from Carboxydothermus hydrogenoformans, which is not intolerant to oxygen and loses activity very quickly in the presence of oxygen, was used as a model enzyme and produced as an oxygen-tolerant active form even under atmospheric conditions.

[0140]

[0141] Example 2: Comparison of oxygen tunnels of various carbon monoxide dehydrogenases (CODHs).

[0142] Figure 2 is a three-dimensional stereoscopic structure showing an oxygen-passing tunnel residue at the tunnel entrance in a carbon monoxide dehydrogenase according to the present invention.

[0143] Referring to Figure 2, it can be confirmed that the substrate tunnels of various CO dehydrogenases, including ChCODH-II and ChCODH-IV, were compared with each other to determine the key residues constituting the oxygen tunnels that are expected to be related to oxygen influx.

[0144] In ChCODH-II, three entrance tunnels are predicted to be related to oxygen stability: non-selective tunnel #1, non-selective tunnel #2, and non-selective tunnel #3. The residues constituting these tunnels were determined to be E43 (Glutamic acid 43), K450 (Lysine 450), and L583 (Leucine 583) in non-selective tunnel #1; I586 (Isoleucine 586), T593 (Threonine 593), T597 (Threonine 597), and V610 (Valine) in non-selective tunnel #2; and Q206 (Glutamine 206), S559 (Serine 599), and I603 (Isoleucine 603) in non-selective tunnel #3. Among these, a mutant whose oxygen tolerance was measured under atmospheric conditions was created through combinational mutation with A559, and additional mutants were created and experiments were conducted to see the influence of each site.

[0145]

[0146] Example 3: Production of a mutant of carbon monoxide dehydrogenase (CODH).

[0147] An attempt was made to produce oxygen-tolerant carbon monoxide dehydrogenase (CODH) and a recombinant microorganism containing the same under atmospheric conditions.

[0148]

[0149] wild-type carbon monoxide dehydrogenase

[0150] To be used as a template for genetic mutation of oxygen-resistant carbon monoxide dehydrogenase, the genes encoding ChCODH-2 and ChCODH-4 proteins (SEQ ID NOs: 1 and 2) from C. hydrogenoforman (GenBank no. NC_007503) were artificially synthesized by GenScript (Piscataway, NJ, USA).

[0151] The above synthesized ChCODH-2 gene derived from C. hydrogenoforman was digested with restriction enzymes NdeI / BamHI or NdeI / XhoI (New England BioLabs Inc., US) at 37°C for 20 minutes, and then cloned into the expression vector pET-28 (Novagen, USA, SEQ ID NO: 3) using SolGent T4 DNA Ligase. The vector (SEQ ID NO: 4 and 5) containing the carbon monoxide dehydrogenase gene was introduced into Escherichia coli BL21 by heat shock (42°C, 1 minute), thereby producing a recombinant microorganism containing wild-type carbon monoxide dehydrogenase.

[0152]

[0153] Oxygen-tolerant carbon monoxide dehydrogenase under atmospheric conditions

[0154] Using the wild-type ChCODH-2 synthesized above as a template, site-directed mutagenesis was performed for single or multiple amino acid substitutions to synthesize various oxygen-resistant candidate carbon monoxide dehydrogenase mutants, and vectors containing the mutant carbon monoxide dehydrogenases were introduced into E. coli BL21 in the same manner as the wild-type carbon monoxide dehydrogenase to produce recombinant microorganisms containing the mutant carbon monoxide dehydrogenases.

[0155] Information on the primers used in the synthesis of the above mutant carbon monoxide dehydrogenase was as shown in Table 1 below.

[0156]

[0157] Substituted amino acid primer sequence number A559WF-5'gcgcggcggaatggatgcatgagaaggcggtgg6R-5'tctcatgcatccattccgccgcgctcgcaacc7A559HF-5'cgcggcggaacacatgcatgagaaggcggtgg8R-5'tctcatgcatgtgttccgccgcgctcgcaacc9V610WF-5'gctacttcatctgggaactggacccggagacc 10R-5'ggtccagttcccagatgaagtagccaccgg11V610HF-5'gctacttcatccacgaactggacccggagacc12R-5'ggtccagttcgtggatgaagt agccaccgg13V610SF-5'gctacttcatcagcgaactggacccggagacc14R-5'ggtccagttcgctgatgaagtagccaccgg15A559W / V610SA559W F&R; V610S F&R-A559W / V610WA559W F&R; V610W F&R-A559W / V610HA559W F&R; V610H F&R-A559H / V610SA559H F&R; V610S F&R-A559H / V610WA559H F&R; V610W F&R-A559H / V610HA559H F&R; V610H F&R-

[0158] Example 4: Expression and purification of oxygen-resistant carbon monoxide dehydrogenase.

[0159] In order to obtain the oxygen-resistant carbon monoxide dehydrogenase derived from the above recombinant microorganism, an expression vector containing a mutant carbon monoxide dehydrogenase with a His-tag terminal was synthesized using the pET-28 (SEQ ID NO: 2) expression vector. The synthesized mutant carbon monoxide dehydrogenase expression vector was introduced into Escherichia coli BL21 containing the pRKISC (J. Biochem. 126:917, 1999) plasmid to complete the final recombinant microorganism, and each of these was cultured to induce expression in the form of a His-tag terminal protein, thereby purifying carbon monoxide dehydrogenase.

[0160] The above culture was performed aerobically in TB medium (400 mL, 2 L flask) containing 50 μg / mL kanamycin, 10 μg / mL tetracycline, 0.02 mM nickel chloride (NiCl2), 0.1 mM ferrous sulfate (FeSO4), and 2 mM l-cysteine ​​at 37°C and 225 rpm.

[0161] Afterwards, to induce enzyme expression, when the OD (optical density) 600 value reached approximately 0.4 to 0.6, 0.2 mM isopropyl-β-d-thiogalactopyranoside (IPTG), 0.5 mM nickel chloride (NiCl2), 1 mM ferrous sulfate (FeSO4), and 50 mM potassium nitrate (KNO3) were added to a nitrogen-fluxed (N2) serum bottle. At this time, the temperature was lowered to 30°C.

[0162] After 24 hours of culture, recombinant E. coli was obtained by centrifugation at 12,000 rpm for 30 minutes in a 4°C environment, and the enzyme was purified using Ni-NTA resin in an anaerobic chamber.

[0163]

[0164] Example 5: Measurement of carbon monoxide dehydrogenase activity

[0165] The carbon monoxide oxidation activity of carbon monoxide dehydrogenase was measured by the oxidation-reduction reaction of ethyl viologen (EV) by the enzyme in a carbon monoxide-saturated 30°C reaction buffer using a spectrophotometer (578 nm).

[0166] The above reaction was carried out using a screw-cap cuvette with a carbon monoxide headspace, and the reaction solution (2 mL) contained 20 mM oxidized ethyl viologen and 50 mM HEPES / NaOH buffer (pH 8) saturated with carbon monoxide. The reaction was initiated by enzyme injection and measured for 2 minutes. Here, 1 unit of CO dehydrogenase activity is defined as the amount of enzyme required for the reduction reaction of 1 μmol oxidized ethyl viologen at 30°C and pH 8.

[0167]

[0168] Example 6: Measurement of oxygen stability of carbon monoxide dehydrogenase

[0169] The oxygen stability of carbon monoxide dehydrogenase was measured by first reacting the enzyme with oxygen at a concentration of 0 - 500 μM for 1 minute, and then measuring the oxidation-reduction reaction of ethyl viologen (EV) by the oxygen-exposed enzyme using a spectrophotometric method (578 nm) as in Example 5.

[0170]

[0171] Example 7: Measurement of activity and oxygen tolerance of a single mutant of carbon monoxide dehydrogenase

[0172] Figure 3 is a graph showing the oxygen stability of carbon monoxide dehydrogenase according to an embodiment of the present invention.

[0173] Referring to Figure 3, the results of measuring the activity and oxygen tolerance of wild type and mutant ChCODH-II derived from Carboxydothermus hydrogenoformans and oxygen conditions under atmospheric conditions can be confirmed.

[0174] As shown in Fig. 3, the experimental results showed that ChCODH-II A559W / V610W, A559W / V610H, A559H / V610W, and A559H / V610H exhibited excellent oxygen tolerance characteristics, as they were active even at a concentration of 250 μM under oxygen conditions under atmospheric conditions. The kinetic characteristics of these mutants were investigated as shown in Table 2 below.

[0175]

[0176] CODH typeSequence numberActivity (U / mg)Calculated oxygen inhibition concentration (mM)50% enzyme inhibition (IC50)80% enzyme inhibition (IC80)Wild species ChCODH-II19000.630.81Wild species ChCODH-IV28529.731.7ChCODH-II A559H161,90092.995.6ChCODH-II A559H:V610H182,000184.6394.0ChCODH-II A559H:V610W191,60070.8933.4ChCODH-II A559W172,00038.244.0ChCODH-II A559W:V610H202,80054.9332.3ChCODH-II A559W:V610W211,80041.0221.7

[0177] To directly confirm the changes in the substrate tunnel that constitutes these tunnel residues, the following experiment was conducted to determine the three-dimensional structure of the protein.

[0178]

[0179] Example 8: Prediction of the 3D protein structure and substrate tunnel of a single mutant of carbon monoxide dehydrogenase.

[0180] Figure 4 is a three-dimensional stereoscopic structure showing a three-dimensional protein crystal structure and a gas tunnel of carbon monoxide dehydrogenase according to an embodiment of the present invention.

[0181] To investigate the properties of the oxygen-tolerant ChCODH-II mutants A559W / V610W, A559W / V610H, and A559H / V610H under ambient conditions, the three-dimensional protein structures were determined. Referring to Fig. 4, the protein structures obtained from X-ray crystals can be used to confirm the substrate tunneling changes.

[0182] Experimental results showed that the substrate tunnels through which oxygen passes in the identified mutants were narrowed or disappeared, suggesting a mechanism that may explain the mutants' superior oxygen tolerance under atmospheric conditions.

[0183] Although the embodiments described above have been described with limited drawings, those skilled in the art will appreciate that various technical modifications and variations can be applied based on the above. For example, appropriate results can still be achieved even if the described techniques are performed in a different order than described, and / or components of the described systems, structures, devices, circuits, etc. are combined or combined in a different manner than described, or are replaced or substituted with other components or equivalents.

[0184] Therefore, other implementations, other embodiments, and equivalents to the claims also fall within the scope of the claims described below.

[0185] Attach an electronic file of the sequence list

[0186] (C: / KipoNet / NKEditor / appfile / APC-2023-0721_Specification.xml)

Claims

1. Increased enzyme activity, oxygen tolerance, or both; Carbon monoxide dehydrogenase.

2. In paragraph 1, The above carbon monoxide dehydrogenase is a compound in which the 559th amino acid, the 610th amino acid, or both amino acids are modified. Carbon monoxide dehydrogenase.

3. In paragraph 2, The above modification is at least one form selected from the group consisting of deletion, addition and substitution. Carbon monoxide dehydrogenase.

4. In paragraph 2, The 559th amino acid of the above carbon monoxide dehydrogenase is Alanine. The 610th amino acid of the above carbon monoxide dehydrogenase is valine. Carbon monoxide dehydrogenase.

5. In paragraph 3, When the above transformation is the above substitution, Alanine, the 559th amino acid of the above carbon monoxide dehydrogenase, can be substituted with tryptophan or histidine. Valine, the 610th amino acid of the above carbon monoxide dehydrogenase, can be substituted with Alanine, Serine, Tryptophan or Histidine. Carbon monoxide dehydrogenase.

6. In paragraph 1, The above carbon monoxide dehydrogenase comprises a protein encoded by a polynucleotide comprising at least one base sequence selected from the group consisting of base sequences of SEQ ID NOs: 18 to 21. Carbon monoxide dehydrogenase.

7. In paragraph 1, The above oxygen tolerance is increased by 1 to 250 times compared to the wild type. Carbon monoxide dehydrogenase.

8. In paragraph 1, The above enzyme activity is increased by 1 to 250 times compared to the wild type. carbon monoxide dehydrogenase 9. In paragraph 1, The above carbon monoxide dehydrogenase, Temperature of 10℃ to 70℃; and At atmospheric pressures of 1000 hPa to 5000 hPa; under which enzyme activity, oxygen tolerance, or both are increased, Carbon monoxide dehydrogenase.

10. In paragraph 1, The above carbon monoxide dehydrogenase comprises a protein having a sequence homology of 70% or more to the amino acid sequence of carbon monoxide dehydrogenase, The above carbon monoxide dehydrogenase is at least one carbon monoxide dehydrogenase selected from the group consisting of carbon monoxide dehydrogenase-1 (CODH-1), carbon monoxide dehydrogenase-2 (CODH-2), carbon monoxide dehydrogenase-3 (CODH-3), and carbon monoxide dehydrogenase-4 (CODH-4). Carbon monoxide dehydrogenase.

11. Coding carbon monoxide dehydrogenase of paragraph 1, Polynucleotide.

12. A polynucleotide of claim 11, comprising the carbon monoxide dehydrogenase of claim 1; vector.

13. Cloning or expressing the vector of Article 12, microorganism.

14. Step of culturing the microorganism of Article 13; A step of treating the above microorganism with a substance capable of promoting the expression of carbon monoxide dehydrogenase; and A step of separating and purifying a protein from the above microorganism; comprising; A method for producing carbon monoxide dehydrogenase.

15. Containing carbon monoxide dehydrogenase of paragraph 1, Carbon monoxide removal device.

16. Containing carbon monoxide dehydrogenase of paragraph 1, filter.

Citation Information

Patent Citations

  • Recombinant vector including gene encoding aerobic CODH from Pantoea species YR343 which can be overexpressed in E.coli, Method of overexpressing recombinant PsCODH and Method of converting CO by using PsCODH

    KR101826207B1

  • Genetically engineered bacterium with altered carbon monoxide dehydrogenase (CODH) activity

    KR1020170036789A

  • Method for providing shared webtoon platform

    KR1020230116381A

  • Lawn management system

    KR1020230116992A